#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACHE	43	broad.mit.edu	37	7	100490104	100490105	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:100490104_100490105insA	ENST00000412389.1	-	2	1558_1559	c.1403_1404insT	c.(1402-1404)ctcfs	p.L468fs	ACHE_ENST00000428317.1_Frame_Shift_Ins_p.L468fs|ACHE_ENST00000302913.4_Frame_Shift_Ins_p.L468fs|UFSP1_ENST00000388761.2_5'Flank|ACHE_ENST00000411582.1_Frame_Shift_Ins_p.L468fs|ACHE_ENST00000241069.5_Frame_Shift_Ins_p.L468fs|ACHE_ENST00000419336.2_Frame_Shift_Ins_p.L380fs			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	468					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	GGGGCCAGGAGAGCGTGGAAGC	0.634																																					p.L468fs												.	.	0			c.1404_1405insT	7						.																																			100328041	SO:0001589	frameshift_variant	43	exon3				CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.1404dupT	7.37:g.100490105_100490105dupA	ENSP00000394976:p.Leu468fs	Somatic		Unspecified	Illumina	Phase_I	100328040	NM_015831	A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Frame_Shift_Ins	INS	ENST00000412389.1	37	CCDS5709.1																																																																																				ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	NM_015831	
CCM2	83605	broad.mit.edu	37	7	45109445	45109446	+	In_Frame_Ins	INS	-	-	TGG			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:45109445_45109446insTGG	ENST00000258781.6	+	6	779_780	c.630_631insTGG	c.(631-633)tgt>TGGtgt	p.210_211insW	CCM2_ENST00000461377.1_3'UTR|CCM2_ENST00000474617.1_Intron|CCM2_ENST00000544363.1_Intron|CCM2_ENST00000475551.1_In_Frame_Ins_p.204_205insW|CCM2_ENST00000381112.3_In_Frame_Ins_p.231_232insW|CCM2_ENST00000541586.1_In_Frame_Ins_p.152_153insW	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2	210	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)				NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						AGGAGCTTTGCTGTCTGCTAGG	0.614																																					p.C210delinsCW												.	.	0			c.630_631insTGG	7						.																																			45075971	SO:0001652	inframe_insertion	83605	exon6			BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	Exception_encountered	7.37:g.45109445_45109446insTGG	ENSP00000258781:p.Cys210_Cys211insTrp	Somatic		Unspecified	Illumina	Phase_I	45075970	NM_031443	A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	In_Frame_Ins	INS	ENST00000258781.6	37	CCDS5500.1																																																																																				CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251348.1	NM_031443	
ZNF335	63925	broad.mit.edu	37	20	44588930	44588931	+	Frame_Shift_Ins	INS	-	-	AGCG			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr20:44588930_44588931insAGCG	ENST00000322927.2	-	14	2036_2037	c.1936_1937insCGCT	c.(1936-1938)gacfs	p.D646fs	ZNF335_ENST00000426788.1_Frame_Shift_Ins_p.D491fs	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	646					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)	p.D646fs*37(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GAAGGGCTTGTCACTGACGTGG	0.535																																					p.D646fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1937_1938insCGCT	20						.																																			44022338	SO:0001589	frameshift_variant	63925	exon14			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1936_1937insCGCT	20.37:g.44588930_44588931insAGCG	ENSP00000325326:p.Asp646fs	Somatic		Unspecified	Illumina	Phase_I	44022337	NM_022095	B4DLG7|Q548D0|Q9H684	Frame_Shift_Ins	INS	ENST00000322927.2	37	CCDS13389.1																																																																																				ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
ZMAT5	55954	broad.mit.edu	37	22	30127246	30127247	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr22:30127246_30127247insC	ENST00000344318.3	-	6	596_597	c.480_481insG	c.(478-483)gggtggfs	p.W161fs	ZMAT5_ENST00000397781.3_Frame_Shift_Ins_p.W161fs|CABP7_ENST00000216144.3_3'UTR	NM_001003692.1	NP_001003692.1	Q9UDW3	ZMAT5_HUMAN	zinc finger, matrin-type 5	161					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	zinc ion binding (GO:0008270)	p.W161fs*>11(2)		large_intestine(1)|lung(1)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(5;0.000597)|all cancers(5;0.0534)|Epithelial(10;0.0574)			TGCAGAGGCCACCCCCCAGGTG	0.644																																					p.W161fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.481_482insG	22						.		,,	25,4229		1,23,2103					,,	5.1	1.0			37	23,8207		1,21,4093	no	utr-3,frameshift,frameshift	ZMAT5,CABP7	NM_182527.2,NM_019103.2,NM_001003692.1	,,	2,44,6196	A1A1,A1R,RR		0.2795,0.5877,0.3845	,,	,,		48,12436				28457247	SO:0001589	frameshift_variant	55954	exon7				CCDS13868.1	22q12.2	2013-09-20	2010-09-15		ENSG00000100319	ENSG00000100319		"""Zinc fingers, matrin-type"""	28046	protein-coding gene	gene with protein product	"""U11/U12 snRNP 20K"""					9847074	Standard	NM_019103		Approved	SNRNP20	uc003agn.3	Q9UDW3	OTTHUMG00000151292	ENST00000344318.3:c.481dupG	22.37:g.30127252_30127252dupC	ENSP00000344241:p.Trp161fs	Somatic		Unspecified	Illumina	Phase_I	28457246	NM_019103	A8K9F6	Frame_Shift_Ins	INS	ENST00000344318.3	37	CCDS13868.1																																																																																				ZMAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322114.1	NM_019103	
SMG5	23381	broad.mit.edu	37	1	156230253	156230254	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:156230253_156230254insA	ENST00000361813.5	-	15	2415_2416	c.2271_2272insT	c.(2269-2274)agcaccfs	p.T758fs	SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	758					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					TCCTCTAAGGTGCTGAGCAGGG	0.559																																					p.T758fs												.	.	0			c.2272_2273insT	1						.																																			154496878	SO:0001589	frameshift_variant	23381	exon15			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2271_2272insT	1.37:g.156230253_156230254insA	ENSP00000355261:p.Thr758fs	Somatic		Unspecified	Illumina	Phase_I	154496877	NM_015327	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Frame_Shift_Ins	INS	ENST00000361813.5	37	CCDS1137.1																																																																																				SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
PPP2R3A	5523	broad.mit.edu	37	3	135720430	135720431	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:135720430_135720431insTG	ENST00000264977.3	+	2	707_708	c.90_91insTG	c.(91-93)tgcfs	p.C31fs	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	31					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)	p.T32fs*38(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CTATACATTATTGCACTGGAAC	0.450																																					p.Y30fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.90_91insTG	3						.																																			137203121	SO:0001589	frameshift_variant	5523	exon2			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.91_92dupTG	3.37:g.135720431_135720432dupTG	ENSP00000264977:p.Cys31fs	Somatic		Unspecified	Illumina	Phase_I	137203120	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Frame_Shift_Ins	INS	ENST00000264977.3	37	CCDS3087.1																																																																																				PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
CAMKV	79012	broad.mit.edu	37	3	49898881	49898882	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:49898881_49898882insA	ENST00000477224.1	-	5	909_910	c.431_432insT	c.(430-432)aggfs	p.R144fs	RN7SL217P_ENST00000584520.1_RNA|CAMKV_ENST00000488336.1_Frame_Shift_Ins_p.R144fs|CAMKV_ENST00000466940.1_Splice_Site_p.L101fs|CAMKV_ENST00000498324.1_5'Flank|CAMKV_ENST00000296471.7_Frame_Shift_Ins_p.R144fs|CAMKV_ENST00000467248.1_Frame_Shift_Ins_p.R69fs|CAMKV_ENST00000463537.1_Frame_Shift_Ins_p.R144fs			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	144	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CCTTGAGATTCCTGTGCACGAT	0.604																																					p.R144fs												.	.	0			c.432_433insT	3						.																																			49873886	SO:0001589	frameshift_variant	79012	exon5			BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.431_432insT	3.37:g.49898881_49898882insA	ENSP00000419195:p.Arg144fs	Somatic		Unspecified	Illumina	Phase_I	49873885	NM_024046	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Frame_Shift_Ins	INS	ENST00000477224.1	37	CCDS33762.1																																																																																				CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350584.4	NM_024046	
CAMKV	79012	broad.mit.edu	37	3	49898884	49898885	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:49898884_49898885insA	ENST00000477224.1	-	5	906_907	c.428_429insT	c.(427-429)cacfs	p.H143fs	RN7SL217P_ENST00000584520.1_RNA|CAMKV_ENST00000488336.1_Frame_Shift_Ins_p.H143fs|CAMKV_ENST00000466940.1_Intron|CAMKV_ENST00000498324.1_5'Flank|CAMKV_ENST00000296471.7_Frame_Shift_Ins_p.H143fs|CAMKV_ENST00000467248.1_Frame_Shift_Ins_p.H68fs|CAMKV_ENST00000463537.1_Frame_Shift_Ins_p.H143fs			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	143	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.R144fs*23(1)		central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TGAGATTCCTGTGCACGATCTT	0.604																																					p.H143fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.429_430insT	3						.																																			49873889	SO:0001589	frameshift_variant	79012	exon5			BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.428_429insT	3.37:g.49898884_49898885insA	ENSP00000419195:p.His143fs	Somatic		Unspecified	Illumina	Phase_I	49873888	NM_024046	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Frame_Shift_Ins	INS	ENST00000477224.1	37	CCDS33762.1																																																																																				CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350584.4	NM_024046	
SLCO6A1	133482	broad.mit.edu	37	5	101709056	101709057	+	Stop_Codon_Ins	INS	-	-	C	rs113965602		TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:101709056_101709057insC	ENST00000506729.1	-	0	2330_2331				SLCO6A1_ENST00000513675.1_Stop_Codon_Ins|SLCO6A1_ENST00000379807.3_Stop_Codon_Ins|SLCO6A1_ENST00000389019.3_Stop_Codon_Ins|SLCO6A1_ENST00000379810.1_Stop_Codon_Ins			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GATGATCCAGTTACAAGTCAGT	0.267																																					p.X720delinsX												.	.	1	Unknown(1)	large_intestine(1)	c.2160_2161insG	5						.																																			101736956	SO:0001567	stop_retained_variant	133482	exon13			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.2158_2158insG	5.37:g.101709056_101709057insC		Somatic		Unspecified	Illumina	Phase_I	101736955	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Frame_Shift_Ins	INS	ENST00000506729.1	37	CCDS34206.1																																																																																				SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
RGMB	285704	broad.mit.edu	37	5	98129379	98129380	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:98129379_98129380insA	ENST00000513185.1	+	3	1672_1673	c.1236_1237insA	c.(1237-1239)aatfs	p.N413fs	RGMB_ENST00000308234.7_Frame_Shift_Ins_p.N454fs			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	413					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)	p.N454fs*9(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		CCAGCAGTGGCAATGGGACTCC	0.530																																					p.G453fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1359_1360insA	5						.																																			98157280	SO:0001589	frameshift_variant	285704	exon5			AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.1238dupA	5.37:g.98129381_98129381dupA	ENSP00000423256:p.Asn413fs	Somatic		Unspecified	Illumina	Phase_I	98157279	NM_001012761	D6R9A0|Q8NC92	Frame_Shift_Ins	INS	ENST00000513185.1	37																																																																																					RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
PRIM2	5558	broad.mit.edu	37	6	57512916	57512917	+	3'UTR	INS	-	-	T	rs140176282|rs200683929|rs560402019	byFrequency	TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr6:57512916_57512917insT	ENST00000389488.2	+	0	1831_1832				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttttttttcaattttttttgta	0.530																																					.												.	.	0			.	6						.																																			57620876	SO:0001624	3_prime_UTR_variant	5558	.				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1829->T	6.37:g.57512924_57512924dupT		Somatic		Unspecified	Illumina	Phase_I	57620875	.	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Splice_Site	INS	ENST00000389488.2	37																																																																																					PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3	NM_000947	
OR10W1	81341	broad.mit.edu	37	11	58035483	58035484	+	De_novo_Start_InFrame	INS	-	-	C			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr11:58035483_58035484insC	ENST00000395079.2	-	0	248_249					NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				AAACTGGAAGGATCAAGACTAG	0.376																																					.												.	.	0			.	11						.																																			57792060			81341	.			AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6			11.37:g.58035483_58035484insC		Somatic		Unspecified	Illumina	Phase_I	57792059	.	A2RUD2|A8MTE1|Q6UXQ2	De_novo_Start_OutOfFrame	INS	ENST00000395079.2	37	CCDS7968.1																																																																																				OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394704.1	NM_207374	
RPS2	6187	broad.mit.edu	37	16	2012734	2012735	+	Intron	INS	-	-	A			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr16:2012734_2012735insA	ENST00000343262.4	-	5	606				RPS2_ENST00000529806.1_Intron|SNORA64_ENST00000384674.1_RNA|RPS2_ENST00000530225.1_Intron|RPS2_ENST00000526522.1_Intron|SNORA10_ENST00000384084.1_RNA|SNHG9_ENST00000459373.1_lincRNA	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.?(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						GCCACCAGCCTACCTTGCAAGG	0.668																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	16						.																																			1952736	SO:0001627	intron_variant	6187	.			AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.549+1->T	16.37:g.2012735_2012735dupA		Somatic		Unspecified	Illumina	Phase_I	1952735	.	B2R5G0|D3DU82|Q3MIB1	Splice_Site	INS	ENST00000343262.4	37	CCDS10452.1																																																																																				RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250613.2	NM_002952	
C7orf66	154907	broad.mit.edu	37	7	108524118	108524118	+	Silent	SNP	G	G	C			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:108524118G>C	ENST00000379007.2	-	2	348	c.294C>G	c.(292-294)gtC>gtG	p.V98V		NM_001024607.1	NP_001019778.1	A4D0T2	CG066_HUMAN	chromosome 7 open reading frame 66	98						integral component of membrane (GO:0016021)		p.V98V(1)		breast(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	15						GTTTCTTGTGGACAATCCGTA	0.348																																					p.V98V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C294G	7						.						160.0	142.0	148.0					7																	108524118		2203	4300	6503	108311354	SO:0001819	synonymous_variant	154907	exon2			AF103078	CCDS34735.1	7q31.1	2009-03-06			ENSG00000205174	ENSG00000205174			33712	protein-coding gene	gene with protein product							Standard	NM_001024607		Approved		uc003vfo.3	A4D0T2	OTTHUMG00000154867	ENST00000379007.2:c.294C>G	7.37:g.108524118G>C		Somatic		Unspecified	Illumina	Phase_I	108311354	NM_001024607		Silent	SNP	ENST00000379007.2	37	CCDS34735.1																																																																																				C7orf66-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337420.1	NM_001024607	
SLC13A1	6561	broad.mit.edu	37	7	122811857	122811857	+	Silent	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:122811857C>T	ENST00000194130.2	-	3	369	c.330G>A	c.(328-330)ctG>ctA	p.L110L	SLC13A1_ENST00000539873.1_Silent_p.L46L	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	110					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)	p.L110L(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TCACCATTTTCAGAGCAATTC	0.378																																					p.L110L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G330A	7						.						238.0	212.0	221.0					7																	122811857		2203	4300	6503	122599093	SO:0001819	synonymous_variant	6561	exon3				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.330G>A	7.37:g.122811857C>T		Somatic		Unspecified	Illumina	Phase_I	122599093	NM_022444	Q9H5Z0	Silent	SNP	ENST00000194130.2	37	CCDS5786.1																																																																																				SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444	
AHCYL2	23382	broad.mit.edu	37	7	129066319	129066319	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:129066319G>A	ENST00000325006.3	+	16	1798	c.1744G>A	c.(1744-1746)Gat>Aat	p.D582N	AHCYL2_ENST00000446544.2_Missense_Mutation_p.D581N|AHCYL2_ENST00000446212.1_Missense_Mutation_p.D480N|AHCYL2_ENST00000531335.2_Missense_Mutation_p.D501N|AHCYL2_ENST00000490911.1_Missense_Mutation_p.D479N|AHCYL2_ENST00000474594.1_Missense_Mutation_p.D479N	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	582					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)	p.D582N(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						GCCTACCTTTGATGCCCACTT	0.507																																					p.D582N	Pancreas(160;1736 1964 29875 40941 45605)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1744A	7						.						149.0	129.0	136.0					7																	129066319		2203	4300	6503	128853555	SO:0001583	missense	23382	exon16			AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.1744G>A	7.37:g.129066319G>A	ENSP00000315931:p.Asp582Asn	Somatic		Unspecified	Illumina	Phase_I	128853555	NM_015328	B4DIZ5|D9N155|O94917	Missense_Mutation	SNP	ENST00000325006.3	37	CCDS5812.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872170	0.51695	.	.	ENSG00000158467	ENST00000325006;ENST00000446544;ENST00000531335;ENST00000474594;ENST00000446212;ENST00000490911	T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.59878	0.2226	N	0.12853	0.265	0.80722	D	1	B;B;B;B;B	0.32693	0.017;0.004;0.38;0.004;0.328	B;B;B;B;B	0.32928	0.042;0.023;0.155;0.023;0.096	T	0.58375	-0.7647	10	0.25106	T	0.35	-19.105	18.2799	0.90096	0.0:0.0:1.0:0.0	.	479;480;582;479;581	B4DIZ5;D7UEQ7;Q96HN2;D9N155;Q96HN2-2	.;.;SAHH3_HUMAN;.;.	N	582;581;501;479;480;479	ENSP00000315931:D582N;ENSP00000413639:D581N;ENSP00000431787:D501N;ENSP00000420459:D479N;ENSP00000405267:D480N;ENSP00000420801:D479N	ENSP00000315931:D582N	D	+	1	0	AHCYL2	128853555	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.841000	0.99482	2.657000	0.90304	0.557000	0.71058	GAT		AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354065.1		
CCM2	83605	broad.mit.edu	37	7	45109449	45109449	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:45109449delC	ENST00000258781.6	+	6	783	c.634delC	c.(634-636)ctgfs	p.L213fs	CCM2_ENST00000461377.1_3'UTR|CCM2_ENST00000474617.1_Intron|CCM2_ENST00000544363.1_Intron|CCM2_ENST00000475551.1_Frame_Shift_Del_p.L207fs|CCM2_ENST00000381112.3_Frame_Shift_Del_p.L234fs|CCM2_ENST00000541586.1_Frame_Shift_Del_p.L155fs	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2	213	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)		p.L233fs*2(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						GCTTTGCTGTCTGCTAGGCCA	0.607																																					p.L212fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.634delC	7						.						129.0	120.0	123.0					7																	45109449		2203	4300	6503	45075974	SO:0001589	frameshift_variant	83605	exon6			BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.634delC	7.37:g.45109449delC	ENSP00000258781:p.Leu213fs	Somatic		Unspecified	Illumina	Phase_I	45075974	NM_031443	A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	Frame_Shift_Del	DEL	ENST00000258781.6	37	CCDS5500.1																																																																																				CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251348.1	NM_031443	
PON2	5445	broad.mit.edu	37	7	95041017	95041017	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:95041017C>T	ENST00000222572.3	-	5	688	c.442G>A	c.(442-444)Gca>Aca	p.A148T	PON2_ENST00000433091.2_Missense_Mutation_p.A136T|PON2_ENST00000536183.1_Missense_Mutation_p.A169T|PON2_ENST00000483292.1_5'Flank			Q15165	PON2_HUMAN	paraoxonase 2	148			A -> G (associated with elevated mean fasting plasma glucose level; dbSNP:rs12026). {ECO:0000269|PubMed:9329371, ECO:0000269|PubMed:9714608, ECO:0000269|Ref.5}.		aromatic compound catabolic process (GO:0019439)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arylesterase activity (GO:0004064)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.A148T(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_cancers(62;9.35e-11)|all_epithelial(64;3.37e-09)		STAD - Stomach adenocarcinoma(171;0.0151)			GAATTTTCTGCTTCTTCAAAT	0.338																																					p.A148T	GBM(42;803 823 13649 23368 31463)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G442A	7						.						70.0	72.0	72.0					7																	95041017		2203	4300	6503	94878953	SO:0001583	missense	5445	exon5			M63012, AF001601	CCDS5640.1, CCDS47644.1	7q21.3	2014-03-14			ENSG00000105854	ENSG00000105854	3.1.1.2	"""Paraoxonases"""	9205	protein-coding gene	gene with protein product	"""paraoxonase nirs"", ""arylesterase 2"""	602447				8661009, 9714608	Standard	XM_005250453		Approved		uc003unv.3	Q15165	OTTHUMG00000153948	ENST00000222572.3:c.442G>A	7.37:g.95041017C>T	ENSP00000222572:p.Ala148Thr	Somatic		Unspecified	Illumina	Phase_I	94878953	NM_000305	A4D1H7|B2RCP9|B4DJD5|O15114|O15115|O75856|Q5FBX7|Q86YL0	Missense_Mutation	SNP	ENST00000222572.3	37	CCDS5640.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.394005	0.25205	.	.	ENSG00000105854	ENST00000536183;ENST00000355659;ENST00000433091;ENST00000222572	T;T;T	0.42513	2.28;0.97;2.28	4.94	4.06	0.47325	Six-bladed beta-propeller, TolB-like (1);	0.296339	0.41500	D	0.000871	T	0.25457	0.0619	N	0.12182	0.205	0.26467	N	0.975341	B;B	0.23591	0.043;0.088	B;B	0.22386	0.039;0.039	T	0.12192	-1.0557	10	0.25106	T	0.35	-16.649	13.8893	0.63729	0.0:0.9263:0.0:0.0737	.	148;148	A4D1H7;Q15165	.;PON2_HUMAN	T	169;146;136;148	ENSP00000440282:A169T;ENSP00000404622:A136T;ENSP00000222572:A148T	ENSP00000222572:A148T	A	-	1	0	PON2	94878953	1.000000	0.71417	1.000000	0.80357	0.003000	0.03518	5.401000	0.66326	1.456000	0.47831	-0.157000	0.13467	GCA		PON2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333142.1	NM_000305	
LMTK2	22853	broad.mit.edu	37	7	97834799	97834799	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:97834799G>C	ENST00000297293.5	+	14	4800	c.4507G>C	c.(4507-4509)Gac>Cac	p.D1503H		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1503				Missing (in Ref. 2; BAA83031). {ECO:0000305}.	early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CGGAGAAAAGGACTAGGTGGC	0.607																																					p.D1503H												.	.	0			c.G4507C	7						.						83.0	78.0	80.0					7																	97834799		2203	4300	6503	97672735	SO:0001583	missense	22853	exon14			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.4507G>C	7.37:g.97834799G>C	ENSP00000297293:p.Asp1503His	None		Unspecified	Illumina	Phase_I	97672735	NM_014916	A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	ENST00000297293.5	37	CCDS5654.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.830774	0.91036	.	.	ENSG00000164715	ENST00000297293	D	0.88975	-2.45	5.52	5.52	0.82312	.	0.110145	0.64402	D	0.000014	D	0.93930	0.8057	M	0.72479	2.2	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.94343	0.7572	10	0.87932	D	0	.	16.5933	0.84781	0.0:0.0:1.0:0.0	.	1503	Q8IWU2	LMTK2_HUMAN	H	1503	ENSP00000297293:D1503H	ENSP00000297293:D1503H	D	+	1	0	LMTK2	97672735	1.000000	0.71417	0.982000	0.44146	0.897000	0.52465	8.144000	0.89623	2.588000	0.87417	0.462000	0.41574	GAC		LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
CNPY4	245812	broad.mit.edu	37	7	99719968	99719968	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:99719968G>T	ENST00000262932.3	+	2	337	c.205G>T	c.(205-207)Gat>Tat	p.D69Y	TAF6_ENST00000344095.4_5'Flank|TAF6_ENST00000418432.2_5'Flank|TAF6_ENST00000437822.2_5'Flank|TAF6_ENST00000497233.1_5'Flank|TAF6_ENST00000452041.1_5'Flank|CNPY4_ENST00000480692.1_3'UTR|RP11-506M12.1_ENST00000494221.1_RNA|TAF6_ENST00000453269.2_5'Flank	NM_152755.1	NP_689968.1	Q8N129	CNPY4_HUMAN	canopy FGF signaling regulator 4	69						extracellular region (GO:0005576)		p.D69Y(1)		breast(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCAGGTGCTGGATACAGGCAA	0.602																																					p.D69Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G205T	7						.						127.0	118.0	121.0					7																	99719968		2203	4300	6503	99557904	SO:0001583	missense	245812	exon2			AK075537	CCDS34701.1	7q22.1	2013-07-23	2013-07-23		ENSG00000166997	ENSG00000166997			28631	protein-coding gene	gene with protein product	"""protein associated with TLR4"""	610047	"""canopy 4 homolog (zebrafish)"""			12975309	Standard	NM_152755		Approved	MGC40499, PRAT4B	uc003uto.3	Q8N129	OTTHUMG00000154817	ENST00000262932.3:c.205G>T	7.37:g.99719968G>T	ENSP00000262932:p.Asp69Tyr	Somatic		Unspecified	Illumina	Phase_I	99557904	NM_152755	Q8WUN9	Missense_Mutation	SNP	ENST00000262932.3	37	CCDS34701.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.652763	0.88056	.	.	ENSG00000166997	ENST00000262932	T	0.42513	0.97	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.66137	0.2759	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70557	-0.4839	10	0.72032	D	0.01	-21.9607	14.3585	0.66754	0.0:0.0:1.0:0.0	.	69	Q8N129	CNPY4_HUMAN	Y	69	ENSP00000262932:D69Y	ENSP00000262932:D69Y	D	+	1	0	CNPY4	99557904	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.096000	0.76960	2.439000	0.82584	0.462000	0.41574	GAT		CNPY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337224.4	NM_152755	
ZCWPW1	55063	broad.mit.edu	37	7	100013971	100013971	+	Silent	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:100013971C>T	ENST00000398027.2	-	7	835	c.588G>A	c.(586-588)aaG>aaA	p.K196K	ZCWPW1_ENST00000360951.4_Silent_p.K196K|ZCWPW1_ENST00000324725.6_Silent_p.K75K|ZCWPW1_ENST00000490721.1_Silent_p.K75K	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	196							zinc ion binding (GO:0008270)	p.K196K(1)		breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TATTGGATTTCTTCTTAGAGG	0.438																																					p.K196K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G588A	7						.						153.0	142.0	145.0					7																	100013971		1868	4111	5979	99851907	SO:0001819	synonymous_variant	55063	exon7			AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.588G>A	7.37:g.100013971C>T		Somatic		Unspecified	Illumina	Phase_I	99851907	NM_017984	A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Silent	SNP	ENST00000398027.2	37	CCDS43623.1																																																																																				ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356083.1	NM_017984	
EXOC4	60412	broad.mit.edu	37	7	133002108	133002108	+	Missense_Mutation	SNP	G	G	A	rs372024692		TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr7:133002108G>A	ENST00000253861.4	+	5	756	c.727G>A	c.(727-729)Gat>Aat	p.D243N	EXOC4_ENST00000539845.1_Missense_Mutation_p.D142N|EXOC4_ENST00000393161.2_Missense_Mutation_p.D243N	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	243					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				AAAATTCCTTGATACCTCTCA	0.413																																					p.D243N												.	.	0			c.G727A	7						.	G	ASN/ASP,ASN/ASP	0,4406		0,0,2203	226.0	210.0	215.0		727,727	5.4	0.3	7		215	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	EXOC4	NM_001037126.1,NM_021807.3	23,23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	243/474,243/975	133002108	1,13005	2203	4300	6503	132652648	SO:0001583	missense	60412	exon5			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.727G>A	7.37:g.133002108G>A	ENSP00000253861:p.Asp243Asn	None		Unspecified	Illumina	Phase_I	132652648	NM_001037126	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.916612	0.33815	0.0	1.16E-4	ENSG00000131558	ENST00000253861;ENST00000393161;ENST00000539845	.	.	.	5.4	5.4	0.78164	.	0.202361	0.51477	D	0.000084	T	0.64080	0.2566	M	0.64404	1.975	0.80722	D	1	B;B	0.10296	0.003;0.0	B;B	0.09377	0.004;0.001	T	0.59107	-0.7516	9	0.21540	T	0.41	.	16.7445	0.85468	0.0:0.0:1.0:0.0	.	243;243	Q96A65;Q8TAR2	EXOC4_HUMAN;.	N	243;243;142	.	ENSP00000253861:D243N	D	+	1	0	EXOC4	132652648	0.998000	0.40836	0.333000	0.25482	0.499000	0.33736	5.438000	0.66550	2.567000	0.86603	0.558000	0.71614	GAT		EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
ZNF335	63925	broad.mit.edu	37	20	44588925	44588927	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr20:44588925_44588927delGCT	ENST00000322927.2	-	14	2040_2042	c.1940_1942delAGC	c.(1939-1944)aagccc>acc	p.647_648KP>T	ZNF335_ENST00000426788.1_In_Frame_Del_p.492_493KP>T	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	647					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)	p.K647_P648>T(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CATTTGAAGGGCTTGTCACTGAC	0.542																																					p.647_648del												.	.	1	Complex - deletion inframe(1)	large_intestine(1)	c.1940_1942del	20						.																																			44022334	SO:0001651	inframe_deletion	63925	exon14			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1940_1942delAGC	20.37:g.44588925_44588927delGCT	ENSP00000325326:p.Lys647_Pro648delinsThr	Somatic		Unspecified	Illumina	Phase_I	44022332	NM_022095	B4DLG7|Q548D0|Q9H684	In_Frame_Del	DEL	ENST00000322927.2	37	CCDS13389.1																																																																																				ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
