#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SEMA6D	80031	hgsc.bcm.edu	37	15	48058789	48058791	+	Intron	DEL	CTT	CTT	-			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr15:48058789_48058791delCTT	ENST00000316364.5	+	16	2085				SEMA6D_ENST00000354744.4_Intron|SEMA6D_ENST00000389428.3_Intron|SEMA6D_ENST00000355997.3_Intron|SEMA6D_ENST00000537942.1_In_Frame_Del_p.F556del|SEMA6D_ENST00000536845.2_Intron|SEMA6D_ENST00000558816.1_Intron|SEMA6D_ENST00000358066.4_In_Frame_Del_p.F556del|SEMA6D_ENST00000558014.1_In_Frame_Del_p.F556del|SEMA6D_ENST00000389433.2_Intron|SEMA6D_ENST00000389432.2_In_Frame_Del_p.F556del	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D						axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TAACCGAAGACTTCTTTGCTTTC	0.429																																					p.554_555del		Atlas-Indel	.											.	SEMA6D	322	.	0			c.1661_1663del						PASS	.																																			SO:0001627	intron_variant	80031	exon16			.	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1647-22CTT>-	15.37:g.48058792_48058794delCTT		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	116	11	0.0948276	NM_020858	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	In_Frame_Del	DEL	ENST00000316364.5	37	CCDS32225.1																																																																																			.	.	none		0.429	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
SRSF1	6426	hgsc.bcm.edu	37	17	56083716	56083717	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr17:56083716_56083717delCT	ENST00000258962.4	-	2	574_575	c.366_367delAG	c.(364-369)agagtgfs	p.RV122fs	SRSF1_ENST00000584773.1_Frame_Shift_Del_p.RV122fs|RP11-159D12.5_ENST00000578794.1_5'Flank|SRSF1_ENST00000582730.2_Frame_Shift_Del_p.RV122fs|SRSF1_ENST00000581497.1_5'Flank|SRSF1_ENST00000585096.1_Intron	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	122	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V123L(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GAGACAACCACTCTGTTTTCAG	0.554																																					p.123_123del		Pindel,Atlas-Indel	.											SRSF1,NS,carcinoma,-1,1	SRSF1	41	1	1	Substitution - Missense(1)	lung(1)	c.367_368del						PASS	.																																			SO:0001589	frameshift_variant	6426	exon2			.		CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.366_367delAG	17.37:g.56083718_56083719delCT	ENSP00000258962:p.Arg122fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	11	11	1.000	NM_001078166	B2R6Z7|D3DTZ3|Q13809	Frame_Shift_Del	DEL	ENST00000258962.4	37	CCDS11600.1																																																																																			.	.	none		0.554	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443335.1	NM_006924	
URB1	9875	hgsc.bcm.edu	37	21	33747729	33747731	+	In_Frame_Del	DEL	AAA	AAA	-			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	AAA	AAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr21:33747729_33747731delAAA	ENST00000382751.3	-	6	841_843	c.726_728delTTT	c.(724-729)atttta>ata	p.L244del	SNORA80_ENST00000363922.1_RNA	NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	244						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						TGTGGATAATAAAATATTGATGG	0.35																																					p.243_243del		Atlas-Indel	.											.	URB1	176	.	0			c.727_729del						PASS	.																																			SO:0001651	inframe_deletion	9875	exon6			.	AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.726_728delTTT	21.37:g.33747729_33747731delAAA	ENSP00000372199:p.Leu244del	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	128	12	0.09375	NM_014825	D3DSE5|Q96NX1|Q9NYQ1	In_Frame_Del	DEL	ENST00000382751.3	37	CCDS46645.1																																																																																			.	.	none		0.350	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139400.2		
CCDC168	643677	hgsc.bcm.edu	37	13	103383805	103383806	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr13:103383805_103383806insT	ENST00000322527.2	-	1	5353_5354	c.5354_5355insA	c.(5353-5355)aatfs	p.N1785fs		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1785																	TAGTAAGCTTATTTTTTTCTTT	0.356																																					p.N6414fs		Pindel,Atlas-Indel	.											.	.	.	.	0			c.19242_19243insA						PASS	.																																			SO:0001589	frameshift_variant	643677	exon4			.		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.5355dupA	13.37:g.103383812_103383812dupT	ENSP00000320232:p.Asn1785fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	13	13	1.000	NM_001146197	Q8N800	Frame_Shift_Ins	INS	ENST00000322527.2	37																																																																																				.	.	none		0.356	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
NEFH	4744	hgsc.bcm.edu	37	22	29885567	29885568	+	In_Frame_Ins	INS	-	-	AAGTCCCCTGAGAAGGCC	rs147489453|rs559153194|rs75808076|rs59279731		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr22:29885567_29885568insAAGTCCCCTGAGAAGGCC	ENST00000310624.6	+	4	1971_1972	c.1938_1939insAAGTCCCCTGAGAAGGCC	c.(1939-1941)aag>AAGTCCCCTGAGAAGGCCaag	p.647_647K>KSPEKAK		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	653	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAGGAAGCAAAGTCCCCTGA	0.569																																					p.A646delinsAKSPEKA		Atlas-Indel	.											NEFH,rectum,carcinoma,0,1	NEFH	178	1	0			c.1938_1939insAAGTCCCCTGAGAAGGCC						PASS	.			2816,1448		937,942,253						-5.3	0.0		dbSNP_134	77	5046,3206		1537,1972,617	no	coding	NEFH	NM_021076.3		2474,2914,870	A1A1,A1R,RR		38.8512,33.9587,37.1844				7862,4654				SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1939_1956dupAAGTCCCCTGAGAAGGCC	22.37:g.29885567_29885568insAAGTCCCCTGAGAAGGCC	Exception_encountered	Somatic	193	0	0		WXS	Illumina HiSeq	Phase_I	163	65	0.398773	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	strong		0.569	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
CXCR5	643	hgsc.bcm.edu	37	11	118765330	118765331	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:118765330_118765331delTC	ENST00000292174.4	+	2	1253_1254	c.1077_1078delTC	c.(1075-1080)agtctcfs	p.L360fs	BCL9L_ENST00000334801.3_3'UTR	NM_001716.4|NM_032966.2	NP_001707.1|NP_116743.1	P32302	CXCR5_HUMAN	chemokine (C-X-C motif) receptor 5	360					B cell activation (GO:0042113)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of cytokinesis (GO:0032467)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		GCAGGAGCAGTCTCTCTGAGTC	0.599																																					p.359_359del		Atlas-Indel	.											.	CXCR5	34	.	0			c.1076_1077del						PASS	.																																			SO:0001589	frameshift_variant	643	exon2			.	X68829	CCDS8402.1	11q23.3	2012-08-08	2008-01-22	2008-01-22	ENSG00000160683	ENSG00000160683		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	1060	protein-coding gene	gene with protein product		601613	"""Burkitt lymphoma receptor 1, GTP-binding protein"", ""Burkitt lymphoma receptor 1, GTP binding protein (chemokine (C-X-C motif) receptor 5)"""	BLR1		1425907	Standard	NM_001716		Approved	MDR15, CD185	uc001pue.4	P32302	OTTHUMG00000166345	ENST00000292174.4:c.1077_1078delTC	11.37:g.118765334_118765335delTC	ENSP00000292174:p.Leu360fs	Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	34	11	0.323529	NM_001716	Q14811	Frame_Shift_Del	DEL	ENST00000292174.4	37	CCDS8402.1																																																																																			.	.	none		0.599	CXCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389309.1	NM_001716	
KCNN3	3782	hgsc.bcm.edu	37	1	154842199	154842200	+	In_Frame_Ins	INS	-	-	GCTGCTGCTGCT	rs56352724|rs3831942|rs367921715|rs58327065		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:154842199_154842200insGCTGCTGCTGCT	ENST00000271915.4	-	1	556_557	c.241_242insAGCAGCAGCAGC	c.(241-243)cca>cAGCAGCAGCAGCca	p.80_81insQQQQ	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	80	Gln-rich.		Missing.		potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.Q80_P81insQQ(2)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GGGATGCGGTGgctgctgctgc	0.698																																					p.P81delinsQQQQP		Atlas-Indel	.											KCNN3,colon,carcinoma,0,1	KCNN3	141	1	2	Insertion - In frame(2)	prostate(2)	c.242_243insAGCAGCAGCAGC						PASS	.																																			SO:0001652	inframe_insertion	3782	exon1			.	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.230_241dupAGCAGCAGCAGC	1.37:g.154842199_154842200insGCTGCTGCTGCT	ENSP00000271915:p.Gln77_Gln80dup	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	47	16	0.340426	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Ins	INS	ENST00000271915.4	37	CCDS30880.1																																																																																			.	.	alt		0.698	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
EP400	57634	hgsc.bcm.edu	37	12	132547068	132547069	+	In_Frame_Ins	INS	-	-	GCA	rs68030464|rs367737531|rs60930033		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:132547068_132547069insGCA	ENST00000333577.4	+	48	8373_8374	c.8264_8265insGCA	c.(8263-8268)aggcag>agGCAgcag	p.2784_2785insQ	EP400_ENST00000332482.4_In_Frame_Ins_p.2711_2712insQ|EP400_ENST00000330386.6_In_Frame_Ins_p.2667_2668insQ|EP400_ENST00000389562.2_In_Frame_Ins_p.2747_2748insQ|EP400_ENST00000389561.2_In_Frame_Ins_p.2748_2749insQ			Q96L91	EP400_HUMAN	E1A binding protein p400	2784	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R2718K(2)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CAGCTTCTCAGgcagcagcagc	0.564																																					p.R2719delinsRQ		Atlas-Indel	.											EP400,NS,carcinoma,0,2	EP400	370	2	2	Substitution - Missense(2)	lung(2)	c.8156_8157insGCA						PASS	.																																			SO:0001652	inframe_insertion	57634	exon47			.	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8283_8285dupGCA	12.37:g.132547075_132547077dupGCA	ENSP00000333602:p.Gln2784_Gln2784dup	Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	43	16	0.372093	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	In_Frame_Ins	INS	ENST00000333577.4	37																																																																																				.	.	weak		0.564	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
KCNQ4	9132	hgsc.bcm.edu	37	1	41300690	41300690	+	Silent	SNP	G	G	T	rs55964611	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:41300690G>T	ENST00000347132.5	+	12	1747	c.1665G>T	c.(1663-1665)ccG>ccT	p.P555P	KCNQ4_ENST00000509682.2_Silent_p.P501P|KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	555	A-domain (Tetramerization).				inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	CACTGCGACCGTACGACGTGA	0.577																																					p.P555P		Atlas-SNP	.											KCNQ4,colon,carcinoma,+1,1	KCNQ4	58	1	0			c.G1665T						scavenged	.						126.0	111.0	116.0					1																	41300690		2203	4300	6503	SO:0001819	synonymous_variant	9132	exon12			GCGACCGTACGAC	AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1665G>T	1.37:g.41300690G>T		Somatic	235	0	0		WXS	Illumina HiSeq	Phase_I	158	3	0.0189873	NM_004700	O96025	Silent	SNP	ENST00000347132.5	37	CCDS456.1	.	.	.	.	.	.	.	.	.	.	G	6.858	0.527646	0.13127	.	.	ENSG00000117013	ENST00000443478	.	.	.	5.12	-10.2	0.00374	.	.	.	.	.	T	0.34978	0.0916	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48980	-0.8986	4	.	.	.	-16.1176	3.1599	0.06516	0.2055:0.2654:0.3752:0.1539	.	.	.	.	L	416	.	.	V	+	1	0	KCNQ4	41073277	0.000000	0.05858	0.129000	0.21949	0.974000	0.67602	-5.980000	0.00087	-3.636000	0.00128	-1.535000	0.00915	GTA	G|0.974;A|0.026	.	alt		0.577	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	
UNK	85451	hgsc.bcm.edu	37	17	73780999	73780999	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr17:73780999C>T	ENST00000589666.1	+	1	148	c.38C>T	c.(37-39)tCc>tTc	p.S13F	H3F3B_ENST00000586607.1_Intron|UNK_ENST00000293218.3_Missense_Mutation_p.S89F|MIR4738_ENST00000579134.1_RNA	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger	13							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCCGCAGCTTCCTCGGCGCCC	0.711																																					p.S13F		Atlas-SNP	.											.	UNK	87	.	0			c.C38T						PASS	.						6.0	10.0	9.0					17																	73780999		1748	3892	5640	SO:0001583	missense	85451	exon1			CAGCTTCCTCGGC	AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.38C>T	17.37:g.73780999C>T	ENSP00000464893:p.Ser13Phe	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	51	8	0.156863	NM_001080419		Missense_Mutation	SNP	ENST00000589666.1	37	CCDS45778.2	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823706	0.71143	.	.	ENSG00000132478	ENST00000293218	.	.	.	5.88	4.91	0.64330	.	0.228714	0.47093	N	0.000253	T	0.56108	0.1963	L	0.51422	1.61	0.51767	D	0.999932	D	0.55385	0.971	B	0.44278	0.445	T	0.62348	-0.6873	9	0.72032	D	0.01	-19.3886	14.8103	0.69989	0.0:0.855:0.145:0.0	.	13	Q9C0B0	UNK_HUMAN	F	89	.	ENSP00000293218:S89F	S	+	2	0	UNK	71292594	1.000000	0.71417	1.000000	0.80357	0.306000	0.27790	3.612000	0.54142	1.473000	0.48159	-0.175000	0.13238	TCC	.	.	none		0.711	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448835.1	NM_001080419	
NUFIP1	26747	hgsc.bcm.edu	37	13	45523879	45523879	+	Silent	SNP	T	T	C	rs563561324	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr13:45523879T>C	ENST00000379161.4	-	8	1162	c.1116A>G	c.(1114-1116)tcA>tcG	p.S372S		NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	372					box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)	p.S372S(3)		breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		TCTCTGACCCTGAAAGACTGC	0.443													T|||	252	0.0503195	0.0439	0.0432	5008	,	,		18441	0.0565		0.0517	False		,,,				2504	0.0562				p.S372S		Atlas-SNP	.											NUFIP1,NS,carcinoma,0,5	NUFIP1	41	5	3	Substitution - coding silent(3)	prostate(3)	c.A1116G						scavenged	.						237.0	204.0	215.0					13																	45523879		2203	4300	6503	SO:0001819	synonymous_variant	26747	exon8			TGACCCTGAAAGA	AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.1116A>G	13.37:g.45523879T>C		Somatic	70	4	0.0571429		WXS	Illumina HiSeq	Phase_I	78	7	0.0897436	NM_012345	Q8WVM5|Q96SG1	Silent	SNP	ENST00000379161.4	37	CCDS9393.1																																																																																			.	.	none		0.443	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044755.2	NM_012345	
KCNJ6	3763	hgsc.bcm.edu	37	21	39087049	39087049	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr21:39087049G>A	ENST00000609713.1	-	3	1000	c.411C>T	c.(409-411)aaC>aaT	p.N137N	KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Silent_p.N137N	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	137					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	AGACGAACCCGTTGAGGTTGG	0.468																																					p.N137N	Pancreas(48;379 1118 2936 19024 28214)	Atlas-SNP	.											.	KCNJ6	58	.	0			c.C411T						PASS	.						109.0	112.0	111.0					21																	39087049		1857	4106	5963	SO:0001819	synonymous_variant	3763	exon3			GAACCCGTTGAGG	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.411C>T	21.37:g.39087049G>A		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	79	9	0.113924	NM_002240	Q3MJ74|Q53WW6	Silent	SNP	ENST00000609713.1	37	CCDS42927.1																																																																																			.	.	none		0.468	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240	
NBPF10	100132406	hgsc.bcm.edu	37	1	145304529	145304529	+	Missense_Mutation	SNP	T	T	C	rs57379664		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:145304529T>C	ENST00000369339.3	+	7	902	c.649T>C	c.(649-651)Tct>Cct	p.S217P	NBPF10_ENST00000369338.1_Missense_Mutation_p.S217P|NBPF10_ENST00000342960.5_Missense_Mutation_p.S488P|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	488	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S488P(2)|p.S217P(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TAGCCATGGCTCTTATGACTC	0.468																																					p.S488P		Atlas-SNP	.											NBPF10_ENST00000369338,NS,carcinoma,0,6	NBPF10	221	6	4	Substitution - Missense(4)	kidney(4)	c.T1462C						scavenged	.																																			SO:0001583	missense	100132406	exon10			CATGGCTCTTATG	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.649T>C	1.37:g.145304529T>C	ENSP00000358345:p.Ser217Pro	Somatic	83	15	0.180723		WXS	Illumina HiSeq	Phase_I	87	23	0.264368	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.	.	.	.	.	.	.	.	.	.	.	0	-2.687902	0.00100	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960	T;T	0.05580	3.42;3.42	0.811	-1.62	0.08372	.	.	.	.	.	T	0.00496	0.0016	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43556	-0.9384	8	0.02654	T	1	.	2.7867	0.05376	0.0:0.3083:0.2528:0.4389	.	217	A8MQ30	.	P	413;217;217;488	ENSP00000358344:S217P;ENSP00000345684:S488P	ENSP00000345684:S488P	S	+	1	0	NBPF10	144015886	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.482000	0.00981	-1.752000	0.01325	-0.883000	0.02948	TCT	T|0.625;C|0.375	0.375	strong		0.468	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703	
CTSH	1512	hgsc.bcm.edu	37	15	79215405	79215405	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr15:79215405A>G	ENST00000220166.5	-	11	971	c.862T>C	c.(862-864)Tat>Cat	p.Y288H	CTSH_ENST00000534533.1_5'UTR	NM_004390.3	NP_004381.2	P09668	CATH_HUMAN	cathepsin H	288					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|bradykinin catabolic process (GO:0010815)|cellular response to thyroid hormone stimulus (GO:0097067)|dichotomous subdivision of terminal units involved in lung branching (GO:0060448)|ERK1 and ERK2 cascade (GO:0070371)|immune response-regulating signaling pathway (GO:0002764)|membrane protein proteolysis (GO:0033619)|metanephros development (GO:0001656)|negative regulation of apoptotic process (GO:0043066)|neuropeptide catabolic process (GO:0010813)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidase activity (GO:0010952)|protein destabilization (GO:0031648)|proteolysis (GO:0006508)|response to retinoic acid (GO:0032526)|spermatogenesis (GO:0007283)|surfactant homeostasis (GO:0043129)|T cell mediated cytotoxicity (GO:0001913)|zymogen activation (GO:0031638)	acrosomal vesicle (GO:0001669)|alveolar lamellar body (GO:0097208)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|outer dense fiber (GO:0001520)	aminopeptidase activity (GO:0004177)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)|HLA-A specific activating MHC class I receptor activity (GO:0030108)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|thyroid hormone binding (GO:0070324)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)	10						TTTTCTCCATACCCAACAGCC	0.453																																					p.Y288H		Atlas-SNP	.											.	CTSH	23	.	0			c.T862C						PASS	.						94.0	95.0	95.0					15																	79215405		2196	4293	6489	SO:0001583	missense	1512	exon11			CTCCATACCCAAC	X07549	CCDS10308.1	15q25.1	2014-01-28			ENSG00000103811	ENSG00000103811	3.4.22.16	"""Cathepsins"""	2535	protein-coding gene	gene with protein product		116820		CPSB		2849458	Standard	NM_004390		Approved	ACC-4, ACC-5	uc021srk.1	P09668	OTTHUMG00000144171	ENST00000220166.5:c.862T>C	15.37:g.79215405A>G	ENSP00000220166:p.Tyr288His	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	104	14	0.134615	NM_004390	B2RBK0|Q96NY6|Q9BUM7	Missense_Mutation	SNP	ENST00000220166.5	37	CCDS10308.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.284657	0.80803	.	.	ENSG00000103811	ENST00000220166;ENST00000394758	T	0.37411	1.2	4.65	4.65	0.58169	Peptidase C1A, papain C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.71676	0.3368	H	0.97783	4.075	0.53005	D	0.999967	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80491	-0.1359	10	0.87932	D	0	.	10.3628	0.44006	1.0:0.0:0.0:0.0	.	288;276	P09668;E9PBP2	CATH_HUMAN;.	H	288;276	ENSP00000220166:Y288H	ENSP00000220166:Y288H	Y	-	1	0	CTSH	77002460	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.492000	0.81482	1.959000	0.56917	0.402000	0.26972	TAT	.	.	none		0.453	CTSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291370.1	NM_004390	
ZNF749	388567	hgsc.bcm.edu	37	19	57956104	57956104	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:57956104G>C	ENST00000334181.4	+	3	1838	c.1588G>C	c.(1588-1590)Gag>Cag	p.E530Q	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	530					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		AGTTCAGCATGAGAAAATCCA	0.448																																					p.E530Q		Atlas-SNP	.											ZNF749,NS,malignant_melanoma,0,2	ZNF749	75	2	0			c.G1588C						scavenged	.						96.0	93.0	94.0					19																	57956104		2203	4300	6503	SO:0001583	missense	388567	exon3			CAGCATGAGAAAA	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.1588G>C	19.37:g.57956104G>C	ENSP00000333980:p.Glu530Gln	Somatic	112	1	0.00892857		WXS	Illumina HiSeq	Phase_I	102	3	0.0294118	NM_001023561		Missense_Mutation	SNP	ENST00000334181.4	37	CCDS33132.2	.	.	.	.	.	.	.	.	.	.	G	0	-2.620200	0.00118	.	.	ENSG00000186230	ENST00000334181	T	0.07567	3.18	0.858	-0.38	0.12490	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01976	0.0062	N	0.01235	-0.94	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.45308	-0.9270	9	0.02654	T	1	.	5.0363	0.14436	0.0:0.6227:0.3773:0.0	.	530	O43361	ZN749_HUMAN	Q	530	ENSP00000333980:E530Q	ENSP00000333980:E530Q	E	+	1	0	ZNF749	62647916	.	.	0.006000	0.13384	0.045000	0.14185	.	.	-0.053000	0.13289	-1.525000	0.00928	GAG	.	.	none		0.448	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
HPS3	84343	hgsc.bcm.edu	37	3	148863160	148863160	+	Silent	SNP	A	A	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr3:148863160A>G	ENST00000296051.2	+	5	1130	c.990A>G	c.(988-990)ggA>ggG	p.G330G	HPS3_ENST00000460120.1_Silent_p.G165G	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	330					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)		p.N332fs*31(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CATCTGATGGAAAAAATTTGT	0.343									Hermansky-Pudlak syndrome																												p.G330G		Atlas-SNP	.											.	HPS3	104	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.A990G						PASS	.						96.0	103.0	101.0					3																	148863160		2203	4300	6503	SO:0001819	synonymous_variant	84343	exon5	Familial Cancer Database	HPS, HPS1-8	TGATGGAAAAAAT	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.990A>G	3.37:g.148863160A>G		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	83	7	0.0843373	NM_032383	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Silent	SNP	ENST00000296051.2	37	CCDS3140.1																																																																																			.	.	none		0.343	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356151.1	NM_032383	
HLA-C	3107	hgsc.bcm.edu	37	6	31238202	31238202	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr6:31238202C>T	ENST00000376228.5	-	4	694	c.680G>A	c.(679-681)tGc>tAc	p.C227Y	HLA-C_ENST00000383329.3_Missense_Mutation_p.C227Y	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	227	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CAGGGCCCAGCACCTCAGGGT	0.607																																					p.C227Y		Atlas-SNP	.											.	HLA-C	92	.	0			c.G680A						PASS	.						46.0	49.0	48.0					6																	31238202		2203	4295	6498	SO:0001583	missense	3107	exon4			GCCCAGCACCTCA	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.680G>A	6.37:g.31238202C>T	ENSP00000365402:p.Cys227Tyr	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	58	5	0.0862069	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	.	.	.	.	.	.	.	.	.	.	.	10.47	1.359977	0.24598	.	.	ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	D;D	0.93488	-3.23;-3.23	2.65	2.65	0.31530	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.000000	0.45867	U	0.000326	D	0.97414	0.9154	H	0.99312	4.51	0.29781	N	0.833962	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	D	0.92277	0.5830	10	0.87932	D	0	.	8.9782	0.35948	0.0:1.0:0.0:0.0	.	227;227;227;227	A2AEA4;A6H578;A2AEA2;P10321	.;.;.;1C07_HUMAN	Y	227;227;227;264	ENSP00000365402:C227Y;ENSP00000372819:C227Y	ENSP00000365402:C227Y	C	-	2	0	HLA-C	31346181	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	2.210000	0.42816	1.812000	0.52913	0.281000	0.19383	TGC	.	.	none		0.607	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
PER3	8863	hgsc.bcm.edu	37	1	7887248	7887248	+	Silent	SNP	G	G	A	rs2859387	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:7887248G>A	ENST00000361923.2	+	17	2410	c.2235G>A	c.(2233-2235)ccG>ccA	p.P745P	PER3_ENST00000377532.3_Silent_p.P753P|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	745	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		AGAAGCTGCCGGAGCCGCCAG	0.632													G|||	2588	0.516773	0.5333	0.4597	5008	,	,		14514	0.8026		0.3718	False		,,,				2504	0.3896				p.P745P		Atlas-SNP	.											PER3,NS,carcinoma,+1,1	PER3	95	1	0			c.G2235A						scavenged	.	G		2207,2153		589,1029,562	21.0	26.0	24.0		2235	-8.8	0.0	1	dbSNP_100	24	3035,5501		587,1861,1820	no	coding-synonymous	PER3	NM_016831.1		1176,2890,2382	AA,AG,GG		35.5553,49.3807,40.6483		745/1202	7887248	5242,7654	2180	4268	6448	SO:0001819	synonymous_variant	8863	exon17			GCTGCCGGAGCCG	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2235G>A	1.37:g.7887248G>A		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	82	3	0.0365854	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Silent	SNP	ENST00000361923.2	37	CCDS89.1																																																																																			G|0.567;A|0.433	0.433	strong		0.632	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
MUC6	4588	hgsc.bcm.edu	37	11	1016851	1016851	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:1016851T>C	ENST00000421673.2	-	31	6000	c.5950A>G	c.(5950-5952)Atg>Gtg	p.M1984V		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1984	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTTGCAGTCATAGGACCTGTG	0.582																																					p.M1984V		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,+2,2	MUC6	408	2	0			c.A5950G						scavenged	.						1531.0	1522.0	1525.0					11																	1016851		2203	4298	6501	SO:0001583	missense	4588	exon31			CAGTCATAGGACC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5950A>G	11.37:g.1016851T>C	ENSP00000406861:p.Met1984Val	Somatic	549	24	0.0437158		WXS	Illumina HiSeq	Phase_I	402	16	0.039801	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	1.757	-0.487796	0.04352	.	.	ENSG00000184956	ENST00000421673	T	0.17370	2.28	2.75	-1.23	0.09465	.	.	.	.	.	T	0.10809	0.0264	L	0.43152	1.355	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45205	-0.9277	9	0.06365	T	0.9	.	7.0983	0.25321	0.0:0.1589:0.2688:0.5723	.	1984	Q6W4X9	MUC6_HUMAN	V	1984	ENSP00000406861:M1984V	ENSP00000406861:M1984V	M	-	1	0	MUC6	1006851	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.137000	0.00588	-0.732000	0.04856	-2.319000	0.00253	ATG	.	.	none		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
PRB2	653247	hgsc.bcm.edu	37	12	11546309	11546309	+	Missense_Mutation	SNP	C	C	G	rs201308939		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:11546309C>G	ENST00000389362.4	-	3	738	c.703G>C	c.(703-705)Gcc>Ccc	p.A235P	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	235	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)		p.A214P(1)|p.A235P(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGAGATCGGGCACTTTGGGAC	0.612																																					p.A235P		Atlas-SNP	.											PRB2_ENST00000389362,trunk,malignant_melanoma,0,2	PRB2	168	2	2	Substitution - Missense(2)	skin(2)	c.G703C						scavenged	.						249.0	265.0	259.0					12																	11546309		2203	4297	6500	SO:0001583	missense	653247	exon3			ATCGGGCACTTTG	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.703G>C	12.37:g.11546309C>G	ENSP00000374013:p.Ala235Pro	Somatic	178	4	0.0224719		WXS	Illumina HiSeq	Phase_I	151	6	0.0397351	NM_006248	O00599|P02811|P04281	Missense_Mutation	SNP	ENST00000389362.4	37	CCDS41757.2	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.112856	0.00353	.	.	ENSG00000121335	ENST00000389362	T	0.03860	3.78	1.17	-2.34	0.06704	.	.	.	.	.	T	0.01092	0.0036	N	0.00621	-1.32	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46762	-0.9168	9	0.09084	T	0.74	.	1.6626	0.02795	0.2887:0.3081:0.0:0.4032	.	235	P02812	PRB2_HUMAN	P	235	ENSP00000374013:A235P	ENSP00000374013:A235P	A	-	1	0	PRB2	11437576	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-3.155000	0.00580	-0.311000	0.08754	-2.162000	0.00326	GCC	.	.	weak		0.612	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
MPEG1	219972	hgsc.bcm.edu	37	11	58978525	58978525	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:58978525G>A	ENST00000361050.3	-	1	1899	c.1814C>T	c.(1813-1815)gCt>gTt	p.A605V		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	605						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				ATTGGTGGCAGCCTGACTCAT	0.572																																					p.A605V		Atlas-SNP	.											.	MPEG1	72	.	0			c.C1814T						PASS	.						103.0	110.0	108.0					11																	58978525		1949	4129	6078	SO:0001583	missense	219972	exon1			GTGGCAGCCTGAC	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1814C>T	11.37:g.58978525G>A	ENSP00000354335:p.Ala605Val	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	108	43	0.398148	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	37	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	G	0.041	-1.285390	0.01387	.	.	ENSG00000197629	ENST00000361050	T	0.23147	1.92	5.69	2.76	0.32466	.	0.496999	0.22900	N	0.054275	T	0.12860	0.0312	N	0.21142	0.635	0.23559	N	0.997413	B	0.10296	0.003	B	0.08055	0.003	T	0.32402	-0.9908	10	0.13108	T	0.6	-5.3059	4.8432	0.13501	0.2569:0.1569:0.5862:0.0	.	605	Q2M385	MPEG1_HUMAN	V	605	ENSP00000354335:A605V	ENSP00000354335:A605V	A	-	2	0	MPEG1	58735101	0.011000	0.17503	1.000000	0.80357	0.389000	0.30415	0.242000	0.18087	0.316000	0.23135	0.655000	0.94253	GCT	.	.	none		0.572	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
