#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PARP9	83666	hgsc.bcm.edu	37	3	122247338	122247343	+	In_Frame_Del	DEL	GCCTGC	GCCTGC	-			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	GCCTGC	GCCTGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:122247338_122247343delGCCTGC	ENST00000360356.2	-	11	2660_2665	c.2433_2438delGCAGGC	c.(2431-2439)atgcaggct>att	p.811_813MQA>I	PARP9_ENST00000471785.1_In_Frame_Del_p.776_778MQA>I|PARP9_ENST00000492382.1_In_Frame_Del_p.356_358MQA>I|PARP9_ENST00000477522.2_In_Frame_Del_p.776_778MQA>I	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	811	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		CTGAGGTATAGCCTGCATGCCACTAA	0.466																																					p.812_813del		Atlas-Indel	.											.	PARP9	72	.	0			c.2434_2439del						PASS	.																																			SO:0001651	inframe_deletion	83666	exon11			.	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.2433_2438delGCAGGC	3.37:g.122247338_122247343delGCCTGC	ENSP00000353512:p.Met811_Ala813delinsIle	Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	115	26	0.226087	NM_001146102	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	In_Frame_Del	DEL	ENST00000360356.2	37	CCDS3014.1																																																																																			.	.	none		0.466	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458	
AR	367	hgsc.bcm.edu	37	X	66765228	66765242	+	In_Frame_Del	DEL	AGAGACTAGCCCCAG	AGAGACTAGCCCCAG	-			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	AGAGACTAGCCCCAG	AGAGACTAGCCCCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chrX:66765228_66765242delAGAGACTAGCCCCAG	ENST00000374690.3	+	1	764_778	c.240_254delAGAGACTAGCCCCAG	c.(238-255)caagagactagccccagg>cag	p.ETSPR81del	AR_ENST00000504326.1_In_Frame_Del_p.ETSPR81del|AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_In_Frame_Del_p.ETSPR81del	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	79	Gln-rich.|Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	agcagcagcaagagactagccccaggcagcagcag	0.637									Androgen Insensitivity Syndrome																												p.80_85del		Atlas-Indel	.											.	AR	249	.	0			c.239_253del						PASS	.			19,3613		1,10,7,1561,481						4.9	1.0		dbSNP_102	10	116,6256		1,61,53,2278,1639	no	coding	AR	NM_000044.3		2,71,60,3839,2120	A1A1,A1R,A1,RR,R		1.8205,0.5231,1.3495				135,9869				SO:0001651	inframe_deletion	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	.	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.240_254delAGAGACTAGCCCCAG	X.37:g.66765228_66765242delAGAGACTAGCCCCAG	ENSP00000363822:p.Glu81_Arg85del	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	105	23	0.219048	NM_000044	A2RUN2|B1AKD7|Q9UD95	In_Frame_Del	DEL	ENST00000374690.3	37	CCDS14387.1																																																																																			.	.	alt		0.637	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
PARP9	83666	hgsc.bcm.edu	37	3	122247346	122247346	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:122247346delG	ENST00000360356.2	-	11	2657	c.2430delC	c.(2428-2430)ggcfs	p.G810fs	PARP9_ENST00000471785.1_Frame_Shift_Del_p.G775fs|PARP9_ENST00000492382.1_Frame_Shift_Del_p.G355fs|PARP9_ENST00000477522.2_Frame_Shift_Del_p.G775fs	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	810	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		TAGCCTGCATGCCACTAAAAA	0.448																																					p.M811fs		Atlas-Indel	.											.	PARP9	72	.	0			c.2431delA						PASS	.						125.0	111.0	116.0					3																	122247346		2203	4300	6503	SO:0001589	frameshift_variant	83666	exon11			.	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.2430delC	3.37:g.122247346delG	ENSP00000353512:p.Gly810fs	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	120	28	0.233333	NM_001146102	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Frame_Shift_Del	DEL	ENST00000360356.2	37	CCDS3014.1																																																																																			.	.	none		0.448	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458	
PASD1	139135	hgsc.bcm.edu	37	X	150817142	150817144	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chrX:150817142_150817144delGCT	ENST00000370357.4	+	9	930_932	c.685_687delGCT	c.(685-687)gctdel	p.A236del		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	236	Poly-Ala.					nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.A229A(2)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					CGTTGAACCCgctgctgctgctg	0.433																																					p.228_229del		Atlas-Indel	.											.	PASD1	286	.	2	Substitution - coding silent(2)	lung(2)	c.684_686del						PASS	.																																			SO:0001651	inframe_deletion	139135	exon9			.	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.685_687delGCT	X.37:g.150817151_150817153delGCT	ENSP00000359382:p.Ala236del	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	111	10	0.0900901	NM_173493	Q3MNE0|Q69HD7|Q8N7X9	In_Frame_Del	DEL	ENST00000370357.4	37	CCDS35431.1																																																																																			.	.	none		0.433	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