SLC2A10	81031	broad.mit.edu	37	20	45358112	45358112	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr20:45358112A>G	ENST00000359271.2	+	4	1782	c.1532A>G	c.(1531-1533)cAg>cGg	p.Q511R		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	511					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)	p.Q511R(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				ATAGACCAGCAGTTCCAGAAG	0.522																																					p.Q511R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1532G	20						.						56.0	55.0	55.0					20																	45358112		2203	4300	6503	44791519	SO:0001583	missense	81031	exon4			AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.1532A>G	20.37:g.45358112A>G	ENSP00000352216:p.Gln511Arg	Somatic		Unspecified	Illumina	Phase_I	44791519	NM_030777	A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.419695	0.83559	.	.	ENSG00000197496	ENST00000359271	T	0.74002	-0.8	6.03	4.92	0.64577	Major facilitator superfamily domain, general substrate transporter (1);	0.264493	0.38778	N	0.001577	T	0.71600	0.3359	N	0.12920	0.275	0.38424	D	0.946263	D	0.64830	0.994	D	0.64595	0.927	T	0.69491	-0.5131	10	0.18710	T	0.47	-0.9788	12.7331	0.57208	0.8768:0.0:0.0:0.1232	.	511	O95528	GTR10_HUMAN	R	511	ENSP00000352216:Q511R	ENSP00000352216:Q511R	Q	+	2	0	SLC2A10	44791519	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.491000	0.73649	1.078000	0.41014	0.533000	0.62120	CAG		SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2		
ACIN1	22985	broad.mit.edu	37	14	23564317	23564317	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr14:23564317G>A	ENST00000262710.1	-	1	506	c.179C>T	c.(178-180)gCg>gTg	p.A60V	C14orf119_ENST00000554203.1_5'Flank|ACIN1_ENST00000457657.1_Missense_Mutation_p.A60V|ACIN1_ENST00000555053.1_Missense_Mutation_p.A60V|C14orf119_ENST00000319074.4_5'UTR|ACIN1_ENST00000605057.1_Missense_Mutation_p.A2V	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	60					apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A60V(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CTCCAGCTCCGCCATCTTGCG	0.652																																					p.A60V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C179T	14						.						47.0	46.0	46.0					14																	23564317		2203	4300	6503	22634157	SO:0001583	missense	22985	exon1			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.179C>T	14.37:g.23564317G>A	ENSP00000262710:p.Ala60Val	Somatic		Unspecified	Illumina	Phase_I	22634157	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	G	35	5.535441	0.96460	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.24538	1.86;1.89;1.85	5.45	5.45	0.79879	.	0.000000	0.35870	N	0.002936	T	0.33585	0.0868	N	0.08118	0	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	T	0.43718	-0.9374	10	0.87932	D	0	-11.0251	18.2118	0.89872	0.0:0.0:1.0:0.0	.	60;60	G3V3M7;Q9UKV3	.;ACINU_HUMAN	V	60	ENSP00000262710:A60V;ENSP00000405677:A60V;ENSP00000451328:A60V	ENSP00000262710:A60V	A	-	2	0	ACIN1	22634157	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.140000	0.89616	2.837000	0.97791	0.591000	0.81541	GCG		ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
ZFYVE26	23503	broad.mit.edu	37	14	68264768	68264768	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr14:68264768C>A	ENST00000347230.4	-	11	2349	c.2211G>T	c.(2209-2211)caG>caT	p.Q737H	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.Q737H	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	737					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TGTGTCTCCACTGGGCCTCAG	0.542																																					p.Q737H												.	.	0			c.G2211T	14						.						98.0	102.0	101.0					14																	68264768		2203	4300	6503	67334521	SO:0001583	missense	23503	exon11			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2211G>T	14.37:g.68264768C>A	ENSP00000251119:p.Gln737His	None		Unspecified	Illumina	Phase_I	67334521	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.405441	0.42715	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.35789	1.46;1.29	5.95	5.07	0.68467	.	0.055033	0.85682	D	0.000000	T	0.39200	0.1069	L	0.56769	1.78	0.53005	D	0.999961	P;P;P	0.50272	0.933;0.617;0.482	P;B;B	0.45406	0.479;0.221;0.11	T	0.25847	-1.0120	10	0.45353	T	0.12	-17.4683	11.8331	0.52307	0.0:0.8008:0.1307:0.0686	.	737;737;737	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	H	737;716;737	ENSP00000251119:Q737H;ENSP00000450603:Q737H	ENSP00000251119:Q737H	Q	-	3	2	ZFYVE26	67334521	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	1.872000	0.39549	1.528000	0.49103	-0.150000	0.13652	CAG		ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
TRIP11	9321	broad.mit.edu	37	14	92471877	92471877	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr14:92471877T>C	ENST00000267622.4	-	11	2816	c.2443A>G	c.(2443-2445)Att>Gtt	p.I815V		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	815					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.I815V(1)		breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TCAATAAAAATTTCTTTCTTG	0.313			T	PDGFRB	AML																																p.I815V	Ovarian(84;609 1888 9852 42686)		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2443G	14						.						67.0	73.0	71.0					14																	92471877		2203	4297	6500	91541630	SO:0001583	missense	9321	exon11			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.2443A>G	14.37:g.92471877T>C	ENSP00000267622:p.Ile815Val	Somatic		Unspecified	Illumina	Phase_I	91541630	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.005|0.005	-2.135516|-2.135516	0.00335|0.00335	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	T|.	0.03772|.	3.81|.	5.77|5.77	-1.14|-1.14	0.09741|0.09741	.|.	0.714554|.	0.14207|.	N|.	0.334345|.	T|T	0.22282|0.22282	0.0537|0.0537	L|L	0.31926|0.31926	0.97|0.97	0.09310|0.09310	N|N	1|1	B;B|.	0.09022|.	0.001;0.002|.	B;B|.	0.06405|.	0.001;0.002|.	T|T	0.25222|0.25222	-1.0138|-1.0138	10|5	0.27082|.	T|.	0.32|.	.|.	1.3989|1.3989	0.02267|0.02267	0.1186:0.2406:0.2441:0.3968|0.1186:0.2406:0.2441:0.3968	.|.	551;815|.	F5H1Z0;Q15643|.	.;TRIPB_HUMAN|.	V|S	815;551|530	ENSP00000267622:I815V|.	ENSP00000267622:I815V|.	I|N	-|-	1|2	0|0	TRIP11|TRIP11	91541630|91541630	0.000000|0.000000	0.05858|0.05858	0.031000|0.031000	0.17742|0.17742	0.601000|0.601000	0.36947|0.36947	-0.080000|-0.080000	0.11339|0.11339	-0.422000|-0.422000	0.07405|0.07405	0.254000|0.254000	0.18369|0.18369	ATT|AAT		TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
SERPINA1	5265	broad.mit.edu	37	14	94848949	94848949	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr14:94848949A>G	ENST00000448921.1	-	4	1198	c.626T>C	c.(625-627)gTg>gCg	p.V209A	SERPINA1_ENST00000404814.4_Missense_Mutation_p.V209A|SERPINA1_ENST00000402629.1_Missense_Mutation_p.V209A|SERPINA1_ENST00000393087.4_Missense_Mutation_p.V209A|SERPINA1_ENST00000555289.1_5'Flank|SERPINA1_ENST00000393088.4_Missense_Mutation_p.V209A|SERPINA1_ENST00000437397.1_Missense_Mutation_p.V209A|SERPINA1_ENST00000355814.4_Missense_Mutation_p.V209A|SERPINA1_ENST00000449399.3_Missense_Mutation_p.V209A|SERPINA1_ENST00000440909.1_Missense_Mutation_p.V209A	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	209					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.V209A(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		GATGTAATTCACCAGAGCAAA	0.423																																					p.V209A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T626C	14						.						106.0	109.0	108.0					14																	94848949		2203	4300	6503	93918702	SO:0001583	missense	5265	exon3			X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.626T>C	14.37:g.94848949A>G	ENSP00000416066:p.Val209Ala	Somatic		Unspecified	Illumina	Phase_I	93918702	NM_001127702	A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Missense_Mutation	SNP	ENST00000448921.1	37	CCDS9925.1	.	.	.	.	.	.	.	.	.	.	A	19.99	3.929126	0.73327	.	.	ENSG00000197249	ENST00000440909;ENST00000448921;ENST00000437397;ENST00000355814;ENST00000393087;ENST00000393088;ENST00000404814;ENST00000449399;ENST00000402629	D;D;D;D;D;D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25;-2.25;-2.25;-2.25;-2.25;-2.25	5.79	4.61	0.57282	Serpin domain (3);	0.473727	0.19413	N	0.114896	D	0.91536	0.7327	M	0.82433	2.59	0.32386	N	0.553927	P;P	0.49635	0.926;0.812	P;P	0.56823	0.768;0.807	D	0.91650	0.5334	10	0.38643	T	0.18	.	10.7189	0.46030	0.8656:0.0:0.1344:0.0	.	209;209	P01009-2;P01009	.;A1AT_HUMAN	A	209	ENSP00000390299:V209A;ENSP00000416066:V209A;ENSP00000408474:V209A;ENSP00000348068:V209A;ENSP00000376802:V209A;ENSP00000376803:V209A;ENSP00000385960:V209A;ENSP00000416354:V209A;ENSP00000386094:V209A	ENSP00000348068:V209A	V	-	2	0	SERPINA1	93918702	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.976000	0.76135	0.981000	0.38548	0.459000	0.35465	GTG		SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317768.2	NM_001002235	
AHNAK2	113146	broad.mit.edu	37	14	105416570	105416570	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr14:105416570G>T	ENST00000333244.5	-	7	5337	c.5218C>A	c.(5218-5220)Cac>Aac	p.H1740N	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1740						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTGGGGAGGTGCCCTTTGAAG	0.642																																					p.H1740N												.	.	0			c.C5218A	14						.						85.0	98.0	94.0					14																	105416570		1816	4037	5853	104487615	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.5218C>A	14.37:g.105416570G>T	ENSP00000353114:p.His1740Asn	None		Unspecified	Illumina	Phase_I	104487615	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	1.360	-0.589119	0.03799	.	.	ENSG00000185567	ENST00000333244	T	0.01918	4.56	4.61	3.68	0.42216	.	.	.	.	.	T	0.06600	0.0169	L	0.45581	1.43	0.09310	N	1	D	0.61080	0.989	D	0.71184	0.972	T	0.39354	-0.9618	9	0.18276	T	0.48	-25.3783	9.3866	0.38347	0.0:0.281:0.5734:0.1455	.	1740	Q8IVF2	AHNK2_HUMAN	N	1740	ENSP00000353114:H1740N	ENSP00000353114:H1740N	H	-	1	0	AHNAK2	104487615	0.008000	0.16893	0.675000	0.29917	0.007000	0.05969	0.907000	0.28531	2.124000	0.65301	0.505000	0.49811	CAC		AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
TANGO2	128989	broad.mit.edu	37	22	20030945	20030945	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr22:20030945A>G	ENST00000327374.4	+	3	302	c.124A>G	c.(124-126)Aac>Gac	p.N42D	TANGO2_ENST00000432883.1_Missense_Mutation_p.N42D|TANGO2_ENST00000398042.2_Missense_Mutation_p.N42D|TANGO2_ENST00000434570.2_Missense_Mutation_p.N83D|TANGO2_ENST00000401886.1_Missense_Mutation_p.N42D|TANGO2_ENST00000456048.1_Missense_Mutation_p.N47D|TANGO2_ENST00000447208.2_Missense_Mutation_p.N42D|TANGO2_ENST00000401833.1_Missense_Mutation_p.N83D|TANGO2_ENST00000420290.2_5'UTR|TANGO2_ENST00000479679.1_3'UTR	NM_001283106.1|NM_001283116.1|NM_001283148.1|NM_001283154.1|NM_152906.4	NP_001270035.1|NP_001270045.1|NP_001270077.1|NP_001270083.1|NP_690870.3	Q6ICL3	TNG2_HUMAN	transport and golgi organization 2 homolog (Drosophila)	42								p.N42D(1)									CTTCTGGGGGAACAACAACGA	0.567																																					p.N42D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A124G	22						.						137.0	140.0	139.0					22																	20030945		2203	4300	6503	18410945	SO:0001583	missense	128989	exon3				CCDS13772.1, CCDS63404.1, CCDS63405.1, CCDS63406.1, CCDS63407.1, CCDS74821.1, CCDS74822.1	22q11.21	2012-12-13	2012-12-13	2012-12-13	ENSG00000183597	ENSG00000183597			25439	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 25"""	C22orf25		12477932	Standard	XM_005261222		Approved	DKFZp761P1121	uc002zrc.1	Q6ICL3	OTTHUMG00000150510	ENST00000327374.4:c.124A>G	22.37:g.20030945A>G	ENSP00000332721:p.Asn42Asp	Somatic		Unspecified	Illumina	Phase_I	18410945	NM_152906	A8MUE9|B7WNV6|B7Z583|B7Z730|D3DX23|Q8IW05|Q8NAL0|Q8TCS0|Q96M16	Missense_Mutation	SNP	ENST00000327374.4	37	CCDS13772.1	.	.	.	.	.	.	.	.	.	.	A	0.201	-1.045089	0.01997	.	.	ENSG00000183597	ENST00000401886;ENST00000432198;ENST00000447208;ENST00000398042;ENST00000450664;ENST00000327374;ENST00000432883;ENST00000401833;ENST00000434168;ENST00000434570;ENST00000456048	T;T;T;T;T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92	4.89	2.71	0.32032	.	0.683909	0.15490	N	0.259634	T	0.09379	0.0231	N	0.04335	-0.225	0.80722	D	1	B;B;B;B;B;B;B	0.11235	0.001;0.002;0.004;0.001;0.004;0.0;0.0	B;B;B;B;B;B;B	0.12156	0.004;0.007;0.003;0.004;0.007;0.002;0.001	T	0.24870	-1.0148	10	0.02654	T	1	-6.4641	7.9459	0.29987	0.8224:0.0:0.1776:0.0	.	42;83;42;83;42;42;42	B7Z9Q5;B7Z730;B7Z4A5;B7WNV6;Q6AHY1;Q6ICL3;Q6ICL3-2	.;.;.;.;.;CV025_HUMAN;.	D	42;42;42;42;42;42;42;83;42;83;47	ENSP00000385662:N42D;ENSP00000413850:N42D;ENSP00000389797:N42D;ENSP00000381122:N42D;ENSP00000415450:N42D;ENSP00000332721:N42D;ENSP00000402926:N42D;ENSP00000384827:N83D;ENSP00000411602:N42D;ENSP00000391262:N83D;ENSP00000403645:N47D	ENSP00000332721:N42D	N	+	1	0	C22orf25	18410945	0.587000	0.26791	0.164000	0.22755	0.043000	0.13939	1.382000	0.34374	0.292000	0.22492	0.459000	0.35465	AAC		TANGO2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318689.2	NM_152906	
CSF2RB	1439	broad.mit.edu	37	22	37331394	37331394	+	Splice_Site	SNP	G	G	C			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr22:37331394G>C	ENST00000403662.3	+	11	1539	c.1317G>C	c.(1315-1317)gtG>gtC	p.V439V	CSF2RB_ENST00000262825.5_Splice_Site_p.V445V|CSF2RB_ENST00000406230.1_Splice_Site_p.V445V|CSF2RB_ENST00000536485.1_Splice_Site_p.V386V			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	439					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.V439V(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	TGCTGGAAGTGCTGCCTATGT	0.602																																					p.V439V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1317C	22						.						134.0	101.0	112.0					22																	37331394		2203	4300	6503	35661340	SO:0001630	splice_region_variant	1439	exon11			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.1316-1G>C	22.37:g.37331394G>C		Somatic		Unspecified	Illumina	Phase_I	35661340	NM_000395	Q5JZI1|Q6ICE0	Silent	SNP	ENST00000403662.3	37	CCDS13936.1																																																																																				CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395	Silent
L3MBTL2	83746	broad.mit.edu	37	22	41621031	41621031	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr22:41621031G>A	ENST00000216237.5	+	11	1470	c.1312G>A	c.(1312-1314)Gac>Aac	p.D438N		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	438					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGAGGCCATTGACCCCCTGAA	0.597																																					p.D438N												.	.	0			c.G1312A	22						.						169.0	159.0	162.0					22																	41621031		2203	4300	6503	39950977	SO:0001583	missense	83746	exon11			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1312G>A	22.37:g.41621031G>A	ENSP00000216237:p.Asp438Asn	None		Unspecified	Illumina	Phase_I	39950977	NM_031488	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	37	CCDS14011.1	.	.	.	.	.	.	.	.	.	.	G	35	5.518447	0.96416	.	.	ENSG00000100395	ENST00000216237	T	0.52057	0.68	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.71904	0.3395	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72293	-0.4336	10	0.45353	T	0.12	.	19.4437	0.94838	0.0:0.0:1.0:0.0	.	438;438	Q969R5-3;Q969R5	.;LMBL2_HUMAN	N	438	ENSP00000216237:D438N	ENSP00000216237:D438N	D	+	1	0	L3MBTL2	39950977	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.600000	0.87896	0.561000	0.74099	GAC		L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	NM_031488	
PKN1	5585	broad.mit.edu	37	19	14580191	14580191	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr19:14580191G>C	ENST00000242783.6	+	16	2180	c.2015G>C	c.(2014-2016)aGt>aCt	p.S672T	PKN1_ENST00000342216.4_Missense_Mutation_p.S678T	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	672	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						GCAGTGACCAGTGCGGGACAC	0.607																																					p.S678T	NSCLC(185;2539 2965 10733 52867)											.	.	0			c.G2033C	19						.						102.0	117.0	112.0					19																	14580191		2126	4224	6350	14441191	SO:0001583	missense	5585	exon16			S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.2015G>C	19.37:g.14580191G>C	ENSP00000242783:p.Ser672Thr	None		Unspecified	Illumina	Phase_I	14441191	NM_213560	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	ENST00000242783.6	37	CCDS42513.1	.	.	.	.	.	.	.	.	.	.	G	0.030	-1.339843	0.01277	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.24723	1.84;1.84	3.45	-0.0114	0.13992	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.886059	0.09679	U	0.770030	T	0.16854	0.0405	L	0.32530	0.975	0.09310	N	1	B;B	0.12013	0.004;0.005	B;B	0.14578	0.006;0.011	T	0.31724	-0.9933	10	0.28530	T	0.3	-12.0979	5.846	0.18665	0.2742:0.1457:0.5801:0.0	.	678;672	Q16512-2;Q16512	.;PKN1_HUMAN	T	672;678	ENSP00000242783:S672T;ENSP00000343325:S678T	ENSP00000242783:S672T	S	+	2	0	PKN1	14441191	0.000000	0.05858	0.013000	0.15412	0.018000	0.09664	-1.269000	0.02834	-0.262000	0.09392	-1.564000	0.00881	AGT		PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	NM_002741, NM_213560	
HAUS8	93323	broad.mit.edu	37	19	17170455	17170455	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr19:17170455C>A	ENST00000253669.5	-	6	522	c.332G>T	c.(331-333)aGc>aTc	p.S111I	HAUS8_ENST00000448593.2_Missense_Mutation_p.S110I|HAUS8_ENST00000593360.1_Missense_Mutation_p.S50I			Q9BT25	HAUS8_HUMAN	HAUS augmin-like complex, subunit 8	111					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.S111I(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	12						TTTGACGATGCTTTTGTCTAA	0.398																																					p.S110I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G329T	19						.						129.0	125.0	127.0					19																	17170455		2203	4300	6503	17031455	SO:0001583	missense	93323	exon6			BC004398	CCDS32948.1, CCDS46009.1	19p13.11	2013-10-11	2009-04-20	2009-04-20	ENSG00000131351	ENSG00000131351		"""HAUS augmin-like complex subunits"""	30532	protein-coding gene	gene with protein product		613434	"""HEC1/NDC80 interacting, centrosome associated 1"""	HICE1		19427217	Standard	XM_005260154		Approved	MGC20533, NY-SAR-48	uc002nfe.3	Q9BT25		ENST00000253669.5:c.332G>T	19.37:g.17170455C>A	ENSP00000253669:p.Ser111Ile	Somatic		Unspecified	Illumina	Phase_I	17031455	NM_001011699	B4DJA7|C9JBZ4|Q49AC4|Q86WF0|Q96FX3	Missense_Mutation	SNP	ENST00000253669.5	37	CCDS32948.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235588	0.39498	.	.	ENSG00000131351	ENST00000253669;ENST00000448593	T;T	0.42900	0.96;0.96	2.84	2.84	0.33178	.	0.426114	0.22098	N	0.064654	T	0.51941	0.1704	L	0.49350	1.555	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.994;0.994	T	0.42982	-0.9419	10	0.27785	T	0.31	-8.1076	9.3687	0.38241	0.0:1.0:0.0:0.0	.	50;110;111	Q9BT25-2;C9JBZ4;Q9BT25	.;.;HAUS8_HUMAN	I	111;110	ENSP00000253669:S111I;ENSP00000395298:S110I	ENSP00000253669:S111I	S	-	2	0	HAUS8	17031455	0.053000	0.20554	0.250000	0.24296	0.106000	0.19336	1.265000	0.33027	1.910000	0.55303	0.561000	0.74099	AGC		HAUS8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463015.1	NM_001011699	
ARRDC2	27106	broad.mit.edu	37	19	18120673	18120674	+	Missense_Mutation	DNP	AG	AG	GC			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr19:18120673_18120674AG>GC	ENST00000222250.4	+	5	817_818	c.674_675AG>GC	c.(673-675)cAG>cGC	p.Q225R	ARRDC2_ENST00000379656.3_Missense_Mutation_p.Q220R	NM_015683.1	NP_056498.1	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2	225					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)		p.Q220>?(1)		endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)	12						GTGCAGACACAGACGTTCATGG	0.693																																					.												.	.	1	Complex(1)	large_intestine(1)	c.659_660GC	19						.																																			17981674	SO:0001583	missense	27106	exon5				CCDS12370.1, CCDS32956.1	19p13.12	2008-02-05				ENSG00000105643			25225	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015683		Approved	CLONE24945, PP2703	uc002nhv.3	Q8TBH0		Exception_encountered	19.37:g.18120673_18120674delinsGC	ENSP00000222250:p.Gln225Arg	Somatic		Unspecified	Illumina	Phase_I	17981673	NM_001025604	B2RBG9|O95895|Q6ZRV9|Q8WYG6	Missense_Mutation	DNP	ENST00000222250.4	37	CCDS12370.1																																																																																				ARRDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466845.1	NM_015683	
TSHZ3	57616	broad.mit.edu	37	19	31768811	31768811	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr19:31768811C>T	ENST00000240587.4	-	2	2215	c.1888G>A	c.(1888-1890)Gag>Aag	p.E630K		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	630					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CCATCCGGCTCCTTCATCTTC	0.582																																					p.E630K												.	.	0			c.G1888A	19						.						45.0	50.0	48.0					19																	31768811		2203	4299	6502	36460651	SO:0001583	missense	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1888G>A	19.37:g.31768811C>T	ENSP00000240587:p.Glu630Lys	None		Unspecified	Illumina	Phase_I	36460651	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	12.12	1.841870	0.32513	.	.	ENSG00000121297	ENST00000240587	T	0.46063	0.88	5.3	5.3	0.74995	.	0.144725	0.56097	D	0.000033	T	0.21347	0.0514	N	0.03608	-0.345	0.51233	D	0.999918	B	0.16603	0.018	B	0.10450	0.005	T	0.15752	-1.0426	10	0.06236	T	0.91	-30.7539	18.9628	0.92682	0.0:1.0:0.0:0.0	.	630	Q63HK5	TSH3_HUMAN	K	630	ENSP00000240587:E630K	ENSP00000240587:E630K	E	-	1	0	TSHZ3	36460651	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.461000	0.80834	2.467000	0.83353	0.585000	0.79938	GAG		TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
ZFR2	23217	broad.mit.edu	37	19	3823262	3823262	+	Silent	SNP	G	G	T			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr19:3823262G>T	ENST00000262961.4	-	8	1363	c.1353C>A	c.(1351-1353)ggC>ggA	p.G451G		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	451							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.G451G(1)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		CATATTCCGGGCCCACCGGCT	0.622																																					p.G451G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1353A	19						.						91.0	97.0	95.0					19																	3823262		1917	4120	6037	3774262	SO:0001819	synonymous_variant	23217	exon8			AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.1353C>A	19.37:g.3823262G>T		Somatic		Unspecified	Illumina	Phase_I	3774262	NM_015174		Silent	SNP	ENST00000262961.4	37	CCDS45921.1																																																																																				ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2	NM_015174	
TSHZ3	57616	broad.mit.edu	37	19	31769600	31769600	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr19:31769600C>T	ENST00000240587.4	-	2	1426	c.1099G>A	c.(1099-1101)Ggc>Agc	p.G367S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	367					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G184S(2)|p.G367S(2)|p.Y366_G367>*(1)|p.Y183_G184>*(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TTCTGGTGGCCGTACCGATTA	0.557																																					p.G367S												.	.	6	Substitution - Missense(4)|Complex - deletion inframe(2)	large_intestine(2)|lung(2)|endometrium(2)	c.G1099A	19						.						246.0	236.0	240.0					19																	31769600		2203	4300	6503	36461440	SO:0001583	missense	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1099G>A	19.37:g.31769600C>T	ENSP00000240587:p.Gly367Ser	Somatic		Unspecified	Illumina	Phase_I	36461440	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	13.78	2.340420	0.41498	.	.	ENSG00000121297	ENST00000240587	T	0.15952	2.38	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.40619	0.1124	M	0.66297	2.02	0.80722	D	1	D	0.76494	0.999	D	0.63957	0.92	T	0.16129	-1.0413	10	0.54805	T	0.06	-41.6635	18.9894	0.92784	0.0:1.0:0.0:0.0	.	367	Q63HK5	TSH3_HUMAN	S	367	ENSP00000240587:G367S	ENSP00000240587:G367S	G	-	1	0	TSHZ3	36461440	1.000000	0.71417	0.999000	0.59377	0.033000	0.12548	7.461000	0.80834	2.468000	0.83385	0.655000	0.94253	GGC		TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
PNMAL1	55228	broad.mit.edu	37	19	46973959	46973959	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr19:46973959C>A	ENST00000313683.10	-	2	639	c.334G>T	c.(334-336)Gaa>Taa	p.E112*	PNMAL1_ENST00000602246.1_Intron|PNMAL1_ENST00000438932.2_Nonsense_Mutation_p.E112*	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	112								p.E112*(2)		cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		tccaggaattcattcagattt	0.577																																					p.E112X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G334T	19						.						42.0	44.0	43.0					19																	46973959		2203	4300	6503	51665799	SO:0001587	stop_gained	55228	exon2			BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.334G>T	19.37:g.46973959C>A	ENSP00000318131:p.Glu112*	Somatic		Unspecified	Illumina	Phase_I	51665799	NM_018215	A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Nonsense_Mutation	SNP	ENST00000313683.10	37	CCDS33059.1	.	.	.	.	.	.	.	.	.	.	C	38	6.932287	0.97944	.	.	ENSG00000182013	ENST00000438932;ENST00000313683;ENST00000417103	.	.	.	3.36	3.36	0.38483	.	0.206543	0.24298	N	0.039753	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-22.4724	10.5182	0.44903	0.0:1.0:0.0:0.0	.	.	.	.	X	112	.	ENSP00000318131:E112X	E	-	1	0	PNMAL1	51665799	0.463000	0.25799	0.517000	0.27799	0.898000	0.52572	1.152000	0.31663	2.185000	0.69588	0.655000	0.94253	GAA		PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403929.1	NM_018215	
USP17L2	377630	broad.mit.edu	37	8	11995190	11995190	+	Silent	SNP	A	A	G			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr8:11995190A>G	ENST00000333796.3	-	1	1396	c.1080T>C	c.(1078-1080)acT>acC	p.T360T	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	360	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.T360T(1)		central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						TCAGGACAGAAGTGATGCTAC	0.483																																					p.T360T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1080C	8						.						58.0	61.0	60.0					8																	11995190		1816	3997	5813	12032599	SO:0001819	synonymous_variant	377630	exon1			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1080T>C	8.37:g.11995190A>G		Somatic		Unspecified	Illumina	Phase_I	12032599	NM_201402		Silent	SNP	ENST00000333796.3	37	CCDS43713.1																																																																																				USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2	NM_201402	
EBF2	64641	broad.mit.edu	37	8	25718591	25718591	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr8:25718591G>C	ENST00000520164.1	-	13	1853	c.1316C>G	c.(1315-1317)tCa>tGa	p.S439*	EBF2_ENST00000408929.3_Nonsense_Mutation_p.S291*|EBF2_ENST00000535548.1_Nonsense_Mutation_p.S170*	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	439					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S439*(2)		endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TGTTGACTCTGAGATGCTGAC	0.488																																					p.S439X	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)											.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1316G	8						.						132.0	131.0	132.0					8																	25718591		1980	4171	6151	25774508	SO:0001587	stop_gained	64641	exon13			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.1316C>G	8.37:g.25718591G>C	ENSP00000430241:p.Ser439*	Somatic		Unspecified	Illumina	Phase_I	25774508	NM_022659	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Nonsense_Mutation	SNP	ENST00000520164.1	37	CCDS43726.1	.	.	.	.	.	.	.	.	.	.	G	36	5.946411	0.97134	.	.	ENSG00000221818	ENST00000520164;ENST00000408929;ENST00000535548	.	.	.	5.29	5.29	0.74685	.	0.122041	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-23.7317	18.9368	0.92589	0.0:0.0:1.0:0.0	.	.	.	.	X	439;291;170	.	ENSP00000386178:S291X	S	-	2	0	EBF2	25774508	1.000000	0.71417	1.000000	0.80357	0.262000	0.26303	5.762000	0.68809	2.476000	0.83614	0.655000	0.94253	TCA		EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
PRKDC	5591	broad.mit.edu	37	8	48866458	48866459	+	Missense_Mutation	DNP	AG	AG	CA			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr8:48866458_48866459AG>CA	ENST00000314191.2	-	6	585_586	c.529_530CT>TG	c.(529-531)CTc>TGc	p.L177C	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.L177C	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	177					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.L177>?(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TAATCCTAGGAGCTCATATACT	0.337								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)											.	.	2	Complex(2)	large_intestine(2)	c.529_530TG	8						.																																			49029012	SO:0001583	missense	5591	exon6				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.529_530delinsCA	8.37:g.48866458_48866459delinsCA	ENSP00000313420:p.Leu177Cys	Somatic		Unspecified	Illumina	Phase_I	49029011	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	DNP	ENST00000314191.2	37																																																																																					PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
NSMAF	8439	broad.mit.edu	37	8	59535796	59535796	+	Silent	SNP	T	T	C			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr8:59535796T>C	ENST00000038176.3	-	9	752	c.540A>G	c.(538-540)acA>acG	p.T180T	NSMAF_ENST00000427130.2_Silent_p.T211T|NSMAF_ENST00000519858.1_5'UTR	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	180	GRAM.				ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)	p.T180T(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				TGTCAAATGATGTTCTAGCTA	0.303																																					p.T180T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A540G	8						.						54.0	51.0	52.0					8																	59535796		2203	4300	6503	59698350	SO:0001819	synonymous_variant	8439	exon9			X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.540A>G	8.37:g.59535796T>C		Somatic		Unspecified	Illumina	Phase_I	59698350	NM_003580	B4DFB0|E9PCH0|Q8IW26	Silent	SNP	ENST00000038176.3	37	CCDS6173.1																																																																																				NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580	