ZNF575	284346	hgsc.bcm.edu	37	19	44039461	44039461	+	Silent	SNP	G	G	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:44039461G>T	ENST00000314228.5	+	4	872	c.360G>T	c.(358-360)ccG>ccT	p.P120P	ZNF575_ENST00000601282.1_Silent_p.P120P|ZNF575_ENST00000458714.2_Silent_p.P219P	NM_174945.2	NP_777605.1	Q86XF7	ZN575_HUMAN	zinc finger protein 575	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	4		Prostate(69;0.0199)				GCCCGCACCCGTGCCCACACT	0.731																																					p.P120P		Atlas-SNP	.											ZNF575,NS,carcinoma,+1,1	ZNF575	14	1	0			c.G360T						scavenged	.						23.0	24.0	24.0					19																	44039461		2199	4297	6496	SO:0001819	synonymous_variant	284346	exon4			GCACCCGTGCCCA	BC043611	CCDS12623.1	19q13.31	2013-09-20			ENSG00000176472	ENSG00000176472		"""Zinc fingers, C2H2-type"""	27606	protein-coding gene	gene with protein product							Standard	NM_174945		Approved	FLJ32567	uc002ows.3	Q86XF7	OTTHUMG00000182698	ENST00000314228.5:c.360G>T	19.37:g.44039461G>T		Somatic	90	1	0.0111111		WXS	Illumina HiSeq	Phase_I	76	5	0.0657895	NM_174945	B4DX54	Silent	SNP	ENST00000314228.5	37	CCDS12623.1																																																																																			.	.	none		0.731	ZNF575-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463191.1	NM_174945	
PCDH12	51294	hgsc.bcm.edu	37	5	141324966	141324966	+	Missense_Mutation	SNP	T	T	C	rs62380003|rs532090538	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr5:141324966T>C	ENST00000231484.3	-	4	4745	c.3535A>G	c.(3535-3537)Agc>Ggc	p.S1179G		NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	1179	Poly-Ser.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ctgctgctgctgctgctgcct	0.557																																					p.S1179G		Atlas-SNP	.											.	PCDH12	133	.	0			c.A3535G						PASS	.						22.0	24.0	23.0					5																	141324966		2203	4295	6498	SO:0001583	missense	51294	exon4			TGCTGCTGCTGCT	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.3535A>G	5.37:g.141324966T>C	ENSP00000231484:p.Ser1179Gly	Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	51	14	0.27451	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	37	CCDS4269.1	26	0.011904761904761904	1	0.0020325203252032522	3	0.008287292817679558	0	0.0	22	0.029023746701846966	T	8.193	0.796523	0.16327	.	.	ENSG00000113555	ENST00000231484	T	0.53640	0.61	5.24	-0.821	0.10822	.	0.585786	0.17591	N	0.168779	T	0.12347	0.0300	L	0.31294	0.92	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14924	-1.0455	10	0.87932	D	0	.	8.4335	0.32773	0.0:0.4561:0.0:0.5439	rs62380003	1179	Q9NPG4	PCD12_HUMAN	G	1179	ENSP00000231484:S1179G	ENSP00000231484:S1179G	S	-	1	0	PCDH12	141305150	1.000000	0.71417	0.027000	0.17364	0.001000	0.01503	0.556000	0.23438	-0.256000	0.09473	-0.353000	0.07706	AGC	T|0.988;C|0.012	0.012	strong		0.557	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
LILRA2	11027	hgsc.bcm.edu	37	19	55086873	55086873	+	Nonsense_Mutation	SNP	G	G	A	rs575246367	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:55086873G>A	ENST00000251377.3	+	6	939	c.806G>A	c.(805-807)tGg>tAg	p.W269*	LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000391738.3_Nonsense_Mutation_p.W269*|LILRA2_ENST00000391737.1_Nonsense_Mutation_p.W257*|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000251376.3_Nonsense_Mutation_p.W269*|LILRB1_ENST00000396321.2_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	269	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.W269L(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CGCCCTGGTTGGCAGCCCCAG	0.622													g|||	24	0.00479233	0.0	0.0	5008	,	,		15852	0.0		0.001	False		,,,				2504	0.0235				p.W269X		Atlas-SNP	.											LILRA2,NS,carcinoma,0,1	LILRA2	99	1	1	Substitution - Missense(1)	lung(1)	c.G806A						scavenged	.						75.0	74.0	74.0					19																	55086873		2203	4300	6503	SO:0001587	stop_gained	11027	exon5			CTGGTTGGCAGCC	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.806G>A	19.37:g.55086873G>A	ENSP00000251377:p.Trp269*	Somatic	217	4	0.0184332		WXS	Illumina HiSeq	Phase_I	166	5	0.0301205	NM_001130917	O75020	Nonsense_Mutation	SNP	ENST00000251377.3	37	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.154944	0.38021	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	.	.	.	2.26	-4.53	0.03462	.	3.839380	0.00628	N	0.000462	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	0.3518	0.00350	0.3906:0.152:0.2111:0.2464	.	.	.	.	X	269;269;269;269;257	.	ENSP00000251376:W269X	W	+	2	0	LILRA2	59778685	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.564000	0.00918	-1.647000	0.01511	-0.527000	0.04329	TGG	.	.	none		0.622	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
PEX2	5828	hgsc.bcm.edu	37	8	77896279	77896279	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr8:77896279G>A	ENST00000419564.2	-	4	600	c.136C>T	c.(136-138)Cct>Tct	p.P46S	PEX2_ENST00000357039.4_Missense_Mutation_p.P46S|PEX2_ENST00000520103.1_Missense_Mutation_p.P46S|PEX2_ENST00000522527.1_Missense_Mutation_p.P46S	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	46					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						AACAGCCCAGGTTTAAATCCA	0.473																																					p.P46S		Atlas-SNP	.											.	PEX2	44	.	0			c.C136T						PASS	.						91.0	90.0	90.0					8																	77896279		2203	4300	6503	SO:0001583	missense	5828	exon4			GCCCAGGTTTAAA	M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.136C>T	8.37:g.77896279G>A	ENSP00000400984:p.Pro46Ser	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	102	8	0.0784314	NM_000318	Q567S6|Q9BW41	Missense_Mutation	SNP	ENST00000419564.2	37	CCDS6221.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531768	0.85706	.	.	ENSG00000164751	ENST00000357039;ENST00000419564;ENST00000520103;ENST00000522527;ENST00000518986	D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57	5.74	5.74	0.90152	Pex, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90133	0.6917	M	0.64404	1.975	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.88246	0.2913	10	0.38643	T	0.18	-14.1507	19.9336	0.97129	0.0:0.0:1.0:0.0	.	46	P28328	PEX2_HUMAN	S	46	ENSP00000349543:P46S;ENSP00000400984:P46S;ENSP00000428590:P46S;ENSP00000428638:P46S;ENSP00000429304:P46S	ENSP00000349543:P46S	P	-	1	0	PEX2	78058834	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	9.434000	0.97515	2.717000	0.92951	0.563000	0.77884	CCT	.	.	none		0.473	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379122.1	NM_000318	
KLRC3	3823	hgsc.bcm.edu	37	12	10588444	10588444	+	Missense_Mutation	SNP	G	G	C	rs111237999	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:10588444G>C	ENST00000539033.1	-	1	156	c.142C>G	c.(142-144)Cct>Gct	p.P48A	KLRC2_ENST00000536833.2_Intron|KLRC2_ENST00000381901.1_Missense_Mutation_p.P48A|KLRC2_ENST00000381902.2_Missense_Mutation_p.P48A																							TTCAGGGAAGGATTTTGAAGA	0.363													G|||	125	0.0249601	0.0386	0.0101	5008	,	,		16153	0.0298		0.0268	False		,,,				2504	0.0102				p.P48A		Atlas-SNP	.											KLRC2,NS,carcinoma,+1,1	KLRC2	29	1	0			c.C142G						scavenged	.						94.0	104.0	101.0					12																	10588444		1994	3988	5982	SO:0001583	missense	3822	exon1			GGGAAGGATTTTG																												ENST00000539033.1:c.142C>G	12.37:g.10588444G>C	ENSP00000437563:p.Pro48Ala	Somatic	104	17	0.163462		WXS	Illumina HiSeq	Phase_I	89	20	0.224719	NM_002260		Missense_Mutation	SNP	ENST00000539033.1	37		.	.	.	.	.	.	.	.	.	.	G	0	-2.662523	0.00107	.	.	ENSG00000255641;ENSG00000205809;ENSG00000205809	ENST00000539033;ENST00000381902;ENST00000381901	T;T;T	0.04119	3.7;3.7;3.7	2.57	-1.4	0.08968	.	0.714893	0.12708	N	0.445758	T	0.01222	0.0040	N	0.00637	-1.305	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.46925	-0.9156	10	0.02654	T	1	.	9.8776	0.41213	0.0:0.3246:0.6754:0.0	rs34194304	34;48;48	Q3KQS7;P26717;F5H6K3	.;NKG2C_HUMAN;.	A	48	ENSP00000437563:P48A;ENSP00000371327:P48A;ENSP00000371326:P48A	ENSP00000371326:P48A	P	-	1	0	KLRC2;RP11-277P12.6	10479711	0.000000	0.05858	0.020000	0.16555	0.010000	0.07245	-0.911000	0.04050	-0.034000	0.13713	-1.406000	0.01132	CCT	.	.	weak		0.363	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000400274.1		
HIST1H2BK	85236	hgsc.bcm.edu	37	6	27114224	27114224	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr6:27114224G>A	ENST00000356950.1	-	1	353	c.354C>T	c.(352-354)gcC>gcT	p.A118A	HIST1H2BK_ENST00000396891.4_Silent_p.A118A|MIR3143_ENST00000584253.1_RNA|HIST1H2AH_ENST00000377459.1_5'Flank			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	118					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						ACTTGGTGACGGCCTTGGTGC	0.557																																					p.A118A		Atlas-SNP	.											HIST1H2BK_ENST00000396891,NS,carcinoma,0,2	HIST1H2BK	68	2	0			c.C354T						scavenged	.						74.0	81.0	79.0					6																	27114224		2202	4297	6499	SO:0001819	synonymous_variant	85236	exon1			GGTGACGGCCTTG	AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.354C>T	6.37:g.27114224G>A		Somatic	136	2	0.0147059		WXS	Illumina HiSeq	Phase_I	91	3	0.032967	NM_080593	A8K7P7|Q2VPI7	Silent	SNP	ENST00000356950.1	37	CCDS4621.1																																																																																			.	.	none		0.557	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040141.1	NM_080593	
DEFB114	245928	hgsc.bcm.edu	37	6	49928117	49928117	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr6:49928117T>A	ENST00000322066.3	-	2	97	c.98A>T	c.(97-99)tAc>tTc	p.Y33F		NM_001037499.1	NP_001032588.1	Q30KQ6	DB114_HUMAN	defensin, beta 114	33					defense response to bacterium (GO:0042742)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)	extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Lung NSC(77;0.042)					ACAACGACCGTAACGTTTGGT	0.353																																					p.Y33F		Atlas-SNP	.											.	DEFB114	12	.	0			c.A98T						PASS	.						108.0	98.0	101.0					6																	49928117		2203	4299	6502	SO:0001583	missense	245928	exon2			CGACCGTAACGTT	DQ012018	CCDS34474.1	6p12.3	2010-03-30			ENSG00000177684	ENSG00000177684		"""Defensins, beta"""	18095	protein-coding gene	gene with protein product		615243				11854508, 16033865	Standard	NM_001037499		Approved	DEFB-14	uc011dwp.2	Q30KQ6	OTTHUMG00000160209	ENST00000322066.3:c.98A>T	6.37:g.49928117T>A	ENSP00000312702:p.Tyr33Phe	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	97	18	0.185567	NM_001037499	Q8NES9	Missense_Mutation	SNP	ENST00000322066.3	37	CCDS34474.1	.	.	.	.	.	.	.	.	.	.	T	10.48	1.363120	0.24684	.	.	ENSG00000177684	ENST00000322066	T	0.11495	2.77	3.55	1.08	0.20341	.	2.144620	0.02476	N	0.088045	T	0.01627	0.0052	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40776	-0.9545	8	.	.	.	-2.5461	2.8936	0.05684	0.2578:0.131:0.0:0.6112	.	33	Q30KQ6	DB114_HUMAN	F	33	ENSP00000312702:Y33F	.	Y	-	2	0	DEFB114	50036076	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.082000	0.14847	0.227000	0.20999	0.528000	0.53228	TAC	.	.	none		0.353	DEFB114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359665.1	NM_001037499	
ATN1	1822	hgsc.bcm.edu	37	12	7045924	7045924	+	Missense_Mutation	SNP	G	G	T	rs199988271		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:7045924G>T	ENST00000356654.4	+	5	1731	c.1494G>T	c.(1492-1494)caG>caT	p.Q498H	ATN1_ENST00000396684.2_Missense_Mutation_p.Q498H	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	498	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.637																																					p.Q498H		Atlas-SNP	.											ATN1,colon,carcinoma,0,1	ATN1	95	1	0			c.G1494T						scavenged	.						43.0	53.0	49.0					12																	7045924		2201	4297	6498	SO:0001583	missense	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1494G>T	12.37:g.7045924G>T	ENSP00000349076:p.Gln498His	Somatic	41	2	0.0487805		WXS	Illumina HiSeq	Phase_I	36	3	0.0833333	NM_001007026	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.273578	0.00257	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.56776	0.44;0.44;0.44	1.44	-2.88	0.05682	.	.	.	.	.	T	0.24392	0.0591	N	0.22421	0.69	0.09310	N	1	P	0.40970	0.734	B	0.30401	0.115	T	0.19353	-1.0308	9	0.17832	T	0.49	.	3.3676	0.07208	0.2981:0.2446:0.4573:0.0	.	498	P54259	ATN1_HUMAN	H	498;498;498;83	ENSP00000349076:Q498H;ENSP00000379915:Q498H;ENSP00000441744:Q498H	ENSP00000229279:Q83H	Q	+	3	2	ATN1	6916185	0.175000	0.23083	0.269000	0.24586	0.334000	0.28698	-0.489000	0.06490	-0.760000	0.04677	0.109000	0.15622	CAG	G|0.999;A|0.001	.	alt		0.637	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
MUC16	94025	hgsc.bcm.edu	37	19	9006370	9006370	+	Silent	SNP	A	A	G	rs79341062	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:9006370A>G	ENST00000397910.4	-	45	39851	c.39648T>C	c.(39646-39648)taT>taC	p.Y13216Y	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13218	SEA 8. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGCAGCCAGAATACAGAGGGC	0.522																																					p.Y13216Y		Atlas-SNP	.											MUC16_ENST00000397910,NS,carcinoma,-2,2	MUC16	4315	2	0			c.T39648C						scavenged	.						104.0	85.0	91.0					19																	9006370		2007	4178	6185	SO:0001819	synonymous_variant	94025	exon45			GCCAGAATACAGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39648T>C	19.37:g.9006370A>G		Somatic	48	2	0.0416667		WXS	Illumina HiSeq	Phase_I	35	3	0.0857143	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	2.163	-0.391777	0.04932	.	.	ENSG00000181143	ENST00000542240	.	.	.	2.73	-2.09	0.07232	.	.	.	.	.	T	0.36799	0.0980	.	.	.	.	.	.	.	.	.	.	.	.	T	0.44544	-0.9321	3	.	.	.	-18.4462	7.5909	0.28021	0.6138:0.0:0.3862:0.0	.	.	.	.	T	56	.	.	I	-	2	0	MUC16	8867370	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.632000	0.00870	-0.715000	0.04968	-2.373000	0.00235	ATT	A|0.500;G|0.500	0.500	strong		0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
TNXB	7148	hgsc.bcm.edu	37	6	32017196	32017196	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr6:32017196C>T	ENST00000375244.3	-	28	9809	c.9608G>A	c.(9607-9609)aGg>aAg	p.R3203K	TNXB_ENST00000375247.2_Missense_Mutation_p.R3201K			P22105	TENX_HUMAN	tenascin XB	3248					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CTGCCCGTCCCTGTCCTTGTA	0.662																																					p.R3201K		Atlas-SNP	.											.	TNXB	553	.	0			c.G9602A						PASS	.						68.0	73.0	71.0					6																	32017196		1278	2543	3821	SO:0001583	missense	7148	exon28			CCGTCCCTGTCCT	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.9608G>A	6.37:g.32017196C>T	ENSP00000364393:p.Arg3203Lys	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	85	4	0.0470588	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	C	2.339	-0.351566	0.05173	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.54866	0.55;0.55	4.39	2.57	0.30868	.	0.368597	0.23524	N	0.047242	T	0.12518	0.0304	L	0.41573	1.285	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.32402	-0.9908	10	0.02654	T	1	.	4.1787	0.10365	0.1809:0.6141:0.0:0.205	.	3201	P22105-3	.	K	3203;3201	ENSP00000364393:R3203K;ENSP00000364396:R3201K	ENSP00000364393:R3203K	R	-	2	0	TNXB	32125174	0.000000	0.05858	0.656000	0.29637	0.211000	0.24417	0.021000	0.13489	0.848000	0.35191	0.306000	0.20318	AGG	.	.	none		0.662	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
TRPM6	140803	hgsc.bcm.edu	37	9	77427256	77427256	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr9:77427256G>A	ENST00000360774.1	-	12	1639	c.1402C>T	c.(1402-1404)Cgc>Tgc	p.R468C	TRPM6_ENST00000376871.3_Missense_Mutation_p.R468C|TRPM6_ENST00000376864.4_Missense_Mutation_p.R468C|TRPM6_ENST00000376872.3_Missense_Mutation_p.R468C|TRPM6_ENST00000449912.2_Missense_Mutation_p.R463C|TRPM6_ENST00000361255.3_Missense_Mutation_p.R463C|TRPM6_ENST00000451710.3_Missense_Mutation_p.R468C	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	468					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GTAAGAAAGCGATGGAGGTTC	0.433																																					p.R468C		Atlas-SNP	.											TRPM6,NS,carcinoma,0,1	TRPM6	377	1	0			c.C1402T						scavenged	.						127.0	114.0	119.0					9																	77427256		2203	4300	6503	SO:0001583	missense	140803	exon12			GAAAGCGATGGAG	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1402C>T	9.37:g.77427256G>A	ENSP00000354006:p.Arg468Cys	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	61	5	0.0819672	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579285	0.65878	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25;1.25	5.7	3.82	0.43975	.	0.258733	0.45867	N	0.000333	T	0.60843	0.2300	M	0.80616	2.505	0.46981	D	0.999271	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.79784	0.917;0.917;0.993;0.988	T	0.62558	-0.6829	10	0.59425	D	0.04	.	13.5144	0.61533	0.0634:0.0:0.823:0.1135	.	468;468;468;463	Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3	.;.;TRPM6_HUMAN;.	C	468;468;468;468;463;463;468;131;131	ENSP00000354006:R468C;ENSP00000407341:R468C;ENSP00000366068:R468C;ENSP00000366067:R468C;ENSP00000396672:R463C;ENSP00000354962:R463C;ENSP00000366060:R468C	ENSP00000309693:R131C	R	-	1	0	TRPM6	76617076	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	3.439000	0.52878	0.332000	0.23536	-0.813000	0.03139	CGC	.	.	none		0.433	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
PHKA1	5255	hgsc.bcm.edu	37	X	71855062	71855062	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chrX:71855062G>A	ENST00000373542.4	-	16	1816	c.1657C>T	c.(1657-1659)Cgc>Tgc	p.R553C	PHKA1_ENST00000541944.1_Missense_Mutation_p.R553C|PHKA1_ENST00000373539.3_Missense_Mutation_p.R553C|PHKA1_ENST00000373545.3_Missense_Mutation_p.R553C|PHKA1_ENST00000339490.3_Missense_Mutation_p.R553C	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	553					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					ATCCGCCAGCGGCTACAGAGG	0.483																																					p.R553C		Atlas-SNP	.											.	PHKA1	129	.	0			c.C1657T						PASS	.						106.0	84.0	92.0					X																	71855062		2203	4300	6503	SO:0001583	missense	5255	exon16			GCCAGCGGCTACA		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1657C>T	X.37:g.71855062G>A	ENSP00000362643:p.Arg553Cys	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	55	17	0.309091	NM_001172436	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	G	6.750	0.507139	0.12883	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34;-2.34	4.33	4.33	0.51752	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.84106	0.5399	N	0.05351	-0.065	0.80722	D	1	D;B;B	0.89917	1.0;0.005;0.021	D;B;B	0.66351	0.943;0.008;0.021	T	0.82908	-0.0224	10	0.23891	T	0.37	-5.103	13.7081	0.62653	0.0:0.0:1.0:0.0	.	553;553;553	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	C	553	ENSP00000362646:R553C;ENSP00000362643:R553C;ENSP00000441251:R553C;ENSP00000342469:R553C;ENSP00000362640:R553C	ENSP00000342469:R553C	R	-	1	0	PHKA1	71771787	1.000000	0.71417	1.000000	0.80357	0.227000	0.25037	2.565000	0.45939	1.890000	0.54733	0.415000	0.27848	CGC	.	.	none		0.483	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
MPEG1	219972	hgsc.bcm.edu	37	11	58978341	58978341	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:58978341G>A	ENST00000361050.3	-	1	2083	c.1998C>T	c.(1996-1998)acC>acT	p.T666T		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	666						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				CAGCCAGAATGGTGGTGACCC	0.552																																					p.T666T		Atlas-SNP	.											.	MPEG1	72	.	0			c.C1998T						PASS	.						119.0	125.0	123.0					11																	58978341		2046	4179	6225	SO:0001819	synonymous_variant	219972	exon1			CAGAATGGTGGTG	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1998C>T	11.37:g.58978341G>A		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	138	11	0.0797101	NM_001039396	Q2M1T6|Q8TEF8	Silent	SNP	ENST00000361050.3	37	CCDS41650.1																																																																																			.	.	none		0.552	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
MYH13	8735	hgsc.bcm.edu	37	17	10267752	10267752	+	Silent	SNP	G	G	A	rs189377998		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr17:10267752G>A	ENST00000418404.3	-	2	259	c.96C>T	c.(94-96)ttC>ttT	p.F32F	MYH13_ENST00000252172.4_Silent_p.F32F			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	32					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TCTTGGAATCGAATGGACGAT	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		19558	0.001		0.0	False		,,,				2504	0.0				p.F32F		Atlas-SNP	.											MYH13_ENST00000252172,NS,carcinoma,0,2	MYH13	533	2	0			c.C96T						PASS	.						121.0	113.0	115.0					17																	10267752		1920	4138	6058	SO:0001819	synonymous_variant	8735	exon3			GGAATCGAATGGA	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.96C>T	17.37:g.10267752G>A		Somatic	193	0	0		WXS	Illumina HiSeq	Phase_I	159	19	0.119497	NM_003802	O95252|Q9P0U8	Silent	SNP	ENST00000418404.3	37	CCDS45613.1																																																																																			G|1.000;A|0.000	0.000	strong		0.463	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
ANKRD36	375248	hgsc.bcm.edu	37	2	97883094	97883094	+	Missense_Mutation	SNP	T	T	G	rs62156176	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr2:97883094T>G	ENST00000461153.2	+	64	4082	c.3838T>G	c.(3838-3840)Tgg>Ggg	p.W1280G	ANKRD36_ENST00000420699.2_Missense_Mutation_p.W1280G			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1280								p.W1084G(2)|p.W1280G(2)		endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						AACAGGCGGTTGGAAATCTGG	0.338																																					p.W1280G		Atlas-SNP	.											ANKRD36_ENST00000420699,NS,carcinoma,0,4	ANKRD36	170	4	4	Substitution - Missense(4)	prostate(2)|endometrium(2)	c.T3838G						scavenged	.						151.0	119.0	129.0					2																	97883094		692	1591	2283	SO:0001583	missense	375248	exon64			GGCGGTTGGAAAT	BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.3838T>G	2.37:g.97883094T>G	ENSP00000419530:p.Trp1280Gly	Somatic	314	3	0.00955414		WXS	Illumina HiSeq	Phase_I	305	4	0.0131148	NM_001164315	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	ENST00000461153.2	37	CCDS54379.1	.	.	.	.	.	.	.	.	.	.	.	0.018	-1.470424	0.01044	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.28255	1.62;1.62	0.569	-0.453	0.12201	.	.	.	.	.	T	0.13329	0.0323	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.22208	-1.0223	8	0.41790	T	0.15	.	.	.	.	rs62156176	1280;105	A6QL64;A6QL64-3	AN36A_HUMAN;.	G	1280;1280;547	ENSP00000419530:W1280G;ENSP00000391950:W1280G	ENSP00000391950:W1280G	W	+	1	0	ANKRD36	97246821	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.272000	0.08560	-0.248000	0.09583	-1.372000	0.01188	TGG	T|0.905;G|0.095	0.095	strong		0.338	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5		
LPHN1	22859	hgsc.bcm.edu	37	19	14288465	14288465	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:14288465G>A	ENST00000340736.6	-	3	459	c.162C>T	c.(160-162)gaC>gaT	p.D54D	LPHN1_ENST00000361434.3_Silent_p.D54D	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	54	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCATGATGACGTCGCTGCCGG	0.652																																					p.D54D		Atlas-SNP	.											LPHN1,NS,carcinoma,-1,1	LPHN1	107	1	0			c.C162T						PASS	.						114.0	91.0	99.0					19																	14288465		2203	4300	6503	SO:0001819	synonymous_variant	22859	exon3			GATGACGTCGCTG	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.162C>T	19.37:g.14288465G>A		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	48	7	0.145833	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Silent	SNP	ENST00000340736.6	37	CCDS32928.1																																																																																			.	.	none		0.652	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
NOM1	64434	hgsc.bcm.edu	37	7	156743222	156743222	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:156743222A>G	ENST00000275820.3	+	1	806	c.791A>G	c.(790-792)gAg>gGg	p.E264G		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	264	Glu-rich.|Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		gaggaggaggagggagacgta	0.542																																					p.E264G		Atlas-SNP	.											NOM1,NS,carcinoma,+1,1	NOM1	73	1	0			c.A791G						scavenged	.						64.0	46.0	52.0					7																	156743222		2203	4300	6503	SO:0001583	missense	64434	exon1			AGGAGGAGGGAGA	AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.791A>G	7.37:g.156743222A>G	ENSP00000275820:p.Glu264Gly	Somatic	73	2	0.0273973		WXS	Illumina HiSeq	Phase_I	72	3	0.0416667	NM_138400	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	.	.	.	.	.	.	.	.	.	.	A	11.47	1.648378	0.29336	.	.	ENSG00000146909	ENST00000275820	T	0.13901	2.55	3.07	-6.13	0.02118	.	2.984370	0.01388	N	0.013164	T	0.05686	0.0149	N	0.08118	0	0.09310	N	1	B	0.22003	0.063	B	0.17098	0.017	T	0.25710	-1.0124	10	0.18710	T	0.47	0.0073	4.0147	0.09639	0.36:0.4427:0.0802:0.1172	.	264	Q5C9Z4	NOM1_HUMAN	G	264	ENSP00000275820:E264G	ENSP00000275820:E264G	E	+	2	0	NOM1	156435983	0.146000	0.22672	0.000000	0.03702	0.139000	0.21198	0.678000	0.25277	-1.661000	0.01484	0.456000	0.33151	GAG	.	.	none		0.542	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
MPEG1	219972	hgsc.bcm.edu	37	11	58978740	58978740	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:58978740G>A	ENST00000361050.3	-	1	1684	c.1599C>T	c.(1597-1599)agC>agT	p.S533S		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	533						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				CAACTGTGCAGCTAAAGAACC	0.537																																					p.S533S		Atlas-SNP	.											MPEG1,NS,lymphoid_neoplasm,0,2	MPEG1	72	2	0			c.C1599T						PASS	.						40.0	43.0	42.0					11																	58978740		1837	4086	5923	SO:0001819	synonymous_variant	219972	exon1			TGTGCAGCTAAAG	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1599C>T	11.37:g.58978740G>A		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	99	6	0.0606061	NM_001039396	Q2M1T6|Q8TEF8	Silent	SNP	ENST00000361050.3	37	CCDS41650.1																																																																																			.	.	none		0.537	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
C21orf62	56245	hgsc.bcm.edu	37	21	34166724	34166724	+	Silent	SNP	T	T	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr21:34166724T>A	ENST00000536776.1	-	2	149	c.9A>T	c.(7-9)ccA>ccT	p.P3P	C21orf49_ENST00000453404.1_Intron|C21orf62_ENST00000490358.1_Silent_p.P3P|C21orf62_ENST00000479548.1_Silent_p.P3P|C21orf49_ENST00000477513.1_Intron|C21orf62_ENST00000487113.1_Silent_p.P3P|C21orf49_ENST00000382375.4_Intron|C21orf49_ENST00000382377.3_Intron|C21orf49_ENST00000382378.1_Intron	NM_001162495.2|NM_001162496.2|NM_019596.5	NP_001155967.2|NP_001155968.2|NP_062542.5	Q9NYP8	CU062_HUMAN	chromosome 21 open reading frame 62	3										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	6		Myeloproliferative disorder(46;0.0255)				GCCTGGAAGGTGGTGCCATGC	0.493																																					p.P3P		Atlas-SNP	.											.	C21orf62	26	.	0			c.A9T						PASS	.						37.0	37.0	37.0					21																	34166724		1963	4151	6114	SO:0001819	synonymous_variant	56245	exon4			GGAAGGTGGTGCC	AF231922	CCDS42919.1, CCDS42919.2	21q22.1	2011-02-24			ENSG00000205929	ENSG00000205929			1305	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 120"""	C21orf120			Standard	NM_001162495		Approved	B37, PRED81	uc011adu.2	Q9NYP8	OTTHUMG00000163477	ENST00000536776.1:c.9A>T	21.37:g.34166724T>A		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	63	7	0.111111	NM_001162495	A8K4L8	Silent	SNP	ENST00000536776.1	37	CCDS42919.2																																																																																			.	.	none		0.493	C21orf62-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139598.5	NM_019596	
ADARB1	104	hgsc.bcm.edu	37	21	46595934	46595934	+	Silent	SNP	G	G	A	rs201356458		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr21:46595934G>A	ENST00000360697.3	+	2	333	c.318G>A	c.(316-318)gcG>gcA	p.A106A	ADARB1_ENST00000539173.1_Silent_p.A106A|ADARB1_ENST00000389863.4_Silent_p.A106A|ADARB1_ENST00000437626.1_Intron|ADARB1_ENST00000348831.4_Silent_p.A106A			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	106	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A106A(2)		endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		CCGTGCACGCGCCTTTGTTTG	0.557																																					p.A106A		Atlas-SNP	.											ADARB1_ENST00000389863,NS,carcinoma,0,4	ADARB1	81	4	2	Substitution - coding silent(2)	large_intestine(2)	c.G318A						PASS	.						113.0	118.0	116.0					21																	46595934		2203	4300	6503	SO:0001819	synonymous_variant	104	exon4			GCACGCGCCTTTG	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.318G>A	21.37:g.46595934G>A		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	124	16	0.129032	NM_001160230	A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Silent	SNP	ENST00000360697.3	37	CCDS33589.1																																																																																			G|0.999;A|0.001	0.001	weak		0.557	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2	NM_015833	
HERC1	8925	hgsc.bcm.edu	37	15	63970537	63970537	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr15:63970537C>T	ENST00000443617.2	-	37	6664	c.6577G>A	c.(6577-6579)Ggc>Agc	p.G2193S	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2193	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CGGGGTGTGCCACGCATCTGC	0.433																																					p.G2193S		Atlas-SNP	.											.	HERC1	624	.	0			c.G6577A						PASS	.						29.0	27.0	28.0					15																	63970537		1945	4132	6077	SO:0001583	missense	8925	exon37			GTGTGCCACGCAT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.6577G>A	15.37:g.63970537C>T	ENSP00000390158:p.Gly2193Ser	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	79	10	0.126582	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.012108	0.93346	.	.	ENSG00000103657	ENST00000443617	T	0.59224	0.28	5.7	5.7	0.88788	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.85682	D	0.000000	T	0.65647	0.2711	N	0.20685	0.6	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66881	-0.5811	10	0.46703	T	0.11	.	19.8247	0.96612	0.0:1.0:0.0:0.0	.	2193	Q15751	HERC1_HUMAN	S	2193	ENSP00000390158:G2193S	ENSP00000390158:G2193S	G	-	1	0	HERC1	61757590	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	2.696000	0.92011	0.655000	0.94253	GGC	.	.	none		0.433	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
