#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PCCB	5096	hgsc.bcm.edu	37	3	136046079	136046080	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:136046079_136046080insT	ENST00000251654.4	+	12	1351_1352	c.1281_1282insT	c.(1282-1284)acafs	p.T428fs	PCCB_ENST00000474833.1_Intron|PCCB_ENST00000478469.1_Intron|PCCB_ENST00000462637.1_Frame_Shift_Ins_p.T405fs|PCCB_ENST00000483687.1_Frame_Shift_Ins_p.T409fs|PCCB_ENST00000469217.1_Frame_Shift_Ins_p.T448fs|PCCB_ENST00000471595.1_Frame_Shift_Ins_p.T428fs|PCCB_ENST00000468777.1_Frame_Shift_Ins_p.T459fs|PCCB_ENST00000482086.1_Frame_Shift_Ins_p.T312fs|PCCB_ENST00000466072.1_Frame_Shift_Ins_p.T448fs|PCCB_ENST00000490504.1_Frame_Shift_Ins_p.T371fs	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide	428	Carboxyltransferase.		T -> I (in PA-2; dbSNP:rs28934887). {ECO:0000269|PubMed:12189489, ECO:0000269|PubMed:15059621}.		biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)	p.T428fs*13(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	TACCCAAAGTCACAGTCATCAC	0.540																																					p.V427fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1281_1282insT	3						.																																			137528770	SO:0001589	frameshift_variant	5096	exon12				CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	Exception_encountered	3.37:g.136046079_136046080insT	ENSP00000251654:p.Thr428fs	Somatic		Capture	SOLID	Phase_I	137528769	NM_000532	B7Z2Z4|Q16813|Q96CX0	Frame_Shift_Ins	INS	ENST00000251654.4	37	CCDS3089.1																																																																																				PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357335.1		
ACVR2B	93	hgsc.bcm.edu	37	3	38518793	38518794	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:38518793_38518794insC	ENST00000352511.4	+	2	540_541	c.68_69insC	c.(67-72)gaggctfs	p.EA23fs		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	23					activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.E23fs*3(1)		lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		GGGCGTGGGGAGGCTGAGACAC	0.649																																					p.E23fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.68_69insC	3						.																																			38493798	SO:0001589	frameshift_variant	93	exon2			X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	Exception_encountered	3.37:g.38518793_38518794insC	ENSP00000340361:p.Glu23fs	Somatic		Capture	SOLID	Phase_I	38493797	NM_001106	Q4VAV0	Frame_Shift_Ins	INS	ENST00000352511.4	37	CCDS2679.1																																																																																				ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254059.3	NM_001106	
PTPRG	5793	hgsc.bcm.edu	37	3	62189363	62189364	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:62189363_62189364insG	ENST00000474889.1	+	12	2271_2272	c.1894_1895insG	c.(1894-1896)aggfs	p.R632fs	PTPRG_ENST00000295874.10_Frame_Shift_Ins_p.R632fs	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	632					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T633fs*13(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		GTCTCCTAACAGGACTGCCGAG	0.634																																					p.R632fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1894_1895insG	3						.																																			62164404	SO:0001589	frameshift_variant	5793	exon12			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.1896dupG	3.37:g.62189365_62189365dupG	ENSP00000418112:p.Arg632fs	Somatic		Capture	SOLID	Phase_I	62164403	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Frame_Shift_Ins	INS	ENST00000474889.1	37	CCDS2895.1																																																																																				PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
TROAP	10024	hgsc.bcm.edu	37	12	49724135	49724136	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:49724135_49724136insCA	ENST00000257909.3	+	13	1583_1584	c.1507_1508insCA	c.(1507-1509)cccfs	p.P503fs	TROAP_ENST00000547923.1_Frame_Shift_Ins_p.P211fs|TROAP_ENST00000551245.1_Frame_Shift_Ins_p.P503fs	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	503					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)		p.C504fs*54(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						GCTGCCAAAGCCCTGTCTTCCA	0.589																																					p.P503fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1507_1508insCA	12						.																																			48010403	SO:0001589	frameshift_variant	10024	exon13			U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	Exception_encountered	12.37:g.49724135_49724136insCA	ENSP00000257909:p.Pro503fs	Somatic		Capture	SOLID	Phase_I	48010402	NM_005480	F8VSF9|Q6PJU7|Q8N5B2	Frame_Shift_Ins	INS	ENST00000257909.3	37	CCDS8784.1																																																																																				TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480	
KMT2C	58508	hgsc.bcm.edu	37	7	151945071	151945072	+	Frame_Shift_Ins	INS	-	-	T	rs150073007|rs202184064		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:151945071_151945072insT	ENST00000262189.6	-	14	2665_2666	c.2447_2448insA	c.(2446-2448)tacfs	p.Y816fs	KMT2C_ENST00000355193.2_Frame_Shift_Ins_p.Y816fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	816					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.Y816fs*1(2)									TGACTGAGATGTAAGTTGTTGG	0.436																																					p.Y816_I817delinsX												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.2448_2449insA	7						.																																			151576005	SO:0001589	frameshift_variant	58508	exon14			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2448dupA	7.37:g.151945072_151945072dupT	ENSP00000262189:p.Tyr816fs	Somatic		Capture	SOLID	Phase_I	151576004	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Ins	INS	ENST00000262189.6	37	CCDS5931.1																																																																																				KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MEPCE	56257	hgsc.bcm.edu	37	7	100030612	100030613	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:100030612_100030613insG	ENST00000310512.2	+	2	2130_2131	c.1742_1743insG	c.(1741-1746)ctcagcfs	p.S582fs	PPP1R35_ENST00000476185.1_5'Flank|RP11-758P17.2_ENST00000492523.1_RNA|MEPCE_ENST00000414441.1_Frame_Shift_Ins_p.S113fs	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	582	Bin3-type SAM. {ECO:0000255|PROSITE- ProRule:PRU00848}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.S582fs*81(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTGCTCTGCCTCAGCCTCACCA	0.589																																					p.L581fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1742_1743insG	7						.																																			99868549	SO:0001589	frameshift_variant	56257	exon2			AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	Exception_encountered	7.37:g.100030612_100030613insG	ENSP00000308546:p.Ser582fs	Somatic		Capture	SOLID	Phase_I	99868548	NM_019606	B3KP86|D6W5V7|Q9NPD4	Frame_Shift_Ins	INS	ENST00000310512.2	37	CCDS5693.1																																																																																				MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339135.1		
NR4A2	4929	hgsc.bcm.edu	37	2	157184440	157184441	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:157184440_157184441insTA	ENST00000339562.4	-	5	1442_1443	c.1080_1081insTA	c.(1078-1083)cccccgfs	p.P361fs	NR4A2_ENST00000409108.2_Frame_Shift_Ins_p.P361fs|NR4A2_ENST00000426264.1_Frame_Shift_Ins_p.P298fs|NR4A2_ENST00000539077.1_Frame_Shift_Ins_p.P372fs|NR4A2_ENST00000429376.1_Frame_Shift_Ins_p.P298fs|NR4A2_ENST00000409572.1_Frame_Shift_Ins_p.P361fs	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	361	Pro-rich.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.P361fs*3(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						AGACTCACCGGGGGCGAAGGGG	0.604																																					p.P361fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1081_1082insTA	2						.																																			156892687	SO:0001589	frameshift_variant	4929	exon5			X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.1080_1081insTA	2.37:g.157184440_157184441insTA	ENSP00000344479:p.Pro361fs	Somatic		Capture	SOLID	Phase_I	156892686	NM_006186	Q16311|Q53RZ2|Q6NXU0	Frame_Shift_Ins	INS	ENST00000339562.4	37	CCDS2201.1																																																																																				NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2		
C19orf10	56005	hgsc.bcm.edu	37	19	4660748	4660749	+	Frame_Shift_Ins	INS	-	-	CATC			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:4660748_4660749insCATC	ENST00000262947.3	-	4	336_337	c.301_302insGATG	c.(301-303)tccfs	p.S101fs	C19orf10_ENST00000599630.1_Frame_Shift_Ins_p.S101fs	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	101					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)		p.S101fs*1(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		GTACAGATAGGACTTCCCCTGG	0.644																																					p.S101_Y102delinsX												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.302_303insGATG	19						.																																			4611749	SO:0001589	frameshift_variant	56005	exon4			AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.301_302insGATG	19.37:g.4660748_4660749insCATC	ENSP00000262947:p.Ser101fs	Somatic		Capture	SOLID	Phase_I	4611748	NM_019107	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Frame_Shift_Ins	INS	ENST00000262947.3	37	CCDS12133.1																																																																																				C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
NUP62	23636	hgsc.bcm.edu	37	19	50412684	50412685	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:50412684_50412685insA	ENST00000596217.1	-	2	2267_2268	c.380_381insT	c.(379-381)agcfs	p.S127fs	NUP62_ENST00000413454.1_Frame_Shift_Ins_p.S127fs|NUP62_ENST00000422090.2_Frame_Shift_Ins_p.S127fs|NUP62_ENST00000597029.1_Frame_Shift_Ins_p.S127fs|NUP62_ENST00000597723.1_Frame_Shift_Ins_p.S127fs|NUP62_ENST00000600583.1_5'Flank|IL4I1_ENST00000341114.3_Intron|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000352066.3_Frame_Shift_Ins_p.S127fs			P37198	NUP62_HUMAN	nucleoporin 62kDa	127	15 X 9 AA approximate repeats.|Thr-rich.				carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)	p.T128fs*301(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AGGTGACGGTGCTCGATATGGC	0.594																																					p.S127fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.381_382insT	19						.																																			55104497	SO:0001589	frameshift_variant	23636	exon2			X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.380_381insT	19.37:g.50412684_50412685insA	ENSP00000471191:p.Ser127fs	Somatic		Capture	SOLID	Phase_I	55104496	NM_153718	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Frame_Shift_Ins	INS	ENST00000596217.1	37	CCDS12788.1																																																																																				NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719	
NRG1	3084	hgsc.bcm.edu	37	8	32621746	32621747	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr8:32621746_32621747insG	ENST00000405005.3	+	12	1749_1750	c.1749_1750insG	c.(1750-1752)gaafs	p.E584fs	NRG1_ENST00000338921.4_Frame_Shift_Ins_p.E592fs|NRG1_ENST00000287842.3_Frame_Shift_Ins_p.E581fs|NRG1_ENST00000287845.5_Frame_Shift_Ins_p.E555fs|NRG1_ENST00000539990.1_Frame_Shift_Ins_p.E427fs|NRG1_ENST00000356819.4_Frame_Shift_Ins_p.E589fs|NRG1_ENST00000341377.5_3'UTR|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000519301.1_Frame_Shift_Ins_p.E534fs			Q02297	NRG1_HUMAN	neuregulin 1	584					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.E589fs*17(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		AAAGAGTAGGTGAAGATACGCC	0.545																																					p.G580fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1740_1741insG	8						.																																			32741289	SO:0001589	frameshift_variant	3084	exon12			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1750dupG	8.37:g.32621747_32621747dupG	ENSP00000384620:p.Glu584fs	Somatic		Capture	SOLID	Phase_I	32741288	NM_013957	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Frame_Shift_Ins	INS	ENST00000405005.3	37	CCDS6085.1																																																																																				NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
PDE4B	5142	hgsc.bcm.edu	37	1	66838194	66838195	+	Frame_Shift_Ins	INS	-	-	T	rs34469235	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:66838194_66838195insT	ENST00000329654.4	+	17	2231_2232	c.2044_2045insT	c.(2044-2046)ctgfs	p.L682fs	PDE4B_ENST00000480109.2_Frame_Shift_Ins_p.L449fs|PDE4B_ENST00000371049.3_Frame_Shift_Ins_p.L682fs|PDE4B_ENST00000371045.5_Frame_Shift_Ins_p.L510fs|PDE4B_ENST00000423207.2_Frame_Shift_Ins_p.L667fs	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	682					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.T511fs*4(1)|p.T683fs*4(1)|p.T668fs*4(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	TCAGTTTGAACTGACTCTCGAT	0.495																																					p.L682fs												.	.	3	Insertion - Frameshift(3)	large_intestine(3)	c.2044_2045insT	1						.																																			66610783	SO:0001589	frameshift_variant	5142	exon17			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.2045dupT	1.37:g.66838195_66838195dupT	ENSP00000332116:p.Leu682fs	Somatic		Capture	SOLID	Phase_I	66610782	NM_001037341	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Frame_Shift_Ins	INS	ENST00000329654.4	37	CCDS632.1																																																																																				PDE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025188.3	NM_002600	
ARHGAP20	57569	hgsc.bcm.edu	37	11	110451496	110451497	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:110451496_110451497insCA	ENST00000260283.4	-	16	2457_2458	c.2173_2174insTG	c.(2173-2175)aagfs	p.K725fs	ARHGAP20_ENST00000357139.3_Frame_Shift_Ins_p.K699fs|ARHGAP20_ENST00000529591.1_Frame_Shift_Ins_p.K268fs|ARHGAP20_ENST00000533353.1_Frame_Shift_Ins_p.K699fs|ARHGAP20_ENST00000524756.1_Frame_Shift_Ins_p.K702fs|ARHGAP20_ENST00000527598.1_Frame_Shift_Ins_p.K689fs|ARHGAP20_ENST00000528829.1_Frame_Shift_Ins_p.K689fs	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	725					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.K725fs*20(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		CTTGCGTAGCTTTTTCTGATAA	0.450																																					p.K725fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2174_2175insTG	11						.																																			109956707	SO:0001589	frameshift_variant	57569	exon16			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.2173_2174insTG	11.37:g.110451496_110451497insCA	ENSP00000260283:p.Lys725fs	Somatic		Capture	SOLID	Phase_I	109956706	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Frame_Shift_Ins	INS	ENST00000260283.4	37	CCDS31673.1																																																																																				ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
MRGPRX4	117196	hgsc.bcm.edu	37	11	18195753	18195754	+	In_Frame_Ins	INS	-	-	TAC			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:18195753_18195754insTAC	ENST00000314254.3	+	1	1370_1371	c.950_951insTAC	c.(949-954)ggaagc>ggTACaagc	p.317_318GS>GTS	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	317				S -> R (in Ref. 2; AAL86882). {ECO:0000305}.		integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G317_S318insT(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GAGCTGTCGGGAAGCAGATTGG	0.559																																					p.G317delinsGT												.	.	1	Insertion - In frame(1)	large_intestine(1)	c.950_951insTAC	11						.																																			18152330	SO:0001652	inframe_insertion	117196	exon1			AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	Exception_encountered	11.37:g.18195753_18195754insTAC	ENSP00000314042:p.Gly317_Ser318insThr	Somatic		Capture	SOLID	Phase_I	18152329	NM_054032	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	In_Frame_Ins	INS	ENST00000314254.3	37	CCDS7831.1																																																																																				MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389788.1	NM_054032	
GYLTL1B	120071	hgsc.bcm.edu	37	11	45946111	45946112	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:45946111_45946112insGG	ENST00000531526.1	+	5	658_659	c.547_548insGG	c.(547-549)aagfs	p.K183fs	GYLTL1B_ENST00000536139.1_Frame_Shift_Ins_p.K152fs|GYLTL1B_ENST00000401752.1_Frame_Shift_Ins_p.K183fs|GYLTL1B_ENST00000389968.3_5'UTR|GYLTL1B_ENST00000325468.5_Frame_Shift_Ins_p.K183fs|GYLTL1B_ENST00000529052.1_Frame_Shift_Ins_p.K152fs	NM_152312.3	NP_689525.3	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	183					muscle cell cellular homeostasis (GO:0046716)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.K183fs*77(1)		breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(35;0.226)		TGGGCTAATGAAGCTGGTGCTG	0.614																																					p.K183fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.547_548insGG	11						.																																			45902688	SO:0001589	frameshift_variant	120071	exon5				CCDS31473.1	11p11.12	2013-02-22			ENSG00000165905	ENSG00000165905		"""Glycosyltransferase family 8 domain containing"""	16522	protein-coding gene	gene with protein product		609709				15661757, 15958417	Standard	XM_005252785		Approved	PP5656, FLJ35207, LARGE2	uc001nbv.1	Q8N3Y3	OTTHUMG00000167037	Exception_encountered	11.37:g.45946111_45946112insGG	ENSP00000432869:p.Lys183fs	Somatic		Capture	SOLID	Phase_I	45902687	NM_152312	A6NN75|Q8N8Y6|Q8NAK3|Q8WY62	Frame_Shift_Ins	INS	ENST00000531526.1	37	CCDS31473.1																																																																																				GYLTL1B-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392572.1	NM_152312	
RBM4B	83759	hgsc.bcm.edu	37	11	66436369	66436370	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:66436369_66436370insA	ENST00000525754.1	-	2	1473_1474	c.805_806insT	c.(805-807)gatfs	p.D269fs	RP11-658F2.8_ENST00000548810.1_RNA|RP11-658F2.8_ENST00000550837.1_RNA|RBM4B_ENST00000531969.1_Intron|RBM4B_ENST00000310046.4_Frame_Shift_Ins_p.D269fs|RBM4B_ENST00000529195.2_5'Flank			Q9BQ04	RBM4B_HUMAN	RNA binding motif protein 4B	269	Interaction with TNPO3. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|entrainment of circadian clock by photoperiod (GO:0043153)|mRNA processing (GO:0006397)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.D269fs*4(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(1)|urinary_tract(2)	10						GTCATAGGGATCAACAGAAGTA	0.545																																					p.D269fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.806_807insT	11						.																																			66192946	SO:0001589	frameshift_variant	83759	exon3			AK095158	CCDS8149.1, CCDS66144.1	11q13	2013-02-12	2006-01-25	2006-01-25				"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	28842	protein-coding gene	gene with protein product			"""RNA binding motif protein 30"""	RBM30		12477932	Standard	XR_247213		Approved	MGC10871, ZCCHC15, RBM4L, ZCRB3B, ZCCHC21B	uc001ojb.3	Q9BQ04		ENST00000525754.1:c.805_806insT	11.37:g.66436369_66436370insA	ENSP00000433071:p.Asp269fs	Somatic		Capture	SOLID	Phase_I	66192945	NM_031492	B3KT83	Frame_Shift_Ins	INS	ENST00000525754.1	37	CCDS8149.1																																																																																				RBM4B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393851.1	NM_031492	
SLC43A2	124935	hgsc.bcm.edu	37	17	1519953	1519954	+	Frame_Shift_Ins	INS	-	-	AG	rs376006102		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:1519953_1519954insAG	ENST00000301335.5	-	3	358_359	c.270_271insCT	c.(268-273)ttggccfs	p.A91fs	SLC43A2_ENST00000382147.4_Frame_Shift_Ins_p.A91fs|snoU13_ENST00000459614.1_RNA|SLC43A2_ENST00000571650.1_Frame_Shift_Ins_p.A91fs	NM_001284498.1|NM_001284499.1	NP_001271427.1|NP_001271428.1	Q8N370	LAT4_HUMAN	solute carrier family 43 (amino acid system L transporter), member 2	91					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-amino acid transmembrane transporter activity (GO:0015179)	p.A91fs*43(1)		endometrium(4)|large_intestine(4)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)		ACAGTGAAGGCCAAATTTAGCA	0.624																																					p.A91fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.271_272insCT	17						.																																			1466704	SO:0001589	frameshift_variant	124935	exon3			BC027923	CCDS11006.1, CCDS67107.1, CCDS67108.1	17p13.3	2013-07-17	2013-07-17		ENSG00000167703	ENSG00000167703		"""Solute carriers"""	23087	protein-coding gene	gene with protein product		610791				23268354	Standard	NM_001284498		Approved	MGC34680	uc002fsv.3	Q8N370	OTTHUMG00000090345	ENST00000301335.5:c.270_271insCT	17.37:g.1519953_1519954insAG	ENSP00000301335:p.Ala91fs	Somatic		Capture	SOLID	Phase_I	1466703	NM_152346	B7Z6X9|C9JNU8|D3DTH9|Q5CD75|Q6IPM1|Q8NBX1|Q8NC21|Q8WZ00	Frame_Shift_Ins	INS	ENST00000301335.5	37	CCDS11006.1																																																																																				SLC43A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206717.4	NM_152346	
MRC2	9902	hgsc.bcm.edu	37	17	60743538	60743539	+	In_Frame_Ins	INS	-	-	TCT			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:60743538_60743539insTCT	ENST00000303375.5	+	3	1006_1007	c.604_605insTCT	c.(604-606)acc>aTCTcc	p.202_202T>IS		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	202	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00479}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.T202>IS(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CCACGGCTGCACCAGCACGGGC	0.609																																					p.T202delinsIS												.	.	1	Complex - insertion inframe(1)	large_intestine(1)	c.604_605insTCT	17						.																																			58097271	SO:0001652	inframe_insertion	9902	exon3			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		Exception_encountered	17.37:g.60743538_60743539insTCT	ENSP00000307513:p.Thr202delinsIleSer	Somatic		Capture	SOLID	Phase_I	58097270	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	In_Frame_Ins	INS	ENST00000303375.5	37	CCDS11634.1																																																																																				MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
NAT9	26151	hgsc.bcm.edu	37	17	72768361	72768362	+	Frame_Shift_Ins	INS	-	-	T	rs566744182		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:72768361_72768362insT	ENST00000357814.3	-	5	462_463	c.389_390insA	c.(388-390)tctfs	p.S130fs	NAT9_ENST00000580216.1_5'Flank|NAT9_ENST00000583476.1_Frame_Shift_Ins_p.S130fs|NAT9_ENST00000583757.1_Frame_Shift_Ins_p.S129fs|NAT9_ENST00000580632.1_Intron|NAT9_ENST00000580301.1_Frame_Shift_Ins_p.S129fs|NAT9_ENST00000578822.1_Frame_Shift_Ins_p.S135fs|NAT9_ENST00000582524.1_Frame_Shift_Ins_p.S130fs|NAT9_ENST00000582870.1_Frame_Shift_Ins_p.S134fs|NAT9_ENST00000581136.1_Frame_Shift_Ins_p.S130fs	NM_015654.3	NP_056469.2	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9 (GCN5-related, putative)	130	N-acetyltransferase.					protein complex (GO:0043234)	N-acetyltransferase activity (GO:0008080)	p.Y131fs*12(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)	8						TCTTACCGTAAGACAGCATCGC	0.609																																					p.S130fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.390_391insA	17						.																																			70279957	SO:0001589	frameshift_variant	26151	exon5			AK123115	CCDS11706.1	17q25.2	2011-11-25	2008-09-24		ENSG00000109065	ENSG00000109065			23133	protein-coding gene	gene with protein product			"""N-acetyltransferase 9"""			14608357	Standard	NM_015654		Approved	DKFZP564C103	uc002jlq.3	Q9BTE0		ENST00000357814.3:c.389_390insA	17.37:g.72768361_72768362insT	ENSP00000350467:p.Ser130fs	Somatic		Capture	SOLID	Phase_I	70279956	NM_015654	B2R7F0|Q9BTD0|Q9Y3T3	Frame_Shift_Ins	INS	ENST00000357814.3	37	CCDS11706.1																																																																																				NAT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443700.1	NM_015654	
TMEM104	54868	hgsc.bcm.edu	37	17	72832329	72832330	+	In_Frame_Ins	INS	-	-	ACTGCA	rs574674425		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:72832329_72832330insACTGCA	ENST00000335464.5	+	10	1156_1157	c.994_995insACTGCA	c.(994-996)gac>gACTGCAac	p.332_333insCN	TMEM104_ENST00000582773.1_Intron|TMEM104_ENST00000417024.2_Intron|TMEM104_ENST00000582330.1_In_Frame_Ins_p.332_333insCN	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	332						integral component of membrane (GO:0016021)		p.D332_S333insCN(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					CTTCCGCGGCGACAGCCTCATG	0.619																																					p.D332delinsDCN												.	.	1	Insertion - In frame(1)	large_intestine(1)	c.994_995insACTGCA	17						.																																			70343925	SO:0001652	inframe_insertion	54868	exon10			AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		Exception_encountered	17.37:g.72832329_72832330insACTGCA	ENSP00000334849:p.Asp332_Ser333insCysAsn	Somatic		Capture	SOLID	Phase_I	70343924	NM_017728	Q8TEU1|Q9NT56|Q9NXH1	In_Frame_Ins	INS	ENST00000335464.5	37	CCDS32723.1																																																																																				TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444442.1	NM_017728	
UNC13D	201294	hgsc.bcm.edu	37	17	73826131	73826132	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:73826131_73826132insC	ENST00000207549.4	-	30	3310_3311	c.2931_2932insG	c.(2929-2934)ccattgfs	p.L978fs	UNC13D_ENST00000412096.2_Frame_Shift_Ins_p.L978fs	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	978	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)		p.L978fs*3(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCATCAAACAATGGGTGAAGGT	0.609									Familial Hemophagocytic Lymphohistiocytosis																												p.L978fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2932_2933insG	17						.																																			71337727	SO:0001589	frameshift_variant	201294	exon30	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.2931_2932insG	17.37:g.73826131_73826132insC	ENSP00000207549:p.Leu978fs	Somatic		Capture	SOLID	Phase_I	71337726	NM_199242	B4DWG9|Q9H7K5	Frame_Shift_Ins	INS	ENST00000207549.4	37	CCDS11730.1																																																																																				UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	XM_113950	
FAT2	2196	hgsc.bcm.edu	37	5	150948423	150948424	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:150948423_150948424insT	ENST00000261800.5	-	1	81_82	c.69_70insA	c.(67-72)gaagggfs	p.G24fs		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	24					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G24fs*21(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAGAGAATCCCTTCTAGAGGCT	0.485																																					p.G24fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.70_71insA	5						.																																			150928617	SO:0001589	frameshift_variant	2196	exon1			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.70dupA	5.37:g.150948425_150948425dupT	ENSP00000261800:p.Gly24fs	Somatic		Capture	SOLID	Phase_I	150928616	NM_001447	O75091|Q9NSR7	Frame_Shift_Ins	INS	ENST00000261800.5	37	CCDS4317.1																																																																																				FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
PDZD2	23037	hgsc.bcm.edu	37	5	32098677	32098678	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:32098677_32098678insA	ENST00000438447.1	+	23	8543_8544	c.8155_8156insA	c.(8155-8157)cctfs	p.P2719fs	PDZD2_ENST00000282493.3_Frame_Shift_Ins_p.P2719fs			O15018	PDZD2_HUMAN	PDZ domain containing 2	2719					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.P2719fs*34(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CCGGCAGGAGCCTCCCACAGCC	0.564																																					p.P2719fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.8155_8156insA	5						.																																			32134435	SO:0001589	frameshift_variant	23037	exon22			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		Exception_encountered	5.37:g.32098677_32098678insA	ENSP00000402033:p.Pro2719fs	Somatic		Capture	SOLID	Phase_I	32134434	NM_178140	Q9BXD4	Frame_Shift_Ins	INS	ENST00000438447.1	37	CCDS34137.1																																																																																				PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
SRRT	51593	hgsc.bcm.edu	37	7	100482167	100482167	+	Silent	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:100482167C>A	ENST00000347433.4	+	7	1094	c.936C>A	c.(934-936)ggC>ggA	p.G312G	SRRT_ENST00000388793.4_Silent_p.G312G|SRRT_ENST00000432932.1_Silent_p.G312G|SRRT_ENST00000457580.2_Silent_p.G312G			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	312	Glu-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.G312G(1)		breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						AGGAAGACGGCAAGCAGGTCC	0.632																																					p.G312G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C936A	7						.						44.0	46.0	45.0					7																	100482167		2199	4300	6499	100320103	SO:0001819	synonymous_variant	51593	exon7				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.936C>A	7.37:g.100482167C>A		Somatic		Capture	SOLID	Phase_I	100320103	NM_001128853	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Silent	SNP	ENST00000347433.4	37	CCDS34709.1																																																																																				SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
LAMB4	22798	hgsc.bcm.edu	37	7	107717485	107717485	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:107717485G>A	ENST00000388781.3	-	17	2111	c.2028C>T	c.(2026-2028)atC>atT	p.I676I	LAMB4_ENST00000388780.3_Silent_p.I676I|LAMB4_ENST00000205386.4_Silent_p.I676I|LAMB4_ENST00000414450.2_Silent_p.I676I|LAMB4_ENST00000418464.1_Silent_p.I676I	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	676	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.I676I(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GTTCTAAACAGATGGGTGTGG	0.383																																					p.I676I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2028T	7						.						97.0	102.0	101.0					7																	107717485		2203	4300	6503	107504721	SO:0001819	synonymous_variant	22798	exon17			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2028C>T	7.37:g.107717485G>A		Somatic		Capture	SOLID	Phase_I	107504721	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Silent	SNP	ENST00000388781.3	37	CCDS34732.1																																																																																				LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
NRCAM	4897	hgsc.bcm.edu	37	7	107880469	107880469	+	Missense_Mutation	SNP	C	C	T	rs535571962		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:107880469C>T	ENST00000425651.2	-	1	39	c.40G>A	c.(40-42)Gcg>Acg	p.A14T	NRCAM_ENST00000379028.3_Missense_Mutation_p.A14T|NRCAM_ENST00000379022.4_Missense_Mutation_p.A14T|NRCAM_ENST00000351718.4_Missense_Mutation_p.A14T|NRCAM_ENST00000379024.4_Missense_Mutation_p.A14T|NRCAM_ENST00000413765.2_Missense_Mutation_p.A14T	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	14					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)	p.A14T(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						ACTCTGCCCGCAGATAAGCGC	0.423																																					p.A14T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G40A	7						.						125.0	125.0	125.0					7																	107880469		2203	4300	6503	107667705	SO:0001583	missense	4897	exon4				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.40G>A	7.37:g.107880469C>T	ENSP00000401244:p.Ala14Thr	Somatic		Capture	SOLID	Phase_I	107667705	NM_001193584	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	37	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365137	0.41902	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979;ENST00000417701;ENST00000442580;ENST00000419936;ENST00000456431;ENST00000418239	T;T;T;T;T;T;T;T;T;T	0.74737	0.33;0.6;0.32;0.42;0.33;0.36;-0.28;-0.85;-0.87;-0.87	5.87	4.06	0.47325	.	0.644642	0.16184	N	0.225690	T	0.50633	0.1627	N	0.04959	-0.14	0.26752	N	0.970184	B;B;B;B;B	0.09022	0.002;0.001;0.001;0.002;0.002	B;B;B;B;B	0.17979	0.013;0.02;0.006;0.02;0.01	T	0.36601	-0.9741	10	0.29301	T	0.29	.	7.1413	0.25558	0.0:0.6736:0.1278:0.1986	.	14;14;14;14;14	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	T	14	ENSP00000368314:A14T;ENSP00000407858:A14T;ENSP00000325269:A14T;ENSP00000368310:A14T;ENSP00000401244:A14T;ENSP00000368308:A14T;ENSP00000390421:A14T;ENSP00000390868:A14T;ENSP00000397544:A14T;ENSP00000408203:A14T	ENSP00000325269:A14T	A	-	1	0	NRCAM	107667705	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.654000	0.37334	1.633000	0.50488	0.655000	0.94253	GCG		NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
FOXP2	93986	hgsc.bcm.edu	37	7	114268633	114268633	+	Silent	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:114268633C>T	ENST00000393494.2	+	4	576	c.297C>T	c.(295-297)atC>atT	p.I99I	FOXP2_ENST00000393489.3_Silent_p.I7I|FOXP2_ENST00000390668.3_Silent_p.I123I|FOXP2_ENST00000403559.4_Silent_p.I99I|FOXP2_ENST00000378237.3_Silent_p.I99I|FOXP2_ENST00000393498.2_Silent_p.I99I|FOXP2_ENST00000360232.4_Silent_p.I99I|FOXP2_ENST00000393500.3_Silent_p.I7I|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000408937.3_Silent_p.I124I|FOXP2_ENST00000393491.3_Silent_p.I7I|FOXP2_ENST00000459666.1_3'UTR|FOXP2_ENST00000350908.4_Silent_p.I99I			O15409	FOXP2_HUMAN	forkhead box P2	99	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I124I(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						CCCAGGTGATCACCCCTCAGC	0.493																																					p.I99I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C297T	7						.						206.0	176.0	186.0					7																	114268633		2203	4300	6503	114055869	SO:0001819	synonymous_variant	93986	exon4			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.297C>T	7.37:g.114268633C>T		Somatic		Capture	SOLID	Phase_I	114055869	NM_001172766	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Silent	SNP	ENST00000393494.2	37	CCDS5760.1																																																																																				FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	
FOXP2	93986	hgsc.bcm.edu	37	7	114269905	114269905	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:114269905C>T	ENST00000393494.2	+	5	721	c.442C>T	c.(442-444)Ctt>Ttt	p.L148F	FOXP2_ENST00000393489.3_Missense_Mutation_p.L56F|FOXP2_ENST00000390668.3_Missense_Mutation_p.L172F|FOXP2_ENST00000403559.4_Missense_Mutation_p.L165F|FOXP2_ENST00000378237.3_Missense_Mutation_p.L148F|FOXP2_ENST00000393498.2_Intron|FOXP2_ENST00000360232.4_Missense_Mutation_p.L148F|FOXP2_ENST00000393500.3_Missense_Mutation_p.L73F|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000408937.3_Missense_Mutation_p.L173F|FOXP2_ENST00000393491.3_Missense_Mutation_p.L56F|FOXP2_ENST00000350908.4_Missense_Mutation_p.L148F			O15409	FOXP2_HUMAN	forkhead box P2	148	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						GCAGTTACATCTTCAGCTTTT	0.403																																					p.L148F												.	.	0			c.C442T	7						.						60.0	62.0	61.0					7																	114269905		2203	4300	6503	114057141	SO:0001583	missense	93986	exon5			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.442C>T	7.37:g.114269905C>T	ENSP00000377132:p.Leu148Phe	None		Capture	SOLID	Phase_I	114057141	NM_001172766	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	37	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.099781	0.56183	.	.	ENSG00000128573	ENST00000393500;ENST00000324462;ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000378237;ENST00000393489;ENST00000360232;ENST00000452963;ENST00000390668;ENST00000393491	T;T;T;T;T;T;T;T;T;T	0.50277	1.55;1.29;1.99;1.55;1.29;0.75;0.94;1.29;1.54;1.54	6.16	6.16	0.99307	.	0.121568	0.64402	D	0.000017	T	0.72431	0.3459	M	0.79123	2.44	0.80722	D	1	D;D;D;D;D;D;D	0.69078	0.995;0.995;0.995;0.997;0.997;0.995;0.997	D;D;D;D;D;D;D	0.78314	0.969;0.969;0.969;0.986;0.991;0.969;0.991	T	0.72805	-0.4182	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	148;165;56;148;172;148;173	B7ZLK5;B4DLD9;Q0PRL4;O15409-6;Q8N6B5;O15409;O15409-4	.;.;.;.;.;FOXP2_HUMAN;.	F	73;148;148;173;165;148;148;56;148;154;172;56	ENSP00000377137:L73F;ENSP00000377132:L148F;ENSP00000386200:L173F;ENSP00000385069:L165F;ENSP00000265436:L148F;ENSP00000367482:L148F;ENSP00000377129:L56F;ENSP00000353367:L148F;ENSP00000375084:L172F;ENSP00000377130:L56F	ENSP00000319424:L148F	L	+	1	0	FOXP2	114057141	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.335000	0.65929	2.937000	0.99478	0.650000	0.86243	CTT		FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	
FOXP2	93986	hgsc.bcm.edu	37	7	114271694	114271694	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:114271694C>T	ENST00000393494.2	+	6	988	c.709C>T	c.(709-711)Cag>Tag	p.Q237*	FOXP2_ENST00000393489.3_Nonsense_Mutation_p.Q145*|FOXP2_ENST00000390668.3_Nonsense_Mutation_p.Q261*|FOXP2_ENST00000403559.4_Nonsense_Mutation_p.Q254*|FOXP2_ENST00000378237.3_Nonsense_Mutation_p.Q237*|FOXP2_ENST00000393498.2_Nonsense_Mutation_p.Q216*|FOXP2_ENST00000360232.4_Nonsense_Mutation_p.Q237*|FOXP2_ENST00000393500.3_Nonsense_Mutation_p.Q162*|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000408937.3_Nonsense_Mutation_p.Q262*|FOXP2_ENST00000393491.3_Nonsense_Mutation_p.Q145*|FOXP2_ENST00000350908.4_Nonsense_Mutation_p.Q237*			O15409	FOXP2_HUMAN	forkhead box P2	237	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						GCTCAGCCTTCAGCGTCAGGG	0.537																																					p.Q236X												.	.	0			c.C706T	7						.						79.0	61.0	67.0					7																	114271694		2203	4300	6503	114058930	SO:0001587	stop_gained	93986	exon6			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.709C>T	7.37:g.114271694C>T	ENSP00000377132:p.Gln237*	None		Capture	SOLID	Phase_I	114058930	NM_001172766	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Nonsense_Mutation	SNP	ENST00000393494.2	37	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.560186	0.65538	.	.	ENSG00000128573	ENST00000393500;ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000378237;ENST00000393489;ENST00000360232;ENST00000452963;ENST00000393495;ENST00000390668;ENST00000393491	.	.	.	5.91	5.91	0.95273	.	0.545614	0.21104	N	0.080105	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	20.3011	0.98612	0.0:1.0:0.0:0.0	.	.	.	.	X	162;237;262;254;237;214;237;145;237;243;94;261;145	.	ENSP00000265436:Q237X	Q	+	1	0	FOXP2	114058930	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	6.870000	0.75526	2.804000	0.96469	0.650000	0.86243	CAG		FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	
BBS9	27241	hgsc.bcm.edu	37	7	33573584	33573584	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:33573584G>A	ENST00000242067.6	+	21	2838	c.2317G>A	c.(2317-2319)Gat>Aat	p.D773N	BBS9_ENST00000350941.3_Missense_Mutation_p.D733N|BBS9_ENST00000354265.4_Missense_Mutation_p.D738N|BBS9_ENST00000396127.2_Missense_Mutation_p.D738N|BBS9_ENST00000355070.2_Missense_Mutation_p.D768N	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	773					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			AGAAACGGTGGATGCCGCCAT	0.428									Bardet-Biedl syndrome																												p.D738N												.	.	0			c.G2212A	7						.						143.0	142.0	142.0					7																	33573584		2203	4300	6503	33540109	SO:0001583	missense	27241	exon20	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.2317G>A	7.37:g.33573584G>A	ENSP00000242067:p.Asp773Asn	None		Capture	SOLID	Phase_I	33540109	NM_001033604	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	37	CCDS43566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.1|26.1	4.709523|4.709523	0.89018|0.89018	.|.	.|.	ENSG00000122507|ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132|ENST00000434373	T;T;T;T;T|.	0.13778|.	2.56;2.56;2.56;2.56;2.56|.	5.75|5.75	4.87|4.87	0.63330|0.63330	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71821|0.71821	0.3385|0.3385	M|M	0.68593|0.68593	2.085|2.085	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.87578|.	0.992;0.992;0.995;0.992;0.998|.	T|T	0.71731|0.71731	-0.4504|-0.4504	10|5	0.54805|.	T|.	0.06|.	-20.2035|-20.2035	14.8793|14.8793	0.70519|0.70519	0.0686:0.0:0.9314:0.0|0.0686:0.0:0.9314:0.0	.|.	773;733;768;738;773|.	Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4|.	.;.;.;.;PTHB1_HUMAN|.	N|E	773;733;738;768;738;773|339	ENSP00000242067:D773N;ENSP00000313122:D733N;ENSP00000379433:D738N;ENSP00000347182:D768N;ENSP00000346214:D738N|.	ENSP00000242067:D773N|.	D|G	+|+	1|2	0|0	BBS9|BBS9	33540109|33540109	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.204000|9.204000	0.95041|0.95041	1.445000|1.445000	0.47624|0.47624	0.655000|0.655000	0.94253|0.94253	GAT|GGA		BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1		
KIAA1324L	222223	hgsc.bcm.edu	37	7	86542401	86542401	+	Silent	SNP	C	C	T	rs369087183		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:86542401C>T	ENST00000450689.2	-	14	2036	c.1851G>A	c.(1849-1851)tcG>tcA	p.S617S	KIAA1324L_ENST00000297222.6_Silent_p.S377S|KIAA1324L_ENST00000444627.1_Intron|KIAA1324L_ENST00000490995.1_5'UTR|KIAA1324L_ENST00000416314.1_Silent_p.S450S	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	617						integral component of membrane (GO:0016021)		p.S377S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					AGGGGACACACGATGAACCCG	0.522																																					p.S617S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1851A	7						.	C	,	1,4405	2.1+/-5.4	0,1,2202	157.0	130.0	139.0		1851,1350	0.5	1.0	7		139	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	KIAA1324L	NM_001142749.2,NM_152748.3	,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,	617/1030,450/863	86542401	2,13004	2203	4300	6503	86380337	SO:0001819	synonymous_variant	222223	exon14			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1851G>A	7.37:g.86542401C>T		Somatic		Capture	SOLID	Phase_I	86380337	NM_001142749	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Silent	SNP	ENST00000450689.2	37	CCDS47632.1	.	.	.	.	.	.	.	.	.	.	C	9.993	1.231426	0.22626	2.27E-4	1.16E-4	ENSG00000164659	ENST00000423294	.	.	.	5.82	0.506	0.16961	.	.	.	.	.	T	0.43144	0.1234	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25676	-1.0125	4	.	.	.	.	2.5706	0.04794	0.1114:0.4305:0.2392:0.2188	.	.	.	.	M	578	.	.	V	-	1	0	KIAA1324L	86380337	0.902000	0.30710	1.000000	0.80357	0.972000	0.66771	-0.060000	0.11712	0.360000	0.24265	-0.878000	0.02970	GTG		KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
AKAP9	10142	hgsc.bcm.edu	37	7	91726506	91726506	+	Silent	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:91726506A>G	ENST00000359028.2	+	41	10470	c.10245A>G	c.(10243-10245)aaA>aaG	p.K3415K	AKAP9_ENST00000358100.2_Silent_p.K3361K|AKAP9_ENST00000356239.3_Silent_p.K3411K			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3415					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.K3411K(1)|p.K3415K(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCCAGTCCAAAGTGGAAGATC	0.448			T	BRAF	papillary thyroid																																p.K3403K			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A10209G	7						.						42.0	44.0	44.0					7																	91726506		2203	4299	6502	91564442	SO:0001819	synonymous_variant	10142	exon41			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.10245A>G	7.37:g.91726506A>G		Somatic		Capture	SOLID	Phase_I	91564442	NM_147185	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Silent	SNP	ENST00000359028.2	37																																																																																					AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
ARPC1B	10095	hgsc.bcm.edu	37	7	98985737	98985737	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:98985737A>T	ENST00000451682.1	+	6	554	c.245A>T	c.(244-246)aAg>aTg	p.K82M	ARPC1B_ENST00000474880.1_3'UTR|ARPC1B_ENST00000252725.5_Missense_Mutation_p.K82M|ARPC1A_ENST00000432884.2_3'UTR			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	82					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TGGACGCTGAAGGGCCGCACA	0.652																																					p.K82M												.	.	0			c.A245T	7						.						68.0	67.0	67.0					7																	98985737		2203	4300	6503	98823673	SO:0001583	missense	10095	exon4			AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.245A>T	7.37:g.98985737A>T	ENSP00000389631:p.Lys82Met	None		Capture	SOLID	Phase_I	98823673	NM_005720	Q9BU00	Missense_Mutation	SNP	ENST00000451682.1	37	CCDS5661.1	.	.	.	.	.	.	.	.	.	.	a	19.99	3.928431	0.73327	.	.	ENSG00000130429	ENST00000443222;ENST00000414376;ENST00000252725;ENST00000455009;ENST00000418347;ENST00000417330;ENST00000431816;ENST00000427217;ENST00000458033;ENST00000451682	T;T;T;T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.39	4.24	0.50183	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.089982	0.85682	D	0.000000	T	0.70395	0.3219	M	0.68728	2.09	0.58432	D	0.999993	P;P	0.44478	0.836;0.836	P;P	0.50314	0.637;0.637	T	0.71122	-0.4684	10	0.62326	D	0.03	-32.1531	8.4458	0.32841	0.8469:0.0:0.1531:0.0	.	82;82	A4D275;O15143	.;ARC1B_HUMAN	M	82	ENSP00000413173:K82M;ENSP00000398620:K82M;ENSP00000252725:K82M;ENSP00000410238:K82M;ENSP00000413067:K82M;ENSP00000403324:K82M;ENSP00000398110:K82M;ENSP00000403211:K82M;ENSP00000388802:K82M;ENSP00000389631:K82M	ENSP00000252725:K82M	K	+	2	0	ARPC1B	98823673	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	6.342000	0.72982	0.996000	0.38943	0.454000	0.30748	AAG		ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335894.1	NM_005720	
TAF6	6878	hgsc.bcm.edu	37	7	99710479	99710479	+	Silent	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:99710479C>T	ENST00000344095.4	-	6	1041	c.516G>A	c.(514-516)caG>caA	p.Q172Q	TAF6_ENST00000453269.2_Silent_p.Q172Q|TAF6_ENST00000497233.1_5'Flank|TAF6_ENST00000452041.1_Silent_p.Q172Q|RP11-506M12.1_ENST00000494221.1_RNA|TAF6_ENST00000418432.2_Silent_p.Q96Q|TAF6_ENST00000472509.1_Silent_p.Q229Q|TAF6_ENST00000437822.2_Silent_p.Q209Q	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	172					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q172Q(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CGTCTTCCTCCTGGCCTGGCT	0.607																																					p.Q209Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G627A	7						.						186.0	182.0	183.0					7																	99710479		2203	4300	6503	99548415	SO:0001819	synonymous_variant	6878	exon6				CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.516G>A	7.37:g.99710479C>T		Somatic		Capture	SOLID	Phase_I	99548415	NM_001190415	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Silent	SNP	ENST00000344095.4	37	CCDS5686.1																																																																																				TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641	
CEP41	95681	hgsc.bcm.edu	37	7	130040078	130040078	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr7:130040078G>A	ENST00000223208.5	-	10	1045	c.775C>T	c.(775-777)Cag>Tag	p.Q259*	CEP41_ENST00000541543.1_Intron|CEP41_ENST00000343969.5_Intron	NM_001257158.1|NM_018718.2	NP_001244087.1|NP_061188.1	Q9BYV8	CEP41_HUMAN	centrosomal protein 41kDa	259	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein polyglutamylation (GO:0018095)|protein transport (GO:0015031)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|primary cilium (GO:0072372)											GGGAATTTCTGAGCTAAGACT	0.512																																					p.Q259X												.	.	0			c.C775T	7						.						56.0	66.0	62.0					7																	130040078		2203	4300	6503	129827314	SO:0001587	stop_gained	95681	exon10			AJ278890	CCDS5821.1, CCDS59078.1, CCDS59079.1, CCDS59080.1	7q32	2014-02-20	2011-10-04	2011-10-04	ENSG00000106477	ENSG00000106477			12370	protein-coding gene	gene with protein product		610523	"""testis specific, 14"""	TSGA14		14654843, 22246503	Standard	NM_018718		Approved	DKFZp762H1311, FLJ22445, JBTS15	uc003vpz.4	Q9BYV8	OTTHUMG00000157823	ENST00000223208.5:c.775C>T	7.37:g.130040078G>A	ENSP00000223208:p.Gln259*	None		Capture	SOLID	Phase_I	129827314	NM_018718	A4D1M0|B4DQ35|F5H0V6|Q7Z496|Q86TM1|Q8NFU8|Q9H6A3|Q9NPV3	Nonsense_Mutation	SNP	ENST00000223208.5	37	CCDS5821.1	.	.	.	.	.	.	.	.	.	.	G	39	7.305301	0.98200	.	.	ENSG00000106477	ENST00000223208	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-17.7987	19.1304	0.93404	0.0:0.0:1.0:0.0	.	.	.	.	X	259	.	ENSP00000223208:Q259X	Q	-	1	0	TSGA14	129827314	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.202000	0.95026	2.854000	0.98071	0.655000	0.94253	CAG		CEP41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349702.2	NM_018718	
DNMT3B	1789	hgsc.bcm.edu	37	20	31390254	31390254	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr20:31390254G>A	ENST00000328111.2	+	20	2530	c.2209G>A	c.(2209-2211)Ggc>Agc	p.G737S	DNMT3B_ENST00000348286.2_Missense_Mutation_p.G717S|DNMT3B_ENST00000344505.4_Missense_Mutation_p.G717S|DNMT3B_ENST00000443239.3_Missense_Mutation_p.G675S|DNMT3B_ENST00000201963.3_Missense_Mutation_p.G729S|DNMT3B_ENST00000456297.2_Missense_Mutation_p.G641S|DNMT3B_ENST00000353855.2_Missense_Mutation_p.G717S	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	737	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ATACTTCTGGGGCAACCTACC	0.468																																					p.G717S												.	.	0			c.G2149A	20						.						142.0	138.0	139.0					20																	31390254		2203	4300	6503	30853915	SO:0001583	missense	1789	exon19				CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.2209G>A	20.37:g.31390254G>A	ENSP00000328547:p.Gly737Ser	None		Capture	SOLID	Phase_I	30853915	NM_175848	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	37	CCDS13205.1	.	.	.	.	.	.	.	.	.	.	G	36	5.734878	0.96865	.	.	ENSG00000088305	ENST00000328111;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000456297;ENST00000344505;ENST00000201963	D;D;D;D;D;T;D	0.97642	-4.47;-4.47;-4.47;-4.47;-4.47;0.48;-4.47	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.98492	0.9497	M	0.83692	2.655	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;0.999;0.999;0.999;0.997;0.999;1.0	D;D;D;D;D;D;D	0.87578	0.973;0.997;0.991;0.993;0.987;0.99;0.998	D	0.98505	1.0616	10	0.46703	T	0.11	-30.1411	18.8794	0.92351	0.0:0.0:1.0:0.0	.	641;675;436;729;717;717;737	E9PBF2;E7EN63;B3KM53;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;.;.;DNM3B_HUMAN	S	737;717;717;675;641;717;729	ENSP00000328547:G737S;ENSP00000313397:G717S;ENSP00000337764:G717S;ENSP00000403169:G675S;ENSP00000412305:G641S;ENSP00000345105:G717S;ENSP00000201963:G729S	ENSP00000201963:G729S	G	+	1	0	DNMT3B	30853915	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.869000	0.99810	2.776000	0.95493	0.650000	0.86243	GGC		DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
ZNFX1	57169	hgsc.bcm.edu	37	20	47866180	47866180	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr20:47866180G>A	ENST00000396105.1	-	14	3627	c.3381C>T	c.(3379-3381)agC>agT	p.S1127S	ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000371752.1_Silent_p.S1127S	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1127							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GGTTCTGATGGCTTTTGCCCT	0.468																																					p.S1127S												.	.	0			c.C3381T	20						.						102.0	103.0	103.0					20																	47866180		2203	4300	6503	47299587	SO:0001819	synonymous_variant	57169	exon14			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.3381C>T	20.37:g.47866180G>A		None		Capture	SOLID	Phase_I	47299587	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Silent	SNP	ENST00000396105.1	37	CCDS13417.1																																																																																				ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
ATP9A	10079	hgsc.bcm.edu	37	20	50346475	50346475	+	Silent	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr20:50346475C>T	ENST00000338821.5	-	2	375	c.111G>A	c.(109-111)agG>agA	p.R37R	ATP9A_ENST00000477492.1_5'UTR|ATP9A_ENST00000402822.1_Silent_p.R37R|ATP9A_ENST00000311637.5_Silent_p.R22R	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	37					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CAGTGCGGGGCCTGGCCTCCC	0.582																																					p.R37R												.	.	0			c.G111A	20						.						98.0	92.0	94.0					20																	50346475		2203	4300	6503	49779882	SO:0001819	synonymous_variant	10079	exon2			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.111G>A	20.37:g.50346475C>T		None		Capture	SOLID	Phase_I	49779882	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Silent	SNP	ENST00000338821.5	37	CCDS33489.1																																																																																				ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