HEY1	23462	broad.mit.edu	37	8	80678909	80678909	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr8:80678909A>G	ENST00000354724.3	-	4	507	c.308T>C	c.(307-309)aTg>aCg	p.M103T	RP11-26J3.1_ENST00000502766.2_lincRNA|RP11-27N21.3_ENST00000607172.1_lincRNA|HEY1_ENST00000435063.2_5'Flank|HEY1_ENST00000523976.1_5'Flank|HEY1_ENST00000337919.5_Missense_Mutation_p.M107T	NM_012258.3	NP_036390.3	Q9Y5J3	HEY1_HUMAN	hes-related family bHLH transcription factor with YRPW motif 1	103	Transcriptional repression and interaction with NCOR1 and SIN3A. {ECO:0000250}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular valve formation (GO:0003190)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac septum morphogenesis (GO:0060411)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to glucocorticoid stimulus (GO:0071385)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion morphogenesis (GO:0003203)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve morphogenesis (GO:0003184)|regulation of vasculogenesis (GO:2001212)|transcription from RNA polymerase II promoter (GO:0006366)|umbilical cord morphogenesis (GO:0036304)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.M103T(1)	HEY1/NCOA2(10)	cervix(1)|kidney(2)|large_intestine(5)|lung(14)	22	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			CGTATGCAGCATTTTCAGGTG	0.502			T	NCOA2	mesenchymal chondrosarcoma																																p.M103T			Dom	yes		8	8q21	23462	hairy/enhancer-of-split related with YRPW motif 1		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T308C	8						.						234.0	223.0	227.0					8																	80678909		2203	4300	6503	80841464	SO:0001583	missense	23462	exon4			AF151522	CCDS6225.1, CCDS43749.1, CCDS64915.1	8q21	2013-10-17	2013-10-17					"""Basic helix-loop-helix proteins"""	4880	protein-coding gene	gene with protein product		602953	"""hairy/enhancer-of-split related with YRPW motif 1"""			10415358, 10403790	Standard	NM_001040708		Approved	HESR-1, CHF2, HESR1, HRT-1, CHF-2, HERP2, BHLHb31	uc003ybl.3	Q9Y5J3		ENST00000354724.3:c.308T>C	8.37:g.80678909A>G	ENSP00000346761:p.Met103Thr	Somatic		Unspecified	Illumina	Phase_I	80841464	NM_012258	B2R883|Q5TZS3|Q8NAM2|Q9NYP4	Missense_Mutation	SNP	ENST00000354724.3	37	CCDS6225.1	.	.	.	.	.	.	.	.	.	.	A	17.96	3.515848	0.64634	.	.	ENSG00000164683	ENST00000354724;ENST00000542205;ENST00000337919;ENST00000518733	D;D;D	0.97811	-4.55;-4.55;-4.55	4.9	4.9	0.64082	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.95557	0.8556	N	0.02960	-0.455	0.80722	D	1	D;B	0.56521	0.976;0.228	D;B	0.65140	0.932;0.125	D	0.96333	0.9245	10	0.41790	T	0.15	-15.2159	14.5443	0.68017	1.0:0.0:0.0:0.0	.	103;107	Q9Y5J3;Q9Y5J3-2	HEY1_HUMAN;.	T	103;107;107;65	ENSP00000346761:M103T;ENSP00000338272:M107T;ENSP00000429705:M65T	ENSP00000338272:M107T	M	-	2	0	HEY1	80841464	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.927000	0.92846	1.825000	0.53177	0.459000	0.35465	ATG		HEY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379516.1	NM_012258	
LY6D	8581	broad.mit.edu	37	8	143867013	143867013	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr8:143867013G>A	ENST00000301263.4	-	2	218	c.143C>T	c.(142-144)aCg>aTg	p.T48M	RP11-706C16.8_ENST00000510610.2_RNA|LY6D_ENST00000518434.1_5'UTR	NM_003695.2	NP_003686.1	Q14210	LY6D_HUMAN	lymphocyte antigen 6 complex, locus D	48	UPAR/Ly6.				cell adhesion (GO:0007155)|lymphocyte differentiation (GO:0030098)|response to stilbenoid (GO:0035634)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.T48M(1)		large_intestine(1)|lung(3)|prostate(1)	5	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					ACCTGTGTTCGTGGTCTTGCA	0.642																																					p.T48M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C143T	8						.						76.0	74.0	75.0					8																	143867013		2203	4300	6503	143864015	SO:0001583	missense	8581	exon2			U66837	CCDS6390.1	8q24	2004-07-06			ENSG00000167656	ENSG00000167656			13348	protein-coding gene	gene with protein product		606204				7790363, 9551972	Standard	NM_003695		Approved	E48	uc003yxf.1	Q14210	OTTHUMG00000164693	ENST00000301263.4:c.143C>T	8.37:g.143867013G>A	ENSP00000301263:p.Thr48Met	Somatic		Unspecified	Illumina	Phase_I	143864015	NM_003695	B2R5F1|D3DWJ0|O43783|Q6GTV9|Q8TBD4|Q92933	Missense_Mutation	SNP	ENST00000301263.4	37	CCDS6390.1	.	.	.	.	.	.	.	.	.	.	a	7.273	0.607634	0.14002	.	.	ENSG00000167656	ENST00000301263	T	0.70749	-0.51	3.15	0.199	0.15175	Ly-6 antigen / uPA receptor -like (1);CD59 antigen, conserved site (1);CD59 antigen (1);	1.524060	0.04307	N	0.348249	T	0.49167	0.1541	N	0.10972	0.075	0.09310	N	1	B	0.17038	0.02	B	0.06405	0.002	T	0.29640	-1.0005	10	0.41790	T	0.15	-3.9964	3.3197	0.07045	0.4462:0.222:0.3319:0.0	.	48	Q14210	LY6D_HUMAN	M	48	ENSP00000301263:T48M	ENSP00000301263:T48M	T	-	2	0	LY6D	143864015	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.090000	0.15025	-0.252000	0.09528	-0.379000	0.06801	ACG		LY6D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379774.1	NM_003695	
CD53	963	broad.mit.edu	37	1	111437611	111437611	+	Silent	SNP	C	C	T	rs201211085		TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:111437611C>T	ENST00000271324.5	+	5	469	c.357C>T	c.(355-357)acC>acT	p.T119T	CD53_ENST00000429072.2_Intron|CD53_ENST00000497404.1_3'UTR	NM_000560.3|NM_001040033.1	NP_000551.1|NP_001035122.1	P19397	CD53_HUMAN	CD53 molecule	119					positive regulation of myoblast fusion (GO:1901741)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T119T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	17		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		AGGGTCTGACCGACAGCATCC	0.507																																					p.T119T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C357T	1						.						196.0	160.0	172.0					1																	111437611		2203	4300	6503	111239134	SO:0001819	synonymous_variant	963	exon5			BC040693	CCDS829.1	1p13	2013-02-14	2006-03-28		ENSG00000143119	ENSG00000143119		"""CD molecules"", ""Tetraspanins"""	1686	protein-coding gene	gene with protein product		151525	"""CD53 antigen"""	MOX44		8319976	Standard	XM_006711053		Approved	TSPAN25	uc001dzw.3	P19397	OTTHUMG00000048020	ENST00000271324.5:c.357C>T	1.37:g.111437611C>T		Somatic		Unspecified	Illumina	Phase_I	111239134	NM_000560	B2R905|Q5U0D6	Silent	SNP	ENST00000271324.5	37	CCDS829.1																																																																																				CD53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032931.1	NM_000560	
GBA	2629	broad.mit.edu	37	1	155209750	155209750	+	Silent	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:155209750G>A	ENST00000327247.5	-	4	466	c.234C>T	c.(232-234)cgC>cgT	p.R78R	GBA_ENST00000428024.3_5'UTR|GBA_ENST00000493842.1_5'UTR|GBA_ENST00000427500.3_Silent_p.R78R|GBA_ENST00000368373.3_Silent_p.R78R|GBA_ENST00000536770.1_Intron	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	78					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)	p.R78R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	TACTCTCATAGCGGCTGAAGG	0.577									Gaucher disease type I																												p.R78R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C234T	1						.						52.0	43.0	46.0					1																	155209750		2203	4300	6503	153476374	SO:0001819	synonymous_variant	2629	exon3	Familial Cancer Database	glucocerebrosidase insufficiency	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.234C>T	1.37:g.155209750G>A		Somatic		Unspecified	Illumina	Phase_I	153476374	NM_000157	A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Silent	SNP	ENST00000327247.5	37	CCDS1102.1																																																																																				GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087204.1	NM_000157	
NDUFS2	4720	broad.mit.edu	37	1	161179294	161179294	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:161179294G>A	ENST00000367993.3	+	6	984	c.536G>A	c.(535-537)cGt>cAt	p.R179H	NDUFS2_ENST00000392179.4_Missense_Mutation_p.R179H|NDUFS2_ENST00000476409.2_Missense_Mutation_p.R81H	NM_004550.4	NP_004541.1	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)	179					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|quinone binding (GO:0048038)	p.R179H(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	18	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Doxorubicin(DB00997)	GAAATCACACGTTTGTTGAAC	0.527											OREG0013941	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R179H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G536A	1						.						92.0	80.0	84.0					1																	161179294		2203	4300	6503	159445918	SO:0001583	missense	4720	exon6			BC008868	CCDS1224.1, CCDS53404.1	1q23.3	2011-07-04	2002-08-29		ENSG00000158864	ENSG00000158864	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7708	protein-coding gene	gene with protein product	"""complex I 49kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"""	602985	"""NADH dehydrogenase (ubiquinone) Fe-S protein 2 (49kD) (NADH-coenzyme Q reductase)"""			1832859, 9585441	Standard	NM_004550		Approved	CI-49	uc001fyw.3	O75306	OTTHUMG00000034344	ENST00000367993.3:c.536G>A	1.37:g.161179294G>A	ENSP00000356972:p.Arg179His	Somatic	1814	Unspecified	Illumina	Phase_I	159445918	NM_004550	D3DVG7|J3KPM7|Q5VTW0|Q969P3|Q9UEV3	Missense_Mutation	SNP	ENST00000367993.3	37	CCDS1224.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.982064	0.93044	.	.	ENSG00000158864	ENST00000367993;ENST00000392179;ENST00000476409	D;D;D	0.91180	-2.8;-2.8;-2.8	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.96439	0.8838	M	0.94063	3.49	0.58432	D	0.999992	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;1.0	D	0.97118	0.9809	9	0.87932	D	0	.	17.5462	0.87863	0.0:0.0:1.0:0.0	.	128;81;179;179	B7Z792;B7Z9L2;Q53HG2;O75306	.;.;.;NDUS2_HUMAN	H	179;179;81	ENSP00000356972:R179H;ENSP00000376018:R179H;ENSP00000446447:R81H	ENSP00000356972:R179H	R	+	2	0	NDUFS2	159445918	1.000000	0.71417	0.960000	0.40013	0.736000	0.42039	6.917000	0.75782	2.654000	0.90174	0.655000	0.94253	CGT		NDUFS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083015.1	NM_004550	
MROH9	80133	broad.mit.edu	37	1	170961432	170961432	+	Missense_Mutation	SNP	C	C	T	rs553009271	byFrequency	TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:170961432C>T	ENST00000367758.3	+	12	1255	c.1156C>T	c.(1156-1158)Cgt>Tgt	p.R386C	MROH9_ENST00000367759.4_Missense_Mutation_p.R386C	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	386								p.R386C(2)									GGAAGGGAAACGTTTCTCTCT	0.448													C|||	6	0.00119808	0.0	0.0	5008	,	,		20236	0.0		0.0	False		,,,				2504	0.0061				p.R386C												.	.	2	Substitution - Missense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.C1156T	1						.						168.0	170.0	169.0					1																	170961432		1969	4143	6112	169228056	SO:0001583	missense	80133	exon12			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.1156C>T	1.37:g.170961432C>T	ENSP00000356732:p.Arg386Cys	Somatic		Unspecified	Illumina	Phase_I	169228056	NM_025063	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367758.3	37	CCDS41436.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.385863	0.25031	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.16743	3.91;2.32	5.61	1.73	0.24493	.	0.405814	0.24014	N	0.042342	T	0.06962	0.0177	M	0.69823	2.125	0.09310	N	1	B;B	0.22541	0.071;0.032	B;B	0.18871	0.023;0.018	T	0.28490	-1.0042	10	0.46703	T	0.11	0.0523	7.4505	0.27235	0.0:0.655:0.0:0.345	.	386;386	F5GWX6;Q5TGP6	.;CA129_HUMAN	C	386	ENSP00000356733:R386C;ENSP00000356732:R386C	ENSP00000356732:R386C	R	+	1	0	C1orf129	169228056	0.134000	0.22483	0.000000	0.03702	0.001000	0.01503	0.897000	0.28390	0.073000	0.16731	-0.229000	0.12294	CGT		MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063	
CACNA1E	777	broad.mit.edu	37	1	181741329	181741329	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:181741329G>A	ENST00000367573.2	+	37	5101	c.5101G>A	c.(5101-5103)Gtg>Atg	p.V1701M	RNA5SP70_ENST00000517168.1_RNA|CACNA1E_ENST00000360108.3_Missense_Mutation_p.V1682M|CACNA1E_ENST00000358338.5_Missense_Mutation_p.V1633M|CACNA1E_ENST00000526775.1_Missense_Mutation_p.V1682M|CACNA1E_ENST00000367567.4_Missense_Mutation_p.V1308M|CACNA1E_ENST00000367570.1_Missense_Mutation_p.V1701M|CACNA1E_ENST00000357570.5_Missense_Mutation_p.V1652M	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1701					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.V1701M(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TCTGGCCTACGTGTACTTTGT	0.547																																					p.V1701M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5101A	1						.						218.0	216.0	217.0					1																	181741329		2185	4277	6462	180007952	SO:0001583	missense	777	exon37			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5101G>A	1.37:g.181741329G>A	ENSP00000356545:p.Val1701Met	Somatic		Unspecified	Illumina	Phase_I	180007952	NM_000721	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921974	0.73213	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98684	-5.07;-5.07;-5.07;-5.07;-5.07;-5.07;-5.07	5.77	3.65	0.41850	Ion transport (1);	0.232379	0.42821	D	0.000642	D	0.97489	0.9178	L	0.32530	0.975	0.45415	D	0.998393	P;P;D	0.56287	0.839;0.907;0.975	P;P;P	0.51833	0.542;0.652;0.681	D	0.97562	1.0099	10	0.54805	T	0.06	.	15.8891	0.79279	0.0:0.0:0.7427:0.2573	.	1682;1701;1701	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	M	1701;1682;1652;1633;1308;1682;1701	ENSP00000356542:V1701M;ENSP00000434814:V1682M;ENSP00000350183:V1652M;ENSP00000351101:V1633M;ENSP00000356539:V1308M;ENSP00000353222:V1682M;ENSP00000356545:V1701M	ENSP00000350183:V1652M	V	+	1	0	CACNA1E	180007952	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.645000	0.67909	1.387000	0.46486	0.643000	0.83706	GTG		CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
KCNT2	343450	broad.mit.edu	37	1	196398809	196398809	+	Silent	SNP	C	C	A			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:196398809C>A	ENST00000294725.9	-	9	1632	c.717G>T	c.(715-717)acG>acT	p.T239T	KCNT2_ENST00000609185.1_Silent_p.T239T|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000367433.5_Silent_p.T239T|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000367431.4_Silent_p.T239T			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	239					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.T239T(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CAGTAGAAAACGTCACAATGC	0.413																																					p.T239T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G717T	1						.						109.0	95.0	99.0					1																	196398809		2203	4300	6503	194665432	SO:0001819	synonymous_variant	343450	exon9			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.717G>T	1.37:g.196398809C>A		Somatic		Unspecified	Illumina	Phase_I	194665432	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	ENST00000294725.9	37	CCDS1384.1																																																																																				KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
DISP1	84976	broad.mit.edu	37	1	223176891	223176891	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:223176891C>T	ENST00000284476.6	+	8	2316	c.2152C>T	c.(2152-2154)Cgc>Tgc	p.R718C		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	718					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)	p.R718C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		CATTAAGTTTCGCTACCTTTG	0.423																																					p.R718C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2152T	1						.						163.0	160.0	161.0					1																	223176891		2203	4300	6503	221243514	SO:0001583	missense	84976	exon8			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.2152C>T	1.37:g.223176891C>T	ENSP00000284476:p.Arg718Cys	Somatic		Unspecified	Illumina	Phase_I	221243514	NM_032890	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	37	CCDS1536.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065781	0.76187	.	.	ENSG00000154309	ENST00000284476	D	0.87334	-2.24	5.73	5.73	0.89815	.	0.046696	0.85682	D	0.000000	D	0.93409	0.7898	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93407	0.6765	10	0.72032	D	0.01	-35.9979	19.8966	0.96963	0.0:1.0:0.0:0.0	.	718	Q96F81	DISP1_HUMAN	C	718	ENSP00000284476:R718C	ENSP00000284476:R718C	R	+	1	0	DISP1	221243514	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.818000	0.86416	2.700000	0.92200	0.655000	0.94253	CGC		DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890	
ZBTB8A	653121	broad.mit.edu	37	1	33065909	33065909	+	Silent	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:33065909G>A	ENST00000373510.4	+	5	1444	c.1215G>A	c.(1213-1215)gaG>gaA	p.E405E	RP1-27O5.3_ENST00000480336.1_3'UTR|ZBTB8OS_ENST00000341885.5_Missense_Mutation_p.S59F|ZBTB8A_ENST00000316459.4_3'UTR	NM_001040441.1	NP_001035531.1	Q96BR9	ZBT8A_HUMAN	zinc finger and BTB domain containing 8A	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E405E(1)		cervix(2)|large_intestine(2)|lung(2)|prostate(1)	7						GTGAAGATGAGAATAGATCCT	0.428																																					p.E405E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1215A	1						.						147.0	132.0	137.0					1																	33065909		2203	4300	6503	32838496	SO:0001819	synonymous_variant	653121	exon5			AF548353	CCDS30664.1	1p34.3	2013-01-08	2009-03-25	2009-03-25	ENSG00000160062	ENSG00000160062		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24172	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 8"""	ZBTB8		12477932	Standard	NM_001040441		Approved	BOZF1, FLJ90065, ZNF916A	uc001bvn.3	Q96BR9	OTTHUMG00000007855	ENST00000373510.4:c.1215G>A	1.37:g.33065909G>A		Somatic		Unspecified	Illumina	Phase_I	32838496	NM_001040441	Q8IUL5|Q8IWR9|Q8N2Y5|Q96BX0	Silent	SNP	ENST00000373510.4	37	CCDS30664.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476558	0.44044	.	.	ENSG00000176261	ENST00000341885	.	.	.	5.59	4.67	0.58626	.	.	.	.	.	T	0.63283	0.2498	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65676	-0.6110	5	0.87932	D	0	-18.2496	7.0097	0.24855	0.1517:0.1662:0.682:0.0	.	.	.	.	F	59	.	ENSP00000343760:S59F	S	-	2	0	ZBTB8OS	32838496	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.703000	0.37846	2.804000	0.96469	0.655000	0.94253	TCT		ZBTB8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021665.2	NM_144621	
COL9A2	1298	broad.mit.edu	37	1	40766888	40766888	+	Missense_Mutation	SNP	C	C	G	rs199897562		TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:40766888C>G	ENST00000372748.3	-	32	2132	c.2036G>C	c.(2035-2037)cGc>cCc	p.R679P	COL9A2_ENST00000466267.1_5'Flank	NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	679	Nonhelical region 1 (NC1).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.R679P(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			CTCTGTAAGGCGGGCAGAGGC	0.677																																					p.R679P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2036C	1						.						33.0	38.0	36.0					1																	40766888		2203	4300	6503	40539475	SO:0001583	missense	1298	exon32			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.2036G>C	1.37:g.40766888C>G	ENSP00000361834:p.Arg679Pro	Somatic		Unspecified	Illumina	Phase_I	40539475	NM_001852	B2RMP9	Missense_Mutation	SNP	ENST00000372748.3	37	CCDS450.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025807	0.75390	.	.	ENSG00000049089	ENST00000372748	D	0.90324	-2.65	5.38	5.38	0.77491	.	0.107792	0.64402	D	0.000010	D	0.92433	0.7598	L	0.47716	1.5	0.48975	D	0.999735	D	0.76494	0.999	D	0.66084	0.941	D	0.92240	0.5800	10	0.54805	T	0.06	.	12.374	0.55269	0.0:0.8301:0.1699:0.0	.	679	Q14055	CO9A2_HUMAN	P	679	ENSP00000361834:R679P	ENSP00000361834:R679P	R	-	2	0	COL9A2	40539475	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	4.063000	0.57499	2.534000	0.85438	0.561000	0.74099	CGC		COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015764.3	NM_001852	
CYP4B1	1580	broad.mit.edu	37	1	47280904	47280904	+	Silent	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:47280904C>T	ENST00000271153.4	+	8	1074	c.1038C>T	c.(1036-1038)cgC>cgT	p.R346R	CYP4B1_ENST00000371923.4_Silent_p.R347R|CYP4B1_ENST00000371919.4_Silent_p.R332R|CYP4B1_ENST00000452782.2_Silent_p.R184R			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	346					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.R346R(2)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	AGGAGGTCCGCGAGATCCTAG	0.582																																					p.R347R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1041T	1						.						96.0	82.0	87.0					1																	47280904		2203	4300	6503	47053491	SO:0001819	synonymous_variant	1580	exon8			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.1038C>T	1.37:g.47280904C>T		Somatic		Unspecified	Illumina	Phase_I	47053491	NM_001099772	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Silent	SNP	ENST00000271153.4	37	CCDS542.1																																																																																				CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
HEATR1	55127	broad.mit.edu	37	1	236734962	236734962	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr1:236734962C>A	ENST00000366582.3	-	27	3846	c.3732G>T	c.(3730-3732)gaG>gaT	p.E1244D	HEATR1_ENST00000366581.2_Missense_Mutation_p.E1163D	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1244					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.E1244D(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TATTTCCCTGCTCTTGTGGCA	0.383																																					p.E1244D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3732T	1						.						129.0	127.0	128.0					1																	236734962		2203	4300	6503	234801585	SO:0001583	missense	55127	exon27			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.3732G>T	1.37:g.236734962C>A	ENSP00000355541:p.Glu1244Asp	Somatic		Unspecified	Illumina	Phase_I	234801585	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120476	0.56613	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66099	-0.19;3.4	5.58	2.64	0.31445	Armadillo-like helical (1);Armadillo-type fold (1);	0.214383	0.47093	N	0.000251	T	0.45538	0.1347	L	0.45470	1.425	0.80722	D	1	B;B	0.27765	0.188;0.075	B;B	0.22880	0.042;0.016	T	0.16364	-1.0405	10	0.17369	T	0.5	.	4.4388	0.11564	0.0:0.4851:0.1577:0.3572	.	1163;1244	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	D	1244;1163	ENSP00000355541:E1244D;ENSP00000355540:E1163D	ENSP00000355540:E1163D	E	-	3	2	HEATR1	234801585	0.931000	0.31567	0.993000	0.49108	0.893000	0.52053	0.026000	0.13599	0.291000	0.22468	0.585000	0.79938	GAG		HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
SCN2B	6327	broad.mit.edu	37	11	118037796	118037796	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr11:118037796G>A	ENST00000278947.5	-	4	695	c.454C>T	c.(454-456)Cct>Tct	p.P152S		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	152	Ig-like C2-type.				cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.P152S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	TCCCGCTCAGGGGGCTCTGGA	0.632																																					p.P152S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C454T	11						.						49.0	52.0	51.0					11																	118037796		2200	4296	6496	117543006	SO:0001583	missense	6327	exon4			AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.454C>T	11.37:g.118037796G>A	ENSP00000278947:p.Pro152Ser	Somatic		Unspecified	Illumina	Phase_I	117543006	NM_004588	O75302|Q9UNN3	Missense_Mutation	SNP	ENST00000278947.5	37	CCDS8390.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681465	0.88542	.	.	ENSG00000149575	ENST00000278947	D	0.97455	-4.39	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.97464	0.9170	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.66716	0.946	D	0.95885	0.8902	10	0.10636	T	0.68	-18.7896	18.1626	0.89714	0.0:0.0:1.0:0.0	.	152	O60939	SCN2B_HUMAN	S	152	ENSP00000278947:P152S	ENSP00000278947:P152S	P	-	1	0	SCN2B	117543006	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.206000	0.89745	2.640000	0.89533	0.655000	0.94253	CCT		SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109748.2	NM_004588	
HEPACAM	220296	broad.mit.edu	37	11	124794954	124794954	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr11:124794954C>T	ENST00000298251.4	-	2	502	c.97G>A	c.(97-99)Ggg>Agg	p.G33R		NM_152722.4	NP_689935.2			hepatic and glial cell adhesion molecule									p.G33R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.54e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		ATGTTCACCCCCTCCAGGGGG	0.602																																					p.G33R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G97A	11						.						31.0	30.0	30.0					11																	124794954		2201	4299	6500	124300164	SO:0001583	missense	220296	exon2			AK098396	CCDS8456.1	11q24.2	2013-01-29	2011-02-11		ENSG00000165478	ENSG00000165478		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26361	protein-coding gene	gene with protein product	"""glial cell adhesion molecule"""	611642	"""hepatocyte cell adhesion molecule"""			15885354, 15917256	Standard	NM_152722		Approved	FLJ25530, hepaCAM, GLIALCAM	uc001qbk.3	Q14CZ8	OTTHUMG00000165938	ENST00000298251.4:c.97G>A	11.37:g.124794954C>T	ENSP00000298251:p.Gly33Arg	Somatic		Unspecified	Illumina	Phase_I	124300164	NM_152722		Missense_Mutation	SNP	ENST00000298251.4	37	CCDS8456.1	.	.	.	.	.	.	.	.	.	.	C	32	5.188787	0.94923	.	.	ENSG00000165478	ENST00000298251;ENST00000374961	T	0.50813	0.73	5.84	5.84	0.93424	.	0.148535	0.64402	D	0.000011	T	0.68888	0.3050	M	0.65498	2.005	0.52099	D	0.999948	D;D	0.69078	0.992;0.997	D;D	0.69824	0.962;0.966	T	0.68784	-0.5317	10	0.62326	D	0.03	-26.1067	20.1434	0.98067	0.0:1.0:0.0:0.0	.	33;33	Q14CZ8-2;Q14CZ8	.;HECAM_HUMAN	R	33	ENSP00000298251:G33R	ENSP00000298251:G33R	G	-	1	0	HEPACAM	124300164	0.946000	0.32159	1.000000	0.80357	0.872000	0.50106	6.049000	0.71053	2.769000	0.95229	0.563000	0.77884	GGG		HEPACAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387125.1	NM_152722	
NUP98	4928	broad.mit.edu	37	11	3704613	3704613	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr11:3704613G>T	ENST00000324932.7	-	30	5155	c.4735C>A	c.(4735-4737)Cct>Act	p.P1579T	NUP98_ENST00000355260.3_Missense_Mutation_p.P1505T|NUP98_ENST00000359171.4_Missense_Mutation_p.P1505T	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1596					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		CAAGATTCAGGGGTCTCCAAC	0.512			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.P1505T			Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	.	0			c.C4513A	11						.						102.0	98.0	99.0					11																	3704613		2201	4298	6499	3661189	SO:0001583	missense	4928	exon29			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.4735C>A	11.37:g.3704613G>T	ENSP00000316032:p.Pro1579Thr	None		Unspecified	Illumina	Phase_I	3661189	NM_139132	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	37	CCDS7746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.28|14.28	2.489184|2.489184	0.44249|0.44249	.|.	.|.	ENSG00000110713|ENSG00000110713	ENST00000429801|ENST00000324932;ENST00000359171;ENST00000355260	.|.	.|.	.|.	6.02|6.02	5.11|5.11	0.69529|0.69529	.|.	0.133962|0.133962	0.50627|0.50627	D|D	0.000108|0.000108	T|T	0.60663|0.60663	0.2286|0.2286	L|L	0.58428|0.58428	1.81|1.81	0.23056|0.23056	N|N	0.998368|0.998368	.|D;D;B	.|0.62365	.|0.96;0.991;0.006	.|P;P;B	.|0.59703	.|0.675;0.862;0.009	T|T	0.56177|0.56177	-0.8022|-0.8022	6|9	.|0.32370	.|T	.|0.25	-16.917|-16.917	15.9965|15.9965	0.80250|0.80250	0.0:0.0:0.8646:0.1354|0.0:0.0:0.8646:0.1354	.|.	.|1505;1579;1493	.|P52948-2;P52948-5;P52948-6	.|.;.;.	H|T	531|1579;1505;1505	.|.	.|ENSP00000316032:P1579T	P|P	-|-	2|1	0|0	NUP98|NUP98	3661189|3661189	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	4.884000|4.884000	0.63135|0.63135	1.568000|1.568000	0.49683|0.49683	0.650000|0.650000	0.86243|0.86243	CCC|CCT		NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
OR51I2	390064	broad.mit.edu	37	11	5475386	5475386	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr11:5475386G>A	ENST00000341449.2	+	1	749	c.668G>A	c.(667-669)cGt>cAt	p.R223H	AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	223					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R223H(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCATTCTGCGTTCTGTCATG	0.448																																					p.R223H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G668A	11						.						334.0	284.0	301.0					11																	5475386		2201	4297	6498	5431962	SO:0001583	missense	390064	exon1			BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.668G>A	11.37:g.5475386G>A	ENSP00000341987:p.Arg223His	Somatic		Unspecified	Illumina	Phase_I	5431962	NM_001004754	Q6IF81	Missense_Mutation	SNP	ENST00000341449.2	37	CCDS31383.1	.	.	.	.	.	.	.	.	.	.	G	0.082	-1.182284	0.01633	.	.	ENSG00000187918	ENST00000341449	T	0.39592	1.07	5.58	-8.98	0.00754	GPCR, rhodopsin-like superfamily (1);	0.640335	0.15500	N	0.259069	T	0.25680	0.0625	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.02132	-1.1208	10	0.33940	T	0.23	.	17.9915	0.89170	0.6218:0.0:0.3782:0.0	.	223	Q9H344	O51I2_HUMAN	H	223	ENSP00000341987:R223H	ENSP00000341987:R223H	R	+	2	0	OR51I2	5431962	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.817000	0.01719	-1.833000	0.01195	-1.021000	0.02439	CGT		OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	NM_001004754	
NDUFS3	4722	broad.mit.edu	37	11	47603714	47603714	+	Silent	SNP	C	C	G			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr11:47603714C>G	ENST00000263774.4	+	5	538	c.456C>G	c.(454-456)ccC>ccG	p.P152P	NDUFS3_ENST00000533507.1_3'UTR	NM_004551.2	NP_004542.1	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)	152					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)	p.P152P(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)	9					Doxorubicin(DB00997)	AGCTGACGCCCATTGAGTCTG	0.527																																					p.P152P	Pancreas(15;551 601 22438 23457 52512)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C456G	11						.						162.0	148.0	153.0					11																	47603714		2201	4298	6499	47560290	SO:0001819	synonymous_variant	4722	exon5			AF067139	CCDS7941.1	11p11.11	2011-08-03	2002-08-29		ENSG00000213619	ENSG00000213619	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7710	protein-coding gene	gene with protein product	"""complex I 30kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 3, mitochondrial"""	603846	"""NADH dehydrogenase (ubiquinone) Fe-S protein 3 (30kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004551		Approved	CI-30	uc001nga.2	O75489	OTTHUMG00000166893	ENST00000263774.4:c.456C>G	11.37:g.47603714C>G		Somatic		Unspecified	Illumina	Phase_I	47560290	NM_004551	B2R9J1|B4DFM8|Q9UNQ8	Silent	SNP	ENST00000263774.4	37	CCDS7941.1																																																																																				NDUFS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391749.1	NM_004551	
FERMT3	83706	broad.mit.edu	37	11	63979205	63979205	+	Missense_Mutation	SNP	G	G	T	rs139416960		TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr11:63979205G>T	ENST00000279227.5	+	6	867	c.772G>T	c.(772-774)Gat>Tat	p.D258Y	FERMT3_ENST00000345728.5_Missense_Mutation_p.D258Y	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	258	FERM.				integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)	p.D258Y(2)		breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						CAGCTTCTTCGATTTGGATCC	0.627																																					p.D258Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G772T	11						.						100.0	91.0	94.0					11																	63979205		2201	4297	6498	63735781	SO:0001583	missense	83706	exon6			L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.772G>T	11.37:g.63979205G>T	ENSP00000279227:p.Asp258Tyr	Somatic		Unspecified	Illumina	Phase_I	63735781	NM_178443	Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	ENST00000279227.5	37	CCDS8060.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242660	0.79912	.	.	ENSG00000149781	ENST00000544997;ENST00000345728;ENST00000279227;ENST00000541252	D;D;D;T	0.83419	-1.72;-1.72;-1.72;0.14	3.6	3.6	0.41247	Band 4.1 domain (1);FERM central domain (2);	0.060767	0.64402	D	0.000009	D	0.90539	0.7035	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.973;0.993	D	0.92142	0.5721	10	0.87932	D	0	-30.8291	14.5431	0.68011	0.0:0.0:1.0:0.0	.	258;258	Q86UX7-2;Q86UX7	.;URP2_HUMAN	Y	258;258;258;78	ENSP00000445778:D258Y;ENSP00000339950:D258Y;ENSP00000279227:D258Y;ENSP00000438885:D78Y	ENSP00000279227:D258Y	D	+	1	0	FERMT3	63735781	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.336000	0.96533	2.032000	0.59987	0.462000	0.41574	GAT		FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1	NM_031471	