HIST1H2BK	85236	hgsc.bcm.edu	37	6	27114250	27114250	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr6:27114250G>A	ENST00000356950.1	-	1	327	c.328C>T	c.(328-330)Cac>Tac	p.H110Y	HIST1H2BK_ENST00000396891.4_Missense_Mutation_p.H110Y|MIR3143_ENST00000584253.1_RNA|HIST1H2AH_ENST00000377459.1_5'Flank			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	110					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						GACACGGCGTGCTTGGCCAAC	0.597																																					p.H110Y		Atlas-SNP	.											.	HIST1H2BK	68	.	0			c.C328T						PASS	.						59.0	65.0	63.0					6																	27114250		2203	4292	6495	SO:0001583	missense	85236	exon1			CGGCGTGCTTGGC	AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.328C>T	6.37:g.27114250G>A	ENSP00000349430:p.His110Tyr	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	81	9	0.111111	NM_080593	A8K7P7|Q2VPI7	Missense_Mutation	SNP	ENST00000356950.1	37	CCDS4621.1	.	.	.	.	.	.	.	.	.	.	.	19.40	3.820178	0.71028	.	.	ENSG00000197903	ENST00000396891;ENST00000356950	T;T	0.51574	0.7;0.7	4.05	4.05	0.47172	Histone-fold (2);	0.000000	0.40469	U	0.001098	T	0.67850	0.2937	M	0.92738	3.34	0.40826	D	0.983549	D	0.71674	0.998	D	0.63957	0.92	T	0.77773	-0.2462	10	0.87932	D	0	.	14.5252	0.67884	0.0:0.0:1.0:0.0	.	110	O60814	H2B1K_HUMAN	Y	110	ENSP00000380100:H110Y;ENSP00000349430:H110Y	ENSP00000349430:H110Y	H	-	1	0	HIST1H2BK	27222229	1.000000	0.71417	1.000000	0.80357	0.530000	0.34684	5.915000	0.69973	2.196000	0.70406	0.650000	0.86243	CAC	.	.	none		0.597	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040141.1	NM_080593	
FCRLB	127943	hgsc.bcm.edu	37	1	161695618	161695618	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:161695618G>A	ENST00000367948.2	+	6	530	c.315G>A	c.(313-315)ctG>ctA	p.L105L	FCRLB_ENST00000336830.5_Silent_p.L105L|FCRLB_ENST00000367945.1_Silent_p.L98L|FCRLB_ENST00000392158.1_Silent_p.L105L|FCRLB_ENST00000367944.3_Silent_p.L98L|FCRLB_ENST00000367946.3_Silent_p.L105L			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	105	Ig-like C2-type 2.				negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			CAGATTGGCTGATTCTGCAAG	0.567																																					p.L105L		Atlas-SNP	.											.	FCRLB	35	.	0			c.G315A						PASS	.						118.0	111.0	113.0					1																	161695618		2203	4300	6503	SO:0001819	synonymous_variant	127943	exon4			TTGGCTGATTCTG	AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.315G>A	1.37:g.161695618G>A		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	56	4	0.0714286	NM_001002901	A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Silent	SNP	ENST00000367948.2	37	CCDS30927.1																																																																																			.	.	none		0.567	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083585.1	NM_152378	
DPY19L1	23333	hgsc.bcm.edu	37	7	35009120	35009120	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:35009120G>A	ENST00000310974.4	-	9	864	c.720C>T	c.(718-720)agC>agT	p.S240S	DPY19L1_ENST00000462134.2_5'UTR	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	240						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)	p.S240S(2)		endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						GTGCAATCAAGCTTCCTCTAT	0.358																																					p.S240S		Atlas-SNP	.											DPY19L1,NS,carcinoma,0,2	DPY19L1	56	2	2	Substitution - coding silent(2)	kidney(2)	c.C720T						scavenged	.						81.0	76.0	77.0					7																	35009120		1833	4097	5930	SO:0001819	synonymous_variant	23333	exon9			AATCAAGCTTCCT	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.720C>T	7.37:g.35009120G>A		Somatic	643	21	0.0326594		WXS	Illumina HiSeq	Phase_I	535	29	0.0542056	NM_015283	O94954|Q4G151	Silent	SNP	ENST00000310974.4	37	CCDS43567.1																																																																																			.	.	none		0.358	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1		
NLRP9	338321	hgsc.bcm.edu	37	19	56244558	56244558	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:56244558G>A	ENST00000332836.2	-	2	666	c.639C>T	c.(637-639)atC>atT	p.I213I		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	213	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AAATGTCTTCGATCTTCTCTG	0.443																																					p.I213I		Atlas-SNP	.											NLRP9,NS,carcinoma,0,1	NLRP9	163	1	0			c.C639T						PASS	.						33.0	32.0	32.0					19																	56244558		2203	4300	6503	SO:0001819	synonymous_variant	338321	exon2			GTCTTCGATCTTC	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.639C>T	19.37:g.56244558G>A		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	84	11	0.130952	NM_176820	B2RN12|Q86W27	Silent	SNP	ENST00000332836.2	37	CCDS12934.1																																																																																			.	.	none		0.443	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
COL4A4	1286	hgsc.bcm.edu	37	2	228009244	228009244	+	Silent	SNP	T	T	C	rs3817617	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr2:228009244T>C	ENST00000396625.3	-	3	309	c.102A>G	c.(100-102)caA>caG	p.Q34Q	COL4A4_ENST00000329662.7_Silent_p.Q34Q	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	34					axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.Q34H(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CATATACATATTGTACAGAAA	0.299													T|||	28	0.00559105	0.0	0.0	5008	,	,		17138	0.0278		0.0	False		,,,				2504	0.0				p.Q34Q		Atlas-SNP	.											COL4A4,NS,carcinoma,0,1	COL4A4	215	1	1	Substitution - Missense(1)	lung(1)	c.A102G						scavenged	.						88.0	83.0	85.0					2																	228009244		1815	4072	5887	SO:0001819	synonymous_variant	1286	exon3			TACATATTGTACA		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.102A>G	2.37:g.228009244T>C		Somatic	659	2	0.0030349		WXS	Illumina HiSeq	Phase_I	608	8	0.0131579	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	ENST00000396625.3	37	CCDS42828.1																																																																																			T|0.987;C|0.013	0.013	strong		0.299	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
CHERP	10523	hgsc.bcm.edu	37	19	16640580	16640580	+	Silent	SNP	T	T	C	rs528619775	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:16640580T>C	ENST00000198939.6	-	8	1077	c.1041A>G	c.(1039-1041)caA>caG	p.Q347Q	CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000546361.2_Silent_p.Q336Q					calcium homeostasis endoplasmic reticulum protein									p.Q336Q(2)		endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						gctgctgctgttgctgctgct	0.667													T|||	23	0.00459265	0.0129	0.0043	5008	,	,		16097	0.001		0.001	False		,,,				2504	0.001				p.Q336Q		Atlas-SNP	.											CHERP,NS,carcinoma,0,2	CHERP	70	2	2	Substitution - coding silent(2)	lung(2)	c.A1008G						scavenged	.						21.0	29.0	26.0					19																	16640580		2193	4293	6486	SO:0001819	synonymous_variant	10523	exon8			CTGCTGTTGCTGC	U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.1041A>G	19.37:g.16640580T>C		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	28	2	0.0714286	NM_006387		Silent	SNP	ENST00000198939.6	37																																																																																				.	.	none		0.667	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000403372.1	NM_006387	
RGPD3	653489	hgsc.bcm.edu	37	2	107049631	107049631	+	Silent	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr2:107049631C>T	ENST00000409886.3	-	16	2403	c.2316G>A	c.(2314-2316)gcG>gcA	p.A772A	RGPD3_ENST00000304514.7_Silent_p.A772A	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	772					protein targeting to Golgi (GO:0000042)			p.A772A(4)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTTCTGAATCCGCATTTCGCA	0.373																																					p.A772A		Atlas-SNP	.											RGPD3_ENST00000304514,bladder,carcinoma,0,6	RGPD3	316	6	4	Substitution - coding silent(4)	kidney(2)|endometrium(2)	c.G2316A						scavenged	.						81.0	68.0	72.0					2																	107049631		692	1590	2282	SO:0001819	synonymous_variant	653489	exon16			TGAATCCGCATTT		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2316G>A	2.37:g.107049631C>T		Somatic	631	6	0.00950872		WXS	Illumina HiSeq	Phase_I	601	12	0.0199667	NM_001144013	B8ZZM4	Silent	SNP	ENST00000409886.3	37	CCDS46379.1																																																																																			.	.	weak		0.373	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
DDX52	11056	hgsc.bcm.edu	37	17	35993354	35993354	+	Silent	SNP	T	T	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr17:35993354T>G	ENST00000349699.2	-	3	424	c.381A>C	c.(379-381)ctA>ctC	p.L127L	DDX52_ENST00000394367.3_Silent_p.L19L	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	127						membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				TTCCGGAAGTTAGTTTACTTT	0.348																																					p.L127L		Atlas-SNP	.											.	DDX52	40	.	0			c.A381C						PASS	.						93.0	95.0	94.0					17																	35993354		2202	4298	6500	SO:0001819	synonymous_variant	11056	exon3			GGAAGTTAGTTTA	AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.381A>C	17.37:g.35993354T>G		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	60	9	0.15	NM_007010	Q86YG1|Q8N213|Q9NVE0|Q9Y482	Silent	SNP	ENST00000349699.2	37	CCDS11323.1																																																																																			.	.	none		0.348	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256795.1	NM_152300	
KRT37	8688	hgsc.bcm.edu	37	17	39580747	39580747	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr17:39580747C>A	ENST00000225550.3	-	1	28	c.29G>T	c.(28-30)tGc>tTc	p.C10F	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	10	Head.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				ACCCAGAGGGCATGAGGAGGT	0.572																																					p.C10F		Atlas-SNP	.											.	KRT37	61	.	0			c.G29T						PASS	.						66.0	70.0	68.0					17																	39580747		2203	4300	6503	SO:0001583	missense	8688	exon1			AGAGGGCATGAGG	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.29G>T	17.37:g.39580747C>A	ENSP00000225550:p.Cys10Phe	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	71	6	0.084507	NM_003770		Missense_Mutation	SNP	ENST00000225550.3	37	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	.	3.388	-0.124847	0.06795	.	.	ENSG00000108417	ENST00000225550	D	0.81739	-1.53	4.0	-5.2	0.02823	.	1.694370	0.03249	N	0.181556	T	0.50769	0.1635	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.54016	-0.8356	10	0.06365	T	0.9	.	3.0653	0.06212	0.1093:0.34:0.3573:0.1934	.	10	O76014	KRT37_HUMAN	F	10	ENSP00000225550:C10F	ENSP00000225550:C10F	C	-	2	0	KRT37	36834273	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.529000	0.02223	-0.991000	0.03476	0.655000	0.94253	TGC	.	.	none		0.572	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770	
OR10G4	390264	hgsc.bcm.edu	37	11	123886796	123886796	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:123886796A>G	ENST00000320891.4	+	1	515	c.515A>G	c.(514-516)cAg>cGg	p.Q172R		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GGACCCAACCAGATCCAGCAC	0.557																																					p.Q172R		Atlas-SNP	.											OR10G4,NS,carcinoma,+1,1	OR10G4	77	1	0			c.A515G						scavenged	.						167.0	148.0	154.0					11																	123886796		2201	4287	6488	SO:0001583	missense	390264	exon1			CCAACCAGATCCA	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.515A>G	11.37:g.123886796A>G	ENSP00000325076:p.Gln172Arg	Somatic	183	4	0.0218579		WXS	Illumina HiSeq	Phase_I	184	6	0.0326087	NM_001004462	Q6IEW0	Missense_Mutation	SNP	ENST00000320891.4	37	CCDS31702.1	.	.	.	.	.	.	.	.	.	.	a	0.521	-0.862106	0.02610	.	.	ENSG00000254737	ENST00000320891	T	0.00099	8.73	3.33	-0.69	0.11309	GPCR, rhodopsin-like superfamily (1);	0.568844	0.14743	N	0.301047	T	0.00073	0.0002	N	0.25380	0.74	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.05971	-1.0853	10	0.17369	T	0.5	.	4.3343	0.11078	0.5939:0.0:0.1866:0.2195	.	172	Q8NGN3	O10G4_HUMAN	R	172	ENSP00000325076:Q172R	ENSP00000325076:Q172R	Q	+	2	0	OR10G4	123392006	0.000000	0.05858	0.142000	0.22268	0.212000	0.24457	-0.225000	0.09151	-0.243000	0.09653	-1.544000	0.00907	CAG	.	.	none		0.557	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462	
ZNF841	284371	hgsc.bcm.edu	37	19	52570006	52570006	+	Silent	SNP	G	G	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:52570006G>T	ENST00000426391.2	-	5	1332	c.781C>A	c.(781-783)Cga>Aga	p.R261R	ZNF841_ENST00000594295.1_Silent_p.R377R|ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000359973.2_Silent_p.R261R|ZNF841_ENST00000389534.4_Silent_p.R377R			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						TTCCCACATCGATTACATTTG	0.393																																					p.R377R		Atlas-SNP	.											ZNF841_ENST00000389534,NS,carcinoma,+1,3	ZNF841	183	3	0			c.C1129A						scavenged	.						107.0	95.0	99.0					19																	52570006		692	1591	2283	SO:0001819	synonymous_variant	284371	exon7			CACATCGATTACA	AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.781C>A	19.37:g.52570006G>T		Somatic	79	1	0.0126582		WXS	Illumina HiSeq	Phase_I	58	2	0.0344828	NM_001136499	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Silent	SNP	ENST00000426391.2	37																																																																																				.	.	none		0.393	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1	XM_209155	
RBM5	10181	hgsc.bcm.edu	37	3	50154752	50154752	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr3:50154752G>A	ENST00000347869.3	+	24	2437	c.2262G>A	c.(2260-2262)atG>atA	p.M754I	RP11-493K19.3_ENST00000425674.1_RNA|RP11-493K19.3_ENST00000437204.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	754	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.|Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGCAGGCCATGGGCTGGCGGG	0.517																																					p.M754I		Atlas-SNP	.											.	RBM5	76	.	0			c.G2262A						PASS	.						171.0	164.0	167.0					3																	50154752		2203	4300	6503	SO:0001583	missense	10181	exon24			GGCCATGGGCTGG	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.2262G>A	3.37:g.50154752G>A	ENSP00000343054:p.Met754Ile	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	88	8	0.0909091	NM_005778	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	ENST00000347869.3	37	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	G	34	5.322192	0.95708	.	.	ENSG00000003756	ENST00000347869;ENST00000543047;ENST00000544851	T	0.50001	0.76	5.48	5.48	0.80851	D111/G-patch (3);	0.000000	0.85682	D	0.000000	D	0.83266	0.5217	H	0.99487	4.59	0.80722	D	1	D;D	0.63046	0.992;0.981	D;D	0.70227	0.968;0.966	D	0.90805	0.4697	10	0.87932	D;D	0;0	-14.2084	19.3354	0.94316	0.0:0.0:1.0:0.0	.	444;754	Q59HE6;P52756	.;RBM5_HUMAN	I	754;753;444	ENSP00000343054:M754I	ENSP00000343054:M754I;ENSP00000343054:M754I	M	+	3	0	RBM5	50129756	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.532000	0.98057	2.571000	0.86741	0.650000	0.86243	ATG	.	.	none		0.517	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	
MUC2	4583	hgsc.bcm.edu	37	11	1092971	1092971	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:1092971C>T	ENST00000441003.2	+	30	4817	c.4790C>T	c.(4789-4791)aCa>aTa	p.T1597I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaaccccaacacccaccggc	0.632																																					p.T1597I		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,1	MUC2	614	1	0			c.C4790T						scavenged	.						47.0	82.0	70.0					11																	1092971		1782	3233	5015	SO:0001583	missense	4583	exon30			CCCCAACACCCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4790C>T	11.37:g.1092971C>T	ENSP00000415183:p.Thr1597Ile	Somatic	34	2	0.0588235		WXS	Illumina HiSeq	Phase_I	43	6	0.139535	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.395	-0.338980	0.05243	.	.	ENSG00000198788	ENST00000441003	T	0.14640	2.49	1.75	0.762	0.18454	.	.	.	.	.	T	0.07143	0.0181	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.41520	-0.9504	8	0.22109	T	0.4	.	4.3366	0.11089	0.0:0.6142:0.0:0.3858	.	1597	E7EUV1	.	I	1597	ENSP00000415183:T1597I	ENSP00000415183:T1597I	T	+	2	0	MUC2	1082971	0.029000	0.19370	0.001000	0.08648	0.134000	0.20937	1.107000	0.31110	0.104000	0.17725	0.121000	0.15741	ACA	.	.	none		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
RIMS2	9699	hgsc.bcm.edu	37	8	105263836	105263836	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr8:105263836G>A	ENST00000436393.2	+	28	4133	c.3892G>A	c.(3892-3894)Gtc>Atc	p.V1298I	RIMS2_ENST00000507740.1_Missense_Mutation_p.V1094I|RIMS2_ENST00000262231.10_Missense_Mutation_p.V1119I|RIMS2_ENST00000339750.2_Missense_Mutation_p.V216I|RIMS2_ENST00000406091.3_Missense_Mutation_p.V1280I			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1342	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ACAGATCATCGTCTGGGGAGA	0.358										HNSCC(12;0.0054)																											p.V1280I		Atlas-SNP	.											RIMS2_ENST00000507740,NS,carcinoma,-2,4	RIMS2	1357	4	0			c.G3838A						PASS	.						118.0	115.0	116.0					8																	105263836		1880	4138	6018	SO:0001583	missense	9699	exon24			ATCATCGTCTGGG	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3892G>A	8.37:g.105263836G>A	ENSP00000390665:p.Val1298Ile	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	100	12	0.12	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	G	22.0	4.231635	0.79688	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000436393;ENST00000523362;ENST00000339750	D;D;D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9;-1.9;-1.9	5.64	5.64	0.86602	.	.	.	.	.	D	0.92564	0.7638	M	0.79614	2.46	0.80722	D	1	D;D;D;D	0.71674	0.984;0.995;0.995;0.998	D;D;D;D	0.69824	0.925;0.95;0.95;0.966	D	0.92842	0.6289	9	0.72032	D	0.01	.	19.6939	0.96016	0.0:0.0:1.0:0.0	.	1298;1119;1094;1280	D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	.;.;.;.	I	1317;1280;1342;1119;1094;1298;216;216	ENSP00000384892:V1280I;ENSP00000262231:V1119I;ENSP00000423559:V1094I;ENSP00000390665:V1298I;ENSP00000428478:V216I;ENSP00000342051:V216I	ENSP00000262231:V1119I	V	+	1	0	RIMS2	105333012	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.857000	0.99534	2.660000	0.90430	0.655000	0.94253	GTC	.	.	none		0.358	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
KIAA1549	57670	hgsc.bcm.edu	37	7	138603173	138603173	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:138603173G>A	ENST00000422774.1	-	2	1247	c.1199C>T	c.(1198-1200)cCc>cTc	p.P400L	KIAA1549_ENST00000440172.1_Missense_Mutation_p.P400L|KIAA1549_ENST00000242365.4_Missense_Mutation_p.P350L			Q9HCM3	K1549_HUMAN	KIAA1549	400						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CACAGGACCGGGGAGGGCTGA	0.527			O	BRAF	pilocytic astrocytoma																																p.P400L	NSCLC(119;1534 1718 44213 46230 50068)	Atlas-SNP	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549	314	.	0			c.C1199T						PASS	.						98.0	98.0	98.0					7																	138603173		2015	4181	6196	SO:0001583	missense	57670	exon2			GGACCGGGGAGGG		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1199C>T	7.37:g.138603173G>A	ENSP00000416040:p.Pro400Leu	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	91	9	0.0989011	NM_020910	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.303705	0.40795	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.25414	1.8;1.81;1.81	4.73	4.73	0.59995	.	0.299915	0.24303	N	0.039706	T	0.24890	0.0604	L	0.29908	0.895	0.30414	N	0.778801	P;P	0.44946	0.761;0.846	B;P	0.44811	0.272;0.461	T	0.09487	-1.0672	10	0.56958	D	0.05	.	15.023	0.71647	0.0:0.0:1.0:0.0	.	400;400	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	L	400;350;400	ENSP00000406661:P400L;ENSP00000242365:P350L;ENSP00000416040:P400L	ENSP00000242365:P350L	P	-	2	0	KIAA1549	138253713	0.746000	0.28272	0.227000	0.23927	0.010000	0.07245	2.470000	0.45119	2.459000	0.83118	0.650000	0.86243	CCC	.	.	none		0.527	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
DTX1	1840	hgsc.bcm.edu	37	12	113496044	113496044	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:113496044G>A	ENST00000257600.3	+	1	550	c.47G>A	c.(46-48)gGc>gAc	p.G16D		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	16	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						AATGGTCTGGGCTTCCCACCG	0.677																																					p.G16D		Atlas-SNP	.											DTX1,NS,lymphoid_neoplasm,0,1	DTX1	83	1	0			c.G47A						PASS	.						63.0	52.0	55.0					12																	113496044		2202	4299	6501	SO:0001583	missense	1840	exon1			GTCTGGGCTTCCC	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.47G>A	12.37:g.113496044G>A	ENSP00000257600:p.Gly16Asp	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	111	9	0.0810811	NM_004416	O60630|Q9BS04	Missense_Mutation	SNP	ENST00000257600.3	37	CCDS9164.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862540	0.71949	.	.	ENSG00000135144	ENST00000257600	T	0.12879	2.64	3.89	3.89	0.44902	WWE domain (1);	0.178522	0.35151	U	0.003402	T	0.11495	0.0280	L	0.44542	1.39	0.41096	D	0.985633	P	0.42908	0.793	B	0.38225	0.268	T	0.03728	-1.1009	10	0.51188	T	0.08	-13.5407	8.7963	0.34881	0.107:0.0:0.893:0.0	.	16	Q86Y01	DTX1_HUMAN	D	16	ENSP00000257600:G16D	ENSP00000257600:G16D	G	+	2	0	DTX1	111980427	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	6.846000	0.75399	2.017000	0.59298	0.549000	0.68633	GGC	.	.	none		0.677	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
TNFRSF14	8764	hgsc.bcm.edu	37	1	2494626	2494626	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:2494626G>C	ENST00000355716.4	+	8	1065	c.766G>C	c.(766-768)Gag>Cag	p.E256Q		NM_003820.2	NP_003811.2	Q92956	TNR14_HUMAN	tumor necrosis factor receptor superfamily, member 14	256					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell migration (GO:2000406)|T cell costimulation (GO:0031295)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			kidney(1)	1	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;1.11e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000326)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		CACAGTCATTGAGGCCCTGCA	0.627			"""Mis, N, F"""		follicular lymphoma																																p.E256Q		Atlas-SNP	.		Rec	yes		1	1p36.32	8764	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""		L	.	TNFRSF14	89	.	0			c.G766C						PASS	.						120.0	103.0	109.0					1																	2494626		2203	4300	6503	SO:0001583	missense	8764	exon8			GTCATTGAGGCCC	U70321	CCDS44046.1	1p36.32	2012-02-27	2011-08-11		ENSG00000157873	ENSG00000157873		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11912	protein-coding gene	gene with protein product	"""herpesvirus entry mediator"""	602746	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""			8898196, 9162061	Standard	XM_006711018		Approved	HVEM, ATAR, TR2, LIGHTR, HVEA, CD270	uc001ajt.1	Q92956	OTTHUMG00000000792	ENST00000355716.4:c.766G>C	1.37:g.2494626G>C	ENSP00000347948:p.Glu256Gln	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	65	13	0.2	NM_003820	B3KW30|B9DI89|Q6IB95|Q8N634|Q8WXR1|Q96J31|Q9UM65	Missense_Mutation	SNP	ENST00000355716.4	37	CCDS44046.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.662888	0.00772	.	.	ENSG00000157873	ENST00000355716	D	0.86865	-2.18	1.85	-0.23	0.13090	.	.	.	.	.	T	0.68384	0.2995	N	0.04508	-0.205	0.09310	N	1	B	0.24576	0.106	B	0.10450	0.005	T	0.54944	-0.8217	9	0.26408	T	0.33	1.2888	7.7934	0.29133	0.0:0.6123:0.3877:0.0	.	256	Q92956	TNR14_HUMAN	Q	256	ENSP00000347948:E256Q	ENSP00000347948:E256Q	E	+	1	0	TNFRSF14	2479792	0.011000	0.17503	0.000000	0.03702	0.002000	0.02628	0.441000	0.21611	-0.044000	0.13491	-0.304000	0.09214	GAG	.	.	none		0.627	TNFRSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002088.1		
TAS2R16	50833	hgsc.bcm.edu	37	7	122634960	122634960	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:122634960T>C	ENST00000249284.2	-	1	794	c.729A>G	c.(727-729)atA>atG	p.I243M		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	243					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGGTGATGAGTATGGTTAGAA	0.418																																					p.I243M		Atlas-SNP	.											.	TAS2R16	57	.	0			c.A729G						PASS	.						135.0	124.0	128.0					7																	122634960		2203	4300	6503	SO:0001583	missense	50833	exon1			GATGAGTATGGTT	AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.729A>G	7.37:g.122634960T>C	ENSP00000249284:p.Ile243Met	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	102	8	0.0784314	NM_016945	A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	ENST00000249284.2	37	CCDS5785.1	.	.	.	.	.	.	.	.	.	.	T	14.07	2.426121	0.43020	.	.	ENSG00000128519	ENST00000249284	T	0.38077	1.16	4.67	1.06	0.20224	.	1.003370	0.08035	N	0.994197	T	0.43144	0.1234	L	0.53249	1.67	0.09310	N	1	D	0.57571	0.98	P	0.54270	0.747	T	0.27262	-1.0079	10	0.39692	T	0.17	.	6.0768	0.19919	0.0:0.3142:0.0:0.6858	.	243	Q9NYV7	T2R16_HUMAN	M	243	ENSP00000249284:I243M	ENSP00000249284:I243M	I	-	3	3	TAS2R16	122422196	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	0.432000	0.21461	0.384000	0.24942	0.533000	0.62120	ATA	.	.	none		0.418	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347409.1	NM_016945	
CPEB1	64506	hgsc.bcm.edu	37	15	83218322	83218322	+	Silent	SNP	G	G	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr15:83218322G>T	ENST00000562019.1	-	9	1618	c.1302C>A	c.(1300-1302)gtC>gtA	p.V434V	CPEB1_ENST00000568128.1_Silent_p.V429V|RP11-152F13.10_ENST00000562833.1_Nonsense_Mutation_p.S164*|CPEB1_ENST00000423133.2_Silent_p.V354V|CPEB1_ENST00000568757.1_Silent_p.V354V|CPEB1_ENST00000563800.1_Silent_p.V456V|CPEB1_ENST00000261723.6_Silent_p.V432V|CPEB1_ENST00000398592.2_Silent_p.V203V|CPEB1_ENST00000564522.1_Silent_p.V354V|CPEB1_ENST00000398591.2_Silent_p.V359V|RP11-379H8.1_ENST00000568285.1_Intron|CPEB1_ENST00000450751.2_Silent_p.V354V			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1	434	Necessary for stress granule assembly and correct localization in dcp1 bodies.|RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.V359V(1)		breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			GCAGAGCACCGACAAACACCG	0.542																																					p.V429V		Atlas-SNP	.											CPEB1,colon,carcinoma,0,1	CPEB1	114	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C1287A						scavenged	.						73.0	73.0	73.0					15																	83218322		2022	4182	6204	SO:0001819	synonymous_variant	64506	exon9			AGCACCGACAAAC	AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.1302C>A	15.37:g.83218322G>T		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	85	2	0.0235294	NM_030594	B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Silent	SNP	ENST00000562019.1	37																																																																																				.	.	none		0.542	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000421102.1	NM_030594	
TMPRSS13	84000	hgsc.bcm.edu	37	11	117789317	117789317	+	Silent	SNP	T	T	C	rs201746372|rs58754377|rs201369736		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:117789317T>C	ENST00000430170.2	-	2	345	c.258A>G	c.(256-258)ccA>ccG	p.P86P	TMPRSS13_ENST00000524993.1_Silent_p.P86P|TMPRSS13_ENST00000445164.2_Silent_p.P86P|TMPRSS13_ENST00000526090.1_Silent_p.P86P|TMPRSS13_ENST00000528626.1_Silent_p.P86P	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	86	13 X 5 AA repeats of A-S-P-A-[GLQR].|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.Q83_A87delQASPA(1)		endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		ATGCCCGGGCTGGAGATGCCT	0.652																																					p.P86P		Atlas-SNP	.											TMPRSS13,caecum,carcinoma,0,1	TMPRSS13	75	1	1	Deletion - In frame(1)	urinary_tract(1)	c.A258G						scavenged	.						34.0	41.0	38.0					11																	117789317		1955	4135	6090	SO:0001819	synonymous_variant	84000	exon2			CCGGGCTGGAGAT	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.258A>G	11.37:g.117789317T>C		Somatic	57	1	0.0175439		WXS	Illumina HiSeq	Phase_I	56	4	0.0714286	NM_001206790	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Silent	SNP	ENST00000430170.2	37	CCDS58185.1																																																																																			.	.	weak		0.652	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
BTG2	7832	hgsc.bcm.edu	37	1	203276375	203276375	+	Silent	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:203276375C>T	ENST00000290551.4	+	2	357	c.286C>T	c.(286-288)Ctg>Ttg	p.L96L	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	96					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			GCACCAGCTGCTGCCCAGCGA	0.642																																					p.L96L		Atlas-SNP	.											.	BTG2	16	.	0			c.C286T						PASS	.						47.0	49.0	48.0					1																	203276375		2203	4300	6503	SO:0001819	synonymous_variant	7832	exon2			CAGCTGCTGCCCA		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.286C>T	1.37:g.203276375C>T		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	57	11	0.192982	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Silent	SNP	ENST00000290551.4	37	CCDS1437.1																																																																																			.	.	none		0.642	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
MAML3	55534	hgsc.bcm.edu	37	4	140811123	140811123	+	Silent	SNP	T	T	C	rs62344939		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr4:140811123T>C	ENST00000509479.2	-	2	2323	c.1467A>G	c.(1465-1467)caA>caG	p.Q489Q	MAML3_ENST00000398940.1_Silent_p.Q28Q|MAML3_ENST00000327122.5_Silent_p.Q333Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgttgctgttgct	0.547																																					p.Q489Q		Atlas-SNP	.											MAML3_ENST00000509479,colon,carcinoma,0,2	MAML3	192	2	0			c.A1467G						scavenged	.						17.0	20.0	19.0					4																	140811123		2193	4294	6487	SO:0001819	synonymous_variant	55534	exon2			CTGCTGTTGCTGT	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1467A>G	4.37:g.140811123T>C		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	44	5	0.113636	NM_018717		Silent	SNP	ENST00000509479.2	37	CCDS54805.1																																																																																			.	.	weak		0.547	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