EFCAB6	64800	hgsc.bcm.edu	37	22	44022363	44022363	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr22:44022363G>A	ENST00000262726.7	-	20	2682	c.2429C>T	c.(2428-2430)cCa>cTa	p.P810L	EFCAB6_ENST00000396231.2_Missense_Mutation_p.P658L	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	810					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				TGTTCTCCATGGTCTCTTCTC	0.473																																					p.P658L												.	.	0			c.C1973T	22						.						86.0	80.0	82.0					22																	44022363		2203	4300	6503	42353696	SO:0001583	missense	64800	exon18			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2429C>T	22.37:g.44022363G>A	ENSP00000262726:p.Pro810Leu	None		Capture	SOLID	Phase_I	42353696	NM_198856	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	G	11.13	1.548477	0.27652	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.06449	3.3;3.3	4.84	2.63	0.31362	EF-hand-like domain (1);	1.197690	0.06116	N	0.668062	T	0.06690	0.0171	L	0.53249	1.67	0.18873	N	0.999987	B;B	0.25441	0.02;0.126	B;B	0.21546	0.034;0.035	T	0.47837	-0.9086	10	0.07990	T	0.79	-0.226	5.1279	0.14894	0.1063:0.0:0.6748:0.2189	.	658;810	Q5THR3-2;Q5THR3	.;EFCB6_HUMAN	L	658;810	ENSP00000379533:P658L;ENSP00000262726:P810L	ENSP00000262726:P810L	P	-	2	0	EFCAB6	42353696	0.002000	0.14202	0.001000	0.08648	0.008000	0.06430	1.134000	0.31442	1.256000	0.44068	0.563000	0.77884	CCA		EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
MMP14	4323	hgsc.bcm.edu	37	14	23311706	23311706	+	Silent	SNP	A	A	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr14:23311706A>T	ENST00000311852.6	+	4	729	c.468A>T	c.(466-468)ccA>ccT	p.P156P	MMP14_ENST00000548162.1_3'UTR	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	156					angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P156P(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	GTGCCACACCACTGCGCTTCC	0.602																																					p.P156P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A468T	14						.						82.0	57.0	65.0					14																	23311706		2203	4300	6503	22381546	SO:0001819	synonymous_variant	4323	exon4				CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.468A>T	14.37:g.23311706A>T		Somatic		Capture	SOLID	Phase_I	22381546	NM_004995	A8K5L0|Q6GSF3|Q92678	Silent	SNP	ENST00000311852.6	37	CCDS9577.1																																																																																				MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071660.3	NM_004995	
ATL1	51062	hgsc.bcm.edu	37	14	51087444	51087444	+	Splice_Site	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr14:51087444G>A	ENST00000358385.6	+	9	1231	c.990G>A	c.(988-990)aaG>aaA	p.K330K	ATL1_ENST00000441560.2_Splice_Site_p.K330K|ATL1_ENST00000357032.3_Splice_Site_p.K330K|ATL1_ENST00000354525.4_Splice_Site_p.K330K	NM_015915.4	NP_056999.2	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1	330					axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(3)	18						AGTACTTCAAGGTATCACTCT	0.388																																					p.K330K												.	.	0			c.G990A	14						.						106.0	115.0	112.0					14																	51087444		2203	4300	6503	50157194	SO:0001630	splice_region_variant	51062	exon10			AF131801	CCDS9700.1, CCDS32077.1	14q21.3	2014-09-17	2008-09-17	2008-09-17	ENSG00000198513	ENSG00000198513			11231	protein-coding gene	gene with protein product	"""atlastin"""	606439	"""spastic paraplegia 3A (autosomal dominant)"""	SPG3, SPG3A		8252041, 7825576	Standard	NM_015915		Approved	FSP1, AD-FSP	uc001wyd.4	Q8WXF7	OTTHUMG00000140297	ENST00000358385.6:c.990+1G>A	14.37:g.51087444G>A		None		Capture	SOLID	Phase_I	50157194	NM_001127713	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Silent	SNP	ENST00000358385.6	37	CCDS9700.1																																																																																				ATL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276884.2		Silent
SAV1	60485	hgsc.bcm.edu	37	14	51107504	51107504	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr14:51107504G>A	ENST00000324679.4	-	4	1277	c.914C>T	c.(913-915)cCt>cTt	p.P305L	RN7SL452P_ENST00000482923.2_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	305					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					AAGCCAGTCAGGAATTTCTGC	0.463																																					p.P305L												.	.	0			c.C914T	14						.						182.0	169.0	173.0					14																	51107504		2203	4300	6503	50177254	SO:0001583	missense	60485	exon4			AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.914C>T	14.37:g.51107504G>A	ENSP00000324729:p.Pro305Leu	None		Capture	SOLID	Phase_I	50177254	NM_021818	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Missense_Mutation	SNP	ENST00000324679.4	37	CCDS9701.1	.	.	.	.	.	.	.	.	.	.	G	32	5.145830	0.94603	.	.	ENSG00000151748	ENST00000555720;ENST00000324679;ENST00000535862	T;T	0.69806	-0.31;-0.43	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.82121	0.4968	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83101	-0.0128	10	0.87932	D	0	-14.8676	19.0161	0.92896	0.0:0.0:1.0:0.0	.	305	Q9H4B6	SAV1_HUMAN	L	237;305;272	ENSP00000451492:P237L;ENSP00000324729:P305L	ENSP00000324729:P305L	P	-	2	0	SAV1	50177254	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.332000	0.96446	2.733000	0.93635	0.655000	0.94253	CCT		SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
ZFYVE1	53349	hgsc.bcm.edu	37	14	73441537	73441537	+	Missense_Mutation	SNP	G	G	A	rs142709121		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr14:73441537G>A	ENST00000556143.1	-	10	2657	c.1937C>T	c.(1936-1938)gCg>gTg	p.A646V	ZFYVE1_ENST00000555072.1_Missense_Mutation_p.A231V|ZFYVE1_ENST00000554145.1_5'UTR|ZFYVE1_ENST00000318876.5_Missense_Mutation_p.A632V|ZFYVE1_ENST00000553891.1_Missense_Mutation_p.A646V|ZFYVE1_ENST00000394207.2_Missense_Mutation_p.A231V	NM_001281735.1|NM_021260.2	NP_001268664.1|NP_067083.1	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1	646					negative regulation of phosphatase activity (GO:0010923)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|ER-mitochondrion membrane contact site (GO:0044233)|Golgi stack (GO:0005795)|perinuclear region of cytoplasm (GO:0048471)|pre-autophagosomal structure (GO:0000407)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|zinc ion binding (GO:0008270)	p.A646V(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(17)|ovary(1)|prostate(2)|skin(1)	35		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		CCGCACTGGCGCAGGGCCCCA	0.612																																					p.A231V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C692T	14						.	G	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	85.0	82.0	83.0		1937,692	5.2	1.0	14	dbSNP_134	83	0,8600		0,0,4300	no	missense,missense	ZFYVE1	NM_021260.2,NM_178441.1	64,64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	646/778,231/363	73441537	1,13005	2203	4300	6503	72511290	SO:0001583	missense	53349	exon7			AF251025	CCDS9811.1, CCDS41969.1, CCDS61498.1	14q24.2	2014-06-13	2003-02-28	2003-03-07		ENSG00000165861		"""Zinc fingers, FYVE domain containing"""	13180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 172"""	605471	"""zinc finger protein, subfamily 2A (FYVE domain containing), 1"""	ZNFN2A1		11024279, 11256955	Standard	NM_021260		Approved	DFCP1, KIAA1589, TAFF1, PPP1R172	uc001xnm.3	Q9HBF4		ENST00000556143.1:c.1937C>T	14.37:g.73441537G>A	ENSP00000450742:p.Ala646Val	Somatic		Capture	SOLID	Phase_I	72511290	NM_178441	J3KNL9|Q8WYX7|Q96K57|Q9BXP9|Q9HCI3	Missense_Mutation	SNP	ENST00000556143.1	37	CCDS9811.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.929917	0.73327	2.27E-4	0.0	ENSG00000165861	ENST00000553891;ENST00000318876;ENST00000556143;ENST00000394207;ENST00000555072	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66	6.07	5.18	0.71444	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.222755	0.46145	N	0.000306	T	0.54208	0.1844	N	0.20483	0.58	0.45139	D	0.998151	B;B	0.34200	0.441;0.386	B;B	0.25884	0.05;0.064	T	0.55256	-0.8169	10	0.38643	T	0.18	-24.1912	15.3906	0.74741	0.0664:0.0:0.9336:0.0	.	646;646	G3V5N8;Q9HBF4	.;ZFYV1_HUMAN	V	646;632;646;231;231	ENSP00000452442:A646V;ENSP00000326921:A632V;ENSP00000450742:A646V;ENSP00000377757:A231V;ENSP00000452232:A231V	ENSP00000326921:A646V	A	-	2	0	ZFYVE1	72511290	1.000000	0.71417	0.994000	0.49952	0.962000	0.63368	5.635000	0.67841	1.578000	0.49821	0.655000	0.94253	GCG		ZFYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413172.1	NM_021260	
NGB	58157	hgsc.bcm.edu	37	14	77734869	77734869	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr14:77734869C>A	ENST00000298352.4	-	3	635	c.261G>T	c.(259-261)gaG>gaT	p.E87D	MIR1260A_ENST00000408827.1_RNA	NM_021257.3	NP_067080.1	Q9NPG2	NGB_HUMAN	neuroglobin	87	Globin.				apoptotic process (GO:0006915)|oxygen transport (GO:0015671)	mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		TGGCAAGGTACTCCTCCAGTG	0.592																																					p.E87D												.	.	0			c.G261T	14						.						133.0	106.0	115.0					14																	77734869		2203	4300	6503	76804622	SO:0001583	missense	58157	exon3			AJ245946	CCDS9856.1	14q24.3	2014-06-13			ENSG00000165553	ENSG00000165553			14077	protein-coding gene	gene with protein product		605304				11029004, 17210637	Standard	NM_021257		Approved		uc001xtg.1	Q9NPG2	OTTHUMG00000171558	ENST00000298352.4:c.261G>T	14.37:g.77734869C>A	ENSP00000298352:p.Glu87Asp	None		Capture	SOLID	Phase_I	76804622	NM_021257		Missense_Mutation	SNP	ENST00000298352.4	37	CCDS9856.1	.	.	.	.	.	.	.	.	.	.	C	9.766	1.171507	0.21704	.	.	ENSG00000165553	ENST00000298352	D	0.93247	-3.19	4.44	2.56	0.30785	Globin-like (1);Globin, structural domain (1);	0.096778	0.64402	D	0.000001	D	0.84844	0.5562	L	0.27053	0.805	0.44221	D	0.997053	B	0.02656	0.0	B	0.01281	0.0	T	0.77520	-0.2557	10	0.26408	T	0.33	.	5.4747	0.16690	0.0:0.6367:0.0:0.3633	.	87	Q9NPG2	NGB_HUMAN	D	87	ENSP00000298352:E87D	ENSP00000298352:E87D	E	-	3	2	NGB	76804622	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	1.708000	0.37899	2.022000	0.59522	0.491000	0.48974	GAG		NGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414194.1	NM_021257	
TSHR	7253	hgsc.bcm.edu	37	14	81606046	81606046	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr14:81606046C>T	ENST00000541158.2	+	10	1038	c.716C>T	c.(715-717)aCt>aTt	p.T239I	RP11-114N19.3_ENST00000557775.1_RNA|TSHR_ENST00000298171.2_Missense_Mutation_p.T239I			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	239					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)			breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	ACCAGTGTCACTGCCCTTCCA	0.512			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																														p.T239I		yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	.	.	0			c.C716T	14						.						100.0	85.0	90.0					14																	81606046		2203	4300	6503	80675799	SO:0001583	missense	7253	exon9			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.716C>T	14.37:g.81606046C>T	ENSP00000441235:p.Thr239Ile	None		Capture	SOLID	Phase_I	80675799	NM_000369	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	ENST00000541158.2	37	CCDS9872.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767111	0.31320	.	.	ENSG00000165409	ENST00000541158;ENST00000298171	D;D	0.84516	-1.86;-1.86	5.67	5.67	0.87782	.	0.269477	0.41396	D	0.000896	D	0.83764	0.5325	M	0.72624	2.21	0.32864	D	0.508323	B	0.30455	0.28	B	0.27076	0.076	D	0.85848	0.1402	10	0.37606	T	0.19	.	14.9649	0.71184	0.0:0.9301:0.0:0.0699	.	239	F5GYU5	.	I	239	ENSP00000441235:T239I;ENSP00000298171:T239I	ENSP00000298171:T239I	T	+	2	0	TSHR	80675799	0.027000	0.19231	0.954000	0.39281	0.661000	0.39034	1.890000	0.39728	2.677000	0.91161	0.655000	0.94253	ACT		TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369	
CATSPERB	79820	hgsc.bcm.edu	37	14	92139281	92139281	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr14:92139281A>G	ENST00000256343.3	-	13	1214	c.1058T>C	c.(1057-1059)aTt>aCt	p.I353T		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	353					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)		p.I353T(1)		NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				AGTTGGAAAAATTTTTATTCC	0.363																																					p.I353T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1058C	14						.						76.0	83.0	80.0					14																	92139281		2203	4298	6501	91209034	SO:0001583	missense	79820	exon13			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1058T>C	14.37:g.92139281A>G	ENSP00000256343:p.Ile353Thr	Somatic		Capture	SOLID	Phase_I	91209034	NM_024764	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	37	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.330614	0.00227	.	.	ENSG00000133962	ENST00000256343	T	0.43294	0.95	5.43	-10.9	0.00192	.	15.000100	0.00166	N	0.000000	T	0.11410	0.0278	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37502	-0.9703	10	0.33141	T	0.24	2.2839	1.8133	0.03095	0.3809:0.0856:0.2912:0.2423	.	353	Q9H7T0	CTSRB_HUMAN	T	353	ENSP00000256343:I353T	ENSP00000256343:I353T	I	-	2	0	CATSPERB	91209034	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.220000	0.00271	-3.843000	0.00100	-3.094000	0.00064	ATT		CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	
NLGN4Y	22829	hgsc.bcm.edu	37	Y	16734312	16734312	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrY:16734312C>A	ENST00000297967.5	+	1	412	c.313C>A	c.(313-315)Cag>Aag	p.Q105K	NLGN4Y_ENST00000476359.1_3'UTR	NM_001164238.1	NP_001157710.1	Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked	105					learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.Q105K(2)		large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						AAATGCTACTCAGTTTTCTGC	0.522																																					p.Q105K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C313A	Y						.						65.0	59.0	60.0					Y																	16734312		612	1959	2571	15243706	SO:0001583	missense	22829	exon1				CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000297967.5:c.313C>A	Y.37:g.16734312C>A	ENSP00000297967:p.Gln105Lys	Somatic		Capture	SOLID	Phase_I	15243706	NM_001164238	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Missense_Mutation	SNP	ENST00000297967.5	37	CCDS55553.1																																																																																				NLGN4Y-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014893	
PRSS55	203074	hgsc.bcm.edu	37	8	10387198	10387198	+	Silent	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr8:10387198C>T	ENST00000328655.3	+	2	376	c.336C>T	c.(334-336)tcC>tcT	p.S112S	PRSS55_ENST00000522210.1_Silent_p.S112S|PRSS51_ENST00000523024.1_RNA	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	112	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.S112S(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						GCTTATATTCCGAGGAGCTGT	0.592																																					p.S112S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C336T	8						.						156.0	160.0	159.0					8																	10387198		2203	4300	6503	10424608	SO:0001819	synonymous_variant	203074	exon2			AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.336C>T	8.37:g.10387198C>T		Somatic		Capture	SOLID	Phase_I	10424608	NM_001197020	E5RJX5	Silent	SNP	ENST00000328655.3	37	CCDS5976.1																																																																																				PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	NM_198464	
SH2D4A	63898	hgsc.bcm.edu	37	8	19250959	19250959	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr8:19250959T>C	ENST00000265807.3	+	9	1590	c.1179T>C	c.(1177-1179)caT>caC	p.H393H	SH2D4A_ENST00000518040.1_Silent_p.H348H|SH2D4A_ENST00000519207.1_Silent_p.H393H	NM_001174160.1|NM_022071.3	NP_001167631.1|NP_071354.2	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	393	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				negative regulation of phosphatase activity (GO:0010923)	cytoplasm (GO:0005737)	phosphatase binding (GO:0019902)	p.H393H(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|stomach(1)	16				Colorectal(111;0.0732)		GCTGTAAACATTTCCTCATCG	0.537																																					p.H393H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1179C	8						.						105.0	95.0	99.0					8																	19250959		2203	4300	6503	19295239	SO:0001819	synonymous_variant	63898	exon9			AY190323	CCDS6009.1, CCDS55206.1	8p21	2013-02-14			ENSG00000104611	ENSG00000104611		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	26102	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 38"""	614968					Standard	NM_022071		Approved	FLJ20967, SH2A, PPP1R38	uc003wzc.3	Q9H788	OTTHUMG00000097005	ENST00000265807.3:c.1179T>C	8.37:g.19250959T>C		Somatic		Capture	SOLID	Phase_I	19295239	NM_022071	B4DDR1|Q5XKC1|Q6NXE9|Q86YM2|Q96C88|Q9H7F7	Silent	SNP	ENST00000265807.3	37	CCDS6009.1																																																																																				SH2D4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214094.1	NM_022071	
SH2D4A	63898	hgsc.bcm.edu	37	8	19250967	19250967	+	Missense_Mutation	SNP	T	T	G	rs147445565	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr8:19250967T>G	ENST00000265807.3	+	9	1598	c.1187T>G	c.(1186-1188)aTc>aGc	p.I396S	SH2D4A_ENST00000518040.1_Missense_Mutation_p.I351S|SH2D4A_ENST00000519207.1_Missense_Mutation_p.I396S	NM_001174160.1|NM_022071.3	NP_001167631.1|NP_071354.2	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	396	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				negative regulation of phosphatase activity (GO:0010923)	cytoplasm (GO:0005737)	phosphatase binding (GO:0019902)	p.I396S(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|stomach(1)	16				Colorectal(111;0.0732)		CATTTCCTCATCGATGCCTCT	0.532																																					p.I396S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1187G	8						.						100.0	90.0	93.0					8																	19250967		2203	4300	6503	19295247	SO:0001583	missense	63898	exon9			AY190323	CCDS6009.1, CCDS55206.1	8p21	2013-02-14			ENSG00000104611	ENSG00000104611		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	26102	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 38"""	614968					Standard	NM_022071		Approved	FLJ20967, SH2A, PPP1R38	uc003wzc.3	Q9H788	OTTHUMG00000097005	ENST00000265807.3:c.1187T>G	8.37:g.19250967T>G	ENSP00000265807:p.Ile396Ser	Somatic		Capture	SOLID	Phase_I	19295247	NM_022071	B4DDR1|Q5XKC1|Q6NXE9|Q86YM2|Q96C88|Q9H7F7	Missense_Mutation	SNP	ENST00000265807.3	37	CCDS6009.1	.	.	.	.	.	.	.	.	.	.	T	14.60	2.585145	0.46110	.	.	ENSG00000104611	ENST00000265807;ENST00000518040;ENST00000519207	T;T;T	0.75938	-0.98;-0.98;-0.98	5.89	4.73	0.59995	SH2 motif (4);	0.124363	0.52532	N	0.000067	D	0.90625	0.7060	H	0.98238	4.18	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92289	0.5840	10	0.87932	D	0	.	11.503	0.50448	0.1345:0.0:0.0:0.8655	.	351;396	B4DDR1;Q9H788	.;SH24A_HUMAN	S	396;351;396	ENSP00000265807:I396S;ENSP00000429482:I351S;ENSP00000428684:I396S	ENSP00000265807:I396S	I	+	2	0	SH2D4A	19295247	1.000000	0.71417	0.782000	0.31804	0.011000	0.07611	6.742000	0.74843	1.035000	0.39972	-0.354000	0.07668	ATC		SH2D4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214094.1	NM_022071	
ST18	9705	hgsc.bcm.edu	37	8	53084623	53084623	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr8:53084623G>A	ENST00000276480.7	-	10	1481	c.798C>T	c.(796-798)ccC>ccT	p.P266P		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	266					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P266P(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGCCATCCAGGGGTTCTGCGA	0.493																																					p.P266P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C798T	8						.						97.0	100.0	99.0					8																	53084623		2203	4300	6503	53247176	SO:0001819	synonymous_variant	9705	exon10			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.798C>T	8.37:g.53084623G>A		Somatic		Capture	SOLID	Phase_I	53247176	NM_014682	Q17RY1	Silent	SNP	ENST00000276480.7	37	CCDS6149.1																																																																																				ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
PLAG1	5324	hgsc.bcm.edu	37	8	57080762	57080762	+	Missense_Mutation	SNP	G	G	A	rs144724863		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr8:57080762G>A	ENST00000316981.3	-	4	546	c.67C>T	c.(67-69)Cgt>Tgt	p.R23C	PLAG1_ENST00000429357.2_Missense_Mutation_p.R23C|PLAG1_ENST00000423799.2_Intron	NM_001114634.1|NM_002655.2	NP_001108106.1|NP_002646.2	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1	23	Interacts with KPNA2.				gland morphogenesis (GO:0022612)|multicellular organism growth (GO:0035264)|negative regulation of gene expression (GO:0010629)|organ growth (GO:0035265)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R23C(1)	CTNNB1/PLAG1(60)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|FGFR1_ENST00000447712/PLAG1(28)|COL1A2/PLAG1(3)|CHCHD7/PLAG1(12)|TCEA1_ENST00000521604/PLAG1(3)	breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			CCACGCTTACGTTTCCCTGAA	0.448			T	"""TCEA1, LIFR, CTNNB1, CHCHD7"""	salivary adenoma																																p.R23C			Dom	yes		8	8q12	5324	pleiomorphic adenoma gene 1		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C67T	8						.	G	CYS/ARG,,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	115.0	104.0	108.0		67,,67	5.5	1.0	8	dbSNP_134	108	0,8600		0,0,4300	no	missense,intron,missense	PLAG1	NM_001114634.1,NM_001114635.1,NM_002655.2	180,,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,,probably-damaging	23/501,,23/501	57080762	1,13005	2203	4300	6503	57243316	SO:0001583	missense	5324	exon3			U65002	CCDS6165.1, CCDS47860.1	8q12	2010-07-30				ENSG00000181690		"""Zinc fingers, C2H2-type"""	9045	protein-coding gene	gene with protein product		603026				9268638	Standard	NM_002655		Approved	ZNF912	uc010lyi.3	Q6DJT9		ENST00000316981.3:c.67C>T	8.37:g.57080762G>A	ENSP00000325546:p.Arg23Cys	Somatic		Capture	SOLID	Phase_I	57243316	NM_001114634	B4DLC2|Q59GH8|Q9Y4L2	Missense_Mutation	SNP	ENST00000316981.3	37	CCDS6165.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509050	0.64410	2.27E-4	0.0	ENSG00000181690	ENST00000316981;ENST00000429357	T;T	0.13901	2.55;2.55	5.46	5.46	0.80206	.	0.052285	0.85682	D	0.000000	T	0.20820	0.0501	N	0.14661	0.345	0.80722	D	1	D	0.89917	1.0	P	0.58928	0.848	T	0.05852	-1.0860	10	0.87932	D	0	-17.9986	19.6662	0.95894	0.0:0.0:1.0:0.0	.	23	Q6DJT9	PLAG1_HUMAN	C	23	ENSP00000325546:R23C;ENSP00000416537:R23C	ENSP00000325546:R23C	R	-	1	0	PLAG1	57243316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.650000	0.83521	2.695000	0.91970	0.563000	0.77884	CGT		PLAG1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378212.1	NM_002655	
CA8	767	hgsc.bcm.edu	37	8	61178527	61178527	+	Missense_Mutation	SNP	C	C	T	rs200882621		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr8:61178527C>T	ENST00000317995.4	-	3	638	c.374G>A	c.(373-375)cGt>cAt	p.R125H		NM_004056.4	NP_004047.3	P35219	CAH8_HUMAN	carbonic anhydrase VIII	125					one-carbon metabolic process (GO:0006730)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasm (GO:0005737)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.R125H(1)		endometrium(2)|large_intestine(5)|lung(6)|prostate(2)|skin(1)	16		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)			Zonisamide(DB00909)	CTCAGAACCACGCTGGTTTTC	0.383																																					p.R125H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G374A	8						.						79.0	76.0	77.0					8																	61178527		2203	4300	6503	61341081	SO:0001583	missense	767	exon3			L04656	CCDS6174.1	8q12.1	2012-08-21			ENSG00000178538	ENSG00000178538		"""Carbonic anhydrases"""	1382	protein-coding gene	gene with protein product		114815		CALS		17219437	Standard	NM_004056		Approved	CARP	uc003xtz.1	P35219	OTTHUMG00000165325	ENST00000317995.4:c.374G>A	8.37:g.61178527C>T	ENSP00000314407:p.Arg125His	Somatic		Capture	SOLID	Phase_I	61341081	NM_004056	A8K0A5|B3KQZ7|Q32MY2	Missense_Mutation	SNP	ENST00000317995.4	37	CCDS6174.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870337	0.51588	.	.	ENSG00000178538	ENST00000317995	T	0.66995	-0.24	5.58	5.58	0.84498	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	T	0.73737	0.3625	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.65541	-0.6143	10	0.02654	T	1	.	19.5923	0.95520	0.0:1.0:0.0:0.0	.	125	P35219	CAH8_HUMAN	H	125	ENSP00000314407:R125H	ENSP00000314407:R125H	R	-	2	0	CA8	61341081	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.644000	0.89710	0.557000	0.71058	CGT		CA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383445.1		
TTPA	7274	hgsc.bcm.edu	37	8	63998434	63998434	+	Missense_Mutation	SNP	G	G	C	rs199805621	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr8:63998434G>C	ENST00000260116.4	-	1	178	c.147C>G	c.(145-147)gaC>gaG	p.D49E	TTPA_ENST00000521138.1_5'UTR	NM_000370.3	NP_000361.1	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	49					embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)	p.D49E(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)	15	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	GCAGGAAGGAGTCGGTGAGCG	0.746																																					p.D49E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C147G	8						.						3.0	3.0	3.0					8																	63998434		1417	2680	4097	64160988	SO:0001583	missense	7274	exon1			BC058000	CCDS6178.1	8q12.3	2007-07-18	2007-07-16			ENSG00000137561			12404	protein-coding gene	gene with protein product		600415	"""ataxia (Friedreich-like) with vitamin E deficiency"""	AVED		7719340, 7887897	Standard	NM_000370		Approved		uc003xux.2	P49638		ENST00000260116.4:c.147C>G	8.37:g.63998434G>C	ENSP00000260116:p.Asp49Glu	Somatic		Capture	SOLID	Phase_I	64160988	NM_000370	Q71V64	Missense_Mutation	SNP	ENST00000260116.4	37	CCDS6178.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.839185	0.51057	.	.	ENSG00000137561	ENST00000260116	D	0.92446	-3.04	4.29	3.39	0.38822	Phosphatidylinositol transfer protein-like, N-terminal (1);Cellular retinaldehyde-binding/triple function, N-terminal (1);	0.562105	0.19880	N	0.103997	D	0.92107	0.7498	M	0.80746	2.51	0.35346	D	0.786964	P	0.35612	0.512	B	0.43360	0.417	D	0.93262	0.6644	10	0.48119	T	0.1	.	7.0014	0.24811	0.195:0.0:0.805:0.0	.	49	P49638	TTPA_HUMAN	E	49	ENSP00000260116:D49E	ENSP00000260116:D49E	D	-	3	2	TTPA	64160988	0.995000	0.38212	0.986000	0.45419	0.146000	0.21551	1.075000	0.30716	2.190000	0.69967	0.460000	0.39030	GAC		TTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378460.1	NM_000370	
PDP1	54704	hgsc.bcm.edu	37	8	94935248	94935248	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr8:94935248G>A	ENST00000297598.4	+	2	1230	c.961G>A	c.(961-963)Gaa>Aaa	p.E321K	PDP1_ENST00000517764.1_Missense_Mutation_p.E321K|PDP1_ENST00000520728.1_Missense_Mutation_p.E321K|PDP1_ENST00000396200.3_Missense_Mutation_p.E346K	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	321					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						AAATGAAAGAGAACTAGAACG	0.502																																					p.E380K												.	.	0			c.G1138A	8						.						82.0	75.0	78.0					8																	94935248		2203	4300	6503	95004424	SO:0001583	missense	54704	exon2			AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.961G>A	8.37:g.94935248G>A	ENSP00000297598:p.Glu321Lys	None		Capture	SOLID	Phase_I	95004424	NM_001161778	B3KX71|J3KPU0|Q5U5K1	Missense_Mutation	SNP	ENST00000297598.4	37	CCDS6259.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577285	0.86645	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000517764	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.9	5.9	0.94986	Protein phosphatase 2C-like (5);	0.048835	0.85682	N	0.000000	D	0.85418	0.5692	H	0.96996	3.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89436	0.3720	10	0.87932	D	0	-9.7797	20.2789	0.98501	0.0:0.0:1.0:0.0	.	372;321	B4DYX8;Q9P0J1	.;PDP1_HUMAN	K	321;321;346;321	ENSP00000297598:E321K;ENSP00000428317:E321K;ENSP00000379503:E346K;ENSP00000430380:E321K	ENSP00000297598:E321K	E	+	1	0	PDP1	95004424	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.835000	0.99442	2.788000	0.95919	0.650000	0.86243	GAA		PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378415.2	NM_018444	
PABPC1	26986	hgsc.bcm.edu	37	8	101721870	101721870	+	Silent	SNP	G	G	A	rs146609644	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr8:101721870G>A	ENST00000318607.5	-	8	2190	c.1062C>T	c.(1060-1062)aaC>aaT	p.N354N	PABPC1_ENST00000519596.1_5'UTR|AP001205.1_ENST00000579868.1_RNA|PABPC1_ENST00000522387.1_Silent_p.N322N|PABPC1_ENST00000519004.1_Silent_p.N309N	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	354	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.N354N(1)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CAATTCTACCGTTCATTTCTG	0.448																																					p.N354N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1062T	8						.						90.0	82.0	85.0					8																	101721870		2203	4297	6500	101791046	SO:0001819	synonymous_variant	26986	exon8			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1062C>T	8.37:g.101721870G>A		Somatic		Capture	SOLID	Phase_I	101791046	NM_002568	Q15097|Q93004	Silent	SNP	ENST00000318607.5	37	CCDS6289.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.395|9.395	1.076506|1.076506	0.20227|0.20227	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000519596|ENST00000519100	.|.	.|.	.|.	4.92|4.92	0.812|0.812	0.18744|0.18744	.|.	.|.	.|.	.|.	.|.	T|T	0.55465|0.55465	0.1922|0.1922	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.45440|0.45440	-0.9261|-0.9261	4|4	.|.	.|.	.|.	.|.	8.6459|8.6459	0.34005|0.34005	0.7462:0.0:0.2538:0.0|0.7462:0.0:0.2538:0.0	.|.	.|.	.|.	.|.	W|M	187|223	.|.	.|.	R|T	-|-	1|2	2|0	PABPC1|PABPC1	101791046|101791046	0.998000|0.998000	0.40836|0.40836	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	0.616000|0.616000	0.24344|0.24344	-0.042000|-0.042000	0.13535|0.13535	-0.345000|-0.345000	0.07892|0.07892	CGG|ACG		PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
APC2	10297	hgsc.bcm.edu	37	19	1462030	1462030	+	Silent	SNP	G	G	A	rs376388515		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:1462030G>A	ENST00000535453.1	+	13	3420	c.1707G>A	c.(1705-1707)gcG>gcA	p.A569A	APC2_ENST00000233607.2_Silent_p.A569A|CTB-25B13.12_ENST00000588225.1_RNA|C19orf25_ENST00000588427.1_Intron|APC2_ENST00000238483.4_Silent_p.A295A			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)	p.A569A(1)		breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGAACAAGGCGGCCATCTGCC	0.652																																					p.A569A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1707A	19						.	G		0,4406		0,0,2203	62.0	52.0	56.0		1707	-3.3	1.0	19		56	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	APC2	NM_005883.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		569/2304	1462030	1,13005	2203	4300	6503	1413030	SO:0001819	synonymous_variant	10297	exon14				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.1707G>A	19.37:g.1462030G>A		Somatic		Capture	SOLID	Phase_I	1413030	NM_005883	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Silent	SNP	ENST00000535453.1	37	CCDS12068.1																																																																																				APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883	
ZNF556	80032	hgsc.bcm.edu	37	19	2876218	2876218	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:2876218A>C	ENST00000307635.2	+	3	345	c.258A>C	c.(256-258)aaA>aaC	p.K86N	ZNF556_ENST00000586426.1_Missense_Mutation_p.K86N	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K86N(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTTAGGAAAAAATTGGGAAG	0.398																																					p.K86N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A258C	19						.						131.0	144.0	139.0					19																	2876218		2203	4300	6503	2827218	SO:0001583	missense	80032	exon3			BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.258A>C	19.37:g.2876218A>C	ENSP00000302603:p.Lys86Asn	Somatic		Capture	SOLID	Phase_I	2827218	NM_024967	Q96GM3	Missense_Mutation	SNP	ENST00000307635.2	37	CCDS12097.1	.	.	.	.	.	.	.	.	.	.	A	12.95	2.091731	0.36952	.	.	ENSG00000172000	ENST00000307635	T	0.06218	3.33	2.39	1.34	0.21922	.	.	.	.	.	T	0.08582	0.0213	M	0.77313	2.365	0.09310	N	1	B	0.28026	0.198	B	0.18263	0.021	T	0.22452	-1.0216	9	0.52906	T	0.07	.	5.4887	0.16763	0.8452:0.0:0.1548:0.0	.	86	Q9HAH1	ZN556_HUMAN	N	86	ENSP00000302603:K86N	ENSP00000302603:K86N	K	+	3	2	ZNF556	2827218	0.126000	0.22350	0.018000	0.16275	0.515000	0.34225	0.255000	0.18333	0.199000	0.20427	0.323000	0.21402	AAA		ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451638.2	NM_024967	
ZNF556	80032	hgsc.bcm.edu	37	19	2878138	2878138	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:2878138G>A	ENST00000307635.2	+	4	1269	c.1182G>A	c.(1180-1182)ggG>ggA	p.G394G	ZNF556_ENST00000586426.1_Silent_p.G393G	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	394					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G394G(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCACACTGGGGAGAAACCTG	0.438																																					p.G394G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1182A	19						.						83.0	86.0	85.0					19																	2878138		2203	4300	6503	2829138	SO:0001819	synonymous_variant	80032	exon4			BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.1182G>A	19.37:g.2878138G>A		Somatic		Capture	SOLID	Phase_I	2829138	NM_024967	Q96GM3	Silent	SNP	ENST00000307635.2	37	CCDS12097.1																																																																																				ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451638.2	NM_024967	
AP1M1	8907	hgsc.bcm.edu	37	19	16319905	16319905	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:16319905A>C	ENST00000291439.3	+	5	912	c.463A>C	c.(463-465)Aac>Cac	p.N155H	AP1M1_ENST00000541844.1_Missense_Mutation_p.N83H|AP1M1_ENST00000590756.1_Missense_Mutation_p.N83H|AP1M1_ENST00000429941.2_Missense_Mutation_p.N155H|AP1M1_ENST00000444449.2_Missense_Mutation_p.N155H	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	155					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)		p.N155Y(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						CACCGTCACCAACGCGGTGTC	0.577																																					p.N155H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A463C	19						.						128.0	115.0	119.0					19																	16319905		2203	4300	6503	16180905	SO:0001583	missense	8907	exon5				CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.463A>C	19.37:g.16319905A>C	ENSP00000291439:p.Asn155His	None		Capture	SOLID	Phase_I	16180905	NM_032493	Q4TTY5	Missense_Mutation	SNP	ENST00000291439.3	37	CCDS12342.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.147467	0.77888	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000541844;ENST00000429941	T;T;T;T	0.65916	0.41;0.4;0.42;-0.18	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	D	0.82559	0.5063	M	0.92077	3.27	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	P;D;D	0.91635	0.827;0.986;0.999	D	0.86669	0.1909	10	0.72032	D	0.01	-39.3831	12.9082	0.58164	1.0:0.0:0.0:0.0	.	155;155;155	E7ENJ6;Q4TTY5;Q9BXS5	.;.;AP1M1_HUMAN	H	155;155;83;155	ENSP00000388996:N155H;ENSP00000291439:N155H;ENSP00000445682:N83H;ENSP00000411498:N155H	ENSP00000291439:N155H	N	+	1	0	AP1M1	16180905	1.000000	0.71417	0.977000	0.42913	0.873000	0.50193	8.897000	0.92532	1.826000	0.53198	0.460000	0.39030	AAC		AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460492.1	NM_032493	
TSHZ3	57616	hgsc.bcm.edu	37	19	31768281	31768281	+	Silent	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:31768281C>G	ENST00000240587.4	-	2	2745	c.2418G>C	c.(2416-2418)gtG>gtC	p.V806V		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	806					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V623V(1)|p.V806V(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GTGACAGAAGCACTGAACCCA	0.547																																					p.V806V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2418C	19						.						109.0	91.0	97.0					19																	31768281		2203	4300	6503	36460121	SO:0001819	synonymous_variant	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2418G>C	19.37:g.31768281C>G		Somatic		Capture	SOLID	Phase_I	36460121	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																				TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
U2AF1L4	199746	hgsc.bcm.edu	37	19	36235245	36235245	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:36235245G>A	ENST00000412391.2	-	5	340	c.327C>T	c.(325-327)ctC>ctT	p.L109L	U2AF1L4_ENST00000588100.1_5'Flank|AC002398.11_ENST00000585365.1_RNA|AD000671.6_ENST00000589807.1_3'UTR|IGFLR1_ENST00000246532.1_5'Flank|PSENEN_ENST00000587708.2_5'Flank|U2AF1L4_ENST00000292879.5_Silent_p.L70L|AC002398.9_ENST00000591613.2_5'Flank|IGFLR1_ENST00000344990.3_5'Flank|AC002398.11_ENST00000591091.1_RNA|U2AF1L4_ENST00000378975.3_Silent_p.L70L|PSENEN_ENST00000222266.2_5'Flank|IGFLR1_ENST00000588992.1_5'Flank|IGFLR1_ENST00000592537.1_5'Flank|PSENEN_ENST00000591949.1_5'Flank			Q8WU68	U2AF4_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 4	109	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.			L -> V (in Ref. 3; AAH21186). {ECO:0000305}.	mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L70L(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGTTGCCCACGAGGTGGTCCC	0.557																																					p.L70L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C210T	19						.						128.0	122.0	124.0					19																	36235245		2203	4300	6503	40927085	SO:0001819	synonymous_variant	199746	exon3			BC021186, AY569437	CCDS12473.1, CCDS42551.1	19q13.13	2013-02-12	2006-04-12	2006-04-12		ENSG00000161265		"""RNA binding motif (RRM) containing"""	23020	protein-coding gene	gene with protein product		601080	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 3"", ""U2 small nuclear RNA auxiliary factor 1-like 3"""	U2AF1L3		8586425, 11739736	Standard	NM_001040425		Approved	MGC33901, U2af26	uc002obf.3	Q8WU68		ENST00000412391.2:c.327C>T	19.37:g.36235245G>A		Somatic		Capture	SOLID	Phase_I	40927085	NM_001040425	A6NKI8|Q56UU3	Silent	SNP	ENST00000412391.2	37		.	.	.	.	.	.	.	.	.	.	G	1.823	-0.471745	0.04445	.	.	ENSG00000161265	ENST00000392196	.	.	.	5.41	-3.63	0.04529	.	.	.	.	.	T	0.36635	0.0974	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40327	-0.9569	4	.	.	.	-12.6686	0.8603	0.01191	0.1964:0.2557:0.3229:0.225	.	.	.	.	L	10	.	.	S	-	2	0	U2AF1L4	40927085	0.146000	0.22672	0.987000	0.45799	0.240000	0.25518	-0.723000	0.04952	-0.076000	0.12775	0.561000	0.74099	TCG		U2AF1L4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144987	
ZNF781	163115	hgsc.bcm.edu	37	19	38160433	38160433	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:38160433A>G	ENST00000590008.1	-	5	1469	c.617T>C	c.(616-618)gTa>gCa	p.V206A	ZNF781_ENST00000593040.1_5'Flank|ZFP30_ENST00000586732.1_Intron|ZNF781_ENST00000358582.4_Missense_Mutation_p.V206A			Q8N8C0	ZN781_HUMAN	zinc finger protein 781	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24						AAGCCTTTTTACATTCCTGAC	0.358																																					p.V206A												.	.	0			c.T617C	19						.						71.0	71.0	71.0					19																	38160433		2203	4300	6503	42852273	SO:0001583	missense	163115	exon4			AK097019	CCDS12507.1	19q13.12	2013-01-08				ENSG00000196381		"""Zinc fingers, C2H2-type"""	26745	protein-coding gene	gene with protein product							Standard	NM_152605		Approved	FLJ37549	uc002ogy.2	Q8N8C0		ENST00000590008.1:c.617T>C	19.37:g.38160433A>G	ENSP00000466370:p.Val206Ala	None		Capture	SOLID	Phase_I	42852273	NM_152605	Q2VPJ8	Missense_Mutation	SNP	ENST00000590008.1	37	CCDS12507.1	.	.	.	.	.	.	.	.	.	.	A	11.67	1.708235	0.30322	.	.	ENSG00000196381	ENST00000358582;ENST00000545586	T	0.08102	3.13	2.43	2.43	0.29744	.	.	.	.	.	T	0.18002	0.0432	M	0.84511	2.7	0.23016	N	0.998424	P	0.51791	0.948	P	0.46975	0.533	T	0.09400	-1.0676	9	0.87932	D	0	-19.3522	9.5006	0.39015	1.0:0.0:0.0:0.0	.	206	Q8N8C0	ZN781_HUMAN	A	206	ENSP00000351391:V206A	ENSP00000351391:V206A	V	-	2	0	ZNF781	42852273	0.840000	0.29493	0.115000	0.21578	0.012000	0.07955	1.693000	0.37742	1.105000	0.41606	0.421000	0.28195	GTA		ZNF781-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459495.2	NM_152605	
SIRT2	22933	hgsc.bcm.edu	37	19	39380372	39380372	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:39380372G>T	ENST00000249396.7	-	7	690	c.389C>A	c.(388-390)cCc>cAc	p.P130H	SIRT2_ENST00000392081.2_Missense_Mutation_p.P93H|SIRT2_ENST00000358931.5_Missense_Mutation_p.P130H	NM_012237.3	NP_036369.2	Q8IXJ6	SIR2_HUMAN	sirtuin 2	130	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				autophagy (GO:0006914)|cellular lipid catabolic process (GO:0044242)|cellular response to caloric restriction (GO:0061433)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to hypoxia (GO:0071456)|cellular response to molecule of bacterial origin (GO:0071219)|cellular response to oxidative stress (GO:0034599)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|chromatin silencing at telomere (GO:0006348)|gene silencing (GO:0016458)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|innate immune response (GO:0045087)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|myelination in peripheral nervous system (GO:0022011)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)|negative regulation of defense response to bacterium (GO:1900425)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of oligodendrocyte progenitor proliferation (GO:0070446)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cell division (GO:0051781)|positive regulation of DNA binding (GO:0043388)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of meiosis (GO:0045836)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)|protein kinase B signaling (GO:0043491)|regulation of cell cycle (GO:0051726)|regulation of exit from mitosis (GO:0007096)|regulation of myelination (GO:0031641)|regulation of phosphorylation (GO:0042325)|response to redox state (GO:0051775)|ripoptosome assembly involved in necroptotic process (GO:1901026)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)	centriole (GO:0005814)|centrosome (GO:0005813)|chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|glial cell projection (GO:0097386)|juxtaparanode region of axon (GO:0044224)|lateral loop (GO:0043219)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|myelin sheath (GO:0043209)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|spindle (GO:0005819)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|NAD-dependent protein deacetylase activity (GO:0034979)|protein deacetylase activity (GO:0033558)|transcription factor binding (GO:0008134)|tubulin deacetylase activity (GO:0042903)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			GGCGAAGAAGGGTTCCGGATG	0.602																																					p.P93H												.	.	0			c.C278A	19						.						86.0	71.0	76.0					19																	39380372		2203	4300	6503	44072212	SO:0001583	missense	22933	exon6			AF083107	CCDS12523.1, CCDS46069.1, CCDS74361.1	19q13	2010-06-25	2010-06-25		ENSG00000068903	ENSG00000068903			10886	protein-coding gene	gene with protein product		604480	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 2"", ""sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae)"""	SIR2L		10393250, 10381378	Standard	NM_012237		Approved		uc002ojt.2	Q8IXJ6	OTTHUMG00000150480	ENST00000249396.7:c.389C>A	19.37:g.39380372G>T	ENSP00000249396:p.Pro130His	None		Capture	SOLID	Phase_I	44072212	NM_030593	A8K3V1|B2RB45|O95889|Q924Y7|Q9P0G8|Q9UNT0|Q9Y6E9|U5TP13	Missense_Mutation	SNP	ENST00000249396.7	37	CCDS12523.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611456	0.87258	.	.	ENSG00000068903	ENST00000249396;ENST00000392081;ENST00000358931;ENST00000456703;ENST00000414941;ENST00000407552;ENST00000381766	T;T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23;2.23	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.52338	0.1728	M	0.91459	3.21	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	T	0.62520	-0.6837	10	0.87932	D	0	-29.4584	17.7802	0.88522	0.0:0.0:1.0:0.0	.	130;93;130;110	Q8IXJ6-4;Q8IXJ6-2;Q8IXJ6;Q8IXJ6-3	.;.;SIRT2_HUMAN;.	H	130;93;130;115;93;93;93	ENSP00000249396:P130H;ENSP00000375931:P93H;ENSP00000351809:P130H;ENSP00000404309:P93H;ENSP00000385146:P93H;ENSP00000401203:P93H	ENSP00000249396:P130H	P	-	2	0	SIRT2	44072212	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	9.136000	0.94489	2.739000	0.93911	0.561000	0.74099	CCC		SIRT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318278.1		
GSK3A	2931	hgsc.bcm.edu	37	19	42738779	42738779	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:42738779C>G	ENST00000222330.3	-	5	845	c.718G>C	c.(718-720)Gtg>Ctg	p.V240L	AC006486.9_ENST00000594664.1_Missense_Mutation_p.V153L|GSK3A_ENST00000398249.4_Missense_Mutation_p.V158L	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				CGGTGACACACGCCCTGGGAG	0.597																																					p.V240L												.	.	0			c.G718C	19						.						74.0	63.0	66.0					19																	42738779		2202	4300	6502	47430619	SO:0001583	missense	2931	exon5				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.718G>C	19.37:g.42738779C>G	ENSP00000222330:p.Val240Leu	None		Capture	SOLID	Phase_I	47430619	NM_019884	O14959	Missense_Mutation	SNP	ENST00000222330.3	37	CCDS12599.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092274	0.76756	.	.	ENSG00000105723	ENST00000222330;ENST00000398249;ENST00000544315	T;T	0.69175	-0.38;-0.38	4.97	2.84	0.33178	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.066193	0.64402	D	0.000015	T	0.60405	0.2266	L	0.41710	1.295	0.54753	D	0.999986	P;B	0.39352	0.669;0.087	B;B	0.44163	0.443;0.157	T	0.62765	-0.6785	10	0.59425	D	0.04	-7.1767	9.8762	0.41205	0.0:0.8297:0.0:0.1703	.	240;158	P49840;A8MT37	GSK3A_HUMAN;.	L	240;158;185	ENSP00000222330:V240L;ENSP00000381301:V158L	ENSP00000222330:V240L	V	-	1	0	GSK3A	47430619	0.979000	0.34478	0.977000	0.42913	0.983000	0.72400	2.470000	0.45119	1.230000	0.43646	0.591000	0.81541	GTG		GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1		
PRKD2	25865	hgsc.bcm.edu	37	19	47214231	47214231	+	Silent	SNP	C	C	T	rs371861713		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:47214231C>T	ENST00000291281.4	-	3	669	c.444G>A	c.(442-444)gcG>gcA	p.A148A	PRKD2_ENST00000595515.1_Silent_p.A148A|PRKD2_ENST00000433867.1_Silent_p.A148A|PRKD2_ENST00000600194.1_5'UTR|PRKD2_ENST00000601806.1_5'UTR|MIR320E_ENST00000390179.3_RNA			Q9BZL6	KPCD2_HUMAN	protein kinase D2	148					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.A148A(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		AGAAGGCAGGCGCCCGATAGG	0.652																																					p.A148A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G444A	19						.	C	,,,	1,4381		0,1,2190	31.0	25.0	27.0		444,444,,444	-11.2	0.0	19		27	0,8576		0,0,4288	no	coding-synonymous,coding-synonymous,utr-5,coding-synonymous	PRKD2	NM_001079880.1,NM_001079881.1,NM_001079882.1,NM_016457.4	,,,	0,1,6478	TT,TC,CC		0.0,0.0228,0.0077	,,,	148/879,148/879,,148/879	47214231	1,12957	2191	4288	6479	51906071	SO:0001819	synonymous_variant	25865	exon3			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.444G>A	19.37:g.47214231C>T		Somatic		Capture	SOLID	Phase_I	51906071	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Silent	SNP	ENST00000291281.4	37	CCDS12689.1																																																																																				PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
MUM1	84939	hgsc.bcm.edu	37	19	1366323	1366327	+	Frame_Shift_Del	DEL	GAGAT	GAGAT	-	rs373401790|rs376603583		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	GAGAT	GAGAT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:1366323_1366327delGAGAT	ENST00000415183.3	+	7	1333_1337	c.1307_1311delGAGAT	c.(1306-1311)agagatfs	p.RD436fs	MUM1_ENST00000344663.3_Frame_Shift_Del_p.RD436fs|MUM1_ENST00000591806.1_Frame_Shift_Del_p.RD436fs|MUM1_ENST00000311401.5_Frame_Shift_Del_p.RD367fs			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	435	PWWP.				chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)	p.R436fs*24(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCAGGCAGAGAGATAAGAAAGCAA	0.415																																					p.436_437del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1307_1311del	19						.																																			1317327	SO:0001589	frameshift_variant	84939	exon8			AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.1307_1311delGAGAT	19.37:g.1366323_1366327delGAGAT	ENSP00000394925:p.Arg436fs	Somatic		Capture	SOLID	Phase_I	1317323	NM_032853	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Frame_Shift_Del	DEL	ENST00000415183.3	37																																																																																					MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1	NM_032853	
ZNF222	7673	hgsc.bcm.edu	37	19	44536830	44536831	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	CA	CA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:44536830_44536831delCA	ENST00000187879.8	+	4	1165_1166	c.1003_1004delCA	c.(1003-1005)cacfs	p.H335fs	ZNF223_ENST00000591793.1_Intron|ZNF222_ENST00000391960.3_Frame_Shift_Del_p.H375fs	NM_013360.2	NP_037492.2	Q9UK12	ZN222_HUMAN	zinc finger protein 222	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T336fs*8(1)		endometrium(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20		Prostate(69;0.0435)				TCAACGAGTCCACACTGGAGAA	0.431																																					p.335_335del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1003_1004del	19						.																																			49228671	SO:0001589	frameshift_variant	7673	exon4			AF187988	CCDS33045.1, CCDS46098.1	19q13.2	2013-01-08				ENSG00000159885		"""Zinc fingers, C2H2-type"", ""-"""	13015	protein-coding gene	gene with protein product							Standard	NM_013360		Approved		uc002oye.3	Q9UK12		ENST00000187879.8:c.1003_1004delCA	19.37:g.44536832_44536833delCA	ENSP00000187879:p.His335fs	Somatic		Capture	SOLID	Phase_I	49228670	NM_013360	G5E9B9|Q8N6G7|Q9P1U5	Frame_Shift_Del	DEL	ENST00000187879.8	37	CCDS33045.1																																																																																				ZNF222-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460465.2		
CPT1C	126129	hgsc.bcm.edu	37	19	50209279	50209279	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:50209279C>A	ENST00000392518.4	+	11	1450	c.1078C>A	c.(1078-1080)Cag>Aag	p.Q360K	CPT1C_ENST00000405931.2_Missense_Mutation_p.Q349K|CPT1C_ENST00000354199.5_Missense_Mutation_p.Q360K|CPT1C_ENST00000598293.1_Missense_Mutation_p.Q360K|CPT1C_ENST00000323446.5_Missense_Mutation_p.Q360K	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	360					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		AGCCCTGGAGCAGCAGTTTCA	0.622																																					p.Q349K												.	.	0			c.C1045A	19						.						57.0	52.0	54.0					19																	50209279		2203	4300	6503	54901091	SO:0001583	missense	126129	exon11			AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.1078C>A	19.37:g.50209279C>A	ENSP00000376303:p.Gln360Lys	None		Capture	SOLID	Phase_I	54901091	NM_001136052	A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Missense_Mutation	SNP	ENST00000392518.4	37	CCDS12779.1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.894360	0.33442	.	.	ENSG00000169169	ENST00000392518;ENST00000354199;ENST00000405931;ENST00000323446;ENST00000295404	D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39	4.29	4.29	0.51040	.	0.000000	0.45126	D	0.000391	T	0.79528	0.4461	N	0.13003	0.285	0.31628	N	0.649405	B;P;B;B	0.42248	0.049;0.774;0.019;0.004	B;P;B;B	0.44946	0.055;0.465;0.032;0.055	T	0.76277	-0.3018	10	0.05525	T	0.97	-23.7305	12.1789	0.54202	0.0:0.8258:0.1742:0.0	.	231;360;349;360	C9IY45;Q8TCG5-3;Q8TCG5-2;Q8TCG5	.;.;.;CPT1C_HUMAN	K	360;360;349;360;231	ENSP00000376303:Q360K;ENSP00000346138:Q360K;ENSP00000384465:Q349K;ENSP00000319343:Q360K	ENSP00000295404:Q231K	Q	+	1	0	CPT1C	54901091	0.114000	0.22134	1.000000	0.80357	0.989000	0.77384	0.563000	0.23547	2.225000	0.72522	0.555000	0.69702	CAG		CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465873.1	NM_152359	
NLRP11	204801	hgsc.bcm.edu	37	19	56321102	56321105	+	Frame_Shift_Del	DEL	CCTC	CCTC	-			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	CCTC	CCTC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr19:56321102_56321105delCCTC	ENST00000589093.1	-	3	964_967	c.871_874delGAGG	c.(871-876)gaggtafs	p.EV291fs	NLRP11_ENST00000360133.3_Frame_Shift_Del_p.EV291fs|NLRP11_ENST00000443188.1_Frame_Shift_Del_p.EV291fs|NLRP11_ENST00000592953.1_Frame_Shift_Del_p.EV192fs|NLRP11_ENST00000589824.2_Frame_Shift_Del_p.EV291fs			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	291	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)	p.E291fs*1(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CAGCAATCTACCTCTTTCAAGAAC	0.495																																					p.291_292del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.871_874del	19						.																																			61012917	SO:0001589	frameshift_variant	204801	exon5			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.871_874delGAGG	19.37:g.56321102_56321105delCCTC	ENSP00000466285:p.Glu291fs	Somatic		Capture	SOLID	Phase_I	61012914	NM_145007	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Frame_Shift_Del	DEL	ENST00000589093.1	37	CCDS12935.1																																																																																				NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