ADRBK1	156	broad.mit.edu	37	11	67051781	67051781	+	Missense_Mutation	SNP	G	G	C	rs139609139	byFrequency	TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr11:67051781G>C	ENST00000308595.5	+	18	1881	c.1591G>C	c.(1591-1593)Gct>Cct	p.A531P	ADRBK1_ENST00000527176.1_3'UTR|ADRBK1_ENST00000526285.1_Intron	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	531					activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)	p.A531P(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	CACCATCAACGCTGAGACAGA	0.622																																					p.A531P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1591C	11						.						80.0	70.0	73.0					11																	67051781		2200	4295	6495	66808357	SO:0001583	missense	156	exon18			X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.1591G>C	11.37:g.67051781G>C	ENSP00000312262:p.Ala531Pro	Somatic		Unspecified	Illumina	Phase_I	66808357	NM_001619	B0ZBE1|Q13837|Q6GTT3	Missense_Mutation	SNP	ENST00000308595.5	37	CCDS8156.1	.	.	.	.	.	.	.	.	.	.	G	7.636	0.679876	0.14907	.	.	ENSG00000173020	ENST00000308595	T	0.24538	1.85	4.64	2.63	0.31362	AGC-kinase, C-terminal (1);Protein kinase-like domain (1);	0.141721	0.32918	N	0.005481	T	0.13970	0.0338	N	0.22421	0.69	0.19775	N	0.999955	P	0.36282	0.546	B	0.31245	0.126	T	0.15009	-1.0452	10	0.34782	T	0.22	-11.05	9.3996	0.38424	0.0806:0.0:0.7759:0.1435	.	531	P25098	ARBK1_HUMAN	P	531	ENSP00000312262:A531P	ENSP00000312262:A531P	A	+	1	0	ADRBK1	66808357	0.007000	0.16637	0.047000	0.18901	0.003000	0.03518	1.493000	0.35605	1.317000	0.45149	0.591000	0.81541	GCT		ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393153.1	NM_001619	
FEZ1	9638	broad.mit.edu	37	11	125351506	125351506	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr11:125351506T>C	ENST00000278919.3	-	3	569	c.335A>G	c.(334-336)aAt>aGt	p.N112S	FEZ1_ENST00000527350.1_5'Flank	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	112					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)		p.N112S(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		AGGGATGTAATTGTCTGTCAG	0.547																																					p.N112S	Melanoma(180;509 2033 10762 15939 24711)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A335G	11						.						148.0	146.0	146.0					11																	125351506		2201	4299	6500	124856716	SO:0001583	missense	9638	exon3			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.335A>G	11.37:g.125351506T>C	ENSP00000278919:p.Asn112Ser	Somatic		Unspecified	Illumina	Phase_I	124856716	NM_005103	O00679|O00728|Q6IBI7	Missense_Mutation	SNP	ENST00000278919.3	37	CCDS31716.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.528157	0.64860	.	.	ENSG00000149557	ENST00000278919	T	0.52754	0.65	5.89	4.77	0.60923	.	0.121727	0.85682	N	0.000000	T	0.47040	0.1424	M	0.69248	2.105	0.80722	D	1	P;B	0.39094	0.659;0.43	B;B	0.40565	0.333;0.137	T	0.40739	-0.9547	9	.	.	.	-24.6226	9.7858	0.40675	0.0:0.1417:0.0:0.8583	.	112;112	B4DKG5;Q99689	.;FEZ1_HUMAN	S	112	ENSP00000278919:N112S	.	N	-	2	0	FEZ1	124856716	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.352000	0.66028	1.060000	0.40578	0.533000	0.62120	AAT		FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386875.1	NM_005103	
JARID2	3720	broad.mit.edu	37	6	15504789	15504789	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr6:15504789G>C	ENST00000341776.2	+	9	2751	c.2507G>C	c.(2506-2508)tGt>tCt	p.C836S	JARID2_ENST00000541660.1_Missense_Mutation_p.C798S|JARID2_ENST00000397311.3_Missense_Mutation_p.C664S|JARID2_ENST00000474854.1_3'UTR	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	836					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.C836S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				ATGAGCATGTGTTTCAGCAAG	0.502																																					p.C836S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2507C	6						.						72.0	76.0	75.0					6																	15504789		2203	4300	6503	15612768	SO:0001583	missense	3720	exon9			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2507G>C	6.37:g.15504789G>C	ENSP00000341280:p.Cys836Ser	Somatic		Unspecified	Illumina	Phase_I	15612768	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787195	0.70337	.	.	ENSG00000008083	ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.89270	-1.84;-1.84;-2.49	5.24	5.24	0.73138	.	0.043082	0.85682	D	0.000000	D	0.90542	0.7036	L	0.44542	1.39	0.53005	D	0.999969	D;D	0.67145	0.996;0.993	D;P	0.62955	0.909;0.813	D	0.91561	0.5264	10	0.72032	D	0.01	-9.9036	18.8078	0.92045	0.0:0.0:1.0:0.0	.	798;836	F5H590;Q92833	.;JARD2_HUMAN	S	836;664;798	ENSP00000341280:C836S;ENSP00000380478:C664S;ENSP00000444623:C798S	ENSP00000341280:C836S	C	+	2	0	JARID2	15612768	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	6.605000	0.74155	2.435000	0.82474	0.561000	0.74099	TGT		JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
PHF1	5252	broad.mit.edu	37	6	33383799	33383799	+	Missense_Mutation	SNP	G	G	A	rs147032936		TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr6:33383799G>A	ENST00000374516.3	+	15	1899	c.1628G>A	c.(1627-1629)cGg>cAg	p.R543Q	CUTA_ENST00000492510.1_5'Flank|PHF1_ENST00000374512.3_3'UTR	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	543					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R543Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				GACCCTGTCCGGGTCCTTGCT	0.647																																					p.R543Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1628A	6						.	G	,GLN/ARG	0,4406		0,0,2203	86.0	86.0	86.0		,1628	4.5	1.0	6	dbSNP_134	86	1,8599	1.2+/-3.3	0,1,4299	no	utr-3,missense	PHF1	NM_002636.4,NM_024165.2	,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,possibly-damaging	,543/568	33383799	1,13005	2203	4300	6503	33491777	SO:0001583	missense	5252	exon15			AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.1628G>A	6.37:g.33383799G>A	ENSP00000363640:p.Arg543Gln	Somatic		Unspecified	Illumina	Phase_I	33491777	NM_024165	B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Missense_Mutation	SNP	ENST00000374516.3	37	CCDS4777.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191936	0.78902	0.0	1.16E-4	ENSG00000112511	ENST00000374516;ENST00000427826	T	0.24538	1.85	4.54	4.54	0.55810	.	0.000000	0.56097	D	0.000034	T	0.26666	0.0652	L	0.34521	1.04	0.46749	D	0.999181	D	0.71674	0.998	D	0.76575	0.988	T	0.01460	-1.1349	9	.	.	.	-13.2601	12.6788	0.56910	0.0:0.0:1.0:0.0	.	543	O43189	PHF1_HUMAN	Q	543;157	ENSP00000363640:R543Q	.	R	+	2	0	PHF1	33491777	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	2.973000	0.49264	2.365000	0.80145	0.655000	0.94253	CGG		PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076175.3		
GPR111	222611	broad.mit.edu	37	6	47649059	47649059	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr6:47649059T>C	ENST00000296862.1	+	6	764	c.764T>C	c.(763-765)tTc>tCc	p.F255S	GPR111_ENST00000507065.1_Missense_Mutation_p.F187S|GPR111_ENST00000398742.2_Missense_Mutation_p.F187S			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	255					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.F187S(1)|p.F255S(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						AACTGGACTTTCATTCCTGAC	0.423																																					p.F187S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T560C	6						.						93.0	88.0	89.0					6																	47649059		1979	4171	6150	47757018	SO:0001583	missense	222611	exon7			AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.764T>C	6.37:g.47649059T>C	ENSP00000296862:p.Phe255Ser	Somatic		Unspecified	Illumina	Phase_I	47757018	NM_153839	Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Missense_Mutation	SNP	ENST00000296862.1	37		.	.	.	.	.	.	.	.	.	.	T	18.40	3.615588	0.66672	.	.	ENSG00000164393	ENST00000507065;ENST00000296862;ENST00000398742	T;T;T	0.23147	1.92;1.92;1.92	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000006	T	0.32763	0.0840	M	0.78637	2.42	0.31863	N	0.620724	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.991	T	0.33599	-0.9862	10	0.07644	T	0.81	.	14.2669	0.66123	0.0:0.0:0.0:1.0	.	187;255	Q8IZF7-2;Q8IZF7	.;GP111_HUMAN	S	187;255;187	ENSP00000422934:F187S;ENSP00000296862:F255S;ENSP00000381727:F187S	ENSP00000296862:F255S	F	+	2	0	GPR111	47757018	0.361000	0.24972	1.000000	0.80357	0.956000	0.61745	1.429000	0.34903	1.981000	0.57761	0.524000	0.50904	TTC		GPR111-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000106423.2	NM_153839	
DST	667	broad.mit.edu	37	6	56327936	56327936	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr6:56327936G>A	ENST00000244364.6	-	82	15244	c.15037C>T	c.(15037-15039)Cgc>Tgc	p.R5013C	DST_ENST00000370769.4_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Intron	NM_001144769.2|NM_001144770.1|NM_015548.4|NM_183380.3	NP_001138241.1|NP_001138242.1|NP_056363.2|NP_899236.1	Q03001	DYST_HUMAN	dystonin	7442					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.R5013C(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCATAATTGCGTGTTAAAGGA	0.388																																					p.R5013C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C15037T	6						.						163.0	149.0	153.0					6																	56327936		1898	4124	6022	56435895	SO:0001583	missense	667	exon82			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000244364.6:c.15037C>T	6.37:g.56327936G>A	ENSP00000244364:p.Arg5013Cys	Somatic		Unspecified	Illumina	Phase_I	56435895	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000244364.6	37	CCDS47443.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236336	0.58886	.	.	ENSG00000151914	ENST00000244364	T	0.52983	0.64	5.79	5.79	0.91817	.	.	.	.	.	T	0.59074	0.2167	L	0.48642	1.525	0.19300	N	0.99998	D;D	0.89917	0.963;1.0	B;D	0.78314	0.36;0.991	T	0.60439	-0.7263	8	0.87932	D	0	.	20.0417	0.97594	0.0:0.0:1.0:0.0	.	5013;100	Q03001-8;Q86T18	.;.	C	5013	ENSP00000244364:R5013C	ENSP00000244364:R5013C	R	-	1	0	DST	56435895	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.736000	0.93811	0.655000	0.94253	CGC		DST-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041022.4	NM_001723	
DST	667	broad.mit.edu	37	6	56391236	56391236	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr6:56391236C>G	ENST00000361203.3	-	64	17099	c.17092G>C	c.(17092-17094)Gag>Cag	p.E5698Q	DST_ENST00000370769.4_Missense_Mutation_p.E5809Q|DST_ENST00000340834.4_5'UTR|DST_ENST00000421834.2_Missense_Mutation_p.E3721Q|DST_ENST00000446842.2_Missense_Mutation_p.E5483Q|DST_ENST00000370754.5_Missense_Mutation_p.E5987Q|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Missense_Mutation_p.E3612Q|DST_ENST00000244364.6_Missense_Mutation_p.E3395Q			Q03001	DYST_HUMAN	dystonin	5698					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.E3395Q(1)|p.E5809Q(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CGGTAGCGCTCATTGTCCTCA	0.493																																					p.E3395Q												.	.	2	Substitution - Missense(2)	urinary_tract(2)	c.G10183C	6						.						244.0	232.0	236.0					6																	56391236		2025	4197	6222	56499195	SO:0001583	missense	667	exon50			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17092G>C	6.37:g.56391236C>G	ENSP00000354508:p.Glu5698Gln	None		Unspecified	Illumina	Phase_I	56499195	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	18.69	3.678985	0.68042	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29	5.73	5.73	0.89815	.	0.371318	0.22544	N	0.058693	T	0.35451	0.0932	M	0.70903	2.155	0.30692	N	0.751219	P;D;P;B;B	0.53619	0.653;0.961;0.658;0.041;0.32	B;P;B;B;B	0.46026	0.316;0.501;0.433;0.018;0.275	T	0.09975	-1.0650	9	0.23891	T	0.37	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	3721;5809;5987;5807;3395	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	Q	3395;5987;5809;3721;5483;3612;5698	ENSP00000244364:E3395Q;ENSP00000359790:E5987Q;ENSP00000359805:E5809Q;ENSP00000400883:E3721Q;ENSP00000393645:E5483Q;ENSP00000359824:E3612Q;ENSP00000354508:E5698Q	ENSP00000244364:E3395Q	E	-	1	0	DST	56499195	0.998000	0.40836	0.997000	0.53966	0.997000	0.91878	3.918000	0.56432	2.854000	0.98071	0.655000	0.94253	GAG		DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DOPEY1	23033	broad.mit.edu	37	6	83878990	83878990	+	IGR	SNP	G	G	T	rs541410808		TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr6:83878990G>T	ENST00000349129.2	+	0	8210				DOPEY1_ENST00000484282.1_Intron|PGM3_ENST00000283977.4_Missense_Mutation_p.A450D|PGM3_ENST00000506587.1_Missense_Mutation_p.A559D|PGM3_ENST00000512866.1_Missense_Mutation_p.A531D|PGM3_ENST00000513973.1_Missense_Mutation_p.A531D	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1						protein transport (GO:0015031)			p.A531D(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AATTCCTCCAGCCAGCTGAAA	0.383																																					p.A531D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1592A	6						.						65.0	62.0	63.0					6																	83878990		2203	4300	6503	83935709	SO:0001628	intergenic_variant	5238	exon13			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365		6.37:g.83878990G>T		Somatic		Unspecified	Illumina	Phase_I	83935709	NM_015599	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915627	0.92178	.	.	ENSG00000013375	ENST00000513973;ENST00000512866;ENST00000283977;ENST00000506587	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.71151	0.3306	M	0.93150	3.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.77795	-0.2454	10	0.62326	D	0.03	-49.9041	19.2576	0.93952	0.0:0.0:1.0:0.0	.	559;531	E9PF86;O95394	.;AGM1_HUMAN	D	531;531;450;559	ENSP00000424874:A531D;ENSP00000421565:A531D;ENSP00000283977:A450D;ENSP00000425809:A559D	ENSP00000283977:A450D	A	-	2	0	PGM3	83935709	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.273000	0.89887	2.789000	0.95967	0.655000	0.94253	GCT		DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
HTR1E	3354	broad.mit.edu	37	6	87725488	87725488	+	Missense_Mutation	SNP	G	G	A	rs200719637		TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr6:87725488G>A	ENST00000305344.5	+	2	1139	c.436G>A	c.(436-438)Gtc>Atc	p.V146I		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	146					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.V146I(2)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	GATCCTTACCGTCTGGACCAT	0.582																																					p.V146I												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G436A	6						.						108.0	94.0	99.0					6																	87725488		2203	4300	6503	87782207	SO:0001583	missense	3354	exon2				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.436G>A	6.37:g.87725488G>A	ENSP00000307766:p.Val146Ile	Somatic		Unspecified	Illumina	Phase_I	87782207	NM_000865	E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.640966	0.67244	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.73152	-0.72;-0.72	4.26	4.26	0.50523	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	U	0.000069	T	0.78477	0.4289	M	0.69358	2.11	0.44834	D	0.997845	D	0.76494	0.999	D	0.68483	0.958	T	0.82133	-0.0608	10	0.72032	D	0.01	.	16.6564	0.85229	0.0:0.0:1.0:0.0	.	146	P28566	5HT1E_HUMAN	I	146	ENSP00000307766:V146I;ENSP00000358597:V146I	ENSP00000307766:V146I	V	+	1	0	HTR1E	87782207	1.000000	0.71417	0.986000	0.45419	0.941000	0.58515	7.241000	0.78201	1.929000	0.55896	0.404000	0.27445	GTC		HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865	
ZNF292	23036	broad.mit.edu	37	6	87970724	87970724	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr6:87970724T>G	ENST00000369577.3	+	8	7420	c.7377T>G	c.(7375-7377)aaT>aaG	p.N2459K	ZNF292_ENST00000339907.4_Missense_Mutation_p.N2454K	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2459						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.N2314K(1)|p.N2459K(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CAGAGAGCAATGATAATTCAA	0.333																																					p.N2459K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T7377G	6						.						33.0	30.0	31.0					6																	87970724		1886	4109	5995	88027443	SO:0001583	missense	23036	exon8			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.7377T>G	6.37:g.87970724T>G	ENSP00000358590:p.Asn2459Lys	Somatic		Unspecified	Illumina	Phase_I	88027443	NM_015021	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	T	0.944	-0.708694	0.03230	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.06687	3.27;3.29	5.52	0.256	0.15567	.	1.028850	0.07618	N	0.926528	T	0.03434	0.0099	L	0.60455	1.87	0.09310	N	1	B	0.24258	0.1	B	0.19148	0.024	T	0.42699	-0.9436	10	0.45353	T	0.12	.	9.8865	0.41264	0.0:0.2594:0.0:0.7406	.	2459	O60281	ZN292_HUMAN	K	2459;2454	ENSP00000358590:N2459K;ENSP00000342847:N2454K	ENSP00000342847:N2454K	N	+	3	2	ZNF292	88027443	0.923000	0.31300	0.009000	0.14445	0.305000	0.27757	1.002000	0.29796	0.062000	0.16340	0.482000	0.46254	AAT		ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
UST	10090	broad.mit.edu	37	6	149342567	149342567	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AG-A014-01	TCGA-AG-A014-01			G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr6:149342567delG	ENST00000367463.4	+	7	990	c.887delG	c.(886-888)agafs	p.R296fs		NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	296					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		TTACTGGAAAGATTTTTACCT	0.463																																					p.R296fs												.	.	0			c.887delG	6						.						127.0	115.0	119.0					6																	149342567		2203	4300	6503	149384260	SO:0001589	frameshift_variant	10090	exon7			AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.887delG	6.37:g.149342567delG	ENSP00000356433:p.Arg296fs	None		Unspecified	Illumina	Phase_I	149384260	NM_005715	B2RCX6	Frame_Shift_Del	DEL	ENST00000367463.4	37	CCDS5213.1																																																																																				UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715	
DHRS13	147015	broad.mit.edu	37	17	27225675	27225675	+	Silent	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr17:27225675G>A	ENST00000378895.4	-	5	1044	c.918C>T	c.(916-918)gcC>gcT	p.A306A	FLOT2_ENST00000585169.1_5'Flank|FLOT2_ENST00000394906.2_5'Flank|RP11-20B24.4_ENST00000579187.1_RNA|DHRS13_ENST00000394901.3_Silent_p.A256A|FLOT2_ENST00000577789.1_5'Flank|DHRS13_ENST00000426464.2_Silent_p.A225A|DHRS13_ENST00000581974.1_5'Flank|FLOT2_ENST00000394908.4_5'Flank|RP11-20B24.4_ENST00000580603.1_RNA	NM_144683.3	NP_653284.2	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	306						extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)	p.A306A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	9	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			GCCTCTTGCTGGCCTCCCATA	0.632																																					p.A306A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C918T	17						.						14.0	16.0	16.0					17																	27225675		2199	4297	6496	24249801	SO:0001819	synonymous_variant	147015	exon5			BC015582	CCDS11246.2	17q11.2	2011-09-14			ENSG00000167536	ENSG00000167536	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	28326	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 5"""					12975309, 19027726	Standard	NM_144683		Approved	MGC23280, SDR7C5	uc002hde.4	Q6UX07	OTTHUMG00000132678	ENST00000378895.4:c.918C>T	17.37:g.27225675G>A		Somatic		Unspecified	Illumina	Phase_I	24249801	NM_144683	Q96BH7	Silent	SNP	ENST00000378895.4	37	CCDS11246.2																																																																																				DHRS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255952.1	NM_144683	
C17orf102	400591	broad.mit.edu	37	17	32905944	32905944	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr17:32905944A>G	ENST00000357754.1	-	1	444	c.356T>C	c.(355-357)aTt>aCt	p.I119T	TMEM132E_ENST00000321639.5_5'Flank	NM_207454.2	NP_997337.2	A2RUQ5	CQ102_HUMAN	chromosome 17 open reading frame 102	119								p.I119T(1)		central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(3)|ovary(1)	9						CAGCAACAGAATAAATAGGTT	0.612																																					p.I119T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T356C	17						.						134.0	144.0	141.0					17																	32905944		1913	4117	6030	29930057	SO:0001583	missense	400591	exon1				CCDS42297.1	17q12	2009-02-11			ENSG00000197322	ENSG00000197322			34412	protein-coding gene	gene with protein product							Standard	NM_207454		Approved	FLJ44815	uc002hie.1	A2RUQ5	OTTHUMG00000156883	ENST00000357754.1:c.356T>C	17.37:g.32905944A>G	ENSP00000350392:p.Ile119Thr	Somatic		Unspecified	Illumina	Phase_I	29930057	NM_207454	A5PKX0|Q6ZTB3	Missense_Mutation	SNP	ENST00000357754.1	37	CCDS42297.1	.	.	.	.	.	.	.	.	.	.	A	8.115	0.779724	0.16120	.	.	ENSG00000197322	ENST00000357754	T	0.38722	1.12	3.4	-6.8	0.01709	.	5.024240	0.00897	U	0.002317	T	0.24084	0.0583	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.13415	-1.0510	10	0.87932	D	0	.	2.1016	0.03681	0.2062:0.1226:0.4133:0.2579	.	119	A2RUQ5	CQ102_HUMAN	T	119	ENSP00000350392:I119T	ENSP00000350392:I119T	I	-	2	0	C17orf102	29930057	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.573000	0.05874	-2.676000	0.00411	-1.100000	0.02121	ATT		C17orf102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346435.1	NM_207454	
SLFN5	162394	broad.mit.edu	37	17	33585725	33585725	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr17:33585725G>T	ENST00000299977.4	+	2	164	c.16G>T	c.(16-18)Gat>Tat	p.D6Y	SLFN5_ENST00000592325.1_Missense_Mutation_p.D6Y|SLFN5_ENST00000542451.1_Missense_Mutation_p.D6Y	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	6					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.D6Y(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		TCTTAGGATTGATGTGGATAC	0.458																																					p.D6Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G16T	17						.						74.0	71.0	72.0					17																	33585725		2203	4300	6503	30609838	SO:0001583	missense	162394	exon2			BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.16G>T	17.37:g.33585725G>T	ENSP00000299977:p.Asp6Tyr	Somatic		Unspecified	Illumina	Phase_I	30609838	NM_144975	Q08AF2|Q8WU54|Q96A82	Missense_Mutation	SNP	ENST00000299977.4	37	CCDS32619.1	.	.	.	.	.	.	.	.	.	.	G	10.31	1.314896	0.23908	.	.	ENSG00000166750	ENST00000299977;ENST00000542451	T;T	0.10860	4.09;2.83	3.76	0.44	0.16572	.	0.748090	0.10989	N	0.611857	T	0.21307	0.0513	M	0.75615	2.305	0.09310	N	1	P;P;D	0.56035	0.906;0.845;0.974	B;B;P	0.57244	0.431;0.273;0.816	T	0.12426	-1.0548	10	0.35671	T	0.21	.	4.2989	0.10915	0.2216:0.1881:0.5903:0.0	.	6;6;6	B4E128;Q08AF3;Q08AF3-2	.;SLFN5_HUMAN;.	Y	6	ENSP00000299977:D6Y;ENSP00000440537:D6Y	ENSP00000299977:D6Y	D	+	1	0	SLFN5	30609838	0.000000	0.05858	0.001000	0.08648	0.033000	0.12548	0.212000	0.17497	0.035000	0.15519	-0.140000	0.14226	GAT		SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448649.2	NM_144975	
KRT37	8688	broad.mit.edu	37	17	39580043	39580043	+	Silent	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr17:39580043C>T	ENST00000225550.3	-	2	545	c.546G>A	c.(544-546)gcG>gcA	p.A182A	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	182	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.A182A(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				CAGCCAGCTTCGCGTTGTCAA	0.493																																					p.A182A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G546A	17						.						125.0	104.0	111.0					17																	39580043		2203	4300	6503	36833569	SO:0001819	synonymous_variant	8688	exon2			Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.546G>A	17.37:g.39580043C>T		Somatic		Unspecified	Illumina	Phase_I	36833569	NM_003770		Silent	SNP	ENST00000225550.3	37	CCDS32653.1																																																																																				KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770	
STAT5B	6777	broad.mit.edu	37	17	40369193	40369193	+	Silent	SNP	C	C	G			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr17:40369193C>G	ENST00000293328.3	-	11	1533	c.1365G>C	c.(1363-1365)ctG>ctC	p.L455L		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	455					2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.L455L(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	CTTGAAAAACCAGCTCATTTC	0.428																																					p.L455L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1365C	17						.						69.0	60.0	63.0					17																	40369193		2203	4300	6503	37622719	SO:0001819	synonymous_variant	6777	exon11			BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.1365G>C	17.37:g.40369193C>G		Somatic		Unspecified	Illumina	Phase_I	37622719	NM_012448	Q8WWS8	Silent	SNP	ENST00000293328.3	37	CCDS11423.1																																																																																				STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319797.1	NM_012448	
TP53	7157	broad.mit.edu	37	17	7577118	7577118	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr17:7577118C>G	ENST00000269305.4	-	8	1009	c.820G>C	c.(820-822)Gtt>Ctt	p.V274L	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.V274L|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.V274L|TP53_ENST00000445888.2_Missense_Mutation_p.V274L|TP53_ENST00000455263.2_Missense_Mutation_p.V274L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	274	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V274F(21)|p.V274L(11)|p.0?(8)|p.V274I(4)|p.?(2)|p.R273_C275delRVC(1)|p.V274fs*71(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V274_P278del(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGCACAAACACGCACCTCA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V274L	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-2	.	54	Substitution - Missense(36)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Unknown(2)	large_intestine(9)|breast(7)|upper_aerodigestive_tract(6)|ovary(4)|prostate(4)|bone(4)|central_nervous_system(3)|urinary_tract(3)|lung(3)|oesophagus(3)|haematopoietic_and_lymphoid_tissue(2)|skin(2)|adrenal_gland(1)|stomach(1)|soft_tissue(1)|liver(1)	c.G820C	17						.						69.0	60.0	63.0					17																	7577118		2203	4300	6503	7517843	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.820G>C	17.37:g.7577118C>G	ENSP00000269305:p.Val274Leu	Somatic		Unspecified	Illumina	Phase_I	7517843	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.397576	0.42512	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99812	-6.88;-6.88;-6.88;-6.88;-6.88;-6.88	4.92	-0.763	0.11030	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.312804	0.33382	N	0.004980	D	0.99411	0.9792	M	0.87456	2.885	0.34283	D	0.682342	B;B;B;B	0.28584	0.216;0.067;0.087;0.049	B;B;B;B	0.40375	0.185;0.096;0.327;0.195	D	0.99980	1.2436	10	0.87932	D	0	-10.2267	9.2232	0.37390	0.0:0.5803:0.0:0.4197	.	274;274;274;274	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	L	274;274;274;274;274;263;142	ENSP00000352610:V274L;ENSP00000269305:V274L;ENSP00000398846:V274L;ENSP00000391127:V274L;ENSP00000391478:V274L;ENSP00000425104:V142L	ENSP00000269305:V274L	V	-	1	0	TP53	7517843	0.002000	0.14202	0.148000	0.22405	0.724000	0.41520	-0.002000	0.12924	-0.004000	0.14419	0.462000	0.41574	GTT		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KCNAB3	9196	broad.mit.edu	37	17	7829030	7829030	+	Missense_Mutation	SNP	C	C	T	rs535006786	byFrequency	TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr17:7829030C>T	ENST00000303790.2	-	7	508	c.509G>A	c.(508-510)cGa>cAa	p.R170Q		NM_004732.3	NP_004723.2	O43448	KCAB3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 3	170					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.R170Q(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	8		Prostate(122;0.157)				GCTTAAACCTCGCTCGGTTTC	0.502													C|||	2	0.000399361	0.0	0.0	5008	,	,		16872	0.002		0.0	False		,,,				2504	0.0				p.R170Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G509A	17						.						210.0	210.0	210.0					17																	7829030		2203	4300	6503	7769755	SO:0001583	missense	9196	exon7			AF016411	CCDS11124.1	17p13.1	2006-11-29			ENSG00000170049	ENSG00000170049		"""Potassium channels"", ""Aldo-keto reductases"""	6230	protein-coding gene	gene with protein product		604111				9857044	Standard	NM_004732		Approved	AKR6A9, KCNA3B	uc002gjm.2	O43448	OTTHUMG00000108170	ENST00000303790.2:c.509G>A	17.37:g.7829030C>T	ENSP00000302719:p.Arg170Gln	Somatic		Unspecified	Illumina	Phase_I	7769755	NM_004732	Q4VAW0	Missense_Mutation	SNP	ENST00000303790.2	37	CCDS11124.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353453	0.82243	.	.	ENSG00000170049	ENST00000303790	T	0.23754	1.89	5.83	4.86	0.63082	NADP-dependent oxidoreductase domain (3);	0.056844	0.64402	D	0.000003	T	0.20210	0.0486	L	0.35414	1.06	0.58432	D	0.999999	P	0.38300	0.626	B	0.32805	0.153	T	0.03008	-1.1083	10	0.62326	D	0.03	.	14.8413	0.70226	0.0:0.9297:0.0:0.0703	.	170	O43448	KCAB3_HUMAN	Q	170	ENSP00000302719:R170Q	ENSP00000302719:R170Q	R	-	2	0	KCNAB3	7769755	0.999000	0.42202	1.000000	0.80357	0.979000	0.70002	4.255000	0.58804	1.471000	0.48121	0.591000	0.81541	CGA		KCNAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226974.1	NM_004732	
GUCY2D	3000	broad.mit.edu	37	17	7907365	7907366	+	Missense_Mutation	DNP	AT	AT	CC			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr17:7907365_7907366AT>CC	ENST00000254854.4	+	3	1067_1068	c.917_918AT>CC	c.(916-918)gAT>gCC	p.D306A		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	306					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.D306>?(1)		skin(1)	1		Prostate(122;0.157)				AGGGCCCACGATGCCGTGCTCA	0.673																																					.												.	.	1	Complex(1)	large_intestine(1)	c.917_918CC	17						.																																			7848091	SO:0001583	missense	3000	exon3			L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	Exception_encountered	17.37:g.7907365_7907366delinsCC	ENSP00000254854:p.Asp306Ala	Somatic		Unspecified	Illumina	Phase_I	7848090	NM_000180	Q6LEA7	Missense_Mutation	DNP	ENST00000254854.4	37	CCDS11127.1																																																																																				GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