MUC6	4588	hgsc.bcm.edu	37	11	1016849	1016849	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:1016849C>G	ENST00000421673.2	-	31	6002	c.5952G>C	c.(5950-5952)atG>atC	p.M1984I		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1984	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.M1984I(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATGTTGCAGTCATAGGACCTG	0.582																																					p.M1984I		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	2	Substitution - Missense(2)	lung(2)	c.G5952C						scavenged	.						1544.0	1533.0	1537.0					11																	1016849		2203	4298	6501	SO:0001583	missense	4588	exon31			TGCAGTCATAGGA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5952G>C	11.37:g.1016849C>G	ENSP00000406861:p.Met1984Ile	Somatic	557	24	0.043088		WXS	Illumina HiSeq	Phase_I	405	18	0.0444444	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	c	0.326	-0.959077	0.02267	.	.	ENSG00000184956	ENST00000421673	T	0.17691	2.26	2.64	-5.29	0.02747	.	.	.	.	.	T	0.09598	0.0236	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.27839	-1.0062	9	0.14656	T	0.56	.	1.5757	0.02624	0.1743:0.1847:0.3717:0.2692	.	1984	Q6W4X9	MUC6_HUMAN	I	1984	ENSP00000406861:M1984I	ENSP00000406861:M1984I	M	-	3	0	MUC6	1006849	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.496000	0.02291	-4.003000	0.00082	-2.547000	0.00178	ATG	.	.	none		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
CLCN6	1185	hgsc.bcm.edu	37	1	11879572	11879572	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:11879572C>T	ENST00000346436.6	+	5	359	c.307C>T	c.(307-309)Cga>Tga	p.R103*	CLCN6_ENST00000376496.3_Nonsense_Mutation_p.R103*|CLCN6_ENST00000376487.3_Nonsense_Mutation_p.R81*|CLCN6_ENST00000376497.3_Nonsense_Mutation_p.R103*|CLCN6_ENST00000312413.6_Nonsense_Mutation_p.R103*|CLCN6_ENST00000376492.3_3'UTR	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	103					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CTTTTTTGTGCGACTCTTCAC	0.463																																					p.R103X		Atlas-SNP	.											CLCN6,NS,carcinoma,-1,1	CLCN6	77	1	0			c.C307T						scavenged	.						297.0	249.0	266.0					1																	11879572		2203	4300	6503	SO:0001587	stop_gained	1185	exon5			TTTGTGCGACTCT	X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.307C>T	1.37:g.11879572C>T	ENSP00000234488:p.Arg103*	Somatic	96	1	0.0104167		WXS	Illumina HiSeq	Phase_I	98	7	0.0714286	NM_001286	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Nonsense_Mutation	SNP	ENST00000346436.6	37	CCDS138.1	.	.	.	.	.	.	.	.	.	.	C	35	5.418281	0.96092	.	.	ENSG00000011021	ENST00000312413;ENST00000346436;ENST00000376497;ENST00000376487;ENST00000376496;ENST00000376490;ENST00000376491;ENST00000376492	.	.	.	5.34	5.34	0.76211	.	0.222897	0.47852	D	0.000215	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-6.8753	18.3846	0.90463	0.0:1.0:0.0:0.0	.	.	.	.	X	103;103;103;81;103;103;103;103	.	ENSP00000308367:R103X	R	+	1	2	CLCN6	11802159	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.617000	0.67716	2.651000	0.90000	0.655000	0.94253	CGA	.	.	none		0.463	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	NM_001286	
KMT2C	58508	hgsc.bcm.edu	37	7	151962134	151962134	+	Nonsense_Mutation	SNP	G	G	T	rs146238849		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:151962134G>T	ENST00000262189.6	-	8	1391	c.1173C>A	c.(1171-1173)tgC>tgA	p.C391*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.C391*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	391					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C391*(2)									TGCAGTTCTGGCACACTTTGC	0.408																																					p.C391X		Atlas-SNP	.											MLL3_ENST00000355193,NS,malignant_melanoma,0,2	MLL3	1564	2	2	Substitution - Nonsense(2)	NS(2)	c.C1173A						scavenged	.						230.0	213.0	219.0					7																	151962134		2203	4297	6500	SO:0001587	stop_gained	58508	exon8			GTTCTGGCACACT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1173C>A	7.37:g.151962134G>T	ENSP00000262189:p.Cys391*	Somatic	138	1	0.00724638		WXS	Illumina HiSeq	Phase_I	140	5	0.0357143	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	39	7.887843	0.98545	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	4.53	3.62	0.41486	.	0.000000	0.45867	U	0.000330	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2395	0.54534	0.0835:0.0:0.9165:0.0	.	.	.	.	X	391	.	ENSP00000262189:C391X	C	-	3	2	MLL3	151593067	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.718000	0.74713	2.206000	0.71126	0.460000	0.39030	TGC	.	.	weak		0.408	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
BAZ1A	11177	hgsc.bcm.edu	37	14	35231204	35231204	+	Silent	SNP	A	A	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr14:35231204A>G	ENST00000382422.2	-	23	4329	c.4002T>C	c.(4000-4002)cgT>cgC	p.R1334R	BAZ1A_ENST00000358716.4_Silent_p.R1302R|BAZ1A_ENST00000360310.1_Silent_p.R1334R			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1334					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		GGCGAGTAGAACGACTGGCAA	0.423																																					p.R1334R		Atlas-SNP	.											.	BAZ1A	128	.	0			c.T4002C						PASS	.						188.0	179.0	182.0					14																	35231204		2203	4300	6503	SO:0001819	synonymous_variant	11177	exon24			AGTAGAACGACTG	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.4002T>C	14.37:g.35231204A>G		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	140	12	0.0857143	NM_013448	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Silent	SNP	ENST00000382422.2	37	CCDS9651.1																																																																																			.	.	none		0.423	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
CXCL3	2921	hgsc.bcm.edu	37	4	74904067	74904067	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr4:74904067T>C	ENST00000296026.4	-	2	241	c.164A>G	c.(163-165)aAg>aGg	p.K55R	CXCL3_ENST00000511669.1_5'UTR	NM_002090.2	NP_002081.2	P19876	CXCL3_HUMAN	chemokine (C-X-C motif) ligand 3	55					immune response (GO:0006955)|inflammatory response (GO:0006954)|neutrophil chemotaxis (GO:0030593)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			central_nervous_system(1)|endometrium(1)	2	Breast(15;0.00612)		all cancers(17;0.00273)|Lung(101;0.196)			TTGGATGTTCTTGAGGTGAAT	0.597																																					p.K55R		Atlas-SNP	.											.	CXCL3	9	.	0			c.A164G						PASS	.						93.0	101.0	98.0					4																	74904067		2203	4300	6503	SO:0001583	missense	2921	exon2			ATGTTCTTGAGGT	M36821	CCDS34007.1	4q21	2013-02-25	2002-08-22	2002-08-23		ENSG00000163734		"""Endogenous ligands"""	4604	protein-coding gene	gene with protein product		139111	"""GRO3 oncogene"""	GRO3		2217207	Standard	NM_002090		Approved	SCYB3, GROg, MIP-2b, CINC-2b	uc003hhl.3	P19876		ENST00000296026.4:c.164A>G	4.37:g.74904067T>C	ENSP00000296026:p.Lys55Arg	Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	155	14	0.0903226	NM_002090	Q4W5H9	Missense_Mutation	SNP	ENST00000296026.4	37	CCDS34007.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.946577	0.53186	.	.	ENSG00000163734	ENST00000296026	T	0.04406	3.63	3.45	0.597	0.17504	CXC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.477746	0.24341	N	0.039377	T	0.07728	0.0194	L	0.58583	1.82	0.09310	N	1	P	0.40066	0.701	P	0.50109	0.631	T	0.19844	-1.0293	10	0.23891	T	0.37	.	3.2866	0.06934	0.0:0.1382:0.2414:0.6204	.	55	P19876	CXCL3_HUMAN	R	55	ENSP00000296026:K55R	ENSP00000296026:K55R	K	-	2	0	CXCL3	75122931	0.014000	0.17966	0.064000	0.19789	0.282000	0.26991	0.231000	0.17872	0.355000	0.24131	0.254000	0.18369	AAG	.	.	none		0.597	CXCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362721.1		
ARAP1	116985	hgsc.bcm.edu	37	11	72397100	72397100	+	Missense_Mutation	SNP	G	G	T	rs371806185	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:72397100G>T	ENST00000393609.3	-	34	4524	c.4322C>A	c.(4321-4323)gCg>gAg	p.A1441E	ARAP1_ENST00000426523.1_Missense_Mutation_p.A1185E|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000455638.2_Missense_Mutation_p.A1430E|ARAP1_ENST00000334211.8_Missense_Mutation_p.A1196E|ARAP1_ENST00000429686.1_Missense_Mutation_p.A1124E|ARAP1_ENST00000393605.3_Missense_Mutation_p.A1201E|ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000359373.5_Missense_Mutation_p.A1430E	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1441					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						CAGAGGGTCCGCGGTGAAGGC	0.617																																					p.A1441E	Ovarian(102;1198 1520 13195 17913 37529)	Atlas-SNP	.											ARAP1_ENST00000393609,colon,carcinoma,0,4	ARAP1	168	4	0			c.C4322A						scavenged	.						42.0	50.0	47.0					11																	72397100		2199	4293	6492	SO:0001583	missense	116985	exon34			GGGTCCGCGGTGA	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.4322C>A	11.37:g.72397100G>T	ENSP00000377233:p.Ala1441Glu	Somatic	183	1	0.00546448		WXS	Illumina HiSeq	Phase_I	127	3	0.023622	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662630	0.67700	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686	T;T;T;T;T;T;T	0.06371	3.31;3.31;3.32;3.37;3.31;3.37;3.34	5.25	5.25	0.73442	.	0.562374	0.18019	N	0.154315	T	0.05273	0.0140	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.31054	0.259;0.22;0.082;0.306;0.253	B;B;B;B;B	0.37692	0.09;0.044;0.095;0.131;0.256	T	0.37197	-0.9716	10	0.87932	D	0	.	11.3285	0.49463	0.0842:0.0:0.9158:0.0	.	1185;1124;1430;1441;1201	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	E	1430;1430;1201;1196;1441;1185;1124	ENSP00000352332:A1430E;ENSP00000390461:A1430E;ENSP00000377230:A1201E;ENSP00000335506:A1196E;ENSP00000377233:A1441E;ENSP00000392264:A1185E;ENSP00000403127:A1124E	ENSP00000335506:A1196E	A	-	2	0	ARAP1	72074748	0.857000	0.29778	0.020000	0.16555	0.602000	0.36980	5.115000	0.64655	2.638000	0.89438	0.555000	0.69702	GCG	.	.	alt		0.617	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
PIK3C2G	5288	hgsc.bcm.edu	37	12	18691191	18691191	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:18691191G>A	ENST00000266497.5	+	23	3340	c.3302G>A	c.(3301-3303)cGt>cAt	p.R1101H	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.R1101H|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.R1142H			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1101	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)	p.R1101H(2)		breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				CTTTGCTGTCGTGCTTATAAT	0.373																																					p.R1101H		Atlas-SNP	.											PIK3C2G_ENST00000433979,colon,carcinoma,0,2	PIK3C2G	315	2	2	Substitution - Missense(2)	large_intestine(2)	c.G3302A						scavenged	.						79.0	76.0	77.0					12																	18691191		1807	4067	5874	SO:0001583	missense	5288	exon24			GCTGTCGTGCTTA	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3302G>A	12.37:g.18691191G>A	ENSP00000266497:p.Arg1101His	Somatic	109	1	0.00917431		WXS	Illumina HiSeq	Phase_I	110	15	0.136364	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.806365	0.31961	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.75821	-0.97;-0.97;-0.97	4.21	1.45	0.22620	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.650248	0.14461	N	0.318218	T	0.65048	0.2654	L	0.48935	1.535	0.39991	D	0.975043	B;B;B	0.21071	0.051;0.042;0.015	B;B;B	0.19391	0.025;0.014;0.015	T	0.61178	-0.7115	10	0.72032	D	0.01	-8.2819	7.7154	0.28702	0.339:0.0:0.661:0.0	.	1141;1142;1101	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	H	1101;1101;1142	ENSP00000404845:R1101H;ENSP00000266497:R1101H;ENSP00000445381:R1142H	ENSP00000266497:R1101H	R	+	2	0	PIK3C2G	18582458	1.000000	0.71417	0.999000	0.59377	0.933000	0.57130	2.304000	0.43655	0.346000	0.23899	-0.899000	0.02877	CGT	.	.	none		0.373	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
GP9	2815	hgsc.bcm.edu	37	3	128780664	128780664	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr3:128780664G>A	ENST00000307395.4	+	3	304	c.82G>A	c.(82-84)Gcc>Acc	p.A28T		NM_000174.3	NP_000165.1	P14770	GPIX_HUMAN	glycoprotein IX (platelet)	28	LRRNT.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|lung(4)	6					Quinine(DB00468)	TACCTGCCGCGCCCTGGAAAC	0.697																																					p.A28T		Atlas-SNP	.											GP9,colon,carcinoma,-1,1	GP9	10	1	0			c.G82A						scavenged	.						20.0	21.0	20.0					3																	128780664		2202	4296	6498	SO:0001583	missense	2815	exon3			TGCCGCGCCCTGG		CCDS3055.1	3q21.3	2014-09-17				ENSG00000169704		"""CD molecules"""	4444	protein-coding gene	gene with protein product		173515				2253772	Standard	XM_005247374		Approved	CD42a, GPIX	uc003elm.2	P14770		ENST00000307395.4:c.82G>A	3.37:g.128780664G>A	ENSP00000303942:p.Ala28Thr	Somatic	75	1	0.0133333		WXS	Illumina HiSeq	Phase_I	75	19	0.253333	NM_000174	Q14445|Q8N1D1|Q92525	Missense_Mutation	SNP	ENST00000307395.4	37	CCDS3055.1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.484390	0.01027	.	.	ENSG00000169704	ENST00000307395	T	0.79141	-1.24	4.17	-2.72	0.05968	Leucine-rich repeat-containing N-terminal (2);	0.533187	0.17413	N	0.175135	T	0.47820	0.1466	N	0.17474	0.49	0.09310	N	1	B	0.33000	0.393	B	0.22601	0.04	T	0.38693	-0.9649	10	0.29301	T	0.29	-0.5344	0.6074	0.00755	0.3136:0.2824:0.2313:0.1728	.	28	P14770	GPIX_HUMAN	T	28	ENSP00000303942:A28T	ENSP00000303942:A28T	A	+	1	0	GP9	130263354	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-2.698000	0.00826	-0.879000	0.04002	0.462000	0.41574	GCC	.	.	none		0.697	GP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358428.1		
COL4A5	1287	hgsc.bcm.edu	37	X	107923951	107923951	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chrX:107923951C>A	ENST00000361603.2	+	43	4211	c.3967C>A	c.(3967-3969)Cct>Act	p.P1323T	COL4A5_ENST00000328300.6_Missense_Mutation_p.P1329T	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1323	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GAAAGGAGATCCTGGTCTCCC	0.428									Alport syndrome with Diffuse Leiomyomatosis																												p.P1323T		Atlas-SNP	.											.	COL4A5	262	.	0			c.C3967A						PASS	.						89.0	84.0	86.0					X																	107923951		2203	4300	6503	SO:0001583	missense	1287	exon43	Familial Cancer Database		GGAGATCCTGGTC	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3967C>A	X.37:g.107923951C>A	ENSP00000354505:p.Pro1323Thr	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	102	22	0.215686	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.142734	0.37825	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.96651	-4.08;-4.08	5.32	4.43	0.53597	.	0.407150	0.28047	N	0.016807	D	0.94023	0.8085	M	0.63428	1.95	0.41880	D	0.990319	B;B	0.14012	0.009;0.004	B;B	0.11329	0.006;0.001	D	0.91307	0.5071	10	0.11794	T	0.64	.	14.5286	0.67909	0.1468:0.8532:0.0:0.0	.	1326;1323	E7EVY4;P29400	.;CO4A5_HUMAN	T	1329;1323;1329	ENSP00000331902:P1329T;ENSP00000354505:P1323T	ENSP00000331902:P1329T	P	+	1	0	COL4A5	107810607	0.883000	0.30277	1.000000	0.80357	0.993000	0.82548	1.094000	0.30951	2.212000	0.71576	0.523000	0.50628	CCT	.	.	none		0.428	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
SPEN	23013	hgsc.bcm.edu	37	1	16235856	16235856	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:16235856C>T	ENST00000375759.3	+	4	1126	c.922C>T	c.(922-924)Cga>Tga	p.R308*	snoU13_ENST00000459258.1_RNA	NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	308	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TTCTCCAGCTCGATCAGTTCA	0.443																																					p.R308X		Atlas-SNP	.											SPEN,NS,carcinoma,0,2	SPEN	374	2	0			c.C922T						PASS	.						147.0	147.0	147.0					1																	16235856		2203	4300	6503	SO:0001587	stop_gained	23013	exon4			CCAGCTCGATCAG		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.922C>T	1.37:g.16235856C>T	ENSP00000364912:p.Arg308*	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	96	23	0.239583	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154147	0.78114	.	.	ENSG00000065526	ENST00000375759;ENST00000438066;ENST00000375753	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.8431	17.6753	0.88229	0.0:1.0:0.0:0.0	.	.	.	.	X	308;267;267	.	ENSP00000364906:R267X	R	+	1	2	SPEN	16108443	0.997000	0.39634	0.999000	0.59377	0.826000	0.46750	3.632000	0.54287	2.615000	0.88500	0.655000	0.94253	CGA	.	.	none		0.443	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
DSEL	92126	hgsc.bcm.edu	37	18	65180409	65180409	+	Silent	SNP	G	G	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr18:65180409G>T	ENST00000310045.7	-	2	2940	c.1467C>A	c.(1465-1467)ccC>ccA	p.P489P	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	479					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				CTTGTCCATTGGGGGCAAAAG	0.423																																					p.P489P		Atlas-SNP	.											.	DSEL	196	.	0			c.C1467A						PASS	.						103.0	99.0	101.0					18																	65180409		2203	4300	6503	SO:0001819	synonymous_variant	92126	exon2			TCCATTGGGGGCA	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1467C>A	18.37:g.65180409G>T		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	113	11	0.0973451	NM_032160	Q17RH1|Q6P5Z3	Silent	SNP	ENST00000310045.7	37	CCDS11995.1																																																																																			.	.	none		0.423	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
HLA-DRB1	3123	hgsc.bcm.edu	37	6	32557461	32557461	+	Missense_Mutation	SNP	A	A	G	rs35053532	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr6:32557461A>G	ENST00000360004.5	-	1	164	c.59T>C	c.(58-60)aTg>aCg	p.M20T		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	20					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GCTCAGCACCATCAGTGTCAC	0.572										Multiple Myeloma(14;0.17)																											p.M20T		Atlas-SNP	.											HLA-DRB1,NS,carcinoma,0,1	HLA-DRB1	41	1	0			c.T59C						scavenged	.						83.0	99.0	93.0					6																	32557461		1511	2709	4220	SO:0001583	missense	3123	exon1			AGCACCATCAGTG	AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.59T>C	6.37:g.32557461A>G	ENSP00000353099:p.Met20Thr	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	99	4	0.040404	NM_002124	P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	.	.	.	.	.	.	.	.	.	.	.	4.424	0.078455	0.08533	.	.	ENSG00000196126	ENST00000360004	T	0.00253	8.43	4.4	2.05	0.26809	MHC classes I/II-like antigen recognition protein (1);	1.753860	0.02864	N	0.130685	T	0.00073	0.0002	L	0.51422	1.61	0.09310	N	0.999999	B	0.20887	0.049	B	0.21360	0.034	T	0.43097	-0.9412	10	0.59425	D	0.04	.	5.3115	0.15833	0.7604:0.0:0.2396:0.0	rs35053532	20	P01911	2B1F_HUMAN	T	20	ENSP00000353099:M20T	ENSP00000353099:M20T	M	-	2	0	HLA-DRB1	32665439	0.226000	0.23696	0.380000	0.26093	0.101000	0.19017	1.241000	0.32743	0.270000	0.21984	0.379000	0.24179	ATG	A|0.986;G|0.013	0.013	strong		0.572	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
SPATA31C1	441452	hgsc.bcm.edu	37	9	90534206	90534206	+	RNA	SNP	T	T	C	rs2481989		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr9:90534206T>C	ENST00000602681.1	+	0	952							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGTCTCCCAGTGTCCAACAGG	0.582																																					p.C76R		Atlas-SNP	.											.	.	.	.	0			c.T226C						PASS	.						153.0	124.0	133.0					9																	90534206		692	1591	2283			441452	exon2			TCCCAGTGTCCAA	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90534206T>C		Somatic	225	0	0		WXS	Illumina HiSeq	Phase_I	195	17	0.0871795	NM_001145124		Missense_Mutation	SNP	ENST00000602681.1	37																																																																																				.	.	weak		0.582	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
POTEG	404785	hgsc.bcm.edu	37	14	19553571	19553571	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr14:19553571C>A	ENST00000409832.3	+	1	207	c.155C>A	c.(154-156)tCt>tAt	p.S52Y		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	52								p.S52F(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						CACGACGATTCTGCTATGAAG	0.612																																					p.S52Y		Atlas-SNP	.											POTEG,NS,carcinoma,0,1	POTEG	118	1	1	Substitution - Missense(1)	cervix(1)	c.C155A						scavenged	.						103.0	143.0	129.0					14																	19553571		2198	4286	6484	SO:0001583	missense	404785	exon1			ACGATTCTGCTAT		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.155C>A	14.37:g.19553571C>A	ENSP00000386971:p.Ser52Tyr	Somatic	681	3	0.00440529		WXS	Illumina HiSeq	Phase_I	541	13	0.0240296	NM_001005356	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	c	9.049	0.991636	0.18966	.	.	ENSG00000222036	ENST00000409832	T	0.38077	1.16	.	.	.	.	.	.	.	.	T	0.48223	0.1488	L	0.50333	1.59	0.09310	N	1	D	0.71674	0.998	D	0.80764	0.994	T	0.30995	-0.9959	7	0.87932	D	0	.	.	.	.	.	52	Q6S5H5	POTEG_HUMAN	Y	52	ENSP00000386971:S52Y	ENSP00000386971:S52Y	S	+	2	0	POTEG	18623571	0.001000	0.12720	0.005000	0.12908	0.005000	0.04900	0.411000	0.21115	0.162000	0.19483	0.165000	0.16767	TCT	.	.	none		0.612	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356	
FRG2B	441581	hgsc.bcm.edu	37	10	135438933	135438933	+	Silent	SNP	C	C	T	rs200793608		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr10:135438933C>T	ENST00000425520.1	-	4	559	c.507G>A	c.(505-507)ccG>ccA	p.P169P	FRG2B_ENST00000443774.1_Silent_p.P170P	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	169						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTCGAATTGACGGTGTTTGGA	0.552																																					p.P169P		Atlas-SNP	.											FRG2B,colon,carcinoma,-1,1	FRG2B	47	1	0			c.G507A						scavenged	.						126.0	151.0	143.0					10																	135438933		2193	4291	6484	SO:0001819	synonymous_variant	441581	exon4			AATTGACGGTGTT	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.507G>A	10.37:g.135438933C>T		Somatic	289	1	0.00346021		WXS	Illumina HiSeq	Phase_I	223	5	0.0224215	NM_001080998	Q5VSQ1	Silent	SNP	ENST00000425520.1	37	CCDS44502.1																																																																																			C|0.996;T|0.004	0.004	weak		0.552	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
ZDHHC17	23390	hgsc.bcm.edu	37	12	77242136	77242136	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:77242136G>T	ENST00000426126.2	+	15	2280	c.1631G>T	c.(1630-1632)tGg>tTg	p.W544L	ZDHHC17_ENST00000334822.5_Missense_Mutation_p.W544L|ZDHHC17_ENST00000550789.1_3'UTR	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	544					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						CACTTCATGTGGGTGGCTGTA	0.403																																					p.W544L		Atlas-SNP	.											.	ZDHHC17	45	.	0			c.G1631T						PASS	.						205.0	200.0	202.0					12																	77242136		2005	4162	6167	SO:0001583	missense	23390	exon15			TCATGTGGGTGGC	AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.1631G>T	12.37:g.77242136G>T	ENSP00000403397:p.Trp544Leu	Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	90	4	0.0444444	NM_015336	B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Missense_Mutation	SNP	ENST00000426126.2	37	CCDS44946.1	.	.	.	.	.	.	.	.	.	.	G	35	5.460578	0.96240	.	.	ENSG00000186908	ENST00000426126;ENST00000334822	T;T	0.20463	2.07;2.07	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.44414	0.1292	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.28902	-1.0029	10	0.87932	D	0	-5.0867	19.5662	0.95393	0.0:0.0:1.0:0.0	.	544	Q8IUH5	ZDH17_HUMAN	L	544	ENSP00000403397:W544L;ENSP00000334868:W544L	ENSP00000334868:W544L	W	+	2	0	ZDHHC17	75766267	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.608000	0.88229	0.655000	0.94253	TGG	.	.	none		0.403	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406555.1	NM_015336	
UPF3A	65110	hgsc.bcm.edu	37	13	115047496	115047496	+	Splice_Site	SNP	G	G	C	rs76186578		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr13:115047496G>C	ENST00000375299.3	+	2	264	c.208G>C	c.(208-210)Gtg>Ctg	p.V70L	UPF3A_ENST00000351487.5_Splice_Site_p.V70L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	70	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.V70L(4)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		CTCCCCGCAGGTGGTCATCCG	0.731																																					p.V70L		Atlas-SNP	.											UPF3A,extremity,malignant_melanoma,0,3	UPF3A	47	3	4	Substitution - Missense(4)	skin(2)|upper_aerodigestive_tract(1)|lung(1)	c.G208C						scavenged	.						3.0	3.0	3.0					13																	115047496		1806	3727	5533	SO:0001630	splice_region_variant	65110	exon2			CCGCAGGTGGTCA	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.208-1G>C	13.37:g.115047496G>C		Somatic	34	2	0.0588235		WXS	Illumina HiSeq	Phase_I	23	7	0.304348	NM_080687	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Missense_Mutation	SNP	ENST00000375299.3	37	CCDS9543.1	.	.	.	.	.	.	.	.	.	.	g	24.7	4.562889	0.86335	.	.	ENSG00000169062	ENST00000375299;ENST00000351487	T;T	0.69806	-0.43;-0.43	4.77	4.77	0.60923	Regulator of nonsense-mediated decay, UPF3 (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.79167	0.4400	L	0.58354	1.805	0.80722	D	1	D;D;D	0.89917	0.988;1.0;0.997	D;D;D	0.80764	0.951;0.994;0.991	T	0.78492	-0.2183	9	.	.	.	-20.8011	18.2246	0.89913	0.0:0.0:1.0:0.0	.	70;70;70	B4DGE0;Q9H1J1-2;Q9H1J1	.;.;REN3A_HUMAN	L	70	ENSP00000364448:V70L;ENSP00000329592:V70L	.	V	+	1	0	UPF3A	114065598	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	6.880000	0.75578	2.371000	0.80710	0.473000	0.43528	GTG	.	.	weak		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		Missense_Mutation
FOXD4L1	200350	hgsc.bcm.edu	37	2	114257354	114257354	+	Missense_Mutation	SNP	A	A	G	rs202243377	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr2:114257354A>G	ENST00000306507.5	+	1	694	c.521A>G	c.(520-522)cAc>cGc	p.H174R		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	174					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						GAGCCGGGCCACCCAGGCAAG	0.632													.|||	294	0.0587061	0.0091	0.0908	5008	,	,		10222	0.1776		0.0139	False		,,,				2504	0.0266				p.H174R		Atlas-SNP	.											FOXD4L1,NS,carcinoma,0,1	FOXD4L1	48	1	0			c.A521G						scavenged	.						75.0	97.0	89.0					2																	114257354		2141	4139	6280	SO:0001583	missense	200350	exon1			CGGGCCACCCAGG	AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.521A>G	2.37:g.114257354A>G	ENSP00000302756:p.His174Arg	Somatic	92	2	0.0217391		WXS	Illumina HiSeq	Phase_I	92	6	0.0652174	NM_012184	B3KWN1|B9EGF3	Missense_Mutation	SNP	ENST00000306507.5	37	CCDS2117.1	.	.	.	.	.	.	.	.	.	.	.	11.09	1.536728	0.27475	.	.	ENSG00000184492	ENST00000306507	D	0.95069	-3.6	2.57	2.57	0.30868	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.35739	U	0.003002	T	0.78426	0.4281	N	0.00471	-1.455	0.41757	D	0.989692	B	0.14012	0.009	B	0.15052	0.012	T	0.71768	-0.4493	10	0.24483	T	0.36	.	8.6531	0.34046	1.0:0.0:0.0:0.0	.	174	Q9NU39	FX4L1_HUMAN	R	174	ENSP00000302756:H174R	ENSP00000302756:H174R	H	+	2	0	FOXD4L1	113973824	0.878000	0.30173	1.000000	0.80357	0.878000	0.50629	5.717000	0.68446	1.190000	0.43042	0.155000	0.16302	CAC	A|0.999;G|0.001	0.001	weak		0.632	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254148.1	NM_012184	
TUBB8	347688	hgsc.bcm.edu	37	10	95167	95167	+	Silent	SNP	G	G	A	rs202227666	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr10:95167G>A	ENST00000309812.4	-	1	74	c.12C>T	c.(10-12)atC>atT	p.I4I	TUBB8_ENST00000447903.2_Intron|TUBB8_ENST00000413237.3_Intron|TUBB8_ENST00000332708.5_Silent_p.I4I	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	4					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GCGTGAGCACGATCTCCCTCA	0.667																																					p.I4I	Pancreas(192;2041 3010 9013 18103)	Atlas-SNP	.											TUBB8,colon,carcinoma,-2,2	TUBB8	62	2	0			c.C12T						scavenged	.						18.0	17.0	17.0					10																	95167		2197	4294	6491	SO:0001819	synonymous_variant	347688	exon1			GAGCACGATCTCC	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.12C>T	10.37:g.95167G>A		Somatic	99	4	0.040404		WXS	Illumina HiSeq	Phase_I	108	4	0.037037	NM_177987	Q5SQX9|Q8WZ78	Silent	SNP	ENST00000309812.4	37	CCDS7051.1																																																																																			G|0.980;A|0.019	0.019	strong		0.667	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
OR2T4	127074	hgsc.bcm.edu	37	1	248525639	248525639	+	Missense_Mutation	SNP	A	A	C	rs34079073|rs76878172	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:248525639A>C	ENST00000366475.1	+	1	757	c.757A>C	c.(757-759)Atc>Ctc	p.I253L		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTATTTACTCATCCTCCTCAC	0.522																																					p.I253L		Atlas-SNP	.											OR2T4,brain,glioma,0,1	OR2T4	126	1	0			c.A757C						scavenged	.						94.0	74.0	81.0					1																	248525639		2024	3426	5450	SO:0001583	missense	127074	exon1			TTACTCATCCTCC	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.757A>C	1.37:g.248525639A>C	ENSP00000355431:p.Ile253Leu	Somatic	321	4	0.0124611		WXS	Illumina HiSeq	Phase_I	311	12	0.0385852	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	A	13.74	2.326339	0.41197	.	.	ENSG00000196944	ENST00000366475	T	0.00392	7.58	3.09	3.09	0.35607	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000219	T	0.01156	0.0038	H	0.94306	3.52	0.31855	N	0.621781	P	0.50156	0.932	P	0.59948	0.866	T	0.00865	-1.1535	10	0.72032	D	0.01	.	11.1471	0.48436	1.0:0.0:0.0:0.0	.	253	Q8NH00	OR2T4_HUMAN	L	253	ENSP00000355431:I253L	ENSP00000355431:I253L	I	+	1	0	OR2T4	246592262	1.000000	0.71417	0.050000	0.19076	0.010000	0.07245	7.329000	0.79170	1.264000	0.44198	0.477000	0.44152	ATC	.	.	alt		0.522	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
HOMEZ	57594	hgsc.bcm.edu	37	14	23744829	23744829	+	Silent	SNP	C	C	T	rs79723196|rs35076736|rs67447855	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr14:23744829C>T	ENST00000357460.5	-	2	1772	c.1608G>A	c.(1606-1608)gaG>gaA	p.E536E	HOMEZ_ENST00000431326.2_Silent_p.E538E|HOMEZ_ENST00000561013.1_Silent_p.E538E	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	536	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		catcatcttcctcctcctcct	0.483													C|||	22	0.00439297	0.0045	0.0058	5008	,	,		18800	0.001		0.0099	False		,,,				2504	0.001				p.E536E		Atlas-SNP	.											.	HOMEZ	80	.	0			c.G1608A						PASS	.						32.0	32.0	32.0					14																	23744829		2132	4146	6278	SO:0001819	synonymous_variant	57594	exon2			ATCTTCCTCCTCC	AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.1608G>A	14.37:g.23744829C>T		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	31	4	0.129032	NM_020834	A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Silent	SNP	ENST00000357460.5	37	CCDS45085.1																																																																																			.	.	weak		0.483	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000416939.2	NM_020834	