PRDM2	7799	hgsc.bcm.edu	37	1	14105363	14105363	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:14105363T>G	ENST00000235372.7	+	8	1929	c.1073T>G	c.(1072-1074)tTt>tGt	p.F358C	PRDM2_ENST00000413440.1_Missense_Mutation_p.F157C|PRDM2_ENST00000311066.5_Missense_Mutation_p.F358C|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.F157C	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TTTGAAACGTTTATGTTTCCG	0.418																																					p.F358C												.	.	0			c.T1073G	1						.						125.0	117.0	119.0					1																	14105363		2203	4300	6503	13977950	SO:0001583	missense	7799	exon8			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.1073T>G	1.37:g.14105363T>G	ENSP00000235372:p.Phe358Cys	None		Capture	SOLID	Phase_I	13977950	NM_012231	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	T	12.77	2.038369	0.35989	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01599	4.86;4.74;4.76;4.76	5.67	4.51	0.55191	.	0.211717	0.42172	D	0.000748	T	0.05593	0.0147	L	0.39898	1.24	0.47737	D	0.999506	D;D;D;D	0.89917	0.999;0.975;0.998;1.0	D;P;P;D	0.69479	0.921;0.498;0.887;0.964	T	0.34576	-0.9823	10	0.72032	D	0.01	.	10.8479	0.46753	0.1415:0.0:0.0:0.8585	.	358;216;358;358	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	C	358;358;358;157;157	ENSP00000235372:F358C;ENSP00000312352:F358C;ENSP00000411103:F157C;ENSP00000341621:F157C	ENSP00000235372:F358C	F	+	2	0	PRDM2	13977950	0.955000	0.32602	0.209000	0.23619	0.942000	0.58702	2.454000	0.44979	0.928000	0.37168	0.459000	0.35465	TTT		PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
S1PR1	1901	hgsc.bcm.edu	37	1	101705672	101705672	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:101705672G>A	ENST00000305352.6	+	2	1507	c.1132G>A	c.(1132-1134)Gtc>Atc	p.V378I		NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	378					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.V378I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						TTCTGGAAACGTCAACTCTTC	0.532																																					p.V378I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1132A	1						.						38.0	36.0	37.0					1																	101705672		2093	4143	6236	101478260	SO:0001583	missense	1901	exon2			M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.1132G>A	1.37:g.101705672G>A	ENSP00000305416:p.Val378Ile	Somatic		Capture	SOLID	Phase_I	101478260	NM_001400	D3DT66|Q9BYY4|Q9NYN8	Missense_Mutation	SNP	ENST00000305352.6	37	CCDS777.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830396	0.32329	.	.	ENSG00000170989	ENST00000305352	T	0.72051	-0.62	5.38	5.38	0.77491	.	0.207523	0.40640	N	0.001056	T	0.40398	0.1115	N	0.16478	0.41	0.36239	D	0.853157	B	0.06786	0.001	B	0.04013	0.001	T	0.34153	-0.9840	10	0.13470	T	0.59	.	19.1353	0.93426	0.0:0.0:1.0:0.0	.	378	P21453	S1PR1_HUMAN	I	378	ENSP00000305416:V378I	ENSP00000305416:V378I	V	+	1	0	S1PR1	101478260	0.994000	0.37717	1.000000	0.80357	0.973000	0.67179	2.153000	0.42282	2.524000	0.85096	0.305000	0.20034	GTC		S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029908.1	NM_001400	
GJA8	2703	hgsc.bcm.edu	37	1	147380601	147380601	+	Silent	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:147380601C>T	ENST00000369235.1	+	1	519	c.519C>T	c.(517-519)taC>taT	p.Y173Y	GJA8_ENST00000240986.4_Silent_p.Y173Y			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	173					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)	p.Y173Y(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					ACTTCCTGTACGGGTTCCGGA	0.597																																					p.Y173Y	Melanoma(76;1255 1795 8195 52096)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C519T	1						.						107.0	101.0	103.0					1																	147380601		2203	4300	6503	145847225	SO:0001819	synonymous_variant	2703	exon2			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.519C>T	1.37:g.147380601C>T		Somatic		Capture	SOLID	Phase_I	145847225	NM_005267	A7L5M5|Q5VVN9|Q9NP25	Silent	SNP	ENST00000369235.1	37	CCDS30834.1																																																																																				GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267	
KPRP	448834	hgsc.bcm.edu	37	1	152733396	152733396	+	Silent	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:152733396G>T	ENST00000606109.1	+	1	1360	c.1332G>T	c.(1330-1332)ccG>ccT	p.P444P	KPRP_ENST00000368773.1_Silent_p.P444P			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	444	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.P444P(1)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCAACACCGCGGCCAGTTC	0.577																																					p.P444P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1332T	1						.						173.0	173.0	173.0					1																	152733396		2203	4300	6503	151000020	SO:0001819	synonymous_variant	448834	exon2			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1332G>T	1.37:g.152733396G>T		Somatic		Capture	SOLID	Phase_I	151000020	NM_001025231		Silent	SNP	ENST00000606109.1	37	CCDS30862.1																																																																																				KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231	
APOA1BP	128240	hgsc.bcm.edu	37	1	156562358	156562358	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:156562358C>G	ENST00000368235.3	+	4	455	c.412C>G	c.(412-414)Cca>Gca	p.P138A	APOA1BP_ENST00000368233.3_Missense_Mutation_p.P138A|APOA1BP_ENST00000467374.1_3'UTR|APOA1BP_ENST00000368234.3_Missense_Mutation_p.P138A	NM_144772.2	NP_658985.2			apolipoprotein A-I binding protein									p.P138A(1)		central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|urinary_tract(1)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGGCTACGAGCCAACCATCTA	0.542																																					p.P138A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C412G	1						.						173.0	173.0	173.0					1																	156562358		2203	4300	6503	154828982	SO:0001583	missense	128240	exon4			AJ315849	CCDS1145.1	1q21	2008-08-14			ENSG00000163382	ENSG00000163382			18453	protein-coding gene	gene with protein product	"""apoA-I binding protein"""	608862				11991719, 17533573	Standard	NM_144772		Approved	AIBP, MGC119143, MGC119144, MGC119145, YJEFN1	uc001fph.3	Q8NCW5	OTTHUMG00000033206	ENST00000368235.3:c.412C>G	1.37:g.156562358C>G	ENSP00000357218:p.Pro138Ala	Somatic		Capture	SOLID	Phase_I	154828982	NM_144772		Missense_Mutation	SNP	ENST00000368235.3	37	CCDS1145.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.337500	0.60963	.	.	ENSG00000163382	ENST00000446584;ENST00000368234;ENST00000368235;ENST00000368233	T;T;T	0.39056	1.1;1.1;1.1	4.08	4.08	0.47627	YjeF-related protein, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.60818	0.2298	M	0.89030	3	0.80722	D	1	P;P;D	0.89917	0.738;0.927;1.0	P;P;D	0.97110	0.672;0.762;1.0	T	0.64262	-0.6449	10	0.30854	T	0.27	.	15.0102	0.71545	0.0:1.0:0.0:0.0	.	138;138;138	Q5T3I3;Q8NCW5;Q5T3I4	.;AIBP_HUMAN;.	A	156;138;138;138	ENSP00000357217:P138A;ENSP00000357218:P138A;ENSP00000357216:P138A	ENSP00000357216:P138A	P	+	1	0	APOA1BP	154828982	1.000000	0.71417	0.998000	0.56505	0.221000	0.24807	7.582000	0.82546	2.104000	0.64026	0.655000	0.94253	CCA		APOA1BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081044.1	NM_144772	
FCRL5	83416	hgsc.bcm.edu	37	1	157497673	157497673	+	Missense_Mutation	SNP	C	C	T	rs376321602		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:157497673C>T	ENST00000361835.3	-	9	1851	c.1694G>A	c.(1693-1695)cGc>cAc	p.R565H	FCRL5_ENST00000368190.3_Missense_Mutation_p.R565H|FCRL5_ENST00000356953.4_Missense_Mutation_p.R565H|FCRL5_ENST00000368191.3_Missense_Mutation_p.R480H	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	565					negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.R565H(2)|p.R565P(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GAGGATGGGGCGAGACACTGG	0.527																																					p.R565H												.	.	3	Substitution - Missense(3)	ovary(1)|large_intestine(1)|kidney(1)	c.G1694A	1						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	44.0	49.0	47.0		1694,1694	1.6	0.9	1		47	2,8598		0,2,4298	no	missense,missense	FCRL5	NM_001195388.1,NM_031281.2	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	565/999,565/978	157497673	2,13004	2203	4300	6503	155764297	SO:0001583	missense	83416	exon9			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1694G>A	1.37:g.157497673C>T	ENSP00000354691:p.Arg565His	Somatic		Capture	SOLID	Phase_I	155764297	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	C	7.816	0.716824	0.15306	0.0	2.33E-4	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191	T;T;T;T	0.03496	3.91;3.91;3.91;3.91	3.53	1.59	0.23543	.	0.445392	0.16880	N	0.195724	T	0.01523	0.0049	L	0.45352	1.415	0.80722	D	1	P;P;P;P	0.51057	0.514;0.941;0.783;0.783	B;B;B;B	0.43809	0.167;0.432;0.38;0.38	T	0.63152	-0.6701	10	0.30854	T	0.27	.	6.3384	0.21309	0.0:0.7603:0.0:0.2397	.	480;565;565;565	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9	.;.;.;FCRL5_HUMAN	H	565;565;565;480	ENSP00000354691:R565H;ENSP00000349434:R565H;ENSP00000357173:R565H;ENSP00000357174:R480H	ENSP00000349434:R565H	R	-	2	0	FCRL5	155764297	0.001000	0.12720	0.922000	0.36590	0.821000	0.46438	-2.375000	0.01071	0.293000	0.22520	0.650000	0.86243	CGC		FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
CD5L	922	hgsc.bcm.edu	37	1	157804357	157804357	+	Silent	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:157804357C>A	ENST00000368174.4	-	4	654	c.558G>T	c.(556-558)ctG>ctT	p.L186L	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	186	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.L186L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GTTTTTGAGTCAGTACAGCCC	0.577																																					p.L186L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G558T	1						.						97.0	87.0	91.0					1																	157804357		2203	4300	6503	156070981	SO:0001819	synonymous_variant	922	exon4			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.558G>T	1.37:g.157804357C>A		Somatic		Capture	SOLID	Phase_I	156070981	NM_005894	A8K7M5|Q6UX63	Silent	SNP	ENST00000368174.4	37	CCDS1171.1																																																																																				CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
NOS1AP	9722	hgsc.bcm.edu	37	1	162326870	162326870	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:162326870C>T	ENST00000361897.5	+	8	1285	c.883C>T	c.(883-885)Ctc>Ttc	p.L295F	NOS1AP_ENST00000530878.1_Missense_Mutation_p.L290F	NM_001164757.1|NM_014697.2	NP_001158229.1|NP_055512.1	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein	295					regulation of apoptotic process (GO:0042981)|regulation of nitric oxide biosynthetic process (GO:0045428)|regulation of nitric-oxide synthase activity (GO:0050999)		nitric-oxide synthase binding (GO:0050998)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			CCAGATgcagctcctccagca	0.617																																					p.L295F												.	.	0			c.C883T	1						.						58.0	56.0	57.0					1																	162326870		2203	4300	6503	160593494	SO:0001583	missense	9722	exon8			AB007933	CCDS1237.1, CCDS44267.1, CCDS53421.1	1q23.3	2010-08-20			ENSG00000198929	ENSG00000198929			16859	protein-coding gene	gene with protein product	"""C-terminal PDZ domain ligand of neuronal nitric oxide synthase"""	605551				9455484, 9459447	Standard	NM_001126060		Approved	KIAA0464, CAPON	uc001gbv.2	O75052	OTTHUMG00000024049	ENST00000361897.5:c.883C>T	1.37:g.162326870C>T	ENSP00000355133:p.Leu295Phe	None		Capture	SOLID	Phase_I	160593494	NM_014697	B7ZLF5|O43564|Q3T551|Q5VU95	Missense_Mutation	SNP	ENST00000361897.5	37	CCDS1237.1	.	.	.	.	.	.	.	.	.	.	C	19.26	3.794235	0.70452	.	.	ENSG00000198929	ENST00000530878;ENST00000361897	D;D	0.81821	-1.54;-1.54	5.36	5.36	0.76844	.	0.057880	0.64402	D	0.000001	D	0.87366	0.6159	M	0.72894	2.215	.	.	.	D;P;P	0.71674	0.998;0.653;0.903	D;B;B	0.75484	0.986;0.24;0.351	D	0.87768	0.2603	9	0.56958	D	0.05	.	17.676	0.88230	0.0:1.0:0.0:0.0	.	290;290;295	E9PSG0;B7ZLF5;O75052	.;.;CAPON_HUMAN	F	290;295	ENSP00000431586:L290F;ENSP00000355133:L295F	ENSP00000355133:L295F	L	+	1	0	NOS1AP	160593494	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.432000	0.52824	2.496000	0.84212	0.563000	0.77884	CTC		NOS1AP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060555.2	NM_014697	
ASTN1	460	hgsc.bcm.edu	37	1	176833480	176833480	+	Silent	SNP	C	C	T	rs144824957	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:176833480C>T	ENST00000367654.3	-	23	4060	c.3849G>A	c.(3847-3849)acG>acA	p.T1283T	ASTN1_ENST00000367657.3_Intron|ASTN1_ENST00000361833.2_Silent_p.T1275T	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1283					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.T1275T(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GCTCCTCACACGTCTTCCTGA	0.582													C|||	9	0.00179712	0.0	0.0	5008	,	,		17840	0.0		0.001	False		,,,				2504	0.0082				p.T1275T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3825A	1						.	C		2,4404	4.2+/-10.8	0,2,2201	126.0	121.0	123.0		3825	-9.2	0.6	1	dbSNP_134	123	34,8566	24.0+/-70.4	0,34,4266	no	coding-synonymous	ASTN1	NM_004319.1		0,36,6467	TT,TC,CC		0.3953,0.0454,0.2768		1275/1295	176833480	36,12970	2203	4300	6503	175100103	SO:0001819	synonymous_variant	460	exon23			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3849G>A	1.37:g.176833480C>T		Somatic		Capture	SOLID	Phase_I	175100103	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	37																																																																																					ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
AXDND1	126859	hgsc.bcm.edu	37	1	179502937	179502937	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:179502937C>T	ENST00000367618.3	+	24	3110	c.2723C>T	c.(2722-2724)tCa>tTa	p.S908L		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	908	Glu-rich.									NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						CAGAGAGAGTCAGCTAAGCAA	0.363																																					p.S908L												.	.	0			c.C2723T	1						.						159.0	148.0	152.0					1																	179502937		2203	4300	6503	177769560	SO:0001583	missense	126859	exon24			BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2723C>T	1.37:g.179502937C>T	ENSP00000356590:p.Ser908Leu	None		Capture	SOLID	Phase_I	177769560	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	37	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	C	7.415	0.635520	0.14322	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.18174	2.23;2.23	4.5	1.48	0.22813	.	1.278560	0.05863	N	0.623288	T	0.14700	0.0355	L	0.51422	1.61	0.09310	N	1	B;B	0.30068	0.267;0.267	B;B	0.25140	0.058;0.058	T	0.32719	-0.9896	10	0.23891	T	0.37	-1.5499	4.8511	0.13537	0.421:0.4761:0.0:0.1028	.	792;908	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	L	908;792;768	ENSP00000356590:S908L;ENSP00000391716:S768L	ENSP00000353471:S792L	S	+	2	0	AXDND1	177769560	0.000000	0.05858	0.011000	0.14972	0.329000	0.28539	0.008000	0.13197	0.567000	0.29293	-0.274000	0.10170	TCA		AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
CDC73	79577	hgsc.bcm.edu	37	1	193104577	193104577	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:193104577A>G	ENST00000367435.3	+	4	548	c.364A>G	c.(364-366)Act>Gct	p.T122A	MIR1278_ENST00000408753.1_RNA	NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	122					cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						TCAGCGATCTACTCAAGGTAT	0.353																																					p.T122A												.	.	0			c.A364G	1						.						101.0	96.0	98.0					1																	193104577		2203	4300	6503	191371200	SO:0001583	missense	79577	exon4			AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.364A>G	1.37:g.193104577A>G	ENSP00000356405:p.Thr122Ala	None		Capture	SOLID	Phase_I	191371200	NM_024529	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	37	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	A	15.95	2.983517	0.53827	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	D	0.84442	-1.85	5.7	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.76205	0.3955	L	0.41027	1.25	0.80722	D	1	B	0.16802	0.019	B	0.16289	0.015	T	0.66180	-0.5988	10	0.07644	T	0.81	-17.3636	11.5137	0.50509	0.9298:0.0:0.0702:0.0	.	122	Q6P1J9	CDC73_HUMAN	A	122	ENSP00000356405:T122A	ENSP00000356405:T122A	T	+	1	0	CDC73	191371200	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	0.983000	0.38602	0.528000	0.53228	ACT		CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529	
C4BPA	722	hgsc.bcm.edu	37	1	207318002	207318002	+	Silent	SNP	T	T	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:207318002T>A	ENST00000367070.3	+	12	1928	c.1734T>A	c.(1732-1734)atT>atA	p.I578I		NM_000715.3	NP_000706.1	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	578					complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.I578I(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(1)|urinary_tract(2)	28						CTCTGGAAATTGAACAACTGG	0.438																																					p.I578I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1734A	1						.						55.0	53.0	54.0					1																	207318002		2203	4300	6503	205384625	SO:0001819	synonymous_variant	722	exon12			M31452	CCDS1477.1	1q32	2010-09-24	2001-11-28		ENSG00000123838	ENSG00000123838			1325	protein-coding gene	gene with protein product		120830	"""complement component 4-binding protein, alpha"""	C4BP			Standard	XM_005273251		Approved		uc001hfo.3	P04003	OTTHUMG00000036173	ENST00000367070.3:c.1734T>A	1.37:g.207318002T>A		Somatic		Capture	SOLID	Phase_I	205384625	NM_000715	Q5VVQ8	Silent	SNP	ENST00000367070.3	37	CCDS1477.1																																																																																				C4BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088089.3		
LPGAT1	9926	hgsc.bcm.edu	37	1	211966418	211966418	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:211966418C>T	ENST00000366997.4	-	3	579	c.353G>A	c.(352-354)gGa>gAa	p.G118E	LPGAT1_ENST00000366996.1_Missense_Mutation_p.G118E|RN7SL344P_ENST00000485522.2_RNA	NM_014873.2	NP_055688.1	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	118					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		GCTTACCAGTCCTTTGTCCTG	0.458																																					p.G118E												.	.	0			c.G353A	1						.						280.0	261.0	267.0					1																	211966418		2203	4300	6503	210033041	SO:0001583	missense	9926	exon3			D86960	CCDS31018.1	1q32.3	2008-05-14	2004-11-25	2004-11-26	ENSG00000123684	ENSG00000123684			28985	protein-coding gene	gene with protein product		610473	"""family with sequence similarity 34, member A"""	FAM34A		9039502, 15485873	Standard	NM_014873		Approved	KIAA0205, FAM34A1, NET8	uc001hiv.3	Q92604	OTTHUMG00000037120	ENST00000366997.4:c.353G>A	1.37:g.211966418C>T	ENSP00000355964:p.Gly118Glu	None		Capture	SOLID	Phase_I	210033041	NM_014873	Q53YL2	Missense_Mutation	SNP	ENST00000366997.4	37	CCDS31018.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772937	0.90108	.	.	ENSG00000123684	ENST00000366997;ENST00000366996	D;D	0.93604	-3.25;-3.25	5.68	5.68	0.88126	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.96169	0.8751	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95000	0.8142	10	0.38643	T	0.18	-8.9808	19.8668	0.96806	0.0:1.0:0.0:0.0	.	118	Q92604	LGAT1_HUMAN	E	118	ENSP00000355964:G118E;ENSP00000355963:G118E	ENSP00000355963:G118E	G	-	2	0	LPGAT1	210033041	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.129000	0.77225	2.702000	0.92279	0.556000	0.70494	GGA		LPGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090150.1	NM_014873	
ECE1	1889	hgsc.bcm.edu	37	1	21599259	21599259	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:21599259G>A	ENST00000374893.6	-	4	500	c.426C>T	c.(424-426)ggC>ggT	p.G142G	ECE1_ENST00000436918.2_Silent_p.G142G|ECE1_ENST00000415912.2_Silent_p.G126G|ECE1_ENST00000264205.6_Silent_p.G139G|ECE1_ENST00000357071.4_Silent_p.G130G	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	142					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)	p.G142G(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		AGCGTGAGTGGCCATCAGGGA	0.577																																					p.G130G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C390T	1						.						153.0	136.0	142.0					1																	21599259		2203	4300	6503	21471846	SO:0001819	synonymous_variant	1889	exon2			D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.426C>T	1.37:g.21599259G>A		Somatic		Capture	SOLID	Phase_I	21471846	NM_001113347	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Silent	SNP	ENST00000374893.6	37	CCDS215.1																																																																																				ECE1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007470.2	NM_001397	
USH2A	7399	hgsc.bcm.edu	37	1	216465661	216465661	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:216465661G>A	ENST00000307340.3	-	10	2082	c.1696C>T	c.(1696-1698)Caa>Taa	p.Q566*	USH2A_ENST00000366943.2_Nonsense_Mutation_p.Q566*|USH2A_ENST00000366942.3_Nonsense_Mutation_p.Q566*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	566	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCGTAAACTTGATCACCTTGG	0.388										HNSCC(13;0.011)																											p.Q566X												.	.	0			c.C1696T	1	GRCh37	CM001370	USH2A	M		.						103.0	96.0	98.0					1																	216465661		2203	4300	6503	214532284	SO:0001587	stop_gained	7399	exon10			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1696C>T	1.37:g.216465661G>A	ENSP00000305941:p.Gln566*	None		Capture	SOLID	Phase_I	214532284	NM_206933	Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	42	9.437386	0.99171	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	.	.	.	4.81	2.81	0.32909	.	0.559054	0.14758	U	0.300180	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	10.1943	0.43045	0.0:0.1314:0.6874:0.1812	.	.	.	.	X	566	.	ENSP00000305941:Q566X	Q	-	1	0	USH2A	214532284	1.000000	0.71417	0.308000	0.25141	0.990000	0.78478	3.153000	0.50685	0.361000	0.24292	0.467000	0.42956	CAA		USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
CDC42BPA	8476	hgsc.bcm.edu	37	1	227222475	227222475	+	Silent	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:227222475C>T	ENST00000366769.3	-	25	4543	c.3252G>A	c.(3250-3252)gtG>gtA	p.V1084V	CDC42BPA_ENST00000366766.2_Silent_p.V1119V|CDC42BPA_ENST00000366767.3_Silent_p.V1003V|CDC42BPA_ENST00000535525.1_Silent_p.V1064V|CDC42BPA_ENST00000366764.2_Silent_p.V1056V|CDC42BPA_ENST00000334218.5_Silent_p.V1084V|CDC42BPA_ENST00000366765.3_Silent_p.V1097V	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				ACCCTTTCTTCACTCCAGCTG	0.393																																					p.V1003V												.	.	0			c.G3009A	1						.						144.0	130.0	135.0					1																	227222475		2203	4300	6503	225289098	SO:0001819	synonymous_variant	8476	exon24			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.3252G>A	1.37:g.227222475C>T		None		Capture	SOLID	Phase_I	225289098	NM_014826		Silent	SNP	ENST00000366769.3	37	CCDS1558.1	.	.	.	.	.	.	.	.	.	.	C	9.749	1.167022	0.21621	.	.	ENSG00000143776	ENST00000448940;ENST00000442054;ENST00000441725	.	.	.	5.81	1.92	0.25849	.	.	.	.	.	T	0.53514	0.1801	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42783	-0.9431	4	.	.	.	.	5.7056	0.17907	0.0:0.5067:0.1319:0.3613	.	.	.	.	K	287;413;309	.	.	E	-	1	0	CDC42BPA	225289098	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.877000	0.28106	0.391000	0.25143	-0.157000	0.13467	GAA		CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
PLD5	200150	hgsc.bcm.edu	37	1	242277226	242277226	+	Missense_Mutation	SNP	C	C	T	rs201629512		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:242277226C>T	ENST00000536534.2	-	7	1277	c.1036G>A	c.(1036-1038)Gac>Aac	p.D346N	PLD5_ENST00000427495.1_Missense_Mutation_p.D284N|PLD5_ENST00000442594.2_Missense_Mutation_p.D254N			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	346						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.D254N(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			GGCAGGTAGTCCATGACAGCG	0.473																																					p.D284N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G850A	1						.						190.0	142.0	158.0					1																	242277226		2203	4300	6503	240343849	SO:0001583	missense	200150	exon7			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1036G>A	1.37:g.242277226C>T	ENSP00000440896:p.Asp346Asn	Somatic		Capture	SOLID	Phase_I	240343849	NM_001195811	A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	37	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	C	24.8	4.568102	0.86439	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.22945	1.93;1.93;1.93	5.48	5.48	0.80851	Phospholipase D/viral envelope (1);	0.000000	0.85682	D	0.000000	T	0.47322	0.1439	L	0.60455	1.87	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.984;0.989;0.984	T	0.17930	-1.0353	10	0.30854	T	0.27	-15.3805	17.1341	0.86734	0.0:1.0:0.0:0.0	.	254;346;284	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	N	284;254;346	ENSP00000401285:D284N;ENSP00000414188:D254N;ENSP00000440896:D346N	ENSP00000401285:D284N	D	-	1	0	PLD5	240343849	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	6.251000	0.72441	2.569000	0.86673	0.643000	0.83706	GAC		PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	
CCNL2	81669	hgsc.bcm.edu	37	1	1322887	1322892	+	In_Frame_Del	DEL	CGGTGG	CGGTGG	-	rs368716428|rs577659961		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	CGGTGG	CGGTGG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:1322887_1322892delCGGTGG	ENST00000400809.3	-	11	1287_1292	c.1282_1287delCCACCG	c.(1282-1287)ccaccgdel	p.PP428del	CCNL2_ENST00000408952.5_In_Frame_Del_p.PP206del|CCNL2_ENST00000505849.1_5'UTR	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	428					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.P428_P429delPP(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		GGGCCTGTCTCGGTGGGGAGTCACTC	0.626																																					p.428_429del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.1282_1287del	1						.																																			1312755	SO:0001651	inframe_deletion	81669	exon11			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.1282_1287delCCACCG	1.37:g.1322887_1322892delCGGTGG	ENSP00000383611:p.Pro428_Pro429del	Somatic		Capture	SOLID	Phase_I	1312750	NM_030937	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	In_Frame_Del	DEL	ENST00000400809.3	37	CCDS30557.1																																																																																				CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937	
SLC9A1	6548	hgsc.bcm.edu	37	1	27440563	27440563	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:27440563G>C	ENST00000263980.3	-	2	1142	c.567C>G	c.(565-567)atC>atG	p.I189M	SLC9A1_ENST00000374086.3_Missense_Mutation_p.I189M|SLC9A1_ENST00000545949.1_Intron	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	189					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)	p.I189M(1)		central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	CAAAGATCAGGATGGTGCCCA	0.607																																					p.I189M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C567G	1						.						83.0	70.0	75.0					1																	27440563		2203	4300	6503	27313150	SO:0001583	missense	6548	exon2			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.567C>G	1.37:g.27440563G>C	ENSP00000263980:p.Ile189Met	Somatic		Capture	SOLID	Phase_I	27313150	NM_003047	B1ALD6|D3DPL4|Q96EM2	Missense_Mutation	SNP	ENST00000263980.3	37	CCDS295.1	.	.	.	.	.	.	.	.	.	.	G	32	5.123183	0.94429	.	.	ENSG00000090020	ENST00000263980;ENST00000374086	T;T	0.20200	2.09;2.09	5.8	5.8	0.92144	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.59770	0.2218	M	0.94063	3.49	0.80722	D	1	D;D	0.89917	0.985;1.0	P;D	0.77557	0.897;0.99	T	0.69811	-0.5044	10	0.87932	D	0	.	19.0453	0.93018	0.0:0.0:1.0:0.0	.	189;189	P19634-2;P19634	.;SL9A1_HUMAN	M	189	ENSP00000263980:I189M;ENSP00000363199:I189M	ENSP00000263980:I189M	I	-	3	3	SLC9A1	27313150	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	6.700000	0.74619	2.751000	0.94390	0.655000	0.94253	ATC		SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047	
PRPF38A	84950	hgsc.bcm.edu	37	1	52870494	52870494	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:52870494A>C	ENST00000257181.9	+	1	259	c.73A>C	c.(73-75)Att>Ctt	p.I25L	PRPF38A_ENST00000474048.1_3'UTR|ORC1_ENST00000371566.1_5'Flank|ORC1_ENST00000371568.3_5'Flank	NM_032864.3	NP_116253.2	Q8NAV1	PR38A_HUMAN	pre-mRNA processing factor 38A	25					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			cervix(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|stomach(1)	9						GGAGAAGATCATTCGAACGCG	0.507											OREG0013487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I25L												.	.	0			c.A73C	1						.						116.0	107.0	110.0					1																	52870494		2203	4300	6503	52643082	SO:0001583	missense	84950	exon1			AK092038	CCDS567.1	1p32.3	2013-10-03	2013-10-03		ENSG00000134748	ENSG00000134748			25930	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing A"""			12477932	Standard	NM_032864		Approved	FLJ14936, Prp38	uc001ctw.4	Q8NAV1	OTTHUMG00000008199	ENST00000257181.9:c.73A>C	1.37:g.52870494A>C	ENSP00000257181:p.Ile25Leu	None	988	Capture	SOLID	Phase_I	52643082	NM_032864	Q96JW1|Q9BVZ8	Missense_Mutation	SNP	ENST00000257181.9	37	CCDS567.1	.	.	.	.	.	.	.	.	.	.	A	32	5.188829	0.94923	.	.	ENSG00000134748	ENST00000257181	.	.	.	5.82	5.82	0.92795	.	0.140555	0.64402	N	0.000006	T	0.65491	0.2696	L	0.56396	1.775	0.80722	D	1	B	0.31125	0.309	B	0.42882	0.401	T	0.59873	-0.7372	9	0.10636	T	0.68	-13.3637	16.1917	0.81992	1.0:0.0:0.0:0.0	.	25	Q8NAV1	PR38A_HUMAN	L	25	.	ENSP00000257181:I25L	I	+	1	0	PRPF38A	52643082	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.107000	0.94261	2.216000	0.71823	0.533000	0.62120	ATT		PRPF38A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022459.2	NM_032864	
LRRC8C	84230	hgsc.bcm.edu	37	1	90179160	90179160	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:90179160G>A	ENST00000370454.4	+	3	1286	c.1031G>A	c.(1030-1032)cGt>cAt	p.R344H	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	344					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R344H(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CTGTTCTACCGTTCTCTACGG	0.388																																					p.R344H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1031A	1						.						69.0	59.0	63.0					1																	90179160		2203	4300	6503	89951748	SO:0001583	missense	84230	exon3				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1031G>A	1.37:g.90179160G>A	ENSP00000359483:p.Arg344His	Somatic		Capture	SOLID	Phase_I	89951748	NM_032270	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	37	CCDS725.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425343	0.62733	.	.	ENSG00000171488	ENST00000370454	T	0.52295	0.67	5.77	5.77	0.91146	.	0.146393	0.64402	D	0.000007	T	0.60945	0.2308	M	0.64404	1.975	0.53005	D	0.999963	D	0.89917	1.0	D	0.67725	0.953	T	0.58216	-0.7675	10	0.48119	T	0.1	.	19.9923	0.97371	0.0:0.0:1.0:0.0	.	344	Q8TDW0	LRC8C_HUMAN	H	344	ENSP00000359483:R344H	ENSP00000359483:R344H	R	+	2	0	LRRC8C	89951748	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.874000	0.87199	2.729000	0.93468	0.585000	0.79938	CGT		LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
LPPR4	9890	hgsc.bcm.edu	37	1	99772291	99772291	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:99772291T>A	ENST00000370185.3	+	7	2514	c.2017T>A	c.(2017-2019)Tgt>Agt	p.C673S	LPPR4_ENST00000457765.1_Missense_Mutation_p.C615S|LPPR4_ENST00000370184.1_Missense_Mutation_p.C515S	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		673					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		CTCAGAAAGCTGTGAGTCTCT	0.512																																					p.C615S												.	.	0			c.T1843A	1						.						68.0	63.0	65.0					1																	99772291		2203	4300	6503	99544879	SO:0001583	missense	9890	exon6																														ENST00000370185.3:c.2017T>A	1.37:g.99772291T>A	ENSP00000359204:p.Cys673Ser	None		Capture	SOLID	Phase_I	99544879	NM_001166252	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	CCDS757.1	.	.	.	.	.	.	.	.	.	.	T	13.44	2.237172	0.39498	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000370184	T;T;T	0.20332	2.65;2.68;2.08	5.9	5.9	0.94986	.	0.334028	0.36740	N	0.002422	T	0.06645	0.0170	N	0.19112	0.55	0.80722	D	1	B;B	0.28998	0.23;0.012	B;B	0.23574	0.047;0.006	T	0.22661	-1.0210	9	.	.	.	-19.4262	16.3317	0.83023	0.0:0.0:0.0:1.0	.	615;673	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	S	673;615;515	ENSP00000359204:C673S;ENSP00000394913:C615S;ENSP00000359203:C515S	.	C	+	1	0	RP4-788L13.1	99544879	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	5.667000	0.68067	2.264000	0.75181	0.533000	0.62120	TGT		LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
PALMD	54873	hgsc.bcm.edu	37	1	100152323	100152323	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:100152323C>T	ENST00000263174.4	+	4	718	c.343C>T	c.(343-345)Cgg>Tgg	p.R115W	PALMD_ENST00000605497.1_Missense_Mutation_p.R115W	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	115					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)		p.R115W(2)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		GTCAATTGAGCGGACAACAGA	0.333																																					p.R115W												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C343T	1						.						83.0	91.0	88.0					1																	100152323		2203	4300	6503	99924911	SO:0001583	missense	54873	exon4			AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.343C>T	1.37:g.100152323C>T	ENSP00000263174:p.Arg115Trp	Somatic		Capture	SOLID	Phase_I	99924911	NM_017734	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Missense_Mutation	SNP	ENST00000263174.4	37	CCDS758.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.772301	0.69992	.	.	ENSG00000099260	ENST00000263174	T	0.17370	2.28	5.87	3.52	0.40303	.	0.191850	0.56097	D	0.000039	T	0.24547	0.0595	L	0.56769	1.78	0.34706	D	0.727288	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.984	T	0.08743	-1.0707	10	0.87932	D	0	-9.4698	13.0487	0.58942	0.735:0.2649:0.0:0.0	.	115;35	Q9NP74;Q9NP74-2	PALMD_HUMAN;.	W	115	ENSP00000263174:R115W	ENSP00000263174:R115W	R	+	1	2	PALMD	99924911	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.301000	0.51842	0.545000	0.28902	-0.262000	0.10625	CGG		PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029672.1	NM_017734	
CNST	163882	hgsc.bcm.edu	37	1	246810608	246810608	+	Missense_Mutation	SNP	G	G	T	rs369168079		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:246810608G>T	ENST00000366513.4	+	9	1374	c.1105G>T	c.(1105-1107)Gcc>Tcc	p.A369S	CNST_ENST00000366512.3_Missense_Mutation_p.A369S|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	369					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)	p.A369S(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						CAGCGCTGAAGCCACGTTAGC	0.582											OREG0014367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A369S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1105T	1						.						83.0	85.0	84.0					1																	246810608		2203	4300	6503	244877231	SO:0001583	missense	163882	exon9			AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1105G>T	1.37:g.246810608G>T	ENSP00000355470:p.Ala369Ser	Somatic	2468	Capture	SOLID	Phase_I	244877231	NM_152609	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	ENST00000366513.4	37	CCDS1628.1	.	.	.	.	.	.	.	.	.	.	G	4.396	0.073089	0.08485	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.16073	2.37;2.42	5.39	1.95	0.26073	.	0.735360	0.13405	N	0.390356	T	0.10508	0.0257	L	0.41356	1.27	0.09310	N	0.999997	B;B	0.23377	0.084;0.084	B;B	0.18561	0.022;0.022	T	0.38607	-0.9653	10	0.05721	T	0.95	5.7986	6.7202	0.23327	0.1696:0.0:0.6407:0.1896	.	369;369	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	S	369	ENSP00000355470:A369S;ENSP00000355469:A369S	ENSP00000355469:A369S	A	+	1	0	CNST	244877231	0.337000	0.24766	0.004000	0.12327	0.012000	0.07955	1.258000	0.32944	0.739000	0.32628	0.467000	0.42956	GCC		CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609	
BEND3	57673	hgsc.bcm.edu	37	6	107391651	107391651	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:107391651G>A	ENST00000369042.1	-	4	934	c.744C>T	c.(742-744)ctC>ctT	p.L248L	BEND3_ENST00000429433.2_Silent_p.L248L			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	248	BEN 1. {ECO:0000255|PROSITE- ProRule:PRU00784}.							p.L248L(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						CTGCGGCTGTGAGCTGGTACT	0.637																																					p.L248L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C744T	6						.						39.0	35.0	36.0					6																	107391651		2203	4300	6503	107498344	SO:0001819	synonymous_variant	57673	exon5			AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.744C>T	6.37:g.107391651G>A		Somatic		Capture	SOLID	Phase_I	107498344	NM_001080450	A2RRH2|Q9HCL9	Silent	SNP	ENST00000369042.1	37	CCDS34507.1																																																																																				BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913	
ZBTB24	9841	hgsc.bcm.edu	37	6	109787463	109787463	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	G	T	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:109787463T>G	ENST00000230122.3	-	7	1852	c.1685A>C	c.(1684-1686)aAc>aCc	p.N562T	MICAL1_ENST00000368952.4_5'Flank	NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	562					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		GAAATTGATGTTATGTACAGA	0.468																																					p.N562T												.	.	0			c.A1685C	6						.						139.0	132.0	135.0					6																	109787463		2203	4300	6503	109894156	SO:0001583	missense	9841	exon7			AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.1685A>C	6.37:g.109787463T>G	ENSP00000230122:p.Asn562Thr	Germline		Capture	SOLID	Phase_I	109894156	NM_014797	Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	ENST00000230122.3	37	CCDS34509.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.576324	0.86645	.	.	ENSG00000112365	ENST00000230122	T	0.10860	2.83	6.06	6.06	0.98353	.	0.089147	0.85682	D	0.000000	T	0.08358	0.0208	N	0.24115	0.695	0.41414	D	0.987758	D	0.89917	1.0	D	0.68765	0.96	T	0.05241	-1.0897	10	0.02654	T	1	-37.6964	16.6093	0.84858	0.0:0.0:0.0:1.0	.	562	O43167	ZBT24_HUMAN	T	562	ENSP00000230122:N562T	ENSP00000230122:N562T	N	-	2	0	ZBTB24	109894156	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.318000	0.79029	2.324000	0.78689	0.533000	0.62120	AAC		ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041758.1	NM_014797	
GPR6	2830	hgsc.bcm.edu	37	6	110301320	110301320	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:110301320G>A	ENST00000275169.3	+	1	1023	c.1005G>A	c.(1003-1005)gaG>gaA	p.E335E	GPR6_ENST00000414000.2_Silent_p.E350E	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	335					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.E335E(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		GCAACCAGGAGATCCAGCGCG	0.612																																					p.E335E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1005A	6						.						107.0	110.0	109.0					6																	110301320		2203	4300	6503	110408013	SO:0001819	synonymous_variant	2830	exon1				CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.1005G>A	6.37:g.110301320G>A		Somatic		Capture	SOLID	Phase_I	110408013	NM_005284	B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Silent	SNP	ENST00000275169.3	37	CCDS5079.1																																																																																				GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041774.1		
REV3L	5980	hgsc.bcm.edu	37	6	111632322	111632322	+	Silent	SNP	T	T	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:111632322T>A	ENST00000358835.3	-	30	9199	c.8745A>T	c.(8743-8745)ggA>ggT	p.G2915G	REV3L_ENST00000435970.1_Silent_p.G2837G|REV3L_ENST00000462119.1_5'UTR|RP5-1112D6.8_ENST00000607434.1_RNA|REV3L_ENST00000368802.3_Silent_p.G2915G|REV3L_ENST00000368805.1_Silent_p.G2915G			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2915					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.G2837G(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AAGAAAAACTTCCTCTGTATT	0.413								DNA polymerases (catalytic subunits)																													p.G2915G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A8745T	6						.						161.0	162.0	162.0					6																	111632322		2203	4300	6503	111739015	SO:0001819	synonymous_variant	5980	exon29			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.8745A>T	6.37:g.111632322T>A		Somatic		Capture	SOLID	Phase_I	111739015	NM_002912	O43214|Q5TC33	Silent	SNP	ENST00000358835.3	37	CCDS5091.2																																																																																				REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
HECA	51696	hgsc.bcm.edu	37	6	139488137	139488137	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:139488137G>T	ENST00000367658.2	+	2	1273	c.988G>T	c.(988-990)Gca>Tca	p.A330S	RP1-225E12.2_ENST00000587577.1_RNA|RP1-225E12.2_ENST00000586266.1_RNA|RP1-225E12.2_ENST00000586229.1_RNA|RP1-225E12.2_ENST00000588638.1_RNA|RP1-225E12.3_ENST00000585874.1_RNA|RP1-225E12.2_ENST00000591102.1_RNA|RP1-225E12.2_ENST00000589192.1_RNA|RP1-225E12.2_ENST00000590679.1_RNA|RP1-225E12.2_ENST00000415194.2_RNA|RP1-225E12.2_ENST00000588529.1_RNA	NM_016217.2	NP_057301.1	Q9UBI9	HDC_HUMAN	headcase homolog (Drosophila)	330					respiratory tube development (GO:0030323)	membrane (GO:0016020)				endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		TGCGGGGTTGGCAGTTCACAG	0.577																																					p.A330S												.	.	0			c.G988T	6						.						54.0	57.0	56.0					6																	139488137		2202	4300	6502	139529830	SO:0001583	missense	51696	exon2			AB033492	CCDS5194.1	6q23-q24	2010-11-25			ENSG00000112406	ENSG00000112406			21041	protein-coding gene	gene with protein product		607977				11696983, 19643820	Standard	NM_016217		Approved	HDCL, hHDC, HDC, dJ225E12.1	uc003qin.3	Q9UBI9	OTTHUMG00000015686	ENST00000367658.2:c.988G>T	6.37:g.139488137G>T	ENSP00000356630:p.Ala330Ser	None		Capture	SOLID	Phase_I	139529830	NM_016217		Missense_Mutation	SNP	ENST00000367658.2	37	CCDS5194.1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.838218	0.00573	.	.	ENSG00000112406	ENST00000367658	.	.	.	5.07	2.68	0.31781	.	0.444855	0.24820	N	0.035337	T	0.03434	0.0099	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43556	-0.9384	9	0.02654	T	1	.	4.1327	0.10156	0.0:0.1875:0.5274:0.2851	.	330	Q9UBI9	HDC_HUMAN	S	330	.	ENSP00000356630:A330S	A	+	1	0	HECA	139529830	0.001000	0.12720	0.007000	0.13788	0.114000	0.19823	0.451000	0.21779	0.410000	0.25675	-0.362000	0.07510	GCA		HECA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042456.1	NM_016217	
NMBR	4829	hgsc.bcm.edu	37	6	142409609	142409609	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:142409609T>G	ENST00000258042.1	-	1	327	c.187A>C	c.(187-189)Atg>Ctg	p.M63L	RP11-137J7.2_ENST00000454401.1_RNA	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	63					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		TTCACCAGCATGATGTTGCCC	0.607																																					p.M63L												.	.	0			c.A187C	6						.						86.0	79.0	81.0					6																	142409609		2203	4300	6503	142451302	SO:0001583	missense	4829	exon1				CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.187A>C	6.37:g.142409609T>G	ENSP00000258042:p.Met63Leu	None		Capture	SOLID	Phase_I	142451302	NM_002511	E9KL38|Q5VUK8	Missense_Mutation	SNP	ENST00000258042.1	37	CCDS5196.1	.	.	.	.	.	.	.	.	.	.	T	12.28	1.890821	0.33348	.	.	ENSG00000135577	ENST00000258042	T	0.62788	0.0	5.61	-7.84	0.01196	GPCR, rhodopsin-like superfamily (1);	0.409722	0.31020	N	0.008417	T	0.06690	0.0171	N	0.00855	-1.145	0.23282	N	0.997988	B	0.02656	0.0	B	0.01281	0.0	T	0.40270	-0.9572	10	0.14252	T	0.57	-3.3535	9.1352	0.36870	0.0:0.4094:0.2376:0.353	.	63	P28336	NMBR_HUMAN	L	63	ENSP00000258042:M63L	ENSP00000258042:M63L	M	-	1	0	NMBR	142451302	0.987000	0.35691	0.225000	0.23894	0.296000	0.27459	0.190000	0.17057	-1.602000	0.01599	-0.256000	0.11100	ATG		NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1		
FBXO30	84085	hgsc.bcm.edu	37	6	146125582	146125582	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:146125582G>A	ENST00000237281.4	-	2	2126	c.1960C>T	c.(1960-1962)Cgt>Tgt	p.R654C		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	654							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		ACCATGCCACGAGACTGAAGC	0.448																																					p.R654C												.	.	0			c.C1960T	6						.						145.0	137.0	140.0					6																	146125582		2203	4300	6503	146167275	SO:0001583	missense	84085	exon2			AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.1960C>T	6.37:g.146125582G>A	ENSP00000237281:p.Arg654Cys	None		Capture	SOLID	Phase_I	146167275	NM_032145	Q9BXZ7	Missense_Mutation	SNP	ENST00000237281.4	37	CCDS5208.1	.	.	.	.	.	.	.	.	.	.	G	16.01	3.001072	0.54254	.	.	ENSG00000118496	ENST00000237281	T	0.60548	0.18	5.86	5.86	0.93980	F-box domain, cyclin-like (1);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.74344	0.3704	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75764	-0.3203	10	0.87932	D	0	-16.5277	20.1784	0.98192	0.0:0.0:1.0:0.0	.	654	Q8TB52	FBX30_HUMAN	C	654	ENSP00000237281:R654C	ENSP00000237281:R654C	R	-	1	0	FBXO30	146167275	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.545000	0.73883	2.771000	0.95319	0.643000	0.83706	CGT		FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042570.2		
JARID2	3720	hgsc.bcm.edu	37	6	15501450	15501450	+	Missense_Mutation	SNP	G	G	C	rs369351310		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:15501450G>C	ENST00000341776.2	+	8	2502	c.2258G>C	c.(2257-2259)cGc>cCc	p.R753P	JARID2_ENST00000397311.3_Missense_Mutation_p.R581P|JARID2_ENST00000541660.1_Missense_Mutation_p.R715P	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	753					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CCTCTGCCCCGCTTCGAGCCC	0.637																																					p.R753P												.	.	0			c.G2258C	6						.						89.0	96.0	93.0					6																	15501450		2203	4300	6503	15609429	SO:0001583	missense	3720	exon8			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2258G>C	6.37:g.15501450G>C	ENSP00000341280:p.Arg753Pro	None		Capture	SOLID	Phase_I	15609429	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632967	0.87660	.	.	ENSG00000008083	ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.92647	-2.37;-2.37;-3.08	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.94647	0.8274	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.95150	0.8272	10	0.72032	D	0.01	-15.6472	18.4009	0.90515	0.0:0.0:1.0:0.0	.	715;753	F5H590;Q92833	.;JARD2_HUMAN	P	753;581;715	ENSP00000341280:R753P;ENSP00000380478:R581P;ENSP00000444623:R715P	ENSP00000341280:R753P	R	+	2	0	JARID2	15609429	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.582000	0.98214	2.339000	0.79563	0.561000	0.74099	CGC		JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
JARID2	3720	hgsc.bcm.edu	37	6	15501452	15501452	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:15501452T>C	ENST00000341776.2	+	8	2504	c.2260T>C	c.(2260-2262)Ttc>Ctc	p.F754L	JARID2_ENST00000397311.3_Missense_Mutation_p.F582L|JARID2_ENST00000541660.1_Missense_Mutation_p.F716L	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	754				F -> L (in Ref. 1; AAC50822). {ECO:0000305}.	central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.F754L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				TCTGCCCCGCTTCGAGCCCAA	0.642																																					p.F754L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2260C	6						.						88.0	95.0	93.0					6																	15501452		2203	4300	6503	15609431	SO:0001583	missense	3720	exon8			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2260T>C	6.37:g.15501452T>C	ENSP00000341280:p.Phe754Leu	Somatic		Capture	SOLID	Phase_I	15609431	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.470174	0.63625	.	.	ENSG00000008083	ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.88277	-1.71;-1.71;-2.36	5.05	5.05	0.67936	.	0.056142	0.64402	D	0.000001	T	0.73202	0.3557	L	0.36672	1.1	0.49213	D	0.999768	B;B	0.33171	0.4;0.085	B;B	0.30855	0.121;0.039	T	0.74153	-0.3757	10	0.11794	T	0.64	-11.9726	14.7923	0.69851	0.0:0.0:0.0:1.0	.	716;754	F5H590;Q92833	.;JARD2_HUMAN	L	754;582;716	ENSP00000341280:F754L;ENSP00000380478:F582L;ENSP00000444623:F716L	ENSP00000341280:F754L	F	+	1	0	JARID2	15609431	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.809000	0.86057	1.895000	0.54865	0.459000	0.35465	TTC		JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
SYNE1	23345	hgsc.bcm.edu	37	6	152675802	152675802	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:152675802G>A	ENST00000367255.5	-	67	11519	c.10918C>T	c.(10918-10920)Cag>Tag	p.Q3640*	SYNE1_ENST00000423061.1_Intron|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.Q3640*|SYNE1_ENST00000448038.1_Intron|SYNE1_ENST00000341594.5_Nonsense_Mutation_p.Q3611*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3640					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ACCTTCATCTGATGTAATTGT	0.388										HNSCC(10;0.0054)																											p.Q3640X												.	.	0			c.C10918T	6						.						236.0	206.0	217.0					6																	152675802		2203	4300	6503	152717495	SO:0001587	stop_gained	23345	exon67			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10918C>T	6.37:g.152675802G>A	ENSP00000356224:p.Gln3640*	None		Capture	SOLID	Phase_I	152717495	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	55	23.331096	0.99954	.	.	ENSG00000131018	ENST00000367255;ENST00000265368;ENST00000341594	.	.	.	5.4	5.4	0.78164	.	0.000000	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	19.5287	0.95219	0.0:0.0:1.0:0.0	.	.	.	.	X	3640;3640;3611	.	ENSP00000265368:Q3640X	Q	-	1	0	SYNE1	152717495	1.000000	0.71417	0.996000	0.52242	0.618000	0.37518	5.034000	0.64152	2.676000	0.91093	0.650000	0.86243	CAG		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
ZDHHC14	79683	hgsc.bcm.edu	37	6	158066850	158066850	+	Silent	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:158066850C>G	ENST00000359775.5	+	6	1723	c.834C>G	c.(832-834)tcC>tcG	p.S278S	ZDHHC14_ENST00000414563.2_Silent_p.S278S|ZDHHC14_ENST00000341375.8_3'UTR			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	278					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.S278S(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		TGATCAGCTCCAACCAGACAA	0.522																																					p.S278S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C834G	6						.						161.0	121.0	135.0					6																	158066850		2203	4296	6499	157986838	SO:0001819	synonymous_variant	79683	exon6			AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.834C>G	6.37:g.158066850C>G		Somatic		Capture	SOLID	Phase_I	157986838	NM_153746	A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Silent	SNP	ENST00000359775.5	37	CCDS5252.1	.	.	.	.	.	.	.	.	.	.	C	11.03	1.519183	0.27211	.	.	ENSG00000175048	ENST00000340347	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	T	0.54631	0.1870	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56208	-0.8017	4	.	.	.	-34.8274	12.9264	0.58262	0.1625:0.8375:0.0:0.0	.	.	.	.	R	103	.	.	P	+	2	0	ZDHHC14	157986838	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.361000	0.52306	2.043000	0.60533	0.459000	0.35465	CCA		ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042841.2	NM_153746	
RNF144B	255488	hgsc.bcm.edu	37	6	18399782	18399782	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:18399782G>T	ENST00000259939.3	+	2	334	c.17G>T	c.(16-18)aGg>aTg	p.R6M	RNF144B_ENST00000429054.2_Intron|RNF144B_ENST00000486622.1_3'UTR|snoU13_ENST00000459328.1_RNA	NM_182757.3	NP_877434.2	Q7Z419	R144B_HUMAN	ring finger protein 144B	6					apoptotic process (GO:0006915)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)	11	Ovarian(93;0.00365)|Breast(50;0.0145)	all_hematologic(90;0.0536)	OV - Ovarian serous cystadenocarcinoma(7;0.00165)|all cancers(50;0.0102)|Epithelial(50;0.0105)			TCAGCTGGTAGGCTCCACTAT	0.498																																					p.R6M												.	.	0			c.G17T	6						.						85.0	82.0	83.0					6																	18399782		2203	4300	6503	18507761	SO:0001583	missense	255488	exon2			AK096832	CCDS34345.1	6p22.3	2011-05-23	2009-01-05	2007-08-20	ENSG00000137393	ENSG00000137393		"""RING-type (C3HC4) zinc fingers"""	21578	protein-coding gene	gene with protein product			"""IBR domain containing 2"""	IBRDC2			Standard	NM_182757		Approved	bA528A10.3	uc003ncs.3	Q7Z419	OTTHUMG00000014322	ENST00000259939.3:c.17G>T	6.37:g.18399782G>T	ENSP00000259939:p.Arg6Met	None		Capture	SOLID	Phase_I	18507761	NM_182757	B3KUA8|B4DZI2|Q5TB85|Q6P4Q0|Q8N3R7|Q9BX38	Missense_Mutation	SNP	ENST00000259939.3	37	CCDS34345.1	.	.	.	.	.	.	.	.	.	.	G	9.193	1.026590	0.19512	.	.	ENSG00000137393	ENST00000259939	T	0.31769	1.48	5.74	3.65	0.41850	.	1.266200	0.04947	N	0.459605	T	0.06690	0.0171	N	0.14661	0.345	0.09310	N	0.999996	P	0.39576	0.679	B	0.31614	0.133	T	0.09422	-1.0675	10	0.46703	T	0.11	.	6.6695	0.23060	0.3521:0.0:0.6479:0.0	.	6	Q7Z419	R144B_HUMAN	M	6	ENSP00000259939:R6M	ENSP00000259939:R6M	R	+	2	0	RNF144B	18507761	0.048000	0.20356	0.006000	0.13384	0.283000	0.27025	2.360000	0.44151	1.437000	0.47472	0.655000	0.94253	AGG		RNF144B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039965.2	XM_172581	