PSMC5	5705	broad.mit.edu	37	17	61908218	61908218	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr17:61908218G>A	ENST00000310144.6	+	7	910	c.602G>A	c.(601-603)cGg>cAg	p.R201Q	FTSJ3_ENST00000580295.1_5'Flank|PSMC5_ENST00000375812.4_Missense_Mutation_p.R193Q|PSMC5_ENST00000581882.1_Missense_Mutation_p.R193Q|PSMC5_ENST00000580864.1_Missense_Mutation_p.R193Q	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5	201	May mediate interaction with PRPF9. {ECO:0000250|UniProtKB:P62196}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.R201Q(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						CTGTTGGCCCGGGCTGTGGCT	0.527																																					p.R201Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G602A	17						.						107.0	96.0	99.0					17																	61908218		2203	4300	6503	59261950	SO:0001583	missense	5705	exon7			L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195		ENST00000310144.6:c.602G>A	17.37:g.61908218G>A	ENSP00000310572:p.Arg201Gln	Somatic		Unspecified	Illumina	Phase_I	59261950	NM_002805	A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Missense_Mutation	SNP	ENST00000310144.6	37	CCDS11645.1	.	.	.	.	.	.	.	.	.	.	G	35	5.486317	0.96323	.	.	ENSG00000087191	ENST00000310144;ENST00000375812	D;D	0.93712	-3.27;-3.27	6.17	5.2	0.72013	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.95385	0.8502	L	0.55213	1.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.95690	0.8739	10	0.87932	D	0	.	13.2422	0.60004	0.0761:0.0:0.9239:0.0	.	193;201	A8K3Z3;P62195	.;PRS8_HUMAN	Q	201;193	ENSP00000310572:R201Q;ENSP00000364970:R193Q	ENSP00000310572:R201Q	R	+	2	0	PSMC5	59261950	0.995000	0.38212	0.994000	0.49952	0.926000	0.56050	6.716000	0.74702	1.616000	0.50265	0.655000	0.94253	CGG		PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444404.1	NM_002805	
ZBTB21	49854	broad.mit.edu	37	21	43411789	43411789	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr21:43411789T>G	ENST00000310826.5	-	3	2599	c.2416A>C	c.(2416-2418)Acc>Ccc	p.T806P	ZBTB21_ENST00000465968.1_5'UTR|ZBTB21_ENST00000398505.3_Missense_Mutation_p.T605P|ZBTB21_ENST00000398499.1_Missense_Mutation_p.T806P|ZBTB21_ENST00000398511.3_Missense_Mutation_p.T806P	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	806					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)	p.T806P(1)									AAGTTTTCGGTGGGTGCCATG	0.507																																					p.T605P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1813C	21						.						125.0	121.0	123.0					21																	43411789		2203	4300	6503	42284858	SO:0001583	missense	49854	exon4			AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.2416A>C	21.37:g.43411789T>G	ENSP00000308759:p.Thr806Pro	Somatic		Unspecified	Illumina	Phase_I	42284858	NM_001098403	Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	ENST00000310826.5	37	CCDS13678.1	.	.	.	.	.	.	.	.	.	.	T	3.861	-0.029899	0.07543	.	.	ENSG00000173276	ENST00000398505;ENST00000310826;ENST00000398499;ENST00000398511	T;T;T;T	0.07567	3.46;3.18;3.18;3.18	5.2	-4.28	0.03732	.	0.427176	0.22699	N	0.056702	T	0.03608	0.0103	N	0.22421	0.69	0.09310	N	1	B;B	0.28258	0.205;0.112	B;B	0.25759	0.059;0.063	T	0.26883	-1.0090	10	0.44086	T	0.13	-3.0782	2.0493	0.03567	0.1918:0.2213:0.1089:0.4779	.	605;806	Q9ULJ3-2;Q9ULJ3	.;ZN295_HUMAN	P	605;806;806;806	ENSP00000381517:T605P;ENSP00000308759:T806P;ENSP00000381512:T806P;ENSP00000381523:T806P	ENSP00000308759:T806P	T	-	1	0	ZNF295	42284858	0.010000	0.17322	0.000000	0.03702	0.145000	0.21501	0.177000	0.16801	-0.783000	0.04534	-0.376000	0.06991	ACC		ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727	
AXIN1	8312	broad.mit.edu	37	16	396705	396706	+	Missense_Mutation	DNP	CT	CT	TA			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr16:396705_396706CT>TA	ENST00000262320.3	-	2	691_692	c.320_321AG>TA	c.(319-321)aAG>aTA	p.K107I	AXIN1_ENST00000354866.3_Missense_Mutation_p.K107I|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	107	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.K107>?(1)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				AGCCCTCCTGCTTCAGGAAAGT	0.579											OREG0003698	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									.												.	.	1	Complex(1)	large_intestine(1)	c.320_321TA	16						.																																			336707	SO:0001583	missense	8312	exon2			AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.320_321delinsTA	16.37:g.396705_396706delinsTA	ENSP00000262320:p.Lys107Ile	Somatic	588	Unspecified	Illumina	Phase_I	336706	NM_003502	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	DNP	ENST00000262320.3	37	CCDS10405.1																																																																																				AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
SLX4	84464	broad.mit.edu	37	16	3647577	3647577	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr16:3647577C>T	ENST00000294008.3	-	7	2126	c.1486G>A	c.(1486-1488)Gaa>Aaa	p.E496K		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	496	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CTAGACAATTCCACTTCCTCA	0.567								Direct reversal of damage																													p.E496K												.	.	0			c.G1486A	16						.						83.0	83.0	83.0					16																	3647577		2197	4300	6497	3587578	SO:0001583	missense	84464	exon7			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1486G>A	16.37:g.3647577C>T	ENSP00000294008:p.Glu496Lys	None		Unspecified	Illumina	Phase_I	3587578	NM_032444	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	C	14.08	2.427760	0.43122	.	.	ENSG00000188827	ENST00000294008	T	0.20463	2.07	5.14	4.17	0.49024	.	0.633854	0.14571	N	0.311454	T	0.36054	0.0953	L	0.49126	1.545	0.09310	N	1	D	0.71674	0.998	P	0.57425	0.82	T	0.15867	-1.0422	10	0.62326	D	0.03	.	14.5594	0.68126	0.0:0.8529:0.1471:0.0	.	496	Q8IY92	SLX4_HUMAN	K	496	ENSP00000294008:E496K	ENSP00000294008:E496K	E	-	1	0	SLX4	3587578	0.029000	0.19370	0.002000	0.10522	0.663000	0.39108	2.332000	0.43903	1.120000	0.41904	0.655000	0.94253	GAA		SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
SNX29	92017	broad.mit.edu	37	16	12136895	12136895	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr16:12136895G>T	ENST00000566228.1	+	5	458	c.389G>T	c.(388-390)cGc>cTc	p.R130L	SNX29_ENST00000568359.1_3'UTR	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	130	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)	p.R130L(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						TCCCTGGAGCGCTACCTGCAC	0.652																																					p.R130L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G389T	16						.						35.0	29.0	31.0					16																	12136895		2197	4300	6497	12044396	SO:0001583	missense	84127	exon5			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.389G>T	16.37:g.12136895G>T	ENSP00000456480:p.Arg130Leu	Somatic		Unspecified	Illumina	Phase_I	12044396	NM_032167	B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	ENST00000566228.1	37	CCDS10553.2	.	.	.	.	.	.	.	.	.	.	G	34	5.319651	0.95682	.	.	ENSG00000140660	ENST00000268271	.	.	.	4.91	4.91	0.64330	.	0.071529	0.53938	D	0.000046	T	0.75079	0.3801	M	0.69823	2.125	0.80722	D	1	.	.	.	.	.	.	T	0.77378	-0.2610	7	0.59425	D	0.04	-0.7179	16.8321	0.85947	0.0:0.0:1.0:0.0	.	.	.	.	L	130	.	ENSP00000268271:R130L	R	+	2	0	RUNDC2A	12044396	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.354000	0.97083	2.555000	0.86185	0.462000	0.41574	CGC		SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422622.1		
RBFOX1	54715	broad.mit.edu	37	16	7760731	7760731	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr16:7760731G>A	ENST00000550418.1	+	16	2166	c.1178G>A	c.(1177-1179)cGt>cAt	p.R393H	RBFOX1_ENST00000436368.2_Missense_Mutation_p.R388H|RBFOX1_ENST00000311745.5_Missense_Mutation_p.R414H|RBFOX1_ENST00000547372.1_3'UTR|RBFOX1_ENST00000547338.1_Missense_Mutation_p.R393H|RBFOX1_ENST00000553186.1_Missense_Mutation_p.R366H|RBFOX1_ENST00000552089.1_3'UTR|RBFOX1_ENST00000355637.4_3'UTR|RBFOX1_ENST00000340209.4_Missense_Mutation_p.R398H	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	393					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.R414H(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						GGATACAACCGTTTTGCTCCA	0.443																																					p.R388H	Ovarian(157;934 2567 15163 39509)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1163A	16						.						149.0	134.0	139.0					16																	7760731		2197	4300	6497	7700732	SO:0001583	missense	54715	exon13			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.1178G>A	16.37:g.7760731G>A	ENSP00000450031:p.Arg393His	Somatic		Unspecified	Illumina	Phase_I	7700732	NM_145892	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.219661	0.79464	.	.	ENSG00000078328	ENST00000550418;ENST00000553186;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000352951;ENST00000340209	T;T;T;T;T;T	0.50813	0.77;0.73;0.77;1.15;1.03;0.8	5.95	5.95	0.96441	.	0.104988	0.64402	D	0.000003	T	0.64091	0.2567	L	0.39245	1.2	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.939;0.996;0.996;0.988;0.983	T	0.63985	-0.6513	10	0.87932	D	0	-6.5935	20.3923	0.98948	0.0:0.0:1.0:0.0	.	387;414;388;366;393	F8WAC5;Q9NWB1-2;Q9NWB1-4;Q9NWB1-3;Q9NWB1	.;.;.;.;RFOX1_HUMAN	H	393;366;393;388;414;387;398	ENSP00000450031:R393H;ENSP00000447753:R366H;ENSP00000447717:R393H;ENSP00000402745:R388H;ENSP00000309117:R414H;ENSP00000344196:R398H	ENSP00000309117:R414H	R	+	2	0	RBFOX1	7700732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.014000	0.93635	2.831000	0.97527	0.609000	0.83330	CGT		RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
CMTM4	146223	broad.mit.edu	37	16	66656124	66656125	+	Splice_Site	DNP	AT	AT	CA			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr16:66656124_66656125AT>CA	ENST00000330687.4	-	4	644_645	c.463_464AT>TG	c.(463-465)ATa>TGa	p.I155*	CMTM4_ENST00000394106.2_Splice_Site_p.I155*|CMTM4_ENST00000563952.1_Splice_Site_p.I126*	NM_178818.2|NM_181521.2	NP_848933.1|NP_852662.1	Q8IZR5	CKLF4_HUMAN	CKLF-like MARVEL transmembrane domain containing 4	155	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.I155>?(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0811)|Epithelial(162;0.214)		GAAGCCAAATATCTAAAAACAC	0.559																																					.												.	.	1	Complex(1)	large_intestine(1)	c.463_464TG	16						.																																			65213626	SO:0001630	splice_region_variant	146223	exon4			AF479814	CCDS10817.1, CCDS42170.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000183723	ENSG00000183723			19175	protein-coding gene	gene with protein product		607887	"""chemokine-like factor super family 4"", ""chemokine-like factor superfamily 4"""	CKLFSF4		12782130	Standard	NM_178818		Approved		uc002epz.3	Q8IZR5	OTTHUMG00000137500	ENST00000330687.4:c.463_464delinsCA	16.37:g.66656124_66656125delinsCA		Somatic		Unspecified	Illumina	Phase_I	65213625	NM_181521	Q52M40|Q8IZR4|Q8IZV1	Nonsense_Mutation	DNP	ENST00000330687.4	37	CCDS10817.1																																																																																				CMTM4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268807.1		Nonsense_Mutation
ZC3H18	124245	broad.mit.edu	37	16	88694438	88694439	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr16:88694438_88694439CC>TT	ENST00000301011.5	+	15	2580_2581	c.2380_2381CC>TT	c.(2380-2382)CCc>TTc	p.P794F	ZC3H18_ENST00000452588.2_Missense_Mutation_p.P818F	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	794						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.P794>?(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		CTCCCAGCAGCCCTCGACACCC	0.569																																					.	Ovarian(121;375 2276 20373 38669)											.	.	1	Complex(1)	large_intestine(1)	c.2380_2381TT	16						.																																			87221940	SO:0001583	missense	124245	exon15			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	Exception_encountered	16.37:g.88694438_88694439delinsTT	ENSP00000301011:p.Pro794Phe	Somatic		Unspecified	Illumina	Phase_I	87221939	NM_144604	Q96DG4|Q96MP7	Missense_Mutation	DNP	ENST00000301011.5	37	CCDS10967.1																																																																																				ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	
SLC14A2	8170	broad.mit.edu	37	18	43247924	43247924	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr18:43247924C>T	ENST00000255226.6	+	14	2660	c.1844C>T	c.(1843-1845)gCg>gTg	p.A615V	RP11-116O18.3_ENST00000589510.1_RNA|SLC14A2_ENST00000586448.1_Missense_Mutation_p.A615V|SLC14A2_ENST00000589658.1_Missense_Mutation_p.A92V	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	615					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)	p.A615V(1)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CCCTGGTGGGCGATCTCAGGC	0.567																																					p.A615V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1844T	18						.						137.0	131.0	133.0					18																	43247924		2203	4300	6503	41501922	SO:0001583	missense	8170	exon14			X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.1844C>T	18.37:g.43247924C>T	ENSP00000255226:p.Ala615Val	Somatic		Unspecified	Illumina	Phase_I	41501922	NM_007163	A8K8Q7|Q2TBD6|Q96PH5	Missense_Mutation	SNP	ENST00000255226.6	37	CCDS11924.1	.	.	.	.	.	.	.	.	.	.	c	33	5.240137	0.95240	.	.	ENSG00000132874	ENST00000255226	T	0.57595	0.39	4.52	4.52	0.55395	.	0.129380	0.34906	N	0.003596	T	0.75860	0.3907	M	0.90369	3.11	0.80722	D	1	D	0.65815	0.995	D	0.63283	0.913	T	0.81357	-0.0969	10	0.52906	T	0.07	-24.7051	17.468	0.87639	0.0:1.0:0.0:0.0	.	615	Q15849	UT2_HUMAN	V	615	ENSP00000255226:A615V	ENSP00000255226:A615V	A	+	2	0	SLC14A2	41501922	0.999000	0.42202	1.000000	0.80357	0.906000	0.53458	4.230000	0.58632	2.358000	0.79984	0.558000	0.71614	GCG		SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1		
ATP5A1	498	broad.mit.edu	37	18	43671703	43671703	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr18:43671703T>C	ENST00000398752.6	-	3	375	c.254A>G	c.(253-255)cAt>cGt	p.H85R	ATP5A1_ENST00000591267.1_5'Flank|ATP5A1_ENST00000282050.2_Missense_Mutation_p.H85R|ATP5A1_ENST00000590665.1_Missense_Mutation_p.H85R|ATP5A1_ENST00000593152.2_Missense_Mutation_p.H35R	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	85					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)	p.H85R(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						CCTCAGCCCATGTACGCGGGC	0.393																																					p.H85R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A254G	18						.						104.0	102.0	103.0					18																	43671703		2203	4300	6503	41925701	SO:0001583	missense	498	exon3			D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.254A>G	18.37:g.43671703T>C	ENSP00000381736:p.His85Arg	Somatic		Unspecified	Illumina	Phase_I	41925701	NM_004046	A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	ENST00000398752.6	37	CCDS11927.1	.	.	.	.	.	.	.	.	.	.	T	19.56	3.851174	0.71719	.	.	ENSG00000152234	ENST00000282050;ENST00000398752;ENST00000542290	D;D	0.85629	-2.01;-2.01	5.24	5.24	0.73138	ATPase, F1/A1 complex, alpha subunit, N-terminal (1);ATPase, F1/V1/A1 complex, alpha/beta subunit, N-terminal (1);ATPase, F1/A1 complex, alpha/beta subunit, N-terminal (1);	0.189396	0.49305	D	0.000141	D	0.86686	0.5992	L	0.49699	1.58	0.43857	D	0.996455	B	0.27951	0.195	B	0.42593	0.392	D	0.86298	0.1678	10	0.66056	D	0.02	-18.3519	15.1468	0.72662	0.0:0.0:0.0:1.0	.	85	P25705	ATPA_HUMAN	R	85;85;35	ENSP00000282050:H85R;ENSP00000381736:H85R	ENSP00000282050:H85R	H	-	2	0	ATP5A1	41925701	1.000000	0.71417	0.964000	0.40570	0.969000	0.65631	7.992000	0.88273	1.975000	0.57531	0.533000	0.62120	CAT		ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255884.1	NM_004046	
ZBTB7C	201501	broad.mit.edu	37	18	45567411	45567411	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr18:45567411C>G	ENST00000588982.1	-	3	569	c.68G>C	c.(67-69)aGc>aCc	p.S23T	ZBTB7C_ENST00000332053.2_Missense_Mutation_p.S23T|ZBTB7C_ENST00000586438.1_Missense_Mutation_p.S23T|ZBTB7C_ENST00000590800.1_Missense_Mutation_p.S23T|ZBTB7C_ENST00000535628.2_Missense_Mutation_p.S23T			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	23							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CTCATTGAGGCTGCACAGGAC	0.597																																					p.S23T												.	.	0			c.G68C	18						.						86.0	79.0	81.0					18																	45567411		2203	4300	6503	43821409	SO:0001583	missense	201501	exon2			Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.68G>C	18.37:g.45567411C>G	ENSP00000468782:p.Ser23Thr	None		Unspecified	Illumina	Phase_I	43821409	NM_001039360	O73453	Missense_Mutation	SNP	ENST00000588982.1	37	CCDS32830.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666827	0.47677	.	.	ENSG00000184828	ENST00000535628;ENST00000332053;ENST00000540333	T;T	0.70986	-0.53;-0.53	5.04	5.04	0.67666	BTB/POZ fold (2);	0.043988	0.85682	D	0.000000	T	0.69824	0.3154	L	0.38733	1.17	0.39016	D	0.959642	D;P;P	0.53745	0.962;0.759;0.759	P;B;B	0.49047	0.599;0.259;0.259	T	0.72191	-0.4365	10	0.39692	T	0.17	.	18.3518	0.90340	0.0:1.0:0.0:0.0	.	23;23;23	B4DKU0;B2RG49;A1YPR0	.;.;ZBT7C_HUMAN	T	23	ENSP00000439781:S23T;ENSP00000328732:S23T	ENSP00000328732:S23T	S	-	2	0	ZBTB7C	43821409	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.999000	0.70665	2.332000	0.79248	0.561000	0.74099	AGC		ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
DVL3	1857	broad.mit.edu	37	3	183884308	183884308	+	Silent	SNP	G	G	A	rs186597752		TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:183884308G>A	ENST00000313143.3	+	9	1226	c.978G>A	c.(976-978)ccG>ccA	p.P326P	EIF2B5_ENST00000444495.1_Intron|DVL3_ENST00000431765.1_Silent_p.P326P	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	326					canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)	p.P326P(1)		breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			TGCACAAACCGGGGTATGGAT	0.537																																					p.P326P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G978A	3						.						145.0	145.0	145.0					3																	183884308		2203	4300	6503	185367002	SO:0001819	synonymous_variant	1857	exon9			D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.978G>A	3.37:g.183884308G>A		Somatic		Unspecified	Illumina	Phase_I	185367002	NM_004423	B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Silent	SNP	ENST00000313143.3	37	CCDS3253.1																																																																																				DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346184.1	NM_004423	
ITIH3	3699	broad.mit.edu	37	3	52840399	52840399	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:52840399G>A	ENST00000449956.2	+	18	2039	c.2033G>A	c.(2032-2034)cGc>cAc	p.R678H	ITIH3_ENST00000416872.2_Intron	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	678					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R678H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		ACAGTGCTGCGCCTTATTCAG	0.612																																					p.R678H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2033A	3						.						44.0	44.0	44.0					3																	52840399		1954	4137	6091	52815439	SO:0001583	missense	3699	exon18				CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.2033G>A	3.37:g.52840399G>A	ENSP00000415769:p.Arg678His	Somatic		Unspecified	Illumina	Phase_I	52815439	NM_002217	Q3B7H5|Q53F06|Q6LAM2|Q99085	Missense_Mutation	SNP	ENST00000449956.2	37	CCDS46845.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679546	0.47886	.	.	ENSG00000162267	ENST00000273291;ENST00000449956	T	0.01705	4.68	5.38	4.27	0.50696	.	0.337826	0.33496	N	0.004854	T	0.03011	0.0089	M	0.74881	2.28	0.29739	N	0.837221	P	0.48016	0.904	B	0.37650	0.255	T	0.16988	-1.0384	10	0.52906	T	0.07	-10.1344	11.5428	0.50675	0.1232:0.0:0.8768:0.0	.	678	Q06033	ITIH3_HUMAN	H	673;678	ENSP00000415769:R678H	ENSP00000273291:R673H	R	+	2	0	ITIH3	52815439	0.786000	0.28738	1.000000	0.80357	0.106000	0.19336	1.342000	0.33919	2.692000	0.91855	0.561000	0.74099	CGC		ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217	
CPOX	1371	broad.mit.edu	37	3	98304422	98304422	+	Silent	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:98304422C>T	ENST00000264193.2	-	5	1253	c.1035G>A	c.(1033-1035)ccG>ccA	p.P345P		NM_000097.5	NP_000088.3	P36551	HEM6_HUMAN	coproporphyrinogen oxidase	345					heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to arsenic-containing substance (GO:0046685)|response to insecticide (GO:0017085)|response to iron ion (GO:0010039)|response to lead ion (GO:0010288)|response to methylmercury (GO:0051597)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	coproporphyrinogen oxidase activity (GO:0004109)|protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)	p.P345P(1)		endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						CCTCCTTGGACGGAGAGTCAA	0.493																																					p.P345P	Esophageal Squamous(75;7 1223 22300 43648 48951)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1035A	3						.						130.0	137.0	134.0					3																	98304422		2203	4300	6503	99787112	SO:0001819	synonymous_variant	1371	exon5			BC017210	CCDS2932.1	3q12	2012-10-02		2004-01-30		ENSG00000080819	1.3.3.3		2321	protein-coding gene	gene with protein product	"""coproporphyria"""	612732	"""coproporphyrinogen oxidase (coproporphyria, harderoporphyria)"""	CPO		7757079, 8407975	Standard	NM_000097		Approved	CPX, HCP	uc003dsx.3	P36551		ENST00000264193.2:c.1035G>A	3.37:g.98304422C>T		Somatic		Unspecified	Illumina	Phase_I	99787112	NM_000097	A8K275|B4DSD5|Q14060|Q53F08|Q8IZ45|Q96AF3	Silent	SNP	ENST00000264193.2	37	CCDS2932.1																																																																																				CPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358900.1	NM_000097	
CHRD	8646	broad.mit.edu	37	3	184101188	184101188	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:184101188T>A	ENST00000204604.1	+	11	1548	c.1302T>A	c.(1300-1302)aaT>aaA	p.N434K	CHRD_ENST00000450923.1_Missense_Mutation_p.N434K|EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000545352.1_Missense_Mutation_p.N64K|CHRD_ENST00000348986.3_Missense_Mutation_p.N434K	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	434	CHRD 3. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGCTAGGAAATGGCTCCCTGA	0.637																																					p.N434K												.	.	0			c.T1302A	3						.						51.0	51.0	51.0					3																	184101188		2203	4300	6503	185583882	SO:0001583	missense	8646	exon11			AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1302T>A	3.37:g.184101188T>A	ENSP00000204604:p.Asn434Lys	None		Unspecified	Illumina	Phase_I	185583882	NM_003741	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	CCDS3266.1	.	.	.	.	.	.	.	.	.	.	T	17.48	3.400706	0.62177	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352;ENST00000342610	T;T;T;T	0.42131	0.98;0.98;2.31;0.98	4.65	-2.64	0.06114	CHRD (3);	0.100700	0.64402	D	0.000005	T	0.57666	0.2069	M	0.73598	2.24	0.52099	D	0.999946	D;D;P;D	0.89917	0.999;1.0;0.947;1.0	D;D;P;D	0.97110	0.992;0.992;0.9;1.0	T	0.60388	-0.7273	10	0.87932	D	0	-11.4676	11.1122	0.48239	0.0:0.5115:0.0:0.4885	.	64;434;434;434	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0	.;.;.;CHRD_HUMAN	K	434;434;434;64;147	ENSP00000204604:N434K;ENSP00000408972:N434K;ENSP00000334036:N434K;ENSP00000442948:N64K	ENSP00000204604:N434K	N	+	3	2	CHRD	185583882	0.005000	0.15991	0.995000	0.50966	0.832000	0.47134	-1.520000	0.02241	-0.382000	0.07870	0.379000	0.24179	AAT		CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741	
BCL6	604	broad.mit.edu	37	3	187446265	187446265	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AG-A014-01	TCGA-AG-A014-01			A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:187446265delA	ENST00000406870.2	-	6	1789	c.1423delT	c.(1423-1425)tgcfs	p.C475fs	RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000232014.4_Frame_Shift_Del_p.C475fs|RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000450123.2_Frame_Shift_Del_p.C475fs	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	475					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		CAGGACGTGCACTTCGGGGGG	0.612			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.C475fs			Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	.	0			c.1423delT	3						.						68.0	60.0	62.0					3																	187446265		2203	4300	6503	188928959	SO:0001589	frameshift_variant	604	exon6				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1423delT	3.37:g.187446265delA	ENSP00000384371:p.Cys475fs	None		Unspecified	Illumina	Phase_I	188928959	NM_001130845	A7E241|B8PSA7|D3DNV5	Frame_Shift_Del	DEL	ENST00000406870.2	37	CCDS3289.1																																																																																				BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
BCL6	604	broad.mit.edu	37	3	187446268	187446269	+	Frame_Shift_Del	DEL	TC	TC	-	rs149258247		TCGA-AG-A014-01	TCGA-AG-A014-01			TC	TC	TC	TC	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:187446268_187446269delTC	ENST00000406870.2	-	6	1785_1786	c.1419_1420delGA	c.(1417-1422)ccgaagfs	p.K474fs	RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000232014.4_Frame_Shift_Del_p.K474fs|RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000450123.2_Frame_Shift_Del_p.K474fs	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	474					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K474fs*26(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GACGTGCACTTCGGGGGGTGCA	0.624			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.473_474del			Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1419_1420del	3						.																																			188928963	SO:0001589	frameshift_variant	604	exon6				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1419_1420delGA	3.37:g.187446268_187446269delTC	ENSP00000384371:p.Lys474fs	None		Unspecified	Illumina	Phase_I	188928962	NM_001130845	A7E241|B8PSA7|D3DNV5	Frame_Shift_Del	DEL	ENST00000406870.2	37	CCDS3289.1																																																																																				BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
ATRIP	84126	broad.mit.edu	37	3	48501185	48501188	+	Splice_Site	DEL	GGTT	GGTT	-			TCGA-AG-A014-01	TCGA-AG-A014-01			GGTT	GGTT	GGTT	GGTT	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:48501185_48501188delGGTT	ENST00000320211.3	+	7	1038_1041	c.925_928delGGTT	c.(925-930)ggttcc>cc	p.GS309fs	ATRIP_ENST00000412052.1_Splice_Site_p.GS216fs|ATRIP_ENST00000357105.6_Splice_Site_p.GS182fs|ATRIP_ENST00000346691.4_Splice_Site_p.GS309fs	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	309					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GTCTTCTGCAGGTTCCATTTTGAT	0.485								Other conserved DNA damage response genes																													p.309_310del												.	.	0			c.926_928del	3						.																																			48476192	SO:0001630	splice_region_variant	84126	exon7			AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.926-1GGTT>-	3.37:g.48501185_48501188delGGTT		None		Unspecified	Illumina	Phase_I	48476189	NM_130384	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Splice_Site	DEL	ENST00000320211.3	37	CCDS2768.1																																																																																				ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384	Frame_Shift_Del
CAMKV	79012	broad.mit.edu	37	3	49898887	49898887	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr3:49898887delC	ENST00000477224.1	-	5	904	c.426delG	c.(424-426)gtgfs	p.V142fs	RN7SL217P_ENST00000584520.1_RNA|CAMKV_ENST00000488336.1_Frame_Shift_Del_p.V142fs|CAMKV_ENST00000466940.1_Intron|CAMKV_ENST00000498324.1_5'Flank|CAMKV_ENST00000296471.7_Frame_Shift_Del_p.V142fs|CAMKV_ENST00000467248.1_Frame_Shift_Del_p.V67fs|CAMKV_ENST00000463537.1_Frame_Shift_Del_p.V142fs			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	142	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.H143fs*15(1)		central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GATTCCTGTGCACGATCTTGA	0.602																																					p.V142fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.426delG	3						.						76.0	69.0	71.0					3																	49898887		2203	4300	6503	49873891	SO:0001589	frameshift_variant	79012	exon5			BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.426delG	3.37:g.49898887delC	ENSP00000419195:p.Val142fs	Somatic		Unspecified	Illumina	Phase_I	49873891	NM_024046	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Frame_Shift_Del	DEL	ENST00000477224.1	37	CCDS33762.1																																																																																				CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350584.4	NM_024046	
GLT8D2	83468	broad.mit.edu	37	12	104413414	104413414	+	Nonsense_Mutation	SNP	G	G	A	rs527597208		TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr12:104413414G>A	ENST00000360814.4	-	3	418	c.13C>T	c.(13-15)Cga>Tga	p.R5*	GLT8D2_ENST00000547583.1_Nonsense_Mutation_p.R5*|GLT8D2_ENST00000548660.1_Nonsense_Mutation_p.R5*|GLT8D2_ENST00000546436.1_Nonsense_Mutation_p.R5*	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	5						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.R5*(1)		kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						TTACTTTTTCGTAACAGAGCC	0.338																																					p.R5X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C13T	12						.						69.0	67.0	68.0					12																	104413414		2203	4300	6503	102937544	SO:0001587	stop_gained	83468	exon3			BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.13C>T	12.37:g.104413414G>A	ENSP00000354053:p.Arg5*	Somatic		Unspecified	Illumina	Phase_I	102937544	NM_031302	Q96KA2	Nonsense_Mutation	SNP	ENST00000360814.4	37	CCDS9096.1	.	.	.	.	.	.	.	.	.	.	G	39	7.553357	0.98355	.	.	ENSG00000120820	ENST00000360814;ENST00000546436;ENST00000548660;ENST00000547583	.	.	.	4.29	4.29	0.51040	.	0.188567	0.41294	D	0.000902	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.489	0.67637	0.0:0.0:1.0:0.0	.	.	.	.	X	5	.	ENSP00000354053:R5X	R	-	1	2	GLT8D2	102937544	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.584000	0.36589	2.325000	0.78763	0.655000	0.94253	CGA		GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407371.1	NM_031302	
ACACB	32	broad.mit.edu	37	12	109684236	109684236	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr12:109684236C>T	ENST00000338432.7	+	39	5673	c.5554C>T	c.(5554-5556)Cca>Tca	p.P1852S	ACACB_ENST00000543201.1_Missense_Mutation_p.P518S|ACACB_ENST00000377848.3_Missense_Mutation_p.P1852S|ACACB_ENST00000377854.5_Missense_Mutation_p.P1782S			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1852	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TTGGGTGGACCCAGAAGACCC	0.552																																					p.P1852S												.	.	0			c.C5554T	12						.						56.0	59.0	58.0					12																	109684236		2203	4300	6503	108168619	SO:0001583	missense	32	exon38			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.5554C>T	12.37:g.109684236C>T	ENSP00000341044:p.Pro1852Ser	None		Unspecified	Illumina	Phase_I	108168619	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248695	0.59103	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201	D;D;D;D	0.97089	-4.24;-4.24;-4.24;-4.24	5.29	4.38	0.52667	Carboxyl transferase (1);Acetyl-coenzyme A carboxyltransferase, N-terminal (1);	0.048785	0.85682	D	0.000000	D	0.96516	0.8863	M	0.77313	2.365	0.80722	D	1	P	0.39717	0.684	B	0.39706	0.307	D	0.96151	0.9108	10	0.54805	T	0.06	.	16.1387	0.81509	0.0:0.8661:0.1339:0.0	.	1852	O00763	ACACB_HUMAN	S	1852;1852;1782;1083;518	ENSP00000341044:P1852S;ENSP00000367079:P1852S;ENSP00000367085:P1782S;ENSP00000444075:P518S	ENSP00000341044:P1852S	P	+	1	0	ACACB	108168619	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.809000	0.86057	1.338000	0.45544	0.561000	0.74099	CCA		ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