EBF1	1879	hgsc.bcm.edu	37	5	158267047	158267047	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr5:158267047C>A	ENST00000313708.6	-	7	908	c.626G>T	c.(625-627)cGg>cTg	p.R209L	EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Missense_Mutation_p.R186L|EBF1_ENST00000517373.1_Missense_Mutation_p.R209L	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	209					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGGAATCTCCGCATGTCACG	0.388			T	HMGA2	lipoma																																p.R209L		Atlas-SNP	.		Dom	yes		5	5q34	1879	early B-cell factor 1		M	EBF1,colon,carcinoma,-1,1	EBF1	110	1	0			c.G626T						PASS	.						115.0	122.0	119.0					5																	158267047		2203	4300	6503	SO:0001583	missense	1879	exon7			AATCTCCGCATGT	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.626G>T	5.37:g.158267047C>A	ENSP00000322898:p.Arg209Leu	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	127	21	0.165354	NM_024007	Q8IW11	Missense_Mutation	SNP	ENST00000313708.6	37	CCDS4343.1	.	.	.	.	.	.	.	.	.	.	C	30	5.056361	0.93793	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	T;T;T	0.60171	0.21;0.46;0.36	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.77398	0.4124	M	0.75884	2.315	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.994;0.972;0.998;0.999	T	0.79897	-0.1609	10	0.87932	D	0	-5.0542	19.1382	0.93436	0.0:1.0:0.0:0.0	.	209;195;209;186	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	L	209;209;186;209	ENSP00000322898:R209L;ENSP00000370029:R186L;ENSP00000428020:R209L	ENSP00000322898:R209L	R	-	2	0	EBF1	158199625	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.277000	0.78572	2.505000	0.84491	0.655000	0.94253	CGG	.	.	none		0.388	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007	
HLA-A	3105	hgsc.bcm.edu	37	6	29911239	29911239	+	Silent	SNP	T	T	C	rs9260155	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr6:29911239T>C	ENST00000396634.1	+	5	879	c.538T>C	c.(538-540)Ttg>Ctg	p.L180L	HLA-A_ENST00000376806.5_Silent_p.L180L|HLA-A_ENST00000376802.2_Silent_p.L180L|HLA-A_ENST00000376809.5_Silent_p.L180L			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	180	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GGCGGAGCAGTTGAGAGCCTA	0.662									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			N|||	1927	0.384784	0.1982	0.3487	5008	,	,		12044	0.5397		0.3489	False		,,,				2504	0.5399				p.L180L		Atlas-SNP	.											HLA-A,mouth,carcinoma,-1,1	HLA-A	89	1	0			c.T538C						scavenged	.						40.0	29.0	33.0					6																	29911239		1509	2697	4206	SO:0001819	synonymous_variant	3105	exon3	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	GAGCAGTTGAGAG	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.538T>C	6.37:g.29911239T>C		Somatic	109	11	0.100917		WXS	Illumina HiSeq	Phase_I	81	14	0.17284	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	ENST00000396634.1	37	CCDS34373.1																																																																																			C|0.290;T|0.710	0.290	strong		0.662	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
CCDC170	80129	hgsc.bcm.edu	37	6	151914338	151914338	+	Nonsense_Mutation	SNP	C	C	T	rs201819308		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr6:151914338C>T	ENST00000239374.7	+	8	1489	c.1390C>T	c.(1390-1392)Cga>Tga	p.R464*	CCDC170_ENST00000367290.5_Nonsense_Mutation_p.R464*	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	464																	GGTTTTAGCTCGAACAGAGCA	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		18393	0.0		0.001	False		,,,				2504	0.0				p.R464X		Atlas-SNP	.											.	.	.	.	0			c.C1390T						PASS	.	C	stop/ARG	0,3844		0,0,1922	96.0	90.0	92.0		1390	5.7	1.0	6		92	3,8273		0,3,4135	yes	stop-gained	C6orf97	NM_025059.3		0,3,6057	TT,TC,CC		0.0362,0.0,0.0248		464/716	151914338	3,12117	1922	4138	6060	SO:0001587	stop_gained	80129	exon8			TTAGCTCGAACAG	AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.1390C>T	6.37:g.151914338C>T	ENSP00000239374:p.Arg464*	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	62	8	0.129032	NM_025059	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Nonsense_Mutation	SNP	ENST00000239374.7	37	CCDS43515.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	40	8.013174	0.98610	0.0	3.62E-4	ENSG00000120262	ENST00000239374;ENST00000367290	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.6122	20.2602	0.98440	0.0:1.0:0.0:0.0	.	.	.	.	X	464	.	ENSP00000239374:R464X	R	+	1	2	C6orf97	151956031	1.000000	0.71417	1.000000	0.80357	0.512000	0.34134	3.649000	0.54417	2.861000	0.98227	0.655000	0.94253	CGA	C|1.000;T|0.000	0.000	strong		0.443	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042727.2	NM_025059	
BAZ2A	11176	hgsc.bcm.edu	37	12	56992706	56992706	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:56992706A>C	ENST00000551812.1	-	28	5691	c.5498T>G	c.(5497-5499)aTc>aGc	p.I1833S	BAZ2A_ENST00000379441.3_Missense_Mutation_p.I1803S|BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000179765.5_Missense_Mutation_p.I1801S|BAZ2A_ENST00000549884.1_Missense_Mutation_p.I1831S	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1833	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						ATTTTTGATGATGCGCCGGTA	0.532																																					p.I1833S		Atlas-SNP	.											.	BAZ2A	263	.	0			c.T5498G						PASS	.						28.0	30.0	30.0					12																	56992706		1892	4125	6017	SO:0001583	missense	11176	exon28			TTGATGATGCGCC	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.5498T>G	12.37:g.56992706A>C	ENSP00000446880:p.Ile1833Ser	Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	35	5	0.142857	NM_013449	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	37	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	A	19.37	3.815359	0.70912	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2	5.81	5.81	0.92471	Bromodomain (6);Bromodomain, conserved site (1);	0.117336	0.53938	D	0.000055	T	0.67363	0.2885	H	0.97564	4.03	0.58432	D	0.999999	P;P;P;P	0.49783	0.879;0.609;0.661;0.928	P;P;P;P	0.52343	0.572;0.521;0.653;0.696	T	0.80049	-0.1545	10	0.87932	D	0	-8.6423	15.5128	0.75798	1.0:0.0:0.0:0.0	.	1831;1829;1833;1806	F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.;.;BAZ2A_HUMAN;.	S	1803;1801;1833;765;1831	ENSP00000368754:I1803S;ENSP00000179765:I1801S;ENSP00000446880:I1833S;ENSP00000448760:I765S;ENSP00000447941:I1831S	ENSP00000179765:I1801S	I	-	2	0	BAZ2A	55278973	1.000000	0.71417	0.992000	0.48379	0.918000	0.54935	8.604000	0.90877	2.367000	0.80283	0.529000	0.55759	ATC	.	.	none		0.532	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
IQCJ	654502	hgsc.bcm.edu	37	3	158980510	158980510	+	Intron	SNP	C	C	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr3:158980510C>A	ENST00000451172.1	+	4	396				IQCJ-SCHIP1_ENST00000467442.1_Intron|IQCJ-SCHIP1_ENST00000485419.1_Intron|IQCJ_ENST00000397832.2_Missense_Mutation_p.T110K|IQCJ_ENST00000482126.1_Intron|IQCJ-SCHIP1_ENST00000476809.1_Intron	NM_001042705.2	NP_001036170.1	Q1A5X6	IQCJ_HUMAN	IQ motif containing J											cervix(1)|endometrium(2)|large_intestine(2)|lung(10)	15			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			CCTGACTTGACATTCAACTGA	0.458																																					p.T110K		Atlas-SNP	.											.	IQCJ	28	.	0			c.C329A						PASS	.						109.0	103.0	105.0					3																	158980510		1953	4159	6112	SO:0001627	intron_variant	654502	exon4			ACTTGACATTCAA	DQ309553, DQ309554	CCDS46946.1, CCDS46947.1, CCDS56290.1	3q25.32	2011-03-24			ENSG00000214216	ENSG00000214216			32406	protein-coding gene	gene with protein product		611622				17045569	Standard	NM_001042705		Approved			Q1A5X6	OTTHUMG00000166440	ENST00000451172.1:c.291+38C>A	3.37:g.158980510C>A		Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	109	9	0.0825688	NM_001042706	B7ZMM2|B9EH97|Q1A5X5	Missense_Mutation	SNP	ENST00000451172.1	37	CCDS46946.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.514430	0.27123	.	.	ENSG00000214216	ENST00000397832	.	.	.	4.84	2.84	0.33178	.	.	.	.	.	T	0.27798	0.0684	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15867	-1.0422	6	.	.	.	.	10.9941	0.47565	0.4198:0.5802:0.0:0.0	.	110	Q1A5X6-2	.	K	110	.	.	T	+	2	0	IQCJ	160463204	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-0.252000	0.08806	1.102000	0.41551	0.655000	0.94253	ACA	.	.	none		0.458	IQCJ-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352395.1	NM_001042705.1	
SLC25A31	83447	hgsc.bcm.edu	37	4	128651717	128651717	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr4:128651717C>T	ENST00000281154.4	+	1	185	c.17C>T	c.(16-18)gCg>gTg	p.A6V		NM_031291.2	NP_112581.1	Q9H0C2	ADT4_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31	6					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|nucleus (GO:0005634)	transporter activity (GO:0005215)			NS(1)|breast(1)|large_intestine(10)|lung(8)|skin(2)	22						CGTGAGCCTGCGAAAAAGAAG	0.552																																					p.A6V		Atlas-SNP	.											SLC25A31,NS,neuroblastoma,0,2	SLC25A31	42	2	0			c.C17T						scavenged	.						54.0	49.0	51.0					4																	128651717		2203	4300	6503	SO:0001583	missense	83447	exon1			AGCCTGCGAAAAA	AL136857	CCDS3733.1	4q28	2013-05-22			ENSG00000151475	ENSG00000151475		"""Solute carriers"""	25319	protein-coding gene	gene with protein product		610796				15670820	Standard	NM_031291		Approved	DKFZP434N1235, ANT4	uc003ifl.3	Q9H0C2	OTTHUMG00000133300	ENST00000281154.4:c.17C>T	4.37:g.128651717C>T	ENSP00000281154:p.Ala6Val	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	132	5	0.0378788	NM_031291		Missense_Mutation	SNP	ENST00000281154.4	37	CCDS3733.1	.	.	.	.	.	.	.	.	.	.	C	10.34	1.324136	0.24080	.	.	ENSG00000151475	ENST00000281154	T	0.79749	-1.3	4.38	-0.889	0.10580	.	2.940760	0.01033	N	0.004178	T	0.64702	0.2622	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.06405	0.002	T	0.52275	-0.8597	10	0.18276	T	0.48	-5.9173	11.0833	0.48072	0.1325:0.2524:0.6152:0.0	.	6	Q9H0C2	ADT4_HUMAN	V	6	ENSP00000281154:A6V	ENSP00000281154:A6V	A	+	2	0	SLC25A31	128871167	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.094000	0.15107	-0.344000	0.08338	-0.211000	0.12701	GCG	.	.	none		0.552	SLC25A31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257094.2	NM_031291	
DND1	373863	hgsc.bcm.edu	37	5	140050894	140050894	+	Missense_Mutation	SNP	G	G	C	rs201638404		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr5:140050894G>C	ENST00000542735.1	-	4	1089	c.1046C>G	c.(1045-1047)aCc>aGc	p.T349S	WDR55_ENST00000520764.1_3'UTR|WDR55_ENST00000358337.5_3'UTR	NM_194249.2	NP_919225.1	Q8IYX4	DND1_HUMAN	DND microRNA-mediated repression inhibitor 1	349					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of gene silencing by miRNA (GO:0060965)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			central_nervous_system(1)|prostate(4)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTAACCATGGTACCTGCCTC	0.602																																					p.T349S		Atlas-SNP	.											DND1,NS,carcinoma,-1,1	DND1	15	1	0			c.C1046G						scavenged	.						75.0	61.0	66.0					5																	140050894		1959	3964	5923	SO:0001583	missense	373863	exon4			ACCATGGTACCTG	AY321065	CCDS4236.1	5q31.3	2013-07-31	2013-07-31		ENSG00000256453	ENSG00000256453		"""RNA binding motif (RRM) containing"""	23799	protein-coding gene	gene with protein product		609385	"""dead end homolog 1 (zebrafish)"""			12932328	Standard	NM_194249		Approved	MGC34750, RBMS4	uc003lgt.3	Q8IYX4	OTTHUMG00000129499	ENST00000542735.1:c.1046C>G	5.37:g.140050894G>C	ENSP00000445366:p.Thr349Ser	Somatic	323	7	0.0216718		WXS	Illumina HiSeq	Phase_I	228	10	0.0438596	NM_194249		Missense_Mutation	SNP	ENST00000542735.1	37	CCDS4236.1	.	.	.	.	.	.	.	.	.	.	G	9.262	1.043394	0.19748	.	.	ENSG00000256453	ENST00000542735	T	0.30182	1.54	4.97	0.117	0.14652	.	1.006470	0.07994	N	0.987573	T	0.16769	0.0403	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29518	-1.0009	10	0.27082	T	0.32	0.0017	3.9136	0.09213	0.3271:0.0:0.5115:0.1614	.	349	Q8IYX4	DND1_HUMAN	S	349	ENSP00000445366:T349S	ENSP00000445366:T349S	T	-	2	0	DND1	140031078	0.002000	0.14202	0.000000	0.03702	0.312000	0.27988	0.583000	0.23849	0.101000	0.17610	0.551000	0.68910	ACC	G|0.979;C|0.021	0.021	strong		0.602	DND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251669.2	NM_194249	
MST1L	11223	hgsc.bcm.edu	37	1	17085452	17085452	+	RNA	SNP	A	A	G	rs3981980		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:17085452A>G	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										GAGCGGGAGCAAAATCGTGGC	0.617																																					p.F413F		Atlas-SNP	.											Q13209_HUMAN,NS,carcinoma,0,1	.	.	1	0			c.T1239C						scavenged	.																																					11223	exon10			GGGAGCAAAATCG	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085452A>G		Somatic	240	5	0.0208333		WXS	Illumina HiSeq	Phase_I	189	4	0.021164	NM_001271733	B7WPB1|Q13209	Silent	SNP	ENST00000455405.2	37																																																																																				A|1.000;|0.000	.	weak		0.617	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733	
FAM153B	202134	hgsc.bcm.edu	37	5	175528119	175528119	+	Splice_Site	SNP	T	T	C	rs199710353		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr5:175528119T>C	ENST00000253490.4	+	11	689	c.632T>C	c.(631-633)aTg>aCg	p.M211T	FAM153B_ENST00000510151.1_Splice_Site_p.M134T|FAM153B_ENST00000512862.1_Intron|FAM153B_ENST00000515817.1_Splice_Site_p.M134T			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	211								p.M211T(4)		endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		GAAGTTCACATGGTAAAGTCG	0.433													N|||	1	0.000199681	0.0	0.0014	5008	,	,		30376	0.0		0.0	False		,,,				2504	0.0				p.M134T		Atlas-SNP	.											FAM153B,NS,carcinoma,0,4	FAM153B	28	4	4	Substitution - Missense(4)	endometrium(3)|kidney(1)	c.T401C						scavenged	.						258.0	307.0	289.0					5																	175528119		1510	2708	4218	SO:0001630	splice_region_variant	202134	exon10			TTCACATGGTAAA	AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.633+1T>C	5.37:g.175528119T>C		Somatic	431	3	0.00696056		WXS	Illumina HiSeq	Phase_I	369	7	0.0189702	NM_001265615	A8MTI1	Missense_Mutation	SNP	ENST00000253490.4	37		.	.	.	.	.	.	.	.	.	.	T	0.008	-1.861446	0.00552	.	.	ENSG00000182230	ENST00000515817;ENST00000253490	.	.	.	0.917	-0.575	0.11734	.	.	.	.	.	T	0.20292	0.0488	N	0.24115	0.695	0.09310	N	1	B	0.33528	0.416	B	0.35470	0.203	T	0.18618	-1.0331	8	0.35671	T	0.21	.	2.9058	0.05720	0.5811:0.0:0.0:0.4189	.	211	P0C7A2	F153B_HUMAN	T	134;211	.	ENSP00000253490:M211T	M	+	2	0	FAM153B	175460725	0.015000	0.18098	0.001000	0.08648	0.003000	0.03518	-0.418000	0.07080	-0.147000	0.11254	-0.935000	0.02700	ATG	T|0.500;C|0.500	0.500	weak		0.433	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001079529	Missense_Mutation
OR1L4	254973	hgsc.bcm.edu	37	9	125486717	125486717	+	Missense_Mutation	SNP	G	G	A	rs76170289		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr9:125486717G>A	ENST00000259466.1	+	1	449	c.449G>A	c.(448-450)tGc>tAc	p.C150Y		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						TTGGGTTCTTGCAGCATCTCC	0.502																																					p.C150Y		Atlas-SNP	.											OR1L4,right_upper_lobe,carcinoma,-1,1	OR1L4	38	1	0			c.G449A						scavenged	.						230.0	184.0	199.0					9																	125486717		2203	4300	6503	SO:0001583	missense	254973	exon1			GTTCTTGCAGCAT		CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.449G>A	9.37:g.125486717G>A	ENSP00000259466:p.Cys150Tyr	Somatic	94	4	0.0425532		WXS	Illumina HiSeq	Phase_I	76	11	0.144737	NM_001005235	Q6IFN0|Q96R81	Missense_Mutation	SNP	ENST00000259466.1	37	CCDS35129.1	.	.	.	.	.	.	.	.	.	.	.	13.85	2.359846	0.41801	.	.	ENSG00000136939	ENST00000259466	T	0.35605	1.3	4.01	3.06	0.35304	GPCR, rhodopsin-like superfamily (1);	0.102403	0.44483	D	0.000453	T	0.26521	0.0648	N	0.01146	-0.985	0.37012	D	0.89577	D	0.89917	1.0	D	0.91635	0.999	T	0.43621	-0.9380	10	0.72032	D	0.01	-25.1842	7.3285	0.26569	0.0988:0.1739:0.7273:0.0	.	150	Q8NGR5	OR1L4_HUMAN	Y	150	ENSP00000259466:C150Y	ENSP00000259466:C150Y	C	+	2	0	OR1L4	124526538	0.027000	0.19231	1.000000	0.80357	0.767000	0.43475	0.314000	0.19432	2.079000	0.62486	0.298000	0.19748	TGC	.	.	weak		0.502	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053951.1		
ANKRD30B	374860	hgsc.bcm.edu	37	18	14848821	14848821	+	Silent	SNP	G	G	A	rs28555630	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr18:14848821G>A	ENST00000358984.4	+	34	3111	c.2931G>A	c.(2929-2931)acG>acA	p.T977T		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	977				T -> M (in Ref. 3; AAK27326 and 4; BAG57852). {ECO:0000305}.						breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TGGAACAAACGAAAAATAAGT	0.348													g|||	2352	0.469649	0.5371	0.4222	5008	,	,		15908	0.4127		0.5109	False		,,,				2504	0.4284				p.T977T		Atlas-SNP	.											ANKRD30B_ENST00000358984,NS,carcinoma,+1,1	ANKRD30B	237	1	0			c.G2931A						scavenged	.						74.0	56.0	61.0					18																	14848821		692	1587	2279	SO:0001819	synonymous_variant	374860	exon34			ACAAACGAAAAAT	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2931G>A	18.37:g.14848821G>A		Somatic	440	3	0.00681818		WXS	Illumina HiSeq	Phase_I	461	5	0.010846	NM_001145029	B4DGP1|F8WAG3|Q4G175	Silent	SNP	ENST00000358984.4	37	CCDS54182.1																																																																																			G|0.500;A|0.500	0.500	weak		0.348	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
UPK3BL	100134938	hgsc.bcm.edu	37	7	102279601	102279601	+	Silent	SNP	G	G	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:102279601G>T	ENST00000340457.8	-	4	580	c.531C>A	c.(529-531)acC>acA	p.T177T	POLR2J2_ENST00000591000.1_3'UTR|POLR2J2_ENST00000476151.1_3'UTR|RP11-514P8.6_ENST00000519541.1_Silent_p.T177T	NM_001114403.2	NP_001107875.1	B0FP48	UPK3L_HUMAN	uroplakin 3B-like	177						integral component of membrane (GO:0016021)		p.T177T(2)		kidney(2)|stomach(1)	3						TGGACCACTTGGTTTCAGCCA	0.622																																					p.T177T		Atlas-SNP	.											UPK3BL,NS,carcinoma,0,2	UPK3BL	6	2	2	Substitution - coding silent(2)	kidney(2)	c.C531A						scavenged	.						126.0	79.0	93.0					7																	102279601		691	1582	2273	SO:0001819	synonymous_variant	100134938	exon4			CCACTTGGTTTCA	EU341824	CCDS47675.1	7q22.1	2014-02-12	2010-03-03		ENSG00000267368	ENSG00000267368			37278	protein-coding gene	gene with protein product	"""uroplakin-like protein"""						Standard	NM_001114403		Approved	UPLP		B0FP48	OTTHUMG00000165036	ENST00000340457.8:c.531C>A	7.37:g.102279601G>T		Somatic	720	11	0.0152778		WXS	Illumina HiSeq	Phase_I	569	10	0.0175747	NM_001114403		Silent	SNP	ENST00000340457.8	37	CCDS47675.1																																																																																			G|0.500;T|0.500	0.500	weak		0.622	UPK3BL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381510.1	NM_001114403	
PRMT2	3275	hgsc.bcm.edu	37	21	48069615	48069615	+	Silent	SNP	C	C	T	rs111614078		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr21:48069615C>T	ENST00000397637.1	+	6	1572	c.618C>T	c.(616-618)gaC>gaT	p.D206D	PRMT2_ENST00000334494.4_Silent_p.D206D|PRMT2_ENST00000355680.3_Silent_p.D206D|PRMT2_ENST00000397638.2_Silent_p.D206D|PRMT2_ENST00000458387.2_Silent_p.D206D|PRMT2_ENST00000397628.1_Silent_p.D206D|PRMT2_ENST00000451211.2_Silent_p.D206D|PRMT2_ENST00000440086.1_Silent_p.D206D|PRMT2_ENST00000291705.6_Silent_p.D206D|PRMT2_ENST00000491389.1_3'UTR			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	206	Interaction with ESR1.|Interaction with RB1. {ECO:0000250}.|SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		AGAAGGTGGACGTGCTGGTGT	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		14573	0.0		0.001	False		,,,				2504	0.0				p.D206D		Atlas-SNP	.											.	PRMT2	48	.	0			c.C618T						PASS	.	C	,,,,	2,4404		0,2,2201	115.0	76.0	89.0		618,618,618,618,618	-5.5	1.0	21	dbSNP_132	89	6,8594		0,6,4294	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PRMT2	NM_001242864.1,NM_001242865.1,NM_001242866.1,NM_001535.3,NM_206962.2	,,,,	0,8,6495	TT,TC,CC		0.0698,0.0454,0.0615	,,,,	206/332,206/285,206/278,206/434,206/434	48069615	8,12998	2203	4300	6503	SO:0001819	synonymous_variant	3275	exon6			GGTGGACGTGCTG	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.618C>T	21.37:g.48069615C>T		Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	164	22	0.134146	NM_001242864	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Silent	SNP	ENST00000397637.1	37	CCDS13737.1	.	.	.	.	.	.	.	.	.	.	.	10.28	1.307050	0.23821	4.54E-4	6.98E-4	ENSG00000160310	ENST00000455177	.	.	.	4.97	-5.54	0.02544	.	.	.	.	.	T	0.60130	0.2245	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61884	-0.6971	4	.	.	.	-7.4869	12.8764	0.57991	0.0:0.4715:0.0:0.5285	.	.	.	.	M	146	.	.	T	+	2	0	PRMT2	46894043	0.012000	0.17670	0.962000	0.40283	0.964000	0.63967	-2.105000	0.01339	-0.813000	0.04357	-1.021000	0.02439	ACG	C|1.000;T|0.000	0.000	strong		0.667	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207401.1	NM_001535	
NRXN1	9378	hgsc.bcm.edu	37	2	51254998	51254998	+	Silent	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr2:51254998C>T	ENST00000406316.2	-	2	1890	c.414G>A	c.(412-414)gtG>gtA	p.V138V	NRXN1_ENST00000405581.1_Silent_p.V138V|NRXN1_ENST00000404971.1_Silent_p.V138V|NRXN1_ENST00000406859.3_Silent_p.V138V|NRXN1_ENST00000401669.2_Silent_p.V138V|NRXN1_ENST00000402717.3_Silent_p.V138V|NRXN1_ENST00000405472.3_Silent_p.V138V	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	138	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ACTTGACCTCCACCCACTTGG	0.682																																					p.V138V		Atlas-SNP	.											.	NRXN1	1118	.	0			c.G414A						PASS	.						29.0	34.0	33.0					2																	51254998		2139	4250	6389	SO:0001819	synonymous_variant	9378	exon2			GACCTCCACCCAC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.414G>A	2.37:g.51254998C>T		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	53	8	0.150943	NM_004801	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1																																																																																			.	.	none		0.682	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
SLC37A3	84255	hgsc.bcm.edu	37	7	140055490	140055490	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:140055490G>T	ENST00000326232.9	-	7	799	c.596C>A	c.(595-597)tCt>tAt	p.S199Y	SLC37A3_ENST00000461089.1_5'Flank|SLC37A3_ENST00000429996.2_Missense_Mutation_p.F150L|SLC37A3_ENST00000340308.3_Missense_Mutation_p.S199Y|SLC37A3_ENST00000447932.2_Missense_Mutation_p.S199Y	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	199					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					CTGAAGAACAGAAGAAGCTAG	0.438																																					p.S199Y	Esophageal Squamous(133;211 1716 4665 11387 37873)	Atlas-SNP	.											.	SLC37A3	80	.	0			c.C596A						PASS	.						177.0	145.0	156.0					7																	140055490		2203	4300	6503	SO:0001583	missense	84255	exon7			AGAACAGAAGAAG	AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.596C>A	7.37:g.140055490G>T	ENSP00000321498:p.Ser199Tyr	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	48	6	0.125	NM_207113	Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	ENST00000326232.9	37	CCDS5859.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	g|g|g	0.599|0.599|0.599	-0.830008|-0.830008|-0.830008	0.02734|0.02734|0.02734	.|.|.	.|.|.	ENSG00000157800|ENSG00000157800|ENSG00000157800	ENST00000429996|ENST00000485861|ENST00000340308;ENST00000447932;ENST00000326232;ENST00000539816	T|.|T;T;T	0.38401|.|0.55760	1.14|.|0.5;0.5;0.5	5.28|5.28|5.28	4.34|4.34|4.34	0.51931|0.51931|0.51931	.|.|Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.|.|0.157131	.|.|0.56097	.|.|D	.|.|0.000027	T|T|T	0.33147|0.33147|0.33147	0.0853|0.0853|0.0853	N|N|N	0.16708|0.16708|0.16708	0.43|0.43|0.43	0.22468|0.22468|0.22468	N|N|N	0.99907|0.99907|0.99907	.|.|B;B;B;B;B	.|.|0.20550	.|.|0.011;0.005;0.009;0.046;0.012	.|.|B;B;B;B;B	.|.|0.19666	.|.|0.026;0.015;0.015;0.022;0.026	T|T|T	0.08351|0.08351|0.08351	-1.0726|-1.0726|-1.0726	7|5|10	0.27785|.|0.02654	T|.|T	0.31|.|1	-20.8037|-20.8037|-20.8037	15.9284|15.9284|15.9284	0.79639|0.79639|0.79639	0.0:0.2129:0.7871:0.0|0.0:0.2129:0.7871:0.0|0.0:0.2129:0.7871:0.0	.|.|.	.|.|171;199;199;199;199	.|.|B4DKF5;F5H743;Q8NCC5-2;Q8NCC5-3;Q8NCC5	.|.|.;.;.;.;SPX3_HUMAN	L|M|Y	150|124|199	ENSP00000412208:F150L|.|ENSP00000343358:S199Y;ENSP00000397481:S199Y;ENSP00000321498:S199Y	ENSP00000412208:F150L|.|ENSP00000321498:S199Y	F|L|S	-|-|-	3|1|2	2|2|0	SLC37A3|SLC37A3|SLC37A3	139701959|139701959|139701959	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.610000|0.610000|0.610000	0.28997|0.28997|0.28997	0.166000|0.166000|0.166000	0.22503|0.22503|0.22503	4.226000|4.226000|4.226000	0.58606|0.58606|0.58606	2.616000|2.616000|2.616000	0.88540|0.88540|0.88540	0.639000|0.639000|0.639000	0.83563|0.83563|0.83563	TTC|CTG|TCT	.	.	none		0.438	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348492.1	NM_032295	
EPHB6	2051	hgsc.bcm.edu	37	7	142564346	142564346	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:142564346C>T	ENST00000392957.2	+	10	2357	c.1570C>T	c.(1570-1572)Cgc>Tgc	p.R524C	EPHB6_ENST00000442129.1_Missense_Mutation_p.R524C|EPHB6_ENST00000411471.2_Missense_Mutation_p.R247C	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	524	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CTATCAGCTCCGCTACTATGA	0.627																																					p.R524C		Atlas-SNP	.											EPHB6,NS,carcinoma,0,1	EPHB6	168	1	0			c.C1570T						scavenged	.						78.0	79.0	78.0					7																	142564346		2203	4300	6503	SO:0001583	missense	2051	exon10			CAGCTCCGCTACT	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.1570C>T	7.37:g.142564346C>T	ENSP00000376684:p.Arg524Cys	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	57	6	0.105263	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	C	20.7	4.030264	0.75504	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.58652	0.32;0.32;0.32	4.95	4.95	0.65309	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.47455	D	0.000230	T	0.68622	0.3021	M	0.65320	2	0.58432	D	0.999999	D	0.61697	0.99	P	0.59643	0.861	T	0.72060	-0.4404	10	0.87932	D	0	.	12.6742	0.56884	0.165:0.835:0.0:0.0	.	524	O15197	EPHB6_HUMAN	C	524;524;247	ENSP00000376684:R524C;ENSP00000410789:R524C;ENSP00000409061:R247C	ENSP00000376684:R524C	R	+	1	0	EPHB6	142274468	0.322000	0.24634	1.000000	0.80357	0.995000	0.86356	0.846000	0.27682	2.451000	0.82905	0.556000	0.70494	CGC	.	.	none		0.627	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
CHEK2	11200	hgsc.bcm.edu	37	22	29091841	29091841	+	Silent	SNP	G	G	A	rs146546850	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr22:29091841G>A	ENST00000405598.1	-	12	1307	c.1116C>T	c.(1114-1116)tcC>tcT	p.S372S	CHEK2_ENST00000404276.1_Silent_p.S372S|CHEK2_ENST00000328354.6_Silent_p.S372S|CHEK2_ENST00000544772.1_Silent_p.S151S|CHEK2_ENST00000402731.1_Silent_p.S343S|CHEK2_ENST00000464581.1_5'Flank|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000403642.1_Silent_p.S281S|CHEK2_ENST00000382578.1_Silent_p.S281S|CHEK2_ENST00000348295.3_Silent_p.S343S|CHEK2_ENST00000382580.2_Silent_p.S415S|CHEK2_ENST00000382566.1_3'UTR			O96017	CHK2_HUMAN	checkpoint kinase 2	372	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.S372S(8)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.S415S		Atlas-SNP	.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	CHEK2,bladder,carcinoma,0,38	CHEK2	438	38	8	Substitution - coding silent(8)	kidney(4)|prostate(2)|endometrium(1)|central_nervous_system(1)	c.C1245T						scavenged	.						43.0	44.0	44.0					22																	29091841		2203	4300	6503	SO:0001819	synonymous_variant	11200	exon12			AATCTTGGAGTGC	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1116C>T	22.37:g.29091841G>A		Somatic	224	2	0.00892857		WXS	Illumina HiSeq	Phase_I	219	5	0.0228311	NM_001005735	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Silent	SNP	ENST00000405598.1	37	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	G	5.792	0.330417	0.10956	.	.	ENSG00000183765	ENST00000434810	.	.	.	5.89	-2.11	0.07187	.	.	.	.	.	T	0.42154	0.1190	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33854	-0.9852	4	.	.	.	-7.6356	3.2532	0.06822	0.327:0.1103:0.4613:0.1014	.	.	.	.	L	116	.	.	P	-	2	0	CHEK2	27421841	0.997000	0.39634	0.996000	0.52242	0.470000	0.32858	0.318000	0.19504	-0.075000	0.12798	-0.907000	0.02831	CCA	.	.	weak		0.413	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
SPATA3	130560	hgsc.bcm.edu	37	2	231861056	231861056	+	Silent	SNP	A	A	C	rs72362780		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr2:231861056A>C	ENST00000452881.1	+	1	216	c.108A>C	c.(106-108)acA>acC	p.T36T	SPATA3_ENST00000455816.1_Silent_p.T36T|AC105344.2_ENST00000414876.1_lincRNA|SPATA3_ENST00000433428.2_Silent_p.T36T|SPATA3_ENST00000424440.1_Silent_p.T36T			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	36										endometrium(2)|lung(1)	3						CTGAATCCACACCACAGCAGC	0.577																																					p.T36T		Atlas-SNP	.											SPATA3,rectum,carcinoma,0,1	SPATA3	52	1	0			c.A108C						scavenged	.						133.0	139.0	137.0					2																	231861056		692	1591	2283	SO:0001819	synonymous_variant	130560	exon1			ATCCACACCACAG	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.108A>C	2.37:g.231861056A>C		Somatic	107	3	0.0280374		WXS	Illumina HiSeq	Phase_I	88	13	0.147727	NM_139073	Q86WX5|Q8N9Y6	Silent	SNP	ENST00000452881.1	37	CCDS2481.1																																																																																			.	.	none		0.577	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
ANGPT4	51378	hgsc.bcm.edu	37	20	865839	865839	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr20:865839G>A	ENST00000381922.3	-	4	819	c.717C>T	c.(715-717)cgC>cgT	p.R239R	ANGPT4_ENST00000546022.1_Silent_p.R239R	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	239					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						CGCGCAGGCCGCGCTCGATGT	0.652																																					p.R239R	Pancreas(181;481 2077 3259 31286 49856)	Atlas-SNP	.											.	ANGPT4	77	.	0			c.C717T						PASS	.						22.0	20.0	21.0					20																	865839		2197	4295	6492	SO:0001819	synonymous_variant	51378	exon4			CAGGCCGCGCTCG	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.717C>T	20.37:g.865839G>A		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	65	9	0.138462	NM_015985	B4E3J9|Q5TFF4|Q9H4Z4	Silent	SNP	ENST00000381922.3	37	CCDS13009.1																																																																																			.	.	none		0.652	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077493.1	NM_015985	