HIST1H2BF	8343	hgsc.bcm.edu	37	6	26199830	26199830	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:26199830C>G	ENST00000359985.1	+	1	83	c.44C>G	c.(43-45)tCc>tGc	p.S15C	HIST1H3D_ENST00000377831.5_5'Flank|HIST1H2AD_ENST00000341023.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank	NM_003522.3	NP_003513.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	15					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(7)|upper_aerodigestive_tract(3)	17		all_hematologic(11;0.196)				AAAAAGGGCTCCAAAAAGGCG	0.498																																					p.S15C												.	.	0			c.C44G	6						.						109.0	106.0	107.0					6																	26199830		2203	4300	6503	26307809	SO:0001583	missense	8343	exon1			Z80779	CCDS4592.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197846	ENSG00000277224		"""Histones / Replication-dependent"""	4752	protein-coding gene	gene with protein product		602804	"""H2B histone family, member G"", ""histone 1, H2bf"""	H2BFG		9119399, 12408966	Standard	NM_003522		Approved	H2B/g	uc003ngx.3	P62807	OTTHUMG00000014445	ENST00000359985.1:c.44C>G	6.37:g.26199830C>G	ENSP00000353074:p.Ser15Cys	None		Capture	SOLID	Phase_I	26307809	NM_003522	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000359985.1	37	CCDS4592.1	.	.	.	.	.	.	.	.	.	.	.	15.37	2.813703	0.50527	.	.	ENSG00000197846	ENST00000359985	T	0.22945	1.93	4.53	3.65	0.41850	.	0.000000	0.40728	N	0.001036	T	0.22513	0.0543	.	.	.	0.31590	N	0.653963	.	.	.	.	.	.	T	0.04294	-1.0962	7	0.87932	D	0	.	11.7591	0.51892	0.0:0.9128:0.0:0.0872	.	.	.	.	C	15	ENSP00000353074:S15C	ENSP00000353074:S15C	S	+	2	0	HIST1H2BF	26307809	1.000000	0.71417	0.995000	0.50966	0.692000	0.40212	5.700000	0.68318	1.010000	0.39314	0.650000	0.86243	TCC		HIST1H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040108.1	NM_003522	
HLA-DPB1	3115	hgsc.bcm.edu	37	6	33052768	33052768	+	Silent	SNP	T	T	C	rs1042187	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:33052768T>C	ENST00000418931.2	+	3	522	c.406T>C	c.(406-408)Ttg>Ctg	p.L136L		NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1	136	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)	p.L136L(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						GAAGGGGCCCTTGCAGCACCA	0.502													.|||	2322	0.463658	0.5976	0.3314	5008	,	,		18424	0.621		0.3151	False		,,,				2504	0.3671				p.L136L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C406C	6						.						74.0	95.0	87.0					6																	33052768		1510	2709	4219	33160746	SO:0001819	synonymous_variant	3115	exon3				CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	ENST00000418931.2:c.406T>C	6.37:g.33052768T>C		Somatic		Capture	SOLID	Phase_I	33160746	NM_002121	A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	Silent	SNP	ENST00000418931.2	37	CCDS4765.1																																																																																				HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076106.2	NM_002121	
DEF6	50619	hgsc.bcm.edu	37	6	35287652	35287652	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:35287652A>G	ENST00000316637.5	+	9	1444	c.1439A>G	c.(1438-1440)cAg>cGg	p.Q480R	DEF6_ENST00000542066.1_Missense_Mutation_p.Q225R	NM_022047.3	NP_071330.3	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog (mouse)	480	Glu-rich.					cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	15						AAGGAGGAGCAGGAGCGCTAC	0.607																																					p.Q480R												.	.	0			c.A1439G	6						.						32.0	29.0	30.0					6																	35287652		2198	4296	6494	35395630	SO:0001583	missense	50619	exon9			AJ276095	CCDS4802.1	6p21.33-p21.1	2013-01-10	2001-11-28		ENSG00000023892	ENSG00000023892		"""Pleckstrin homology (PH) domain containing"""	2760	protein-coding gene	gene with protein product	"""SWAP-70-like adaptor protein of T cells"""	610094	"""differentially expressed in FDCP (mouse homolog) 6"""			19251698	Standard	NM_022047		Approved	IBP, SLAT, SWAP70L	uc003okk.3	Q9H4E7	OTTHUMG00000014563	ENST00000316637.5:c.1439A>G	6.37:g.35287652A>G	ENSP00000319831:p.Gln480Arg	None		Capture	SOLID	Phase_I	35395630	NM_022047	Q86VF4	Missense_Mutation	SNP	ENST00000316637.5	37	CCDS4802.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.951208	0.73787	.	.	ENSG00000023892	ENST00000542066;ENST00000316637	T;T	0.33654	1.4;1.61	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.46756	0.1409	M	0.82056	2.57	0.80722	D	1	D;P;P	0.60575	0.988;0.948;0.948	P;P;P	0.55545	0.778;0.588;0.588	T	0.56619	-0.7949	10	0.72032	D	0.01	-14.9976	14.7644	0.69629	1.0:0.0:0.0:0.0	.	225;480;480	F5H853;B2RBP7;Q9H4E7	.;.;DEFI6_HUMAN	R	225;480	ENSP00000442166:Q225R;ENSP00000319831:Q480R	ENSP00000319831:Q480R	Q	+	2	0	DEF6	35395630	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.172000	0.94808	1.943000	0.56356	0.459000	0.35465	CAG		DEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040276.1	NM_022047	
PTK7	5754	hgsc.bcm.edu	37	6	43126674	43126674	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:43126674T>C	ENST00000230419.4	+	18	3062	c.2841T>C	c.(2839-2841)tcT>tcC	p.S947S	PTK7_ENST00000349241.2_Silent_p.S817S|PTK7_ENST00000481273.1_Silent_p.S955S|PTK7_ENST00000352931.2_Silent_p.S891S|PTK7_ENST00000345201.2_Silent_p.S907S	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	947	Interaction with CTNNB1.|Protein kinase; inactive. {ECO:0000255|PROSITE-ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S947S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			TGAAGGTGTCTGCCCTGGGCC	0.582																																					p.S947S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2841C	6						.						84.0	75.0	78.0					6																	43126674		2203	4300	6503	43234652	SO:0001819	synonymous_variant	5754	exon18			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.2841T>C	6.37:g.43126674T>C		Somatic		Capture	SOLID	Phase_I	43234652	NM_002821	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Silent	SNP	ENST00000230419.4	37	CCDS4884.1	.	.	.	.	.	.	.	.	.	.	T	7.746	0.702334	0.15172	.	.	ENSG00000112655	ENST00000489707	.	.	.	5.93	-10.3	0.00346	.	.	.	.	.	T	0.17450	0.0419	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41070	-0.9529	4	.	.	.	.	2.975	0.05935	0.4391:0.2027:0.2293:0.1289	.	.	.	.	P	242	.	.	L	+	2	0	PTK7	43234652	0.000000	0.05858	0.234000	0.24042	0.890000	0.51754	-2.129000	0.01313	-1.942000	0.01040	-1.392000	0.01152	CTG		PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2		
ICK	22858	hgsc.bcm.edu	37	6	52876618	52876618	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:52876618G>T	ENST00000350082.5	-	11	1787	c.1441C>A	c.(1441-1443)Ctg>Atg	p.L481M	ICK_ENST00000356971.3_Missense_Mutation_p.L481M	NM_014920.3	NP_055735.1	Q9UPZ9	ICK_HUMAN	intestinal cell (MAK-like) kinase	481					intracellular signal transduction (GO:0035556)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(3)|stomach(1)	31	Lung NSC(77;0.103)					GCAGATCTCAGGGTGGGCGTG	0.493																																					p.L481M												.	.	0			c.C1441A	6						.						107.0	110.0	109.0					6																	52876618		2203	4300	6503	52984577	SO:0001583	missense	22858	exon11			AB023153	CCDS4949.1	6p12.3-p11.2	2008-02-05			ENSG00000112144	ENSG00000112144			21219	protein-coding gene	gene with protein product		612325				12103360	Standard	NM_014920		Approved	MRK, LCK2, KIAA0936, MGC46090	uc003pbi.2	Q9UPZ9	OTTHUMG00000014870	ENST00000350082.5:c.1441C>A	6.37:g.52876618G>T	ENSP00000263043:p.Leu481Met	None		Capture	SOLID	Phase_I	52984577	NM_014920	A7MD41|O75985|Q5THL2|Q8IYH8|Q9BX17|Q9NYX3	Missense_Mutation	SNP	ENST00000350082.5	37	CCDS4949.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.414129	0.42817	.	.	ENSG00000112144	ENST00000350082;ENST00000356971	T;T	0.72615	-0.67;-0.67	5.66	0.407	0.16371	.	0.340857	0.26307	N	0.025139	T	0.50531	0.1621	L	0.51422	1.61	0.09310	N	1	P	0.45715	0.865	P	0.45946	0.498	T	0.49457	-0.8938	10	0.45353	T	0.12	0.7456	10.4882	0.44735	0.5372:0.0:0.4628:0.0	.	481	Q9UPZ9	ICK_HUMAN	M	481	ENSP00000263043:L481M;ENSP00000349458:L481M	ENSP00000263043:L481M	L	-	1	2	ICK	52984577	0.517000	0.26226	0.738000	0.30950	0.523000	0.34469	1.272000	0.33109	0.248000	0.21435	0.561000	0.74099	CTG		ICK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040952.1	NM_016513	
BAI3	577	hgsc.bcm.edu	37	6	70071193	70071193	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:70071193A>G	ENST00000370598.1	+	29	4849	c.4028A>G	c.(4027-4029)tAc>tGc	p.Y1343C	BAI3_ENST00000238918.8_Missense_Mutation_p.Y549C|BAI3_ENST00000546190.1_Missense_Mutation_p.Y307C	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1343					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.Y1343C(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CTATTGCACTACAAAGTAAAC	0.408																																					p.Y1343C												BAI3,lung,NS,Substitution - Missense,+1	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4028G	6						.						83.0	81.0	82.0					6																	70071193		2203	4299	6502	70127914	SO:0001583	missense	577	exon29			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.4028A>G	6.37:g.70071193A>G	ENSP00000359630:p.Tyr1343Cys	Somatic		Capture	SOLID	Phase_I	70127914	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	A	12.47	1.947328	0.34377	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.05786	3.39;3.39;3.39	5.8	5.8	0.92144	.	0.057754	0.64402	D	0.000001	T	0.02267	0.0070	N	0.16478	0.41	0.53688	D	0.999979	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.0	T	0.48725	-0.9010	10	0.38643	T	0.18	.	16.1965	0.82029	1.0:0.0:0.0:0.0	.	549;1343	B7Z356;O60242	.;BAI3_HUMAN	C	1343;549;307	ENSP00000359630:Y1343C;ENSP00000238918:Y549C;ENSP00000441821:Y307C	ENSP00000238918:Y549C	Y	+	2	0	BAI3	70127914	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.146000	0.77373	2.232000	0.73038	0.529000	0.55759	TAC		BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
CD109	135228	hgsc.bcm.edu	37	6	74497111	74497111	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:74497111C>A	ENST00000287097.5	+	21	2604	c.2492C>A	c.(2491-2493)cCt>cAt	p.P831H	CD109_ENST00000437994.2_Missense_Mutation_p.P831H|CD109_ENST00000422508.2_Missense_Mutation_p.P754H			Q6YHK3	CD109_HUMAN	CD109 molecule	831					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.P831H(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GGAGAAATTCCTATCACAGTC	0.448																																					p.P754H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2261A	6						.						115.0	111.0	112.0					6																	74497111		2203	4300	6503	74553832	SO:0001583	missense	135228	exon20			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.2492C>A	6.37:g.74497111C>A	ENSP00000287097:p.Pro831His	Somatic		Capture	SOLID	Phase_I	74553832	NM_001159588	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.770118	0.49680	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.25579	1.8;2.01;1.79	5.45	4.58	0.56647	.	0.228496	0.46758	D	0.000267	T	0.38665	0.1049	M	0.77313	2.365	0.50467	D	0.999876	D;P;P	0.56746	0.977;0.869;0.841	P;P;P	0.59171	0.842;0.853;0.538	T	0.45205	-0.9277	10	0.66056	D	0.02	.	15.7273	0.77770	0.1376:0.8624:0.0:0.0	.	754;831;831	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	H	831;754;831	ENSP00000388062:P831H;ENSP00000404475:P754H;ENSP00000287097:P831H	ENSP00000287097:P831H	P	+	2	0	CD109	74553832	0.996000	0.38824	0.782000	0.31804	0.064000	0.16182	3.419000	0.52728	1.504000	0.48704	0.650000	0.86243	CCT		CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
SYTL3	94120	hgsc.bcm.edu	37	6	159084381	159084382	+	Frame_Shift_Del	DEL	GG	GG	-	rs560281807	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	GG	GG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:159084381_159084382delGG	ENST00000297239.9	+	3	275_276	c.81_82delGG	c.(79-84)gcggttfs	p.V28fs	SYTL3_ENST00000360448.3_Frame_Shift_Del_p.V28fs|SYTL3_ENST00000367081.3_5'UTR			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	28	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)	p.V28fs*94(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		GAGACCAGGCGGTTCAAAACAC	0.559																																					p.27_28del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.81_82del	6						.																																			159004370	SO:0001589	frameshift_variant	94120	exon5			AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.81_82delGG	6.37:g.159084381_159084382delGG	ENSP00000297239:p.Val28fs	Somatic		Capture	SOLID	Phase_I	159004369	NM_001009991	Q496J4|Q496J6|Q5U3B9	Frame_Shift_Del	DEL	ENST00000297239.9	37	CCDS56458.1																																																																																				SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042876.1		
PARK2	5071	hgsc.bcm.edu	37	6	162864376	162864376	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr6:162864376G>T	ENST00000366898.1	-	2	239	c.137C>A	c.(136-138)gCa>gAa	p.A46E	PARK2_ENST00000366892.1_Missense_Mutation_p.A46E|PARK2_ENST00000366896.1_Missense_Mutation_p.A46E|PARK2_ENST00000366897.1_Missense_Mutation_p.A46E|PARK2_ENST00000338468.3_5'UTR|PARK2_ENST00000366894.1_5'UTR	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	46	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.		A -> P (in PARK2). {ECO:0000269|PubMed:12362318}.		adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)	p.A46E(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		CTCCTTCCCTGCGAAAATCAC	0.597																																					p.A46E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C137A	6						.						142.0	121.0	128.0					6																	162864376		2203	4300	6503	162784366	SO:0001583	missense	5071	exon2				CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.137C>A	6.37:g.162864376G>T	ENSP00000355865:p.Ala46Glu	Somatic		Capture	SOLID	Phase_I	162784366	NM_013987	A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	ENST00000366898.1	37	CCDS5281.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769564	0.90020	.	.	ENSG00000185345	ENST00000366898;ENST00000366897;ENST00000366896;ENST00000366892;ENST00000542682	T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75	5.63	5.63	0.86233	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	D	0.89227	0.6655	M	0.92122	3.275	0.49213	D	0.999766	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.91635	0.999;0.993;0.997;0.998	D	0.90699	0.4619	10	0.87932	D	0	.	20.0401	0.97581	0.0:0.0:1.0:0.0	.	46;46;46;46	O60260-5;Q5VVX3;Q5VVX4;O60260	.;.;.;PRKN2_HUMAN	E	46;46;46;46;45	ENSP00000355865:A46E;ENSP00000355863:A46E;ENSP00000355862:A46E;ENSP00000355858:A46E	ENSP00000355858:A46E	A	-	2	0	PARK2	162784366	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.633000	0.83260	2.805000	0.96524	0.655000	0.94253	GCA		PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042995.1		
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651120	1651120	+	Missense_Mutation	SNP	G	G	T	rs66665994		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	T	G	T	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:1651120G>T	ENST00000399676.2	+	1	88	c.50G>T	c.(49-51)cGt>cTt	p.R17L		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	17				R -> L (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.R17L(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		tgtggaggccgtggctccggc	0.697																																					p.R17L												KRTAP5-5,lung,NS,Substitution - Missense,+1	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G50T	11						.						49.0	62.0	58.0					11																	1651120		2185	4288	6473	1607696	SO:0001583	missense	439915	exon1			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.50G>T	11.37:g.1651120G>T	ENSP00000382584:p.Arg17Leu	Germline		Capture	SOLID	Phase_I	1607696	NM_001001480	A8MWN2	Missense_Mutation	SNP	ENST00000399676.2	37	CCDS41592.1	1029	0.47115384615384615	280	0.5691056910569106	162	0.44751381215469616	221	0.38636363636363635	366	0.48284960422163586	G	7.595	0.671480	0.14776	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01005	5.45	2.63	2.63	0.31362	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.49389	P	2.1099999999996122E-4	B	0.24963	0.115	B	0.14023	0.01	T	0.01504	-1.1338	8	0.44086	T	0.13	.	9.323	0.37975	0.0:0.0:1.0:0.0	.	17	Q701N2	KRA55_HUMAN	L	17;15	ENSP00000382584:R17L	ENSP00000382584:R17L	R	+	2	0	KRTAP5-5	1607696	1.000000	0.71417	0.817000	0.32601	0.004000	0.04260	3.925000	0.56484	1.420000	0.47138	0.442000	0.29010	CGT		KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
CARS	833	hgsc.bcm.edu	37	11	3041471	3041471	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:3041471G>A	ENST00000397111.5	-	10	1241	c.996C>T	c.(994-996)tcC>tcT	p.S332S	CARS_ENST00000278224.9_Silent_p.S332S|CARS_ENST00000380525.4_Silent_p.S415S|CARS_ENST00000401769.3_Silent_p.S345S|CARS_ENST00000397114.3_Silent_p.S322S			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	332					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.S332S(1)	CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	GGCACGGCCAGGACGGTTCTC	0.627			T	ALK	ALCL																																p.S332S	Ovarian(61;932 1157 5961 20446 52152)		Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C996T	11						.						115.0	92.0	100.0					11																	3041471		2202	4298	6500	2998047	SO:0001819	synonymous_variant	833	exon10			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.996C>T	11.37:g.3041471G>A		Somatic		Capture	SOLID	Phase_I	2998047	NM_139273	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Silent	SNP	ENST00000397111.5	37	CCDS7742.1																																																																																				CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4	NM_001751	
ILK	3611	hgsc.bcm.edu	37	11	6629429	6629429	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:6629429T>C	ENST00000396751.2	+	2	699	c.243T>C	c.(241-243)gaT>gaC	p.D81D	TAF10_ENST00000531760.1_5'Flank|ILK_ENST00000537806.1_Intron|RP11-732A19.2_ENST00000527398.1_RNA|ILK_ENST00000420936.2_Silent_p.D81D|ILK_ENST00000528995.1_Silent_p.D81D|ILK_ENST00000299421.4_Silent_p.D81D	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase	81	Interaction with LIMS1.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.D81D(1)		central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		GACACCGTGATATTGTACAGA	0.502																																					p.D81D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T243C	11						.						95.0	84.0	88.0					11																	6629429		2201	4296	6497	6586005	SO:0001819	synonymous_variant	3611	exon2			U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.243T>C	11.37:g.6629429T>C		Somatic		Capture	SOLID	Phase_I	6586005	NM_001014795	B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	Silent	SNP	ENST00000396751.2	37	CCDS7768.1																																																																																				ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384519.1	NM_004517	
MAPK8IP1	9479	hgsc.bcm.edu	37	11	45927227	45927227	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:45927227G>A	ENST00000241014.2	+	12	2261	c.2091G>A	c.(2089-2091)caG>caA	p.Q697Q	RP11-618K13.2_ENST00000533218.1_RNA|MAPK8IP1_ENST00000395629.2_Silent_p.Q687Q	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	697	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)	p.Q697Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		TCTACAAGCAGTTTGTGGAGT	0.597																																					p.Q697Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2091A	11						.						215.0	197.0	203.0					11																	45927227		2203	4299	6502	45883803	SO:0001819	synonymous_variant	9479	exon12				CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.2091G>A	11.37:g.45927227G>A		Somatic		Capture	SOLID	Phase_I	45883803	NM_005456	D3DQP4|O43407	Silent	SNP	ENST00000241014.2	37	CCDS7916.1																																																																																				MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456	
GYLTL1B	120071	hgsc.bcm.edu	37	11	45946116	45946116	+	Silent	SNP	G	G	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:45946116G>C	ENST00000531526.1	+	5	663	c.552G>C	c.(550-552)ctG>ctC	p.L184L	GYLTL1B_ENST00000536139.1_Silent_p.L153L|GYLTL1B_ENST00000401752.1_Silent_p.L184L|GYLTL1B_ENST00000389968.3_5'UTR|GYLTL1B_ENST00000325468.5_Silent_p.L184L|GYLTL1B_ENST00000529052.1_Silent_p.L153L	NM_152312.3	NP_689525.3	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	184					muscle cell cellular homeostasis (GO:0046716)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.L184L(1)		breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(35;0.226)		TAATGAAGCTGGTGCTGCCCA	0.612																																					p.L184L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G552C	11						.						88.0	85.0	86.0					11																	45946116		2203	4299	6502	45902692	SO:0001819	synonymous_variant	120071	exon5				CCDS31473.1	11p11.12	2013-02-22			ENSG00000165905	ENSG00000165905		"""Glycosyltransferase family 8 domain containing"""	16522	protein-coding gene	gene with protein product		609709				15661757, 15958417	Standard	XM_005252785		Approved	PP5656, FLJ35207, LARGE2	uc001nbv.1	Q8N3Y3	OTTHUMG00000167037	ENST00000531526.1:c.552G>C	11.37:g.45946116G>C		Somatic		Capture	SOLID	Phase_I	45902692	NM_152312	A6NN75|Q8N8Y6|Q8NAK3|Q8WY62	Silent	SNP	ENST00000531526.1	37	CCDS31473.1																																																																																				GYLTL1B-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392572.1	NM_152312	
SLC39A13	91252	hgsc.bcm.edu	37	11	47436855	47436855	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:47436855C>G	ENST00000362021.4	+	10	1099	c.1057C>G	c.(1057-1059)Ctg>Gtg	p.L353V	SLC39A13_ENST00000354884.4_Missense_Mutation_p.L346V|SLC39A13_ENST00000533076.1_3'UTR|SLC39A13_ENST00000524928.1_3'UTR	NM_001128225.2	NP_001121697	Q96H72	S39AD_HUMAN	solute carrier family 39 (zinc transporter), member 13	353	Poly-Leu.				cellular zinc ion homeostasis (GO:0006882)|connective tissue development (GO:0061448)|zinc ion transmembrane transport (GO:0071577)	Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|kidney(1)|lung(1)|prostate(1)	4				Lung(87;0.0936)		CCTGCAGCAGCTGCTTCTGCT	0.642																																					p.L346V												.	.	0			c.C1036G	11						.						126.0	105.0	112.0					11																	47436855		2201	4298	6499	47393431	SO:0001583	missense	91252	exon10				CCDS7934.1, CCDS44592.1	11p11.2	2013-05-22			ENSG00000165915	ENSG00000165915		"""Solute carriers"""	20859	protein-coding gene	gene with protein product		608735	"""solute carrier family 39 (metal ion transporter), member 13"""			12659941	Standard	NM_001128225		Approved	FLJ25785	uc009ylq.3	Q96H72	OTTHUMG00000166890	ENST00000362021.4:c.1057C>G	11.37:g.47436855C>G	ENSP00000354689:p.Leu353Val	None		Capture	SOLID	Phase_I	47393431	NM_152264	D3DQR6|D3DQR7|E9PLY1|E9PQV3|Q659D9|Q8N7C9|Q8WV10	Missense_Mutation	SNP	ENST00000362021.4	37	CCDS44592.1	.	.	.	.	.	.	.	.	.	.	C	1.159	-0.644407	0.03531	.	.	ENSG00000165915	ENST00000362021;ENST00000354884	T;T	0.52295	0.67;0.67	4.93	4.02	0.46733	.	0.342788	0.31102	N	0.008250	T	0.17238	0.0414	N	0.01761	-0.735	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.11329	0.006;0.003	T	0.18241	-1.0343	10	0.02654	T	1	-19.9574	9.3015	0.37849	0.0873:0.1559:0.7568:0.0	.	353;346	Q96H72;Q96H72-2	S39AD_HUMAN;.	V	353;346	ENSP00000354689:L353V;ENSP00000346956:L346V	ENSP00000346956:L346V	L	+	1	2	SLC39A13	47393431	0.987000	0.35691	0.996000	0.52242	0.758000	0.43043	1.370000	0.34238	1.297000	0.44761	-0.502000	0.04539	CTG		SLC39A13-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395652.1	NM_152264	
MS4A10	341116	hgsc.bcm.edu	37	11	60559758	60559758	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:60559758G>A	ENST00000308287.1	+	4	420	c.324G>A	c.(322-324)ttG>ttA	p.L108L		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	108						integral component of membrane (GO:0016021)		p.L108L(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						CAGGGATCTTGGCGATAACAA	0.453																																					p.L108L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G324A	11						.						190.0	174.0	179.0					11																	60559758		2203	4300	6503	60316334	SO:0001819	synonymous_variant	341116	exon4			AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.324G>A	11.37:g.60559758G>A		Somatic		Capture	SOLID	Phase_I	60316334	NM_206893	B2RP45|Q96PG3	Silent	SNP	ENST00000308287.1	37	CCDS7992.1																																																																																				MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395619.1	NM_206893	
AHNAK	79026	hgsc.bcm.edu	37	11	62288674	62288674	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:62288674G>A	ENST00000378024.4	-	5	13489	c.13215C>T	c.(13213-13215)gtC>gtT	p.V4405V	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4405					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.V4405V(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGGGCAGAGAGACATCCACAT	0.468																																					p.V4405V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C13215T	11						.						145.0	152.0	150.0					11																	62288674		2202	4299	6501	62045250	SO:0001819	synonymous_variant	79026	exon5			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.13215C>T	11.37:g.62288674G>A		Somatic		Capture	SOLID	Phase_I	62045250	NM_001620	A1A586	Silent	SNP	ENST00000378024.4	37	CCDS31584.1																																																																																				AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
AHNAK	79026	hgsc.bcm.edu	37	11	62298736	62298736	+	Silent	SNP	T	T	C	rs116435570		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:62298736T>C	ENST00000378024.4	-	5	3427	c.3153A>G	c.(3151-3153)aaA>aaG	p.K1051K	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1051					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.K1051K(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ACTTCGGGCCTTTCAACTTCC	0.443													T|||	1	0.000199681	0.0008	0.0	5008	,	,		21229	0.0		0.0	False		,,,				2504	0.0				p.K1051K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3153G	11						.						92.0	91.0	91.0					11																	62298736		2202	4299	6501	62055312	SO:0001819	synonymous_variant	79026	exon5			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3153A>G	11.37:g.62298736T>C		Somatic		Capture	SOLID	Phase_I	62055312	NM_001620	A1A586	Silent	SNP	ENST00000378024.4	37	CCDS31584.1																																																																																				AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
PANX3	116337	hgsc.bcm.edu	37	11	124481615	124481615	+	Missense_Mutation	SNP	G	G	A	rs142639637	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr11:124481615G>A	ENST00000284288.2	+	1	230	c.163G>A	c.(163-165)Gcc>Acc	p.A55T		NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3	55					cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)	p.A55T(2)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		CCTGGCATTCGCCCAGGAGTT	0.587													G|||	10	0.00199681	0.0076	0.0	5008	,	,		15784	0.0		0.0	False		,,,				2504	0.0				p.A55T												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G163A	11						.	G	THR/ALA	37,4365	42.3+/-75.8	1,35,2165	84.0	87.0	86.0		163	4.8	1.0	11	dbSNP_134	86	0,8598		0,0,4299	yes	missense	PANX3	NM_052959.2	58	1,35,6464	AA,AG,GG		0.0,0.8405,0.2846	probably-damaging	55/393	124481615	37,12963	2201	4299	6500	123986825	SO:0001583	missense	116337	exon1			AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.163G>A	11.37:g.124481615G>A	ENSP00000284288:p.Ala55Thr	Somatic		Capture	SOLID	Phase_I	123986825	NM_052959		Missense_Mutation	SNP	ENST00000284288.2	37	CCDS8447.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	25.4	4.635799	0.87760	0.008405	0.0	ENSG00000154143	ENST00000284288	T	0.38887	1.11	4.78	4.78	0.61160	.	0.051343	0.85682	D	0.000000	T	0.51312	0.1667	L	0.50333	1.59	0.58432	D	0.999995	D	0.89917	1.0	D	0.75020	0.985	T	0.57300	-0.7835	10	0.51188	T	0.08	-16.2529	18.0228	0.89260	0.0:0.0:1.0:0.0	.	55	Q96QZ0	PANX3_HUMAN	T	55	ENSP00000284288:A55T	ENSP00000284288:A55T	A	+	1	0	PANX3	123986825	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.461000	0.97646	2.476000	0.83614	0.655000	0.94253	GCC		PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387064.1		
MYH3	4621	hgsc.bcm.edu	37	17	10541664	10541664	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:10541664C>A	ENST00000583535.1	-	27	3512	c.3425G>T	c.(3424-3426)cGg>cTg	p.R1142L	MYH3_ENST00000226209.7_Missense_Mutation_p.R1142L	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1142					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CTCCAGCTCCCGGGCATAGTC	0.642																																					p.R1142L												.	.	0			c.G3425T	17						.						33.0	35.0	34.0					17																	10541664		2203	4300	6503	10482389	SO:0001583	missense	4621	exon26				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.3425G>T	17.37:g.10541664C>A	ENSP00000464317:p.Arg1142Leu	None		Capture	SOLID	Phase_I	10482389	NM_002470	Q15492	Missense_Mutation	SNP	ENST00000583535.1	37	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	C	31	5.061277	0.93846	.	.	ENSG00000109063	ENST00000226209	T	0.78924	-1.22	5.34	5.34	0.76211	Myosin tail (1);	.	.	.	.	D	0.92851	0.7726	H	0.97240	3.965	0.48901	D	0.999722	D	0.89917	1.0	D	0.83275	0.996	D	0.95042	0.8179	9	0.87932	D	0	.	19.4024	0.94635	0.0:1.0:0.0:0.0	.	1142	P11055	MYH3_HUMAN	L	1142	ENSP00000226209:R1142L	ENSP00000226209:R1142L	R	-	2	0	MYH3	10482389	0.908000	0.30866	0.999000	0.59377	0.718000	0.41266	4.942000	0.63547	2.654000	0.90174	0.563000	0.77884	CGG		MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
PHF12	57649	hgsc.bcm.edu	37	17	27241005	27241005	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:27241005T>C	ENST00000332830.4	-	8	1995	c.1185A>G	c.(1183-1185)gcA>gcG	p.A395A	PHF12_ENST00000577226.1_Silent_p.A395A|PHF12_ENST00000582655.1_5'UTR|PHF12_ENST00000268756.3_Silent_p.A395A	NM_001033561.1	NP_001028733.1			PHD finger protein 12									p.A395A(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			TGGCCGCGGGTGCAATGAGAG	0.517																																					p.A395A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1185G	17						.						95.0	93.0	93.0					17																	27241005		2203	4300	6503	24265131	SO:0001819	synonymous_variant	57649	exon8			AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.1185A>G	17.37:g.27241005T>C		Somatic		Capture	SOLID	Phase_I	24265131	NM_001033561		Silent	SNP	ENST00000332830.4	37	CCDS32598.1																																																																																				PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255941.1	NM_020889	
ACACA	31	hgsc.bcm.edu	37	17	35454825	35454825	+	Silent	SNP	G	G	A	rs548821816		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:35454825G>A	ENST00000394406.2	-	53	6739	c.6549C>T	c.(6547-6549)gcC>gcT	p.A2183A	ACACA_ENST00000335166.5_Silent_p.A2105A|ACACA_ENST00000361253.5_Silent_p.A309A|ACACA_ENST00000353139.5_Silent_p.A2220A|ACACA_ENST00000360679.3_Silent_p.A2125A	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	2183	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.A2125A(1)		NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CAAACTGCACGGCTACCTGAT	0.522																																					p.A2220A	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6660T	17						.						170.0	143.0	152.0					17																	35454825		2203	4300	6503	32528938	SO:0001819	synonymous_variant	31	exon53			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.6549C>T	17.37:g.35454825G>A		Somatic		Capture	SOLID	Phase_I	32528938	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Silent	SNP	ENST00000394406.2	37	CCDS11317.1																																																																																				ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
ERBB2	2064	hgsc.bcm.edu	37	17	37866671	37866671	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:37866671G>A	ENST00000269571.5	+	7	997	c.838G>A	c.(838-840)Gag>Aag	p.E280K	ERBB2_ENST00000584601.1_Missense_Mutation_p.E250K|ERBB2_ENST00000406381.2_Missense_Mutation_p.E250K|ERBB2_ENST00000578199.1_Missense_Mutation_p.E250K|ERBB2_ENST00000540042.1_Missense_Mutation_p.E250K|ERBB2_ENST00000584450.1_Missense_Mutation_p.E280K|ERBB2_ENST00000540147.1_Missense_Mutation_p.E250K|ERBB2_ENST00000541774.1_Missense_Mutation_p.E265K|ERBB2_ENST00000445658.2_Intron			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	280					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	AGACACGTTTGAGTCCATGCC	0.587		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.E250K			Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	.	0			c.G748A	17						.						105.0	87.0	93.0					17																	37866671		2203	4300	6503	35120197	SO:0001583	missense	2064	exon10			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.838G>A	17.37:g.37866671G>A	ENSP00000269571:p.Glu280Lys	None		Capture	SOLID	Phase_I	35120197	NM_001005862	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402352	0.62288	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000269571;ENST00000540147;ENST00000540042	T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0	5.82	5.82	0.92795	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	.	.	.	.	T	0.58722	0.2142	L	0.31420	0.93	0.48632	D	0.999687	P;P;P;B	0.49696	0.927;0.863;0.685;0.109	P;B;B;B	0.45343	0.477;0.329;0.426;0.054	T	0.63616	-0.6597	9	0.87932	D	0	.	18.8605	0.92270	0.0:0.0:1.0:0.0	.	250;265;280;280	F5H1T4;P04626-4;P04626;Q9UK79	.;.;ERBB2_HUMAN;.	K	250;265;280;250;250	ENSP00000385185:E250K;ENSP00000446466:E265K;ENSP00000269571:E280K;ENSP00000443562:E250K;ENSP00000446382:E250K	ENSP00000269571:E280K	E	+	1	0	ERBB2	35120197	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	4.194000	0.58393	2.765000	0.95021	0.591000	0.81541	GAG		ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
GAST	2520	hgsc.bcm.edu	37	17	39872082	39872082	+	Silent	SNP	A	A	G	rs535385347		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:39872082A>G	ENST00000329402.3	+	3	331	c.264A>G	c.(262-264)ggA>ggG	p.G88G	RNA5SP442_ENST00000365050.1_RNA|JUP_ENST00000540235.1_Intron	NM_000805.4	NP_000796.1	P01350	GAST_HUMAN	gastrin	88					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.G88G(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			AAGCCTATGGATGGATGGACT	0.577																																					p.G88G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A264G	17						.						80.0	81.0	80.0					17																	39872082		2203	4300	6503	37125608	SO:0001819	synonymous_variant	2520	exon3				CCDS11404.1	17q21.2	2013-02-26	2005-06-14	2005-06-14	ENSG00000184502	ENSG00000184502		"""Endogenous ligands"""	4164	protein-coding gene	gene with protein product	"""preprogastrin"""	137250		GAS			Standard	NM_000805		Approved		uc002hxl.3	P01350	OTTHUMG00000133496	ENST00000329402.3:c.264A>G	17.37:g.39872082A>G		Somatic		Capture	SOLID	Phase_I	37125608	NM_000805	P78463|P78464	Silent	SNP	ENST00000329402.3	37	CCDS11404.1																																																																																				GAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257409.1		
JUP	3728	hgsc.bcm.edu	37	17	39928059	39928059	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:39928059C>T	ENST00000393931.3	-	2	166	c.48G>A	c.(46-48)tgG>tgA	p.W16*	JUP_ENST00000393930.1_Nonsense_Mutation_p.W16*|JUP_ENST00000310706.5_Nonsense_Mutation_p.W16*|JUP_ENST00000540235.1_Nonsense_Mutation_p.W16*	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	16					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		ATGTCTGCTGCCACTCAGTCA	0.597																																					p.W16X	Colon(16;42 520 6044 17852 28530)											.	.	0			c.G48A	17						.						67.0	62.0	64.0					17																	39928059		2203	4300	6503	37181585	SO:0001587	stop_gained	3728	exon2			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.48G>A	17.37:g.39928059C>T	ENSP00000377508:p.Trp16*	None		Capture	SOLID	Phase_I	37181585	NM_002230	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Nonsense_Mutation	SNP	ENST00000393931.3	37	CCDS11407.1	.	.	.	.	.	.	.	.	.	.	C	37	6.219054	0.97385	.	.	ENSG00000173801	ENST00000540235;ENST00000393930;ENST00000310706;ENST00000393931;ENST00000449889;ENST00000437187;ENST00000420370;ENST00000424457;ENST00000437369	.	.	.	5.02	5.02	0.67125	.	0.118031	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.3993	17.0841	0.86606	0.0:1.0:0.0:0.0	.	.	.	.	X	16	.	ENSP00000311113:W16X	W	-	3	0	JUP	37181585	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.644000	0.83416	2.615000	0.88500	0.542000	0.68232	TGG		JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257406.1		
PPY	5539	hgsc.bcm.edu	37	17	42018858	42018858	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:42018858T>C	ENST00000591228.1	-	2	252	c.165A>G	c.(163-165)agA>agG	p.R55R	PPY_ENST00000587006.1_Silent_p.R55R|PPY_ENST00000225992.3_Silent_p.R55R			P01298	PAHO_HUMAN	pancreatic polypeptide	55					digestion (GO:0007586)|protein secretion (GO:0009306)	extracellular region (GO:0005576)	hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.R55R(1)		large_intestine(2)|lung(1)|skin(1)	4		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TGTTGATGTATCTACGGAGAT	0.622																																					p.R55R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A165G	17						.						152.0	141.0	145.0					17																	42018858		2203	4300	6503	39374384	SO:0001819	synonymous_variant	5539	exon2				CCDS11472.1	17q21.31	2013-02-28			ENSG00000108849	ENSG00000108849		"""Endogenous ligands"""	9327	protein-coding gene	gene with protein product	"""pancreatic polypeptide Y"", ""prepro-PP (prepropancreatic polypeptide)"""	167780				3753985	Standard	NM_002722		Approved	PNP	uc002iep.3	P01298		ENST00000591228.1:c.165A>G	17.37:g.42018858T>C		Somatic		Capture	SOLID	Phase_I	39374384	NM_002722		Silent	SNP	ENST00000591228.1	37	CCDS11472.1																																																																																				PPY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457656.1	NM_002722	
TEX2	55852	hgsc.bcm.edu	37	17	62265635	62265635	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:62265635G>T	ENST00000583097.1	-	5	2489	c.2317C>A	c.(2317-2319)Ctt>Att	p.L773I	TEX2_ENST00000584379.1_Missense_Mutation_p.L773I|TEX2_ENST00000258991.3_Missense_Mutation_p.L780I			Q8IWB9	TEX2_HUMAN	testis expressed 2	773					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TAGTCGAGAAGCATCTTCTGC	0.632																																					p.L780I												.	.	0			c.C2338A	17						.						102.0	82.0	89.0					17																	62265635		2203	4300	6503	59619367	SO:0001583	missense	55852	exon5			AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2317C>A	17.37:g.62265635G>T	ENSP00000462665:p.Leu773Ile	None		Capture	SOLID	Phase_I	59619367	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	37		.	.	.	.	.	.	.	.	.	.	G	13.46	2.245013	0.39697	.	.	ENSG00000136478	ENST00000258991	T	0.48836	0.8	5.76	5.76	0.90799	.	0.122751	0.56097	D	0.000031	T	0.61924	0.2386	M	0.75447	2.3	0.51233	D	0.999913	P;P	0.51351	0.944;0.822	P;P	0.54629	0.757;0.495	T	0.62101	-0.6925	10	0.45353	T	0.12	-12.4173	14.151	0.65384	0.0714:0.0:0.9286:0.0	.	780;773	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	I	780	ENSP00000258991:L780I	ENSP00000258991:L780I	L	-	1	0	TEX2	59619367	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	5.397000	0.66302	2.728000	0.93425	0.462000	0.41574	CTT		TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
TP53	7157	hgsc.bcm.edu	37	17	7577082	7577082	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:7577082C>T	ENST00000269305.4	-	8	1045	c.856G>A	c.(856-858)Gaa>Aaa	p.E286K	TP53_ENST00000420246.2_Missense_Mutation_p.E286K|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.E286K|TP53_ENST00000359597.4_Missense_Mutation_p.E286K|TP53_ENST00000455263.2_Missense_Mutation_p.E286K|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	286	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11023613, ECO:0000269|PubMed:8316628}.|E -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:8829627}.|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E286K(58)|p.E286*(22)|p.0?(8)|p.E286Q(5)|p.?(2)|p.E286fs*59(2)|p.E286fs*17(2)|p.R283fs*16(2)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.R283fs*56(1)|p.E285fs*13(1)|p.G279fs*59(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGATTCTCTTCCTCTGTGCGC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E154K	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	112	Substitution - Missense(63)|Substitution - Nonsense(22)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	lung(18)|upper_aerodigestive_tract(13)|breast(10)|large_intestine(9)|urinary_tract(9)|skin(9)|oesophagus(9)|haematopoietic_and_lymphoid_tissue(8)|liver(7)|central_nervous_system(6)|bone(4)|ovary(3)|stomach(2)|vulva(1)|soft_tissue(1)|eye(1)|biliary_tract(1)|endometrium(1)	c.G460A	17	GRCh37	CM076567	TP53	M		.						95.0	81.0	86.0					17																	7577082		2203	4300	6503	7517807	SO:0001583	missense	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.856G>A	17.37:g.7577082C>T	ENSP00000269305:p.Glu286Lys	Somatic		Capture	SOLID	Phase_I	7517807	NM_001126117	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.310731	0.81358	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	4.99	4.99	0.66335	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92077	3.27	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.77557	0.983;0.985;0.982;0.99	D	0.96355	0.9261	10	0.87932	D	0	-23.2961	15.807	0.78520	0.0:1.0:0.0:0.0	.	286;286;286;286	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	K	286;286;286;286;286;275;154	ENSP00000352610:E286K;ENSP00000269305:E286K;ENSP00000398846:E286K;ENSP00000391127:E286K;ENSP00000391478:E286K;ENSP00000425104:E154K	ENSP00000269305:E286K	E	-	1	0	TP53	7517807	1.000000	0.71417	0.972000	0.41901	0.455000	0.32408	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAA		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ACOX1	51	hgsc.bcm.edu	37	17	73949629	73949629	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:73949629A>T	ENST00000301608.4	-	7	907	c.847T>A	c.(847-849)Tcc>Acc	p.S283T	ACOX1_ENST00000293217.5_Missense_Mutation_p.S283T|ACOX1_ENST00000537812.1_Missense_Mutation_p.S245T|ACOX1_ENST00000591857.1_5'Flank	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	283					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)			large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	ACAAGGAAGGACCTGACAAAC	0.527																																					p.S283T												.	.	0			c.T847A	17						.						160.0	123.0	136.0					17																	73949629		2203	4300	6503	71461224	SO:0001583	missense	51	exon7			U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.847T>A	17.37:g.73949629A>T	ENSP00000301608:p.Ser283Thr	None		Capture	SOLID	Phase_I	71461224	NM_007292	A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	ENST00000301608.4	37	CCDS11735.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184568	0.78677	.	.	ENSG00000161533	ENST00000301608;ENST00000293217;ENST00000537812;ENST00000539791;ENST00000538781	D;D;D	0.91180	-2.8;-2.8;-2.8	6.17	6.17	0.99709	Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.89378	0.6698	M	0.67953	2.075	0.80722	D	1	P;P;B;B	0.42375	0.778;0.635;0.031;0.061	B;B;B;B	0.38655	0.278;0.278;0.018;0.024	D	0.88078	0.2805	10	0.27785	T	0.31	-25.7577	16.8222	0.85835	1.0:0.0:0.0:0.0	.	215;245;283;283	F5H0M0;F5GYQ8;Q15067;Q15067-2	.;.;ACOX1_HUMAN;.	T	283;283;245;283;215	ENSP00000301608:S283T;ENSP00000293217:S283T;ENSP00000441257:S245T	ENSP00000293217:S283T	S	-	1	0	ACOX1	71461224	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	TCC		ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439503.1		
EIF4A3	9775	hgsc.bcm.edu	37	17	78112828	78112828	+	Silent	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:78112828C>T	ENST00000269349.3	-	7	941	c.720G>A	c.(718-720)ttG>ttA	p.L240L		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	240					ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			ACCGTTTCACCAAGATGCGGA	0.468																																					p.L240L												.	.	0			c.G720A	17						.						134.0	115.0	121.0					17																	78112828		2203	4300	6503	75727423	SO:0001819	synonymous_variant	9775	exon7			BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.720G>A	17.37:g.78112828C>T		None		Capture	SOLID	Phase_I	75727423	NM_014740	Q15033|Q6IBQ2|Q96A18	Silent	SNP	ENST00000269349.3	37	CCDS11767.1																																																																																				EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437446.1	NM_014740	
MED24	9862	hgsc.bcm.edu	37	17	38189334	38189335	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	TG	TG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:38189334_38189335delTG	ENST00000394128.2	-	8	877_878	c.796_797delCA	c.(796-798)cagfs	p.Q266fs	MED24_ENST00000394126.1_Frame_Shift_Del_p.Q291fs|MED24_ENST00000479829.1_5'Flank|MED24_ENST00000501516.3_Frame_Shift_Del_p.Q285fs|MED24_ENST00000394127.2_Frame_Shift_Del_p.Q253fs|MED24_ENST00000356271.3_Frame_Shift_Del_p.Q253fs	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	266					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.Q266fs*29(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					CATCGTCAGCTGCTCCACCAGG	0.644																																					p.253_253del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.757_758del	17						.																																			35442861	SO:0001589	frameshift_variant	9862	exon7			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.796_797delCA	17.37:g.38189334_38189335delTG	ENSP00000377686:p.Gln266fs	Somatic		Capture	SOLID	Phase_I	35442860	NM_001079518	A8K4S5|B3KMR9|Q14143|Q9NNY5	Frame_Shift_Del	DEL	ENST00000394128.2	37	CCDS11359.1																																																																																				MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
RNF213	57674	hgsc.bcm.edu	37	17	78319136	78319136	+	Missense_Mutation	SNP	G	G	A	rs9674961	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:78319136G>A	ENST00000582970.1	+	29	7144	c.7001G>A	c.(7000-7002)aGt>aAt	p.S2334N	RNF213_ENST00000336301.6_Missense_Mutation_p.S407N|RNF213_ENST00000508628.2_Missense_Mutation_p.S2383N	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2334					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S407N(2)|p.S2383N(2)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GATGCCATCAGTCACTTGACT	0.522													A|||	2797	0.558506	0.6528	0.4337	5008	,	,		20475	0.376		0.6879	False		,,,				2504	0.5746				p.S2383N												.	.	4	Substitution - Missense(4)	large_intestine(2)|stomach(2)	c.G7148A	17						.	A	ASN/SER	2876,1530	485.5+/-360.3	950,976,277	124.0	114.0	117.0		7148	0.9	0.0	17	dbSNP_119	117	5714,2886	452.3+/-362.9	1909,1896,495	yes	missense	RNF213	NM_020914.4	46	2859,2872,772	AA,AG,GG		33.5581,34.7254,33.9536	benign	2383/5257	78319136	8590,4416	2203	4300	6503	75933731	SO:0001583	missense	57674	exon30			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.7001G>A	17.37:g.78319136G>A	ENSP00000464087:p.Ser2334Asn	Somatic		Capture	SOLID	Phase_I	75933731	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	1244	0.5695970695970696	326	0.6626016260162602	173	0.47790055248618785	212	0.3706293706293706	533	0.7031662269129287	A	3.858	-0.030522	0.07543	0.652746	0.664419	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.21734	1.99	5.84	0.943	0.19531	.	0.670270	0.15010	N	0.285649	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35025	-0.9805	9	0.07644	T	0.81	.	11.2868	0.49226	0.6123:0.0:0.3877:0.0	rs9674961;rs52799145;rs61333363;rs9674961	407	Q63HN8	RN213_HUMAN	N	2334;2383;407	ENSP00000338218:S407N	ENSP00000338218:S407N	S	+	2	0	RNF213	75933731	0.098000	0.21812	0.000000	0.03702	0.002000	0.02628	2.159000	0.42339	-0.073000	0.12842	-0.982000	0.02568	AGT		RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
KRTAP19-2	337969	hgsc.bcm.edu	37	21	31859611	31859611	+	Nonsense_Mutation	SNP	G	G	T	rs144891171		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr21:31859611G>T	ENST00000334055.3	-	1	144	c.57C>A	c.(55-57)tgC>tgA	p.C19*		NM_181608.1	NP_853639.1	Q3LHN2	KR192_HUMAN	keratin associated protein 19-2	19						intermediate filament (GO:0005882)		p.C19C(1)|p.C19*(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						CTTCATAGCCGCAGCCATAGC	0.547																																					p.C19X												.	.	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	large_intestine(2)	c.C57A	21						.						157.0	154.0	155.0					21																	31859611		2203	4300	6503	30781482	SO:0001587	stop_gained	337969	exon1			AP001708	CCDS13595.1	21q22.1	2006-03-13			ENSG00000186965	ENSG00000186965		"""Keratin associated proteins"""	18937	protein-coding gene	gene with protein product						12359730	Standard	NM_181608		Approved	KAP19.2	uc011acy.2	Q3LHN2	OTTHUMG00000057772	ENST00000334055.3:c.57C>A	21.37:g.31859611G>T	ENSP00000335660:p.Cys19*	Somatic		Capture	SOLID	Phase_I	30781482	NM_181608		Nonsense_Mutation	SNP	ENST00000334055.3	37	CCDS13595.1	.	.	.	.	.	.	.	.	.	.	-	14.98	2.698191	0.48307	.	.	ENSG00000186965	ENST00000334055	.	.	.	4.41	4.41	0.53225	.	0.123452	0.36665	N	0.002468	.	.	.	.	.	.	0.29722	N	0.838535	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.9152	0.24355	0.8948:0.0:0.1052:0.0	.	.	.	.	X	19	.	ENSP00000335660:C19X	C	-	3	2	KRTAP19-2	30781482	0.000000	0.05858	0.025000	0.17156	0.280000	0.26924	0.181000	0.16880	0.846000	0.35142	-0.308000	0.09152	TGC		KRTAP19-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128224.3		
PKNOX1	5316	hgsc.bcm.edu	37	21	44427715	44427715	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr21:44427715C>A	ENST00000291547.5	+	3	377	c.166C>A	c.(166-168)Cag>Aag	p.Q56K	PKNOX1_ENST00000432907.2_5'UTR	NM_004571.3	NP_004562.2	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1	56					angiogenesis (GO:0001525)|camera-type eye development (GO:0043010)|erythrocyte differentiation (GO:0030218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|prostate(1)	22						TGTGGACAAGCAGGCCATTTA	0.542																																					p.Q56K												.	.	0			c.C166A	21						.						97.0	97.0	97.0					21																	44427715		2203	4300	6503	43300784	SO:0001583	missense	5316	exon3				CCDS13692.1, CCDS68211.1	21q22.3	2011-06-20			ENSG00000160199	ENSG00000160199		"""Homeoboxes / TALE class"""	9022	protein-coding gene	gene with protein product		602100				9479508	Standard	NM_001286258		Approved	PREP1	uc002zcq.1	P55347	OTTHUMG00000086833	ENST00000291547.5:c.166C>A	21.37:g.44427715C>A	ENSP00000291547:p.Gln56Lys	None		Capture	SOLID	Phase_I	43300784	NM_004571	O00528|Q8IWT7	Missense_Mutation	SNP	ENST00000291547.5	37	CCDS13692.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.337350	0.41398	.	.	ENSG00000160199	ENST00000291547	T	0.40756	1.02	5.14	5.14	0.70334	.	0.192499	0.47455	D	0.000234	T	0.34629	0.0904	L	0.34521	1.04	0.80722	D	1	B;B;B	0.32467	0.187;0.07;0.372	B;B;B	0.33392	0.116;0.024;0.163	T	0.09487	-1.0672	9	.	.	.	0.0061	16.803	0.85618	0.0:1.0:0.0:0.0	.	56;56;56	Q5DNB2;P55347;P55347-2	.;PKNX1_HUMAN;.	K	56	ENSP00000291547:Q56K	.	Q	+	1	0	PKNOX1	43300784	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.264000	0.51553	2.416000	0.81992	0.655000	0.94253	CAG		PKNOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195520.3		
EMP2	2013	hgsc.bcm.edu	37	16	10626820	10626820	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:10626820G>C	ENST00000359543.3	-	5	655	c.446C>G	c.(445-447)gCc>gGc	p.A149G	EMP2_ENST00000566033.1_5'Flank|EMP2_ENST00000536829.1_Missense_Mutation_p.A149G|RP11-27M24.1_ENST00000535363.1_RNA	NM_001424.4	NP_001415.1	P54851	EMP2_HUMAN	epithelial membrane protein 2	149					cell proliferation (GO:0008283)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|regulation of glomerular filtration (GO:0003093)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	integrin binding (GO:0005178)			NS(1)|endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6						GCAGGCGAAGGCCACCCACGC	0.527																																					p.A149G	GBM(158;2021 2691 14714 39478)											.	.	0			c.C446G	16						.						141.0	113.0	122.0					16																	10626820		2197	4300	6497	10534321	SO:0001583	missense	2013	exon5			U52100	CCDS10541.1	16p13.2	2008-08-01			ENSG00000213853	ENSG00000213853			3334	protein-coding gene	gene with protein product		602334				8996089, 10331954, 16216233	Standard	NM_001424		Approved	XMP	uc002czx.3	P54851	OTTHUMG00000129752	ENST00000359543.3:c.446C>G	16.37:g.10626820G>C	ENSP00000352540:p.Ala149Gly	None		Capture	SOLID	Phase_I	10534321	NM_001424	B2R7V6|D3DUF8	Missense_Mutation	SNP	ENST00000359543.3	37	CCDS10541.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298242	0.81025	.	.	ENSG00000213853	ENST00000359543;ENST00000536829	D;D	0.90563	-2.69;-2.69	5.37	4.42	0.53409	.	0.124729	0.53938	U	0.000058	D	0.93187	0.7830	M	0.78637	2.42	0.46167	D	0.998901	D	0.54047	0.964	P	0.54965	0.765	D	0.92557	0.6055	10	0.39692	T	0.17	-16.3912	13.6342	0.62213	0.0749:0.0:0.9251:0.0	.	149	P54851	EMP2_HUMAN	G	149	ENSP00000352540:A149G;ENSP00000445712:A149G	ENSP00000352540:A149G	A	-	2	0	EMP2	10534321	1.000000	0.71417	0.984000	0.44739	0.926000	0.56050	6.948000	0.75965	1.413000	0.46997	0.655000	0.94253	GCC		EMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251965.1	NM_001424	