SLC6A13	6540	broad.mit.edu	37	12	335654	335654	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr12:335654T>C	ENST00000343164.4	-	9	1014	c.962A>G	c.(961-963)aAc>aGc	p.N321S	SLC6A13_ENST00000445055.2_Missense_Mutation_p.N229S|SLC6A13_ENST00000539668.1_5'Flank	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	321				Missing (in Ref. 1; AAF64247). {ECO:0000305}.	neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)	p.N321S(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			GGTGCCGCTGTTGAGGAAGCA	0.617																																					p.N229S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A686G	12						.						61.0	53.0	56.0					12																	335654		2203	4300	6503	205915	SO:0001583	missense	6540	exon7			U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.962A>G	12.37:g.335654T>C	ENSP00000339260:p.Asn321Ser	Somatic		Unspecified	Illumina	Phase_I	205915	NM_001190997	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	37	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.784247	0.90282	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	D;D	0.82433	-1.61;-1.61	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.94538	0.8241	H	0.98218	4.175	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.83275	0.973;0.996	D	0.96534	0.9395	10	0.87932	D	0	.	15.3028	0.73966	0.0:0.0:0.0:1.0	.	229;321	B4DJL1;Q9NSD5	.;S6A13_HUMAN	S	229;300;321	ENSP00000407104:N229S;ENSP00000339260:N321S	ENSP00000318097:N300S	N	-	2	0	SLC6A13	205915	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.974000	0.88039	2.010000	0.58986	0.402000	0.26972	AAC		SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	T	rs121913530		TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr12:25398285C>T	ENST00000256078.4	-	2	97	c.34G>A	c.(34-36)Ggt>Agt	p.G12S	KRAS_ENST00000556131.1_Missense_Mutation_p.G12S|KRAS_ENST00000311936.3_Missense_Mutation_p.G12S|KRAS_ENST00000557334.1_Missense_Mutation_p.G12S	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12S	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1	.	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34A	12	GRCh37	CM076251	KRAS	M	rs121913530	.						93.0	83.0	86.0					12																	25398285		2203	4300	6503	25289552	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>A	12.37:g.25398285C>T	ENSP00000256078:p.Gly12Ser	Somatic		Unspecified	Illumina	Phase_I	25289552	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	35	5.441396	0.96187	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.78559	0.4302	L	0.28344	0.845	0.80722	D	1	P;P	0.39665	0.557;0.682	P;P	0.50570	0.525;0.644	T	0.80254	-0.1459	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	S	12	ENSP00000308495:G12S;ENSP00000452512:G12S;ENSP00000256078:G12S;ENSP00000451856:G12S	ENSP00000256078:G12S	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
RAPGEF3	10411	broad.mit.edu	37	12	48145516	48145516	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr12:48145516T>A	ENST00000449771.2	-	4	458	c.370A>T	c.(370-372)Agg>Tgg	p.R124W	RAPGEF3_ENST00000171000.4_Missense_Mutation_p.R82W|RAPGEF3_ENST00000395358.3_Missense_Mutation_p.R124W|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.R82W|RAPGEF3_ENST00000548919.1_Missense_Mutation_p.R82W|RAPGEF3_ENST00000549347.1_5'Flank|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.R124W|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.R82W			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	124	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		CGATAGAGCCTAAGGTGGTAC	0.617																																					p.R82W												.	.	0			c.A244T	12						.						63.0	67.0	65.0					12																	48145516		2203	4300	6503	46431783	SO:0001583	missense	10411	exon3			AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.370A>T	12.37:g.48145516T>A	ENSP00000395708:p.Arg124Trp	None		Unspecified	Illumina	Phase_I	46431783	NM_001098532	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	37	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	T	19.01	3.743885	0.69418	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919;ENST00000395358;ENST00000466322;ENST00000495953	T;T;T;T;T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37;2.37;2.37;2.37;2.37	4.3	-4.24	0.03777	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.059827	0.64402	D	0.000008	T	0.41858	0.1177	M	0.82716	2.605	0.54753	D	0.999988	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.81914	0.989;0.99;0.995	T	0.54662	-0.8260	10	0.72032	D	0.01	.	18.8955	0.92421	0.0:0.0:0.82:0.18	.	136;124;124	B7Z5J6;O95398-2;O95398	.;.;RPGF3_HUMAN	W	82;124;82;82;82;124;136;82;124;82;82	ENSP00000384521:R82W;ENSP00000395708:R124W;ENSP00000448619:R82W;ENSP00000171000:R82W;ENSP00000373864:R124W;ENSP00000448480:R82W;ENSP00000378764:R124W;ENSP00000446731:R82W;ENSP00000448804:R82W	ENSP00000171000:R82W	R	-	1	2	RAPGEF3	46431783	0.070000	0.21116	0.770000	0.31555	0.981000	0.71138	0.230000	0.17852	-0.814000	0.04352	-0.488000	0.04728	AGG		RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	NM_006105	
ACVRL1	94	broad.mit.edu	37	12	52309909	52309910	+	Missense_Mutation	DNP	GT	GT	TG			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr12:52309909_52309910GT>TG	ENST00000388922.4	+	8	1421_1422	c.1138_1139GT>TG	c.(1138-1140)GTg>TGg	p.V380W	ACVRL1_ENST00000550683.1_Missense_Mutation_p.V394W|ACVRL1_ENST00000419526.2_Missense_Mutation_p.V206W	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	380	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.V380>?(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	GGCACCCGAGGTGCTGGACGAG	0.619																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1138_1139TG	12	GRCh37	CM050026	ACVRL1	M		.																																			50596177	SO:0001583	missense	94	exon7			L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	Exception_encountered	12.37:g.52309909_52309910delinsTG	ENSP00000373574:p.Val380Trp	Somatic		Unspecified	Illumina	Phase_I	50596176	NM_001077401	A6NGA8	Missense_Mutation	DNP	ENST00000388922.4	37	CCDS31804.1																																																																																				ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2		
MYF5	4617	broad.mit.edu	37	12	81111304	81111304	+	Silent	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr12:81111304G>A	ENST00000228644.3	+	1	614	c.462G>A	c.(460-462)tcG>tcA	p.S154S		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	154					camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)	p.S154S(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						AGAGCTGCTCGGAGCCCACCA	0.542																																					p.S154S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G462A	12						.						120.0	130.0	127.0					12																	81111304		2203	4300	6503	79635435	SO:0001819	synonymous_variant	4617	exon1				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.462G>A	12.37:g.81111304G>A		Somatic		Unspecified	Illumina	Phase_I	79635435	NM_005593	Q6ISR9	Silent	SNP	ENST00000228644.3	37	CCDS9020.1																																																																																				MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407757.1	NM_005593	
CUX2	23316	broad.mit.edu	37	12	111744774	111744774	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr12:111744774T>C	ENST00000261726.6	+	11	1062	c.908T>C	c.(907-909)cTg>cCg	p.L303P		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	303					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						GAGGCCGCGCTGGCCTCCAAG	0.642																																					p.L303P												.	.	0			c.T908C	12						.						55.0	60.0	59.0					12																	111744774		1921	4123	6044	110229157	SO:0001583	missense	23316	exon11			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.908T>C	12.37:g.111744774T>C	ENSP00000261726:p.Leu303Pro	None		Unspecified	Illumina	Phase_I	110229157	NM_015267	A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	37	CCDS41837.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.416408	0.83449	.	.	ENSG00000111249	ENST00000261726	T	0.59224	0.28	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000001	T	0.75606	0.3872	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79184	-0.1908	10	0.87932	D	0	-15.9186	14.9123	0.70767	0.0:0.0:0.0:1.0	.	303	O14529	CUX2_HUMAN	P	303	ENSP00000261726:L303P	ENSP00000261726:L303P	L	+	2	0	CUX2	110229157	1.000000	0.71417	0.989000	0.46669	0.944000	0.59088	7.687000	0.84139	2.010000	0.58986	0.523000	0.50628	CTG		CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
MAGEL2	54551	broad.mit.edu	37	15	23889919	23889919	+	Missense_Mutation	SNP	C	C	T	rs372805925	byFrequency	TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr15:23889919C>T	ENST00000532292.1	-	1	1256	c.1162G>A	c.(1162-1164)Gta>Ata	p.V388I		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	271	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GACACAACTACGGGCAGAGAG	0.642													C|||	2	0.000399361	0.0	0.0	5008	,	,		17883	0.0		0.0	False		,,,				2504	0.002				p.V991I												.	.	0			c.G2971A	15						.	C	ILE/VAL	0,3856		0,0,1928	36.0	37.0	37.0		2971	-6.3	0.0	15		37	1,8269		0,1,4134	no	missense	MAGEL2	NM_019066.4	29	0,1,6062	TT,TC,CC		0.0121,0.0,0.0082	benign	991/1250	23889919	1,12125	1928	4135	6063	21441012	SO:0001583	missense	54551	exon1			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1162G>A	15.37:g.23889919C>T	ENSP00000433433:p.Val388Ile	Somatic		Unspecified	Illumina	Phase_I	21441012	NM_019066		Missense_Mutation	SNP	ENST00000532292.1	37																																																																																					MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
NPAP1	23742	broad.mit.edu	37	15	24921147	24921147	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr15:24921147C>T	ENST00000329468.2	+	1	607	c.133C>T	c.(133-135)Cgc>Tgc	p.R45C		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	45					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R45C(1)									ACCCACCCCGCGCCCTTTCCG	0.761																																					p.R45C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C133T	15						.						11.0	14.0	13.0					15																	24921147		2139	4164	6303	22472240	SO:0001583	missense	23742	exon1			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.133C>T	15.37:g.24921147C>T	ENSP00000333735:p.Arg45Cys	Somatic		Unspecified	Illumina	Phase_I	22472240	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	13.85	2.361417	0.41801	.	.	ENSG00000185823	ENST00000329468	T	0.07327	3.2	2.14	-4.28	0.03732	.	2.777100	0.01720	N	0.028204	T	0.05914	0.0154	N	0.22421	0.69	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.35025	-0.9805	10	0.54805	T	0.06	.	3.9791	0.09487	0.0:0.2566:0.3614:0.382	.	45	Q9NZP6	CO002_HUMAN	C	45	ENSP00000333735:R45C	ENSP00000333735:R45C	R	+	1	0	C15orf2	22472240	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.364000	0.07583	-1.295000	0.02357	0.305000	0.20034	CGC		NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
C15orf41	84529	broad.mit.edu	37	15	36950064	36950064	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr15:36950064C>G	ENST00000566621.1	+	5	554	c.304C>G	c.(304-306)Ctt>Gtt	p.L102V	C15orf41_ENST00000569302.1_Missense_Mutation_p.L102V|RP11-16L14.2_ENST00000565366.1_RNA|C15orf41_ENST00000437989.2_Missense_Mutation_p.L102V|C15orf41_ENST00000338183.4_Missense_Mutation_p.L4V|C15orf41_ENST00000567389.1_Missense_Mutation_p.L4V|C15orf41_ENST00000562877.1_Missense_Mutation_p.L4V	NM_001130010.1	NP_001123482.1	Q9Y2V0	CO041_HUMAN	chromosome 15 open reading frame 41	102								p.L102V(1)		kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		AATGGCTCGGCTTATACTGGA	0.398																																					p.L102V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C304G	15						.						66.0	62.0	63.0					15																	36950064		1828	4076	5904	34737356	SO:0001583	missense	84529	exon5			BC006254	CCDS45215.1, CCDS45216.1	15q14	2012-05-31			ENSG00000186073	ENSG00000186073			26929	protein-coding gene	gene with protein product		615626					Standard	XM_005254719		Approved	HH114, MGC11326, FLJ22851	uc001zje.4	Q9Y2V0	OTTHUMG00000172659	ENST00000566621.1:c.304C>G	15.37:g.36950064C>G	ENSP00000455397:p.Leu102Val	Somatic		Unspecified	Illumina	Phase_I	34737356	NM_001130010	B2RD87	Missense_Mutation	SNP	ENST00000566621.1	37	CCDS45215.1	.	.	.	.	.	.	.	.	.	.	C	3.072	-0.190834	0.06299	.	.	ENSG00000186073	ENST00000437989;ENST00000338183	T	0.47869	0.83	5.32	4.23	0.50019	.	.	.	.	.	T	0.38241	0.1033	L	0.35644	1.08	0.23969	N	0.996313	B	0.06786	0.001	B	0.06405	0.002	T	0.20174	-1.0283	9	0.28530	T	0.3	-0.4456	12.3195	0.54977	0.8391:0.1609:0.0:0.0	.	102	Q9Y2V0	CO041_HUMAN	V	102;4	ENSP00000401362:L102V	ENSP00000342433:L4V	L	+	1	0	C15orf41	34737356	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	1.512000	0.35812	1.040000	0.40099	0.650000	0.86243	CTT		C15orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419741.1	NM_032499	
PLA2G4D	283748	broad.mit.edu	37	15	42379579	42379579	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr15:42379579C>G	ENST00000290472.3	-	3	268	c.174G>C	c.(172-174)aaG>aaC	p.K58N		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	58	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)	p.K58N(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		TGGTCTTAAACTTCATTCCAG	0.547																																					p.K58N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G174C	15						.						235.0	206.0	216.0					15																	42379579		2203	4299	6502	40166871	SO:0001583	missense	283748	exon3			AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.174G>C	15.37:g.42379579C>G	ENSP00000290472:p.Lys58Asn	Somatic		Unspecified	Illumina	Phase_I	40166871	NM_178034	Q8N176	Missense_Mutation	SNP	ENST00000290472.3	37	CCDS32203.1	.	.	.	.	.	.	.	.	.	.	C	12.18	1.860578	0.32884	.	.	ENSG00000159337	ENST00000290472	T	0.72051	-0.62	5.15	2.17	0.27698	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.231810	0.35585	N	0.003102	T	0.79364	0.4433	M	0.91818	3.245	0.09310	N	0.999996	P	0.47191	0.891	P	0.51324	0.666	T	0.70666	-0.4809	10	0.52906	T	0.07	-35.4794	7.2849	0.26333	0.0:0.6328:0.0:0.3672	.	58	Q86XP0	PA24D_HUMAN	N	58	ENSP00000290472:K58N	ENSP00000290472:K58N	K	-	3	2	PLA2G4D	40166871	0.007000	0.16637	0.590000	0.28732	0.274000	0.26718	0.053000	0.14184	0.667000	0.31107	-0.140000	0.14226	AAG		PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1	NM_178034	
PRTG	283659	broad.mit.edu	37	15	55974598	55974598	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr15:55974598G>A	ENST00000389286.4	-	4	687	c.640C>T	c.(640-642)Cgt>Tgt	p.R214C	RP11-420M1.2_ENST00000561155.1_RNA	NM_173814.4	NP_776175.2			protogenin									p.R214C(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		ATACTTTTACGTCGGTGGGCT	0.453																																					p.R214C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C640T	15						.						104.0	103.0	103.0					15																	55974598		1919	4126	6045	53761890	SO:0001583	missense	283659	exon4			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.640C>T	15.37:g.55974598G>A	ENSP00000373937:p.Arg214Cys	Somatic		Unspecified	Illumina	Phase_I	53761890	NM_173814		Missense_Mutation	SNP	ENST00000389286.4	37	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.714689	0.48622	.	.	ENSG00000166450	ENST00000389286	T	0.68025	-0.3	5.41	4.49	0.54785	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83547	0.5278	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	P	0.60173	0.87	D	0.87865	0.2667	10	0.72032	D	0.01	-14.6203	14.8166	0.70039	0.0:0.0:0.8555:0.1445	.	214	Q2VWP7	PRTG_HUMAN	C	214	ENSP00000373937:R214C	ENSP00000373937:R214C	R	-	1	0	PRTG	53761890	1.000000	0.71417	0.030000	0.17652	0.179000	0.23085	4.335000	0.59298	1.256000	0.44068	0.491000	0.48974	CGT		PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814	
MYZAP	100820829	broad.mit.edu	37	15	57896494	57896494	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr15:57896494G>A	ENST00000267853.5	+	2	197	c.103G>A	c.(103-105)Gta>Ata	p.V35I	GCOM1_ENST00000380560.2_Missense_Mutation_p.V35I|GCOM1_ENST00000572390.1_Missense_Mutation_p.V35I|GCOM1_ENST00000380568.3_Missense_Mutation_p.V35I|GCOM1_ENST00000380561.2_Missense_Mutation_p.V35I|POLR2M_ENST00000380563.2_5'UTR|MYZAP_ENST00000380565.4_Missense_Mutation_p.V35I|GCOM1_ENST00000380569.2_Missense_Mutation_p.V35I|GCOM1_ENST00000396180.1_Missense_Mutation_p.V35I|GCOM1_ENST00000587652.1_Missense_Mutation_p.V35I|GCOM1_ENST00000574161.1_Missense_Mutation_p.V35I			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	35					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)		p.V35I(1)									ACGGCTGACCGTACCTCCTGA	0.507																																					p.V35I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G103A	15						.						167.0	167.0	167.0					15																	57896494		2192	4292	6484	55683786	SO:0001583	missense	145781	exon2			FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.103G>A	15.37:g.57896494G>A	ENSP00000267853:p.Val35Ile	Somatic		Unspecified	Illumina	Phase_I	55683786	NM_152451	D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	ENST00000267853.5	37	CCDS10162.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.914249	0.33815	.	.	ENSG00000137878	ENST00000380569;ENST00000380561;ENST00000396180;ENST00000380560;ENST00000267853;ENST00000380565;ENST00000380568	T;T;T;T;T;T;T	0.32988	1.67;1.43;1.48;1.53;1.66;1.66;1.65	5.24	4.32	0.51571	.	0.244676	0.35040	N	0.003492	T	0.27629	0.0679	L	0.54323	1.7	0.80722	D	1	B;B;B;B	0.23854	0.092;0.038;0.038;0.018	B;B;B;B	0.15052	0.012;0.012;0.012;0.012	T	0.08186	-1.0734	10	0.48119	T	0.1	-18.6802	9.7885	0.40690	0.0931:0.0:0.9069:0.0	.	35;35;35;35	P0CAP1-2;P0CAP1-11;P0CAP1-4;P0CAP1	.;.;.;GCOM1_HUMAN	I	35	ENSP00000369943:V35I;ENSP00000369935:V35I;ENSP00000379483:V35I;ENSP00000369933:V35I;ENSP00000267853:V35I;ENSP00000369939:V35I;ENSP00000369942:V35I	ENSP00000267853:V35I	V	+	1	0	GCOM1	55683786	0.151000	0.22747	0.503000	0.27626	0.548000	0.35241	1.088000	0.30877	1.567000	0.49668	0.655000	0.94253	GTA		MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255716.2	NM_001018100	
CYP1A2	1544	broad.mit.edu	37	15	75042288	75042289	+	Missense_Mutation	DNP	AG	AG	CC	rs207475597		TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr15:75042288_75042289AG>CC	ENST00000343932.4	+	2	272_273	c.209_210AG>CC	c.(208-210)cAG>cCC	p.Q70P		NM_000761.3	NP_000752.2	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 2	70					alkaloid metabolic process (GO:0009820)|arachidonic acid metabolic process (GO:0019369)|cellular respiration (GO:0045333)|cellular response to cadmium ion (GO:0071276)|dibenzo-p-dioxin metabolic process (GO:0018894)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|hydrogen peroxide biosynthetic process (GO:0050665)|lung development (GO:0030324)|methylation (GO:0032259)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative deethylation (GO:0071615)|oxidative demethylation (GO:0070989)|porphyrin-containing compound metabolic process (GO:0006778)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|toxin biosynthetic process (GO:0009403)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|demethylase activity (GO:0032451)|electron carrier activity (GO:0009055)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)	p.Q70>?(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33					"""""""Insulin(DB00071)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Agomelatine(DB06594)|Albendazole(DB00518)|Alitretinoin(DB00523)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Anagrelide(DB00261)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Asenapine(DB06216)|Atropine(DB00572)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzyl alcohol(DB06770)|Betaxolol(DB00195)|Bortezomib(DB00188)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Caffeine(DB00201)|Carbamazepine(DB00564)|Carmustine(DB00262)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clenbuterol(DB01407)|Clevidipine(DB04920)|Clobetasol propionate(DB01013)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Diazepam(DB00829)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Edetic Acid(DB00974)|Efavirenz(DB00625)|Eltrombopag(DB06210)|Enoxacin(DB00467)|Epinephrine(DB00668)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Ethanol(DB00898)|Etoposide(DB00773)|Etoricoxib(DB01628)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Gemfibrozil(DB01241)|Griseofulvin(DB00400)|Guanabenz(DB00629)|Haloperidol(DB00502)|Hesperetin(DB01094)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|inhaled insulin(DB05278)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Losartan(DB00678)|Lumiracoxib(DB01283)|Malathion(DB00772)|Maprotiline(DB00934)|Meclizine(DB00737)|Melatonin(DB01065)|Menadione(DB00170)|Methadone(DB00333)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Nabumetone(DB00461)|Nafcillin(DB00607)|Naproxen(DB00788)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitric Oxide(DB00435)|Nitroprusside(DB00325)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxaliplatin(DB00526)|Oxtriphylline(DB01303)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pefloxacin(DB00487)|Pentamidine(DB00738)|Pentoxifylline(DB00806)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pomalidomide(DB08910)|Praziquantel(DB01058)|Primaquine(DB01087)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|SIMEPREVIR(DB06290)|Sorafenib(DB00398)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Tenofovir(DB00300)|Terbinafine(DB00857)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiabendazole(DB00730)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tizanidine(DB00697)|Tocainide(DB01056)|Toremifene(DB00539)|Tranylcypromine(DB00752)|Triamterene(DB00384)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)|Vemurafenib(DB08881)|Verapamil(DB00661)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)|Zolpidem(DB00425)"""	AGGATGAGCCAGCGCTACGGGG	0.668																																					.												.	.	1	Complex(1)	large_intestine(1)	c.209_210CC	15						.																																			72829342	SO:0001583	missense	1544	exon2			AF182274	CCDS32293.1	15q24.1	2013-11-11	2003-01-14		ENSG00000140505	ENSG00000140505	1.14.14.1	"""Cytochrome P450s"""	2596	protein-coding gene	gene with protein product		124060	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 2"""			15128046	Standard	NM_000761		Approved	P3-450, CP12	uc002ayr.1	P05177	OTTHUMG00000172901	Exception_encountered	15.37:g.75042288_75042289delinsCC	ENSP00000342007:p.Gln70Pro	Somatic		Unspecified	Illumina	Phase_I	72829341	NM_000761	Q16754|Q6NWU5|Q9BXX7|Q9UK49	Missense_Mutation	DNP	ENST00000343932.4	37	CCDS32293.1																																																																																				CYP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421263.2	NM_000761	
GRIA2	2891	broad.mit.edu	37	4	158281128	158281128	+	Silent	SNP	C	C	T	rs143272523		TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr4:158281128C>T	ENST00000264426.9	+	13	2403	c.2124C>T	c.(2122-2124)gcC>gcT	p.A708A	AC079233.1_ENST00000578227.1_RNA|GRIA2_ENST00000296526.7_Silent_p.A708A|GRIA2_ENST00000393815.2_Silent_p.A661A|GRIA2_ENST00000507898.1_Silent_p.A661A|GRIA2_ENST00000449365.1_Silent_p.A661A	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	708					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.A708A(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GGACTACGGCCGAAGGGGTGG	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		17949	0.0		0.001	False		,,,				2504	0.0				p.A661A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1983T	4						.	C	,,	0,4406		0,0,2203	108.0	106.0	107.0		2124,2124,1983	-10.2	0.3	4	dbSNP_134	107	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous	GRIA2	NM_000826.3,NM_001083619.1,NM_001083620.1	,,	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	,,	708/884,708/884,661/837	158281128	4,13002	2203	4300	6503	158500578	SO:0001819	synonymous_variant	2891	exon13				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.2124C>T	4.37:g.158281128C>T		Somatic		Unspecified	Illumina	Phase_I	158500578	NM_001083620	A8MT92|I6L997|Q96FP6	Silent	SNP	ENST00000264426.9	37	CCDS43274.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	2.571	-0.299619	0.05532	0.0	4.65E-4	ENSG00000120251	ENST00000510854	.	.	.	5.69	-10.2	0.00374	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.7617	0.13111	0.3113:0.0969:0.0672:0.5246	.	.	.	.	X	39	.	.	R	+	1	2	GRIA2	158500578	0.000000	0.05858	0.316000	0.25252	0.978000	0.69477	-4.652000	0.00203	-1.729000	0.01364	-0.345000	0.07892	CGA		GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
NFXL1	152518	broad.mit.edu	37	4	47892713	47892713	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr4:47892713G>T	ENST00000507489.1	-	12	1636	c.1460C>A	c.(1459-1461)cCt>cAt	p.P487H	NFXL1_ENST00000329043.3_Missense_Mutation_p.P487H|NFXL1_ENST00000381538.3_Missense_Mutation_p.P487H	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	487						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P487H(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						ACAGTTTCCAGGGCAACACTG	0.368																																					p.P487H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1460A	4						.						85.0	79.0	81.0					4																	47892713		2203	4300	6503	47587470	SO:0001583	missense	152518	exon12			AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.1460C>A	4.37:g.47892713G>T	ENSP00000422037:p.Pro487His	Somatic		Unspecified	Illumina	Phase_I	47587470	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	37	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286782	0.80803	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	T;T;T	0.53423	0.62;0.62;0.62	5.26	5.26	0.73747	Zinc finger, NF-X1-type (1);	0.000000	0.85682	D	0.000000	T	0.69886	0.3161	M	0.88241	2.94	0.80722	D	1	D	0.63046	0.992	P	0.55785	0.784	T	0.76900	-0.2788	10	0.62326	D	0.03	-12.6511	18.8593	0.92266	0.0:0.0:1.0:0.0	.	487	Q6ZNB6	NFXL1_HUMAN	H	487	ENSP00000370949:P487H;ENSP00000422037:P487H;ENSP00000333113:P487H	ENSP00000333113:P487H	P	-	2	0	NFXL1	47587470	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.390000	0.97246	2.471000	0.83476	0.650000	0.86243	CCT		NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
SGCB	6443	broad.mit.edu	37	4	52899701	52899701	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr4:52899701delT	ENST00000381431.5	-	2	361	c.139delA	c.(139-141)attfs	p.I47fs	SGCB_ENST00000535450.1_Intron	NM_000232.4	NP_000223.1	Q16585	SGCB_HUMAN	sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)	47					cardiac muscle cell development (GO:0055013)|muscle fiber development (GO:0048747)|muscle organ development (GO:0007517)|vascular smooth muscle cell development (GO:0097084)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.I47fs*11(1)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(6)|prostate(1)	17			GBM - Glioblastoma multiforme(4;7.63e-12)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TCTTCATCAATCGGAATGTAT	0.418																																					p.I47fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.139delA	4						.						207.0	183.0	191.0					4																	52899701		2203	4300	6503	52594458	SO:0001589	frameshift_variant	6443	exon2			U29586	CCDS3488.1	4q12	2014-09-17	2002-08-29		ENSG00000163069	ENSG00000163069			10806	protein-coding gene	gene with protein product		600900	"""sarcoglycan, beta (43kD dystrophin-associated glycoprotein)"""	LGMD2E		8968749	Standard	NM_000232		Approved	SGC, A3b	uc003gzj.2	Q16585	OTTHUMG00000128697	ENST00000381431.5:c.139delA	4.37:g.52899701delT	ENSP00000370839:p.Ile47fs	Somatic		Unspecified	Illumina	Phase_I	52594458	NM_000232	B7Z635|O00661	Frame_Shift_Del	DEL	ENST00000381431.5	37	CCDS3488.1																																																																																				SGCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250596.2		
SGCB	6443	broad.mit.edu	37	4	52899712	52899714	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-AG-A014-01	TCGA-AG-A014-01			CCA	CCA	CCA	CCA	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr4:52899712_52899714delCCA	ENST00000381431.5	-	2	348_350	c.126_128delTGG	c.(124-129)gctgga>gca	p.G43del	SGCB_ENST00000535450.1_Intron	NM_000232.4	NP_000223.1	Q16585	SGCB_HUMAN	sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)	43					cardiac muscle cell development (GO:0055013)|muscle fiber development (GO:0048747)|muscle organ development (GO:0007517)|vascular smooth muscle cell development (GO:0097084)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.G43V(1)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(6)|prostate(1)	17			GBM - Glioblastoma multiforme(4;7.63e-12)|LUSC - Lung squamous cell carcinoma(32;0.00204)			CGGAATGTATCCAGCTTTAAAGT	0.414																																					p.42_43del												.	.	1	Substitution - Missense(1)	breast(1)	c.126_128del	4						.																																			52594471	SO:0001651	inframe_deletion	6443	exon2			U29586	CCDS3488.1	4q12	2014-09-17	2002-08-29		ENSG00000163069	ENSG00000163069			10806	protein-coding gene	gene with protein product		600900	"""sarcoglycan, beta (43kD dystrophin-associated glycoprotein)"""	LGMD2E		8968749	Standard	NM_000232		Approved	SGC, A3b	uc003gzj.2	Q16585	OTTHUMG00000128697	ENST00000381431.5:c.126_128delTGG	4.37:g.52899712_52899714delCCA	ENSP00000370839:p.Gly43del	None		Unspecified	Illumina	Phase_I	52594469	NM_000232	B7Z635|O00661	In_Frame_Del	DEL	ENST00000381431.5	37	CCDS3488.1																																																																																				SGCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250596.2		
SGCB	6443	broad.mit.edu	37	4	52899719	52899722	+	Frame_Shift_Del	DEL	TAAA	TAAA	-			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr4:52899719_52899722delTAAA	ENST00000381431.5	-	2	340_343	c.118_121delTTTA	c.(118-123)tttaaafs	p.FK40fs	SGCB_ENST00000535450.1_Intron	NM_000232.4	NP_000223.1	Q16585	SGCB_HUMAN	sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)	40					cardiac muscle cell development (GO:0055013)|muscle fiber development (GO:0048747)|muscle organ development (GO:0007517)|vascular smooth muscle cell development (GO:0097084)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.F40fs*17(1)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(6)|prostate(1)	17			GBM - Glioblastoma multiforme(4;7.63e-12)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TATCCAGCTTTAAAGTTACTGTTG	0.397																																					p.40_41del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.118_121del	4						.																																			52594479	SO:0001589	frameshift_variant	6443	exon2			U29586	CCDS3488.1	4q12	2014-09-17	2002-08-29		ENSG00000163069	ENSG00000163069			10806	protein-coding gene	gene with protein product		600900	"""sarcoglycan, beta (43kD dystrophin-associated glycoprotein)"""	LGMD2E		8968749	Standard	NM_000232		Approved	SGC, A3b	uc003gzj.2	Q16585	OTTHUMG00000128697	ENST00000381431.5:c.118_121delTTTA	4.37:g.52899719_52899722delTAAA	ENSP00000370839:p.Phe40fs	Somatic		Unspecified	Illumina	Phase_I	52594476	NM_000232	B7Z635|O00661	Frame_Shift_Del	DEL	ENST00000381431.5	37	CCDS3488.1																																																																																				SGCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250596.2		