HYDIN	54768	hgsc.bcm.edu	37	16	71004449	71004449	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr16:71004449C>A	ENST00000393567.2	-	36	5743	c.5593G>T	c.(5593-5595)Gat>Tat	p.D1865Y		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1865					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.D1816H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TACTGCTGATCAAATTCTAAG	0.443																																					p.D1865Y		Atlas-SNP	.											LOC652153,NS,carcinoma,0,1	HYDIN	788	1	1	Substitution - Missense(1)	ovary(1)	c.G5593T						scavenged	.						37.0	37.0	37.0					16																	71004449		1803	4051	5854	SO:0001583	missense	54768	exon36			GCTGATCAAATTC	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.5593G>T	16.37:g.71004449C>A	ENSP00000377197:p.Asp1865Tyr	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	51	5	0.0980392	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398623	0.83120	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.42900	0.96	4.65	4.65	0.58169	.	0.000000	0.34411	U	0.003995	T	0.67961	0.2949	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72988	-0.4124	10	0.54805	T	0.06	.	17.4637	0.87626	0.0:1.0:0.0:0.0	.	1864	F8WD23	.	Y	1865;1864	ENSP00000377197:D1865Y	ENSP00000310485:D156Y	D	-	1	0	HYDIN	69561950	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.484000	0.81180	2.311000	0.77944	0.505000	0.49811	GAT	.	.	none		0.443	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
NUP214	8021	hgsc.bcm.edu	37	9	134073744	134073744	+	Silent	SNP	G	G	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr9:134073744G>T	ENST00000359428.5	+	29	5007	c.4863G>T	c.(4861-4863)acG>acT	p.T1621T	NUP214_ENST00000483497.2_Silent_p.T447T|NUP214_ENST00000451030.1_Silent_p.T1622T|NUP214_ENST00000411637.2_Silent_p.T1611T			P35658	NU214_HUMAN	nucleoporin 214kDa	1621	11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CCAGCACCACGTCCATTGTTG	0.577			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.T1621T	Pancreas(4;24 48 25510 30394 32571)	Atlas-SNP	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	NUP214,brain,primitive_neuroectodermal_tumour-medulloblastoma,+1,1	NUP214	166	1	0			c.G4863T						scavenged	.						134.0	117.0	123.0					9																	134073744		2203	4300	6503	SO:0001819	synonymous_variant	8021	exon29			CACCACGTCCATT	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.4863G>T	9.37:g.134073744G>T		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	65	2	0.0307692	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Silent	SNP	ENST00000359428.5	37	CCDS6940.1																																																																																			.	.	none		0.577	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
COPS4	51138	hgsc.bcm.edu	37	4	83996453	83996453	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr4:83996453G>T	ENST00000264389.2	+	10	1226	c.1091G>T	c.(1090-1092)cGa>cTa	p.R364L	COPS4_ENST00000511653.1_Silent_p.T413T|COPS4_ENST00000509093.1_Nonsense_Mutation_p.E336*|COPS4_ENST00000503682.1_Missense_Mutation_p.R396L	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	364					cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				CCCTTAGCACGAGAAGCCCTG	0.363																																					p.E336X		Atlas-SNP	.											COPS4,bladder,carcinoma,+1,2	COPS4	31	2	0			c.G1006T						scavenged	.						63.0	62.0	63.0					4																	83996453		2203	4300	6503	SO:0001583	missense	51138	exon9			TAGCACGAGAAGC	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.1091G>T	4.37:g.83996453G>T	ENSP00000264389:p.Arg364Leu	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	65	2	0.0307692	NM_001258006	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Nonsense_Mutation	SNP	ENST00000264389.2	37	CCDS3600.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.056785|10.056785	0.99326|0.99326	.|.	.|.	ENSG00000138663|ENSG00000138663	ENST00000509093|ENST00000264389;ENST00000509317;ENST00000503682	.|T;T;T	.|0.42513	.|0.97;0.97;0.97	5.78|5.78	5.78|5.78	0.91487|0.91487	.|Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (1);	.|0.064020	.|0.64402	.|D	.|0.000004	.|T	.|0.52058	.|0.1711	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	.|P;B	.|0.52692	.|0.955;0.179	.|P;B	.|0.45829	.|0.494;0.057	.|T	.|0.49214	.|-0.8963	.|10	0.66056|0.30078	D|T	0.02|0.28	-5.9455|-5.9455	20.3754|20.3754	0.98918|0.98918	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|396;364	.|D6RFN0;Q9BT78	.|.;CSN4_HUMAN	X|L	336|364;252;396	.|ENSP00000264389:R364L;ENSP00000425486:R252L;ENSP00000424791:R396L	ENSP00000425976:E336X|ENSP00000264389:R364L	E|R	+|+	1|2	0|0	COPS4|COPS4	84215477|84215477	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.856000|0.856000	0.48823|0.48823	9.352000|9.352000	0.97076|0.97076	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	GAG|CGA	.	.	none		0.363	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252643.1		
RNF123	63891	hgsc.bcm.edu	37	3	49725184	49725184	+	5'Flank	SNP	G	G	A	rs191996618		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr3:49725184G>A	ENST00000327697.6	+	0	0				RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000449682.2_Splice_Site_p.R81W|MST1_ENST00000383728.3_Intron|MST1_ENST00000545762.1_Splice_Site_p.R67W|MST1_ENST00000494828.2_Intron|AC099668.5_ENST00000563780.1_RNA	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R67W(1)		NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GCCACTCACCGGCAGTCCATT	0.617																																					p.R81W		Atlas-SNP	.											MST1,trunk,malignant_melanoma,0,1	MST1	84	1	1	Substitution - Missense(1)	skin(1)	c.C241T						scavenged	.																																			SO:0001631	upstream_gene_variant	4485	exon2			CTCACCGGCAGTC	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49725184G>A	Exception_encountered	Somatic	110	3	0.0272727		WXS	Illumina HiSeq	Phase_I	85	3	0.0352941	NM_020998	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753661	0.31046	.	.	ENSG00000173531	ENST00000449682;ENST00000545762	T;T	0.71222	-0.55;-0.55	4.22	2.22	0.28083	.	0.177772	0.26836	N	0.022260	T	0.63908	0.2551	M	0.65498	2.005	0.39552	D	0.968993	B;P	0.35208	0.169;0.49	B;B	0.28784	0.049;0.094	T	0.65973	-0.6038	10	0.54805	T	0.06	.	11.5769	0.50866	0.0:0.0:0.4124:0.5876	.	67;81	B7Z538;G3XAK1	.;.	W	81;67	ENSP00000414287:R81W;ENSP00000437535:R67W	ENSP00000411117:R81W	R	-	1	2	MST1	49700188	1.000000	0.71417	0.998000	0.56505	0.537000	0.34900	1.595000	0.36708	0.595000	0.29777	-0.293000	0.09583	CGG	.	.	weak		0.617	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
NOTCH2	4853	hgsc.bcm.edu	37	1	120458147	120458147	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:120458147G>A	ENST00000256646.2	-	34	7417	c.7198C>T	c.(7198-7200)Cga>Tga	p.R2400*		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2400					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.R2400*(4)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGGGTGTTCGCTCAGCAGCA	0.562			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.R2400X		Atlas-SNP	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	NOTCH2,NS,lymphoid_neoplasm,0,26	NOTCH2	348	26	4	Substitution - Nonsense(4)	haematopoietic_and_lymphoid_tissue(3)|breast(1)	c.C7198T						scavenged	.						126.0	109.0	115.0					1																	120458147		2203	4300	6503	SO:0001587	stop_gained	4853	exon34	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GTGTTCGCTCAGC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.7198C>T	1.37:g.120458147G>A	ENSP00000256646:p.Arg2400*	Somatic	64	1	0.015625		WXS	Illumina HiSeq	Phase_I	53	17	0.320755	NM_024408	Q5T3X7|Q99734|Q9H240	Nonsense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	48	14.010061	0.99775	.	.	ENSG00000134250	ENST00000256646	.	.	.	5.35	4.43	0.53597	.	0.000000	0.30695	U	0.009069	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	12.2534	0.54611	0.0:0.0:0.6765:0.3235	.	.	.	.	X	2400	.	ENSP00000256646:R2400X	R	-	1	2	NOTCH2	120259670	0.616000	0.27035	1.000000	0.80357	0.996000	0.88848	0.360000	0.20250	1.224000	0.43551	0.591000	0.81541	CGA	.	.	none		0.562	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
INTS3	65123	hgsc.bcm.edu	37	1	153719499	153719499	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:153719499A>G	ENST00000318967.2	+	4	953	c.385A>G	c.(385-387)Ata>Gta	p.I129V	INTS3_ENST00000456435.1_5'UTR|INTS3_ENST00000435409.2_Missense_Mutation_p.I129V|RP11-216N14.8_ENST00000453778.1_RNA	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	129					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AATCAACCAGATACTTATGGA	0.448																																					p.I129V		Atlas-SNP	.											INTS3,NS,carcinoma,0,1	INTS3	83	1	0			c.A385G						PASS	.						104.0	105.0	105.0					1																	153719499		2203	4300	6503	SO:0001583	missense	65123	exon4			AACCAGATACTTA	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.385A>G	1.37:g.153719499A>G	ENSP00000318641:p.Ile129Val	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	87	11	0.126437	NM_023015	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	ENST00000318967.2	37	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.750433	0.49257	.	.	ENSG00000143624	ENST00000318967;ENST00000435409	.	.	.	4.82	3.68	0.42216	.	0.111158	0.64402	D	0.000015	T	0.31009	0.0783	L	0.43152	1.355	0.80722	D	1	B	0.25312	0.123	B	0.21917	0.037	T	0.28106	-1.0054	9	0.66056	D	0.02	.	9.0006	0.36079	0.6135:0.3865:0.0:0.0	.	129	Q68E01-2	.	V	129	.	ENSP00000318641:I129V	I	+	1	0	INTS3	151986123	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.853000	0.48317	0.855000	0.35359	0.459000	0.35465	ATA	.	.	none		0.448	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
TPRX1	284355	hgsc.bcm.edu	37	19	48305555	48305555	+	Missense_Mutation	SNP	G	G	A	rs147380237		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:48305555G>A	ENST00000322175.3	-	2	868	c.713C>T	c.(712-714)cCg>cTg	p.P238L	TPRX1_ENST00000535759.1_Missense_Mutation_p.P335L|TPRX1_ENST00000543508.1_Missense_Mutation_p.P228L	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	238	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gcctgggatcgggcctgggtt	0.662																																					p.P238L	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-SNP	.											TPRX1,colon,carcinoma,+1,1	TPRX1	46	1	0			c.C713T						scavenged	.						10.0	8.0	9.0					19																	48305555		2095	4129	6224	SO:0001583	missense	284355	exon2			GGGATCGGGCCTG		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.713C>T	19.37:g.48305555G>A	ENSP00000323455:p.Pro238Leu	Somatic	32	5	0.15625		WXS	Illumina HiSeq	Phase_I	20	4	0.2	NM_198479	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	37	CCDS33066.1	24	0.01098901098901099	0	0.0	3	0.008287292817679558	0	0.0	21	0.027704485488126648	g	8.014	0.758252	0.15846	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D	0.93659	-2.01;-3.26	0.495	0.495	0.16890	.	.	.	.	.	T	0.79936	0.4532	N	0.14661	0.345	0.09310	N	1	D	0.76494	0.999	P	0.60286	0.872	T	0.76977	-0.2759	8	0.45353	T	0.12	.	.	.	.	.	238	Q8N7U7	TPRX1_HUMAN	L	238;335;228	ENSP00000323455:P238L;ENSP00000438832:P335L	ENSP00000323455:P238L	P	-	2	0	TPRX1	52997367	0.000000	0.05858	0.020000	0.16555	0.015000	0.08874	-2.180000	0.01258	0.561000	0.29186	0.420000	0.28162	CCG	G|0.989;A|0.011	0.011	strong		0.662	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
ARAP1	116985	hgsc.bcm.edu	37	11	72408662	72408662	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:72408662C>T	ENST00000393609.3	-	20	2972	c.2770G>A	c.(2770-2772)Gtg>Atg	p.V924M	ARAP1_ENST00000426523.1_Missense_Mutation_p.V679M|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000455638.2_Missense_Mutation_p.V924M|ARAP1_ENST00000334211.8_Missense_Mutation_p.V679M|ARAP1-AS2_ENST00000500163.2_RNA|ARAP1_ENST00000429686.1_Missense_Mutation_p.V618M|ARAP1_ENST00000393605.3_Missense_Mutation_p.V684M|ARAP1_ENST00000359373.5_Missense_Mutation_p.V924M	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	924					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TCCACCAGCACCAGCACCTGG	0.637																																					p.V924M	Ovarian(102;1198 1520 13195 17913 37529)	Atlas-SNP	.											.	ARAP1	168	.	0			c.G2770A						PASS	.						108.0	94.0	99.0					11																	72408662		2200	4293	6493	SO:0001583	missense	116985	exon20			CCAGCACCAGCAC	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.2770G>A	11.37:g.72408662C>T	ENSP00000377233:p.Val924Met	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	87	7	0.0804598	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.694061	0.88735	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000427971;ENST00000452383	T;T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	4.93	4.93	0.64822	Pleckstrin homology domain (1);	0.133016	0.49916	D	0.000132	T	0.48926	0.1527	L	0.54323	1.7	0.41335	D	0.987265	P;D;P;P;P	0.69078	0.843;0.997;0.881;0.843;0.903	P;P;P;P;P	0.61533	0.779;0.845;0.746;0.677;0.89	T	0.52019	-0.8631	10	0.87932	D	0	.	17.0897	0.86618	0.0:1.0:0.0:0.0	.	679;618;924;924;684	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	M	924;924;684;679;924;679;618;212;212	ENSP00000352332:V924M;ENSP00000390461:V924M;ENSP00000377230:V684M;ENSP00000335506:V679M;ENSP00000377233:V924M;ENSP00000392264:V679M;ENSP00000403127:V618M;ENSP00000411452:V212M;ENSP00000399118:V212M	ENSP00000335506:V679M	V	-	1	0	ARAP1	72086310	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.823000	0.48081	2.435000	0.82474	0.563000	0.77884	GTG	.	.	none		0.637	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
ZNF324	25799	hgsc.bcm.edu	37	19	58983107	58983107	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:58983107G>A	ENST00000536459.2	+	4	1957	c.1248G>A	c.(1246-1248)caG>caA	p.Q416Q	ZNF324_ENST00000535298.1_Silent_p.Q193Q|ZNF324_ENST00000196482.3_Silent_p.Q416Q|ZNF446_ENST00000596341.1_5'Flank			O75467	Z324A_HUMAN	zinc finger protein 324	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(2)|prostate(2)|urinary_tract(2)	16		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		TTAAGCACCAGCGCGTGCACA	0.662																																					p.Q416Q		Atlas-SNP	.											.	ZNF324	46	.	0			c.G1248A						PASS	.						41.0	41.0	41.0					19																	58983107		2203	4299	6502	SO:0001819	synonymous_variant	25799	exon4			GCACCAGCGCGTG	AF060503	CCDS12981.1	19q13.43	2013-01-08				ENSG00000083812		"""Zinc fingers, C2H2-type"", ""-"""	14096	protein-coding gene	gene with protein product							Standard	NM_014347		Approved	ZF5128, ZNF324A	uc002qsw.2	O75467		ENST00000536459.2:c.1248G>A	19.37:g.58983107G>A		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	77	9	0.116883	NM_014347	B3KRX1	Silent	SNP	ENST00000536459.2	37	CCDS12981.1																																																																																			.	.	none		0.662	ZNF324-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467044.1	NM_014347	
CES1	1066	hgsc.bcm.edu	37	16	55862883	55862883	+	Splice_Site	SNP	C	C	A	rs3826190		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr16:55862883C>A	ENST00000361503.4	-	2	183	c.53G>T	c.(52-54)gGg>gTg	p.G18V	CES1_ENST00000360526.3_Missense_Mutation_p.G19V|CES1_ENST00000566555.1_5'Flank|CES1_ENST00000422046.2_Splice_Site_p.G18V			P23141	EST1_HUMAN	carboxylesterase 1	18			G -> GA.		epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)	p.G19V(1)							all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	GGACGGATGCCCTGCTGGACA	0.522																																					p.G19V	NSCLC(162;1801 2756 42904 52896)	Atlas-SNP	.											CES1_ENST00000360526,NS,carcinoma,0,1	CES1	78	1	1	Substitution - Missense(1)	prostate(1)	c.G56T						scavenged	.						38.0	29.0	32.0					16																	55862883		2198	4300	6498	SO:0001630	splice_region_variant	1066	exon2			GGATGCCCTGCTG	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.53-1G>T	16.37:g.55862883C>A		Somatic	38	3	0.0789474		WXS	Illumina HiSeq	Phase_I	20	7	0.35	NM_001025195	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	ENST00000361503.4	37	CCDS45488.1	804	0.36813186813186816	220	0.44715447154471544	142	0.39226519337016574	112	0.1958041958041958	330	0.43535620052770446	.	18.35	3.604104	0.66445	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046	T;T;T	0.66995	-0.24;-0.17;-0.17	4.48	3.52	0.40303	Carboxylesterase, type B (1);	8.429180	0.00357	N	0.000020	T	0.00012	0.0000	M	0.64080	1.96	0.58432	D	0.999993	D;D;D	0.63046	0.992;0.992;0.972	D;D;P	0.70487	0.969;0.958;0.891	T	0.53556	-0.8422	10	0.72032	D	0.01	.	9.5301	0.39189	0.0:0.8943:0.0:0.1057	rs3826190	18;18;19	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	V	19;18;18	ENSP00000353720:G19V;ENSP00000355193:G18V;ENSP00000390492:G18V	ENSP00000353720:G19V	G	-	2	0	CES1	54420384	0.940000	0.31905	0.780000	0.31762	0.099000	0.18886	1.881000	0.39638	2.051000	0.60960	0.393000	0.25936	GGG	C|0.632;A|0.368	0.368	strong		0.522	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266	Missense_Mutation
FAM72A	729533	hgsc.bcm.edu	37	1	206145504	206145504	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:206145504T>C	ENST00000367128.3	+	3	1129	c.281T>C	c.(280-282)cTt>cCt	p.L94P	FAM72A_ENST00000367129.2_Missense_Mutation_p.L94P|FAM72A_ENST00000470041.1_3'UTR|FAM72A_ENST00000341209.5_Missense_Mutation_p.L54P			Q5TYM5	FA72A_HUMAN	family with sequence similarity 72, member A	94						mitochondrion (GO:0005739)		p.L94P(1)		endometrium(2)	2						TCCTGTCTTCTTTCCTGCAAC	0.383																																					p.L94P		Atlas-SNP	.											FAM72A,NS,carcinoma,0,1	FAM72A	9	1	1	Substitution - Missense(1)	endometrium(1)	c.T281C						scavenged	.						244.0	204.0	216.0					1																	206145504		1568	3578	5146	SO:0001583	missense	729533	exon3			GTCTTCTTTCCTG	CR407567	CCDS73016.1	1q32.1	2008-03-26			ENSG00000196550	ENSG00000196550			24044	protein-coding gene	gene with protein product		614710				12477932	Standard	NM_001123168		Approved	MGC57827, RP11-312O7.1	uc001hdr.4	Q5TYM5	OTTHUMG00000042552	ENST00000367128.3:c.281T>C	1.37:g.206145504T>C	ENSP00000356096:p.Leu94Pro	Somatic	702	6	0.00854701		WXS	Illumina HiSeq	Phase_I	673	14	0.0208024	NM_001123168	B2RV15|Q5TYM4	Missense_Mutation	SNP	ENST00000367128.3	37	CCDS41458.1	.	.	.	.	.	.	.	.	.	.	T	15.28	2.785677	0.49997	.	.	ENSG00000196550	ENST00000367129;ENST00000367128;ENST00000341209	T;T;T	0.33654	1.4;1.4;1.4	3.07	3.07	0.35406	.	0.000000	0.64402	U	0.000003	T	0.40595	0.1123	M	0.65975	2.015	0.80722	D	1	D	0.54207	0.965	P	0.47981	0.563	T	0.31052	-0.9957	10	0.35671	T	0.21	.	10.6623	0.45708	0.0:0.0:0.0:1.0	.	94	Q5TYM5	FA72A_HUMAN	P	94;94;54	ENSP00000356097:L94P;ENSP00000356096:L94P;ENSP00000340661:L54P	ENSP00000340661:L54P	L	+	2	0	FAM72A	204312127	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.652000	0.67959	1.399000	0.46721	0.254000	0.18369	CTT	.	.	weak		0.383	FAM72A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100825.1		
THSD7A	221981	hgsc.bcm.edu	37	7	11676123	11676123	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:11676123C>T	ENST00000423059.4	-	2	907	c.656G>A	c.(655-657)cGt>cAt	p.R219H	THSD7A_ENST00000480061.1_5'Flank	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	219	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CACCACATGACGCGTCCGGTG	0.617										HNSCC(18;0.044)																											p.R219H		Atlas-SNP	.											.	THSD7A	219	.	0			c.G656A						PASS	.						28.0	29.0	29.0					7																	11676123		2016	4187	6203	SO:0001583	missense	221981	exon2			ACATGACGCGTCC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.656G>A	7.37:g.11676123C>T	ENSP00000406482:p.Arg219His	Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	53	7	0.132075	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337694	0.81911	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.65364	-0.15	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.89294	0.6674	H	0.99391	4.545	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93148	0.6547	10	0.62326	D	0.03	.	20.0333	0.97547	0.0:1.0:0.0:0.0	.	219	Q9UPZ6	THS7A_HUMAN	H	219	ENSP00000406482:R219H	ENSP00000262042:R219H	R	-	2	0	THSD7A	11642648	1.000000	0.71417	0.086000	0.20670	0.358000	0.29455	7.776000	0.85560	2.810000	0.96702	0.585000	0.79938	CGT	.	.	none		0.617	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
TMEM106B	54664	hgsc.bcm.edu	37	7	12269417	12269417	+	Missense_Mutation	SNP	C	C	G	rs3173615	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:12269417C>G	ENST00000396667.3	+	6	876	c.554C>G	c.(553-555)aCc>aGc	p.T185S	TMEM106B_ENST00000396668.3_Missense_Mutation_p.T185S	NM_018374.3	NP_060844.2	Q9NUM4	T106B_HUMAN	transmembrane protein 106B	185			T -> S (in dbSNP:rs3173615). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:23742080}.		cell death (GO:0008219)|dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(8)|large_intestine(2)|lung(7)	18				UCEC - Uterine corpus endometrioid carcinoma (126;0.185)		AACAACATAACCATTATTGGT	0.308													C|||	2980	0.595048	0.6808	0.5692	5008	,	,		18287	0.6508		0.4016	False		,,,				2504	0.6391				p.T185S		Atlas-SNP	.											TMEM106B,NS,adenoma,0,1	TMEM106B	34	1	0			c.C554G						scavenged	.	C	SER/THR,SER/THR	2897,1509	673.6+/-402.8	965,967,271	69.0	70.0	69.0		554,554	5.4	1.0	7	dbSNP_105	69	3587,5009	516.1+/-378.7	780,2027,1491	yes	missense,missense	TMEM106B	NM_001134232.1,NM_018374.3	58,58	1745,2994,1762	GG,GC,CC		41.7287,34.2488,49.8693	possibly-damaging,possibly-damaging	185/275,185/275	12269417	6484,6518	2203	4298	6501	SO:0001583	missense	54664	exon5			ACATAACCATTAT	BC033901	CCDS5358.1	7p21.3	2012-06-06			ENSG00000106460	ENSG00000106460			22407	protein-coding gene	gene with protein product		613413				20154673, 22511793	Standard	NM_018374		Approved	MGC33727, FLJ11273	uc003ssh.3	Q9NUM4	OTTHUMG00000125537	ENST00000396667.3:c.554C>G	7.37:g.12269417C>G	ENSP00000379901:p.Thr185Ser	Somatic	519	3	0.00578035		WXS	Illumina HiSeq	Phase_I	494	6	0.0121457	NM_001134232	A4D108|Q53FL9|Q8N4L0	Missense_Mutation	SNP	ENST00000396667.3	37	CCDS5358.1	1198	0.5485347985347986	324	0.6585365853658537	184	0.5082872928176796	384	0.6713286713286714	306	0.40369393139841686	C	14.51	2.557596	0.45590	0.657512	0.417287	ENSG00000106460	ENST00000396668;ENST00000396667	T;T	0.22539	1.95;1.95	5.36	5.36	0.76844	.	0.048857	0.85682	D	0.000000	T	0.00012	0.0000	L	0.50333	1.59	0.22330	P	0.99919789	B	0.20261	0.043	B	0.17098	0.017	T	0.38178	-0.9673	9	0.54805	T	0.06	-15.6842	12.7762	0.57451	0.0:0.9247:0.0:0.0753	rs3173615;rs10348977;rs11546466;rs17149904;rs17853942;rs52789343;rs59821228;rs3173615	185	Q9NUM4	T106B_HUMAN	S	185	ENSP00000379902:T185S;ENSP00000379901:T185S	ENSP00000379901:T185S	T	+	2	0	TMEM106B	12235942	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	5.898000	0.69838	2.689000	0.91719	0.655000	0.94253	ACC	C|0.481;G|0.519	0.519	strong		0.308	TMEM106B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246870.3	NM_018374	
LRIG2	9860	hgsc.bcm.edu	37	1	113655236	113655236	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:113655236C>T	ENST00000361127.5	+	14	2132	c.1934C>T	c.(1933-1935)gCg>gTg	p.A645V	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	645	Ig-like C2-type 2.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		GACTTTCCTGCGGCTCGAGAA	0.493																																					p.A645V		Atlas-SNP	.											LRIG2,NS,lymphoid_neoplasm,0,1	LRIG2	67	1	0			c.C1934T						scavenged	.						140.0	125.0	130.0					1																	113655236		2203	4300	6503	SO:0001583	missense	9860	exon14			TTCCTGCGGCTCG	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.1934C>T	1.37:g.113655236C>T	ENSP00000355396:p.Ala645Val	Somatic	115	1	0.00869565		WXS	Illumina HiSeq	Phase_I	70	3	0.0428571	NM_014813	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	37	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	C	35	5.577687	0.96565	.	.	ENSG00000198799	ENST00000361127	T	0.77620	-1.11	5.45	5.45	0.79879	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73837	0.3638	N	0.10629	0.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80986	-0.1137	10	0.56958	D	0.05	.	19.2881	0.94087	0.0:1.0:0.0:0.0	.	645	O94898	LRIG2_HUMAN	V	645	ENSP00000355396:A645V	ENSP00000355396:A645V	A	+	2	0	LRIG2	113456759	1.000000	0.71417	0.962000	0.40283	0.988000	0.76386	7.818000	0.86416	2.560000	0.86352	0.591000	0.81541	GCG	.	.	none		0.493	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
KCTD3	51133	hgsc.bcm.edu	37	1	215759865	215759865	+	Silent	SNP	A	A	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:215759865A>G	ENST00000259154.4	+	9	948	c.654A>G	c.(652-654)caA>caG	p.Q218Q		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	218					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		GATGGCAGCAAGTGTTTACGA	0.438																																					p.Q218Q		Atlas-SNP	.											.	KCTD3	101	.	0			c.A654G						PASS	.						145.0	138.0	140.0					1																	215759865		2203	4300	6503	SO:0001819	synonymous_variant	51133	exon9			GCAGCAAGTGTTT	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.654A>G	1.37:g.215759865A>G		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	98	8	0.0816327	NM_016121	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Silent	SNP	ENST00000259154.4	37	CCDS1515.1																																																																																			.	.	none		0.438	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
SPATA3	130560	hgsc.bcm.edu	37	2	231861057	231861057	+	Missense_Mutation	SNP	C	C	T	rs72362780		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr2:231861057C>T	ENST00000452881.1	+	1	217	c.109C>T	c.(109-111)Cca>Tca	p.P37S	SPATA3_ENST00000455816.1_Missense_Mutation_p.P37S|AC105344.2_ENST00000414876.1_lincRNA|SPATA3_ENST00000433428.2_Missense_Mutation_p.P37S|SPATA3_ENST00000424440.1_Missense_Mutation_p.P37S			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	37										endometrium(2)|lung(1)	3						TGAATCCACACCACAGCAGCC	0.577																																					p.P37S		Atlas-SNP	.											SPATA3,NS,carcinoma,-2,4	SPATA3	52	4	0			c.C109T						scavenged	.						132.0	138.0	137.0					2																	231861057		692	1590	2282	SO:0001583	missense	130560	exon1			TCCACACCACAGC	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.109C>T	2.37:g.231861057C>T	ENSP00000388895:p.Pro37Ser	Somatic	108	2	0.0185185		WXS	Illumina HiSeq	Phase_I	89	12	0.134831	NM_139073	Q86WX5|Q8N9Y6	Missense_Mutation	SNP	ENST00000452881.1	37	CCDS2481.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829371	0.32329	.	.	ENSG00000173699	ENST00000424440;ENST00000452881;ENST00000433428;ENST00000455816;ENST00000355662;ENST00000440792	.	.	.	3.0	-0.25	0.13007	.	0.940554	0.08697	N	0.907107	T	0.19248	0.0462	N	0.12746	0.255	0.09310	N	1	.	.	.	.	.	.	T	0.27673	-1.0067	7	0.72032	D	0.01	0.139	2.334	0.04242	0.2359:0.4502:0.0:0.3139	.	.	.	.	S	37;37;37;37;37;3	.	ENSP00000347884:P37S	P	+	1	0	SPATA3	231569301	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.302000	0.08221	-0.061000	0.13110	-0.367000	0.07326	CCA	.	.	none		0.577	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
AHCYL2	23382	hgsc.bcm.edu	37	7	129064932	129064932	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:129064932C>T	ENST00000325006.3	+	15	1712	c.1658C>T	c.(1657-1659)gCt>gTt	p.A553V	AHCYL2_ENST00000531335.2_Missense_Mutation_p.A472V|AHCYL2_ENST00000490911.1_Missense_Mutation_p.A450V|AHCYL2_ENST00000474594.1_Missense_Mutation_p.A450V|AHCYL2_ENST00000446212.1_Missense_Mutation_p.A451V|AHCYL2_ENST00000446544.2_Missense_Mutation_p.A552V	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	553					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						CTTTACAATGCTCCTGAGGGT	0.463																																					p.A553V	Pancreas(160;1736 1964 29875 40941 45605)	Atlas-SNP	.											.	AHCYL2	79	.	0			c.C1658T						PASS	.						171.0	153.0	159.0					7																	129064932		2203	4300	6503	SO:0001583	missense	23382	exon15			ACAATGCTCCTGA	AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.1658C>T	7.37:g.129064932C>T	ENSP00000315931:p.Ala553Val	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	66	14	0.212121	NM_015328	B4DIZ5|D9N155|O94917	Missense_Mutation	SNP	ENST00000325006.3	37	CCDS5812.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.439306|5.439306	0.96168|0.96168	.|.	.|.	ENSG00000158467|ENSG00000158467	ENST00000325006;ENST00000446544;ENST00000531335;ENST00000474594;ENST00000446212;ENST00000490911|ENST00000466924	T;T;T;T;T;T|.	0.77489|.	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1|.	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	0.046797|.	0.85682|.	D|.	0.000000|.	T|T	0.78572|0.78572	0.4304|0.4304	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.71674|.	0.987;0.978;0.998;0.978;0.997|.	P;P;D;P;P|.	0.65773|.	0.861;0.806;0.938;0.806;0.897|.	T|T	0.79438|0.79438	-0.1803|-0.1803	10|5	0.48119|.	T|.	0.1|.	-12.0409|-12.0409	17.8694|17.8694	0.88807|0.88807	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	450;451;553;450;552|.	B4DIZ5;D7UEQ7;Q96HN2;D9N155;Q96HN2-2|.	.;.;SAHH3_HUMAN;.;.|.	V|F	553;552;472;450;451;450|460	ENSP00000315931:A553V;ENSP00000413639:A552V;ENSP00000431787:A472V;ENSP00000420459:A450V;ENSP00000405267:A451V;ENSP00000420801:A450V|.	ENSP00000315931:A553V|.	A|L	+|+	2|1	0|0	AHCYL2|AHCYL2	128852168|128852168	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.796000|7.796000	0.85898|0.85898	2.565000|2.565000	0.86533|0.86533	0.650000|0.650000	0.86243|0.86243	GCT|CTC	.	.	none		0.463	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354065.1		