CIITA	4261	hgsc.bcm.edu	37	16	11017159	11017159	+	Nonstop_Mutation	SNP	G	G	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:11017159G>C	ENST00000324288.8	+	19	3525	c.3392G>C	c.(3391-3393)tGa>tCa	p.*1131S	CIITA_ENST00000381835.5_Nonstop_Mutation_p.*547S	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	0					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						AGCCTGAGATGATCCCAGCTG	0.582			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.X1131S			Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	.	0			c.G3392C	16						.						101.0	92.0	95.0					16																	11017159		2197	4300	6497	10924660	SO:0001578	stop_lost	4261	exon19			U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.3392G>C	16.37:g.11017159G>C	ENSP00000316328:p.*1131Serext*35	None		Capture	SOLID	Phase_I	10924660	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.979966	0.34942	.	.	ENSG00000179583	ENST00000324288;ENST00000381835	.	.	.	4.61	3.57	0.40892	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.8044	0.23768	0.1281:0.0:0.8719:0.0	.	.	.	.	S	1131;547	.	.	X	+	2	2	CIITA	10924660	1.000000	0.71417	0.995000	0.50966	0.971000	0.66376	2.189000	0.42621	2.373000	0.80994	0.655000	0.94253	TGA		CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
C16orf93	90835	hgsc.bcm.edu	37	16	30770990	30770990	+	Silent	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:30770990A>G	ENST00000543610.1	-	5	1486	c.525T>C	c.(523-525)ttT>ttC	p.F175F	RNF40_ENST00000357890.5_5'Flank|RNF40_ENST00000563683.1_5'Flank|RNF40_ENST00000324685.6_5'Flank|RNF40_ENST00000402121.3_5'Flank|PHKG2_ENST00000563588.1_3'UTR|C16orf93_ENST00000541260.1_Silent_p.F175F|PHKG2_ENST00000424889.3_Intron	NM_001014979.2	NP_001014979.2	A1A4V9	CP093_HUMAN	chromosome 16 open reading frame 93	175								p.F138F(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)	11						CTCCATGGCAAAAAAGGACAC	0.532																																					p.F175F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T525C	16						.						101.0	85.0	91.0					16																	30770990		2197	4300	6497	30678491	SO:0001819	synonymous_variant	90835	exon5			BC042548	CCDS32434.1, CCDS32434.2, CCDS55993.1	16p11.2	2012-10-10			ENSG00000196118	ENSG00000196118			28078	protein-coding gene	gene with protein product							Standard	NM_001195620		Approved	MGC104706	uc002dzm.3	A1A4V9	OTTHUMG00000167926	ENST00000543610.1:c.525T>C	16.37:g.30770990A>G		Somatic		Capture	SOLID	Phase_I	30678491	NM_001014979	A1A4V8|F5GX13|Q569G2	Silent	SNP	ENST00000543610.1	37	CCDS32434.2	.	.	.	.	.	.	.	.	.	.	A	10.37	1.330450	0.24167	.	.	ENSG00000196118	ENST00000535476	.	.	.	5.34	-2.87	0.05700	.	0.165039	0.43260	D	0.000598	T	0.59459	0.2195	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59322	-0.7476	6	0.52906	T	0.07	-14.619	9.8784	0.41218	0.2248:0.1464:0.6288:0.0	.	.	.	.	S	72	.	ENSP00000442644:F72S	F	-	2	0	C16orf93	30678491	0.959000	0.32827	0.985000	0.45067	0.972000	0.66771	0.019000	0.13444	-0.484000	0.06763	0.459000	0.35465	TTT		C16orf93-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397089.1	NM_001014979	
NAE1	8883	hgsc.bcm.edu	37	16	66855428	66855428	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:66855428A>G	ENST00000290810.3	-	7	533	c.436T>C	c.(436-438)Tcc>Ccc	p.S146P	NAE1_ENST00000394074.2_Missense_Mutation_p.S57P|NAE1_ENST00000379463.2_Missense_Mutation_p.S140P|NAE1_ENST00000359087.4_Missense_Mutation_p.S149P|NAE1_ENST00000564040.2_5'UTR			Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1	146					mitotic DNA replication checkpoint (GO:0033314)|neuron apoptotic process (GO:0051402)|protein neddylation (GO:0045116)|regulation of apoptotic process (GO:0042981)|regulation of neuron apoptotic process (GO:0043523)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|protein heterodimerization activity (GO:0046982)|ubiquitin protein ligase binding (GO:0031625)	p.S146P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	GGAATCTGGGAATTCCAGAGG	0.348																																					p.S146P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T436C	16						.						93.0	87.0	89.0					16																	66855428		2200	4300	6500	65412929	SO:0001583	missense	8883	exon7			U50939	CCDS10820.1, CCDS42171.1, CCDS42172.1, CCDS67050.1	16q22	2013-09-26	2007-12-11	2007-12-11	ENSG00000159593	ENSG00000159593		"""Ubiquitin-like modifier activating enzymes"""	621	protein-coding gene	gene with protein product		603385	"""amyloid beta precursor protein binding protein 1, 59kDa"""	APPBP1		8626687, 12740388	Standard	XM_005256215		Approved	ula-1	uc002eqf.3	Q13564	OTTHUMG00000137513	ENST00000290810.3:c.436T>C	16.37:g.66855428A>G	ENSP00000290810:p.Ser146Pro	Somatic		Capture	SOLID	Phase_I	65412929	NM_003905	A6NCK0|A6NFN4|A8MU28|B2R700|B3KUP9	Missense_Mutation	SNP	ENST00000290810.3	37	CCDS10820.1	.	.	.	.	.	.	.	.	.	.	A	12.73	2.026195	0.35701	.	.	ENSG00000159593	ENST00000359087;ENST00000290810;ENST00000379463;ENST00000394074	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	4.63	3.45	0.39498	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.124475	0.56097	D	0.000040	T	0.35098	0.0920	L	0.47716	1.5	0.44595	D	0.997568	B;B;B;B	0.26602	0.154;0.001;0.086;0.059	B;B;B;B	0.27380	0.021;0.007;0.049;0.079	T	0.18116	-1.0347	10	0.30854	T	0.27	.	11.8359	0.52323	0.802:0.198:0.0:0.0	.	57;149;146;140	A8MU28;A6NCK0;Q13564;A6NFN4	.;.;ULA1_HUMAN;.	P	149;146;140;57	ENSP00000351990:S149P;ENSP00000290810:S146P;ENSP00000368776:S140P;ENSP00000377637:S57P	ENSP00000290810:S146P	S	-	1	0	NAE1	65412929	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	1.930000	0.40124	1.836000	0.53414	0.455000	0.32223	TCC		NAE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268832.1	NM_003905	
FAM65A	79567	hgsc.bcm.edu	37	16	67578878	67578878	+	Silent	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:67578878T>G	ENST00000379312.3	+	17	3022	c.2901T>G	c.(2899-2901)tcT>tcG	p.S967S	FAM65A_ENST00000540839.3_Silent_p.S982S|FAM65A_ENST00000428437.2_Silent_p.S977S|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000042381.4_Silent_p.S963S|FAM65A_ENST00000422602.2_Silent_p.S983S|CTD-2012K14.3_ENST00000563083.1_RNA	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	967						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.S963S(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		TCTCGGCCTCTCGGCCTGGCT	0.602																																					p.S977S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2931G	16						.						149.0	150.0	150.0					16																	67578878		2198	4300	6498	66136379	SO:0001819	synonymous_variant	79567	exon17			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.2901T>G	16.37:g.67578878T>G		Somatic		Capture	SOLID	Phase_I	66136379	NM_001193524	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Silent	SNP	ENST00000379312.3	37	CCDS54028.1	.	.	.	.	.	.	.	.	.	.	T	3.843	-0.033350	0.07543	.	.	ENSG00000039523	ENST00000428437	.	.	.	5.44	1.67	0.24075	.	0.324995	0.33327	N	0.005040	T	0.35770	0.0943	.	.	.	0.52099	D	0.999942	.	.	.	.	.	.	T	0.04440	-1.0951	6	0.13108	T	0.6	-13.3653	4.7889	0.13239	0.0:0.1999:0.2996:0.5005	.	.	.	.	A	957	.	ENSP00000389456:S957A	S	+	1	0	FAM65A	66136379	0.063000	0.20901	1.000000	0.80357	0.681000	0.39784	0.053000	0.14184	0.905000	0.36596	0.533000	0.62120	TCG		FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
GFOD2	81577	hgsc.bcm.edu	37	16	67709586	67709586	+	Silent	SNP	G	G	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:67709586G>C	ENST00000268797.7	-	3	975	c.630C>G	c.(628-630)gcC>gcG	p.A210A	GFOD2_ENST00000602377.1_5'UTR	NM_030819.3	NP_110446.3	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain containing 2	210					extracellular matrix organization (GO:0030198)	proteinaceous extracellular matrix (GO:0005578)	oxidoreductase activity (GO:0016491)	p.A210A(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		TGCCACGGATGGCAGCGTTCT	0.582																																					p.A210A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C630G	16						.						77.0	68.0	71.0					16																	67709586		2198	4300	6498	66267087	SO:0001819	synonymous_variant	81577	exon3			AK074382	CCDS10845.1, CCDS59268.1	16q22.1	2008-02-05			ENSG00000141098	ENSG00000141098			28159	protein-coding gene	gene with protein product						12975309	Standard	NM_030819		Approved	FLJ23802, MGC11335	uc002eub.3	Q3B7J2	OTTHUMG00000137537	ENST00000268797.7:c.630C>G	16.37:g.67709586G>C		Somatic		Capture	SOLID	Phase_I	66267087	NM_030819	Q69YL9|Q6UXX6|Q7L648|Q8TE86|Q9BQ07|R4GNG5	Silent	SNP	ENST00000268797.7	37	CCDS10845.1																																																																																				GFOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268868.2	NM_030819	
BCO1	53630	hgsc.bcm.edu	37	16	81293389	81293389	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:81293389C>A	ENST00000258168.2	+	3	763	c.302C>A	c.(301-303)cCc>cAc	p.P101H	BCMO1_ENST00000564552.1_Missense_Mutation_p.P101H|BCMO1_ENST00000425577.2_Intron	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						TATCCGGACCCCTGCAAAAAC	0.403																																					p.P101H												.	.	0			c.C302A	16						.						127.0	119.0	122.0					16																	81293389		2202	4300	6502	79850890	SO:0001583	missense	53630	exon3																														ENST00000258168.2:c.302C>A	16.37:g.81293389C>A	ENSP00000258168:p.Pro101His	None		Capture	SOLID	Phase_I	79850890	NM_017429		Missense_Mutation	SNP	ENST00000258168.2	37	CCDS10934.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808954	0.90707	.	.	ENSG00000135697	ENST00000258168	D	0.95482	-3.72	5.41	5.41	0.78517	.	0.113584	0.64402	D	0.000008	D	0.98413	0.9472	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99063	1.0831	10	0.62326	D	0.03	-19.4866	19.2704	0.94006	0.0:1.0:0.0:0.0	.	101	Q9HAY6	BCDO1_HUMAN	H	101	ENSP00000258168:P101H	ENSP00000258168:P101H	P	+	2	0	BCMO1	79850890	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.439000	0.80444	2.562000	0.86427	0.644000	0.83932	CCC		BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269056.1		
GAN	8139	hgsc.bcm.edu	37	16	81388161	81388161	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:81388161G>A	ENST00000568107.2	+	3	596	c.434G>A	c.(433-435)tGc>tAc	p.C145Y		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	145	BACK.				cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				CTACATTACTGCCTCCATCAC	0.473																																					p.C145Y	GBM(106;1239 1507 7582 9741 33976)											.	.	0			c.G434A	16						.						225.0	199.0	208.0					16																	81388161		2202	4300	6502	79945662	SO:0001583	missense	8139	exon3			AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.434G>A	16.37:g.81388161G>A	ENSP00000476795:p.Cys145Tyr	None		Capture	SOLID	Phase_I	79945662	NM_022041		Missense_Mutation	SNP	ENST00000568107.2	37	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573641	0.86542	.	.	ENSG00000127688	ENST00000248272	T	0.68479	-0.33	5.96	5.96	0.96718	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.68641	0.3023	N	0.25957	0.775	0.80722	D	1	D	0.57899	0.981	P	0.54346	0.749	T	0.66106	-0.6006	10	0.37606	T	0.19	.	20.422	0.99049	0.0:0.0:1.0:0.0	.	145	Q9H2C0	GAN_HUMAN	Y	145	ENSP00000248272:C145Y	ENSP00000248272:C145Y	C	+	2	0	GAN	79945662	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	9.476000	0.97823	2.832000	0.97577	0.655000	0.94253	TGC		GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3		
FOXF1	2294	hgsc.bcm.edu	37	16	86546536	86546536	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:86546536C>A	ENST00000262426.4	+	2	1028	c.985C>A	c.(985-987)Ccg>Acg	p.P329T		NM_001451.2	NP_001442.2	Q12946	FOXF1_HUMAN	forkhead box F1	329					blood vessel development (GO:0001568)|branching involved in open tracheal system development (GO:0060446)|cardiac left ventricle morphogenesis (GO:0003214)|cellular response to cytokine stimulus (GO:0071345)|cellular response to organic cyclic compound (GO:0071407)|detection of wounding (GO:0014822)|determination of left/right symmetry (GO:0007368)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic ectodermal digestive tract morphogenesis (GO:0048613)|embryonic foregut morphogenesis (GO:0048617)|endocardial cushion development (GO:0003197)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lateral mesodermal cell differentiation (GO:0048371)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mesenchyme migration (GO:0090131)|midgut development (GO:0007494)|morphogenesis of a branching structure (GO:0001763)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|respiratory tube development (GO:0030323)|right lung morphogenesis (GO:0060461)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|smoothened signaling pathway (GO:0007224)|somitogenesis (GO:0001756)|trachea development (GO:0060438)|ureter development (GO:0072189)|vasculogenesis (GO:0001570)|venous blood vessel development (GO:0060841)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	12						TGCAGGCATCCCGCGGTATCA	0.637																																					p.P329T												.	.	0			c.C985A	16						.						72.0	68.0	69.0					16																	86546536		2198	4300	6498	85104037	SO:0001583	missense	2294	exon2			U13219	CCDS10957.2	16q24	2008-02-05			ENSG00000103241	ENSG00000103241		"""Forkhead boxes"""	3809	protein-coding gene	gene with protein product		601089		FKHL5		8825632, 7957066	Standard	NM_001451		Approved	FREAC1	uc002fjl.3	Q12946	OTTHUMG00000137651	ENST00000262426.4:c.985C>A	16.37:g.86546536C>A	ENSP00000262426:p.Pro329Thr	None		Capture	SOLID	Phase_I	85104037	NM_001451	B2RAF4|Q5FWE5	Missense_Mutation	SNP	ENST00000262426.4	37	CCDS10957.2	.	.	.	.	.	.	.	.	.	.	C	17.18	3.324102	0.60634	.	.	ENSG00000103241	ENST00000262426	D	0.96587	-4.06	4.88	4.88	0.63580	.	0.222053	0.39341	N	0.001396	D	0.94574	0.8252	L	0.54323	1.7	0.80722	D	1	B	0.27117	0.168	B	0.23275	0.045	D	0.93310	0.6684	10	0.59425	D	0.04	.	17.3653	0.87362	0.0:1.0:0.0:0.0	.	329	Q12946	FOXF1_HUMAN	T	329	ENSP00000262426:P329T	ENSP00000262426:P329T	P	+	1	0	FOXF1	85104037	1.000000	0.71417	0.998000	0.56505	0.913000	0.54294	5.353000	0.66034	2.392000	0.81423	0.655000	0.94253	CCG		FOXF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000269103.2	NM_001451	
SLC12A3	6559	hgsc.bcm.edu	37	16	56906570	56906571	+	Frame_Shift_Del	DEL	GA	GA	-	rs534168507		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	GA	GA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:56906570_56906571delGA	ENST00000563236.1	+	8	992_993	c.967_968delGA	c.(967-969)gacfs	p.D323fs	SLC12A3_ENST00000438926.2_Frame_Shift_Del_p.D323fs|SLC12A3_ENST00000566786.1_Frame_Shift_Del_p.D322fs|SLC12A3_ENST00000262502.5_Frame_Shift_Del_p.D322fs			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	323					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)	p.D323fs*9(1)		breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TTTTCCAGCGGACATTTTTGTC	0.594																																					p.323_323del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.967_968del	16						.																																			55464072	SO:0001589	frameshift_variant	6559	exon8				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.967_968delGA	16.37:g.56906570_56906571delGA	ENSP00000456149:p.Asp323fs	Somatic		Capture	SOLID	Phase_I	55464071	NM_000339	A8MSJ2|C9JNN9	Frame_Shift_Del	DEL	ENST00000563236.1	37	CCDS58464.1																																																																																				SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1		
FANCA	2175	hgsc.bcm.edu	37	16	89851304	89851304	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr16:89851304G>C	ENST00000389301.3	-	15	1458	c.1428C>G	c.(1426-1428)ttC>ttG	p.F476L	FANCA_ENST00000568369.1_Missense_Mutation_p.F476L	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	476					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.F476L(1)		breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GTTCTGACAAGAACGTAAACA	0.567			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.F476L		yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1428G	16						.						170.0	152.0	158.0					16																	89851304		2198	4300	6498	88378805	SO:0001583	missense	2175	exon15	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.1428C>G	16.37:g.89851304G>C	ENSP00000373952:p.Phe476Leu	Somatic		Capture	SOLID	Phase_I	88378805	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.106773	0.56291	.	.	ENSG00000187741	ENST00000389301	D	0.98717	-5.09	5.58	4.43	0.53597	.	0.000000	0.64402	D	0.000008	D	0.98438	0.9480	M	0.80847	2.515	0.80722	D	1	D;D	0.62365	0.991;0.991	P;P	0.53593	0.73;0.73	D	0.98052	1.0388	10	0.72032	D	0.01	-36.8373	10.9233	0.47178	0.1594:0.0:0.8406:0.0	.	476;476	B4DRI7;O15360	.;FANCA_HUMAN	L	476	ENSP00000373952:F476L	ENSP00000373952:F476L	F	-	3	2	FANCA	88378805	1.000000	0.71417	1.000000	0.80357	0.019000	0.09904	4.071000	0.57556	2.643000	0.89663	0.549000	0.68633	TTC		FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
EPB41L3	23136	hgsc.bcm.edu	37	18	5410583	5410583	+	Silent	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr18:5410583C>T	ENST00000341928.2	-	14	2443	c.2103G>A	c.(2101-2103)ggG>ggA	p.G701G	EPB41L3_ENST00000400111.3_Silent_p.G532G|EPB41L3_ENST00000542146.1_5'UTR|EPB41L3_ENST00000342933.3_Silent_p.G701G|EPB41L3_ENST00000540638.2_Silent_p.G532G|EPB41L3_ENST00000544123.1_Silent_p.G532G|EPB41L3_ENST00000427684.2_5'UTR|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	701	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.G701G(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CAGTGGTCTCCCCGTCGGCTG	0.537																																					p.G701G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2103A	18						.						101.0	66.0	78.0					18																	5410583		2203	4300	6503	5400583	SO:0001819	synonymous_variant	23136	exon14			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2103G>A	18.37:g.5410583C>T		Somatic		Capture	SOLID	Phase_I	5400583	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Silent	SNP	ENST00000341928.2	37	CCDS11838.1																																																																																				EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
EPB41L3	23136	hgsc.bcm.edu	37	18	5434072	5434072	+	Silent	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr18:5434072C>A	ENST00000341928.2	-	7	994	c.654G>T	c.(652-654)ctG>ctT	p.L218L	EPB41L3_ENST00000400111.3_Silent_p.L218L|EPB41L3_ENST00000342933.3_Silent_p.L218L|EPB41L3_ENST00000540638.2_Silent_p.L218L|EPB41L3_ENST00000544123.1_Silent_p.L218L|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	218	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						AGGAGCAGGGCAGCCTTCCGG	0.527																																					p.L218L												.	.	0			c.G654T	18						.						115.0	96.0	102.0					18																	5434072		2203	4300	6503	5424072	SO:0001819	synonymous_variant	23136	exon7			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.654G>T	18.37:g.5434072C>A		None		Capture	SOLID	Phase_I	5424072	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Silent	SNP	ENST00000341928.2	37	CCDS11838.1																																																																																				EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
GAREM	64762	hgsc.bcm.edu	37	18	29867425	29867425	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr18:29867425G>C	ENST00000269209.6	-	4	1138	c.1135C>G	c.(1135-1137)Ctc>Gtc	p.L379V	RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000578619.1_5'Flank|GAREM_ENST00000399218.4_Missense_Mutation_p.L379V			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	379					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										GACTGGGTGAGCTCATCGCGG	0.567																																					p.L379V												.	.	0			c.C1135G	18						.						99.0	95.0	97.0					18																	29867425		2203	4300	6503	28121423	SO:0001583	missense	64762	exon4			AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1135C>G	18.37:g.29867425G>C	ENSP00000269209:p.Leu379Val	None		Capture	SOLID	Phase_I	28121423	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336515	0.60963	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.29655	1.56;1.56	5.42	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.42517	0.1206	L	0.39898	1.24	0.54753	D	0.999987	D;D	0.69078	0.997;0.984	D;P	0.78314	0.991;0.815	T	0.03829	-1.1000	10	0.23302	T	0.38	-25.9976	12.5727	0.56347	0.133:0.0:0.867:0.0	.	379;379	Q9H706;Q9H706-3	FA59A_HUMAN;.	V	379	ENSP00000382165:L379V;ENSP00000269209:L379V	ENSP00000269209:L379V	L	-	1	0	FAM59A	28121423	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	6.277000	0.72608	2.706000	0.92434	0.462000	0.41574	CTC		GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
SLC35A5	55032	hgsc.bcm.edu	37	3	112282366	112282366	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:112282366A>G	ENST00000492406.1	+	2	399	c.116A>G	c.(115-117)tAt>tGt	p.Y39C	ATG3_ENST00000283290.5_5'Flank|ATG3_ENST00000495756.1_5'Flank|ATG3_ENST00000402314.2_5'Flank|SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	39					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						CTAGTGAAGTATTCTGCCAAT	0.383																																					p.Y39C												.	.	0			c.A116G	3						.						158.0	137.0	144.0					3																	112282366		2203	4300	6503	113765056	SO:0001583	missense	55032	exon2			AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.116A>G	3.37:g.112282366A>G	ENSP00000417654:p.Tyr39Cys	None		Capture	SOLID	Phase_I	113765056	NM_017945	D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Missense_Mutation	SNP	ENST00000492406.1	37	CCDS2967.1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.599267	0.66332	.	.	ENSG00000138459	ENST00000484995;ENST00000492406;ENST00000468642	T	0.55413	0.52	5.96	4.76	0.60689	.	0.153946	0.56097	D	0.000021	T	0.57592	0.2064	L	0.57536	1.79	0.39537	D	0.968766	D	0.61080	0.989	P	0.52514	0.701	T	0.64123	-0.6481	10	0.87932	D	0	-16.0265	9.9669	0.41730	0.767:0.0:0.0:0.233	.	39	Q9BS91	S35A5_HUMAN	C	39	ENSP00000417654:Y39C	ENSP00000261034:Y39C	Y	+	2	0	SLC35A5	113765056	0.987000	0.35691	0.998000	0.56505	0.965000	0.64279	2.636000	0.46545	2.279000	0.76181	0.533000	0.62120	TAT		SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354184.1	NM_017945	
ZNF80	7634	hgsc.bcm.edu	37	3	113955262	113955262	+	Silent	SNP	T	T	C	rs568691849		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:113955262T>C	ENST00000482457.2	-	1	1163	c.660A>G	c.(658-660)aaA>aaG	p.K220K	RP11-553L6.2_ENST00000481773.1_RNA|RP11-553L6.2_ENST00000493033.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	220					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K220K(1)		NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				TCCCACATTCTTTGCACTCGT	0.483																																					p.K220K	GBM(23;986 1114 21716)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A660G	3						.						109.0	111.0	110.0					3																	113955262		2203	4300	6503	115437952	SO:0001819	synonymous_variant	7634	exon1			X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.660A>G	3.37:g.113955262T>C		Somatic		Capture	SOLID	Phase_I	115437952	NM_007136	Q6NSW4|Q6NT14	Silent	SNP	ENST00000482457.2	37	CCDS2979.1																																																																																				ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2	NM_007136	
ZNF80	7634	hgsc.bcm.edu	37	3	113955772	113955772	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:113955772T>C	ENST00000482457.2	-	1	653	c.150A>G	c.(148-150)aaA>aaG	p.K50K	RP11-553L6.2_ENST00000481773.1_RNA|RP11-553L6.2_ENST00000493033.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				ATTCCTTGCATTTGTAGGTCT	0.483																																					p.K50K	GBM(23;986 1114 21716)											.	.	0			c.A150G	3						.						127.0	113.0	118.0					3																	113955772		2203	4300	6503	115438462	SO:0001819	synonymous_variant	7634	exon1			X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.150A>G	3.37:g.113955772T>C		None		Capture	SOLID	Phase_I	115438462	NM_007136	Q6NSW4|Q6NT14	Silent	SNP	ENST00000482457.2	37	CCDS2979.1																																																																																				ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2	NM_007136	
ZNF80	7634	hgsc.bcm.edu	37	3	113955774	113955774	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:113955774T>C	ENST00000482457.2	-	1	651	c.148A>G	c.(148-150)Aaa>Gaa	p.K50E	RP11-553L6.2_ENST00000481773.1_RNA|RP11-553L6.2_ENST00000493033.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K50E(1)		NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				TCCTTGCATTTGTAGGTCTTC	0.488																																					p.K50E	GBM(23;986 1114 21716)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A148G	3						.						126.0	112.0	117.0					3																	113955774		2203	4300	6503	115438464	SO:0001583	missense	7634	exon1			X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.148A>G	3.37:g.113955774T>C	ENSP00000417192:p.Lys50Glu	Somatic		Capture	SOLID	Phase_I	115438464	NM_007136	Q6NSW4|Q6NT14	Missense_Mutation	SNP	ENST00000482457.2	37	CCDS2979.1	.	.	.	.	.	.	.	.	.	.	T	4.955	0.177330	0.09443	.	.	ENSG00000174255	ENST00000482457	T	0.28895	1.59	2.77	0.389	0.16269	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10852	0.0265	N	0.05124	-0.11	0.09310	N	1	B	0.13594	0.008	B	0.16289	0.015	T	0.35549	-0.9784	9	0.02654	T	1	.	5.8301	0.18577	0.0:0.2574:0.0:0.7426	.	50	P51504	ZNF80_HUMAN	E	50	ENSP00000417192:K50E	ENSP00000309812:K50E	K	-	1	0	ZNF80	115438464	0.000000	0.05858	0.001000	0.08648	0.042000	0.13812	-1.113000	0.03296	0.075000	0.16796	0.533000	0.62120	AAA		ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2	NM_007136	
PPP2R3A	5523	hgsc.bcm.edu	37	3	135806731	135806731	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:135806731C>T	ENST00000264977.3	+	9	3412	c.2795C>T	c.(2794-2796)tCa>tTa	p.S932L	PPP2R3A_ENST00000490467.1_Missense_Mutation_p.S196L|RP11-305O4.3_ENST00000608883.1_RNA|PPP2R3A_ENST00000334546.2_Missense_Mutation_p.S311L	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	932					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TTAGCTTCATCAAGCAGGATT	0.318																																					p.S196L												.	.	0			c.C587T	3						.						148.0	147.0	148.0					3																	135806731		2203	4300	6503	137289421	SO:0001583	missense	5523	exon8			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.2795C>T	3.37:g.135806731C>T	ENSP00000264977:p.Ser932Leu	None		Capture	SOLID	Phase_I	137289421	NM_001190447	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	37	CCDS3087.1	.	.	.	.	.	.	.	.	.	.	C	35	5.560040	0.96514	.	.	ENSG00000073711	ENST00000264977;ENST00000490467;ENST00000334546	T;T;T	0.53423	0.62;0.62;0.62	5.98	5.98	0.97165	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.77928	0.4204	M	0.94142	3.5	0.80722	D	1	D;D	0.67145	0.996;0.988	D;D	0.66497	0.944;0.934	D	0.83385	0.0014	10	0.87932	D	0	.	19.4402	0.94817	0.0:1.0:0.0:0.0	.	311;932	Q06190-2;Q06190	.;P2R3A_HUMAN	L	932;196;311	ENSP00000264977:S932L;ENSP00000419344:S196L;ENSP00000334748:S311L	ENSP00000264977:S932L	S	+	2	0	PPP2R3A	137289421	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	7.413000	0.80104	2.838000	0.97847	0.591000	0.81541	TCA		PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
ATR	545	hgsc.bcm.edu	37	3	142211989	142211989	+	Silent	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:142211989A>G	ENST00000350721.4	-	35	6184	c.6063T>C	c.(6061-6063)atT>atC	p.I2021I	ATR_ENST00000383101.3_Silent_p.I1957I	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	2021	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.I2021I(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ATTTTTTCATAATTGCATTGC	0.358								Other conserved DNA damage response genes																													p.I2021I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T6063C	3						.						80.0	83.0	82.0					3																	142211989		2203	4300	6503	143694679	SO:0001819	synonymous_variant	545	exon35			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.6063T>C	3.37:g.142211989A>G		Somatic		Capture	SOLID	Phase_I	143694679	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	37	CCDS3124.1																																																																																				ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
SLITRK3	22865	hgsc.bcm.edu	37	3	164908522	164908522	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:164908522G>C	ENST00000475390.1	-	2	540	c.97C>G	c.(97-99)Cta>Gta	p.L33V	SLITRK3_ENST00000241274.3_Missense_Mutation_p.L33V			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	33					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TCCTCTATTAGGGGAATCGGG	0.413										HNSCC(40;0.11)																											p.L33V												.	.	0			c.C97G	3						.						103.0	101.0	102.0					3																	164908522		2202	4300	6502	166391216	SO:0001583	missense	22865	exon2			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.97C>G	3.37:g.164908522G>C	ENSP00000420091:p.Leu33Val	None		Capture	SOLID	Phase_I	166391216	NM_014926	Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	4.062	0.009224	0.07912	.	.	ENSG00000121871	ENST00000475390;ENST00000241274;ENST00000497724	T;T;T	0.69306	0.59;0.59;-0.39	6.01	2.92	0.33932	.	0.000000	0.30051	N	0.010531	T	0.64768	0.2628	L	0.31752	0.955	0.37154	D	0.902283	D	0.63880	0.993	D	0.67548	0.952	T	0.64170	-0.6470	10	0.29301	T	0.29	-10.8958	5.2449	0.15490	0.5209:0.0:0.4791:0.0	.	33	O94933	SLIK3_HUMAN	V	33	ENSP00000420091:L33V;ENSP00000241274:L33V;ENSP00000419611:L33V	ENSP00000241274:L33V	L	-	1	2	SLITRK3	166391216	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.429000	0.52800	0.890000	0.36211	0.655000	0.94253	CTA		SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
CRBN	51185	hgsc.bcm.edu	37	3	3215771	3215771	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:3215771C>T	ENST00000231948.4	-	3	371	c.349G>A	c.(349-351)Gat>Aat	p.D117N	CRBN_ENST00000432408.2_Missense_Mutation_p.D116N	NM_016302.3	NP_057386.2	Q96SW2	CRBN_HUMAN	cereblon	117	Lon.				negative regulation of ion transmembrane transport (GO:0034766)|negative regulation of protein homooligomerization (GO:0032463)|positive regulation of protein homodimerization activity (GO:0090073)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP-dependent peptidase activity (GO:0004176)			endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	11				Epithelial(13;0.00244)|OV - Ovarian serous cystadenocarcinoma(96;0.00617)|all cancers(10;0.0079)	Lenalidomide(DB00480)|Pomalidomide(DB08910)|Thalidomide(DB01041)	AAGGTTCTATCTTTCTGAATT	0.408																																					p.D116N												.	.	0			c.G346A	3						.						89.0	91.0	91.0					3																	3215771		2203	4300	6503	3190771	SO:0001583	missense	51185	exon3			BC017419	CCDS2562.1, CCDS54547.1	3p26.3	2014-05-27			ENSG00000113851	ENSG00000113851			30185	protein-coding gene	gene with protein product		609262	"""mental retardation, non-syndromic, autosomal recessive, 2A"""	MRT2A		15557513	Standard	NM_016302		Approved	MRT2	uc003bpq.3	Q96SW2	OTTHUMG00000090261	ENST00000231948.4:c.349G>A	3.37:g.3215771C>T	ENSP00000231948:p.Asp117Asn	None		Capture	SOLID	Phase_I	3190771	NM_001173482	B2R6H4|C9IZA9|C9JAH6|Q6AI62|Q6NVZ0|Q9UHW4	Missense_Mutation	SNP	ENST00000231948.4	37	CCDS2562.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.357821	0.82243	.	.	ENSG00000113851	ENST00000231948;ENST00000432408;ENST00000546075	T;T	0.44482	0.92;0.92	5.75	5.75	0.90469	Peptidase S16, lon N-terminal (2);PUA-like domain (1);	0.000000	0.85682	D	0.000000	T	0.61098	0.2320	L	0.49350	1.555	0.80722	D	1	D;D;D	0.69078	0.995;0.996;0.997	P;D;D	0.83275	0.799;0.993;0.996	T	0.53830	-0.8383	10	0.34782	T	0.22	-24.6119	19.9479	0.97190	0.0:1.0:0.0:0.0	.	54;116;117	F5H3U1;Q96SW2-2;Q96SW2	.;.;CRBN_HUMAN	N	117;116;54	ENSP00000231948:D117N;ENSP00000412499:D116N	ENSP00000231948:D117N	D	-	1	0	CRBN	3190771	1.000000	0.71417	0.957000	0.39632	0.997000	0.91878	7.638000	0.83328	2.704000	0.92352	0.650000	0.86243	GAT		CRBN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206579.3	NM_016302	
CRBN	51185	hgsc.bcm.edu	37	3	3215853	3215853	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:3215853C>T	ENST00000231948.4	-	3	289	c.267G>A	c.(265-267)atG>atA	p.M89I	CRBN_ENST00000432408.2_Missense_Mutation_p.M88I	NM_016302.3	NP_057386.2	Q96SW2	CRBN_HUMAN	cereblon	89	Lon.				negative regulation of ion transmembrane transport (GO:0034766)|negative regulation of protein homooligomerization (GO:0032463)|positive regulation of protein homodimerization activity (GO:0090073)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP-dependent peptidase activity (GO:0004176)			endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	11				Epithelial(13;0.00244)|OV - Ovarian serous cystadenocarcinoma(96;0.00617)|all cancers(10;0.0079)	Lenalidomide(DB00480)|Pomalidomide(DB08910)|Thalidomide(DB01041)	GAATCAGGATCATCATCACTT	0.428																																					p.M88I												.	.	0			c.G264A	3						.						102.0	100.0	101.0					3																	3215853		2203	4300	6503	3190853	SO:0001583	missense	51185	exon3			BC017419	CCDS2562.1, CCDS54547.1	3p26.3	2014-05-27			ENSG00000113851	ENSG00000113851			30185	protein-coding gene	gene with protein product		609262	"""mental retardation, non-syndromic, autosomal recessive, 2A"""	MRT2A		15557513	Standard	NM_016302		Approved	MRT2	uc003bpq.3	Q96SW2	OTTHUMG00000090261	ENST00000231948.4:c.267G>A	3.37:g.3215853C>T	ENSP00000231948:p.Met89Ile	None		Capture	SOLID	Phase_I	3190853	NM_001173482	B2R6H4|C9IZA9|C9JAH6|Q6AI62|Q6NVZ0|Q9UHW4	Missense_Mutation	SNP	ENST00000231948.4	37	CCDS2562.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380629	0.42207	.	.	ENSG00000113851	ENST00000231948;ENST00000432408;ENST00000546075	T;T	0.41758	0.99;0.99	5.75	5.75	0.90469	Peptidase S16, lon N-terminal (2);PUA-like domain (1);	0.099064	0.64402	D	0.000001	T	0.19644	0.0472	N	0.02539	-0.55	0.38885	D	0.956988	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.14578	0.003;0.006;0.011	T	0.12708	-1.0537	10	0.34782	T	0.22	-33.0243	11.2615	0.49085	0.1418:0.7214:0.1368:0.0	.	26;88;89	F5H3U1;Q96SW2-2;Q96SW2	.;.;CRBN_HUMAN	I	89;88;26	ENSP00000231948:M89I;ENSP00000412499:M88I	ENSP00000231948:M89I	M	-	3	0	CRBN	3190853	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.925000	0.40074	2.704000	0.92352	0.650000	0.86243	ATG		CRBN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206579.3	NM_016302	
FYCO1	79443	hgsc.bcm.edu	37	3	46008720	46008720	+	Silent	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:46008720T>G	ENST00000296137.2	-	8	2311	c.2106A>C	c.(2104-2106)ctA>ctC	p.L702L	FYCO1_ENST00000535325.1_Silent_p.L702L	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	702					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CCTTGCTCTGTAGAATGGCCT	0.617																																					p.L702L												.	.	0			c.A2106C	3						.						106.0	112.0	110.0					3																	46008720		2203	4300	6503	45983724	SO:0001819	synonymous_variant	79443	exon8			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.2106A>C	3.37:g.46008720T>G		None		Capture	SOLID	Phase_I	45983724	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Silent	SNP	ENST00000296137.2	37	CCDS2734.1																																																																																				FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
MAP4	4134	hgsc.bcm.edu	37	3	47957778	47957778	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:47957778T>C	ENST00000360240.6	-	7	2057	c.1539A>G	c.(1537-1539)gaA>gaG	p.E513E	MAP4_ENST00000395734.3_Silent_p.E513E|MAP4_ENST00000426837.2_Silent_p.E530E|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	513	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.E513E(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	CCAGAGCCATTTCTGTTTCTG	0.502																																					p.E513E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1539G	3						.						172.0	162.0	165.0					3																	47957778		2203	4300	6503	47932782	SO:0001819	synonymous_variant	4134	exon7				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1539A>G	3.37:g.47957778T>C		Somatic		Capture	SOLID	Phase_I	47932782	NM_001134364	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Silent	SNP	ENST00000360240.6	37	CCDS33750.1																																																																																				MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375	
CHDH	55349	hgsc.bcm.edu	37	3	53855700	53855700	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:53855700C>A	ENST00000315251.6	-	5	1396	c.959G>T	c.(958-960)gGc>gTc	p.G320V		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	320					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	CACAGGGATGCCCAGTTTCTT	0.517																																					p.G320V												.	.	0			c.G959T	3						.						158.0	136.0	144.0					3																	53855700		2203	4300	6503	53830740	SO:0001583	missense	55349	exon5			AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.959G>T	3.37:g.53855700C>A	ENSP00000319851:p.Gly320Val	None		Capture	SOLID	Phase_I	53830740	NM_018397	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.975062	0.74360	.	.	ENSG00000016391	ENST00000315251	T	0.73897	-0.79	5.79	3.87	0.44632	Glucose-methanol-choline oxidoreductase, N-terminal (1);	0.324668	0.32055	N	0.006660	D	0.87752	0.6256	H	0.97940	4.11	0.54753	D	0.999981	P	0.46912	0.886	P	0.52514	0.701	D	0.90878	0.4751	10	0.87932	D	0	-25.2857	11.5784	0.50877	0.0:0.8075:0.1246:0.0679	.	320	Q8NE62	CHDH_HUMAN	V	320	ENSP00000319851:G320V	ENSP00000319851:G320V	G	-	2	0	CHDH	53830740	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.861000	0.48380	1.429000	0.47314	0.655000	0.94253	GGC		CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
EPHA3	2042	hgsc.bcm.edu	37	3	89391122	89391122	+	Silent	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:89391122G>T	ENST00000336596.2	+	5	1413	c.1188G>T	c.(1186-1188)gtG>gtT	p.V396V	EPHA3_ENST00000494014.1_Silent_p.V396V|EPHA3_ENST00000452448.2_Silent_p.V396V	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	396	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.V396V(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CGGTGACAGTGACAGACCTTC	0.502										TSP Lung(6;0.00050)																											p.V396V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1188T	3						.						103.0	86.0	92.0					3																	89391122		2203	4300	6503	89473812	SO:0001819	synonymous_variant	2042	exon5			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1188G>T	3.37:g.89391122G>T		Somatic		Capture	SOLID	Phase_I	89473812	NM_182644	Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	37	CCDS2922.1																																																																																				EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
ECE2	9718	hgsc.bcm.edu	37	3	184002836	184002836	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr3:184002836T>C	ENST00000402825.3	+	9	1445	c.1445T>C	c.(1444-1446)gTg>gCg	p.V482A	ECE2_ENST00000404464.3_Missense_Mutation_p.V364A|ECE2_ENST00000357474.5_Missense_Mutation_p.V410A|ECE2_ENST00000359140.4_Missense_Mutation_p.V335A|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	482	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCTGTGGTGGTGTATGGGATG	0.537											OREG0015945	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V482A												.	.	0			c.T1445C	3						.						125.0	118.0	120.0					3																	184002836		2203	4300	6503	185485530	SO:0001583	missense	9718	exon9			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1445T>C	3.37:g.184002836T>C	ENSP00000384223:p.Val482Ala	None	1988	Capture	SOLID	Phase_I	185485530	NM_014693	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	.	.	.	.	.	.	.	.	.	.	T	19.54	3.846910	0.71603	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	4.37	3.18	0.36537	Peptidase M13 (1);	0.147358	0.46145	D	0.000302	D	0.86711	0.5998	M	0.84219	2.685	0.51233	D	0.999917	D;P;P;P;P;P;D	0.64830	0.982;0.952;0.952;0.469;0.941;0.941;0.994	D;D;D;P;D;P;D	0.73708	0.956;0.949;0.949;0.709;0.915;0.887;0.981	D	0.86376	0.1726	10	0.66056	D	0.02	-15.909	9.9529	0.41649	0.0:0.0:0.1714:0.8286	.	84;335;353;364;410;335;482	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	A	482;335;364;410;356	ENSP00000384223:V482A;ENSP00000352052:V335A;ENSP00000385846:V364A;ENSP00000350066:V410A;ENSP00000398444:V356A	ENSP00000350066:V410A	V	+	2	0	ECE2	185485530	1.000000	0.71417	0.995000	0.50966	0.966000	0.64601	7.251000	0.78297	0.698000	0.31739	0.523000	0.50628	GTG		ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	
STAB2	55576	hgsc.bcm.edu	37	12	104089563	104089563	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:104089563T>A	ENST00000388887.2	+	33	3727	c.3523T>A	c.(3523-3525)Ttt>Att	p.F1175I		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CTACACAGTGTTTGCTCCAAA	0.433																																					p.F1175I												.	.	0			c.T3523A	12						.						113.0	108.0	110.0					12																	104089563		2203	4300	6503	102613693	SO:0001583	missense	55576	exon33			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.3523T>A	12.37:g.104089563T>A	ENSP00000373539:p.Phe1175Ile	None		Capture	SOLID	Phase_I	102613693	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.846032	0.91277	.	.	ENSG00000136011	ENST00000388887	D	0.95518	-3.73	6.17	6.17	0.99709	FAS1 domain (5);Growth factor, receptor (1);	0.054623	0.64402	D	0.000001	D	0.98058	0.9360	M	0.89715	3.055	0.45676	D	0.998597	D	0.89917	1.0	D	0.87578	0.998	D	0.98068	1.0397	10	0.37606	T	0.19	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	1175	Q8WWQ8	STAB2_HUMAN	I	1175	ENSP00000373539:F1175I	ENSP00000373539:F1175I	F	+	1	0	STAB2	102613693	1.000000	0.71417	0.994000	0.49952	0.769000	0.43574	6.187000	0.72039	2.371000	0.80710	0.533000	0.62120	TTT		STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
STAB2	55576	hgsc.bcm.edu	37	12	104089565	104089565	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:104089565T>C	ENST00000388887.2	+	33	3729	c.3525T>C	c.(3523-3525)ttT>ttC	p.F1175F		NM_017564.9	NP_060034.9			stabilin 2									p.F1175F(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						ACACAGTGTTTGCTCCAAACA	0.423																																					p.F1175F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3525C	12						.						113.0	108.0	110.0					12																	104089565		2203	4300	6503	102613695	SO:0001819	synonymous_variant	55576	exon33			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.3525T>C	12.37:g.104089565T>C		Somatic		Capture	SOLID	Phase_I	102613695	NM_017564		Silent	SNP	ENST00000388887.2	37	CCDS31888.1																																																																																				STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
FICD	11153	hgsc.bcm.edu	37	12	108913095	108913095	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:108913095A>T	ENST00000552695.1	+	3	1455	c.1220A>T	c.(1219-1221)aAc>aTc	p.N407I	FICD_ENST00000361549.2_3'UTR	NM_007076.2	NP_009007.2	Q9BVA6	FICD_HUMAN	FIC domain containing	407	Fido. {ECO:0000255|PROSITE- ProRule:PRU00791}.				negative regulation of Rho GTPase activity (GO:0034259)|protein adenylylation (GO:0018117)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein adenylyltransferase activity (GO:0070733)			NS(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|upper_aerodigestive_tract(2)	15						GAAGCTGCCAACGAGGGCGAC	0.587																																					p.N407I												.	.	0			c.A1220T	12						.						99.0	93.0	95.0					12																	108913095		2203	4300	6503	107437225	SO:0001583	missense	11153	exon3			AF049611	CCDS9116.1	12q24.1	2007-12-05				ENSG00000198855			18416	protein-coding gene	gene with protein product	"""huntingtin interacting protein 13"", ""fic S-phase protein cell division homolog (E. coli)"""					9700202	Standard	NM_007076		Approved	HYPE, HIP13	uc001tmx.1	Q9BVA6		ENST00000552695.1:c.1220A>T	12.37:g.108913095A>T	ENSP00000446479:p.Asn407Ile	None		Capture	SOLID	Phase_I	107437225	NM_007076	O75406	Missense_Mutation	SNP	ENST00000552695.1	37	CCDS9116.1	.	.	.	.	.	.	.	.	.	.	A	18.04	3.535305	0.64972	.	.	ENSG00000198855	ENST00000552695	.	.	.	6.02	6.02	0.97574	Filamentation induced by cAMP/death on curing-related (2);	0.000000	0.85682	D	0.000000	T	0.81138	0.4760	M	0.82433	2.59	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.83870	0.0273	9	0.87932	D	0	-40.1926	16.5446	0.84426	1.0:0.0:0.0:0.0	.	407	Q9BVA6	FICD_HUMAN	I	407	.	ENSP00000446479:N407I	N	+	2	0	FICD	107437225	1.000000	0.71417	1.000000	0.80357	0.246000	0.25737	9.339000	0.96797	2.311000	0.77944	0.533000	0.62120	AAC		FICD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404842.1	NM_007076	
FICD	11153	hgsc.bcm.edu	37	12	108913103	108913103	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:108913103G>A	ENST00000552695.1	+	3	1463	c.1228G>A	c.(1228-1230)Gac>Aac	p.D410N	FICD_ENST00000361549.2_3'UTR	NM_007076.2	NP_009007.2	Q9BVA6	FICD_HUMAN	FIC domain containing	410	Fido. {ECO:0000255|PROSITE- ProRule:PRU00791}.				negative regulation of Rho GTPase activity (GO:0034259)|protein adenylylation (GO:0018117)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein adenylyltransferase activity (GO:0070733)	p.D410N(1)		NS(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|upper_aerodigestive_tract(2)	15						CAACGAGGGCGACGTGAGGCC	0.587																																					p.D410N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1228A	12						.						100.0	93.0	95.0					12																	108913103		2203	4300	6503	107437233	SO:0001583	missense	11153	exon3			AF049611	CCDS9116.1	12q24.1	2007-12-05				ENSG00000198855			18416	protein-coding gene	gene with protein product	"""huntingtin interacting protein 13"", ""fic S-phase protein cell division homolog (E. coli)"""					9700202	Standard	NM_007076		Approved	HYPE, HIP13	uc001tmx.1	Q9BVA6		ENST00000552695.1:c.1228G>A	12.37:g.108913103G>A	ENSP00000446479:p.Asp410Asn	Somatic		Capture	SOLID	Phase_I	107437233	NM_007076	O75406	Missense_Mutation	SNP	ENST00000552695.1	37	CCDS9116.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.271747	0.80469	.	.	ENSG00000198855	ENST00000552695	.	.	.	6.02	6.02	0.97574	Filamentation induced by cAMP/death on curing-related (2);	0.000000	0.85682	D	0.000000	T	0.72890	0.3517	L	0.42487	1.325	0.80722	D	1	D	0.76494	0.999	P	0.62649	0.905	T	0.68401	-0.5418	9	0.38643	T	0.18	-50.3835	20.5407	0.99260	0.0:0.0:1.0:0.0	.	410	Q9BVA6	FICD_HUMAN	N	410	.	ENSP00000446479:D410N	D	+	1	0	FICD	107437233	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	9.869000	0.99810	2.865000	0.98341	0.655000	0.94253	GAC		FICD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404842.1	NM_007076	
ANAPC7	51434	hgsc.bcm.edu	37	12	110811952	110811952	+	Silent	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:110811952C>T	ENST00000455511.3	-	11	1797	c.1797G>A	c.(1795-1797)caG>caA	p.Q599Q	ANAPC7_ENST00000481473.1_5'UTR	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	599					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)	p.Q565Q(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						CGCCCCCTCACTGCATGCCGA	0.632																																					p.Q599Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1797A	12						.						97.0	80.0	85.0					12																	110811952		2203	4300	6503	109296335	SO:0001819	synonymous_variant	51434	exon11			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1797G>A	12.37:g.110811952C>T		Somatic		Capture	SOLID	Phase_I	109296335	NM_016238	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Silent	SNP	ENST00000455511.3	37	CCDS9145.2	.	.	.	.	.	.	.	.	.	.	C	2.940	-0.219100	0.06101	.	.	ENSG00000196510	ENST00000552087	.	.	.	5.88	4.07	0.47477	.	.	.	.	.	T	0.71745	0.3376	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68907	-0.5285	4	.	.	.	-24.4285	15.8897	0.79286	0.0:0.8836:0.0:0.1164	.	.	.	.	M	149	.	.	V	-	1	0	ANAPC7	109296335	1.000000	0.71417	1.000000	0.80357	0.408000	0.30992	3.520000	0.53465	0.418000	0.25898	-2.069000	0.00389	GTG		ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347075.3	NM_016238	
RPH3A	22895	hgsc.bcm.edu	37	12	113321203	113321203	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:113321203C>A	ENST00000389385.4	+	16	1929	c.1432C>A	c.(1432-1434)Ctc>Atc	p.L478I	RPH3A_ENST00000420983.2_Missense_Mutation_p.L478I|RPH3A_ENST00000548866.1_Missense_Mutation_p.L429I|RPH3A_ENST00000415485.3_Missense_Mutation_p.L478I|RPH3A_ENST00000549913.2_3'UTR|RPH3A_ENST00000543106.2_Missense_Mutation_p.L478I|RPH3A_ENST00000551052.1_Missense_Mutation_p.L474I|RPH3A_ENST00000447659.2_Missense_Mutation_p.L429I	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	478	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		AAGGAAGACCCTCAGGTACCT	0.577																																					p.L474I												.	.	0			c.C1420A	12						.						50.0	45.0	47.0					12																	113321203		2203	4300	6503	111805586	SO:0001583	missense	22895	exon15			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1432C>A	12.37:g.113321203C>A	ENSP00000374036:p.Leu478Ile	None		Capture	SOLID	Phase_I	111805586	NM_014954	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998771	0.74818	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983;ENST00000549913	T;T;T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12;2.12;2.12	5.25	5.25	0.73442	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.49305	D	0.000157	T	0.44993	0.1320	M	0.74258	2.255	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.42699	-0.9436	10	0.87932	D	0	.	11.1685	0.48558	0.0:0.9143:0.0:0.0857	.	429;478;478;474	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	I	478;478;429;474;478;429;478;130	ENSP00000440384:L478I;ENSP00000374036:L478I;ENSP00000413254:L429I;ENSP00000448297:L474I;ENSP00000405357:L478I;ENSP00000450347:L429I;ENSP00000408889:L478I	ENSP00000374036:L478I	L	+	1	0	RPH3A	111805586	1.000000	0.71417	0.998000	0.56505	0.621000	0.37620	5.775000	0.68915	2.443000	0.82685	0.551000	0.68910	CTC		RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
PSMD9	5715	hgsc.bcm.edu	37	12	122337597	122337597	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:122337597T>A	ENST00000541212.1	+	3	425	c.299T>A	c.(298-300)cTg>cAg	p.L100Q	PSMD9_ENST00000261817.2_Missense_Mutation_p.L100Q|PSMD9_ENST00000542602.1_Intron|RP11-87C12.2_ENST00000546333.1_Intron|PSMD9_ENST00000340175.5_Missense_Mutation_p.L100Q			O00233	PSMD9_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 9	100					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion (GO:0046676)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome regulatory particle (GO:0005838)	bHLH transcription factor binding (GO:0043425)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(1)|lung(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000117)|Epithelial(86;0.000415)|BRCA - Breast invasive adenocarcinoma(302;0.231)		CTGCACCAGCTGCACGCTCGC	0.612																																					p.L100Q												.	.	0			c.T299A	12						.						47.0	43.0	44.0					12																	122337597		2202	4300	6502	120821980	SO:0001583	missense	5715	exon3			AB003177	CCDS9225.1, CCDS58284.1	12q24.31-q24.32	2008-05-22			ENSG00000110801	ENSG00000110801		"""Proteasome (prosome, macropain) subunits"""	9567	protein-coding gene	gene with protein product		603146				9653651	Standard	NM_002813		Approved	p27, Rpn4	uc001ubl.4	O00233	OTTHUMG00000168945	ENST00000541212.1:c.299T>A	12.37:g.122337597T>A	ENSP00000440485:p.Leu100Gln	None		Capture	SOLID	Phase_I	120821980	NM_002813	B2RD35|G3V1Q6|Q9BQ42	Missense_Mutation	SNP	ENST00000541212.1	37	CCDS9225.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.731008	0.89390	.	.	ENSG00000110801	ENST00000541212;ENST00000340175;ENST00000261817;ENST00000538613;ENST00000544724	T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.58836	0.2150	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.72982	0.976;0.979	T	0.66252	-0.5970	10	0.51188	T	0.08	-26.7408	16.1146	0.81295	0.0:0.0:0.0:1.0	.	100;100	F8W7V8;O00233	.;PSMD9_HUMAN	Q	100;100;100;100;11	ENSP00000440485:L100Q;ENSP00000340847:L100Q;ENSP00000261817:L100Q;ENSP00000443081:L100Q;ENSP00000443929:L11Q	ENSP00000261817:L100Q	L	+	2	0	PSMD9	120821980	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.337000	0.79256	2.200000	0.70718	0.460000	0.39030	CTG		PSMD9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401686.1	NM_002813	