TRAPPC11	60684	broad.mit.edu	37	4	184615782	184615782	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr4:184615782G>A	ENST00000334690.6	+	23	2736	c.2534G>A	c.(2533-2535)tGt>tAt	p.C845Y	TRAPPC11_ENST00000357207.4_Missense_Mutation_p.C845Y|TRAPPC11_ENST00000512476.1_Missense_Mutation_p.C451Y	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	845					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.C845Y(1)									TATGTTCGCTGTGGAACAGTG	0.299																																					p.C845Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2534A	4						.						62.0	62.0	62.0					4																	184615782		2203	4294	6497	184852776	SO:0001583	missense	60684	exon23				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.2534G>A	4.37:g.184615782G>A	ENSP00000335371:p.Cys845Tyr	Somatic		Unspecified	Illumina	Phase_I	184852776	NM_199053	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	ENST00000334690.6	37	CCDS34112.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319429	0.81469	.	.	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000360109;ENST00000512476	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.73946	0.3652	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.997	D;D;D;D	0.91635	0.989;0.999;0.983;0.994	T	0.67094	-0.5757	9	0.02654	T	1	.	19.1299	0.93400	0.0:0.0:1.0:0.0	.	576;451;845;845	B3KR79;D6RHE5;Q7Z392;Q7Z392-3	.;.;TPC11_HUMAN;.	Y	845;845;845;451	.	ENSP00000335371:C845Y	C	+	2	0	C4orf41	184852776	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.263000	0.95617	2.753000	0.94483	0.467000	0.42956	TGT		TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2	NM_021942	
XKRX	402415	broad.mit.edu	37	X	100169628	100169628	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chrX:100169628C>T	ENST00000372956.2	-	3	1653	c.1049G>A	c.(1048-1050)gGc>gAc	p.G350D	XKRX_ENST00000328526.5_Missense_Mutation_p.G363D|XKRX_ENST00000468904.1_3'UTR			Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related, X-linked	350						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G363D(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(3)	22						ATAGTGCAGGCCCATATGTCC	0.448																																					p.G350D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1049A	X						.						182.0	163.0	169.0					X																	100169628		2203	4300	6503	100056284	SO:0001583	missense	402415	exon3			AY589511	CCDS14476.1, CCDS14476.2	Xq22	2008-02-05	2006-01-12		ENSG00000182489	ENSG00000182489			29845	protein-coding gene	gene with protein product		300684	"""X Kell blood group precursor-related, X-linked"""				Standard	NM_212559		Approved	XPLAC, XKR2	uc004egn.2	Q6PP77	OTTHUMG00000022010	ENST00000372956.2:c.1049G>A	X.37:g.100169628C>T	ENSP00000362047:p.Gly350Asp	Somatic		Unspecified	Illumina	Phase_I	100056284	NM_212559	B2RNN6|B4DKU2|Q5H9J6	Missense_Mutation	SNP	ENST00000372956.2	37	CCDS14476.2	.	.	.	.	.	.	.	.	.	.	C	13.29	2.192153	0.38707	.	.	ENSG00000182489	ENST00000328526;ENST00000372956	T;T	0.63255	-0.03;-0.03	5.74	2.86	0.33363	.	0.330090	0.35903	N	0.002909	T	0.43634	0.1256	N	0.08118	0	0.33382	D	0.574968	P	0.42584	0.784	P	0.45829	0.494	T	0.55049	-0.8201	10	0.35671	T	0.21	-4.1639	8.7787	0.34778	0.2078:0.4625:0.3297:0.0	.	350	Q6PP77	XKR2_HUMAN	D	363;350	ENSP00000327570:G363D;ENSP00000362047:G350D	ENSP00000327570:G363D	G	-	2	0	XKRX	100056284	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	3.193000	0.50997	1.148000	0.42385	0.544000	0.68410	GGC		XKRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057501.3	NM_212559	
GABRA3	2556	broad.mit.edu	37	X	151358383	151358383	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chrX:151358383A>C	ENST00000370314.4	-	9	1200	c.962T>G	c.(961-963)tTg>tGg	p.L321W	GABRA3_ENST00000535043.1_Missense_Mutation_p.L321W|GABRA3_ENST00000497894.1_5'UTR	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	321					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	ACTGATACTCAAGGTGGTCAT	0.448																																					p.L321W	NSCLC(142;2578 2613 10251 16743)											.	.	0			c.T962G	X						.						72.0	69.0	70.0					X																	151358383		2203	4300	6503	151109039	SO:0001583	missense	2556	exon9				CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.962T>G	X.37:g.151358383A>C	ENSP00000359337:p.Leu321Trp	None		Unspecified	Illumina	Phase_I	151109039	NM_000808	Q8TAF9	Missense_Mutation	SNP	ENST00000370314.4	37	CCDS14706.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.094985	0.76870	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	D;D;D	0.88124	-2.34;-2.34;-2.34	5.56	5.56	0.83823	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.64402	D	0.000001	D	0.94424	0.8206	M	0.91140	3.18	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.95271	0.8377	10	0.87932	D	0	.	12.5433	0.56184	1.0:0.0:0.0:0.0	.	321	P34903	GBRA3_HUMAN	W	321	ENSP00000359337:L321W;ENSP00000359334:L321W;ENSP00000443527:L321W	ENSP00000359334:L321W	L	-	2	0	GABRA3	151109039	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.268000	0.78473	1.868000	0.54150	0.483000	0.47432	TTG		GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808	
ZEB2	9839	broad.mit.edu	37	2	145155885	145155885	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr2:145155885G>A	ENST00000558170.2	-	8	4053	c.2869C>T	c.(2869-2871)Cgg>Tgg	p.R957W	ZEB2_ENST00000539609.3_Missense_Mutation_p.R933W|ZEB2_ENST00000303660.4_Missense_Mutation_p.R957W|ZEB2_ENST00000409487.3_Missense_Mutation_p.R957W	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	957					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.R957W(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCTTGTTTCCGCTGGTACTTT	0.408																																					p.R933W	Melanoma(33;1235 1264 5755 16332)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2797T	2						.						90.0	87.0	88.0					2																	145155885		2203	4300	6503	144872355	SO:0001583	missense	9839	exon7			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.2869C>T	2.37:g.145155885G>A	ENSP00000454157:p.Arg957Trp	Somatic		Unspecified	Illumina	Phase_I	144872355	NM_001171653	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679129	0.47886	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.14766	2.48;2.48;2.48	5.83	3.98	0.46160	.	0.000000	0.85682	D	0.000000	T	0.33702	0.0872	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.77557	0.978;0.99;0.99;0.99	T	0.06092	-1.0846	10	0.87932	D	0	-6.4187	15.2553	0.73579	0.0:0.0:0.7445:0.2555	.	933;822;956;957	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	W	933;957;957	ENSP00000443792:R933W;ENSP00000302501:R957W;ENSP00000386854:R957W	ENSP00000302501:R957W	R	-	1	2	ZEB2	144872355	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.825000	0.62708	0.756000	0.33013	0.563000	0.77884	CGG		ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
LRP2	4036	broad.mit.edu	37	2	170063145	170063145	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr2:170063145C>T	ENST00000263816.3	-	39	7370	c.7085G>A	c.(7084-7086)gGa>gAa	p.G2362E		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2362	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.G2362E(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GGTGTGCAATCCAGGCAGAGC	0.488																																					p.G2362E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7085A	2						.						72.0	66.0	68.0					2																	170063145		2203	4300	6503	169771391	SO:0001583	missense	4036	exon39				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7085G>A	2.37:g.170063145C>T	ENSP00000263816:p.Gly2362Glu	Somatic		Unspecified	Illumina	Phase_I	169771391	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	8.408	0.843470	0.16963	.	.	ENSG00000081479	ENST00000263816	D	0.95482	-3.72	6.07	0.456	0.16655	Epidermal growth factor-like (1);	0.506284	0.23551	N	0.046971	D	0.89210	0.6650	L	0.47078	1.49	0.58432	D	0.999997	B	0.10296	0.003	B	0.08055	0.003	T	0.76310	-0.3006	10	0.02654	T	1	.	6.4822	0.22069	0.0:0.3959:0.123:0.481	.	2362	P98164	LRP2_HUMAN	E	2362	ENSP00000263816:G2362E	ENSP00000263816:G2362E	G	-	2	0	LRP2	169771391	0.672000	0.27530	0.294000	0.24946	0.584000	0.36387	1.302000	0.33459	-0.198000	0.10333	0.655000	0.94253	GGA		LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
PLCL1	5334	broad.mit.edu	37	2	198949476	198949476	+	Missense_Mutation	SNP	C	C	T	rs374856574		TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr2:198949476C>T	ENST00000428675.1	+	2	1633	c.1235C>T	c.(1234-1236)tCt>tTt	p.S412F	PLCL1_ENST00000437704.2_Missense_Mutation_p.S314F	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	412	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.S314F(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	ATCAATGCCTCTCATAACACC	0.418																																					p.S412F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1235T	2						.	C	PHE/SER	0,4406		0,0,2203	87.0	87.0	87.0		1235	5.9	1.0	2		87	1,8599	1.2+/-3.3	0,1,4299	no	missense	PLCL1	NM_006226.3	155	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	412/1096	198949476	1,13005	2203	4300	6503	198657721	SO:0001583	missense	5334	exon2			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1235C>T	2.37:g.198949476C>T	ENSP00000402861:p.Ser412Phe	Somatic		Unspecified	Illumina	Phase_I	198657721	NM_006226	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682740	0.68157	0.0	1.16E-4	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.64618	-0.11;-0.11	5.94	5.94	0.96194	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.64402	D	0.000004	D	0.88119	0.6351	H	0.98068	4.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.91620	0.5310	9	.	.	.	.	20.3633	0.98874	0.0:1.0:0.0:0.0	.	412;338	Q15111;B4DYZ4	PLCL1_HUMAN;.	F	412;314	ENSP00000402861:S412F;ENSP00000414138:S314F	.	S	+	2	0	PLCL1	198657721	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.808000	0.86044	2.826000	0.97356	0.561000	0.74099	TCT		PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
CIB4	130106	broad.mit.edu	37	2	26818086	26818086	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr2:26818086C>T	ENST00000288861.4	-	4	339	c.286G>A	c.(286-288)Gcc>Acc	p.A96T	CIB4_ENST00000405346.3_5'UTR	NM_001029881.1	NP_001025052.1	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	96							calcium ion binding (GO:0005509)	p.A96T(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTGGGCAGGCCTGCTCGCTG	0.542																																					p.A96T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G286A	2						.						133.0	115.0	121.0					2																	26818086		2203	4300	6503	26671590	SO:0001583	missense	130106	exon4				CCDS33160.1	2p23.3	2013-01-10			ENSG00000157884	ENSG00000157884		"""EF-hand domain containing"""	33703	protein-coding gene	gene with protein product		610646				15574431	Standard	NM_001029881		Approved		uc002rhm.3	A0PJX0	OTTHUMG00000151993	ENST00000288861.4:c.286G>A	2.37:g.26818086C>T	ENSP00000288861:p.Ala96Thr	Somatic		Unspecified	Illumina	Phase_I	26671590	NM_001029881	B2RU18	Missense_Mutation	SNP	ENST00000288861.4	37	CCDS33160.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929509	0.92389	.	.	ENSG00000157884	ENST00000288861;ENST00000403670;ENST00000405346	T	0.67865	-0.29	6.08	6.08	0.98989	EF-hand-like domain (1);	0.000000	0.64402	D	0.000009	D	0.82986	0.5156	M	0.83483	2.645	0.49299	D	0.999777	D	0.76494	0.999	D	0.72982	0.979	D	0.84553	0.0645	10	0.87932	D	0	.	16.1722	0.81825	0.0:1.0:0.0:0.0	.	96	A0PJX0	CIB4_HUMAN	T	96;51;98	ENSP00000288861:A96T	ENSP00000288861:A96T	A	-	1	0	CIB4	26671590	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.949000	0.56668	2.894000	0.99253	0.591000	0.81541	GCC		CIB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324709.1		
RETSAT	54884	broad.mit.edu	37	2	85578926	85578926	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr2:85578926C>G	ENST00000295802.4	-	2	344	c.232G>C	c.(232-234)Ggg>Cgg	p.G78R	ELMOD3_ENST00000409344.3_5'Flank|ELMOD3_ENST00000393852.4_5'Flank|ELMOD3_ENST00000409013.3_5'Flank|ELMOD3_ENST00000428955.2_5'Flank|ELMOD3_ENST00000409890.2_5'Flank|RETSAT_ENST00000263854.6_Missense_Mutation_p.G78R|ELMOD3_ENST00000315658.7_5'Flank|RETSAT_ENST00000457495.2_Intron	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	78					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)	p.G78R(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	GCCAGGCCCCCAAAGCCACTG	0.557																																					p.G78R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G232C	2						.						84.0	80.0	81.0					2																	85578926		2203	4300	6503	85432437	SO:0001583	missense	54884	exon2			AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.232G>C	2.37:g.85578926C>G	ENSP00000295802:p.Gly78Arg	Somatic		Unspecified	Illumina	Phase_I	85432437	NM_017750	A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	37	CCDS1972.1	.	.	.	.	.	.	.	.	.	.	C	31	5.092561	0.94149	.	.	ENSG00000042445	ENST00000295802;ENST00000263854	D;D	0.81739	-1.53;-1.53	5.62	5.62	0.85841	Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);	0.054659	0.64402	D	0.000001	D	0.92172	0.7518	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93629	0.6954	10	0.87932	D	0	-20.9854	17.1641	0.86810	0.0:1.0:0.0:0.0	.	78	Q6NUM9	RETST_HUMAN	R	78	ENSP00000295802:G78R;ENSP00000263854:G78R	ENSP00000263854:G78R	G	-	1	0	RETSAT	85432437	1.000000	0.71417	0.995000	0.50966	0.942000	0.58702	7.655000	0.83696	2.665000	0.90641	0.650000	0.86243	GGG		RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750	
ACADL	33	broad.mit.edu	37	2	211069375	211069375	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr2:211069375C>T	ENST00000233710.3	-	7	1027	c.800G>A	c.(799-801)cGg>cAg	p.R267Q	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	267					carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)	p.R267Q(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		AGCTGGCAACCGTATATCTTC	0.373																																					p.R267Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G800A	2						.						125.0	125.0	125.0					2																	211069375		2203	4300	6503	210777620	SO:0001583	missense	33	exon7			M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.800G>A	2.37:g.211069375C>T	ENSP00000233710:p.Arg267Gln	Somatic		Unspecified	Illumina	Phase_I	210777620	NM_001608	B2R8T3|Q8IUN8	Missense_Mutation	SNP	ENST00000233710.3	37	CCDS2389.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737705	0.69304	.	.	ENSG00000115361	ENST00000233710	D	0.99259	-5.64	5.22	4.35	0.52113	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase/oxidase C-terminal (1);	0.056311	0.64402	D	0.000001	D	0.99202	0.9723	M	0.83953	2.67	0.48632	D	0.999688	D	0.63880	0.993	P	0.58454	0.839	D	0.98869	1.0765	10	0.72032	D	0.01	.	13.8394	0.63430	0.0:0.9258:0.0:0.0742	.	267	P28330	ACADL_HUMAN	Q	267	ENSP00000233710:R267Q	ENSP00000233710:R267Q	R	-	2	0	ACADL	210777620	1.000000	0.71417	0.968000	0.41197	0.938000	0.57974	5.735000	0.68587	1.215000	0.43411	0.579000	0.79373	CGG		ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256561.2	NM_001608	
DMRT2	10655	broad.mit.edu	37	9	1053815	1053815	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr9:1053815A>G	ENST00000358146.2	+	2	619	c.619A>G	c.(619-621)Att>Gtt	p.I207V	DMRT2_ENST00000412350.2_Missense_Mutation_p.I207V|DMRT2_ENST00000382255.3_Missense_Mutation_p.I207V|DMRT2_ENST00000259622.6_Missense_Mutation_p.I207V|DMRT2_ENST00000382251.3_Missense_Mutation_p.I207V|DMRT2_ENST00000302441.6_Missense_Mutation_p.I207V			Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor 2	207					embryonic skeletal system development (GO:0048706)|positive regulation of myotome development (GO:2000287)|regulation of somitogenesis (GO:0014807)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I207V(2)		large_intestine(1)|lung(1)|prostate(2)	4		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		GGCCAAAAGCATTTTAGAAGG	0.413																																					p.I207V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A619G	9						.						65.0	69.0	67.0					9																	1053815		2203	4300	6503	1043815	SO:0001583	missense	10655	exon4			AF130729	CCDS6444.1, CCDS6445.1	9p24.3	2008-07-21			ENSG00000173253	ENSG00000173253			2935	protein-coding gene	gene with protein product	"""terra-like protein"""	604935				10332030	Standard	NM_181872		Approved		uc003zha.3	Q9Y5R5	OTTHUMG00000019437	ENST00000358146.2:c.619A>G	9.37:g.1053815A>G	ENSP00000350865:p.Ile207Val	Somatic		Unspecified	Illumina	Phase_I	1043815	NM_001130865	B1ANC0|B9EGJ1|Q9NPG6|Q9NQR6	Missense_Mutation	SNP	ENST00000358146.2	37	CCDS6444.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.351262	0.61183	.	.	ENSG00000173253	ENST00000382255;ENST00000382251;ENST00000412350;ENST00000302441;ENST00000358146;ENST00000259622	T;T;T;T;T;T	0.54279	0.58;1.54;0.58;1.54;1.54;0.58	5.72	5.72	0.89469	.	0.246042	0.31673	N	0.007247	T	0.67692	0.2920	L	0.54323	1.7	0.58432	D	0.999996	B;D;D	0.67145	0.324;0.994;0.996	B;D;D	0.77557	0.133;0.978;0.99	T	0.66168	-0.5991	10	0.38643	T	0.18	-15.654	15.6654	0.77225	1.0:0.0:0.0:0.0	.	207;207;51	Q05C20;Q9Y5R5;Q5HYK2	.;DMRT2_HUMAN;.	V	207	ENSP00000371690:I207V;ENSP00000371686:I207V;ENSP00000397494:I207V;ENSP00000305785:I207V;ENSP00000350865:I207V;ENSP00000259622:I207V	ENSP00000259622:I207V	I	+	1	0	DMRT2	1043815	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.018000	0.93657	2.174000	0.68829	0.454000	0.30748	ATT		DMRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051492.1	NM_006557	
AKNA	80709	broad.mit.edu	37	9	117108256	117108257	+	Missense_Mutation	DNP	AA	AA	GT			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr9:117108256_117108257AA>GT	ENST00000307564.4	-	18	3708_3709	c.3547_3548TT>AC	c.(3547-3549)TTc>ACc	p.F1183T	AKNA_ENST00000374079.4_Missense_Mutation_p.F128T|AKNA_ENST00000223791.3_Missense_Mutation_p.F643T|AKNA_ENST00000374088.3_Missense_Mutation_p.F1183T|AKNA_ENST00000492875.1_5'UTR|AKNA_ENST00000374075.5_Missense_Mutation_p.F1102T	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1183					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.F1183>?(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						CTTCTCAGAGAACAGTGGTAGG	0.584																																					.												.	.	1	Complex(1)	large_intestine(1)	c.3547_3548AC	9						.																																			116148078	SO:0001583	missense	80709	exon18			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.3547_3548delinsGT	9.37:g.117108256_117108257delinsGT	ENSP00000303769:p.Phe1183Thr	Somatic		Unspecified	Illumina	Phase_I	116148077	NM_030767	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	DNP	ENST00000307564.4	37	CCDS6805.1																																																																																				AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
DAB2IP	153090	broad.mit.edu	37	9	124532879	124532880	+	Missense_Mutation	DNP	GC	GC	CG			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr9:124532879_124532880GC>CG	ENST00000408936.3	+	11	2136_2137	c.1954_1955GC>CG	c.(1954-1956)GCa>CGa	p.A652R	DAB2IP_ENST00000259371.2_Missense_Mutation_p.A624R|DAB2IP_ENST00000309989.1_Missense_Mutation_p.A528R			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	652	Necessary for interaction with AKT1.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.A528>?(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						CGTCCACACAGCACTGAGCACC	0.614																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1870_1871CG	9						.																																			123572701	SO:0001583	missense	153090	exon11			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	Exception_encountered	9.37:g.124532879_124532880delinsCG	ENSP00000386183:p.Ala652Arg	Somatic		Unspecified	Illumina	Phase_I	123572700	NM_032552	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Missense_Mutation	DNP	ENST00000408936.3	37																																																																																					DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317857.1	NM_032552	
FOCAD	54914	broad.mit.edu	37	9	20929413	20929413	+	Silent	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr9:20929413G>A	ENST00000380249.1	+	29	3499	c.3135G>A	c.(3133-3135)acG>acA	p.T1045T	FOCAD_ENST00000605086.1_Silent_p.T481T|FOCAD_ENST00000338382.6_Silent_p.T1045T	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1045						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.T1045T(1)									CTGCCGCCACGGCTTTGTCTC	0.473																																					p.T1045T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3135A	9						.						82.0	74.0	77.0					9																	20929413		2203	4300	6503	20919413	SO:0001819	synonymous_variant	54914	exon29			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.3135G>A	9.37:g.20929413G>A		Somatic		Unspecified	Illumina	Phase_I	20919413	NM_017794	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Silent	SNP	ENST00000380249.1	37	CCDS34993.1																																																																																				FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
TOPORS	10210	broad.mit.edu	37	9	32543404	32543404	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr9:32543404A>C	ENST00000360538.2	-	3	1235	c.1119T>G	c.(1117-1119)aaT>aaG	p.N373K	TOPORS_ENST00000379858.1_Missense_Mutation_p.N308K	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	373	Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N373K(1)		large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		GGCAATCATAATTGGCATGCT	0.403																																					p.N308K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T924G	9						.						65.0	68.0	67.0					9																	32543404		2203	4300	6503	32533404	SO:0001583	missense	10210	exon2			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.1119T>G	9.37:g.32543404A>C	ENSP00000353735:p.Asn373Lys	Somatic		Unspecified	Illumina	Phase_I	32533404	NM_001195622	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	37	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	A	0.023	-1.402193	0.01165	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.14022	2.54;2.54	5.93	5.93	0.95920	.	0.000000	0.53938	D	0.000047	T	0.11836	0.0288	L	0.27053	0.805	0.36995	D	0.894977	D	0.54397	0.966	P	0.46479	0.518	T	0.26360	-1.0105	10	0.22109	T	0.4	-29.3046	9.8027	0.40775	0.9226:0.0:0.0774:0.0	.	373	Q9NS56	TOPRS_HUMAN	K	373;308	ENSP00000353735:N373K;ENSP00000369187:N308K	ENSP00000353735:N373K	N	-	3	2	TOPORS	32533404	1.000000	0.71417	1.000000	0.80357	0.228000	0.25075	2.477000	0.45180	2.263000	0.75096	0.533000	0.62120	AAT		TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
LAMC3	10319	broad.mit.edu	37	9	133914332	133914332	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AG-A014-01	TCGA-AG-A014-01			A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr9:133914332delA	ENST00000361069.4	+	5	1191	c.1058delA	c.(1057-1059)cacfs	p.H354fs	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	354	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GGGCGCTGTCACCACTGCCGT	0.637																																					p.H353fs												.	.	0			c.1058delA	9						.						51.0	53.0	53.0					9																	133914332		2203	4300	6503	132904153	SO:0001589	frameshift_variant	10319	exon5			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1058delA	9.37:g.133914332delA	ENSP00000354360:p.His354fs	None		Unspecified	Illumina	Phase_I	132904153	NM_006059	B1APX9|B1APY0|Q59H72	Frame_Shift_Del	DEL	ENST00000361069.4	37	CCDS6938.1																																																																																				LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
OBP2B	29989	broad.mit.edu	37	9	136083879	136083879	+	Missense_Mutation	SNP	C	C	G	rs28584111		TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr9:136083879C>G	ENST00000372034.3	-	2	224	c.183G>C	c.(181-183)aaG>aaC	p.K61N	OBP2B_ENST00000461961.1_Intron|OBP2B_ENST00000372032.2_Intron	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	61					chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)	p.K61N(1)		central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		TGGCTTCCAACTTCCCACCGC	0.622																																					p.K61N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G183C	9						.						124.0	110.0	115.0					9																	136083879		2203	4300	6503	135073700	SO:0001583	missense	29989	exon2			AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.183G>C	9.37:g.136083879C>G	ENSP00000361104:p.Lys61Asn	Somatic		Unspecified	Illumina	Phase_I	135073700	NM_014581	Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	ENST00000372034.3	37	CCDS6961.1	.	.	.	.	.	.	.	.	.	.	G	0.643	-0.812613	0.02798	.	.	ENSG00000171102	ENST00000372034	T	0.08458	3.09	2.31	-0.281	0.12882	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.089000	0.07156	N	0.849966	T	0.02230	0.0069	N	0.01122	-1.005	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.45116	-0.9283	10	0.07813	T	0.8	-15.6209	4.9518	0.14019	0.0:0.4459:0.3286:0.2255	rs28584111	61	Q9NPH6	OBP2B_HUMAN	N	61	ENSP00000361104:K61N	ENSP00000361104:K61N	K	-	3	2	OBP2B	135073700	0.003000	0.15002	0.017000	0.16124	0.019000	0.09904	0.281000	0.18810	-0.129000	0.11620	-0.335000	0.08231	AAG		OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054851.1	NM_014581	
RXFP2	122042	broad.mit.edu	37	13	32351551	32351551	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr13:32351551G>A	ENST00000298386.2	+	8	751	c.680G>A	c.(679-681)cGc>cAc	p.R227H	RXFP2_ENST00000380314.1_Missense_Mutation_p.R227H	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	227					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)	p.R227H(1)		cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		ATTTCACAGCGCTTGTTTACG	0.333																																					p.R227H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G680A	13						.						130.0	123.0	125.0					13																	32351551		2202	4298	6500	31249551	SO:0001583	missense	122042	exon8			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.680G>A	13.37:g.32351551G>A	ENSP00000298386:p.Arg227His	Somatic		Unspecified	Illumina	Phase_I	31249551	NM_001166058	B1ALE9|Q3KU23	Missense_Mutation	SNP	ENST00000298386.2	37	CCDS9342.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.994465	0.35226	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.57752	0.38;3.6	4.96	-4.54	0.03452	.	0.839567	0.10978	N	0.612999	T	0.29423	0.0733	N	0.11756	0.17	0.09310	N	1	B;B	0.31879	0.344;0.195	B;B	0.26864	0.074;0.02	T	0.07809	-1.0753	10	0.45353	T	0.12	.	12.7777	0.57457	0.7608:0.0:0.2392:0.0	.	227;227	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	H	227	ENSP00000369670:R227H;ENSP00000298386:R227H	ENSP00000298386:R227H	R	+	2	0	RXFP2	31249551	0.206000	0.23470	0.029000	0.17559	0.995000	0.86356	-0.273000	0.08548	-0.901000	0.03891	0.655000	0.94253	CGC		RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
ESD	2098	broad.mit.edu	37	13	47345618	47345618	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr13:47345618C>T	ENST00000378720.3	-	10	964	c.782G>A	c.(781-783)aGc>aAc	p.S261N	ESD_ENST00000378697.1_Missense_Mutation_p.S232N	NM_001984.1	NP_001975.1	P10768	ESTD_HUMAN	esterase D	261					formaldehyde catabolic process (GO:0046294)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carboxylic ester hydrolase activity (GO:0052689)|hydrolase activity, acting on ester bonds (GO:0016788)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)|S-formylglutathione hydrolase activity (GO:0018738)	p.S261N(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	9		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)		GBM - Glioblastoma multiforme(144;2.66e-05)	Glutathione(DB00143)	GAAGTAGTAGCTATGATCATA	0.328																																					p.S261N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G782A	13						.						152.0	154.0	153.0					13																	47345618		2203	4296	6499	46243619	SO:0001583	missense	2098	exon10			M13450	CCDS9404.1	13q14.1-q14.2	2014-05-13	2010-05-07		ENSG00000139684	ENSG00000139684	3.1.2.12		3465	protein-coding gene	gene with protein product	"""S-formylglutathione hydrolase"""	133280	"""esterase D/formylglutathione hydrolase"""				Standard	NM_001984		Approved		uc001vbn.3	P10768	OTTHUMG00000016878	ENST00000378720.3:c.782G>A	13.37:g.47345618C>T	ENSP00000367992:p.Ser261Asn	Somatic		Unspecified	Illumina	Phase_I	46243619	NM_001984	Q5TBU8|Q5TBV0|Q5TBV2|Q9BVJ2	Missense_Mutation	SNP	ENST00000378720.3	37	CCDS9404.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344405	0.61073	.	.	ENSG00000139684	ENST00000378720;ENST00000378697	T;T	0.33216	1.42;1.42	6.17	5.17	0.71159	.	0.121779	0.85682	D	0.000000	T	0.45816	0.1361	M	0.91300	3.195	0.58432	D	0.999999	B	0.11235	0.004	B	0.15484	0.013	T	0.52003	-0.8633	10	0.72032	D	0.01	-2.4481	15.5559	0.76192	0.0:0.9239:0.0:0.0761	.	261	P10768	ESTD_HUMAN	N	261;232	ENSP00000367992:S261N;ENSP00000367969:S232N	ENSP00000367969:S232N	S	-	2	0	ESD	46243619	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	5.854000	0.69503	2.941000	0.99782	0.655000	0.94253	AGC		ESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044826.1		
HTR2A	3356	broad.mit.edu	37	13	47466716	47466716	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr13:47466716C>A	ENST00000378688.4	-	2	553	c.422G>T	c.(421-423)tGg>tTg	p.W141L	HTR2A_ENST00000542664.1_Missense_Mutation_p.W141L|HTR2A_ENST00000543956.1_Missense_Mutation_p.W57L			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	141					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CGGCAGAGGCCACCGGTACCC	0.567																																					p.W57L												.	.	0			c.G170T	13						.						93.0	90.0	91.0					13																	47466716		2203	4300	6503	46364717	SO:0001583	missense	3356	exon2			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.422G>T	13.37:g.47466716C>A	ENSP00000367959:p.Trp141Leu	None		Unspecified	Illumina	Phase_I	46364717	NM_001165947	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	ENST00000378688.4	37	CCDS9405.1	.	.	.	.	.	.	.	.	.	.	C	33	5.221680	0.95139	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.77358	-1.09;-1.09;-1.09	6.16	6.16	0.99307	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.93041	0.7785	H	0.97659	4.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.94473	0.7686	10	0.87932	D	0	.	19.848	0.96722	0.0:1.0:0.0:0.0	.	57;141	F5GWE8;P28223	.;5HT2A_HUMAN	L	141;57;141	ENSP00000367959:W141L;ENSP00000441861:W57L;ENSP00000437737:W141L	ENSP00000367959:W141L	W	-	2	0	HTR2A	46364717	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.811000	0.86092	2.937000	0.99478	0.650000	0.86243	TGG		HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621	