KMT2D	8085	hgsc.bcm.edu	37	12	49427102	49427102	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:49427102G>A	ENST00000301067.7	-	39	11385	c.11386C>T	c.(11386-11388)Cag>Tag	p.Q3796*	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3796	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TGGGGCCCCTGGGGTGGTTGA	0.657																																					p.Q3796X		Atlas-SNP	.											.	MLL2	1173	.	0			c.C11386T						PASS	.						12.0	14.0	14.0					12																	49427102		1930	4119	6049	SO:0001587	stop_gained	8085	exon39			GCCCCTGGGGTGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11386C>T	12.37:g.49427102G>A	ENSP00000301067:p.Gln3796*	Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	41	7	0.170732	NM_003482	O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	51	18.491664	0.99906	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.02	5.02	0.67125	.	0.258092	0.20680	N	0.087663	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.4938	0.87712	0.0:0.0:1.0:0.0	.	.	.	.	X	3796	.	ENSP00000301067:Q3796X	Q	-	1	0	MLL2	47713369	0.995000	0.38212	1.000000	0.80357	0.911000	0.54048	3.379000	0.52440	2.505000	0.84491	0.462000	0.41574	CAG	.	.	none		0.657	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
IFT80	57560	hgsc.bcm.edu	37	3	159998476	159998476	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr3:159998476G>A	ENST00000326448.7	-	15	2075	c.1643C>T	c.(1642-1644)aCa>aTa	p.T548I	IFT80_ENST00000496589.1_Missense_Mutation_p.T411I|IFT80_ENST00000483465.1_Missense_Mutation_p.T411I|RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.T719I	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	548					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)		p.T548I(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TTCATATAATGTTTTAGGCAA	0.323																																					p.T548I		Atlas-SNP	.											IFT80,colon,carcinoma,0,1	IFT80	68	1	1	Substitution - Missense(1)	large_intestine(1)	c.C1643T						PASS	.						122.0	111.0	115.0					3																	159998476		2203	4300	6503	SO:0001583	missense	57560	exon15			TATAATGTTTTAG	AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.1643C>T	3.37:g.159998476G>A	ENSP00000312778:p.Thr548Ile	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	119	12	0.10084	NM_020800	B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	ENST00000326448.7	37	CCDS3188.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327407	0.81690	.	.	ENSG00000068885	ENST00000326448;ENST00000483465;ENST00000496589	T;T;T	0.78481	-0.08;-1.18;-1.18	5.6	5.6	0.85130	.	0.000000	0.64402	U	0.000014	D	0.83936	0.5362	M	0.87456	2.885	0.80722	D	1	D	0.53312	0.959	P	0.46076	0.503	D	0.84821	0.0796	10	0.36615	T	0.2	.	19.6123	0.95613	0.0:0.0:1.0:0.0	.	548	Q9P2H3	IFT80_HUMAN	I	548;411;411	ENSP00000312778:T548I;ENSP00000418196:T411I;ENSP00000420646:T411I	ENSP00000312778:T548I	T	-	2	0	IFT80	161481170	1.000000	0.71417	0.982000	0.44146	0.965000	0.64279	9.074000	0.93998	2.640000	0.89533	0.467000	0.42956	ACA	.	.	none		0.323	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2	NM_020800	
KMT2C	58508	hgsc.bcm.edu	37	7	151962168	151962168	+	Missense_Mutation	SNP	C	C	A	rs138908625	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:151962168C>A	ENST00000262189.6	-	8	1357	c.1139G>T	c.(1138-1140)cGt>cTt	p.R380L	KMT2C_ENST00000355193.2_Missense_Mutation_p.R380L	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	380					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R380L(4)									CCAACCTGCACGTTTTAATGG	0.443																																					p.R380L		Atlas-SNP	.											MLL3_ENST00000355193,extremity,malignant_melanoma,0,6	MLL3	1564	6	4	Substitution - Missense(4)	skin(4)	c.G1139T						scavenged	.	C	LEU/ARG	29,4377	25.3+/-52.1	0,29,2174	410.0	369.0	383.0		1139	4.7	1.0	7	dbSNP_134	383	15,8585	3.7+/-12.6	0,15,4285	no	missense	MLL3	NM_170606.2	102	0,44,6459	AA,AC,CC		0.1744,0.6582,0.3383	probably-damaging	380/4912	151962168	44,12962	2203	4300	6503	SO:0001583	missense	58508	exon8			CCTGCACGTTTTA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1139G>T	7.37:g.151962168C>A	ENSP00000262189:p.Arg380Leu	Somatic	208	2	0.00961538		WXS	Illumina HiSeq	Phase_I	194	10	0.0515464	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.688003	0.48097	0.006582	0.001744	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98876	-5.2;-5.2	4.65	4.65	0.58169	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.38548	U	0.001645	D	0.98560	0.9519	M	0.74881	2.28	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	D	0.96263	0.9192	10	0.52906	T	0.07	.	17.9157	0.88950	0.0:1.0:0.0:0.0	.	380	Q8NEZ4	MLL3_HUMAN	L	380	ENSP00000262189:R380L;ENSP00000347325:R380L	ENSP00000262189:R380L	R	-	2	0	MLL3	151593101	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	6.039000	0.70972	2.271000	0.75665	0.557000	0.71058	CGT	C|0.500;A|0.500	0.500	weak		0.443	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
TMPRSS13	84000	hgsc.bcm.edu	37	11	117789345	117789345	+	Missense_Mutation	SNP	G	G	C	rs61900347	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:117789345G>C	ENST00000430170.2	-	2	317	c.230C>G	c.(229-231)gCc>gGc	p.A77G	TMPRSS13_ENST00000524993.1_Missense_Mutation_p.A77G|TMPRSS13_ENST00000445164.2_Missense_Mutation_p.A77G|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.A77G|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.A77G	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	77	13 X 5 AA repeats of A-S-P-A-[GLQR].|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		AGATGCCTGGGCTGGAGATGC	0.672													G|||	2	0.000399361	0.0	0.0	5008	,	,		14255	0.002		0.0	False		,,,				2504	0.0				p.A77G		Atlas-SNP	.											TMPRSS13_ENST00000445164,NS,carcinoma,0,2	TMPRSS13	75	2	0			c.C230G						PASS	.						39.0	48.0	45.0					11																	117789345		1921	4109	6030	SO:0001583	missense	84000	exon2			GCCTGGGCTGGAG	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.230C>G	11.37:g.117789345G>C	ENSP00000387702:p.Ala77Gly	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	52	7	0.134615	NM_001206790	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	CCDS58185.1	219|219	0.10027472527472528|0.10027472527472528	67|67	0.13617886178861788|0.13617886178861788	52|52	0.143646408839779|0.143646408839779	45|45	0.07867132867132867|0.07867132867132867	55|55	0.07255936675461741|0.07255936675461741	G|G	4.978|4.978	0.181711|0.181711	0.09495|0.09495	.|.	.|.	ENSG00000137747|ENSG00000137747	ENST00000336500|ENST00000528626;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	.|D;D;D;D;D	.|0.88431	.|-2.38;-2.36;-2.36;-2.34;-2.24	3.11|3.11	1.04|1.04	0.20106|0.20106	.|.	.|1.049680	.|0.07486	.|N	.|0.904837	.|T	.|0.02380	.|0.0073	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	P|P	0.0|0.0	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	.|T	.|0.28776	.|-1.0033	.|9	.|0.20046	.|T	.|0.44	.|.	6.0296|6.0296	0.19673|0.19673	0.1228:0.2258:0.6514:0.0|0.1228:0.2258:0.6514:0.0	rs61900347|rs61900347	.|77	.|E9PRA0	.|.	.|G	-1|77	.|ENSP00000435813:A77G;ENSP00000434279:A77G;ENSP00000387702:A77G;ENSP00000394114:A77G;ENSP00000436502:A77G	.|ENSP00000387702:A77G	.|A	-|-	.|2	.|0	TMPRSS13|TMPRSS13	117294555|117294555	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.105000|0.105000	0.15333|0.15333	-0.045000|-0.045000	0.13468|0.13468	-0.189000|-0.189000	0.12847|0.12847	.|GCC	G|0.899;C|0.101	0.101	strong		0.672	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
NUP210	23225	hgsc.bcm.edu	37	3	13427859	13427859	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr3:13427859G>A	ENST00000254508.5	-	6	815	c.733C>T	c.(733-735)Ctg>Ttg	p.L245L		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	245					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GCCGGGTTCAGAAGGATGTTT	0.493																																					p.L245L		Atlas-SNP	.											.	NUP210	182	.	0			c.C733T						PASS	.						184.0	165.0	172.0					3																	13427859		2203	4300	6503	SO:0001819	synonymous_variant	23225	exon6			GGTTCAGAAGGAT	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.733C>T	3.37:g.13427859G>A		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	64	10	0.15625	NM_024923	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Silent	SNP	ENST00000254508.5	37	CCDS33704.1																																																																																			.	.	none		0.493	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
COPRS	55352	hgsc.bcm.edu	37	17	30179882	30179882	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr17:30179882A>C	ENST00000302362.6	-	3	471	c.334T>G	c.(334-336)Ttt>Gtt	p.F112V	COPRS_ENST00000378634.2_Missense_Mutation_p.F100V	NM_018405.3	NP_060875.2	Q9NQ92	COPRS_HUMAN	coordinator of PRMT5, differentiation stimulator	112					histone H4-R3 methylation (GO:0043985)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone binding (GO:0042393)										TCCTCATTAAAAAGATCGCCA	0.517																																					p.F112V		Atlas-SNP	.											C17orf79,colon,carcinoma,+1,1	.	.	1	0			c.T334G						scavenged	.						180.0	185.0	183.0					17																	30179882		2203	4300	6503	SO:0001583	missense	55352	exon3			CATTAAAAAGATC	AJ272196	CCDS11268.1	17q11.2	2012-11-16	2012-11-16	2012-11-16	ENSG00000172301	ENSG00000172301			28848	protein-coding gene	gene with protein product	"""cooperator of PRMT5"""		"""chromosome 17 open reading frame 79"""	C17orf79		10843809, 18404153	Standard	NM_018405		Approved	TTP1, HSA272196, COPR5	uc002hgp.3	Q9NQ92	OTTHUMG00000132812	ENST00000302362.6:c.334T>G	17.37:g.30179882A>C	ENSP00000304327:p.Phe112Val	Somatic	94	2	0.0212766		WXS	Illumina HiSeq	Phase_I	84	16	0.190476	NM_018405	A6NP14|E1P656|Q96EF5|Q96P75	Missense_Mutation	SNP	ENST00000302362.6	37	CCDS11268.1	.	.	.	.	.	.	.	.	.	.	A	14.24	2.476405	0.44044	.	.	ENSG00000172301	ENST00000302362;ENST00000378634	T;T	0.40756	1.02;1.02	5.37	4.26	0.50523	.	0.378221	0.22871	N	0.054628	T	0.23210	0.0561	N	0.20986	0.625	0.09310	N	0.999999	P	0.36535	0.557	B	0.34242	0.178	T	0.07558	-1.0766	10	0.27082	T	0.32	-5.3289	4.8505	0.13535	0.8376:0.0:0.1624:0.0	.	112	Q9NQ92	COPR5_HUMAN	V	112;100	ENSP00000304327:F112V;ENSP00000367901:F100V	ENSP00000304327:F112V	F	-	1	0	C17orf79	27203995	0.961000	0.32948	0.156000	0.22583	0.316000	0.28119	2.353000	0.44089	2.030000	0.59900	0.383000	0.25322	TTT	.	.	none		0.517	COPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256257.2	NM_018405	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274291	39274291	+	Missense_Mutation	SNP	T	T	C	rs200214744|rs565505867	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr17:39274291T>C	ENST00000391413.2	-	1	315	c.277A>G	c.(277-279)Atg>Gtg	p.M93V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	93	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.M93V(4)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCAGCACATAGACTGGCAG	0.662																																					p.M93V		Atlas-SNP	.											KRTAP4-11,NS,carcinoma,0,12	KRTAP4-11	94	12	4	Substitution - Missense(4)	endometrium(3)|kidney(1)	c.A277G						scavenged	.						6.0	10.0	8.0					17																	39274291		651	1556	2207	SO:0001583	missense	653240	exon1			AGCACATAGACTG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.277A>G	17.37:g.39274291T>C	ENSP00000375232:p.Met93Val	Somatic	35	3	0.0857143		WXS	Illumina HiSeq	Phase_I	36	11	0.305556	NM_033059	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	0.073	-1.199029	0.01581	.	.	ENSG00000212721	ENST00000391413	T	0.00580	6.43	4.25	-4.9	0.03094	.	.	.	.	.	T	0.00109	0.0003	N	0.00040	-2.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43097	-0.9412	9	0.02654	T	1	.	0.4739	0.00536	0.3479:0.2455:0.1203:0.2863	.	93	Q9BYQ6	KR411_HUMAN	V	93	ENSP00000375232:M93V	ENSP00000375232:M93V	M	-	1	0	KRTAP4-11	36527817	.	.	0.012000	0.15200	0.010000	0.07245	.	.	-1.319000	0.02286	-1.132000	0.01976	ATG	.	.	weak		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
DUSP2	1844	hgsc.bcm.edu	37	2	96810531	96810531	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr2:96810531C>T	ENST00000288943.4	-	2	564	c.479G>A	c.(478-480)cGc>cAc	p.R160H	AC012307.2_ENST00000449242.1_lincRNA	NM_004418.3	NP_004409.1	Q05923	DUS2_HUMAN	dual specificity phosphatase 2	160					endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(1)|lung(2)|skin(1)	5		Ovarian(717;0.0228)				GGAGTCGGAGCGGCTGGTTTT	0.677																																					p.R160H		Atlas-SNP	.											.	DUSP2	20	.	0			c.G479A						PASS	.						12.0	17.0	15.0					2																	96810531		2184	4285	6469	SO:0001583	missense	1844	exon2			TCGGAGCGGCTGG	L11329	CCDS2016.1	2q11	2011-06-09			ENSG00000158050	ENSG00000158050		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3068	protein-coding gene	gene with protein product		603068				7806236, 7590752, 12673251	Standard	NM_004418		Approved	PAC-1	uc002svk.4	Q05923	OTTHUMG00000130456	ENST00000288943.4:c.479G>A	2.37:g.96810531C>T	ENSP00000288943:p.Arg160His	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	51	6	0.117647	NM_004418	Q53T45	Missense_Mutation	SNP	ENST00000288943.4	37	CCDS2016.1	.	.	.	.	.	.	.	.	.	.	c	13.14	2.148441	0.37923	.	.	ENSG00000158050	ENST00000288943	T	0.02498	4.27	4.0	-3.73	0.04398	.	1.159010	0.06242	N	0.690580	T	0.02888	0.0086	L	0.51422	1.61	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.46582	-0.9181	10	0.44086	T	0.13	.	1.8718	0.03210	0.1343:0.4233:0.1327:0.3096	.	160	Q05923	DUS2_HUMAN	H	160	ENSP00000288943:R160H	ENSP00000288943:R160H	R	-	2	0	DUSP2	96174258	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.775000	0.04679	-0.898000	0.03906	0.450000	0.29827	CGC	.	.	none		0.677	DUSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252847.1	NM_004418	
AURKB	9212	hgsc.bcm.edu	37	17	8108196	8108196	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr17:8108196A>G	ENST00000585124.1	-	9	1121	c.1028T>C	c.(1027-1029)gTc>gCc	p.V343A	AURKB_ENST00000578549.1_Missense_Mutation_p.V311A|AURKB_ENST00000316199.6_Missense_Mutation_p.V344A|AURKB_ENST00000535053.1_3'UTR|AURKB_ENST00000534871.1_Missense_Mutation_p.V302A	NM_004217.3	NP_004208.2	Q96GD4	AURKB_HUMAN	aurora kinase B	343					abscission (GO:0009838)|aging (GO:0007568)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|cleavage furrow formation (GO:0036089)|cytokinesis checkpoint (GO:0031565)|histone H3-S28 phosphorylation (GO:0043988)|histone modification (GO:0016570)|mitotic cell cycle (GO:0000278)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytokinesis (GO:0032467)|protein autophosphorylation (GO:0046777)|protein localization to kinetochore (GO:0034501)|protein phosphorylation (GO:0006468)|regulation of chromosome segregation (GO:0051983)|spindle checkpoint (GO:0031577)|spindle midzone assembly involved in mitosis (GO:0051256)|spindle stabilization (GO:0043146)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|central_nervous_system(1)|lung(2)	4						CCATCAGGCGACAGATTGAAG	0.572																																					p.V343A	NSCLC(134;1161 2470 43664 51568)	Atlas-SNP	.											.	AURKB	47	.	0			c.T1028C						PASS	.						70.0	70.0	70.0					17																	8108196		2203	4300	6503	SO:0001583	missense	9212	exon9			CAGGCGACAGATT	AF004022	CCDS11134.1, CCDS58514.1, CCDS67162.1	17p13.1	2013-01-17	2003-07-21	2003-07-23	ENSG00000178999	ENSG00000178999		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11390	protein-coding gene	gene with protein product	"""aurora-B"", ""aurora-1"", ""protein phosphatase 1, regulatory subunit 48"""	604970	"""serine/threonine kinase 12"""	STK12		9858806	Standard	NM_001256834		Approved	Aik2, IPL1, AurB, AIM-1, ARK2, STK5, PPP1R48	uc002gkm.4	Q96GD4	OTTHUMG00000108189	ENST00000585124.1:c.1028T>C	17.37:g.8108196A>G	ENSP00000463999:p.Val343Ala	Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	42	6	0.142857	NM_004217	B4DNM4|C7G533|C7G534|C7G535|D3DTR4|J9JID1|O14630|O60446|O95083|Q96DV5|Q9UQ46	Missense_Mutation	SNP	ENST00000585124.1	37	CCDS11134.1	.	.	.	.	.	.	.	.	.	.	A	9.318	1.057435	0.19907	.	.	ENSG00000178999	ENST00000316199;ENST00000534871	T	0.70399	-0.48	5.03	0.173	0.15036	.	1.328900	0.05074	N	0.482223	T	0.51584	0.1683	N	0.14661	0.345	0.30620	N	0.758543	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44651	-0.9314	10	0.33940	T	0.23	-10.2184	5.6234	0.17469	0.3103:0.1898:0.4999:0.0	.	343;343	C7G533;Q96GD4	.;AURKB_HUMAN	A	343;302	ENSP00000443869:V302A	ENSP00000313950:V343A	V	-	2	0	AURKB	8048921	0.000000	0.05858	0.026000	0.17262	0.280000	0.26924	-1.102000	0.03332	0.117000	0.18138	0.533000	0.62120	GTC	.	.	none		0.572	AURKB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000226995.2	NM_004217	
PISD	23761	hgsc.bcm.edu	37	22	32015667	32015667	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr22:32015667G>A	ENST00000439502.2	-	8	1384	c.1161C>T	c.(1159-1161)ccC>ccT	p.P387P	PISD_ENST00000478893.1_5'Flank|PISD_ENST00000397500.1_3'UTR|PISD_ENST00000336566.4_Silent_p.P386P|PISD_ENST00000266095.5_Silent_p.P353P|PISD_ENST00000382151.2_Silent_p.P353P			Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase	387					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylserine decarboxylase activity (GO:0004609)			central_nervous_system(3)|endometrium(2)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12					Phosphatidylserine(DB00144)	TGAAGTCCTTGGGGGCCTCGA	0.562																																					p.P353P		Atlas-SNP	.											.	PISD	53	.	0			c.C1059T						PASS	.						89.0	84.0	86.0					22																	32015667		2203	4300	6503	SO:0001819	synonymous_variant	23761	exon9			GTCCTTGGGGGCC		CCDS13899.1	22q12.2	2011-01-25			ENSG00000241878	ENSG00000241878	4.1.1.65		8999	protein-coding gene	gene with protein product		612770				10591208	Standard	NM_014338		Approved	dJ858B16.2, PSDC	uc003alk.2	Q9UG56	OTTHUMG00000030252	ENST00000439502.2:c.1161C>T	22.37:g.32015667G>A		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	90	13	0.144444	NM_014338	B1AKM7|O43207|O95535|Q6IC28|Q96GQ2|Q9UGA9	Silent	SNP	ENST00000439502.2	37		.	.	.	.	.	.	.	.	.	.	G	7.019	0.558312	0.13436	.	.	ENSG00000241878	ENST00000435900	.	.	.	5.29	3.17	0.36434	.	0.000000	0.85682	D	0.000000	T	0.62454	0.2429	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62039	-0.6938	6	0.87932	D	0	-35.6684	6.5047	0.22188	0.1533:0.0:0.7027:0.144	.	.	.	.	L	340	.	ENSP00000414395:P340L	P	-	2	0	PISD	30345667	0.985000	0.35326	1.000000	0.80357	0.659000	0.38960	0.069000	0.14552	0.593000	0.29745	-0.216000	0.12614	CCA	.	.	none		0.562	PISD-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000075106.4		
FRG2B	441581	hgsc.bcm.edu	37	10	135439077	135439077	+	Silent	SNP	T	T	C	rs201483744		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr10:135439077T>C	ENST00000425520.1	-	4	415	c.363A>G	c.(361-363)tcA>tcG	p.S121S	FRG2B_ENST00000443774.1_Silent_p.S122S	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	121						nucleus (GO:0005634)		p.S122S(1)		endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTTTATTCAATGACAAGCTGC	0.517																																					p.S121S		Atlas-SNP	.											FRG2B,NS,carcinoma,0,1	FRG2B	47	1	1	Substitution - coding silent(1)	kidney(1)	c.A363G						scavenged	.						33.0	40.0	37.0					10																	135439077		2128	4248	6376	SO:0001819	synonymous_variant	441581	exon4			ATTCAATGACAAG	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.363A>G	10.37:g.135439077T>C		Somatic	167	5	0.0299401		WXS	Illumina HiSeq	Phase_I	138	7	0.0507246	NM_001080998	Q5VSQ1	Silent	SNP	ENST00000425520.1	37	CCDS44502.1																																																																																			C|0.500;A|0.500	0.500	alt		0.517	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
MUC2	4583	hgsc.bcm.edu	37	11	1093094	1093094	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:1093094T>G	ENST00000441003.2	+	30	4940	c.4913T>G	c.(4912-4914)gTg>gGg	p.V1638G	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.V1605G|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.V1605G(1)|p.V1638G(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accactacggtgaccccaacc	0.627																																					p.V1638G		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,8	MUC2	614	8	2	Substitution - Missense(2)	lung(2)	c.T4913G						scavenged	.						70.0	127.0	107.0					11																	1093094		1817	3454	5271	SO:0001583	missense	4583	exon30			CTACGGTGACCCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4913T>G	11.37:g.1093094T>G	ENSP00000415183:p.Val1638Gly	Somatic	32	5	0.15625		WXS	Illumina HiSeq	Phase_I	31	8	0.258065	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	T	2.324	-0.355023	0.05138	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14022	2.54;3.16	1.66	-3.31	0.04988	.	0.262594	0.13470	U	0.385509	T	0.06462	0.0166	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.29822	-0.9999	9	0.41790	T	0.15	.	0.1958	0.00139	0.2143:0.1839:0.2436:0.3582	.	1638	E7EUV1	.	G	1638;1605	ENSP00000415183:V1638G;ENSP00000351956:V1605G	ENSP00000351956:V1605G	V	+	2	0	MUC2	1083094	0.003000	0.15002	0.000000	0.03702	0.171000	0.22731	1.577000	0.36515	-1.792000	0.01259	0.102000	0.15555	GTG	.	.	none		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MTMR11	10903	hgsc.bcm.edu	37	1	149906097	149906097	+	Missense_Mutation	SNP	C	C	T	rs143590446	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:149906097C>T	ENST00000439741.2	-	7	920	c.670G>A	c.(670-672)Gac>Aac	p.D224N	MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000369140.3_Missense_Mutation_p.D152N|MTMR11_ENST00000361405.6_Missense_Mutation_p.D224N|MTMR11_ENST00000406732.3_Missense_Mutation_p.D196N	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	224	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GTGGCTACGTCGAACCTCTCG	0.567													C|||	2	0.000399361	0.0	0.0	5008	,	,		18552	0.002		0.0	False		,,,				2504	0.0				p.D224N		Atlas-SNP	.											.	MTMR11	136	.	0			c.G670A						PASS	.	C	ASN/ASP,ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	100.0	95.0	97.0		670,454	6.1	1.0	1	dbSNP_134	97	0,8600		0,0,4300	yes	missense,missense	MTMR11	NM_001145862.1,NM_181873.3	23,23	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	224/710,152/641	149906097	1,13005	2203	4300	6503	SO:0001583	missense	10903	exon7			CTACGTCGAACCT	AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.670G>A	1.37:g.149906097C>T	ENSP00000391668:p.Asp224Asn	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	52	11	0.211538	NM_001145862	B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Missense_Mutation	SNP	ENST00000439741.2	37	CCDS53360.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	24.0	4.483644	0.84854	2.27E-4	0.0	ENSG00000014914	ENST00000369140;ENST00000439741;ENST00000361405;ENST00000406732;ENST00000405710	D;D;T;D	0.92595	-3.07;-2.67;0.88;-3.07	6.07	6.07	0.98685	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.054950	0.64402	D	0.000001	D	0.91788	0.7402	N	0.24115	0.695	0.53005	D	0.999965	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.78314	0.977;0.984;0.984;0.991	D	0.91383	0.5129	10	0.40728	T	0.16	.	18.1378	0.89627	0.0:1.0:0.0:0.0	.	66;196;152;224	F8W8W0;A4FU01-6;A4FU01-4;A4FU01	.;.;.;MTMRB_HUMAN	N	152;224;224;196;66	ENSP00000358136:D152N;ENSP00000391668:D224N;ENSP00000354941:D224N;ENSP00000383948:D196N	ENSP00000354941:D224N	D	-	1	0	MTMR11	148172721	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.244000	0.72391	2.884000	0.98904	0.655000	0.94253	GAC	C|1.000;T|0.000	0.000	strong		0.567	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_181873	
CBLB	868	hgsc.bcm.edu	37	3	105495385	105495385	+	Splice_Site	SNP	G	G	A	rs369966206		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr3:105495385G>A	ENST00000264122.4	-	4	742	c.421C>T	c.(421-423)Cga>Tga	p.R141*	CBLB_ENST00000394027.3_Splice_Site_p.R163*|CBLB_ENST00000545639.1_Intron|CBLB_ENST00000405772.1_Splice_Site_p.R141*|CBLB_ENST00000403724.1_Splice_Site_p.R141*	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	141	4H.|Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R141*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						GTGAGATTTCGTCTGTAGGCA	0.348			Mis S		AML																																p.R141X	GBM(93;588 1337 9788 29341 43499)	Atlas-SNP	.		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	CBLB,NS,carcinoma,+1,3	CBLB	118	3	1	Substitution - Nonsense(1)	lung(1)	c.C421T						PASS	.	G	stop/ARG	0,4406		0,0,2203	103.0	100.0	101.0		421	3.9	0.8	3		101	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained-near-splice	CBLB	NM_170662.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		141/983	105495385	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	868	exon4			GATTTCGTCTGTA	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.420-1C>T	3.37:g.105495385G>A		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	64	12	0.1875	NM_170662	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Nonsense_Mutation	SNP	ENST00000264122.4	37	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	G	39	7.302140	0.98196	0.0	1.16E-4	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	.	.	.	5.79	3.86	0.44501	.	0.057808	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.1062	9.6351	0.39802	0.0697:0.0:0.6249:0.3054	.	.	.	.	X	141;163;141;141	.	ENSP00000264122:R141X	R	-	1	2	CBLB	106978075	1.000000	0.71417	0.802000	0.32245	0.896000	0.52359	2.245000	0.43133	0.728000	0.32382	0.557000	0.71058	CGA	.	.	weak		0.348	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	Nonsense_Mutation
CRIPAK	285464	hgsc.bcm.edu	37	4	1388726	1388726	+	Missense_Mutation	SNP	T	T	C	rs199689156	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr4:1388726T>C	ENST00000324803.4	+	1	3387	c.427T>C	c.(427-429)Tgc>Cgc	p.C143R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	143					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGCGGAGTGCC	0.697																																					p.C143R		Atlas-SNP	.											CRIPAK,colon,carcinoma,0,4	CRIPAK	185	4	0			c.T427C						scavenged	.						38.0	37.0	37.0					4																	1388726		1908	3685	5593	SO:0001583	missense	285464	exon1			TGCCCATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.427T>C	4.37:g.1388726T>C	ENSP00000323978:p.Cys143Arg	Somatic	34	4	0.117647		WXS	Illumina HiSeq	Phase_I	18	7	0.388889	NM_175918	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	8.608|8.608	0.888529|0.888529	0.17540|0.17540	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	0.948|0.948	-0.668|-0.668	0.11392|0.11392	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.12860|0.12860	0.0312|0.0312	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.27594|.	0.182|.	B|.	0.13407|.	0.009|.	T|T	0.30621|0.30621	-0.9972|-0.9972	9|6	0.51188|0.06365	T|T	0.08|0.9	.|.	4.4755|4.4755	0.11733|0.11733	0.0:0.2357:0.0:0.7643|0.0:0.2357:0.0:0.7643	.|.	143|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	143|126	ENSP00000323978:C143R|.	ENSP00000323978:C143R|ENSP00000372402:M126T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378726|1378726	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.008000|0.008000	0.06430|0.06430	-0.703000|-0.703000	0.05063|0.05063	-0.155000|-0.155000	0.11098|0.11098	0.102000|0.102000	0.15555|0.15555	TGC|ATG	T|0.980;C|0.020	0.020	strong		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
TMPRSS13	84000	hgsc.bcm.edu	37	11	117789327	117789327	+	Missense_Mutation	SNP	T	T	C	rs201746372|rs58754377|rs61900346	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:117789327T>C	ENST00000430170.2	-	2	335	c.248A>G	c.(247-249)cAg>cGg	p.Q83R	TMPRSS13_ENST00000524993.1_Missense_Mutation_p.Q83R|TMPRSS13_ENST00000445164.2_Missense_Mutation_p.Q83R|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.Q83R|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.Q83R	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	83	13 X 5 AA repeats of A-S-P-A-[GLQR].|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.Q83_A87delQASPA(1)		endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TGGAGATGCCTGGGCTGGAGA	0.672													t|||	6	0.00119808	0.0038	0.0	5008	,	,		14227	0.001		0.0	False		,,,				2504	0.0				p.Q83R		Atlas-SNP	.											TMPRSS13_ENST00000445164,NS,carcinoma,0,4	TMPRSS13	75	4	1	Deletion - In frame(1)	urinary_tract(1)	c.A248G						scavenged	.						30.0	37.0	35.0					11																	117789327		1948	4128	6076	SO:0001583	missense	84000	exon2			GATGCCTGGGCTG	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.248A>G	11.37:g.117789327T>C	ENSP00000387702:p.Gln83Arg	Somatic	55	1	0.0181818		WXS	Illumina HiSeq	Phase_I	63	8	0.126984	NM_001206790	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	CCDS58185.1	408|408	0.18681318681318682|0.18681318681318682	89|89	0.18089430894308944|0.18089430894308944	74|74	0.20441988950276244|0.20441988950276244	90|90	0.15734265734265734|0.15734265734265734	155|155	0.20448548812664907|0.20448548812664907	T|t	0.044|0.044	-1.272742|-1.272742	0.01421|0.01421	.|.	.|.	ENSG00000137747|ENSG00000137747	ENST00000336500|ENST00000528626;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	.|D;D;D;D;D	.|0.87729	.|-2.27;-2.29;-2.29;-2.27;-2.17	3.98|3.98	0.663|0.663	0.17885|0.17885	.|.	.|0.679012	.|0.12584	.|N	.|0.456148	.|T	.|0.00144	.|0.0004	.|.	.|.	.|.	0.80722|0.80722	P|P	0.0|0.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	.|T	.|0.10917	.|-1.0609	.|8	.|0.02654	.|T	.|1	.|.	6.985|6.985	0.24723|0.24723	0.0:0.7178:0.1731:0.1091|0.0:0.7178:0.1731:0.1091	rs61900346|rs61900346	.|78;83	.|Q9BYE2-4;E9PRA0	.|.;.	.|R	-1|83	.|ENSP00000435813:Q83R;ENSP00000434279:Q83R;ENSP00000387702:Q83R;ENSP00000394114:Q83R;ENSP00000436502:Q83R	.|ENSP00000387702:Q83R	.|Q	-|-	.|2	.|0	TMPRSS13|TMPRSS13	117294537|117294537	0.000000|0.000000	0.05858|0.05858	0.014000|0.014000	0.15608|0.15608	0.022000|0.022000	0.10575|0.10575	-1.912000|-1.912000	0.01582|0.01582	0.897000|0.897000	0.36392|0.36392	-0.390000|-0.390000	0.06520|0.06520	.|CAG	T|0.814;C|0.186	0.186	strong		0.672	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
TUBB8	347688	hgsc.bcm.edu	37	10	95169	95169	+	Missense_Mutation	SNP	T	T	G	rs199817418	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr10:95169T>G	ENST00000309812.4	-	1	72	c.10A>C	c.(10-12)Atc>Ctc	p.I4L	TUBB8_ENST00000447903.2_Intron|TUBB8_ENST00000413237.3_Intron|TUBB8_ENST00000332708.5_Missense_Mutation_p.I4L	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	4					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GTGAGCACGATCTCCCTCATG	0.667																																					p.I4L	Pancreas(192;2041 3010 9013 18103)	Atlas-SNP	.											TUBB8,colon,carcinoma,0,2	TUBB8	62	2	0			c.A10C						scavenged	.						18.0	17.0	17.0					10																	95169		2196	4294	6490	SO:0001583	missense	347688	exon1			GCACGATCTCCCT	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.10A>C	10.37:g.95169T>G	ENSP00000311042:p.Ile4Leu	Somatic	100	4	0.04		WXS	Illumina HiSeq	Phase_I	108	4	0.037037	NM_177987	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	T	7.968	0.748352	0.15710	.	.	ENSG00000173876	ENST00000440680;ENST00000328974;ENST00000309812;ENST00000332708	T;T	0.75704	-0.96;-0.76	0.109	0.109	0.14578	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.64402	U	0.000017	T	0.73938	0.3651	M	0.88450	2.955	0.80722	D	1	B;B	0.09022	0.0;0.002	B;B	0.27608	0.001;0.081	T	0.68334	-0.5436	10	0.87932	D	0	.	4.6217	0.12455	0.0:4.0E-4:0.0:0.9996	.	4;4	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	L	4	ENSP00000311042:I4L;ENSP00000371071:I4L	ENSP00000311042:I4L	I	-	1	0	RP11-631M21.2	85169	1.000000	0.71417	0.020000	0.16555	0.020000	0.10135	2.326000	0.43849	0.156000	0.19299	0.155000	0.16302	ATC	T|0.980;G|0.020	0.020	strong		0.667	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