DHX37	57647	hgsc.bcm.edu	37	12	125441655	125441655	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:125441655G>A	ENST00000308736.2	-	17	2282	c.2184C>T	c.(2182-2184)ccC>ccT	p.P728P	DHX37_ENST00000544745.1_Silent_p.P515P	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	728							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.P728P(2)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CCACGGAGGGGGGCGTCGGGA	0.612																																					p.P728P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C2184T	12						.						68.0	69.0	69.0					12																	125441655		2203	4300	6503	124007608	SO:0001819	synonymous_variant	57647	exon17			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2184C>T	12.37:g.125441655G>A		Somatic		Capture	SOLID	Phase_I	124007608	NM_032656	Q9BUI7|Q9P211	Silent	SNP	ENST00000308736.2	37	CCDS9261.1																																																																																				DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	SOLID	Phase_I	25289551	NM_033360	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
LRRK2	120892	hgsc.bcm.edu	37	12	40713873	40713873	+	Silent	SNP	A	A	G	rs11176013	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:40713873A>G	ENST00000298910.7	+	34	4969	c.4911A>G	c.(4909-4911)aaA>aaG	p.K1637K		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1637					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.K1637K(1)|p.K1649K(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTCTTTCAAAAAAAAGGAAAT	0.358											OREG0003827	type=REGULATORY REGION|Gene=LOC486608|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	G|||	2933	0.585663	0.587	0.6052	5008	,	,		14667	0.501		0.5427	False		,,,				2504	0.7014				p.K1637K												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A4911G	12						.	G		2529,1869	498.4+/-364.1	744,1041,414	54.0	64.0	60.0		4911	5.5	1.0	12	dbSNP_120	60	4638,3954	529.1+/-381.5	1240,2158,898	no	coding-synonymous	LRRK2	NM_198578.3		1984,3199,1312	GG,GA,AA		46.0196,42.4966,44.8268		1637/2528	40713873	7167,5823	2199	4296	6495	39000140	SO:0001819	synonymous_variant	120892	exon34			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.4911A>G	12.37:g.40713873A>G		Somatic	895	Capture	SOLID	Phase_I	39000140	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Silent	SNP	ENST00000298910.7	37	CCDS31774.1																																																																																				LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
WNT10B	7480	hgsc.bcm.edu	37	12	49361829	49361829	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:49361829T>C	ENST00000301061.4	-	4	959	c.611A>G	c.(610-612)gAc>gGc	p.D204G	WNT10B_ENST00000403957.1_Intron|WNT10B_ENST00000407467.1_Intron	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	204					bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						CTCTCCAAAGTCCATGTCATG	0.602																																					p.D204G												.	.	0			c.A611G	12						.						58.0	58.0	58.0					12																	49361829		2203	4300	6503	47648096	SO:0001583	missense	7480	exon4			X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.611A>G	12.37:g.49361829T>C	ENSP00000301061:p.Asp204Gly	None		Capture	SOLID	Phase_I	47648096	NM_003394	B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Missense_Mutation	SNP	ENST00000301061.4	37	CCDS8775.1	.	.	.	.	.	.	.	.	.	.	T	10.57	1.388244	0.25118	.	.	ENSG00000169884	ENST00000301061	T	0.75704	-0.96	5.11	5.11	0.69529	.	0.244559	0.42053	D	0.000762	T	0.62282	0.2415	N	0.21373	0.66	0.80722	D	1	B	0.17038	0.02	B	0.23852	0.049	T	0.57659	-0.7773	10	0.26408	T	0.33	.	14.1996	0.65693	0.0:0.0:0.0:1.0	.	204	O00744	WN10B_HUMAN	G	204	ENSP00000301061:D204G	ENSP00000301061:D204G	D	-	2	0	WNT10B	47648096	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.013000	0.40942	2.064000	0.61679	0.459000	0.35465	GAC		WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319864.1	NM_003394	
WNT10B	7480	hgsc.bcm.edu	37	12	49362024	49362024	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:49362024C>T	ENST00000301061.4	-	4	764	c.416G>A	c.(415-417)gGc>gAc	p.G139D	WNT10B_ENST00000403957.1_Missense_Mutation_p.G139D|WNT10B_ENST00000407467.1_Missense_Mutation_p.G139D	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	139					bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						CACCAGCTTGCCCAGGCTGCA	0.607																																					p.G139D												.	.	0			c.G416A	12						.						48.0	44.0	45.0					12																	49362024		2203	4300	6503	47648291	SO:0001583	missense	7480	exon4			X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.416G>A	12.37:g.49362024C>T	ENSP00000301061:p.Gly139Asp	None		Capture	SOLID	Phase_I	47648291	NM_003394	B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Missense_Mutation	SNP	ENST00000301061.4	37	CCDS8775.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.634258	0.87660	.	.	ENSG00000169884	ENST00000301061;ENST00000407467;ENST00000403957	D;D;D	0.82893	-1.66;-1.66;-1.66	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.93485	0.7921	M	0.93720	3.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94986	0.8130	10	0.87932	D	0	.	17.6909	0.88269	0.0:1.0:0.0:0.0	.	139;139	Q4VAJ4;O00744	.;WN10B_HUMAN	D	139	ENSP00000301061:G139D;ENSP00000384691:G139D;ENSP00000385980:G139D	ENSP00000301061:G139D	G	-	2	0	WNT10B	47648291	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.783000	0.85696	2.552000	0.86080	0.561000	0.74099	GGC		WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319864.1	NM_003394	
SMARCC2	6601	hgsc.bcm.edu	37	12	56559392	56559392	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:56559392T>G	ENST00000267064.4	-	26	2935	c.2849A>C	c.(2848-2850)cAc>cCc	p.H950P	SMARCC2_ENST00000347471.4_Missense_Mutation_p.H981P|SMARCC2_ENST00000550164.1_Missense_Mutation_p.H981P|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000394023.3_Missense_Mutation_p.H981P	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	950					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CTGTTGGAAGTGCTGCTGCCG	0.642																																					p.H950P												.	.	0			c.A2849C	12						.						46.0	50.0	49.0					12																	56559392		2202	4300	6502	54845659	SO:0001583	missense	6601	exon26			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.2849A>C	12.37:g.56559392T>G	ENSP00000267064:p.His950Pro	None		Capture	SOLID	Phase_I	54845659	NM_003075	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	37	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	T	15.35	2.807347	0.50421	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.46063	1.12;0.89;0.9;0.88	4.49	4.49	0.54785	.	0.144593	0.43919	D	0.000510	T	0.51415	0.1673	L	0.38175	1.15	0.58432	D	0.999995	D;D;D;D;D	0.69078	0.995;0.997;0.995;0.995;0.997	D;D;D;D;D	0.78314	0.979;0.991;0.979;0.979;0.991	T	0.42999	-0.9418	10	0.28530	T	0.3	-12.3474	13.2491	0.60041	0.0:0.0:0.0:1.0	.	870;981;985;950;981	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	P	981;981;981;950	ENSP00000377591:H981P;ENSP00000449396:H981P;ENSP00000302919:H981P;ENSP00000267064:H950P	ENSP00000267064:H950P	H	-	2	0	SMARCC2	54845659	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.606000	0.54095	2.039000	0.60335	0.529000	0.55759	CAC		SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
SMARCC2	6601	hgsc.bcm.edu	37	12	56575598	56575598	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:56575598C>T	ENST00000267064.4	-	9	816	c.730G>A	c.(730-732)Gac>Aac	p.D244N	SMARCC2_ENST00000347471.4_Missense_Mutation_p.D244N|SMARCC2_ENST00000550164.1_Missense_Mutation_p.D244N|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000394023.3_Missense_Mutation_p.D244N|SMARCC2_ENST00000550859.1_5'UTR	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	244					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GTGTCGGTGTCCAGGATCCAC	0.463																																					p.D244N												.	.	0			c.G730A	12						.						123.0	108.0	113.0					12																	56575598		2203	4300	6503	54861865	SO:0001583	missense	6601	exon9			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.730G>A	12.37:g.56575598C>T	ENSP00000267064:p.Asp244Asn	None		Capture	SOLID	Phase_I	54861865	NM_003075	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	37	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	C	36	5.640377	0.96693	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	4.72	4.72	0.59763	BRCT (1);	0.000000	0.85682	D	0.000000	T	0.81221	0.4777	M	0.84948	2.725	0.58432	D	0.999994	D;D;D;D;D	0.67145	0.993;0.996;0.993;0.993;0.996	D;D;D;D;D	0.77557	0.977;0.99;0.977;0.977;0.99	D	0.84536	0.0636	10	0.87932	D	0	-22.6507	16.9971	0.86370	0.0:1.0:0.0:0.0	.	133;244;249;244;244	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	N	244	ENSP00000377591:D244N;ENSP00000449396:D244N;ENSP00000302919:D244N;ENSP00000267064:D244N	ENSP00000267064:D244N	D	-	1	0	SMARCC2	54861865	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.538000	0.82048	2.620000	0.88729	0.561000	0.74099	GAC		SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
SMARCC2	6601	hgsc.bcm.edu	37	12	56575605	56575605	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:56575605C>T	ENST00000267064.4	-	9	809	c.723G>A	c.(721-723)tgG>tgA	p.W241*	SMARCC2_ENST00000347471.4_Nonsense_Mutation_p.W241*|SMARCC2_ENST00000550164.1_Nonsense_Mutation_p.W241*|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000394023.3_Nonsense_Mutation_p.W241*|SMARCC2_ENST00000550859.1_5'UTR	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	241					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TGTCCAGGATCCACTTTGCAT	0.473																																					p.W241X												.	.	0			c.G723A	12						.						115.0	101.0	106.0					12																	56575605		2203	4300	6503	54861872	SO:0001587	stop_gained	6601	exon9			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.723G>A	12.37:g.56575605C>T	ENSP00000267064:p.Trp241*	None		Capture	SOLID	Phase_I	54861872	NM_003075	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Nonsense_Mutation	SNP	ENST00000267064.4	37	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	C	34	5.313315	0.95655	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	.	.	.	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.8039	16.9971	0.86370	0.0:1.0:0.0:0.0	.	.	.	.	X	241	.	ENSP00000267064:W241X	W	-	3	0	SMARCC2	54861872	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.538000	0.82048	2.620000	0.88729	0.561000	0.74099	TGG		SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
DEPDC4	120863	hgsc.bcm.edu	37	12	100649834	100649834	+	Silent	SNP	G	G	A	rs144177026		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:100649834G>A	ENST00000416321.1	-	4	873	c.871C>T	c.(871-873)Cta>Tta	p.L291L	Y_RNA_ENST00000384063.1_RNA	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	291					intracellular signal transduction (GO:0035556)					NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						TACTCAGGTAGACATAAGCTT	0.323													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18385	0.0		0.0	False		,,,				2504	0.0				p.L291L												.	.	0			c.C871T	12						.	G		1,4405	2.1+/-5.4	0,1,2202	137.0	122.0	127.0		871	3.3	0.1	12	dbSNP_134	127	0,8598		0,0,4299	no	coding-synonymous	DEPDC4	NM_152317.2		0,1,6501	AA,AG,GG		0.0,0.0227,0.0077		291/295	100649834	1,13003	2203	4299	6502	99173965	SO:0001819	synonymous_variant	120863	exon4			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.871C>T	12.37:g.100649834G>A		None		Capture	SOLID	Phase_I	99173965	NM_152317	Q496C8|Q96BW0	Silent	SNP	ENST00000416321.1	37	CCDS9075.1																																																																																				DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408482.1	NM_152317	
DEPDC4	120863	hgsc.bcm.edu	37	12	100649877	100649877	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:100649877G>A	ENST00000416321.1	-	4	830	c.828C>T	c.(826-828)atC>atT	p.I276I	Y_RNA_ENST00000384063.1_RNA	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	276					intracellular signal transduction (GO:0035556)			p.I276I(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						AAGTGTTAGTGATAACAAGAT	0.333																																					p.I276I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C828T	12						.						173.0	153.0	160.0					12																	100649877		2203	4298	6501	99174008	SO:0001819	synonymous_variant	120863	exon4			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.828C>T	12.37:g.100649877G>A		Somatic		Capture	SOLID	Phase_I	99174008	NM_152317	Q496C8|Q96BW0	Silent	SNP	ENST00000416321.1	37	CCDS9075.1	.	.	.	.	.	.	.	.	.	.	g	0.016	-1.525995	0.00959	.	.	ENSG00000166153	ENST00000548313	.	.	.	4.96	-2.66	0.06077	.	.	.	.	.	T	0.29355	0.0731	.	.	.	0.24357	N	0.994892	.	.	.	.	.	.	T	0.26292	-1.0107	4	.	.	.	.	7.1104	0.25386	0.5139:0.0:0.374:0.1121	.	.	.	.	L	87	.	.	S	-	2	0	DEPDC4	99174008	0.947000	0.32204	0.002000	0.10522	0.001000	0.01503	0.034000	0.13776	-1.493000	0.01835	-1.203000	0.01651	TCA		DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408482.1	NM_152317	
DEPDC4	120863	hgsc.bcm.edu	37	12	100649906	100649906	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:100649906G>A	ENST00000416321.1	-	4	801	c.799C>T	c.(799-801)Caa>Taa	p.Q267*	Y_RNA_ENST00000384063.1_RNA	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	267					intracellular signal transduction (GO:0035556)					NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						TTGTTTAGTTGAAGATTTTGT	0.338																																					p.Q267X												.	.	0			c.C799T	12						.						161.0	144.0	150.0					12																	100649906		2203	4296	6499	99174037	SO:0001587	stop_gained	120863	exon4			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.799C>T	12.37:g.100649906G>A	ENSP00000396234:p.Gln267*	None		Capture	SOLID	Phase_I	99174037	NM_152317	Q496C8|Q96BW0	Nonsense_Mutation	SNP	ENST00000416321.1	37	CCDS9075.1	.	.	.	.	.	.	.	.	.	.	G	6.132	0.392665	0.11638	.	.	ENSG00000166153	ENST00000422147;ENST00000378250;ENST00000416321;ENST00000550587;ENST00000549249;ENST00000551642	.	.	.	5.18	3.35	0.38373	.	1.089740	0.07101	U	0.840383	.	.	.	.	.	.	0.47153	A	0.999332	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	9.0121	0.36148	0.1747:0.0:0.8253:0.0	.	.	.	.	X	267;213;267;267;213;260	.	ENSP00000367490:Q267X	Q	-	1	0	DEPDC4	99174037	0.042000	0.20092	0.005000	0.12908	0.084000	0.17831	1.134000	0.31442	0.567000	0.29293	0.514000	0.50259	CAA		DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408482.1	NM_152317	
DEPDC4	120863	hgsc.bcm.edu	37	12	100649927	100649927	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:100649927G>A	ENST00000416321.1	-	4	780	c.778C>T	c.(778-780)Cca>Tca	p.P260S	Y_RNA_ENST00000384063.1_RNA	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	260					intracellular signal transduction (GO:0035556)					NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						GTTTTAACTGGAGGCTCCAAA	0.338																																					p.P260S												.	.	0			c.C778T	12						.						146.0	132.0	137.0					12																	100649927		2203	4298	6501	99174058	SO:0001583	missense	120863	exon4			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.778C>T	12.37:g.100649927G>A	ENSP00000396234:p.Pro260Ser	None		Capture	SOLID	Phase_I	99174058	NM_152317	Q496C8|Q96BW0	Missense_Mutation	SNP	ENST00000416321.1	37	CCDS9075.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502640	0.64298	.	.	ENSG00000166153	ENST00000422147;ENST00000378250;ENST00000416321;ENST00000550587;ENST00000549249;ENST00000551642	T;T;T;T	0.30981	1.51;1.52;1.53;1.51	5.18	4.29	0.51040	.	0.064498	0.64402	U	0.000007	T	0.28200	0.0696	L	0.47716	1.5	0.29648	N	0.844214	P;D;B;B	0.53312	0.787;0.959;0.118;0.044	B;B;B;B	0.43623	0.219;0.425;0.026;0.026	T	0.20773	-1.0265	10	0.52906	T	0.07	.	9.7827	0.40658	0.1693:0.0:0.8307:0.0	.	260;260;206;260	E9PGM3;A4FU15;Q3ZCN8;Q8N2C3	.;.;.;DEPD4_HUMAN	S	260;206;260;260;206;253	ENSP00000396234:P260S;ENSP00000448385:P260S;ENSP00000448338:P206S;ENSP00000449590:P253S	ENSP00000367490:P260S	P	-	1	0	DEPDC4	99174058	1.000000	0.71417	0.530000	0.27963	0.786000	0.44442	2.519000	0.45546	1.172000	0.42781	0.514000	0.50259	CCA		DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408482.1	NM_152317	
DEPDC4	120863	hgsc.bcm.edu	37	12	100649960	100649960	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:100649960G>A	ENST00000416321.1	-	4	747	c.745C>T	c.(745-747)Cac>Tac	p.H249Y	Y_RNA_ENST00000384063.1_RNA	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	249					intracellular signal transduction (GO:0035556)					NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						AATGGAAGGTGAATCAATTGA	0.318																																					p.H249Y												.	.	0			c.C745T	12						.						128.0	116.0	120.0					12																	100649960		2203	4298	6501	99174091	SO:0001583	missense	120863	exon4			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.745C>T	12.37:g.100649960G>A	ENSP00000396234:p.His249Tyr	None		Capture	SOLID	Phase_I	99174091	NM_152317	Q496C8|Q96BW0	Missense_Mutation	SNP	ENST00000416321.1	37	CCDS9075.1	.	.	.	.	.	.	.	.	.	.	G	6.250	0.414245	0.11870	.	.	ENSG00000166153	ENST00000422147;ENST00000378250;ENST00000416321;ENST00000550587;ENST00000549249;ENST00000551642	T;T;T;T	0.32753	1.44;1.49;1.5;1.45	5.1	2.15	0.27550	.	0.298874	0.30528	U	0.009431	T	0.26231	0.0640	L	0.47716	1.5	0.09310	N	1	B;B;B;B	0.21753	0.06;0.06;0.012;0.003	B;B;B;B	0.19946	0.027;0.027;0.004;0.002	T	0.18587	-1.0332	10	0.51188	T	0.08	.	10.8067	0.46522	0.0807:0.5801:0.3391:0.0	.	249;249;195;249	E9PGM3;A4FU15;Q3ZCN8;Q8N2C3	.;.;.;DEPD4_HUMAN	Y	249;195;249;249;195;242	ENSP00000396234:H249Y;ENSP00000448385:H249Y;ENSP00000448338:H195Y;ENSP00000449590:H242Y	ENSP00000367490:H249Y	H	-	1	0	DEPDC4	99174091	0.433000	0.25562	0.001000	0.08648	0.115000	0.19883	0.674000	0.25218	0.122000	0.18314	-0.414000	0.06135	CAC		DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408482.1	NM_152317	
DEPDC4	120863	hgsc.bcm.edu	37	12	100649975	100649975	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:100649975G>A	ENST00000416321.1	-	4	732	c.730C>T	c.(730-732)Ctt>Ttt	p.L244F	Y_RNA_ENST00000384063.1_RNA	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	244					intracellular signal transduction (GO:0035556)					NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						AATTGAAGAAGACATAATAAT	0.299																																					p.L244F												.	.	0			c.C730T	12						.						107.0	99.0	102.0					12																	100649975		2203	4298	6501	99174106	SO:0001583	missense	120863	exon4			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.730C>T	12.37:g.100649975G>A	ENSP00000396234:p.Leu244Phe	None		Capture	SOLID	Phase_I	99174106	NM_152317	Q496C8|Q96BW0	Missense_Mutation	SNP	ENST00000416321.1	37	CCDS9075.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560277	0.27827	.	.	ENSG00000166153	ENST00000422147;ENST00000378250;ENST00000416321;ENST00000550587;ENST00000549249;ENST00000551642	T;T;T;T	0.62788	0.15;0.0;0.42;0.16	5.1	-2.57	0.06248	.	0.084638	0.47852	U	0.000217	T	0.53818	0.1820	L	0.43923	1.385	0.09310	N	1	P;P;P;P	0.50066	0.931;0.931;0.745;0.745	P;P;B;B	0.47402	0.546;0.546;0.224;0.224	T	0.56944	-0.7895	10	0.62326	D	0.03	.	10.4141	0.44311	0.0:0.0832:0.6122:0.3046	.	244;244;190;244	E9PGM3;A4FU15;Q3ZCN8;Q8N2C3	.;.;.;DEPD4_HUMAN	F	244;190;244;244;190;237	ENSP00000396234:L244F;ENSP00000448385:L244F;ENSP00000448338:L190F;ENSP00000449590:L237F	ENSP00000367490:L244F	L	-	1	0	DEPDC4	99174106	0.990000	0.36364	0.001000	0.08648	0.002000	0.02628	2.004000	0.40854	-0.026000	0.13895	-0.578000	0.04140	CTT		DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408482.1	NM_152317	
TMEM132D	121256	hgsc.bcm.edu	37	12	129563262	129563262	+	Silent	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr12:129563262A>G	ENST00000422113.2	-	8	2258	c.1932T>C	c.(1930-1932)tcT>tcC	p.S644S	TMEM132D_ENST00000389441.4_Silent_p.S182S	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	644					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.S644S(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTGACAGAGGAGACAGGATCT	0.577																																					p.S644S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1932C	12						.						131.0	111.0	118.0					12																	129563262		2203	4300	6503	128129215	SO:0001819	synonymous_variant	121256	exon8			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1932T>C	12.37:g.129563262A>G		Somatic		Capture	SOLID	Phase_I	128129215	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	CCDS9266.1																																																																																				TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
OCA2	4948	hgsc.bcm.edu	37	15	28196949	28196949	+	Silent	SNP	A	A	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:28196949A>C	ENST00000354638.3	-	18	2087	c.1932T>G	c.(1930-1932)ccT>ccG	p.P644P	OCA2_ENST00000382996.2_Silent_p.P644P|OCA2_ENST00000353809.5_Silent_p.P620P	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	644					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.P644P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GATGAATGCCAGGGACAAACG	0.443									Oculocutaneous Albinism																												p.P644P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1932G	15						.						166.0	128.0	141.0					15																	28196949		2203	4300	6503	25870544	SO:0001819	synonymous_variant	4948	exon18	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1932T>G	15.37:g.28196949A>C		Somatic		Capture	SOLID	Phase_I	25870544	NM_000275	Q15211|Q15212|Q96EN1|Q9UMI5	Silent	SNP	ENST00000354638.3	37	CCDS10020.1																																																																																				OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275	
FAN1	22909	hgsc.bcm.edu	37	15	31220756	31220756	+	Splice_Site	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:31220756G>T	ENST00000362065.4	+	11	2780	c.2489G>T	c.(2488-2490)gGg>gTg	p.G830V	RP11-540B6.6_ENST00000602886.1_RNA|FAN1_ENST00000568145.1_3'UTR	NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	830					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						CTTGTCTTAGGGATTCATGGC	0.483								Direct reversal of damage																													p.G830V												.	.	0			c.G2489T	15						.						205.0	179.0	188.0					15																	31220756		2202	4300	6502	29008048	SO:0001630	splice_region_variant	22909	exon11				CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.2489-1G>T	15.37:g.31220756G>T		None		Capture	SOLID	Phase_I	29008048	NM_014967	A8K4M2|Q86WU8	Missense_Mutation	SNP	ENST00000362065.4	37	CCDS32186.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.255338	0.80135	.	.	ENSG00000198690	ENST00000362065	T	0.79454	-1.27	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.87220	0.6123	M	0.66506	2.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86533	0.1823	9	.	.	.	.	18.6655	0.91488	0.0:0.0:1.0:0.0	.	830;830	Q9Y2M0;D9MXF4	FAN1_HUMAN;.	V	830	ENSP00000354497:G830V	.	G	+	2	0	FAN1	29008048	1.000000	0.71417	0.998000	0.56505	0.640000	0.38277	9.484000	0.97940	2.501000	0.84356	0.655000	0.94253	GGG		FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430740.1	NM_014967	Missense_Mutation
ATP8B4	79895	hgsc.bcm.edu	37	15	50264961	50264961	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:50264961C>T	ENST00000284509.6	-	13	1202	c.1061G>A	c.(1060-1062)aGt>aAt	p.S354N	ATP8B4_ENST00000559829.1_Missense_Mutation_p.S354N	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	354						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TATAAAATAACTGTGTCCTAG	0.378																																					p.S354N												.	.	0			c.G1061A	15						.						62.0	60.0	61.0					15																	50264961		2196	4295	6491	48052253	SO:0001583	missense	79895	exon13			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1061G>A	15.37:g.50264961C>T	ENSP00000284509:p.Ser354Asn	None		Capture	SOLID	Phase_I	48052253	NM_024837	Q9H727	Missense_Mutation	SNP	ENST00000284509.6	37	CCDS32238.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854623	0.91355	.	.	ENSG00000104043	ENST00000284509	T	0.63255	-0.03	4.99	4.99	0.66335	.	0.092556	0.64402	D	0.000001	D	0.85483	0.5707	H	0.96142	3.775	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.90265	0.4303	10	0.87932	D	0	.	15.7702	0.78162	0.0:1.0:0.0:0.0	.	354	Q8TF62	AT8B4_HUMAN	N	354	ENSP00000284509:S354N	ENSP00000284509:S354N	S	-	2	0	ATP8B4	48052253	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.690000	0.84178	2.308000	0.77769	0.650000	0.86243	AGT		ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837	
CYP19A1	1588	hgsc.bcm.edu	37	15	51510831	51510831	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:51510831A>G	ENST00000396402.1	-	6	803	c.650T>C	c.(649-651)aTc>aCc	p.I217T	CYP19A1_ENST00000260433.2_Missense_Mutation_p.I217T|CYP19A1_ENST00000396404.4_Missense_Mutation_p.I217T|RP11-108K3.1_ENST00000559909.1_lincRNA|CYP19A1_ENST00000559878.1_Missense_Mutation_p.I217T	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	217					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.I217T(1)		endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	ATAACCTTGGATTTTAACCAC	0.378																																					p.I217T	Melanoma(142;1016 1807 39614 48966 51721)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T650C	15						.						67.0	65.0	65.0					15																	51510831		2196	4293	6489	49298123	SO:0001583	missense	1588	exon7			D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.650T>C	15.37:g.51510831A>G	ENSP00000379683:p.Ile217Thr	Somatic		Capture	SOLID	Phase_I	49298123	NM_031226	Q16731|Q3B764|Q58FA0|Q8IYJ7	Missense_Mutation	SNP	ENST00000396402.1	37	CCDS10139.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.214745	0.79352	.	.	ENSG00000137869	ENST00000396402;ENST00000260433;ENST00000396404;ENST00000420301;ENST00000439712	T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.85864	0.5796	M	0.91090	3.175	0.80722	D	1	P	0.50617	0.937	D	0.78314	0.991	D	0.88774	0.3266	10	0.87932	D	0	-30.3607	16.2631	0.82557	1.0:0.0:0.0:0.0	.	217	P11511	CP19A_HUMAN	T	217	ENSP00000379683:I217T;ENSP00000260433:I217T;ENSP00000379685:I217T;ENSP00000390614:I217T	ENSP00000260433:I217T	I	-	2	0	CYP19A1	49298123	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	6.960000	0.76036	2.239000	0.73571	0.528000	0.53228	ATC		CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254669.1		
AQP9	366	hgsc.bcm.edu	37	15	58467169	58467169	+	Silent	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:58467169A>G	ENST00000219919.4	+	4	799	c.429A>G	c.(427-429)gcA>gcG	p.A143A	ALDH1A2_ENST00000558231.1_Intron|AQP9_ENST00000558772.1_Silent_p.A78A|AQP9_ENST00000536493.1_Silent_p.A143A	NM_020980.3	NP_066190.2	O43315	AQP9_HUMAN	aquaporin 9	143					amine transport (GO:0015837)|canalicular bile acid transport (GO:0015722)|carboxylic acid transport (GO:0046942)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|glycerol transport (GO:0015793)|immune response (GO:0006955)|metabolic process (GO:0008152)|polyol transport (GO:0015791)|purine nucleobase transport (GO:0006863)|pyrimidine nucleobase transport (GO:0015855)|pyrimidine-containing compound transmembrane transport (GO:0072531)|response to mercury ion (GO:0046689)|response to organic substance (GO:0010033)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water homeostasis (GO:0030104)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carboxylic acid transmembrane transporter activity (GO:0046943)|glycerol channel activity (GO:0015254)|polyol transmembrane transporter activity (GO:0015166)|porin activity (GO:0015288)|purine nucleobase transmembrane transporter activity (GO:0005345)|pyrimidine nucleobase transmembrane transporter activity (GO:0005350)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.A143A(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)	21				GBM - Glioblastoma multiforme(80;0.16)		GAGAAAATGCAACAGCACACA	0.433																																					p.A143A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A429G	15						.						162.0	144.0	150.0					15																	58467169		2192	4292	6484	56254461	SO:0001819	synonymous_variant	366	exon4			AF016495	CCDS10165.1	15q	2005-09-20			ENSG00000103569	ENSG00000103569		"""Ion channels / Aquaporins"""	643	protein-coding gene	gene with protein product		602914					Standard	NM_020980		Approved	SSC1, HsT17287	uc002aez.2	O43315	OTTHUMG00000132631	ENST00000219919.4:c.429A>G	15.37:g.58467169A>G		Somatic		Capture	SOLID	Phase_I	56254461	NM_020980	Q9NP32	Silent	SNP	ENST00000219919.4	37	CCDS10165.1																																																																																				AQP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255878.2	NM_020980	
CILP	8483	hgsc.bcm.edu	37	15	65496628	65496628	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:65496628G>A	ENST00000261883.4	-	6	1063	c.897C>T	c.(895-897)atC>atT	p.I299I		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	299					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.I299I(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						ACTCTGCCTTGATGGTGGCTG	0.473																																					p.I299I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C897T	15						.						86.0	84.0	85.0					15																	65496628		2201	4299	6500	63283681	SO:0001819	synonymous_variant	8483	exon6			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.897C>T	15.37:g.65496628G>A		Somatic		Capture	SOLID	Phase_I	63283681	NM_003613	B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	ENST00000261883.4	37	CCDS10203.1																																																																																				CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
CILP	8483	hgsc.bcm.edu	37	15	65496664	65496664	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:65496664G>A	ENST00000261883.4	-	6	1027	c.861C>T	c.(859-861)ctC>ctT	p.L287L		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	287					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.L287L(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						TGGGCATTGTGAGTACAATGG	0.517																																					p.L287L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C861T	15						.						108.0	98.0	101.0					15																	65496664		2201	4299	6500	63283717	SO:0001819	synonymous_variant	8483	exon6			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.861C>T	15.37:g.65496664G>A		Somatic		Capture	SOLID	Phase_I	63283717	NM_003613	B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	ENST00000261883.4	37	CCDS10203.1																																																																																				CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
CILP	8483	hgsc.bcm.edu	37	15	65496694	65496694	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:65496694G>A	ENST00000261883.4	-	6	997	c.831C>T	c.(829-831)atC>atT	p.I277I		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	277					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.I277I(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						TGACCTTTGTGATCTTCAGGA	0.522																																					p.I277I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C831T	15						.						126.0	110.0	115.0					15																	65496694		2201	4299	6500	63283747	SO:0001819	synonymous_variant	8483	exon6			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.831C>T	15.37:g.65496694G>A		Somatic		Capture	SOLID	Phase_I	63283747	NM_003613	B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	ENST00000261883.4	37	CCDS10203.1																																																																																				CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
CILP	8483	hgsc.bcm.edu	37	15	65496703	65496703	+	Silent	SNP	G	G	A	rs377719940		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:65496703G>A	ENST00000261883.4	-	6	988	c.822C>T	c.(820-822)atC>atT	p.I274I		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	274					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.I274I(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						TGATCTTCAGGATGCTTTTGC	0.532																																					p.I274I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C822T	15						.						132.0	115.0	121.0					15																	65496703		2201	4299	6500	63283756	SO:0001819	synonymous_variant	8483	exon6			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.822C>T	15.37:g.65496703G>A		Somatic		Capture	SOLID	Phase_I	63283756	NM_003613	B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	ENST00000261883.4	37	CCDS10203.1																																																																																				CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
CILP	8483	hgsc.bcm.edu	37	15	65496853	65496853	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:65496853G>A	ENST00000261883.4	-	6	838	c.672C>T	c.(670-672)ttC>ttT	p.F224F		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	224					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.F224F(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						CATGAAGCATGAAGTCCTGGC	0.597																																					p.F224F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C672T	15						.						71.0	68.0	69.0					15																	65496853		2201	4299	6500	63283906	SO:0001819	synonymous_variant	8483	exon6			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.672C>T	15.37:g.65496853G>A		Somatic		Capture	SOLID	Phase_I	63283906	NM_003613	B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	ENST00000261883.4	37	CCDS10203.1																																																																																				CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
DPP8	54878	hgsc.bcm.edu	37	15	65773927	65773927	+	Silent	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:65773927T>G	ENST00000341861.5	-	9	2672	c.1092A>C	c.(1090-1092)ctA>ctC	p.L364L	DPP8_ENST00000321118.7_Silent_p.L364L|DPP8_ENST00000339244.5_Intron|DPP8_ENST00000321147.6_Silent_p.L364L|DPP8_ENST00000559233.1_Silent_p.L364L|DPP8_ENST00000300141.6_Silent_p.L348L|DPP8_ENST00000358939.4_Silent_p.L348L	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	364					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)	p.L348L(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AAGGTTGAATTAGTTCCTTAT	0.294																																					p.L364L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1092C	15						.						81.0	85.0	84.0					15																	65773927		2201	4298	6499	63560980	SO:0001819	synonymous_variant	54878	exon10			AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.1092A>C	15.37:g.65773927T>G		Somatic		Capture	SOLID	Phase_I	63560980	NM_197960	Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Silent	SNP	ENST00000341861.5	37	CCDS10207.1																																																																																				DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256847.1	NM_017743	
CEMIP	57214	hgsc.bcm.edu	37	15	81229031	81229031	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:81229031A>G	ENST00000394685.3	+	24	3445	c.3026A>G	c.(3025-3027)tAc>tGc	p.Y1009C	KIAA1199_ENST00000356249.5_Missense_Mutation_p.Y1009C|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Missense_Mutation_p.Y1009C			Q8WUJ3	CEMIP_HUMAN		1009					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						ATTCAAGCCTACAAGACCAGT	0.458																																					p.Y1009C												.	.	0			c.A3026G	15						.						136.0	142.0	140.0					15																	81229031		2203	4300	6503	79016086	SO:0001583	missense	57214	exon23																														ENST00000394685.3:c.3026A>G	15.37:g.81229031A>G	ENSP00000378177:p.Tyr1009Cys	None		Capture	SOLID	Phase_I	79016086	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	A	14.92	2.680855	0.47886	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249	T;T;T	0.65916	-0.18;-0.18;-0.18	5.4	4.21	0.49690	.	0.226561	0.37393	N	0.002101	T	0.54822	0.1882	L	0.36672	1.1	0.33514	D	0.591465	D	0.63880	0.993	P	0.50231	0.635	T	0.65014	-0.6271	10	0.40728	T	0.16	-30.2037	5.9421	0.19199	0.7767:0.0:0.0767:0.1467	.	1009	Q8WUJ3	K1199_HUMAN	C	1009	ENSP00000220244:Y1009C;ENSP00000378177:Y1009C;ENSP00000348583:Y1009C	ENSP00000220244:Y1009C	Y	+	2	0	KIAA1199	79016086	0.834000	0.29399	1.000000	0.80357	0.967000	0.64934	0.954000	0.29175	2.045000	0.60652	0.383000	0.25322	TAC		KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
POLG	5428	hgsc.bcm.edu	37	15	89866641	89866641	+	Silent	SNP	A	A	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:89866641A>T	ENST00000268124.5	-	13	2592	c.2259T>A	c.(2257-2259)ccT>ccA	p.P753P	POLG_ENST00000442287.2_Silent_p.P753P	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	753					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)	p.P753P(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			ACACCTTGTGAGGCAGCTTGA	0.572								DNA polymerases (catalytic subunits)																													p.P753P	Colon(73;648 1203 11348 18386 27782)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2259A	15						.						156.0	109.0	125.0					15																	89866641		2200	4299	6499	87667645	SO:0001819	synonymous_variant	5428	exon13			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.2259T>A	15.37:g.89866641A>T		Somatic		Capture	SOLID	Phase_I	87667645	NM_001126131	Q8NFM2|Q92515	Silent	SNP	ENST00000268124.5	37	CCDS10350.1																																																																																				POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
MCTP2	55784	hgsc.bcm.edu	37	15	94910964	94910964	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr15:94910964C>G	ENST00000357742.4	+	10	1432	c.1432C>G	c.(1432-1434)Ctg>Gtg	p.L478V	MCTP2_ENST00000331706.4_Missense_Mutation_p.L66V|MCTP2_ENST00000451018.3_Missense_Mutation_p.L478V|MCTP2_ENST00000557742.1_Missense_Mutation_p.L66V	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	478					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CGTCTCTGATCTGTGTGTCTG	0.547																																					p.L478V												.	.	0			c.C1432G	15						.						73.0	66.0	68.0					15																	94910964		2197	4298	6495	92711968	SO:0001583	missense	55784	exon10			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1432C>G	15.37:g.94910964C>G	ENSP00000350377:p.Leu478Val	None		Capture	SOLID	Phase_I	92711968	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	37	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936431	0.52972	.	.	ENSG00000140563	ENST00000451018;ENST00000331706;ENST00000357742	T;T;T	0.70164	-0.46;-0.23;-0.27	5.59	5.59	0.84812	.	0.132166	0.52532	D	0.000072	T	0.64962	0.2646	M	0.62723	1.935	0.52099	D	0.999942	B;B;B	0.29085	0.199;0.112;0.232	B;B;B	0.31245	0.126;0.057;0.048	T	0.62914	-0.6753	10	0.38643	T	0.18	.	13.841	0.63439	0.0:0.9273:0.0:0.0727	.	478;66;478	Q6DN12-2;Q6DN12-4;Q6DN12	.;.;MCTP2_HUMAN	V	478;66;478	ENSP00000395109:L478V;ENSP00000329646:L66V;ENSP00000350377:L478V	ENSP00000329646:L66V	L	+	1	2	MCTP2	92711968	1.000000	0.71417	0.993000	0.49108	0.951000	0.60555	2.250000	0.43178	2.640000	0.89533	0.650000	0.86243	CTG		MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
DRP2	1821	hgsc.bcm.edu	37	X	100509467	100509467	+	Silent	SNP	C	C	T	rs190486006		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:100509467C>T	ENST00000395209.3	+	18	2558	c.2031C>T	c.(2029-2031)ttC>ttT	p.F677F	DRP2_ENST00000538510.1_Silent_p.F677F|DRP2_ENST00000541709.1_Silent_p.F599F|DRP2_ENST00000402866.1_Silent_p.F677F	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	677					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.F674F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						AGAACAAATTCCGCTCCAAGC	0.502													C|||	1	0.000264901	0.0	0.0014	3775	,	,		13282	0.0		0.0	False		,,,				2504	0.0				p.F677F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2031T	X						.						118.0	84.0	96.0					X																	100509467		2203	4300	6503	100396123	SO:0001819	synonymous_variant	1821	exon18			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2031C>T	X.37:g.100509467C>T		Somatic		Capture	SOLID	Phase_I	100396123	NM_001939	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Silent	SNP	ENST00000395209.3	37	CCDS14480.2																																																																																				DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	
ATG4A	115201	hgsc.bcm.edu	37	X	107381041	107381041	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:107381041G>A	ENST00000372232.3	+	8	714	c.555G>A	c.(553-555)atG>atA	p.M185I	ATG4A_ENST00000372254.3_Missense_Mutation_p.M161I|ATG4A_ENST00000545696.1_Missense_Mutation_p.M108I|ATG4A_ENST00000345734.3_Missense_Mutation_p.M185I	NM_052936.3	NP_443168.2	Q8WYN0	ATG4A_HUMAN	autophagy related 4A, cysteine peptidase	185					autophagy (GO:0006914)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)			endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)	11						TAGAAAAAATGTGCCGTGTCC	0.463																																					p.M185I												.	.	0			c.G555A	X						.						131.0	130.0	130.0					X																	107381041		2203	4300	6503	107267697	SO:0001583	missense	115201	exon8			AJ320508	CCDS14538.1, CCDS14539.1	Xq22.1-q22.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000101844	ENSG00000101844			16489	protein-coding gene	gene with protein product		300663	"""AUT-like 2, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog A (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog A (S. cerevisiae)"""	AUTL2, APG4A		12446702, 12473658	Standard	NM_052936		Approved		uc004enr.3	Q8WYN0	OTTHUMG00000022176	ENST00000372232.3:c.555G>A	X.37:g.107381041G>A	ENSP00000361306:p.Met185Ile	None		Capture	SOLID	Phase_I	107267697	NM_052936	A6NCH2|B2RAZ7|D3DUY0|O95534|Q5JYY9|Q5JYZ0|Q86VE5|Q96KQ0|Q96KQ1	Missense_Mutation	SNP	ENST00000372232.3	37	CCDS14538.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.01|14.01	2.407914|2.407914	0.42715|0.42715	.|.	.|.	ENSG00000101844|ENSG00000101844	ENST00000394892|ENST00000372232;ENST00000345734;ENST00000372254;ENST00000457035;ENST00000545696	.|T;T;T;T	.|0.42513	.|0.97;1.04;0.98;1.02	5.62|5.62	4.76|4.76	0.60689|0.60689	.|.	.|0.095434	.|0.64402	.|D	.|0.000001	T|T	0.29524|0.29524	0.0736|0.0736	N|N	0.13299|0.13299	0.325|0.325	0.34138|0.34138	D|D	0.666014|0.666014	.|B;B;B	.|0.30236	.|0.274;0.002;0.002	.|B;B;B	.|0.33960	.|0.173;0.01;0.017	T|T	0.45190|0.45190	-0.9278|-0.9278	5|10	.|0.72032	.|D	.|0.01	-11.9873|-11.9873	11.9055|11.9055	0.52708|0.52708	0.0826:0.0:0.9174:0.0|0.0826:0.0:0.9174:0.0	.|.	.|108;185;185	.|F5H3G3;Q8WYN0-2;Q8WYN0	.|.;.;ATG4A_HUMAN	Y|I	158|185;185;161;108;108	.|ENSP00000361306:M185I;ENSP00000298131:M185I;ENSP00000361328:M161I;ENSP00000438936:M108I	.|ENSP00000341833:M134I	C|M	+|+	2|3	0|0	ATG4A|ATG4A	107267697|107267697	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	6.289000|6.289000	0.72696|0.72696	1.128000|1.128000	0.42052|0.42052	0.600000|0.600000	0.82982|0.82982	TGT|ATG		ATG4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057860.1	NM_052936	
ZCCHC12	170261	hgsc.bcm.edu	37	X	117959297	117959297	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:117959297G>A	ENST00000310164.2	+	4	597	c.90G>A	c.(88-90)ggG>ggA	p.G30G		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	30					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						GGTCCCTGGGGAGAAGTCTCG	0.567																																					p.G30G												.	.	0			c.G90A	X						.						74.0	66.0	68.0					X																	117959297		2203	4300	6503	117843325	SO:0001819	synonymous_variant	170261	exon4			AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.90G>A	X.37:g.117959297G>A		None		Capture	SOLID	Phase_I	117843325	NM_173798	B3KV48|Q6PID5|Q8N1C1	Silent	SNP	ENST00000310164.2	37	CCDS14574.1																																																																																				ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058014.1	NM_173798	
UPF3B	65109	hgsc.bcm.edu	37	X	118972444	118972444	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:118972444C>T	ENST00000276201.2	-	9	962	c.893G>A	c.(892-894)aGa>aAa	p.R298K	UPF3B_ENST00000345865.2_Missense_Mutation_p.R285K|UPF3B_ENST00000478840.1_5'UTR	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	298	Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R298K(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						GGCTTTTTCTCTTTTGTCCAA	0.363																																					p.R298K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G893A	X						.						199.0	174.0	182.0					X																	118972444		2203	4300	6503	118856472	SO:0001583	missense	65109	exon9			AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.893G>A	X.37:g.118972444C>T	ENSP00000276201:p.Arg298Lys	Somatic		Capture	SOLID	Phase_I	118856472	NM_080632	D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Missense_Mutation	SNP	ENST00000276201.2	37	CCDS14588.1	.	.	.	.	.	.	.	.	.	.	C	5.293	0.239389	0.10023	.	.	ENSG00000125351	ENST00000276201;ENST00000345865	T;T	0.75477	-0.94;-0.88	5.43	5.43	0.79202	.	0.042876	0.85682	D	0.000000	T	0.48892	0.1525	N	0.11756	0.17	0.36267	D	0.854915	B;B	0.23128	0.08;0.029	B;B	0.18561	0.022;0.006	T	0.51865	-0.8651	10	0.02654	T	1	.	7.6803	0.28509	0.0:0.817:0.0:0.183	.	285;298	Q9BZI7-2;Q9BZI7	.;REN3B_HUMAN	K	298;285	ENSP00000276201:R298K;ENSP00000245418:R285K	ENSP00000276201:R298K	R	-	2	0	UPF3B	118856472	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.325000	0.43840	2.275000	0.75901	0.526000	0.51066	AGA		UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1		
KAL1	3730	hgsc.bcm.edu	37	X	8553403	8553403	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:8553403C>T	ENST00000262648.3	-	6	910	c.761G>A	c.(760-762)aGa>aAa	p.R254K		NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	254	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R254K(1)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						TCGGCTGGGTCTTATGTCAGT	0.507																																					p.R254K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G761A	X						.						182.0	127.0	146.0					X																	8553403		2203	4300	6503	8513403	SO:0001583	missense	3730	exon6				CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.761G>A	X.37:g.8553403C>T	ENSP00000262648:p.Arg254Lys	Somatic		Capture	SOLID	Phase_I	8513403	NM_000216	B2RPF8	Missense_Mutation	SNP	ENST00000262648.3	37	CCDS14130.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712423	0.68730	.	.	ENSG00000011201	ENST00000262648	T	0.56611	0.45	3.74	3.74	0.42951	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.057290	0.64402	D	0.000003	T	0.62344	0.2420	L	0.43152	1.355	0.53688	D	0.999978	D	0.67145	0.996	D	0.66602	0.945	T	0.64846	-0.6311	10	0.52906	T	0.07	.	14.1448	0.65344	0.0:1.0:0.0:0.0	.	254	P23352	KALM_HUMAN	K	254	ENSP00000262648:R254K	ENSP00000262648:R254K	R	-	2	0	KAL1	8513403	1.000000	0.71417	0.780000	0.31762	0.345000	0.29048	6.411000	0.73298	1.488000	0.48433	0.594000	0.82650	AGA		KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1	NM_000216	
MAGEB2	4113	hgsc.bcm.edu	37	X	30237131	30237131	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:30237131T>G	ENST00000378988.4	+	2	535	c.434T>G	c.(433-435)tTc>tGc	p.F145C		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	145	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						GGCAAAAGGTTCAGGGAGCAC	0.463																																					p.F145C												.	.	0			c.T434G	X						.						62.0	58.0	60.0					X																	30237131		2202	4300	6502	30147052	SO:0001583	missense	4113	exon2			AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.434T>G	X.37:g.30237131T>G	ENSP00000368273:p.Phe145Cys	None		Capture	SOLID	Phase_I	30147052	NM_002364	O75860	Missense_Mutation	SNP	ENST00000378988.4	37	CCDS14219.1	.	.	.	.	.	.	.	.	.	.	T	10.84	1.465184	0.26335	.	.	ENSG00000099399	ENST00000378988	T	0.04809	3.55	3.27	-5.43	0.02632	.	0.210355	0.42053	D	0.000780	T	0.02688	0.0081	L	0.28504	0.86	0.09310	N	1	B	0.32302	0.363	B	0.31191	0.125	T	0.25606	-1.0127	10	0.56958	D	0.05	.	4.7543	0.13075	0.2791:0.1258:0.0:0.5952	.	145	O15479	MAGB2_HUMAN	C	145	ENSP00000368273:F145C	ENSP00000368273:F145C	F	+	2	0	MAGEB2	30147052	0.000000	0.05858	0.000000	0.03702	0.412000	0.31113	-0.567000	0.05916	-1.268000	0.02439	-0.761000	0.03458	TTC		MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	NM_002364	
FOXR2	139628	hgsc.bcm.edu	37	X	55650445	55650445	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:55650445A>G	ENST00000339140.3	+	1	613	c.301A>G	c.(301-303)Aaa>Gaa	p.K101E		NM_198451.3	NP_940853.1	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	101					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	19						GCCCAGTGGAAAAGAGGATCT	0.537																																					p.K101E												.	.	0			c.A301G	X						.						61.0	56.0	57.0					X																	55650445		2203	4300	6503	55667170	SO:0001583	missense	139628	exon1			BC012934	CCDS35308.1	Xp11	2006-12-15			ENSG00000189299	ENSG00000189299		"""Forkhead boxes"""	30469	protein-coding gene	gene with protein product						15202009, 15202027	Standard	NM_198451		Approved	MGC21658, FOXN6	uc004duo.3	Q6PJQ5	OTTHUMG00000021661	ENST00000339140.3:c.301A>G	X.37:g.55650445A>G	ENSP00000427329:p.Lys101Glu	None		Capture	SOLID	Phase_I	55667170	NM_198451		Missense_Mutation	SNP	ENST00000339140.3	37	CCDS35308.1	.	.	.	.	.	.	.	.	.	.	A	6.171	0.399799	0.11696	.	.	ENSG00000189299	ENST00000339140	D	0.94092	-3.35	3.56	-2.27	0.06846	.	2.589200	0.02339	U	0.074679	D	0.83876	0.5349	N	0.17082	0.46	0.09310	N	1	B	0.17268	0.021	B	0.18561	0.022	T	0.76266	-0.3022	10	0.06757	T	0.87	.	4.2545	0.10710	0.3349:0.2724:0.3927:0.0	.	101	Q6PJQ5	FOXR2_HUMAN	E	101	ENSP00000427329:K101E	ENSP00000427329:K101E	K	+	1	0	FOXR2	55667170	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.192000	0.09587	-0.557000	0.06126	0.486000	0.48141	AAA		FOXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056877.2	NM_198451	
LAS1L	81887	hgsc.bcm.edu	37	X	64754516	64754517	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	CA	CA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:64754516_64754517delCA	ENST00000374811.3	-	1	119_120	c.79_80delTG	c.(79-81)tgcfs	p.C27fs	LAS1L_ENST00000312391.8_Frame_Shift_Del_p.C27fs|LAS1L_ENST00000374807.5_Frame_Shift_Del_p.C27fs|LAS1L_ENST00000374804.5_Frame_Shift_Del_p.C27fs	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	27					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.C27fs*2(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						CCCTTTAACGCACTTTCCGTAC	0.604																																					p.27_27del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.79_80del	X						.																																			64671242	SO:0001589	frameshift_variant	81887	exon1			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.79_80delTG	X.37:g.64754516_64754517delCA	ENSP00000363944:p.Cys27fs	Somatic		Capture	SOLID	Phase_I	64671241	NM_001170650	A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Frame_Shift_Del	DEL	ENST00000374811.3	37	CCDS14381.1																																																																																				LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206	
ZCCHC5	203430	hgsc.bcm.edu	37	X	77912908	77912908	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:77912908C>A	ENST00000321110.1	-	2	1305	c.1010G>T	c.(1009-1011)gGt>gTt	p.G337V		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	337							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.G337V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TGCTACATGACCCTCCCCTTG	0.448																																					p.G337V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1010T	X						.						85.0	70.0	75.0					X																	77912908		2203	4300	6503	77799564	SO:0001583	missense	203430	exon2			AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.1010G>T	X.37:g.77912908C>A	ENSP00000316794:p.Gly337Val	Somatic		Capture	SOLID	Phase_I	77799564	NM_152694	B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	C	2.062	-0.415224	0.04766	.	.	ENSG00000179300	ENST00000321110	T	0.19532	2.14	3.2	1.13	0.20643	.	0.507301	0.13804	U	0.361606	T	0.19565	0.0470	L	0.50333	1.59	0.09310	N	1	P	0.48911	0.917	P	0.46049	0.502	T	0.10520	-1.0626	10	0.40728	T	0.16	.	3.9579	0.09398	0.0:0.4061:0.0:0.5939	.	337	Q8N8U3	ZCHC5_HUMAN	V	337	ENSP00000316794:G337V	ENSP00000316794:G337V	G	-	2	0	ZCCHC5	77799564	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.167000	0.16602	0.133000	0.18654	0.506000	0.49869	GGT		ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694	
SATL1	340562	hgsc.bcm.edu	37	X	84362526	84362526	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:84362526T>G	ENST00000395409.3	-	1	1448	c.888A>C	c.(886-888)gaA>gaC	p.E296D	SATL1_ENST00000332921.5_Missense_Mutation_p.E296D|SATL1_ENST00000509231.1_Missense_Mutation_p.E483D			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	296	Gln-rich.						N-acetyltransferase activity (GO:0008080)	p.E483D(1)		NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						TCGGCCCCGGTTCCCATATGC	0.572																																					p.E483D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1449C	X						.						116.0	94.0	101.0					X																	84362526		2203	4300	6503	84249182	SO:0001583	missense	340562	exon1			BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.888A>C	X.37:g.84362526T>G	ENSP00000378804:p.Glu296Asp	Somatic		Capture	SOLID	Phase_I	84249182	NM_001012980	A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	ENST00000395409.3	37		.	.	.	.	.	.	.	.	.	.	T	14.59	2.579830	0.46006	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.46451	0.87;0.87;0.87	3.48	0.972	0.19704	.	0.845116	0.09648	N	0.773992	T	0.37489	0.1005	L	0.46157	1.445	0.09310	N	1	P;P	0.47302	0.893;0.73	B;B	0.44315	0.446;0.263	T	0.21930	-1.0231	10	0.59425	D	0.04	-6.2099	6.2233	0.20693	0.0:0.2486:0.0:0.7514	.	296;483	Q86VE3;E9PB72	SATL1_HUMAN;.	D	296;296;483	ENSP00000378804:E296D;ENSP00000329115:E296D;ENSP00000425421:E483D	ENSP00000329115:E296D	E	-	3	2	SATL1	84249182	0.020000	0.18652	0.000000	0.03702	0.002000	0.02628	-0.022000	0.12480	-0.008000	0.14320	0.486000	0.48141	GAA		SATL1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_291339	