SLITRK1	114798	broad.mit.edu	37	13	84454465	84454465	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr13:84454465G>A	ENST00000377084.2	-	1	2063	c.1178C>T	c.(1177-1179)tCg>tTg	p.S393L		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	393					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.S393L(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CACAAAGTGCGATTTTCGGAT	0.453																																					p.S393L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1178T	13						.						180.0	175.0	177.0					13																	84454465		2203	4300	6503	83352466	SO:0001583	missense	114798	exon1			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1178C>T	13.37:g.84454465G>A	ENSP00000366288:p.Ser393Leu	Somatic		Unspecified	Illumina	Phase_I	83352466	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893641	0.33442	.	.	ENSG00000178235	ENST00000377084	T	0.60171	0.21	5.22	5.22	0.72569	.	0.214383	0.40728	N	0.001036	T	0.57784	0.2077	M	0.62266	1.93	0.40711	D	0.982577	B	0.25048	0.117	B	0.25884	0.064	T	0.58137	-0.7689	10	0.44086	T	0.13	-6.2556	17.3478	0.87314	0.0:0.0:1.0:0.0	.	393	Q96PX8	SLIK1_HUMAN	L	393	ENSP00000366288:S393L	ENSP00000366288:S393L	S	-	2	0	SLITRK1	83352466	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.049000	0.64244	2.448000	0.82819	0.555000	0.69702	TCG		SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
SLITRK5	26050	broad.mit.edu	37	13	88327927	88327927	+	Missense_Mutation	SNP	G	G	A	rs370073384		TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr13:88327927G>A	ENST00000325089.6	+	2	503	c.284G>A	c.(283-285)cGt>cAt	p.R95H	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	95					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.R95H(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CTTTTGAACCGTCTCTATCCC	0.478																																					p.R95H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G284A	13						.	G	HIS/ARG	1,4405		0,1,2202	155.0	162.0	159.0		284	5.9	1.0	13		159	0,8600		0,0,4300	no	missense	SLITRK5	NM_015567.1	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	95/959	88327927	1,13005	2203	4300	6503	87125928	SO:0001583	missense	26050	exon2			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.284G>A	13.37:g.88327927G>A	ENSP00000366283:p.Arg95His	Somatic		Unspecified	Illumina	Phase_I	87125928	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.688547	0.48097	2.27E-4	0.0	ENSG00000165300	ENST00000325089	T	0.52754	0.65	5.94	5.94	0.96194	.	0.056937	0.64402	D	0.000004	T	0.59959	0.2232	L	0.41356	1.27	0.80722	D	1	D	0.76494	0.999	D	0.67231	0.95	T	0.52990	-0.8501	9	.	.	.	-6.5501	17.8571	0.88767	0.0:0.0:1.0:0.0	.	95	O94991	SLIK5_HUMAN	H	95	ENSP00000366283:R95H	.	R	+	2	0	SLITRK5	87125928	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.441000	0.59981	2.826000	0.97356	0.561000	0.74099	CGT		SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
POLL	27343	broad.mit.edu	37	10	103340040	103340041	+	Missense_Mutation	DNP	AT	AT	GG			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr10:103340040_103340041AT>GG	ENST00000370162.3	-	8	1821_1822	c.1327_1328AT>CC	c.(1327-1329)ATc>CCc	p.I443P	POLL_ENST00000456836.2_Missense_Mutation_p.I180P|POLL_ENST00000370168.3_Missense_Mutation_p.I116P|DPCD_ENST00000470165.1_3'UTR|POLL_ENST00000339310.3_Missense_Mutation_p.I166P|POLL_ENST00000370169.1_Missense_Mutation_p.I443P|DPCD_ENST00000416979.2_5'UTR|POLL_ENST00000370172.1_Missense_Mutation_p.I355P|POLL_ENST00000299206.4_Missense_Mutation_p.I443P|POLL_ENST00000370158.3_Missense_Mutation_p.I168P|POLL_ENST00000463515.1_5'UTR	NM_001174084.1|NM_001174085.1|NM_013274.3	NP_001167555.1|NP_001167556.1|NP_037406.1	Q9UGP5	DPOLL_HUMAN	polymerase (DNA directed), lambda	443					DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|nucleotide-excision repair (GO:0006289)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)	p.I443>?(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.234)		Epithelial(162;1.55e-08)|all cancers(201;6.64e-07)		GCGGCTGAAGATACCCCGGTGG	0.609								DNA polymerases (catalytic subunits)																													.												.	.	1	Complex(1)	large_intestine(1)	c.1327_1328CC	10						.																																			103330031	SO:0001583	missense	27343	exon8			AF161019	CCDS7513.1	10q23	2012-05-18			ENSG00000166169	ENSG00000166169		"""DNA polymerases"""	9184	protein-coding gene	gene with protein product		606343				17686665	Standard	NM_001174084		Approved		uc001kti.2	Q9UGP5	OTTHUMG00000018933	ENST00000370162.3:c.1327_1328delinsGG	10.37:g.103340040_103340041delinsGG	ENSP00000359181:p.Ile443Pro	Somatic		Unspecified	Illumina	Phase_I	103330030	NM_013274	D3DR76|Q5JQP5|Q6NUM2|Q9BTN8|Q9HA10|Q9HB35	Missense_Mutation	DNP	ENST00000370162.3	37	CCDS7513.1																																																																																				POLL-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049946.1	NM_013274	
DIP2C	22982	broad.mit.edu	37	10	391004	391004	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr10:391004A>G	ENST00000280886.6	-	27	3365	c.3278T>C	c.(3277-3279)tTg>tCg	p.L1093S		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1093						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.L1093S(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GGACCGCAGCAACTTACAGAT	0.592																																					p.L1093S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3278C	10						.						58.0	49.0	52.0					10																	391004		2203	4300	6503	381004	SO:0001583	missense	22982	exon27			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3278T>C	10.37:g.391004A>G	ENSP00000280886:p.Leu1093Ser	Somatic		Unspecified	Illumina	Phase_I	381004	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.672554	0.88348	.	.	ENSG00000151240	ENST00000280886;ENST00000535541	T	0.46063	0.88	5.59	5.59	0.84812	AMP-dependent synthetase/ligase (1);	0.000000	0.64402	D	0.000001	T	0.59473	0.2196	M	0.75615	2.305	0.80722	D	1	P	0.36974	0.576	P	0.50440	0.641	T	0.61113	-0.7128	10	0.52906	T	0.07	-23.6172	15.7635	0.78106	1.0:0.0:0.0:0.0	.	1093	Q9Y2E4	DIP2C_HUMAN	S	1093;18	ENSP00000280886:L1093S	ENSP00000280886:L1093S	L	-	2	0	DIP2C	381004	1.000000	0.71417	0.889000	0.34880	0.889000	0.51656	9.287000	0.95975	2.132000	0.65825	0.533000	0.62120	TTG		DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
KIAA1217	56243	broad.mit.edu	37	10	24822134	24822134	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr10:24822134G>A	ENST00000376454.3	+	16	3412	c.3382G>A	c.(3382-3384)Gaa>Aaa	p.E1128K	KIAA1217_ENST00000396445.1_Missense_Mutation_p.E811K|KIAA1217_ENST00000376451.2_Missense_Mutation_p.E811K|KIAA1217_ENST00000307544.6_Missense_Mutation_p.E811K|KIAA1217_ENST00000376462.1_Missense_Mutation_p.E1048K|KIAA1217_ENST00000396446.1_Missense_Mutation_p.E811K|KIAA1217_ENST00000376452.3_Missense_Mutation_p.E1092K|KIAA1217_ENST00000458595.1_Missense_Mutation_p.E1093K	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1128					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GGAAGAAGAAGAAGAAGGAGA	0.547																																					p.E1128K												.	.	0			c.G3382A	10						.						68.0	71.0	70.0					10																	24822134		2203	4300	6503	24862140	SO:0001583	missense	56243	exon16			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.3382G>A	10.37:g.24822134G>A	ENSP00000365637:p.Glu1128Lys	None		Unspecified	Illumina	Phase_I	24862140	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037684	0.93630	.	.	ENSG00000120549	ENST00000376462;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28	5.8	5.8	0.92144	.	0.054494	0.64402	D	0.000001	T	0.74489	0.3723	M	0.64997	1.995	0.58432	D	0.999992	D;D;D;D;D;D;D;D	0.89917	0.999;0.986;0.998;0.998;1.0;0.999;0.999;0.993	D;P;D;D;D;D;D;P	0.91635	0.996;0.784;0.991;0.972;0.999;0.997;0.994;0.879	T	0.72865	-0.4163	10	0.46703	T	0.11	.	18.2342	0.89944	0.0:0.0:1.0:0.0	.	1093;1092;811;811;811;811;1128;1128	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	K	1048;1093;811;1128;1092;811;811;811;811;811	ENSP00000365645:E1048K;ENSP00000392625:E1093K;ENSP00000365637:E1128K;ENSP00000365635:E1092K;ENSP00000302343:E811K;ENSP00000379722:E811K;ENSP00000365634:E811K;ENSP00000379723:E811K	ENSP00000302343:E811K	E	+	1	0	KIAA1217	24862140	1.000000	0.71417	0.960000	0.40013	0.733000	0.41908	7.478000	0.81082	2.758000	0.94735	0.561000	0.74099	GAA		KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
GFRA1	2674	broad.mit.edu	37	10	117884988	117884988	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A014-01	TCGA-AG-A014-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr10:117884988A>T	ENST00000355422.6	-	6	1064	c.514T>A	c.(514-516)Tcg>Acg	p.S172T	GFRA1_ENST00000544592.1_Missense_Mutation_p.S51T|GFRA1_ENST00000439649.3_Missense_Mutation_p.S167T|GFRA1_ENST00000369236.1_Missense_Mutation_p.S167T	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	172					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)	p.S167T(1)		endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		ATGTACGCCGACCTGTACTTC	0.577																																					p.S167T	Ovarian(128;329 1725 45498 46808 50759)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T499A	10						.						79.0	67.0	71.0					10																	117884988		2203	4300	6503	117874978	SO:0001583	missense	2674	exon5			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.514T>A	10.37:g.117884988A>T	ENSP00000347591:p.Ser172Thr	Somatic		Unspecified	Illumina	Phase_I	117874978	NM_001145453	A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	A	18.06	3.539424	0.65085	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.64085	-0.08;-0.08	5.74	4.59	0.56863	GDNF/GAS1 (2);	0.120781	0.64402	D	0.000018	T	0.67524	0.2902	L	0.34521	1.04	0.58432	D	0.999992	D;D	0.69078	0.991;0.997	D;D	0.83275	0.996;0.996	T	0.63225	-0.6685	10	0.27082	T	0.32	-10.1407	12.1618	0.54107	0.8717:0.0:0.0:0.1283	.	172;167	P56159;P56159-2	GFRA1_HUMAN;.	T	172;167;167;51;167	ENSP00000358239:S167T;ENSP00000442179:S51T	ENSP00000347591:S167T	S	-	1	0	GFRA1	117874978	1.000000	0.71417	0.886000	0.34754	0.800000	0.45204	4.104000	0.57790	0.977000	0.38444	0.459000	0.35465	TCG		GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	
APC	324	broad.mit.edu	37	5	112174916	112174916	+	Nonsense_Mutation	SNP	G	G	T	rs201185479		TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:112174916G>T	ENST00000457016.1	+	16	4005	c.3625G>T	c.(3625-3627)Gaa>Taa	p.E1209*	APC_ENST00000257430.4_Nonsense_Mutation_p.E1209*|APC_ENST00000508376.2_Nonsense_Mutation_p.E1209*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1209	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1209*(3)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CAGTAAAACCGAACATATGTC	0.398		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1191X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	5	Substitution - Nonsense(3)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(3)|soft_tissue(1)|skin(1)	c.G3571T	5	GRCh37	CD011096	APC	D		.						83.0	83.0	83.0					5																	112174916		2202	4300	6502	112202815	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3625G>T	5.37:g.112174916G>T	ENSP00000413133:p.Glu1209*	Somatic		Unspecified	Illumina	Phase_I	112202815	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782541	0.90282	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.91	5.91	0.95273	.	0.056678	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.108	15.437	0.75155	0.0681:0.0:0.9319:0.0	.	.	.	.	X	1209	.	.	E	+	1	0	APC	112202815	1.000000	0.71417	0.997000	0.53966	0.068000	0.16541	6.778000	0.75043	2.802000	0.96397	0.655000	0.94253	GAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
CHSY3	337876	broad.mit.edu	37	5	129520136	129520136	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A014-01	TCGA-AG-A014-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:129520136T>A	ENST00000305031.4	+	3	1659	c.1301T>A	c.(1300-1302)cTc>cAc	p.L434H	CHSY3_ENST00000507545.1_3'UTR	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	434					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.L434H(1)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		ATGAGCAAGCTCAGTAACACA	0.493																																					p.L434H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1301A	5						.						72.0	66.0	68.0					5																	129520136		2203	4300	6503	129548035	SO:0001583	missense	337876	exon3			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1301T>A	5.37:g.129520136T>A	ENSP00000302629:p.Leu434His	Somatic		Unspecified	Illumina	Phase_I	129548035	NM_175856	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	37	CCDS34223.1	.	.	.	.	.	.	.	.	.	.	T	19.43	3.825669	0.71143	.	.	ENSG00000198108	ENST00000305031	T	0.16897	2.31	4.5	4.5	0.54988	.	0.000000	0.51477	D	0.000084	T	0.30448	0.0765	M	0.69823	2.125	0.53005	D	0.999968	P	0.46784	0.884	P	0.49922	0.626	T	0.03795	-1.1003	9	.	.	.	-2.5329	14.8652	0.70409	0.0:0.0:0.0:1.0	.	434	Q70JA7	CHSS3_HUMAN	H	434	ENSP00000302629:L434H	.	L	+	2	0	CHSY3	129548035	0.997000	0.39634	1.000000	0.80357	0.912000	0.54170	2.400000	0.44504	2.243000	0.73865	0.528000	0.53228	CTC		CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
DNAH5	1767	broad.mit.edu	37	5	13885213	13885213	+	Silent	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:13885213G>A	ENST00000265104.4	-	19	2972	c.2868C>T	c.(2866-2868)cgC>cgT	p.R956R	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	956	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R956R(2)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGAGTAACTCGCGGGCTTCTT	0.443									Kartagener syndrome																												p.R956R												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C2868T	5						.						126.0	120.0	122.0					5																	13885213		2203	4300	6503	13938213	SO:0001819	synonymous_variant	1767	exon19	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2868C>T	5.37:g.13885213G>A		Somatic		Unspecified	Illumina	Phase_I	13938213	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																				DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
PSD2	84249	broad.mit.edu	37	5	139197135	139197135	+	Silent	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:139197135C>T	ENST00000274710.3	+	5	1291	c.1086C>T	c.(1084-1086)gaC>gaT	p.D362D		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	362	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.D362D(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACTCTGGACGGAGCACTCA	0.542																																					p.D362D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1086T	5						.						84.0	79.0	81.0					5																	139197135		2203	4300	6503	139177319	SO:0001819	synonymous_variant	84249	exon5			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1086C>T	5.37:g.139197135C>T		Somatic		Unspecified	Illumina	Phase_I	139177319	NM_032289	D3DQD3|Q8N3J8	Silent	SNP	ENST00000274710.3	37	CCDS4216.1																																																																																				PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PCDHGA11	56105	broad.mit.edu	37	5	140802148	140802148	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:140802148G>A	ENST00000398587.2	+	1	1387	c.1354G>A	c.(1354-1356)Gtt>Att	p.V452I	PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.V452I|PCDHGB7_ENST00000398594.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	452	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAACCCTCCCGTTTTTCCTCA	0.527																																					p.V452I												.	.	0			c.G1354A	5						.						134.0	140.0	138.0					5																	140802148		2063	4234	6297	140782332	SO:0001583	missense	56105	exon1			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1354G>A	5.37:g.140802148G>A	ENSP00000381589:p.Val452Ile	None		Unspecified	Illumina	Phase_I	140782332	NM_018914	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	37	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	g	1.282	-0.609954	0.03690	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.02395	4.31;4.31	6.17	2.84	0.33178	Cadherin (3);Cadherin-like (1);	1.043410	0.07825	U	0.960417	T	0.04318	0.0119	L	0.58101	1.795	0.09310	N	1	B;B;B	0.31351	0.007;0.32;0.084	B;B;B	0.26202	0.004;0.067;0.014	T	0.40608	-0.9554	10	0.41790	T	0.15	.	8.0724	0.30697	0.507:0.0:0.493:0.0	.	452;452;452	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	I	452	ENSP00000381589:V452I;ENSP00000428333:V452I	ENSP00000381589:V452I	V	+	1	0	PCDHGA11	140782332	0.000000	0.05858	0.166000	0.22797	0.075000	0.17131	-0.202000	0.09451	0.803000	0.34113	-0.140000	0.14226	GTT		PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914	
JAKMIP2	9832	broad.mit.edu	37	5	147023718	147023718	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:147023718G>T	ENST00000265272.5	-	7	1594	c.1127C>A	c.(1126-1128)tCt>tAt	p.S376Y	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.S334Y|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.S376Y	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	376						Golgi apparatus (GO:0005794)		p.S376Y(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCATTCAGAGATTTTAATTT	0.373																																					p.S376Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1127A	5						.						121.0	117.0	119.0					5																	147023718		2203	4300	6503	147003911	SO:0001583	missense	9832	exon7			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.1127C>A	5.37:g.147023718G>T	ENSP00000265272:p.Ser376Tyr	Somatic		Unspecified	Illumina	Phase_I	147003911	NM_014790	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764313	0.89932	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.35973	1.28;1.28;1.29	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.63954	0.2555	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.64830	0.994;0.994;0.994;0.994	D;D;D;D	0.74348	0.983;0.983;0.983;0.983	T	0.66685	-0.5861	10	0.87932	D	0	.	19.7462	0.96252	0.0:0.0:1.0:0.0	.	334;376;376;376	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	Y	376;376;334;376	ENSP00000421398:S376Y;ENSP00000265272:S376Y;ENSP00000328989:S334Y	ENSP00000265272:S376Y	S	-	2	0	JAKMIP2	147003911	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.736000	0.93811	0.655000	0.94253	TCT		JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
FOXI1	2299	broad.mit.edu	37	5	169533176	169533176	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:169533176C>T	ENST00000306268.6	+	1	276	c.215C>T	c.(214-216)cCg>cTg	p.P72L	FOXI1_ENST00000449804.2_Missense_Mutation_p.P72L			Q12951	FOXI1_HUMAN	forkhead box I1	72	Pro-rich.				embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P72L(1)		breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACCATGACCCCGCCACCCTAC	0.731									Pendred syndrome																												p.P72L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C215T	5						.						8.0	8.0	8.0					5																	169533176		2169	4252	6421	169465754	SO:0001583	missense	2299	exon1	Familial Cancer Database	Goiter-Deafness syndrome	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.215C>T	5.37:g.169533176C>T	ENSP00000304286:p.Pro72Leu	Somatic		Unspecified	Illumina	Phase_I	169465754	NM_144769	Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	37	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141701	0.57044	.	.	ENSG00000168269	ENST00000306268;ENST00000449804	D;D	0.94931	-3.43;-3.56	5.06	5.06	0.68205	.	0.060050	0.64402	D	0.000002	D	0.93582	0.7951	M	0.72894	2.215	0.80722	D	1	D;D	0.56287	0.975;0.957	B;B	0.40134	0.32;0.17	D	0.94621	0.7813	10	0.72032	D	0.01	.	18.448	0.90693	0.0:1.0:0.0:0.0	.	72;72	Q12951-2;Q12951	.;FOXI1_HUMAN	L	72	ENSP00000304286:P72L;ENSP00000415483:P72L	ENSP00000304286:P72L	P	+	2	0	FOXI1	169465754	0.995000	0.38212	0.898000	0.35279	0.386000	0.30323	5.764000	0.68826	2.353000	0.79882	0.591000	0.81541	CCG		FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188	
KCNIP1	30820	broad.mit.edu	37	5	170160888	170160888	+	Nonsense_Mutation	SNP	G	G	T	rs34559363		TCGA-AG-A014-01	TCGA-AG-A014-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:170160888G>T	ENST00000411494.1	+	8	622	c.622G>T	c.(622-624)Gaa>Taa	p.E208*	KCNIP1_ENST00000328939.4_Nonsense_Mutation_p.E197*|KCNIP1_ENST00000390656.4_Nonsense_Mutation_p.E197*|KCNIP1_ENST00000520740.1_Nonsense_Mutation_p.E169*|KCNIP1_ENST00000434108.1_Nonsense_Mutation_p.E222*|KCNIP1_ENST00000377360.4_Nonsense_Mutation_p.E206*			Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1	208	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of calcium ion (GO:0005513)|positive regulation of action potential (GO:0045760)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|potassium channel complex (GO:0034705)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|voltage-gated ion channel activity (GO:0005244)	p.E208*(1)		autonomic_ganglia(1)|large_intestine(7)|lung(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	18	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGAATTTCTTGAATCATGTCA	0.423																																					p.E206X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G616T	5						.						111.0	105.0	107.0					5																	170160888		2203	4300	6503	170093466	SO:0001587	stop_gained	30820	exon7			AF199597	CCDS34285.1, CCDS34286.1, CCDS4374.1, CCDS64312.1, CCDS64313.1	5q35	2013-01-10			ENSG00000182132	ENSG00000182132		"""EF-hand domain containing"""	15521	protein-coding gene	gene with protein product		604660				10676964	Standard	NM_001278339		Approved	KCHIP1	uc003map.3	Q9NZI2	OTTHUMG00000130442	ENST00000411494.1:c.622G>T	5.37:g.170160888G>T	ENSP00000395323:p.Glu208*	Somatic		Unspecified	Illumina	Phase_I	170093466	NM_001034838	B7Z7B4|Q3YAD0|Q3YAD1|Q3YAD2|Q3YAD3|Q5U822	Nonsense_Mutation	SNP	ENST00000411494.1	37	CCDS34286.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384700	0.82792	.	.	ENSG00000182132	ENST00000377360;ENST00000328939;ENST00000390656;ENST00000520740;ENST00000434108;ENST00000411494	.	.	.	5.66	5.66	0.87406	.	0.180712	0.53938	D	0.000044	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2591	0.87064	0.0:0.0:1.0:0.0	.	.	.	.	X	206;197;197;169;222;208	.	.	E	+	1	0	KCNIP1	170093466	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.209000	0.42806	2.668000	0.90789	0.650000	0.86243	GAA		KCNIP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000371760.1		
ADCY2	108	broad.mit.edu	37	5	7709437	7709438	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-AG-A014-01	TCGA-AG-A014-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:7709437_7709438GC>AA	ENST00000338316.4	+	10	1604_1605	c.1515_1516GC>AA	c.(1513-1518)aaGCcc>aaAAcc	p.P506T	ADCY2_ENST00000537121.1_Missense_Mutation_p.P326T|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	506					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.K505>?(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GGGCAGCCAAGCCCTTTGCACA	0.614																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1515_1516AA	5						.																																			7762438	SO:0001583	missense	108	exon10			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	Exception_encountered	5.37:g.7709437_7709438delinsAA	ENSP00000342952:p.Pro506Thr	Somatic		Unspecified	Illumina	Phase_I	7762437	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	DNP	ENST00000338316.4	37	CCDS3872.2																																																																																				ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
ADAMTS12	81792	broad.mit.edu	37	5	33648973	33648973	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A014-01	TCGA-AG-A014-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:33648973C>A	ENST00000504830.1	-	9	1768	c.1433G>T	c.(1432-1434)tGc>tTc	p.C478F	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.C478F	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	478	Disintegrin.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C478F(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TTGTAGCTGGCACTGGTGGTG	0.498										HNSCC(64;0.19)																											p.C478F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1433T	5						.						152.0	145.0	147.0					5																	33648973		2203	4300	6503	33684730	SO:0001583	missense	81792	exon9			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1433G>T	5.37:g.33648973C>A	ENSP00000422554:p.Cys478Phe	Somatic		Unspecified	Illumina	Phase_I	33684730	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.679955	0.88542	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.09817	2.94;2.94	5.6	5.6	0.85130	Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.48943	0.1528	H	0.95294	3.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.64394	-0.6418	10	0.87932	D	0	.	19.6116	0.95608	0.0:1.0:0.0:0.0	.	478;478	P58397-3;P58397	.;ATS12_HUMAN	F	478	ENSP00000422554:C478F;ENSP00000344847:C478F	ENSP00000344847:C478F	C	-	2	0	ADAMTS12	33684730	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.629000	0.83207	2.641000	0.89580	0.549000	0.68633	TGC		ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
SLCO6A1	133482	broad.mit.edu	37	5	101709059	101709059	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AG-A014-01	TCGA-AG-A014-01			C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:101709059delC	ENST00000506729.1	-	13	2328	c.2157delG	c.(2155-2157)ttgfs	p.L719fs	SLCO6A1_ENST00000513675.1_Frame_Shift_Del_p.L466fs|SLCO6A1_ENST00000379807.3_Frame_Shift_Del_p.L719fs|SLCO6A1_ENST00000389019.3_Frame_Shift_Del_p.L657fs|SLCO6A1_ENST00000379810.1_Frame_Shift_Del_p.L466fs			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	719						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GATCCAGTTACAAGTCAGTTT	0.264																																					p.L719fs												.	.	0			c.2157delG	5						.						137.0	137.0	137.0					5																	101709059		2202	4296	6498	101736958	SO:0001589	frameshift_variant	133482	exon13			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.2157delG	5.37:g.101709059delC	ENSP00000421339:p.Leu719fs	None		Unspecified	Illumina	Phase_I	101736958	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Frame_Shift_Del	DEL	ENST00000506729.1	37	CCDS34206.1																																																																																				SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
GPRIN1	114787	broad.mit.edu	37	5	176026122	176026134	+	Frame_Shift_Del	DEL	CAAAGACCCAGGA	CAAAGACCCAGGA	-	rs3797464|rs200519605|rs386695335|rs550332435|rs142779818|rs371149640|rs199714570|rs373697082	byFrequency	TCGA-AG-A014-01	TCGA-AG-A014-01			CAAAGACCCAGGA	CAAAGACCCAGGA	CAAAGACCCAGGA	CAAAGACCCAGGA	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:176026122_176026134delCAAAGACCCAGGA	ENST00000303991.4	-	2	879_891	c.702_714delTCCTGGGTCTTTG	c.(700-714)gatcctgggtctttgfs	p.DPGSL234fs		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	234				Missing (in Ref. 4; CAD38868). {ECO:0000305}.	neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)		p.L238L(1)		NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCACCTTTCTCAAAGACCCAGGATCCTCCTTCC	0.488																																					p.234_238del												.	.	1	Substitution - coding silent(1)	lung(1)	c.702_714del	5						.			721,3495		76,569,1463						-0.3	0.0		dbSNP_107	106	1092,7070		103,886,3092	no	frameshift	GPRIN1	NM_052899.2		179,1455,4555	A1A1,A1R,RR		13.3791,17.1015,14.647				1813,10565				175958740	SO:0001589	frameshift_variant	114787	exon2			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.702_714delTCCTGGGTCTTTG	5.37:g.176026122_176026134delCAAAGACCCAGGA	ENSP00000305839:p.Asp234fs	None		Unspecified	Illumina	Phase_I	175958728	NM_052899	C9JM70|Q8ND74|Q96PZ4	Frame_Shift_Del	DEL	ENST00000303991.4	37	CCDS4405.1																																																																																				GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899	
GPRIN1	114787	broad.mit.edu	37	5	176026136	176026146	+	Frame_Shift_Del	DEL	CCTCCTTCCTC	CCTCCTTCCTC	-	rs79403503|rs386695335|rs550332435|rs77245696|rs142779818|rs371149640|rs201635586	byFrequency	TCGA-AG-A014-01	TCGA-AG-A014-01			CCTCCTTCCTC	CCTCCTTCCTC	CCTCCTTCCTC	CCTCCTTCCTC	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:176026136_176026146delCCTCCTTCCTC	ENST00000303991.4	-	2	867_877	c.690_700delGAGGAAGGAGG	c.(688-702)ccgaggaaggaggatfs	p.RKED231fs		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	231				Missing (in Ref. 4; CAD38868). {ECO:0000305}.	neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACCCAGGATCCTCCTTCCTCGGTGACACTG	0.498																																					p.230_234del												.	.	0			c.690_700del	5						.			563,3699		9,545,1577						-2.4	0.0		dbSNP_134	89	851,7393		18,815,3289	no	frameshift	GPRIN1	NM_052899.2		27,1360,4866	A1A1,A1R,RR		10.3227,13.2098,11.3066				1414,11092				175958752	SO:0001589	frameshift_variant	114787	exon2			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.690_700delGAGGAAGGAGG	5.37:g.176026136_176026146delCCTCCTTCCTC	ENSP00000305839:p.Arg231fs	None		Unspecified	Illumina	Phase_I	175958742	NM_052899	C9JM70|Q8ND74|Q96PZ4	Frame_Shift_Del	DEL	ENST00000303991.4	37	CCDS4405.1																																																																																				GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899	
NSD1	64324	broad.mit.edu	37	5	176721701	176721701	+	Silent	SNP	G	G	A			TCGA-AG-A014-01	TCGA-AG-A014-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	SOLID			Illumina GAIIx	TCGA-AG-A014-01	TCGA-AG-A014-01	g.chr5:176721701G>A	ENST00000439151.2	+	23	7377	c.7332G>A	c.(7330-7332)caG>caA	p.Q2444Q	NSD1_ENST00000347982.4_Silent_p.Q2175Q|NSD1_ENST00000361032.4_Silent_p.Q2341Q|NSD1_ENST00000354179.4_Silent_p.Q2175Q	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2444					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.Q2444Q(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CTGTGGACCAGAATACTCAGT	0.502			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.Q2444Q			Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G7332A	5						.						51.0	55.0	54.0					5																	176721701		2203	4300	6503	176654307	SO:0001819	synonymous_variant	64324	exon23	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.7332G>A	5.37:g.176721701G>A		Somatic		Unspecified	Illumina	Phase_I	176654307	NM_022455	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	37	CCDS4412.1																																																																																				NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