SPATA3	130560	hgsc.bcm.edu	37	2	231861059	231861059	+	Silent	SNP	A	A	T	rs72362780		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr2:231861059A>T	ENST00000452881.1	+	1	219	c.111A>T	c.(109-111)ccA>ccT	p.P37P	SPATA3_ENST00000455816.1_Silent_p.P37P|AC105344.2_ENST00000414876.1_lincRNA|SPATA3_ENST00000433428.2_Silent_p.P37P|SPATA3_ENST00000424440.1_Silent_p.P37P			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	37										endometrium(2)|lung(1)	3						AATCCACACCACAGCAGCCTA	0.572																																					p.P37P		Atlas-SNP	.											SPATA3,NS,carcinoma,0,4	SPATA3	52	4	0			c.A111T						scavenged	.						127.0	133.0	131.0					2																	231861059		692	1591	2283	SO:0001819	synonymous_variant	130560	exon1			CACACCACAGCAG	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.111A>T	2.37:g.231861059A>T		Somatic	103	4	0.038835		WXS	Illumina HiSeq	Phase_I	89	13	0.146067	NM_139073	Q86WX5|Q8N9Y6	Silent	SNP	ENST00000452881.1	37	CCDS2481.1																																																																																			.	.	none		0.572	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
FLG	2312	hgsc.bcm.edu	37	1	152278749	152278749	+	Silent	SNP	T	T	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr1:152278749T>G	ENST00000368799.1	-	3	8648	c.8613A>C	c.(8611-8613)tcA>tcC	p.S2871S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2871	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGACTGCCTGTGAGTGTCTAG	0.562									Ichthyosis																												p.S2871S		Atlas-SNP	.											.	FLG	900	.	0			c.A8613C						PASS	.						174.0	278.0	244.0					1																	152278749		2116	4297	6413	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TGCCTGTGAGTGT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8613A>C	1.37:g.152278749T>G		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	110	11	0.1	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			.	.	none		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
KRTAP4-6	81871	hgsc.bcm.edu	37	17	39296423	39296423	+	Missense_Mutation	SNP	C	C	T	rs349790	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr17:39296423C>T	ENST00000345847.4	-	1	316	c.317G>A	c.(316-318)cGt>cAt	p.R106H		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	106	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						GCAGCTGGGACGGCAGCAAGT	0.652													C|||	64	0.0127796	0.0023	0.0303	5008	,	,		18713	0.006		0.0149	False		,,,				2504	0.0194				p.R106H		Atlas-SNP	.											KRTAP4-6,NS,carcinoma,0,2	KRTAP4-6	46	2	0			c.G317A						scavenged	.																																			SO:0001583	missense	81871	exon1			CTGGGACGGCAGC	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.317G>A	17.37:g.39296423C>T	ENSP00000328270:p.Arg106His	Somatic	43	2	0.0465116		WXS	Illumina HiSeq	Phase_I	54	4	0.0740741	NM_030976	Q9BYR1	Missense_Mutation	SNP	ENST00000345847.4	37	CCDS54125.1	31	0.014194139194139194	5	0.01016260162601626	4	0.011049723756906077	6	0.01048951048951049	16	0.021108179419525065	.	11.71	1.719810	0.30503	.	.	ENSG00000198090	ENST00000345847	T	0.01505	4.82	5.0	-8.28	0.01013	.	209.318000	0.00520	U	0.000185	T	0.01695	0.0054	M	0.76838	2.35	0.09310	N	1	.	.	.	.	.	.	T	0.38373	-0.9664	8	0.38643	T	0.18	.	4.1396	0.10188	0.0982:0.3223:0.0969:0.4827	.	.	.	.	H	106	ENSP00000328270:R106H	ENSP00000328270:R106H	R	-	2	0	KRTAP4-6	36549949	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.922000	0.04004	-1.133000	0.02903	-2.248000	0.00284	CGT	C|0.988;T|0.012	0.012	strong		0.652	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
GOLGA6L6	727832	hgsc.bcm.edu	37	15	20740191	20740191	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr15:20740191C>A	ENST00000427390.2	-	8	1649	c.1559G>T	c.(1558-1560)cGg>cTg	p.R520L		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	520	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						ctcctgctcccgtatcttctc	0.557																																					p.R520L		Atlas-SNP	.											GOLGA6L6,NS,carcinoma,-1,2	GOLGA6L6	37	2	0			c.G1559T						scavenged	.						125.0	125.0	125.0					15																	20740191		678	1566	2244	SO:0001583	missense	727832	exon8			TGCTCCCGTATCT	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1559G>T	15.37:g.20740191C>A	ENSP00000398615:p.Arg520Leu	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	81	5	0.0617284	NM_001145004	D3YTC0	Missense_Mutation	SNP	ENST00000427390.2	37	CCDS45184.1	.	.	.	.	.	.	.	.	.	.	C	0.121	-1.125295	0.01770	.	.	ENSG00000215405	ENST00000427390	T	0.09538	2.97	.	.	.	.	.	.	.	.	T	0.04724	0.0128	N	0.19112	0.55	0.09310	N	1	B	0.27013	0.166	B	0.18263	0.021	T	0.38628	-0.9652	7	0.25751	T	0.34	.	.	.	.	.	520	A8MZA4	GG6L6_HUMAN	L	520	ENSP00000398615:R520L	ENSP00000398615:R520L	R	-	2	0	GOLGA6L6	19000205	0.111000	0.22076	0.010000	0.14722	0.010000	0.07245	0.689000	0.25437	-1.268000	0.02439	-1.252000	0.01501	CGG	.	.	none		0.557	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414660.3	NM_001145004	
CLCN3	1182	hgsc.bcm.edu	37	4	170616831	170616831	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr4:170616831T>G	ENST00000513761.1	+	8	1564	c.1005T>G	c.(1003-1005)ttT>ttG	p.F335L	CLCN3_ENST00000504131.2_Missense_Mutation_p.F318L|CLCN3_ENST00000347613.4_Missense_Mutation_p.F335L|CLCN3_ENST00000360642.3_Intron	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	335					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		GAGTTCTTTTTAGCCTGGAAG	0.348																																					p.F335L		Atlas-SNP	.											.	CLCN3	85	.	0			c.T1005G						PASS	.						82.0	87.0	85.0					4																	170616831		2203	4300	6503	SO:0001583	missense	1182	exon8			TCTTTTTAGCCTG	X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.1005T>G	4.37:g.170616831T>G	ENSP00000424603:p.Phe335Leu	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	55	8	0.145455	NM_001829	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	ENST00000513761.1	37	CCDS34101.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.13|18.13	3.554513|3.554513	0.65425|0.65425	.|.	.|.	ENSG00000109572|ENSG00000109572	ENST00000513761;ENST00000347613;ENST00000504131;ENST00000507875|ENST00000515420	D;D;D;D|.	0.96885|.	-4.16;-4.16;-4.16;-4.16|.	5.9|5.9	0.483|0.483	0.16820|0.16820	Chloride channel, core (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.85431|.	0.5695|.	H|H	0.97682|0.97682	4.055|4.055	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.998;1.0;0.999|.	D|.	0.85847|.	0.1401|.	10|.	0.87932|.	D|.	0|.	-12.0339|-12.0339	10.6439|10.6439	0.45608|0.45608	0.0:0.3784:0.0:0.6216|0.0:0.3784:0.0:0.6216	.|.	318;308;335;335|.	B9EGJ9;E9PE15;P51790;P51790-2|.	.;.;CLCN3_HUMAN;.|.	L|X	335;335;318;308|17	ENSP00000424603:F335L;ENSP00000261514:F335L;ENSP00000424540:F318L;ENSP00000425323:F308L|.	ENSP00000261514:F335L|.	F|L	+|+	3|2	2|0	CLCN3|CLCN3	170853406|170853406	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.671000|0.671000	0.39405|0.39405	0.955000|0.955000	0.29188|0.29188	-0.106000|-0.106000	0.12110|0.12110	-0.973000|-0.973000	0.02599|0.02599	TTT|TTA	.	.	none		0.348	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363210.2		
KDM2B	84678	hgsc.bcm.edu	37	12	121882313	121882313	+	Silent	SNP	G	G	A	rs34911648	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:121882313G>A	ENST00000377071.4	-	15	2202	c.2130C>T	c.(2128-2130)aaC>aaT	p.N710N	KDM2B_ENST00000377069.4_Silent_p.N679N|KDM2B_ENST00000542973.1_Silent_p.N78N|KDM2B_ENST00000536437.1_Intron	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	710					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						GAAGCTCGTCGTTGACCACAC	0.617													G|||	75	0.014976	0.0567	0.0	5008	,	,		17551	0.0		0.0	False		,,,				2504	0.0				p.N710N		Atlas-SNP	.											.	KDM2B	218	.	0			c.C2130T						PASS	.	G	,	234,4058		6,222,1918	85.0	90.0	88.0		2037,2130	3.0	1.0	12	dbSNP_126	88	1,8465		0,1,4232	no	coding-synonymous,coding-synonymous	KDM2B	NM_001005366.1,NM_032590.4	,	6,223,6150	AA,AG,GG		0.0118,5.452,1.842	,	679/1266,710/1337	121882313	235,12523	2146	4233	6379	SO:0001819	synonymous_variant	84678	exon15			CTCGTCGTTGACC	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2130C>T	12.37:g.121882313G>A		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	52	11	0.211538	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Silent	SNP	ENST00000377071.4	37	CCDS41850.1																																																																																			G|0.990;A|0.010	0.010	strong		0.617	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
NF1	4763	hgsc.bcm.edu	37	17	29528446	29528446	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr17:29528446T>A	ENST00000358273.4	+	11	1586	c.1203T>A	c.(1201-1203)aaT>aaA	p.N401K	NF1_ENST00000431387.4_Missense_Mutation_p.N401K|NF1_ENST00000356175.3_Missense_Mutation_p.N401K	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	401					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGGCTCAGAATTCACCTTCTA	0.303			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.N401K		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	14	Whole gene deletion(8)|Unknown(6)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|lung(1)	c.T1203A						PASS	.						80.0	89.0	86.0					17																	29528446		2203	4295	6498	SO:0001583	missense	4763	exon11	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TCAGAATTCACCT		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1203T>A	17.37:g.29528446T>A	ENSP00000351015:p.Asn401Lys	Somatic	276	0	0		WXS	Illumina HiSeq	Phase_I	312	30	0.0961538	NM_001128147	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.223593	0.39300	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175;ENST00000456735	T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43	5.17	3.87	0.44632	Armadillo-type fold (1);	0.167666	0.56097	D	0.000026	T	0.69797	0.3151	L	0.42245	1.32	0.80722	D	1	B;B;B;B;B	0.33413	0.411;0.013;0.031;0.161;0.161	B;B;B;B;B	0.30495	0.08;0.017;0.034;0.116;0.073	T	0.71159	-0.4674	10	0.59425	D	0.04	.	6.7182	0.23314	0.139:0.0845:0.0:0.7765	.	401;401;401;401;401	E1P657;P21359-2;P21359;Q14931;P21359-3	.;.;NF1_HUMAN;.;.	K	401;401;401;67	ENSP00000412921:N401K;ENSP00000351015:N401K;ENSP00000348498:N401K;ENSP00000389907:N67K	ENSP00000348498:N401K	N	+	3	2	NF1	26552572	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.032000	0.41127	1.953000	0.56701	0.402000	0.26972	AAT	.	.	none		0.303	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
SIRT4	23409	hgsc.bcm.edu	37	12	120750455	120750455	+	Missense_Mutation	SNP	G	G	A	rs557152464		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr12:120750455G>A	ENST00000202967.4	+	3	753	c.694G>A	c.(694-696)Gtt>Att	p.V232I	RNU6-1088P_ENST00000516850.1_RNA|SIRT4_ENST00000537892.1_3'UTR	NM_012240.2	NP_036372.1			sirtuin 4											haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACCAGATGTCGTTTTCTTCGG	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		19764	0.0		0.0	False		,,,				2504	0.001				p.V232I		Atlas-SNP	.											SIRT4,colon,carcinoma,0,1	SIRT4	29	1	0			c.G694A						PASS	.						73.0	67.0	69.0					12																	120750455		2203	4300	6503	SO:0001583	missense	23409	exon3			GATGTCGTTTTCT	AF083109	CCDS9194.1	12q24.31	2010-06-25	2010-06-25		ENSG00000089163	ENSG00000089163			14932	protein-coding gene	gene with protein product		604482	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 4"", ""sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae)"""			10381378	Standard	NM_012240		Approved	SIR2L4	uc001tyc.3	Q9Y6E7	OTTHUMG00000169028	ENST00000202967.4:c.694G>A	12.37:g.120750455G>A	ENSP00000202967:p.Val232Ile	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	70	9	0.128571	NM_012240		Missense_Mutation	SNP	ENST00000202967.4	37	CCDS9194.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.315918	0.60524	.	.	ENSG00000089163	ENST00000202967	T	0.53857	0.6	4.5	1.39	0.22231	.	0.235849	0.41712	N	0.000829	T	0.51500	0.1678	M	0.69358	2.11	0.29480	N	0.856439	P	0.48589	0.912	P	0.46850	0.529	T	0.51694	-0.8673	10	0.46703	T	0.11	-7.8021	7.933	0.29914	0.4701:0.0:0.5299:0.0	.	232	Q9Y6E7	SIRT4_HUMAN	I	232	ENSP00000202967:V232I	ENSP00000202967:V232I	V	+	1	0	SIRT4	119234838	0.999000	0.42202	0.313000	0.25210	0.655000	0.38815	3.571000	0.53841	0.196000	0.20367	-0.201000	0.12746	GTT	.	.	none		0.527	SIRT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402003.1	NM_012240	
TMEM130	222865	hgsc.bcm.edu	37	7	98449156	98449156	+	Silent	SNP	C	C	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr7:98449156C>G	ENST00000416379.2	-	6	898	c.894G>C	c.(892-894)gcG>gcC	p.A298A	TMEM130_ENST00000546258.1_Silent_p.A279A|TMEM130_ENST00000450876.1_Silent_p.A214A|TMEM130_ENST00000339375.4_Silent_p.A298A|TMEM130_ENST00000345589.4_Silent_p.A196A			Q8N3G9	TM130_HUMAN	transmembrane protein 130	298						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	25	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TCAGGTTGTACGCTGTGCTGG	0.602																																					p.A298A		Atlas-SNP	.											TMEM130,NS,carcinoma,0,1	TMEM130	54	1	0			c.G894C						scavenged	.						123.0	88.0	100.0					7																	98449156		2203	4300	6503	SO:0001819	synonymous_variant	222865	exon6			GTTGTACGCTGTG		CCDS5658.1, CCDS47649.1, CCDS47650.1	7q22.1	2006-03-09			ENSG00000166448	ENSG00000166448			25429	protein-coding gene	gene with protein product						12975309	Standard	NM_152913		Approved	DKFZp761L1417, FLJ42643	uc003upo.3	Q8N3G9	OTTHUMG00000154419	ENST00000416379.2:c.894G>C	7.37:g.98449156C>G		Somatic	66	2	0.030303		WXS	Illumina HiSeq	Phase_I	46	5	0.108696	NM_152913	A4D266|B7Z364|Q8IY46|Q8N0W9|Q8N3R2	Silent	SNP	ENST00000416379.2	37	CCDS47650.1																																																																																			.	.	none		0.602	TMEM130-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380713.1	NM_152913	
ZNF568	374900	hgsc.bcm.edu	37	19	37488197	37488197	+	Missense_Mutation	SNP	G	G	A	rs1345748	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:37488197G>A	ENST00000455427.2	+	9	1741	c.1412G>A	c.(1411-1413)tGt>tAt	p.C471Y		NM_001204839.1	NP_001191768.1	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	502					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAGAAACCCTGTAAGTGTAAG	0.448													g|||	2487	0.496605	0.6006	0.5346	5008	,	,		22777	0.25		0.5109	False		,,,				2504	0.5685				p.C535Y		Atlas-SNP	.											.	ZNF568	106	.	0			c.G1604A						PASS	.																																			SO:0001583	missense	374900	exon10			AACCCTGTAAGTG	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000455427.2:c.1412G>A	19.37:g.37488197G>A	ENSP00000413396:p.Cys471Tyr	Somatic	2	0	0		WXS	Illumina HiSeq	Phase_I	7	5	0.714286	NM_001204838	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000455427.2	37	CCDS56093.1	1029	0.47115384615384615	300	0.6097560975609756	189	0.5220994475138122	148	0.25874125874125875	392	0.5171503957783641	a	0.106	-1.145078	0.01714	.	.	ENSG00000198453	ENST00000444991;ENST00000455427	T;T	0.12039	2.72;2.72	3.79	3.79	0.43588	.	.	.	.	.	T	0.00012	0.0000	N	0.00066	-2.3	0.09310	P	0.99999999733738	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42481	-0.9449	8	0.02654	T	1	.	3.4574	0.07521	0.6931:0.0:0.1104:0.1964	rs1345748;rs1644696;rs17272422;rs52803036;rs57207438;rs1345748	471;471	E7ER33;B4DS92	.;.	Y	535;471	ENSP00000389794:C535Y;ENSP00000413396:C471Y	ENSP00000389794:C535Y	C	+	2	0	ZNF568	42180037	.	.	0.949000	0.38748	0.985000	0.73830	.	.	0.628000	0.30357	-0.334000	0.08254	TGT	G|0.530;A|0.469	0.469	strong		0.448	ZNF568-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000457465.1	NM_198539	
LAMA1	284217	hgsc.bcm.edu	37	18	7049165	7049165	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr18:7049165C>T	ENST00000389658.3	-	5	773	c.680G>A	c.(679-681)cGc>cAc	p.R227H		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	227	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GCGTTGCAAGCGAAGGCGAAT	0.468																																					p.R227H		Atlas-SNP	.											.	LAMA1	458	.	0			c.G680A						PASS	.						148.0	123.0	131.0					18																	7049165		2203	4300	6503	SO:0001583	missense	284217	exon5			TGCAAGCGAAGGC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.680G>A	18.37:g.7049165C>T	ENSP00000374309:p.Arg227His	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	113	14	0.123894	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623061	0.87460	.	.	ENSG00000101680	ENST00000389658	T	0.76709	-1.04	5.85	4.95	0.65309	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.87334	0.6151	M	0.82517	2.595	0.48395	D	0.999643	D	0.89917	1.0	D	0.75484	0.986	D	0.87835	0.2647	10	0.62326	D	0.03	.	11.2793	0.49184	0.0:0.8035:0.128:0.0684	.	227	P25391	LAMA1_HUMAN	H	227	ENSP00000374309:R227H	ENSP00000374309:R227H	R	-	2	0	LAMA1	7039165	1.000000	0.71417	0.866000	0.34008	0.886000	0.51366	2.476000	0.45171	2.767000	0.95098	0.557000	0.71058	CGC	.	.	none		0.468	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
LILRA2	11027	hgsc.bcm.edu	37	19	55086872	55086872	+	Missense_Mutation	SNP	T	T	C	rs558649481	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:55086872T>C	ENST00000251377.3	+	6	938	c.805T>C	c.(805-807)Tgg>Cgg	p.W269R	LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000391738.3_Missense_Mutation_p.W269R|LILRA2_ENST00000391737.1_Missense_Mutation_p.W257R|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000251376.3_Missense_Mutation_p.W269R|LILRB1_ENST00000396321.2_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	269	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		GCGCCCTGGTTGGCAGCCCCA	0.622													t|||	24	0.00479233	0.0	0.0	5008	,	,		15887	0.0		0.001	False		,,,				2504	0.0235				p.W269R		Atlas-SNP	.											LILRA2,NS,carcinoma,-1,1	LILRA2	99	1	0			c.T805C						scavenged	.						78.0	76.0	76.0					19																	55086872		2203	4300	6503	SO:0001583	missense	11027	exon5			CCTGGTTGGCAGC	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.805T>C	19.37:g.55086872T>C	ENSP00000251377:p.Trp269Arg	Somatic	215	4	0.0186047		WXS	Illumina HiSeq	Phase_I	169	4	0.0236686	NM_001130917	O75020	Missense_Mutation	SNP	ENST00000251377.3	37	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.976686	0.00452	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.00686	5.85;5.85;5.85;5.85;5.85	2.26	-1.89	0.07689	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	3.839380	0.00628	N	0.000462	T	0.00384	0.0012	N	0.00926	-1.1	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.12156	0.007;0.001;0.001;0.001	T	0.45556	-0.9253	10	0.12103	T	0.63	.	5.5546	0.17109	0.0:0.4435:0.0:0.5565	.	269;257;269;269	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	R	269;269;269;269;257	ENSP00000388131:W269R;ENSP00000251377:W269R;ENSP00000375618:W269R;ENSP00000251376:W269R;ENSP00000375617:W257R	ENSP00000251376:W269R	W	+	1	0	LILRA2	59778684	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.571000	0.02138	-0.336000	0.08438	-1.727000	0.00703	TGG	.	.	none		0.622	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
TPTE2	93492	hgsc.bcm.edu	37	13	20056679	20056679	+	Missense_Mutation	SNP	T	T	G	rs200244531		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr13:20056679T>G	ENST00000400230.2	-	4	172	c.128A>C	c.(127-129)gAa>gCa	p.E43A	TPTE2_ENST00000382978.1_Missense_Mutation_p.E43A|TPTE2_ENST00000400103.2_Missense_Mutation_p.E43A|TPTE2_ENST00000382975.4_Missense_Mutation_p.E43A|TPTE2_ENST00000382977.4_Missense_Mutation_p.E43A|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000457266.2_Missense_Mutation_p.E43A			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	43					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E43A(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		GGAAAGTCGTTCTAACATACT	0.313																																					p.E43A		Atlas-SNP	.											TPTE2_ENST00000400230,NS,carcinoma,0,1	TPTE2	225	1	1	Substitution - Missense(1)	kidney(1)	c.A128C						scavenged	.						52.0	51.0	51.0					13																	20056679		2201	4299	6500	SO:0001583	missense	93492	exon5			AGTCGTTCTAACA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.128A>C	13.37:g.20056679T>G	ENSP00000383089:p.Glu43Ala	Somatic	560	8	0.0142857		WXS	Illumina HiSeq	Phase_I	517	8	0.0154739	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	2.387	-0.340821	0.05243	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94931	-3.56;-3.53;-3.47;-3.47;-3.56;-3.53	2.06	0.858	0.19030	.	0.878504	0.09602	U	0.780065	D	0.86159	0.5866	N	0.21448	0.665	0.09310	N	1	B;B	0.28850	0.225;0.0	B;B	0.19946	0.027;0.0	T	0.74598	-0.3612	9	.	.	.	-0.5937	3.8365	0.08896	0.0:0.192:0.0:0.808	.	43;43	A8MX64;Q6XPS3	.;TPTE2_HUMAN	A	43	ENSP00000372438:E43A;ENSP00000382974:E43A;ENSP00000383089:E43A;ENSP00000372437:E43A;ENSP00000372435:E43A;ENSP00000442218:E43A	.	E	-	2	0	TPTE2	18954679	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.422000	0.21296	0.241000	0.21283	0.383000	0.25322	GAA	.	.	weak		0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
LPHN1	22859	hgsc.bcm.edu	37	19	14266282	14266282	+	Silent	SNP	G	G	A			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr19:14266282G>A	ENST00000340736.6	-	19	3495	c.3198C>T	c.(3196-3198)ttC>ttT	p.F1066F	CTB-55O6.12_ENST00000592086.1_RNA|CTB-55O6.12_ENST00000588658.1_RNA|CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000361434.3_Silent_p.F1061F	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1066					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGAGGAGGCCGAAAGCCCAGG	0.622																																					p.F1066F		Atlas-SNP	.											.	LPHN1	107	.	0			c.C3198T						PASS	.						90.0	86.0	87.0					19																	14266282		2203	4300	6503	SO:0001819	synonymous_variant	22859	exon19			GAGGCCGAAAGCC	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.3198C>T	19.37:g.14266282G>A		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	88	17	0.193182	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Silent	SNP	ENST00000340736.6	37	CCDS32928.1																																																																																			.	.	none		0.622	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
SBF1	6305	hgsc.bcm.edu	37	22	50887015	50887015	+	Missense_Mutation	SNP	C	C	T	rs367954544		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr22:50887015C>T	ENST00000390679.3	-	36	5214	c.5030G>A	c.(5029-5031)cGg>cAg	p.R1677Q	SBF1_ENST00000380817.3_Missense_Mutation_p.R1703Q|SBF1_ENST00000348911.6_Missense_Mutation_p.R1678Q			O95248	MTMR5_HUMAN	SET binding factor 1	1677					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		AGCCTTCACCCGGTCCCAGGT	0.622																																					p.R1703Q		Atlas-SNP	.											.	SBF1	211	.	0			c.G5108A						PASS	.						37.0	45.0	42.0					22																	50887015		2039	4208	6247	SO:0001583	missense	6305	exon37			TTCACCCGGTCCC	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.5030G>A	22.37:g.50887015C>T	ENSP00000375097:p.Arg1677Gln	Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	33	4	0.121212	NM_002972	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		.	.	.	.	.	.	.	.	.	.	C	19.07	3.755100	0.69648	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000337034;ENST00000390679	T;T;T	0.11604	2.76;2.76;2.76	4.57	4.57	0.56435	.	0.367621	0.27406	N	0.019512	T	0.07188	0.0182	N	0.14661	0.345	0.35309	D	0.783682	P;P;P	0.52061	0.95;0.948;0.95	P;B;B	0.44422	0.449;0.182;0.382	T	0.21484	-1.0244	10	0.45353	T	0.12	.	7.4391	0.27172	0.0:0.8096:0.0:0.1904	.	1677;1703;224	O95248;O95248-4;A6PVG7	MTMR5_HUMAN;.;.	Q	1703;1678;1713;1677	ENSP00000370196:R1703Q;ENSP00000252027:R1678Q;ENSP00000375097:R1677Q	ENSP00000336522:R1713Q	R	-	2	0	SBF1	49233881	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.230000	0.58632	2.285000	0.76669	0.491000	0.48974	CGG	.	.	weak		0.622	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
ZNF589	51385	hgsc.bcm.edu	37	3	48309736	48309736	+	Silent	SNP	A	A	G			TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr3:48309736A>G	ENST00000354698.3	+	4	627	c.555A>G	c.(553-555)ttA>ttG	p.L185L	ZNF589_ENST00000412564.1_Intron|ZNF589_ENST00000440261.2_Intron|ZNF589_ENST00000427617.2_Intron	NM_016089.2	NP_057173.2	Q86UQ0	ZN589_HUMAN	zinc finger protein 589	185					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACAGAATATTAGAGATACAGC	0.498																																					p.L185L	Colon(9;319 328 25374 27611 50948)	Atlas-SNP	.											ZNF589,NS,carcinoma,+2,1	ZNF589	20	1	0			c.A555G						scavenged	.						51.0	54.0	53.0					3																	48309736		1872	4126	5998	SO:0001819	synonymous_variant	51385	exon4			AATATTAGAGATA	AF114816	CCDS43085.1	3p21	2013-01-08			ENSG00000164048	ENSG00000164048		"""Zinc fingers, C2H2-type"", ""-"""	16747	protein-coding gene	gene with protein product						10029171	Standard	NM_016089		Approved	SZF1	uc003csl.4	Q86UQ0	OTTHUMG00000156833	ENST00000354698.3:c.555A>G	3.37:g.48309736A>G		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	82	2	0.0243902	NM_016089	Q86UC9|Q9BRI6|Q9BRY3|Q9Y611|Q9Y612	Silent	SNP	ENST00000354698.3	37	CCDS43085.1																																																																																			.	.	none		0.498	ZNF589-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346124.1	NM_016089	
FOLH1	2346	hgsc.bcm.edu	37	11	49186274	49186274	+	Missense_Mutation	SNP	G	G	A	rs61886492	byFrequency	TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr11:49186274G>A	ENST00000256999.2	-	13	1683	c.1423C>T	c.(1423-1425)Cac>Tac	p.H475Y	FOLH1_ENST00000356696.3_Missense_Mutation_p.H475Y|FOLH1_ENST00000533034.1_Missense_Mutation_p.H460Y|FOLH1_ENST00000525629.1_5'UTR|FOLH1_ENST00000340334.7_Missense_Mutation_p.H460Y|FOLH1_ENST00000343844.4_Missense_Mutation_p.H167Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	475	NAALADase.		H -> Y (can be associated with lower folate and higher homocysteine levels; dbSNP:rs61886492). {ECO:0000269|PubMed:11092759}.		folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GTTAGGTTGTGTACCAAGCTG	0.289													A|||	145	0.0289537	0.0333	0.0274	5008	,	,		18035	0.001		0.0507	False		,,,				2504	0.0307				p.H475Y		Atlas-SNP	.											FOLH1,parietal_lobe,glioma,0,1	FOLH1	141	1	0			c.C1423T	GRCh37	CM002779	FOLH1	M	rs61886492	scavenged	.	A	TYR/HIS,TYR/HIS,TYR/HIS,TYR/HIS,TYR/HIS	121,4273	766.3+/-413.4	0,121,2076	41.0	42.0	42.0		1423,1378,1378,499,1423	3.5	1.0	11	dbSNP_129	42	438,8156	771.0+/-407.7	14,410,3873	yes	missense,missense,missense,missense,missense	FOLH1	NM_001014986.1,NM_001193471.1,NM_001193472.1,NM_001193473.1,NM_004476.1	83,83,83,83,83	14,531,5949	AA,AG,GG		5.0966,2.7538,4.304	benign,benign,benign,benign,benign	475/720,460/736,460/705,167/443,475/751	49186274	559,12429	2197	4297	6494	SO:0001583	missense	2346	exon13			GGTTGTGTACCAA	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1423C>T	11.37:g.49186274G>A	ENSP00000256999:p.His475Tyr	Somatic	622	15	0.0241158		WXS	Illumina HiSeq	Phase_I	580	18	0.0310345	NM_004476	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	CCDS7946.1	64	0.029304029304029304	17	0.034552845528455285	9	0.024861878453038673	1	0.0017482517482517483	37	0.048812664907651716	A	0.089	-1.170406	0.01660	0.027538	0.050966	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000343844;ENST00000533034;ENST00000389724	T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18	3.55	3.55	0.40652	.	0.000000	0.49305	N	0.000155	T	0.00936	0.0031	N	0.00166	-1.94	0.09310	N	0.999995	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.35301	-0.9794	10	0.02654	T	1	.	7.0296	0.24960	0.8847:0.0:0.1153:0.0	rs61886492	460;460;475;475	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	Y	475;475;460;167;460;478	ENSP00000256999:H475Y;ENSP00000349129:H475Y;ENSP00000344131:H460Y;ENSP00000344086:H167Y;ENSP00000431463:H460Y	ENSP00000256999:H475Y	H	-	1	0	FOLH1	49142850	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	5.437000	0.66544	0.460000	0.27045	-0.720000	0.03607	CAC	G|0.962;A|0.038	0.038	strong		0.289	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
TREML2	79865	hgsc.bcm.edu	37	6	41166119	41166119	+	Missense_Mutation	SNP	T	T	C	rs76984414		TCGA-FA-A4BB-01A-11D-A31X-10	TCGA-FA-A4BB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	698b2e1b-0389-4dd2-a8bd-1499e0912f11	c1a1aa05-7d9f-41a8-b682-776d11b54183	g.chr6:41166119T>C	ENST00000483722.1	-	2	289	c.104A>G	c.(103-105)gAg>gGg	p.E35G		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	35	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGACAGAGTCTCCCCTTCAAG	0.498																																					p.E35G		Atlas-SNP	.											TREML2,colon,carcinoma,0,2	TREML2	41	2	0			c.A104G						scavenged	.						132.0	135.0	134.0					6																	41166119		2203	4300	6503	SO:0001583	missense	79865	exon2			AGAGTCTCCCCTT	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.104A>G	6.37:g.41166119T>C	ENSP00000418767:p.Glu35Gly	Somatic	63	1	0.015873		WXS	Illumina HiSeq	Phase_I	53	3	0.0566038	NM_024807	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	37	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	.	7.815	0.716447	0.15306	.	.	ENSG00000112195	ENST00000483722	T	0.20598	2.06	4.75	3.58	0.41010	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.462226	0.19397	N	0.115265	T	0.05410	0.0143	L	0.33245	0.995	0.26220	N	0.979173	B	0.14438	0.01	B	0.12156	0.007	T	0.37596	-0.9699	10	0.29301	T	0.29	-14.8097	9.5481	0.39293	0.0:0.0923:0.0:0.9077	.	35	Q5T2D2	TRML2_HUMAN	G	35	ENSP00000418767:E35G	ENSP00000418767:E35G	E	-	2	0	TREML2	41274097	1.000000	0.71417	0.999000	0.59377	0.017000	0.09413	1.360000	0.34125	0.283000	0.22279	-1.195000	0.01675	GAG	.	.	weak		0.498	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