USP26	83844	hgsc.bcm.edu	37	X	132162109	132162109	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:132162109T>C	ENST00000511190.1	-	6	609	c.140A>G	c.(139-141)tAt>tGt	p.Y47C	USP26_ENST00000406273.1_Missense_Mutation_p.Y47C|USP26_ENST00000370832.1_Missense_Mutation_p.Y47C	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	47					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					AAAAGTGCTATATTTTCCACT	0.333																																					p.Y47C	NSCLC(104;342 1621 36940 47097 52632)											.	.	0			c.A140G	X						.						70.0	69.0	70.0					X																	132162109		2202	4298	6500	131989775	SO:0001583	missense	83844	exon1			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.140A>G	X.37:g.132162109T>C	ENSP00000423390:p.Tyr47Cys	None		Capture	SOLID	Phase_I	131989775	NM_031907	B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	T	0.035	-1.309817	0.01342	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.53423	0.62;0.62;0.62	4.28	-8.57	0.00900	.	3.635410	0.00899	N	0.002327	T	0.29524	0.0736	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23190	-1.0195	10	0.38643	T	0.18	13.9022	5.0276	0.14393	0.2504:0.4812:0.0708:0.1976	.	47	Q9BXU7	UBP26_HUMAN	C	47	ENSP00000359869:Y47C;ENSP00000423390:Y47C;ENSP00000384360:Y47C	ENSP00000359869:Y47C	Y	-	2	0	USP26	131989775	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.550000	0.00434	-5.463000	0.00014	-2.807000	0.00112	TAT		USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907	
DCHS2	54798	hgsc.bcm.edu	37	4	155250701	155250701	+	Missense_Mutation	SNP	G	G	A	rs79295524	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr4:155250701G>A	ENST00000357232.4	-	11	2526	c.2527C>T	c.(2527-2529)Ctc>Ttc	p.L843F	DCHS2_ENST00000339452.1_Missense_Mutation_p.L1298F	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	843					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTTCCAGGGAGACACTGGGGG	0.468																																					p.L843F												.	.	0			c.C2527T	4						.						64.0	61.0	62.0					4																	155250701		2203	4300	6503	155470151	SO:0001583	missense	54798	exon11			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.2527C>T	4.37:g.155250701G>A	ENSP00000349768:p.Leu843Phe	None		Capture	SOLID	Phase_I	155470151	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.985783	0.35036	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.59638	0.48;0.25	5.76	3.06	0.35304	Cadherin-like (1);	0.836965	0.10732	N	0.640520	T	0.60971	0.2310	L	0.43152	1.355	0.80722	D	1	D;D	0.67145	0.996;0.993	P;P	0.57548	0.804;0.823	T	0.50206	-0.8855	10	0.09084	T	0.74	.	13.1764	0.59629	0.0:0.4534:0.4292:0.1174	.	1298;843	E9PC11;Q6V1P9	.;PCD23_HUMAN	F	843;1298;1298	ENSP00000349768:L843F;ENSP00000345062:L1298F	ENSP00000345062:L1298F	L	-	1	0	DCHS2	155470151	0.999000	0.42202	0.868000	0.34077	0.012000	0.07955	1.954000	0.40362	0.430000	0.26230	-0.850000	0.03035	CTC		DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DCHS2	54798	hgsc.bcm.edu	37	4	155254104	155254104	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr4:155254104G>A	ENST00000357232.4	-	9	1758	c.1759C>T	c.(1759-1761)Cat>Tat	p.H587Y	DCHS2_ENST00000507542.1_5'Flank|DCHS2_ENST00000339452.1_Missense_Mutation_p.H1086Y	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	587	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TAGACCAAATGTTCGAAAGTC	0.577																																					p.H587Y												.	.	0			c.C1759T	4						.						89.0	90.0	89.0					4																	155254104		2203	4300	6503	155473554	SO:0001583	missense	54798	exon9			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1759C>T	4.37:g.155254104G>A	ENSP00000349768:p.His587Tyr	None		Capture	SOLID	Phase_I	155473554	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379973	0.24944	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.61040	0.14;0.14	5.43	0.278	0.15673	Cadherin (2);Cadherin-like (1);	0.272866	0.28809	N	0.014061	T	0.34600	0.0903	L	0.40543	1.245	0.80722	D	1	P;P	0.42908	0.793;0.793	B;B	0.34489	0.184;0.171	T	0.46414	-0.9193	10	0.05436	T	0.98	.	9.3645	0.38217	0.0:0.0695:0.4203:0.5102	.	1086;587	E9PC11;Q6V1P9	.;PCD23_HUMAN	Y	587;1086;1086	ENSP00000349768:H587Y;ENSP00000345062:H1086Y	ENSP00000345062:H1086Y	H	-	1	0	DCHS2	155473554	1.000000	0.71417	0.349000	0.25694	0.024000	0.10985	2.300000	0.43620	0.161000	0.19458	0.655000	0.94253	CAT		DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
HAND2	9464	hgsc.bcm.edu	37	4	174450034	174450034	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr4:174450034G>A	ENST00000359562.4	-	1	1346	c.407C>T	c.(406-408)tCc>tTc	p.S136F	HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2-AS1_ENST00000510268.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000509866.1_RNA|HAND2-AS1_ENST00000514431.1_RNA|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000504429.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000502334.1_RNA|HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000502896.1_RNA|HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000507636.1_RNA|HAND2-AS1_ENST00000515741.1_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000515345.1_RNA|HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000504740.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000505817.1_RNA|HAND2_ENST00000505300.1_5'UTR|HAND2-AS1_ENST00000505032.1_RNA|HAND2-AS1_ENST00000512209.2_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000503309.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000508887.1_RNA|HAND2-AS1_ENST00000505621.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2	136	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.S136F(1)		endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CTTGATTTTGGAGAGTTTGGT	0.627																																					p.S136F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C407T	4						.						171.0	161.0	164.0					4																	174450034		2203	4300	6503	174686609	SO:0001583	missense	9464	exon1			AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.407C>T	4.37:g.174450034G>A	ENSP00000352565:p.Ser136Phe	Somatic		Capture	SOLID	Phase_I	174686609	NM_021973	B6ECG9|O95300|O95301|P97833|Q494T1	Missense_Mutation	SNP	ENST00000359562.4	37	CCDS3819.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665065	0.67700	.	.	ENSG00000164107	ENST00000359562;ENST00000393686;ENST00000535864	D	0.98937	-5.25	4.63	4.63	0.57726	Helix-loop-helix DNA-binding (5);	0.057435	0.64402	D	0.000001	D	0.99462	0.9809	H	0.97103	3.94	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98145	1.0438	10	0.87932	D	0	-24.7867	17.6856	0.88255	0.0:0.0:1.0:0.0	.	136;136	B6ECG9;P61296	.;HAND2_HUMAN	F	136;105;84	ENSP00000352565:S136F	ENSP00000352565:S136F	S	-	2	0	HAND2	174686609	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.666000	0.83877	2.398000	0.81561	0.561000	0.74099	TCC		HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362241.3		
HAND2	9464	hgsc.bcm.edu	37	4	174450036	174450036	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr4:174450036G>A	ENST00000359562.4	-	1	1344	c.405C>T	c.(403-405)ctC>ctT	p.L135L	HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2-AS1_ENST00000510268.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000509866.1_RNA|HAND2-AS1_ENST00000514431.1_RNA|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000504429.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000502334.1_RNA|HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000502896.1_RNA|HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000507636.1_RNA|HAND2-AS1_ENST00000515741.1_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000515345.1_RNA|HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000504740.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000505817.1_RNA|HAND2_ENST00000505300.1_5'UTR|HAND2-AS1_ENST00000505032.1_RNA|HAND2-AS1_ENST00000512209.2_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000503309.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000508887.1_RNA|HAND2-AS1_ENST00000505621.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2	135	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.L135L(1)		endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		TGATTTTGGAGAGTTTGGTGT	0.632																																					p.L135L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C405T	4						.						170.0	160.0	164.0					4																	174450036		2203	4300	6503	174686611	SO:0001819	synonymous_variant	9464	exon1			AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.405C>T	4.37:g.174450036G>A		Somatic		Capture	SOLID	Phase_I	174686611	NM_021973	B6ECG9|O95300|O95301|P97833|Q494T1	Silent	SNP	ENST00000359562.4	37	CCDS3819.1																																																																																				HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362241.3		
KLB	152831	hgsc.bcm.edu	37	4	39450088	39450088	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr4:39450088A>G	ENST00000257408.4	+	5	3014	c.2917A>G	c.(2917-2919)Agt>Ggt	p.S973G		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	973					carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						TGAGAACAGTAGTTCTAGATG	0.408																																					p.S973G												.	.	0			c.A2917G	4						.						90.0	89.0	89.0					4																	39450088		2203	4300	6503	39126483	SO:0001583	missense	152831	exon5			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2917A>G	4.37:g.39450088A>G	ENSP00000257408:p.Ser973Gly	None		Capture	SOLID	Phase_I	39126483	NM_175737	Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	37	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	A	1.622	-0.521144	0.04171	.	.	ENSG00000134962	ENST00000257408	T	0.27402	1.67	5.25	-0.319	0.12725	.	1.139040	0.06077	N	0.661086	T	0.18257	0.0438	L	0.27053	0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27365	-1.0076	10	0.15066	T	0.55	2.0E-4	4.6516	0.12598	0.3648:0.3232:0.312:0.0	.	964;973	B7ZL50;Q86Z14	.;KLOTB_HUMAN	G	973	ENSP00000257408:S973G	ENSP00000257408:S973G	S	+	1	0	KLB	39126483	0.003000	0.15002	0.000000	0.03702	0.368000	0.29767	0.175000	0.16762	-0.167000	0.10871	0.260000	0.18958	AGT		KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
SCFD2	152579	hgsc.bcm.edu	37	4	54231295	54231295	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr4:54231295C>T	ENST00000401642.3	-	1	947	c.814G>A	c.(814-816)Gtg>Atg	p.V272M	SCFD2_ENST00000388940.4_Missense_Mutation_p.V272M	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	272					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			GTTCTGTCCACAAAAACCACT	0.473																																					p.V272M												.	.	0			c.G814A	4						.						117.0	114.0	115.0					4																	54231295		2203	4300	6503	53926052	SO:0001583	missense	152579	exon1			AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.814G>A	4.37:g.54231295C>T	ENSP00000384182:p.Val272Met	None		Capture	SOLID	Phase_I	53926052	NM_152540	Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	ENST00000401642.3	37	CCDS33984.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293532	0.23564	.	.	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.80994	-1.44;-1.44	5.03	3.29	0.37713	.	0.132984	0.50627	N	0.000105	T	0.79964	0.4537	M	0.74881	2.28	0.37993	D	0.93396	B;B	0.28350	0.208;0.132	B;B	0.34301	0.179;0.087	T	0.76911	-0.2784	10	0.56958	D	0.05	.	9.5656	0.39396	0.0:0.752:0.0:0.2479	.	272;272	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	M	272	ENSP00000384182:V272M;ENSP00000373592:V272M	ENSP00000373592:V272M	V	-	1	0	SCFD2	53926052	1.000000	0.71417	1.000000	0.80357	0.001000	0.01503	1.201000	0.32259	0.324000	0.23333	-1.598000	0.00824	GTG		SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540	
KIT	3815	hgsc.bcm.edu	37	4	55599316	55599316	+	Silent	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr4:55599316C>T	ENST00000288135.5	+	17	2539	c.2442C>T	c.(2440-2442)gcC>gcT	p.A814A		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	814	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A814A(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTGGTCTAGCCAGAGACATCA	0.398		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.A810A		yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2430T	4						.						139.0	141.0	140.0					4																	55599316		2203	4300	6503	55294073	SO:0001819	synonymous_variant	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2442C>T	4.37:g.55599316C>T		Somatic		Capture	SOLID	Phase_I	55294073	NM_001093772	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Silent	SNP	ENST00000288135.5	37	CCDS3496.1																																																																																				KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
ANK2	287	hgsc.bcm.edu	37	4	114278110	114278111	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	CC	CC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr4:114278110_114278111delCC	ENST00000357077.4	+	38	8389_8390	c.8336_8337delCC	c.(8335-8337)gccfs	p.A2779fs	ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Frame_Shift_Del_p.A2746fs	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2779					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.A2779fs*4(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GGATGTGAGGCCATGAGTCCTA	0.470																																					p.2779_2779del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.8336_8337del	4						.																																			114497560	SO:0001589	frameshift_variant	287	exon38			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.8336_8337delCC	4.37:g.114278110_114278111delCC	ENSP00000349588:p.Ala2779fs	Somatic		Capture	SOLID	Phase_I	114497559	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Frame_Shift_Del	DEL	ENST00000357077.4	37	CCDS3702.1																																																																																				ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
DCHS2	54798	hgsc.bcm.edu	37	4	155253904	155253905	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	GG	GG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr4:155253904_155253905delGG	ENST00000357232.4	-	9	1957_1958	c.1958_1959delCC	c.(1957-1959)tccfs	p.S653fs	DCHS2_ENST00000507542.1_5'Flank|DCHS2_ENST00000339452.1_Frame_Shift_Del_p.S1152fs	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	653	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S653fs*5(1)|p.S1152fs*5(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATGTTTGGGTGGATTCATAGTC	0.470																																					p.653_653del												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.1958_1959del	4						.																																			155473355	SO:0001589	frameshift_variant	54798	exon9			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1958_1959delCC	4.37:g.155253904_155253905delGG	ENSP00000349768:p.Ser653fs	Somatic		Capture	SOLID	Phase_I	155473354	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Frame_Shift_Del	DEL	ENST00000357232.4	37	CCDS3785.1																																																																																				DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
HAND2	9464	hgsc.bcm.edu	37	4	174450096	174450096	+	Silent	SNP	G	G	A	rs144784937		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr4:174450096G>A	ENST00000359562.4	-	1	1284	c.345C>T	c.(343-345)atC>atT	p.I115I	HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2-AS1_ENST00000510268.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000509866.1_RNA|HAND2-AS1_ENST00000514431.1_RNA|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000504429.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000502334.1_RNA|HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000502896.1_RNA|HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000507636.1_RNA|HAND2-AS1_ENST00000515741.1_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000515345.1_RNA|HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000504740.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000505817.1_RNA|HAND2_ENST00000505300.1_5'UTR|HAND2-AS1_ENST00000505032.1_RNA|HAND2-AS1_ENST00000512209.2_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000503309.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000508887.1_RNA|HAND2-AS1_ENST00000505621.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2	115	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.I115I(1)		endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		AGGCGCTGTTGATGCTCTGAG	0.711																																					p.I115I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C345T	4						.						127.0	121.0	123.0					4																	174450096		2203	4300	6503	174686671	SO:0001819	synonymous_variant	9464	exon1			AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.345C>T	4.37:g.174450096G>A		Somatic		Capture	SOLID	Phase_I	174686671	NM_021973	B6ECG9|O95300|O95301|P97833|Q494T1	Silent	SNP	ENST00000359562.4	37	CCDS3819.1																																																																																				HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362241.3		
KLF11	8462	hgsc.bcm.edu	37	2	10186541	10186541	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:10186541A>C	ENST00000305883.1	+	2	469	c.307A>C	c.(307-309)Act>Cct	p.T103P	KLF11_ENST00000540845.1_Missense_Mutation_p.T86P|KLF11_ENST00000535335.1_Missense_Mutation_p.T86P	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	103					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		TTCTTTATCGACTCTGGTAAG	0.493																																					p.T86P	Melanoma(56;431 1507 23687 50789)											.	.	0			c.A256C	2						.						85.0	79.0	81.0					2																	10186541		2203	4300	6503	10103992	SO:0001583	missense	8462	exon2			AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.307A>C	2.37:g.10186541A>C	ENSP00000307023:p.Thr103Pro	None		Capture	SOLID	Phase_I	10103992	NM_001177716	B4DZE7|Q9EPF4	Missense_Mutation	SNP	ENST00000305883.1	37	CCDS1668.1	.	.	.	.	.	.	.	.	.	.	A	19.52	3.843582	0.71488	.	.	ENSG00000172059	ENST00000401510;ENST00000305883;ENST00000448523;ENST00000540845;ENST00000440320;ENST00000535335	T;T;T;T;T;T	0.66099	-0.17;2.47;-0.19;2.46;-0.16;2.46	5.4	5.4	0.78164	.	0.157344	0.56097	D	0.000021	T	0.77658	0.4163	M	0.72894	2.215	0.40804	D	0.983362	D	0.71674	0.998	D	0.71656	0.974	T	0.81180	-0.1050	10	0.72032	D	0.01	.	15.4155	0.74962	1.0:0.0:0.0:0.0	.	103	O14901	KLF11_HUMAN	P	86;103;86;86;86;86	ENSP00000386058:T86P;ENSP00000307023:T103P;ENSP00000387866:T86P;ENSP00000444690:T86P;ENSP00000388263:T86P;ENSP00000442722:T86P	ENSP00000307023:T103P	T	+	1	0	KLF11	10103992	0.989000	0.36119	0.448000	0.26945	0.873000	0.50193	3.415000	0.52700	2.038000	0.60285	0.379000	0.24179	ACT		KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000239202.3	NM_003597	
KLF11	8462	hgsc.bcm.edu	37	2	10186545	10186545	+	Splice_Site	SNP	T	T	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:10186545T>A	ENST00000305883.1	+	2	473	c.311T>A	c.(310-312)cTg>cAg	p.L104Q	KLF11_ENST00000540845.1_Splice_Site_p.L87Q|KLF11_ENST00000535335.1_Splice_Site_p.L87Q	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	104					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.L104Q(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		TTATCGACTCTGGTAAGAGGA	0.502																																					p.L87Q	Melanoma(56;431 1507 23687 50789)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T260A	2						.						82.0	76.0	78.0					2																	10186545		2203	4300	6503	10103996	SO:0001630	splice_region_variant	8462	exon2			AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.312+1T>A	2.37:g.10186545T>A		Somatic		Capture	SOLID	Phase_I	10103996	NM_001177716	B4DZE7|Q9EPF4	Missense_Mutation	SNP	ENST00000305883.1	37	CCDS1668.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.579376	0.86645	.	.	ENSG00000172059	ENST00000401510;ENST00000305883;ENST00000448523;ENST00000540845;ENST00000440320;ENST00000535335	T;T;T;T;T;T	0.75154	-0.86;1.77;-0.91;1.78;-0.84;1.78	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.86180	0.5871	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88115	0.2828	10	0.87932	D	0	.	15.4155	0.74962	0.0:0.0:0.0:1.0	.	104	O14901	KLF11_HUMAN	Q	87;104;87;87;87;87	ENSP00000386058:L87Q;ENSP00000307023:L104Q;ENSP00000387866:L87Q;ENSP00000444690:L87Q;ENSP00000388263:L87Q;ENSP00000442722:L87Q	ENSP00000307023:L104Q	L	+	2	0	KLF11	10103996	1.000000	0.71417	0.994000	0.49952	0.901000	0.52897	7.593000	0.82686	2.038000	0.60285	0.379000	0.24179	CTG		KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000239202.3	NM_003597	Missense_Mutation
IL1R2	7850	hgsc.bcm.edu	37	2	102642616	102642616	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:102642616A>T	ENST00000332549.3	+	8	1160	c.931A>T	c.(931-933)Att>Ttt	p.I311F	IL1R2_ENST00000393414.2_Missense_Mutation_p.I311F|IL1R2_ENST00000485335.1_3'UTR	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	311	Ig-like C2-type 3.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.I311F(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						AGTGCCATTGATTTTTGATCC	0.358																																					p.I311F	Pancreas(106;189 1628 2302 5133 12295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A931T	2						.						129.0	125.0	126.0					2																	102642616		2203	4300	6503	102009048	SO:0001583	missense	7850	exon8			X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.931A>T	2.37:g.102642616A>T	ENSP00000330959:p.Ile311Phe	Somatic		Capture	SOLID	Phase_I	102009048	NM_004633	D3DVJ5|Q6LCE6|Q9UE68	Missense_Mutation	SNP	ENST00000332549.3	37	CCDS2054.1	.	.	.	.	.	.	.	.	.	.	A	18.96	3.733531	0.69189	.	.	ENSG00000115590	ENST00000332549;ENST00000393414	T;T	0.20738	2.05;2.05	5.95	0.486	0.16836	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.282439	0.34460	N	0.003957	T	0.30916	0.0780	M	0.63843	1.955	0.80722	D	1	D	0.69078	0.997	P	0.62649	0.905	T	0.06427	-1.0827	10	0.30854	T	0.27	.	5.0998	0.14753	0.6045:0.1447:0.2508:0.0	.	311	P27930	IL1R2_HUMAN	F	311	ENSP00000330959:I311F;ENSP00000377066:I311F	ENSP00000330959:I311F	I	+	1	0	IL1R2	102009048	1.000000	0.71417	0.926000	0.36857	0.958000	0.62258	0.623000	0.24447	0.076000	0.16826	0.533000	0.62120	ATT		IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253191.1	NM_004633	
STAM2	10254	hgsc.bcm.edu	37	2	152989990	152989990	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:152989990C>T	ENST00000263904.4	-	9	1157	c.808G>A	c.(808-810)Gac>Aac	p.D270N		NM_005843.4	NP_005834.4	O75886	STAM2_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	270					endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(3)|large_intestine(4)|lung(8)|ovary(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.22)		TTCAATTTGTCCACAGCCGCT	0.333																																					p.D270N												.	.	0			c.G808A	2						.						80.0	88.0	85.0					2																	152989990		2203	4300	6503	152698236	SO:0001583	missense	10254	exon9			AF042274	CCDS2196.1	2q23.3	2009-04-29			ENSG00000115145	ENSG00000115145			11358	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	606244				10899310, 10993906	Standard	NM_005843		Approved	Hbp	uc002tyc.4	O75886	OTTHUMG00000131885	ENST00000263904.4:c.808G>A	2.37:g.152989990C>T	ENSP00000263904:p.Asp270Asn	None		Capture	SOLID	Phase_I	152698236	NM_005843	A8K8A0|D3DPA1|Q7LDQ0|Q9UF58	Missense_Mutation	SNP	ENST00000263904.4	37	CCDS2196.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.173926	0.57692	.	.	ENSG00000115145	ENST00000263904	T	0.17854	2.25	5.79	5.79	0.91817	Src homology-3 domain (1);	0.527792	0.19976	N	0.101870	T	0.17704	0.0425	L	0.37750	1.13	0.80722	D	1	B;B	0.18610	0.009;0.029	B;B	0.15484	0.013;0.01	T	0.05835	-1.0861	10	0.25106	T	0.35	-12.5844	20.024	0.97514	0.0:1.0:0.0:0.0	.	270;270	O75886-2;O75886	.;STAM2_HUMAN	N	270	ENSP00000263904:D270N	ENSP00000263904:D270N	D	-	1	0	STAM2	152698236	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.929000	0.63455	2.718000	0.92993	0.655000	0.94253	GAC		STAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254835.2	NM_005843	
GPD2	2820	hgsc.bcm.edu	37	2	157367344	157367344	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:157367344C>T	ENST00000310454.6	+	4	683	c.311C>T	c.(310-312)tCa>tTa	p.S104L	GPD2_ENST00000540309.1_Missense_Mutation_p.S104L|GPD2_ENST00000409674.1_Missense_Mutation_p.S104L|GPD2_ENST00000409125.4_Intron|GPD2_ENST00000438166.2_Missense_Mutation_p.S104L	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	104					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						GATGATTTCTCATCAGGGACC	0.373																																					p.S104L												.	.	0			c.C311T	2						.						134.0	130.0	132.0					2																	157367344		2203	4300	6503	157075590	SO:0001583	missense	2820	exon4				CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.311C>T	2.37:g.157367344C>T	ENSP00000308610:p.Ser104Leu	None		Capture	SOLID	Phase_I	157075590	NM_001083112	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Missense_Mutation	SNP	ENST00000310454.6	37	CCDS2202.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.481380	0.84747	.	.	ENSG00000115159	ENST00000415049;ENST00000310454;ENST00000438166;ENST00000540309;ENST00000409674	D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53	5.74	5.74	0.90152	FAD dependent oxidoreductase (1);FAD-dependent glycerol-3-phosphate dehydrogenase (1);	0.057354	0.64402	D	0.000001	D	0.91095	0.7197	M	0.92367	3.3	0.80722	D	1	B	0.24258	0.1	P	0.45119	0.47	D	0.89902	0.4045	10	0.87932	D	0	.	19.9004	0.96983	0.0:1.0:0.0:0.0	.	104	P43304	GPDM_HUMAN	L	104	ENSP00000412621:S104L;ENSP00000308610:S104L;ENSP00000409708:S104L;ENSP00000440892:S104L;ENSP00000386425:S104L	ENSP00000308610:S104L	S	+	2	0	GPD2	157075590	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.451000	0.80668	2.709000	0.92574	0.650000	0.86243	TCA		GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254910.3		
DPP4	1803	hgsc.bcm.edu	37	2	162873305	162873305	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:162873305G>A	ENST00000360534.3	-	18	2100	c.1540C>T	c.(1540-1542)Ctg>Ttg	p.L514L	DPP4_ENST00000491591.1_5'UTR	NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	514					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	ATGAAGTCCAGTTTTTTGGAG	0.373																																					p.L514L												.	.	0			c.C1540T	2						.						87.0	90.0	89.0					2																	162873305		2203	4300	6503	162581551	SO:0001819	synonymous_variant	1803	exon18			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1540C>T	2.37:g.162873305G>A		None		Capture	SOLID	Phase_I	162581551	NM_001935	Q53TN1	Silent	SNP	ENST00000360534.3	37	CCDS2216.1																																																																																				DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2		
ABCG5	64240	hgsc.bcm.edu	37	2	44051053	44051053	+	Splice_Site	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:44051053C>A	ENST00000260645.1	-	9	1462	c.1323G>T	c.(1321-1323)ctG>ctT	p.L441L	ABCG5_ENST00000405322.1_Splice_Site_p.L270L|ABCG5_ENST00000543989.1_Splice_Site_p.L46L	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	441	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)	p.L441L(1)		breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	GGCACTTACACAGATTCACAG	0.507																																					p.L441L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1323T	2						.						74.0	59.0	64.0					2																	44051053		2203	4300	6503	43904557	SO:0001630	splice_region_variant	64240	exon9			T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1324+1G>T	2.37:g.44051053C>A		Somatic		Capture	SOLID	Phase_I	43904557	NM_022436	Q2T9G2|Q96QZ2|Q96QZ3	Silent	SNP	ENST00000260645.1	37	CCDS1814.1																																																																																				ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436	Silent
TTC7A	57217	hgsc.bcm.edu	37	2	47277165	47277165	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:47277165A>G	ENST00000319190.5	+	17	2365	c.1997A>G	c.(1996-1998)gAt>gGt	p.D666G	TTC7A_ENST00000409245.1_Missense_Mutation_p.D632G|TTC7A_ENST00000394850.2_Missense_Mutation_p.D690G|TTC7A_ENST00000263737.6_Missense_Mutation_p.D312G	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	666					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)					breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			ACTTTGCCTGATGCCCATGAT	0.567																																					p.D666G												.	.	0			c.A1997G	2						.						94.0	81.0	85.0					2																	47277165		2203	4300	6503	47130669	SO:0001583	missense	57217	exon17			AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.1997A>G	2.37:g.47277165A>G	ENSP00000316699:p.Asp666Gly	None		Capture	SOLID	Phase_I	47130669	NM_020458	Q6PIX4|Q8ND67|Q9BUS3	Missense_Mutation	SNP	ENST00000319190.5	37	CCDS33193.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.346554	0.82022	.	.	ENSG00000068724	ENST00000409245;ENST00000319190;ENST00000394850;ENST00000263737;ENST00000434093	T;T;T;T	0.36157	1.62;1.61;1.43;1.27	5.01	5.01	0.66863	.	0.048581	0.85682	D	0.000000	T	0.55689	0.1936	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.974;0.993;0.991;0.996	D;P;P;P;P	0.83275	0.996;0.816;0.878;0.838;0.89	T	0.57780	-0.7752	10	0.59425	D	0.04	-21.2528	12.3493	0.55139	1.0:0.0:0.0:0.0	.	690;632;666;494;632	Q2T9J9;B3KPK7;Q9ULT0;Q6P0M3;G5E9G4	.;.;TTC7A_HUMAN;.;.	G	632;666;690;312;493	ENSP00000386307:D632G;ENSP00000316699:D666G;ENSP00000378320:D690G;ENSP00000263737:D312G	ENSP00000263737:D312G	D	+	2	0	TTC7A	47130669	1.000000	0.71417	0.426000	0.26672	0.901000	0.52897	4.935000	0.63498	2.107000	0.64212	0.533000	0.62120	GAT		TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329667.2	XM_372927	
NFU1	27247	hgsc.bcm.edu	37	2	69659037	69659037	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:69659037G>A	ENST00000410022.2	-	2	368	c.163C>T	c.(163-165)Cca>Tca	p.P55S	NFU1_ENST00000394305.1_5'UTR|NFU1_ENST00000471185.1_5'UTR|NFU1_ENST00000303698.3_Missense_Mutation_p.P31S	NM_001002755.2	NP_001002755.1	Q9UMS0	NFU1_HUMAN	NFU1 iron-sulfur cluster scaffold	55					iron-sulfur cluster assembly (GO:0016226)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron ion binding (GO:0005506)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	7						ATTTTACCTGGGTGATAAAAG	0.368																																					p.P55S												.	.	0			c.C163T	2						.						99.0	96.0	97.0					2																	69659037		2203	4300	6503	69512541	SO:0001583	missense	27247	exon2			AJ132584	CCDS33217.1, CCDS42694.1, CCDS46315.1	2p15-p13	2014-07-03	2014-07-03	2006-10-24	ENSG00000169599	ENSG00000169599			16287	protein-coding gene	gene with protein product		608100	"""HIRA interacting protein 5"", ""NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)"""	HIRIP5		11342215, 12886008	Standard	NR_045631		Approved	CGI-33, NifU, NIFUC	uc002sfk.3	Q9UMS0	OTTHUMG00000152668	ENST00000410022.2:c.163C>T	2.37:g.69659037G>A	ENSP00000387219:p.Pro55Ser	None		Capture	SOLID	Phase_I	69512541	NM_001002755	B4DUL9|Q53QE5|Q6VNZ8|Q7Z5B1|Q7Z5B2|Q9Y322	Missense_Mutation	SNP	ENST00000410022.2	37	CCDS33217.1	.	.	.	.	.	.	.	.	.	.	G	0.049	-1.257202	0.01457	.	.	ENSG00000169599	ENST00000410022;ENST00000303698	T;T	0.61980	0.06;0.06	5.1	1.44	0.22558	.	0.461149	0.24433	N	0.038569	T	0.35885	0.0947	N	0.14661	0.345	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.002	T	0.11616	-1.0580	10	0.07644	T	0.81	.	7.9365	0.29933	0.0:0.079:0.1444:0.7766	.	31;55	Q9UMS0-3;Q9UMS0	.;NFU1_HUMAN	S	55;31	ENSP00000387219:P55S;ENSP00000306965:P31S	ENSP00000306965:P31S	P	-	1	0	NFU1	69512541	0.550000	0.26489	0.568000	0.28447	0.013000	0.08279	0.035000	0.13797	0.158000	0.19367	-1.115000	0.02055	CCA		NFU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327279.3	NM_015700	
C2orf42	54980	hgsc.bcm.edu	37	2	70396771	70396771	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:70396771C>G	ENST00000264434.2	-	6	1441	c.1062G>C	c.(1060-1062)gaG>gaC	p.E354D	C2orf42_ENST00000420306.1_Missense_Mutation_p.E354D	NM_017880.1	NP_060350.1	Q9NWW7	CB042_HUMAN	chromosome 2 open reading frame 42	354										endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	12						TCACTTGTGCCTCATCTAACA	0.388																																					p.E354D												.	.	0			c.G1062C	2						.						105.0	90.0	95.0					2																	70396771		2203	4300	6503	70250275	SO:0001583	missense	54980	exon6			AK000565	CCDS1899.1	2p14	2011-03-08			ENSG00000115998	ENSG00000115998			26056	protein-coding gene	gene with protein product						12477932	Standard	XM_005264389		Approved	FLJ20558	uc002sgh.3	Q9NWW7	OTTHUMG00000129642	ENST00000264434.2:c.1062G>C	2.37:g.70396771C>G	ENSP00000264434:p.Glu354Asp	None		Capture	SOLID	Phase_I	70250275	NM_017880	D6W5G3|Q9H629	Missense_Mutation	SNP	ENST00000264434.2	37	CCDS1899.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.212336	0.39102	.	.	ENSG00000115998	ENST00000264434;ENST00000420306	T;T	0.52057	0.68;0.68	5.09	4.14	0.48551	.	0.000000	0.85682	D	0.000000	T	0.56499	0.1989	L	0.44542	1.39	0.36618	D	0.875614	D	0.61697	0.99	D	0.70935	0.971	T	0.56481	-0.7972	10	0.28530	T	0.3	-21.7507	12.5646	0.56301	0.0:0.9074:0.0:0.0926	.	354	Q9NWW7	CB042_HUMAN	D	354	ENSP00000264434:E354D;ENSP00000404515:E354D	ENSP00000264434:E354D	E	-	3	2	C2orf42	70250275	0.994000	0.37717	1.000000	0.80357	0.986000	0.74619	1.691000	0.37721	2.648000	0.89879	0.650000	0.86243	GAG		C2orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251840.1	NM_017880	
RAB11FIP5	26056	hgsc.bcm.edu	37	2	73316429	73316429	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:73316429T>C	ENST00000258098.6	-	2	686	c.446A>G	c.(445-447)cAc>cGc	p.H149R	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	149					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						TGGCTTGGAGTGCAGCTTGTA	0.607																																					p.H149R												.	.	0			c.A446G	2						.						228.0	214.0	219.0					2																	73316429		2203	4300	6503	73169937	SO:0001583	missense	26056	exon2			AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.446A>G	2.37:g.73316429T>C	ENSP00000258098:p.His149Arg	None		Capture	SOLID	Phase_I	73169937	NM_015470	O94939|Q9P0M1	Missense_Mutation	SNP	ENST00000258098.6	37	CCDS1923.1	.	.	.	.	.	.	.	.	.	.	T	12.38	1.921673	0.33908	.	.	ENSG00000135631	ENST00000258098	T	0.70399	-0.48	4.6	4.6	0.57074	C2 calcium/lipid-binding domain, CaLB (1);	0.190297	0.44688	D	0.000429	T	0.46268	0.1384	N	0.12182	0.205	0.46954	D	0.999266	B;B	0.33549	0.126;0.417	B;B	0.28553	0.015;0.091	T	0.44620	-0.9316	10	0.25106	T	0.35	-18.9426	8.0349	0.30486	0.0:0.0928:0.0:0.9072	.	149;149	Q9BXF6;Q2Z1P3	RFIP5_HUMAN;.	R	149	ENSP00000258098:H149R	ENSP00000258098:H149R	H	-	2	0	RAB11FIP5	73169937	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.313000	0.51935	2.077000	0.62373	0.459000	0.35465	CAC		RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251995.1	NM_015470	
PLGLB1	5343	hgsc.bcm.edu	37	2	87244699	87244699	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:87244699T>C	ENST00000355705.3	-	2	230	c.162A>G	c.(160-162)gaA>gaG	p.E54E	PLGLB1_ENST00000409310.2_Silent_p.E54E|PLGLB1_ENST00000478636.1_5'UTR	NM_001032392.2	NP_001027564.1	Q02325	PLGB_HUMAN	plasminogen-like B1	54	PAN. {ECO:0000255|PROSITE- ProRule:PRU00315}.					extracellular region (GO:0005576)		p.E54E(1)		large_intestine(1)	1						CTTTGTCCTCTTCACATTTTG	0.443																																					p.E54E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A162G	2						.						1.0	1.0	1.0					2																	87244699		69	171	240	87098210	SO:0001819	synonymous_variant	5343	exon2			M86874, M86875, M86876	CCDS33238.1	2p11.2	2008-02-05	2005-03-31	2005-03-31	ENSG00000183281	ENSG00000183281			9072	protein-coding gene	gene with protein product		173340	"""plasminogen-like"""	PLGL		1554698, 2714803	Standard	NM_001032392		Approved	PRP-B		Q02325	OTTHUMG00000154612	ENST00000355705.3:c.162A>G	2.37:g.87244699T>C		Somatic		Capture	SOLID	Phase_I	87098210	NM_001032392	Q580R1	Silent	SNP	ENST00000355705.3	37	CCDS33238.1																																																																																				PLGLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330379.1		
CNGA3	1261	hgsc.bcm.edu	37	2	99012713	99012713	+	Silent	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:99012713C>A	ENST00000272602.2	+	7	1119	c.1080C>A	c.(1078-1080)acC>acA	p.T360T	CNGA3_ENST00000393504.1_Silent_p.T360T|CNGA3_ENST00000409937.1_Silent_p.T364T|CNGA3_ENST00000436404.2_Silent_p.T342T			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	360					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.T360T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						ACTGGTCCACCTTGACCCTTA	0.507																																					p.T342T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1026A	2						.						82.0	82.0	82.0					2																	99012713		2203	4300	6503	98379145	SO:0001819	synonymous_variant	1261	exon7			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1080C>A	2.37:g.99012713C>A		Somatic		Capture	SOLID	Phase_I	98379145	NM_001079878	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Silent	SNP	ENST00000272602.2	37	CCDS2034.1																																																																																				CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
TTN	7273	hgsc.bcm.edu	37	2	179666973	179666973	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:179666973C>T	ENST00000591111.1	-	3	411	c.187G>A	c.(187-189)Gct>Act	p.A63T	TTN_ENST00000589042.1_Missense_Mutation_p.A63T|TTN_ENST00000342992.6_Missense_Mutation_p.A63T|TTN_ENST00000360870.5_Missense_Mutation_p.A63T|TTN_ENST00000359218.5_Missense_Mutation_p.A63T|TTN_ENST00000460472.2_Missense_Mutation_p.A63T|TTN_ENST00000342175.6_Missense_Mutation_p.A63T			Q8WZ42	TITIN_HUMAN	titin	32675	Ig-like 1.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A63T(8)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCAGTTTAGCGCGGCCATCG	0.537																																					p.A63T												.	.	8	Substitution - Missense(8)	large_intestine(4)|NS(4)	c.G187A	2						.						121.0	107.0	112.0					2																	179666973		2203	4300	6503	179375218	SO:0001583	missense	7273	exon3			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.187G>A	2.37:g.179666973C>T	ENSP00000465570:p.Ala63Thr	Somatic		Capture	SOLID	Phase_I	179375218	NM_133432	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	21.0	4.076214	0.76415	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.74	5.74	0.90152	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50394	0.1613	N	0.12746	0.255	0.48762	D	0.999704	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.998	T	0.59204	-0.7498	9	0.87932	D	0	.	19.919	0.97077	0.0:1.0:0.0:0.0	.	63;63;63;63;63	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	T	63	ENSP00000343764:A63T;ENSP00000434586:A63T;ENSP00000340554:A63T;ENSP00000352154:A63T;ENSP00000354117:A63T	ENSP00000340554:A63T	A	-	1	0	TTN	179375218	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.818000	0.86416	2.707000	0.92482	0.655000	0.94253	GCT		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TNS1	7145	hgsc.bcm.edu	37	2	218679672	218679674	+	In_Frame_Del	DEL	AGA	AGA	-	rs201496749		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	AGA	AGA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr2:218679672_218679674delAGA	ENST00000171887.4	-	25	4830_4832	c.4378_4380delTCT	c.(4378-4380)tctdel	p.S1460del	TNS1_ENST00000419504.1_In_Frame_Del_p.S1447del|TNS1_ENST00000430930.1_In_Frame_Del_p.S1439del	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1460					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.S1460delS(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		ACCAATACTTAGAAGTGTCCTGG	0.522																																					p.1460_1460del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.4378_4380del	2						.																																			218387919	SO:0001651	inframe_deletion	7145	exon25			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.4378_4380delTCT	2.37:g.218679672_218679674delAGA	ENSP00000171887:p.Ser1460del	Somatic		Capture	SOLID	Phase_I	218387917	NM_022648	Q4ZG71|Q6IPI5	In_Frame_Del	DEL	ENST00000171887.4	37	CCDS2407.1																																																																																				TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
C9orf43	257169	hgsc.bcm.edu	37	9	116176047	116176047	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:116176047C>T	ENST00000288462.4	+	3	606	c.160C>T	c.(160-162)Cca>Tca	p.P54S	C9orf43_ENST00000374165.1_Missense_Mutation_p.P54S|C9orf43_ENST00000490544.1_3'UTR	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	54										breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						AGATAAACTCCCAGTGCTCAC	0.448																																					p.P54S												.	.	0			c.C160T	9						.						101.0	93.0	96.0					9																	116176047		2203	4300	6503	115215868	SO:0001583	missense	257169	exon3			BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.160C>T	9.37:g.116176047C>T	ENSP00000288462:p.Pro54Ser	None		Capture	SOLID	Phase_I	115215868	NM_152786		Missense_Mutation	SNP	ENST00000288462.4	37	CCDS6796.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.205541	0.58234	.	.	ENSG00000157653	ENST00000374165;ENST00000288462	T;T	0.70631	-0.5;-0.5	5.65	5.65	0.86999	.	0.000000	0.49305	D	0.000154	T	0.77572	0.4150	L	0.34521	1.04	0.38139	D	0.93838	D	0.89917	1.0	D	0.97110	1.0	T	0.80659	-0.1284	10	0.87932	D	0	-14.0373	15.5726	0.76352	0.0:1.0:0.0:0.0	.	54	Q8TAL5	CI043_HUMAN	S	54	ENSP00000363280:P54S;ENSP00000288462:P54S	ENSP00000288462:P54S	P	+	1	0	C9orf43	115215868	0.995000	0.38212	0.998000	0.56505	0.158000	0.22134	3.449000	0.52950	2.826000	0.97356	0.563000	0.77884	CCA		C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053739.1	NM_152786	
ZBTB26	57684	hgsc.bcm.edu	37	9	125681862	125681862	+	Missense_Mutation	SNP	G	G	A	rs559840108		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:125681862G>A	ENST00000373656.3	-	2	425	c.352C>T	c.(352-354)Cgg>Tgg	p.R118W	ZBTB26_ENST00000373654.1_Missense_Mutation_p.R118W	NM_020924.2	NP_065975.1	Q9HCK0	ZBT26_HUMAN	zinc finger and BTB domain containing 26	118					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R118W(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)	11						TGTGTGCACCGTTCTACAATG	0.443																																					p.R118W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C352T	9						.						132.0	116.0	121.0					9																	125681862		2203	4300	6503	124721683	SO:0001583	missense	57684	exon2			AB046792	CCDS6847.1	9q34.11	2013-01-08	2004-04-15	2004-04-16	ENSG00000171448	ENSG00000171448		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23383	protein-coding gene	gene with protein product			"""zinc finger protein 481"""	ZNF481			Standard	NM_020924		Approved		uc004bnk.3	Q9HCK0	OTTHUMG00000020627	ENST00000373656.3:c.352C>T	9.37:g.125681862G>A	ENSP00000362760:p.Arg118Trp	Somatic		Capture	SOLID	Phase_I	124721683	NM_020924	B3KQ53|Q8WTR1	Missense_Mutation	SNP	ENST00000373656.3	37	CCDS6847.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738653	0.49045	.	.	ENSG00000171448	ENST00000373656;ENST00000373654	T;T	0.68181	-0.31;-0.31	5.54	4.59	0.56863	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.068526	0.64402	D	0.000015	T	0.76076	0.3937	L	0.52573	1.65	0.48762	D	0.999706	D	0.89917	1.0	D	0.76071	0.987	T	0.77645	-0.2510	10	0.72032	D	0.01	.	13.0917	0.59169	0.0:0.0:0.719:0.281	.	118	Q9HCK0	ZBT26_HUMAN	W	118	ENSP00000362760:R118W;ENSP00000362758:R118W	ENSP00000362758:R118W	R	-	1	2	ZBTB26	124721683	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.606000	0.54095	2.605000	0.88082	0.591000	0.81541	CGG		ZBTB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053960.1	NM_020924	
ST6GALNAC4	27090	hgsc.bcm.edu	37	9	130674691	130674691	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:130674691T>G	ENST00000335791.5	-	4	742	c.467A>C	c.(466-468)cAc>cCc	p.H156P	ST6GALNAC4_ENST00000495983.1_5'UTR|ST6GALNAC4_ENST00000343609.2_Missense_Mutation_p.H72P	NM_175039.3	NP_778204.1	Q9H4F1	SIA7D_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4	156					cellular protein metabolic process (GO:0044267)|glycolipid metabolic process (GO:0006664)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity (GO:0047290)|sialyltransferase activity (GO:0008373)			endometrium(1)|large_intestine(2)|lung(2)|prostate(2)	7						CCGGTCCATGTGCCTGCCCTG	0.637																																					p.H156P												.	.	0			c.A467C	9						.						90.0	84.0	86.0					9																	130674691		2203	4300	6503	129714512	SO:0001583	missense	27090	exon4			AB035172	CCDS6883.1	9q34	2013-03-01	2005-02-07	2005-02-07	ENSG00000136840	ENSG00000136840	2.4.99.7	"""Sialyltransferases"""	17846	protein-coding gene	gene with protein product		606378	"""sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase)"""	SIAT7D		10207017, 11062056	Standard	XM_005251922		Approved	ST6GALNACIV, SIAT3C	uc004bss.3	Q9H4F1	OTTHUMG00000020724	ENST00000335791.5:c.467A>C	9.37:g.130674691T>G	ENSP00000336733:p.His156Pro	None		Capture	SOLID	Phase_I	129714512	NM_175039	Q5T9D0|Q9NWU6|Q9UKU1|Q9ULB9|Q9Y3G3|Q9Y3G4	Missense_Mutation	SNP	ENST00000335791.5	37	CCDS6883.1	.	.	.	.	.	.	.	.	.	.	T	13.88	2.368015	0.42003	.	.	ENSG00000136840	ENST00000541933;ENST00000335791;ENST00000343609;ENST00000361444	T;T;T	0.29142	1.58;1.58;1.58	5.05	3.9	0.45041	.	0.362646	0.33938	N	0.004407	T	0.19366	0.0465	L	0.28192	0.835	0.33784	D	0.624643	P	0.37122	0.583	B	0.34536	0.185	T	0.28299	-1.0048	10	0.35671	T	0.21	-23.1055	10.1059	0.42533	0.0:0.0905:0.0:0.9095	.	156	Q9H4F1	SIA7D_HUMAN	P	72;156;72;72	ENSP00000336733:H156P;ENSP00000340382:H72P;ENSP00000355130:H72P	ENSP00000336733:H156P	H	-	2	0	ST6GALNAC4	129714512	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	3.249000	0.51437	2.126000	0.65437	0.379000	0.24179	CAC		ST6GALNAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054317.2	NM_175040	
C9orf114	51490	hgsc.bcm.edu	37	9	131589352	131589352	+	Silent	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:131589352C>A	ENST00000361256.5	-	4	367	c.327G>T	c.(325-327)gtG>gtT	p.V109V		NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114	109							poly(A) RNA binding (GO:0044822)	p.V109V(1)		kidney(2)|large_intestine(4)|ovary(1)	7						CGATCTCATCCACACAGAAGA	0.627																																					p.V109V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G327T	9						.						144.0	124.0	131.0					9																	131589352		2203	4300	6503	130629173	SO:0001819	synonymous_variant	51490	exon4				CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.327G>T	9.37:g.131589352C>A		Somatic		Capture	SOLID	Phase_I	130629173	NM_016390	Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	Silent	SNP	ENST00000361256.5	37	CCDS6913.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359525	0.24598	.	.	ENSG00000198917	ENST00000372618	.	.	.	5.5	5.5	0.81552	.	0.340815	0.39274	N	0.001401	T	0.56292	0.1975	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49390	-0.8945	6	0.20519	T	0.43	-8.6629	11.8536	0.52425	0.0:0.9206:0.0:0.0794	.	.	.	.	L	109	.	ENSP00000361701:W109L	W	-	2	0	C9orf114	130629173	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.182000	0.32029	2.602000	0.87976	0.650000	0.86243	TGG		C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054500.1	NM_016390	
SMARCA2	6595	hgsc.bcm.edu	37	9	2029064	2029064	+	Silent	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:2029064G>T	ENST00000382203.1	+	2	251	c.42G>T	c.(40-42)ggG>ggT	p.G14G	SMARCA2_ENST00000349721.2_Silent_p.G14G|SMARCA2_ENST00000357248.2_Silent_p.G14G|SMARCA2_ENST00000382194.1_Silent_p.G14G			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	14					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CCCACCCAGGGCCTTCGCCGG	0.597																																					p.G14G												.	.	0			c.G42T	9						.						11.0	11.0	11.0					9																	2029064		2197	4286	6483	2019064	SO:0001819	synonymous_variant	6595	exon2			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.42G>T	9.37:g.2029064G>T		None		Capture	SOLID	Phase_I	2019064	NM_003070	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	37	CCDS34977.1																																																																																				SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
BNC2	54796	hgsc.bcm.edu	37	9	16419387	16419387	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:16419387C>G	ENST00000380672.4	-	7	2957	c.2900G>C	c.(2899-2901)aGc>aCc	p.S967T	BNC2_ENST00000545497.1_Missense_Mutation_p.S872T|BNC2_ENST00000380667.2_Missense_Mutation_p.S900T	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		GGACTGGAGGCTGGAGGTGGT	0.592																																					p.S967T												.	.	0			c.G2900C	9						.						90.0	85.0	87.0					9																	16419387		2203	4300	6503	16409387	SO:0001583	missense	54796	exon7			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.2900G>C	9.37:g.16419387C>G	ENSP00000370047:p.Ser967Thr	None		Capture	SOLID	Phase_I	16409387	NM_017637		Missense_Mutation	SNP	ENST00000380672.4	37	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	C	18.24	3.581139	0.65992	.	.	ENSG00000173068	ENST00000380672;ENST00000380667;ENST00000545497	T;T;T	0.55588	0.51;0.58;0.54	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.71921	0.3397	M	0.67397	2.05	0.80722	D	1	D;P;D	0.63880	0.974;0.956;0.993	D;P;D	0.68192	0.953;0.899;0.956	T	0.71427	-0.4596	10	0.52906	T	0.07	-15.7753	19.8338	0.96646	0.0:1.0:0.0:0.0	.	872;967;732	F5H586;Q6ZN30;D3DRJ1	.;BNC2_HUMAN;.	T	967;900;872	ENSP00000370047:S967T;ENSP00000370042:S900T;ENSP00000444640:S872T	ENSP00000370042:S900T	S	-	2	0	BNC2	16409387	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.625000	0.83145	2.692000	0.91855	0.591000	0.81541	AGC		BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
HAUS6	54801	hgsc.bcm.edu	37	9	19050161	19050161	+	IGR	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:19050161G>A	ENST00000380502.3	-	0	6536				RRAGA_ENST00000380527.1_Silent_p.T168T	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6						centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.T168T(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GGGATGAGACGCTCTACAAAG	0.522																																					p.T168T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G504A	9						.						66.0	64.0	65.0					9																	19050161		2203	4300	6503	19040161	SO:0001628	intergenic_variant	10670	exon1			AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622		9.37:g.19050161G>A		Somatic		Capture	SOLID	Phase_I	19040161	NM_006570	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Silent	SNP	ENST00000380502.3	37	CCDS6489.1																																																																																				HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645	
TLN1	7094	hgsc.bcm.edu	37	9	35698637	35698637	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:35698637A>C	ENST00000314888.9	-	54	7518	c.7165T>G	c.(7165-7167)Tgg>Ggg	p.W2389G	TLN1_ENST00000540444.1_Missense_Mutation_p.W2277G	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2389	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCCTGGGACCACTGCCCATCG	0.537																																					p.W2389G												.	.	0			c.T7165G	9						.						78.0	76.0	77.0					9																	35698637		2203	4300	6503	35688637	SO:0001583	missense	7094	exon54			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.7165T>G	9.37:g.35698637A>C	ENSP00000316029:p.Trp2389Gly	None		Capture	SOLID	Phase_I	35688637	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	A	19.35	3.809993	0.70797	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.72942	-0.7;-0.7	5.77	5.77	0.91146	I/LWEQ (4);	0.120492	0.64402	D	0.000010	D	0.88258	0.6388	H	0.94886	3.595	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.91385	0.5130	10	0.87932	D	0	-8.1783	14.9779	0.71289	1.0:0.0:0.0:0.0	.	2389	Q9Y490	TLN1_HUMAN	G	2389;2277	ENSP00000316029:W2389G;ENSP00000442981:W2277G	ENSP00000316029:W2389G	W	-	1	0	TLN1	35688637	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.253000	0.95501	2.207000	0.71202	0.529000	0.55759	TGG		TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
RECK	8434	hgsc.bcm.edu	37	9	36108015	36108015	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:36108015G>A	ENST00000377966.3	+	14	2185	c.1619G>A	c.(1618-1620)gGg>gAg	p.G540E		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	540					blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.G540V(1)		cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			GTCCGTCAAGGGACACTAATC	0.403																																					p.G540E												.	.	1	Substitution - Missense(1)	lung(1)	c.G1619A	9						.						122.0	108.0	113.0					9																	36108015		2203	4300	6503	36098015	SO:0001583	missense	8434	exon14			E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.1619G>A	9.37:g.36108015G>A	ENSP00000367202:p.Gly540Glu	None		Capture	SOLID	Phase_I	36098015	NM_021111	B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	ENST00000377966.3	37	CCDS6597.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.700004	0.88924	.	.	ENSG00000122707	ENST00000377966	T	0.50001	0.76	5.45	5.45	0.79879	.	0.055190	0.64402	D	0.000001	T	0.61702	0.2368	M	0.68952	2.095	0.50813	D	0.999892	D;D	0.61697	0.99;0.99	P;P	0.54889	0.763;0.763	T	0.65294	-0.6203	10	0.87932	D	0	-14.0294	17.1358	0.86739	0.0:0.0:1.0:0.0	.	540;540	A8K9D8;O95980	.;RECK_HUMAN	E	540	ENSP00000367202:G540E	ENSP00000367202:G540E	G	+	2	0	RECK	36098015	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.318000	0.65829	2.716000	0.92895	0.655000	0.94253	GGG		RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052409.1		
ALDH1B1	219	hgsc.bcm.edu	37	9	38397059	38397059	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:38397059C>G	ENST00000377698.3	+	2	1467	c.1314C>G	c.(1312-1314)aaC>aaG	p.N438K		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	438					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)			NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		AGAGGGCCAACAACACCAGGT	0.567																																					p.N438K												.	.	0			c.C1314G	9						.						74.0	69.0	71.0					9																	38397059		2203	4300	6503	38387059	SO:0001583	missense	219	exon2			M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.1314C>G	9.37:g.38397059C>G	ENSP00000366927:p.Asn438Lys	None		Capture	SOLID	Phase_I	38387059	NM_000692	B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	ENST00000377698.3	37	CCDS6615.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.055207	0.55325	.	.	ENSG00000137124	ENST00000377698;ENST00000540055	D	0.94232	-3.38	5.7	3.61	0.41365	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.075323	0.53938	D	0.000057	D	0.97870	0.9300	H	0.99897	4.91	0.44323	D	0.9972	D	0.71674	0.998	D	0.78314	0.991	D	0.95181	0.8299	10	0.87932	D	0	.	2.9791	0.05947	0.2479:0.5544:0.0:0.1977	.	438	P30837	AL1B1_HUMAN	K	438;139	ENSP00000366927:N438K	ENSP00000366927:N438K	N	+	3	2	ALDH1B1	38387059	0.944000	0.32072	0.998000	0.56505	0.970000	0.65996	0.176000	0.16782	1.395000	0.46643	0.655000	0.94253	AAC		ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052492.1		
TMEM2	23670	hgsc.bcm.edu	37	9	74324230	74324230	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:74324230C>G	ENST00000377044.4	-	17	3469	c.2930G>C	c.(2929-2931)aGc>aCc	p.S977T	TMEM2_ENST00000377066.5_Missense_Mutation_p.S914T	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	977					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S977T(1)		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		ATTTACACAGCTTGGATGGCG	0.458																																					p.S914T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2741C	9						.						251.0	211.0	225.0					9																	74324230		2203	4300	6503	73514050	SO:0001583	missense	23670	exon16				CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.2930G>C	9.37:g.74324230C>G	ENSP00000366243:p.Ser977Thr	Somatic		Capture	SOLID	Phase_I	73514050	NM_001135820	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.635235	0.29068	.	.	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000377055;ENST00000377043	T;T;T;T	0.72615	-0.67;-0.6;1.5;0.92	5.67	1.01	0.19927	.	0.642633	0.18162	N	0.149726	T	0.52403	0.1732	N	0.22421	0.69	0.32739	N	0.507953	B;B	0.12630	0.001;0.006	B;B	0.13407	0.002;0.009	T	0.53788	-0.8389	10	0.59425	D	0.04	.	7.5777	0.27946	0.0:0.2757:0.0:0.7243	.	977;914	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	T	977;914;6;78	ENSP00000366243:S977T;ENSP00000366266:S914T;ENSP00000366254:S6T;ENSP00000366242:S78T	ENSP00000366242:S78T	S	-	2	0	TMEM2	73514050	0.014000	0.17966	0.983000	0.44433	0.942000	0.58702	0.195000	0.17155	0.283000	0.22279	-0.259000	0.10710	AGC		TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
QSOX2	169714	hgsc.bcm.edu	37	9	139113759	139113759	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:139113759C>G	ENST00000358701.5	-	6	741	c.704G>C	c.(703-705)aGc>aCc	p.S235T		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	235					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		CACCACGATGCTTTCATACGG	0.512																																					p.S235T												.	.	0			c.G704C	9						.						139.0	135.0	136.0					9																	139113759		2203	4300	6503	138253580	SO:0001583	missense	169714	exon6			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.704G>C	9.37:g.139113759C>G	ENSP00000351536:p.Ser235Thr	None		Capture	SOLID	Phase_I	138253580	NM_181701	A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	ENST00000358701.5	37	CCDS35178.1	.	.	.	.	.	.	.	.	.	.	C	5.563	0.288747	0.10513	.	.	ENSG00000165661	ENST00000358701	T	0.67171	-0.25	4.65	2.12	0.27331	.	0.269406	0.42420	D	0.000707	T	0.47673	0.1458	N	0.22421	0.69	0.20563	N	0.999889	B	0.24258	0.1	B	0.20384	0.029	T	0.33650	-0.9860	10	0.40728	T	0.16	-26.9303	8.3287	0.32173	0.0:0.1663:0.0:0.8337	.	235	Q6ZRP7	QSOX2_HUMAN	T	235	ENSP00000351536:S235T	ENSP00000351536:S235T	S	-	2	0	QSOX2	138253580	0.989000	0.36119	0.005000	0.12908	0.002000	0.02628	2.005000	0.40864	0.250000	0.21479	-0.290000	0.09829	AGC		QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701	
CENPJ	55835	hgsc.bcm.edu	37	13	25480370	25480370	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr13:25480370T>C	ENST00000381884.4	-	7	1991	c.1806A>G	c.(1804-1806)gaA>gaG	p.E602E	CENPJ_ENST00000545981.1_Silent_p.E602E	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	602					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)	p.E602E(1)		endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		GTTGATCCCTTTCTAAGATTT	0.378																																					p.E602E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1806G	13						.						67.0	69.0	68.0					13																	25480370		2203	4300	6503	24378370	SO:0001819	synonymous_variant	55835	exon7			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.1806A>G	13.37:g.25480370T>C		Somatic		Capture	SOLID	Phase_I	24378370	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Silent	SNP	ENST00000381884.4	37	CCDS9310.1																																																																																				CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
DGKH	160851	hgsc.bcm.edu	37	13	42795469	42795469	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr13:42795469T>C	ENST00000337343.4	+	29	3533	c.3512T>C	c.(3511-3513)aTc>aCc	p.I1171T	DGKH_ENST00000261491.5_Intron|DGKH_ENST00000498255.2_Intron|DGKH_ENST00000379274.2_Missense_Mutation_p.I1035T|DGKH_ENST00000540693.1_Intron|DGKH_ENST00000538674.1_Intron|DGKH_ENST00000536612.1_Missense_Mutation_p.I1035T	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	1171	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.I1171T(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TACAAAGATATCTTCATCCGT	0.418																																					p.I1171T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3512C	13						.						205.0	186.0	193.0					13																	42795469		2203	4300	6503	41693469	SO:0001583	missense	160851	exon29			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.3512T>C	13.37:g.42795469T>C	ENSP00000337572:p.Ile1171Thr	Somatic		Capture	SOLID	Phase_I	41693469	NM_178009	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	T	11.45	1.643348	0.29246	.	.	ENSG00000102780	ENST00000337343;ENST00000379274;ENST00000536612	D;D;D	0.85088	-1.94;-1.94;-1.94	5.58	-0.00731	0.14009	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.746103	0.13084	N	0.415114	T	0.67078	0.2855	N	0.11892	0.195	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.15484	0.005;0.013	T	0.52601	-0.8554	10	0.07175	T	0.84	.	9.5856	0.39514	0.0:0.2906:0.0:0.7094	.	1035;1171	Q86XP1-3;Q86XP1	.;DGKH_HUMAN	T	1171;1035;1035	ENSP00000337572:I1171T;ENSP00000368576:I1035T;ENSP00000445114:I1035T	ENSP00000337572:I1171T	I	+	2	0	DGKH	41693469	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	0.706000	0.25690	0.022000	0.15160	-0.441000	0.05720	ATC		DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
ENOX1	55068	hgsc.bcm.edu	37	13	43930100	43930100	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr13:43930100G>C	ENST00000261488.6	-	8	1355	c.778C>G	c.(778-780)Cac>Gac	p.H260D	ENOX1_ENST00000412891.1_Missense_Mutation_p.H260D|ENOX1_ENST00000540032.1_Missense_Mutation_p.H73D	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	260					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		TCCGAGTAGTGCATTATGGCA	0.632																																					p.H260D												.	.	0			c.C778G	13						.						105.0	118.0	114.0					13																	43930100		2192	4291	6483	42828100	SO:0001583	missense	55068	exon8			EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.778C>G	13.37:g.43930100G>C	ENSP00000261488:p.His260Asp	None		Capture	SOLID	Phase_I	42828100	NM_001127615	A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	ENST00000261488.6	37	CCDS9389.1	.	.	.	.	.	.	.	.	.	.	G	32	5.155023	0.94686	.	.	ENSG00000120658	ENST00000261488;ENST00000412891;ENST00000540032	T;T	0.50548	0.74;0.74	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.70824	0.3268	M	0.75777	2.31	0.80722	D	1	P;D	0.57899	0.894;0.981	P;D	0.69824	0.676;0.966	T	0.72197	-0.4363	10	0.87932	D	0	-11.8609	20.1184	0.97949	0.0:0.0:1.0:0.0	.	73;260	B7Z5K1;Q8TC92	.;ENOX1_HUMAN	D	260;260;73	ENSP00000261488:H260D;ENSP00000415054:H260D	ENSP00000261488:H260D	H	-	1	0	ENOX1	42828100	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.461000	0.97646	2.769000	0.95229	0.655000	0.94253	CAC		ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993	
NUFIP1	26747	hgsc.bcm.edu	37	13	45533703	45533703	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr13:45533703C>T	ENST00000379161.4	-	7	880	c.834G>A	c.(832-834)atG>atA	p.M278I		NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	278					box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		ACATCCCCTTCATCTTGCTGG	0.373																																					p.M278I												.	.	0			c.G834A	13						.						176.0	167.0	170.0					13																	45533703		2203	4300	6503	44431703	SO:0001583	missense	26747	exon7			AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.834G>A	13.37:g.45533703C>T	ENSP00000368459:p.Met278Ile	None		Capture	SOLID	Phase_I	44431703	NM_012345	Q8WVM5|Q96SG1	Missense_Mutation	SNP	ENST00000379161.4	37	CCDS9393.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266309	0.80358	.	.	ENSG00000083635	ENST00000379161	T	0.51071	0.72	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.67961	0.2949	M	0.80847	2.515	0.40391	D	0.979542	D	0.57899	0.981	D	0.67900	0.954	T	0.69903	-0.5019	10	0.41790	T	0.15	-15.5312	14.4002	0.67037	0.0:1.0:0.0:0.0	.	278	Q9UHK0	NUFP1_HUMAN	I	278	ENSP00000368459:M278I	ENSP00000368459:M278I	M	-	3	0	NUFIP1	44431703	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.969000	0.56816	2.523000	0.85059	0.637000	0.83480	ATG		NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044755.2	NM_012345	
RB1	5925	hgsc.bcm.edu	37	13	48953741	48953741	+	Silent	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr13:48953741T>G	ENST00000267163.4	+	14	1482	c.1344T>G	c.(1342-1344)ctT>ctG	p.L448L		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	448	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.L448L(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GATACAAACTTGGAGTTCGCT	0.348		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.L448L		yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	.	24	Whole gene deletion(15)|Unknown(8)|Substitution - coding silent(1)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|large_intestine(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.T1344G	13						.						21.0	21.0	21.0					13																	48953741		2201	4300	6501	47851742	SO:0001819	synonymous_variant	5925	exon14	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1344T>G	13.37:g.48953741T>G		Somatic		Capture	SOLID	Phase_I	47851742	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Silent	SNP	ENST00000267163.4	37	CCDS31973.1																																																																																				RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
PCDH20	64881	hgsc.bcm.edu	37	13	61985847	61985847	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr13:61985847G>A	ENST00000409186.1	-	5	4490	c.2385C>T	c.(2383-2385)ttC>ttT	p.F795F	PCDH20_ENST00000409204.4_Silent_p.F795F			Q8N6Y1	PCD20_HUMAN	protocadherin 20	795	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.F795F(1)|p.F768F(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GGTCAATCCTGAAGGACTCAG	0.478																																					p.F795F												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2385T	13						.						84.0	82.0	82.0					13																	61985847		2203	4300	6503	60883848	SO:0001819	synonymous_variant	64881	exon2			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.2385C>T	13.37:g.61985847G>A		Somatic		Capture	SOLID	Phase_I	60883848	NM_022843	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Silent	SNP	ENST00000409186.1	37	CCDS9442.2																																																																																				PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
KLF5	688	hgsc.bcm.edu	37	13	73636059	73636059	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr13:73636059G>A	ENST00000377687.4	+	2	858	c.322G>A	c.(322-324)Gag>Aag	p.E108K	KLF5_ENST00000477333.1_3'UTR|KLF5_ENST00000539231.1_Missense_Mutation_p.E17K	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	108					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		TATAATTCCAGAGCATAAAAA	0.408																																					p.E108K												.	.	0			c.G322A	13						.						134.0	136.0	135.0					13																	73636059		2203	4300	6503	72534060	SO:0001583	missense	688	exon2			D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.322G>A	13.37:g.73636059G>A	ENSP00000366915:p.Glu108Lys	None		Capture	SOLID	Phase_I	72534060	NM_001730	L0R3U5|L0R4T9|Q9UHP8	Missense_Mutation	SNP	ENST00000377687.4	37	CCDS9448.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357041	0.61293	.	.	ENSG00000102554	ENST00000539231;ENST00000377687;ENST00000545883	T;T	0.07327	3.39;3.2	6.04	6.04	0.98038	.	0.213668	0.48767	D	0.000180	T	0.10252	0.0251	L	0.40543	1.245	0.42689	D	0.99357	B	0.33694	0.421	B	0.29785	0.107	T	0.06826	-1.0805	10	0.46703	T	0.11	.	19.583	0.95478	0.0:0.0:1.0:0.0	.	108	Q13887	KLF5_HUMAN	K	17;108;88	ENSP00000440407:E17K;ENSP00000366915:E108K	ENSP00000366915:E108K	E	+	1	0	KLF5	72534060	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.579000	0.60936	2.873000	0.98535	0.563000	0.77884	GAG		KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045263.1		
SLITRK1	114798	hgsc.bcm.edu	37	13	84454911	84454912	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	GG	GG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr13:84454911_84454912delGG	ENST00000377084.2	-	1	1616_1617	c.731_732delCC	c.(730-732)cccfs	p.P244fs		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	244	LRRCT 1.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.P244fs*6(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GCAGTCTGGTGGGGGCTTCGCA	0.550																																					p.244_244del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.731_732del	13						.																																			83352913	SO:0001589	frameshift_variant	114798	exon1			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.731_732delCC	13.37:g.84454913_84454914delGG	ENSP00000366288:p.Pro244fs	Somatic		Capture	SOLID	Phase_I	83352912	NM_052910	Q5U5I6|Q96SF9	Frame_Shift_Del	DEL	ENST00000377084.2	37	CCDS9464.1																																																																																				SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
CUL4A	8451	hgsc.bcm.edu	37	13	113899295	113899295	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr13:113899295G>A	ENST00000375440.4	+	13	1450	c.1366G>A	c.(1366-1368)Gat>Aat	p.D456N	CUL4A_ENST00000375441.3_Missense_Mutation_p.D356N|CUL4A_ENST00000451881.1_Missense_Mutation_p.D356N|CUL4A_ENST00000326335.4_Missense_Mutation_p.D356N	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	456					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			TTATAAAAAAGATTTGGCAAA	0.373																																					p.D456N												.	.	0			c.G1366A	13						.						72.0	76.0	74.0					13																	113899295		2203	4300	6503	112947296	SO:0001583	missense	8451	exon13			U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1366G>A	13.37:g.113899295G>A	ENSP00000364589:p.Asp456Asn	None		Capture	SOLID	Phase_I	112947296	NM_001008895	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	ENST00000375440.4	37	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	G	34	5.312445	0.95655	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79	5.01	5.01	0.66863	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.85805	0.5782	M	0.92169	3.28	0.80722	D	1	P;P	0.48764	0.915;0.915	P;P	0.50314	0.637;0.637	D	0.88905	0.3355	10	0.52906	T	0.07	-35.9199	18.6736	0.91521	0.0:0.0:1.0:0.0	.	456;456	Q13619;A8MSH7	CUL4A_HUMAN;.	N	356;356;356;456	ENSP00000364590:D356N;ENSP00000389118:D356N;ENSP00000322132:D356N;ENSP00000364589:D456N	ENSP00000322132:D356N	D	+	1	0	CUL4A	112947296	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.505000	0.97989	2.484000	0.83849	0.484000	0.47621	GAT		CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045888.3	NM_003589	
AKR1E2	83592	hgsc.bcm.edu	37	10	4879741	4879741	+	Missense_Mutation	SNP	C	C	T	rs145502026	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr10:4879741C>T	ENST00000298375.7	+	5	621	c.550C>T	c.(550-552)Cct>Tct	p.P184S	AKR1E2_ENST00000532248.1_Missense_Mutation_p.P184S|AKR1E2_ENST00000525281.1_3'UTR|AKR1E2_ENST00000345253.5_Intron|AKR1E2_ENST00000334019.4_Missense_Mutation_p.P184S	NM_001040177.2	NP_001035267.1	Q96JD6	AKCL2_HUMAN	aldo-keto reductase family 1, member E2	184						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	1,5-anhydro-D-fructose reductase activity (GO:0050571)			NS(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)	15						TTTGAATAAGCCTGGGTTGAG	0.532																																					p.P184S	NSCLC(43;343 1097 20371 28813 45509)											.	.	0			c.C550T	10						.	C	SER/PRO	3,4403	6.2+/-15.9	0,3,2200	63.0	61.0	62.0		550	4.2	0.2	10	dbSNP_134	62	0,8600		0,0,4300	yes	missense	AKR1E2	NM_001040177.1	74	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	probably-damaging	184/321	4879741	3,13003	2203	4300	6503	4869741	SO:0001583	missense	83592	exon5			AB040820	CCDS31134.1, CCDS59210.1, CCDS59209.1	10p15.2	2009-09-09	2009-09-09	2009-09-09	ENSG00000165568	ENSG00000165568		"""Aldo-keto reductases"""	23437	protein-coding gene	gene with protein product			"""aldo-keto reductase family 1, member C-like 2"""	AKRDC1, AKR1CL2			Standard	NM_001271021		Approved	MGC10612	uc001ihi.4	Q96JD6	OTTHUMG00000017577	ENST00000298375.7:c.550C>T	10.37:g.4879741C>T	ENSP00000298375:p.Pro184Ser	None		Capture	SOLID	Phase_I	4869741	NM_001040177	Q86Z16|Q86Z17|Q86Z18|Q9BU71	Missense_Mutation	SNP	ENST00000298375.7	37	CCDS31134.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.338897	0.81911	6.81E-4	0.0	ENSG00000165568	ENST00000462718;ENST00000533295;ENST00000298375;ENST00000532248;ENST00000334019	T;T;T;T	0.21361	2.01;2.01;2.01;2.01	4.2	4.2	0.49525	NADP-dependent oxidoreductase domain (3);	0.131345	0.52532	D	0.000069	T	0.26593	0.0650	N	0.16130	0.375	0.80722	D	1	P;D;D;B	0.60575	0.942;0.985;0.988;0.167	P;P;P;B	0.62382	0.844;0.84;0.901;0.053	T	0.09930	-1.0652	10	0.72032	D	0.01	.	14.8419	0.70233	0.0:1.0:0.0:0.0	.	145;184;184;184	B7Z7K2;Q96JD6-2;Q96JD6;Q96JD6-3	.;.;AKCL2_HUMAN;.	S	80;188;184;184;184	ENSP00000435436:P188S;ENSP00000298375:P184S;ENSP00000432947:P184S;ENSP00000335034:P184S	ENSP00000298375:P184S	P	+	1	0	AKR1E2	4869741	1.000000	0.71417	0.235000	0.24058	0.909000	0.53808	3.317000	0.51968	2.626000	0.88956	0.455000	0.32223	CCT		AKR1E2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046520.4	NM_031436	
FRMPD2	143162	hgsc.bcm.edu	37	10	49452829	49452829	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr10:49452829G>A	ENST00000374201.3	-	4	675	c.373C>T	c.(373-375)Cag>Tag	p.Q125*	FRMPD2_ENST00000407470.4_Intron|FRMPD2_ENST00000305531.3_Intron	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	125	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		TTACAAACCTGATGTGGCGGA	0.443																																					p.Q125X												.	.	0			c.C373T	10						.						120.0	107.0	111.0					10																	49452829		2203	4300	6503	49122835	SO:0001587	stop_gained	143162	exon4			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.373C>T	10.37:g.49452829G>A	ENSP00000363317:p.Gln125*	None		Capture	SOLID	Phase_I	49122835	NM_001018071	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Nonsense_Mutation	SNP	ENST00000374201.3	37	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	G	38	6.806865	0.97853	.	.	ENSG00000170324	ENST00000374201	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.9982	0.64416	0.0:0.0:1.0:0.0	.	.	.	.	X	125	.	ENSP00000363317:Q125X	Q	-	1	0	FRMPD2	49122835	1.000000	0.71417	0.938000	0.37757	0.744000	0.42396	5.989000	0.70587	2.375000	0.81037	0.460000	0.39030	CAG		FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428	
ITIH5	80760	hgsc.bcm.edu	37	10	7618864	7618864	+	Silent	SNP	C	C	T	rs578011384		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr10:7618864C>T	ENST00000256861.6	-	10	1608	c.1530G>A	c.(1528-1530)tcG>tcA	p.S510S	ITIH5_ENST00000397145.2_Silent_p.S510S|ITIH5_ENST00000446830.2_Silent_p.S292S|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000298441.6_Silent_p.S296S|ITIH5_ENST00000397146.2_Silent_p.S510S	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	510					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S510S(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TGATGATCTCCGAGCCGTTGA	0.557																																					p.S296S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G888A	10						.						77.0	73.0	74.0					10																	7618864		2203	4300	6503	7658870	SO:0001819	synonymous_variant	80760	exon6					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1530G>A	10.37:g.7618864C>T		Somatic		Capture	SOLID	Phase_I	7658870	NM_032817	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37																																																																																					ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
NDST2	8509	hgsc.bcm.edu	37	10	75567170	75567170	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr10:75567170C>G	ENST00000309979.6	-	3	1533	c.977G>C	c.(976-978)gGg>gCg	p.G326A	NDST2_ENST00000299641.4_Missense_Mutation_p.G203A|RP11-574K11.31_ENST00000603027.1_Missense_Mutation_p.G326A			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	326	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					CATGCGGGTCCCTTCCTTGCC	0.483																																					p.G326A												.	.	0			c.G977C	10						.						94.0	89.0	91.0					10																	75567170		2203	4300	6503	75237176	SO:0001583	missense	8509	exon3			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.977G>C	10.37:g.75567170C>G	ENSP00000310657:p.Gly326Ala	None		Capture	SOLID	Phase_I	75237176	NM_003635	Q2TB32|Q59H89	Missense_Mutation	SNP	ENST00000309979.6	37	CCDS7335.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225777	0.79576	.	.	ENSG00000166507	ENST00000309979;ENST00000299641	T;T	0.53857	0.86;0.6	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.78349	0.4269	M	0.89095	3.005	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.70016	0.956;0.967	T	0.81722	-0.0803	10	0.87932	D	0	.	19.922	0.97089	0.0:1.0:0.0:0.0	.	203;326	B4E139;P52849	.;NDST2_HUMAN	A	326;203	ENSP00000310657:G326A;ENSP00000299641:G203A	ENSP00000299641:G203A	G	-	2	0	NDST2	75237176	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.810000	0.86072	2.716000	0.92895	0.650000	0.86243	GGG		NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048710.1	NM_003635	
SAMD8	142891	hgsc.bcm.edu	37	10	76936001	76936001	+	Intron	SNP	C	C	A	rs148645450		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr10:76936001C>A	ENST00000542569.1	+	5	1046				SAMD8_ENST00000372687.4_Missense_Mutation_p.R324S|SAMD8_ENST00000372690.3_Intron	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8						ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					TGCTTCTATGCGTATTAGGTA	0.438																																					p.R324S												.	.	0			c.C970A	10						.						202.0	176.0	185.0					10																	76936001		2203	4300	6503	76606007	SO:0001627	intron_variant	142891	exon5			AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515	ENST00000542569.1:c.943+27C>A	10.37:g.76936001C>A		None		Capture	SOLID	Phase_I	76606007	NM_144660	Q5JSC5|Q5JSC8|Q66K52	Missense_Mutation	SNP	ENST00000542569.1	37	CCDS53543.1	.	.	.	.	.	.	.	.	.	.	C	5.431	0.264688	0.10294	.	.	ENSG00000156671	ENST00000372687	.	.	.	4.82	2.42	0.29668	.	.	.	.	.	T	0.23611	0.0571	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.17349	-1.0372	6	.	.	.	.	4.7673	0.13139	0.0:0.6496:0.0:0.3504	.	324	Q96LT4-2	.	S	324	.	.	R	+	1	0	SAMD8	76606007	0.000000	0.05858	0.002000	0.10522	0.380000	0.30137	-0.339000	0.07832	1.086000	0.41228	0.655000	0.94253	CGT		SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_144660	
KIF20B	9585	hgsc.bcm.edu	37	10	91478574	91478574	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr10:91478574A>G	ENST00000371728.3	+	12	1444	c.1379A>G	c.(1378-1380)tAt>tGt	p.Y460C	KIF20B_ENST00000260753.4_Missense_Mutation_p.Y460C|KIF20B_ENST00000394289.2_Missense_Mutation_p.Y460C|KIF20B_ENST00000416354.1_Missense_Mutation_p.Y460C	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	460	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						AGCCAATGTTATTTAGCCTAT	0.303																																					p.Y460C												.	.	0			c.A1379G	10						.						53.0	57.0	56.0					10																	91478574		2203	4299	6502	91468554	SO:0001583	missense	9585	exon12			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.1379A>G	10.37:g.91478574A>G	ENSP00000360793:p.Tyr460Cys	None		Capture	SOLID	Phase_I	91468554	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	A	6.715	0.500618	0.12822	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88	5.62	-0.974	0.10293	Kinesin, motor domain (3);	0.573835	0.17051	N	0.188927	T	0.44829	0.1312	N	0.05306	-0.075	0.24770	N	0.992876	B;B	0.09022	0.002;0.001	B;B	0.11329	0.006;0.001	T	0.20806	-1.0264	10	0.25106	T	0.35	1.239	3.8743	0.09050	0.2084:0.4321:0.2583:0.1012	.	460;460	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	C	460	ENSP00000260753:Y460C;ENSP00000411545:Y460C;ENSP00000377830:Y460C;ENSP00000360793:Y460C	ENSP00000260753:Y460C	Y	+	2	0	KIF20B	91468554	1.000000	0.71417	0.897000	0.35233	0.915000	0.54546	1.909000	0.39917	-0.372000	0.07992	-0.242000	0.12053	TAT		KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
WAPAL	23063	hgsc.bcm.edu	37	10	88213443	88213449	+	Frame_Shift_Del	DEL	CGATGAT	CGATGAT	-	rs367828346|rs371694095		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	CGATGAT	CGATGAT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr10:88213443_88213449delCGATGAT	ENST00000298767.5	-	13	3269_3275	c.2797_2803delATCATCG	c.(2797-2805)atcatcgggfs	p.IIG933fs	WAPAL_ENST00000372075.1_Frame_Shift_Del_p.IIG200fs|WAPAL_ENST00000263070.7_Frame_Shift_Del_p.IIG200fs	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	933	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)		p.I933fs*6(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						AGCAACACCCCGATGATGGCCCTCATG	0.391																																					p.933_935del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2797_2803del	10						.																																			88203429	SO:0001589	frameshift_variant	23063	exon13			AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.2797_2803delATCATCG	10.37:g.88213443_88213449delCGATGAT	ENSP00000298767:p.Ile933fs	Somatic		Capture	SOLID	Phase_I	88203423	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Frame_Shift_Del	DEL	ENST00000298767.5	37	CCDS7375.1																																																																																				WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
CYP26A1	1592	hgsc.bcm.edu	37	10	94835617	94835617	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr10:94835617G>A	ENST00000224356.4	+	5	944	c.899G>A	c.(898-900)gGa>gAa	p.G300E	CYP26A1_ENST00000371531.1_Missense_Mutation_p.G231E|CYP26A1_ENST00000394139.1_Missense_Mutation_p.G231E	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	300					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)	p.G231A(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	CTCCTCTTTGGAGGACACGAA	0.493																																					p.G231E												.	.	1	Substitution - Missense(1)	ovary(1)	c.G692A	10						.						82.0	78.0	79.0					10																	94835617		2203	4300	6503	94825607	SO:0001583	missense	1592	exon5			AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.899G>A	10.37:g.94835617G>A	ENSP00000224356:p.Gly300Glu	None		Capture	SOLID	Phase_I	94825607	NM_057157	B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	ENST00000224356.4	37	CCDS7426.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.916281	0.92249	.	.	ENSG00000095596	ENST00000371531;ENST00000224356;ENST00000394139	T;T;T	0.69435	-0.4;-0.4;-0.4	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.67258	0.2874	N	0.21097	0.63	0.80722	D	1	P;P	0.46987	0.888;0.888	P;P	0.52424	0.698;0.588	T	0.71533	-0.4564	10	0.87932	D	0	-9.8409	19.0472	0.93027	0.0:0.0:1.0:0.0	.	231;300	B3KNI4;O43174	.;CP26A_HUMAN	E	231;300;231	ENSP00000360586:G231E;ENSP00000224356:G300E;ENSP00000377695:G231E	ENSP00000224356:G300E	G	+	2	0	CYP26A1	94825607	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.986000	0.93492	2.749000	0.94314	0.655000	0.94253	GGA		CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049408.3		
CCDC112	153733	hgsc.bcm.edu	37	5	114611289	114611289	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:114611289A>T	ENST00000512261.1	-	7	709	c.293T>A	c.(292-294)aTt>aAt	p.I98N	CCDC112_ENST00000395557.4_Missense_Mutation_p.I98N|CCDC112_ENST00000379611.5_Missense_Mutation_p.I181N|CCDC112_ENST00000506442.1_Missense_Mutation_p.I98N|CCDC112_ENST00000503027.1_5'UTR			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	98										endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		CTCTTCTTTAATTAGCTCTTC	0.299																																					p.I181N												.	.	0			c.T542A	5						.						49.0	51.0	51.0					5																	114611289		2201	4297	6498	114639188	SO:0001583	missense	153733	exon6			BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.293T>A	5.37:g.114611289A>T	ENSP00000423712:p.Ile98Asn	None		Capture	SOLID	Phase_I	114639188	NM_001040440	Q6A334	Missense_Mutation	SNP	ENST00000512261.1	37	CCDS4117.1	.	.	.	.	.	.	.	.	.	.	A	17.15	3.316363	0.60524	.	.	ENSG00000164221	ENST00000379611;ENST00000512261;ENST00000506442;ENST00000395557	T;T;T;T	0.22336	1.96;2.3;2.28;2.3	5.74	3.21	0.36854	.	0.264166	0.42420	D	0.000720	T	0.11836	0.0288	N	0.25647	0.755	0.29261	N	0.871336	P;P;P	0.42203	0.573;0.773;0.773	B;B;B	0.33521	0.165;0.165;0.165	T	0.08764	-1.0706	10	0.51188	T	0.08	-5.6631	8.4225	0.32710	0.8002:0.1313:0.0685:0.0	.	98;181;98	D6RF76;Q8NEF3-2;Q8NEF3	.;.;CC112_HUMAN	N	181;98;98;98	ENSP00000368931:I181N;ENSP00000423712:I98N;ENSP00000424876:I98N;ENSP00000378925:I98N	ENSP00000368931:I181N	I	-	2	0	CCDC112	114639188	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	3.125000	0.50469	0.989000	0.38761	0.528000	0.53228	ATT		CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370999.1	NM_152549	
PCDHGC3	5098	hgsc.bcm.edu	37	5	140855813	140855813	+	Missense_Mutation	SNP	G	G	C	rs146372628	byFrequency	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:140855813G>C	ENST00000308177.3	+	1	234	c.130G>C	c.(130-132)Ggt>Cgt	p.G44R	PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	44	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGAGAGAAGGGTTTCGCTGT	0.562																																					p.G44R												.	.	0			c.G130C	5						.						147.0	152.0	151.0					5																	140855813		2203	4300	6503	140835997	SO:0001583	missense	5098	exon1			AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.130G>C	5.37:g.140855813G>C	ENSP00000312070:p.Gly44Arg	None		Capture	SOLID	Phase_I	140835997	NM_032402	O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	ENST00000308177.3	37	CCDS4261.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348169	0.82132	.	.	ENSG00000240184	ENST00000308177	T	0.52754	0.65	5.65	5.65	0.86999	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.77598	0.4154	M	0.92268	3.29	0.46954	D	0.999263	D;D	0.89917	0.999;1.0	D;D	0.76575	0.988;0.979	T	0.81976	-0.0686	9	0.87932	D	0	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	44;44	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	R	44	ENSP00000312070:G44R	ENSP00000312070:G44R	G	+	1	0	PCDHGC3	140835997	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.387000	0.97232	2.941000	0.99782	0.655000	0.94253	GGT		PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
TCERG1	10915	hgsc.bcm.edu	37	5	145838521	145838521	+	Silent	SNP	A	A	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:145838521A>T	ENST00000296702.5	+	4	551	c.513A>T	c.(511-513)tcA>tcT	p.S171S	TCERG1_ENST00000394421.2_Silent_p.S171S	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	171	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)	p.S171S(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCAGCAATCAGAACTGACAC	0.542																																					p.S171S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A513T	5						.						106.0	99.0	101.0					5																	145838521		2203	4300	6503	145818714	SO:0001819	synonymous_variant	10915	exon4			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.513A>T	5.37:g.145838521A>T		Somatic		Capture	SOLID	Phase_I	145818714	NM_006706	Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	37	CCDS4282.1																																																																																				TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
ZBED8	63920	hgsc.bcm.edu	37	5	159822060	159822060	+	Silent	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Illumina	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:159822060G>A	ENST00000408953.3	-	2	945	c.438C>T	c.(436-438)atC>atT	p.I146I	C5orf54_ENST00000523213.1_Silent_p.I146I	NM_022090.3	NP_071373.2												p.I146I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	12						ttctagaatggatcacatcat	0.393																																					p.I146I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C438T	5						.						91.0	92.0	92.0					5																	159822060		2203	4300	6503	159754638	SO:0001819	synonymous_variant	63920	exon2																														ENST00000408953.3:c.438C>T	5.37:g.159822060G>A		Somatic		Capture	SOLID	Phase_I	159754638	NM_022090		Silent	SNP	ENST00000408953.3	37	CCDS34283.1																																																																																				C5orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374143.1		
GABRG2	2566	hgsc.bcm.edu	37	5	161580174	161580174	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:161580174G>A	ENST00000361925.4	+	9	1424	c.1204G>A	c.(1204-1206)Gaa>Aaa	p.E402K	GABRG2_ENST00000393933.4_Missense_Mutation_p.E307K|GABRG2_ENST00000356592.3_Missense_Mutation_p.E410K|GABRG2_ENST00000414552.2_Missense_Mutation_p.E450K			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	402					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.E410K(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGAGAGAGATGAAGAGTACGG	0.488																																					p.E450K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1348A	5						.						182.0	166.0	171.0					5																	161580174		2203	4300	6503	161512752	SO:0001583	missense	2566	exon11				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1204G>A	5.37:g.161580174G>A	ENSP00000354651:p.Glu402Lys	Somatic		Capture	SOLID	Phase_I	161512752	NM_198903	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.997428	0.35226	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933	D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88	5.95	5.08	0.68730	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.047726	0.85682	D	0.000000	D	0.82375	0.5023	L	0.50333	1.59	0.80722	D	1	B;B;B	0.27679	0.185;0.048;0.039	B;B;B	0.35550	0.205;0.158;0.098	T	0.76702	-0.2862	10	0.10636	T	0.68	.	15.3601	0.74464	0.0668:0.0:0.9332:0.0	.	450;402;410	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	K	410;450;402;307	ENSP00000349000:E410K;ENSP00000410732:E450K;ENSP00000354651:E402K;ENSP00000377510:E307K	ENSP00000349000:E410K	E	+	1	0	GABRG2	161512752	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.751000	0.98889	1.526000	0.49068	0.655000	0.94253	GAA		GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
SH3PXD2B	285590	hgsc.bcm.edu	37	5	171766888	171766888	+	Nonsense_Mutation	SNP	G	G	T	rs201017228		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:171766888G>T	ENST00000311601.5	-	13	1391	c.1221C>A	c.(1219-1221)taC>taA	p.Y407*	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	407	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAATCTGAATGTACCACCAGC	0.537																																					p.Y407X												.	.	0			c.C1221A	5						.						50.0	52.0	51.0					5																	171766888		2203	4300	6503	171699493	SO:0001587	stop_gained	285590	exon13			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.1221C>A	5.37:g.171766888G>T	ENSP00000309714:p.Tyr407*	None		Capture	SOLID	Phase_I	171699493	NM_001017995	B6F0V2|Q9P2Q1	Nonsense_Mutation	SNP	ENST00000311601.5	37	CCDS34291.1	.	.	.	.	.	.	.	.	.	.	G	38	7.033878	0.98017	.	.	ENSG00000174705	ENST00000311601	.	.	.	5.82	4.03	0.46877	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.038	8.4697	0.32977	0.2408:0.0:0.7592:0.0	.	.	.	.	X	407	.	.	Y	-	3	2	SH3PXD2B	171699493	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.671000	0.37513	1.466000	0.48025	0.561000	0.74099	TAC		SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963	
RXFP3	51289	hgsc.bcm.edu	37	5	33936948	33936948	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:33936948G>T	ENST00000330120.3	+	1	458	c.103G>T	c.(103-105)Gcc>Tcc	p.A35S		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	35					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						TCTGGAGGCGGCCAACACGAG	0.652																																					p.A35S												.	.	0			c.G103T	5						.						76.0	85.0	82.0					5																	33936948		2203	4300	6503	33972705	SO:0001583	missense	51289	exon1			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.103G>T	5.37:g.33936948G>T	ENSP00000328708:p.Ala35Ser	None		Capture	SOLID	Phase_I	33972705	NM_016568	Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235468	0.22626	.	.	ENSG00000182631	ENST00000330120	T	0.70164	-0.46	5.43	3.64	0.41730	.	0.825842	0.10212	N	0.701949	T	0.49626	0.1568	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.33727	-0.9857	10	0.25751	T	0.34	-7.8335	8.6404	0.33974	0.0693:0.0:0.6607:0.27	.	35	Q9NSD7	RL3R1_HUMAN	S	35	ENSP00000328708:A35S	ENSP00000328708:A35S	A	+	1	0	RXFP3	33972705	0.016000	0.18221	0.626000	0.29213	0.632000	0.37999	1.285000	0.33261	0.769000	0.33313	-0.169000	0.13324	GCC		RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
BHMT2	23743	hgsc.bcm.edu	37	5	78365614	78365614	+	Silent	SNP	T	T	C			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:78365614T>C	ENST00000255192.3	+	1	75	c.9T>C	c.(7-9)ccT>ccC	p.P3P	BHMT2_ENST00000521567.1_Silent_p.P3P|DMGDH_ENST00000520388.1_Intron|DMGDH_ENST00000255189.3_5'Flank|DMGDH_ENST00000380311.4_5'Flank|DMGDH_ENST00000540686.1_5'Flank	NM_017614.4	NP_060084.2	Q9H2M3	BHMT2_HUMAN	betaine--homocysteine S-methyltransferase 2	3					L-methionine salvage (GO:0071267)|S-adenosylmethionine metabolic process (GO:0046500)|S-methylmethionine metabolic process (GO:0033477)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|S-methylmethionine-homocysteine S-methyltransferase activity (GO:0061627)|zinc ion binding (GO:0008270)	p.P3P(1)		endometrium(2)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	15		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	CCATGGCACCTGCTGGACGCC	0.761																																					p.P3P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T9C	5						.						16.0	16.0	16.0					5																	78365614		2084	4083	6167	78401370	SO:0001819	synonymous_variant	23743	exon1				CCDS4045.1, CCDS54871.1	5q13	2010-04-28	2010-04-28		ENSG00000132840	ENSG00000132840	2.1.1.5		1048	protein-coding gene	gene with protein product		605932				11087663, 18230605	Standard	NM_017614		Approved		uc003kft.3	Q9H2M3	OTTHUMG00000108158	ENST00000255192.3:c.9T>C	5.37:g.78365614T>C		Somatic		Capture	SOLID	Phase_I	78401370	NM_001178005	B7Z516|Q9NXX7	Silent	SNP	ENST00000255192.3	37	CCDS4045.1																																																																																				BHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226962.2	NM_017614	
BHMT2	23743	hgsc.bcm.edu	37	5	78365621	78365621	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:78365621C>A	ENST00000255192.3	+	1	82	c.16C>A	c.(16-18)Cgc>Agc	p.R6S	BHMT2_ENST00000521567.1_Missense_Mutation_p.R6S|DMGDH_ENST00000520388.1_Intron|DMGDH_ENST00000255189.3_5'Flank|DMGDH_ENST00000380311.4_5'Flank|DMGDH_ENST00000540686.1_5'Flank	NM_017614.4	NP_060084.2	Q9H2M3	BHMT2_HUMAN	betaine--homocysteine S-methyltransferase 2	6					L-methionine salvage (GO:0071267)|S-adenosylmethionine metabolic process (GO:0046500)|S-methylmethionine metabolic process (GO:0033477)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|S-methylmethionine-homocysteine S-methyltransferase activity (GO:0061627)|zinc ion binding (GO:0008270)	p.R6S(1)		endometrium(2)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	15		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	ACCTGCTGGACGCCCGGGGGC	0.741																																					p.R6S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C16A	5						.						17.0	17.0	17.0					5																	78365621		2096	4105	6201	78401377	SO:0001583	missense	23743	exon1				CCDS4045.1, CCDS54871.1	5q13	2010-04-28	2010-04-28		ENSG00000132840	ENSG00000132840	2.1.1.5		1048	protein-coding gene	gene with protein product		605932				11087663, 18230605	Standard	NM_017614		Approved		uc003kft.3	Q9H2M3	OTTHUMG00000108158	ENST00000255192.3:c.16C>A	5.37:g.78365621C>A	ENSP00000255192:p.Arg6Ser	Somatic		Capture	SOLID	Phase_I	78401377	NM_001178005	B7Z516|Q9NXX7	Missense_Mutation	SNP	ENST00000255192.3	37	CCDS4045.1	.	.	.	.	.	.	.	.	.	.	C	9.297	1.052226	0.19827	.	.	ENSG00000132840	ENST00000255192;ENST00000521567	T;T	0.29142	1.58;1.6	3.59	-0.524	0.11920	.	1.838300	0.03176	N	0.171417	T	0.13286	0.0322	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.15263	-1.0443	10	0.14656	T	0.56	0.3423	4.1752	0.10348	0.3248:0.1849:0.4903:0.0	.	6;6	B7Z516;Q9H2M3	.;BHMT2_HUMAN	S	6	ENSP00000255192:R6S;ENSP00000430278:R6S	ENSP00000255192:R6S	R	+	1	0	BHMT2	78401377	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.070000	0.11523	-0.251000	0.09542	-0.502000	0.04539	CGC		BHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226962.2	NM_017614	
CKMT2	1160	hgsc.bcm.edu	37	5	80561993	80561993	+	Missense_Mutation	SNP	T	T	G	rs369134253		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:80561993T>G	ENST00000424301.2	+	11	1414	c.1176T>G	c.(1174-1176)aaT>aaG	p.N392K	CKMT2_ENST00000437669.1_Missense_Mutation_p.N392K|CKMT2_ENST00000254035.4_Missense_Mutation_p.N392K|CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000500148.2_RNA|CKMT2-AS1_ENST00000512287.1_RNA|CKMT2-AS1_ENST00000502041.2_RNA|CKMT2-AS1_ENST00000501927.2_RNA	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	392	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	ATGGAGTCAATTACCTGGTGG	0.418																																					p.N392K												.	.	0			c.T1176G	5						.						184.0	191.0	188.0					5																	80561993		2203	4300	6503	80597749	SO:0001583	missense	1160	exon10				CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.1176T>G	5.37:g.80561993T>G	ENSP00000404203:p.Asn392Lys	None		Capture	SOLID	Phase_I	80597749	NM_001099735	Q6ICS8|Q8N1E1	Missense_Mutation	SNP	ENST00000424301.2	37	CCDS4053.1	.	.	.	.	.	.	.	.	.	.	T	5.422	0.263071	0.10294	.	.	ENSG00000131730	ENST00000254035;ENST00000437669;ENST00000424301	T;T;T	0.10382	2.88;2.88;2.88	5.82	2.27	0.28462	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.04543	0.0124	N	0.13003	0.285	0.58432	D	0.999994	B	0.28350	0.208	B	0.24848	0.056	T	0.34179	-0.9839	10	0.06365	T	0.9	-6.5649	7.4737	0.27363	0.0:0.3276:0.0:0.6724	.	392	P17540	KCRS_HUMAN	K	392	ENSP00000254035:N392K;ENSP00000410289:N392K;ENSP00000404203:N392K	ENSP00000254035:N392K	N	+	3	2	CKMT2	80597749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.046000	0.41260	0.526000	0.28541	0.528000	0.53228	AAT		CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369600.1	NM_001825	
ARRDC3	57561	hgsc.bcm.edu	37	5	90678707	90678707	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:90678707T>G	ENST00000265138.3	-	1	469	c.203A>C	c.(202-204)aAt>aCt	p.N68T	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	68					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		ATAGGCAGTATTGGAGCCGGC	0.368																																					p.N68T												.	.	0			c.A203C	5						.						122.0	126.0	124.0					5																	90678707		2203	4300	6503	90714463	SO:0001583	missense	57561	exon1			AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.203A>C	5.37:g.90678707T>G	ENSP00000265138:p.Asn68Thr	None		Capture	SOLID	Phase_I	90714463	NM_020801	A8K6T8|Q9P2H1	Missense_Mutation	SNP	ENST00000265138.3	37	CCDS34202.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.939767	0.52972	.	.	ENSG00000113369	ENST00000265138	T	0.12361	2.69	5.16	5.16	0.70880	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.044860	0.85682	D	0.000000	T	0.14657	0.0354	L	0.45422	1.42	0.58432	D	0.999999	B	0.27882	0.192	B	0.34652	0.187	T	0.05566	-1.0877	10	0.10636	T	0.68	-24.4763	14.9756	0.71269	0.0:0.0:0.0:1.0	.	68	Q96B67	ARRD3_HUMAN	T	68	ENSP00000265138:N68T	ENSP00000265138:N68T	N	-	2	0	ARRDC3	90714463	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.034000	0.64152	1.937000	0.56155	0.459000	0.35465	AAT		ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369763.2	NM_020801	
OR2Y1	134083	hgsc.bcm.edu	37	5	180166784	180166784	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr5:180166784A>G	ENST00000307832.2	-	1	315	c.275T>C	c.(274-276)aTc>aCc	p.I92T		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCACGGGTGATGGTGCGGTC	0.587																																					p.I92T												.	.	0			c.T275C	5						.						75.0	66.0	69.0					5																	180166784		2203	4300	6503	180099390	SO:0001583	missense	134083	exon1			AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.275T>C	5.37:g.180166784A>G	ENSP00000312403:p.Ile92Thr	None		Capture	SOLID	Phase_I	180099390	NM_001001657	B9EIP1|Q6IFB1|Q96R16	Missense_Mutation	SNP	ENST00000307832.2	37	CCDS34323.1	.	.	.	.	.	.	.	.	.	.	a	18.64	3.667468	0.67814	.	.	ENSG00000174339	ENST00000307832	T	0.02916	4.11	4.41	3.25	0.37280	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000092	T	0.15046	0.0363	H	0.95470	3.675	0.30024	N	0.814052	D	0.62365	0.991	P	0.55455	0.776	T	0.13899	-1.0492	10	0.87932	D	0	.	8.1809	0.31311	0.9022:0.0:0.0978:0.0	.	92	Q8NGV0	OR2Y1_HUMAN	T	92	ENSP00000312403:I92T	ENSP00000312403:I92T	I	-	2	0	OR2Y1	180099390	1.000000	0.71417	0.984000	0.44739	0.060000	0.15804	3.575000	0.53870	0.832000	0.34804	0.418000	0.28097	ATC		OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368059.2	XM_068682	
CFAP74	85452	hgsc.bcm.edu	37	1	1855256	1855258	+	IGR	DEL	GCT	GCT	-			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	GCT	GCT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr1:1855256_1855258delGCT								TMEM52 (4544 upstream) : C1orf222 (64304 downstream)														p.S115delS(1)									AGAAGTAGAGGCTTTCGTGGTCG	0.631																																					.												.	.	1	Deletion - In frame(1)	large_intestine(1)	.	1						.																																			1845118	SO:0001628	intergenic_variant	339457	.																															1.37:g.1855256_1855258delGCT		Somatic		Capture	SOLID	Phase_I	1845116	.		In_Frame_Del	DEL		37																																																																																				0								
MAP2K4	6416	hgsc.bcm.edu	37	17	12028610	12028610	+	Splice_Site	SNP	G	G	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr17:12028610G>T	ENST00000353533.5	+	8	876		c.e8-1		MAP2K4_ENST00000581941.1_Splice_Site|MAP2K4_ENST00000415385.3_Splice_Site	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4						apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(2)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TTATGTTCCAGCCTGAAAGAA	0.428			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																.			Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	.	12	Whole gene deletion(10)|Unknown(2)	ovary(4)|breast(4)|large_intestine(2)|biliary_tract(1)|pancreas(1)	.	17						.						188.0	152.0	164.0					17																	12028610		2203	4300	6503	11969335	SO:0001630	splice_region_variant	6416	.			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.814-1G>T	17.37:g.12028610G>T		Somatic		Capture	SOLID	Phase_I	11969335	.	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Splice_Site	SNP	ENST00000353533.5	37	CCDS11162.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.263678	0.59431	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8064	0.88602	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAP2K4	11969335	1.000000	0.71417	0.998000	0.56505	0.604000	0.37047	9.561000	0.98142	2.814000	0.96858	0.563000	0.77884	.		MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		Intron
NXF5	55998	hgsc.bcm.edu	37	X	101091715	101091715	+	Missense_Mutation	SNP	C	C	T	rs373035757		TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chrX:101091715C>T	ENST00000361708.2	-	16	1530	c.1171G>A	c.(1171-1173)Gca>Aca	p.A391T	NXF5_ENST00000537026.1_Intron|NXF5_ENST00000473265.2_Intron			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	391					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.A391T(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						CCTGGAATTGCGGCCAGAGGT	0.522																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	X						.	C		0,3835		0,0,1632,571	245.0	173.0	198.0			-0.8	0.0	X		198	1,6727		0,1,2427,1872	no	intron	NXF5	NM_032946.2		0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095			101091715	1,10562	2203	4300	6503	100978371	SO:0001583	missense	55998	.			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.1171G>A	X.37:g.101091715C>T	ENSP00000355286:p.Ala391Thr	Somatic		Capture	SOLID	Phase_I	100978371	.	A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Missense_Mutation	SNP	ENST00000361708.2	37		.	.	.	.	.	.	.	.	.	.	.	13.34	2.206788	0.39003	0.0	1.49E-4	ENSG00000126952	ENST00000361708	T	0.49139	0.79	2.13	-0.829	0.10796	.	0.706535	0.12325	U	0.478945	T	0.28134	0.0694	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24835	-1.0149	7	0.19590	T	0.45	.	5.2591	0.15563	0.0:0.495:0.0:0.505	.	.	.	.	T	391	ENSP00000355286:A391T	ENSP00000263032:A391T	A	-	1	0	NXF5	100978371	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.191000	0.09601	-0.355000	0.08199	-0.789000	0.03336	GCA		NXF5-201	KNOWN	basic	protein_coding	protein_coding			
PDCL	5082	hgsc.bcm.edu	37	9	125585477	125585477	+	Splice_Site	SNP	C	C	T			TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454	.	.	Illumina GAIIx	TCGA-AG-A00Y-01A-02W-A005-10	TCGA-AG-A00Y-10A-01W-A005-10	g.chr9:125585477C>T	ENST00000259467.4	-	3	338		c.e3-1			NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like						heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						CCTTTTGGGCCTGAGTAGGGT	0.537																																					.												.	.	0			.	9						.						136.0	126.0	130.0					9																	125585477		2203	4300	6503	124625298	SO:0001630	splice_region_variant	5082	.			AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.173-1G>A	9.37:g.125585477C>T		None		Capture	SOLID	Phase_I	124625298	.	Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Splice_Site	SNP	ENST00000259467.4	37	CCDS6845.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.993364	0.74703	.	.	ENSG00000136940	ENST00000436632;ENST00000259467;ENST00000394285	.	.	.	5.87	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5512	0.76155	0.1382:0.8618:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDCL	124625298	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.482000	0.81143	2.780000	0.95670	0.563000	0.77884	.		PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053956.1	NM_005388	Intron