DLG5	9231	hgsc.bcm.edu	37	10	79565519	79565520	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:79565519_79565520insA	ENST00000372391.2	-	27	5072_5073	c.5067_5068insT	c.(5065-5070)tttcggfs	p.R1690fs	DLG5_ENST00000372388.2_Frame_Shift_Ins_p.R1350fs|DLG5_ENST00000459739.1_5'UTR	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1690					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TGTTTCCTCCGAAAAAAGGACC	0.535																																					p.R1690fs		Pindel,Atlas-Indel	.											.	DLG5	154	.	0			c.5068_5069insT						PASS	.																																			SO:0001589	frameshift_variant	9231	exon27			.	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.5068dupT	10.37:g.79565525_79565525dupA	ENSP00000361467:p.Arg1690fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	17	17	1.000	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Frame_Shift_Ins	INS	ENST00000372391.2	37	CCDS7353.2																																																																																			.	.	none		0.535	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
ANKRD23	200539	hgsc.bcm.edu	37	2	97507820	97507821	+	Frame_Shift_Ins	INS	-	-	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:97507820_97507821insG	ENST00000318357.4	-	3	317_318	c.276_277insC	c.(274-279)cccaggfs	p.R93fs	ANKRD23_ENST00000418232.1_Frame_Shift_Ins_p.R93fs|ANKRD23_ENST00000476975.1_5'UTR|ANKRD23_ENST00000331001.2_Frame_Shift_Ins_p.R93fs	NM_144994.7	NP_659431.5	Q86SG2	ANR23_HUMAN	ankyrin repeat domain 23	93					fatty acid metabolic process (GO:0006631)|response to mechanical stimulus (GO:0009612)	I band (GO:0031674)|intercalated disc (GO:0014704)|nucleus (GO:0005634)	titin binding (GO:0031432)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)	9						TCAGGTTTCCTGGGGGGGACTC	0.53																																					p.R93fs		Pindel,Atlas-Indel	.											.	ANKRD23	28	.	0			c.277_278insC						PASS	.			3,4263		0,3,2130						4.5	1.0			89	6,8248		0,6,4121	no	frameshift	ANKRD23	NM_144994.7		0,9,6251	A1A1,A1R,RR		0.0727,0.0703,0.0719				9,12511				SO:0001589	frameshift_variant	200539	exon3			.		CCDS2027.1	2q11.2	2013-01-10			ENSG00000163126	ENSG00000163126		"""Ankyrin repeat domain containing"""	24470	protein-coding gene	gene with protein product	"""diabetes related ankyrin repeat protein"""	610736				12456686	Standard	NM_144994		Approved	DARP, FLJ32449, MARP3	uc002sxa.3	Q86SG2	OTTHUMG00000130534	ENST00000318357.4:c.277dupC	2.37:g.97507827_97507827dupG	ENSP00000321679:p.Arg93fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	20	20	1.000	NM_144994	Q711K7|Q8NAJ7	Frame_Shift_Ins	INS	ENST00000318357.4	37	CCDS2027.1																																																																																			.	.	none		0.530	ANKRD23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252956.1	NM_144994	
PARP9	83666	hgsc.bcm.edu	37	3	122247336	122247347	+	In_Frame_Del	DEL	TAGCCTGCATGC	TAGCCTGCATGC	-			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	TAGCCTGCATGC	TAGCCTGCATGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:122247336_122247347delTAGCCTGCATGC	ENST00000360356.2	-	11	2656_2667	c.2429_2440delGCATGCAGGCTA	c.(2428-2442)ggcatgcaggctata>gta	p.810_814GMQAI>V	PARP9_ENST00000471785.1_In_Frame_Del_p.775_779GMQAI>V|PARP9_ENST00000492382.1_In_Frame_Del_p.355_359GMQAI>V|PARP9_ENST00000477522.2_In_Frame_Del_p.775_779GMQAI>V	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	810	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		TACTGAGGTATAGCCTGCATGCCACTAAAAAT	0.453																																					p.810_814del		Pindel	.											.	PARP9	72	.	0			c.2430_2441del						PASS	.																																			SO:0001651	inframe_deletion	83666	exon11			.	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.2429_2440delGCATGCAGGCTA	3.37:g.122247336_122247347delTAGCCTGCATGC	ENSP00000353512:p.Gly810_Ile814delinsVal	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	26	26	1.000	NM_001146102	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	In_Frame_Del	DEL	ENST00000360356.2	37	CCDS3014.1																																																																																			.	.	none		0.453	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458	
HADHB	3032	hgsc.bcm.edu	37	2	26477125	26477126	+	Start_Codon_Ins	INS	-	-	ACT	rs3839049|rs67852333|rs59947000|rs147970487|rs587776502	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:26477125_26477126insACT	ENST00000317799.5	+	0	107_108				HADHB_ENST00000537713.1_Start_Codon_Ins|HADHB_ENST00000405867.3_Start_Codon_Ins|HADHB_ENST00000545822.1_5'UTR	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit						cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTCCAGAATGACTATCTTGAC	0.312														3553	0.709465	0.8767	0.6844	5008	,	,		14729	0.1796		0.9215	False		,,,				2504	0.8292				p.M1delinsMT		Pindel	.											HADHB,colon,carcinoma,0,1	HADHB	50	1	0			c.3_4insACT						PASS	.			3760,506		1661,438,34						5.3	1.0		dbSNP_130	69	7667,581		3571,525,28	no	coding	HADHB	NM_000183.2		5232,963,62	A1A1,A1R,RR		7.0441,11.8612,8.6863				11427,1087				SO:0001582	initiator_codon_variant	3032	exon2			.		CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.4_6dupACT	2.37:g.26477126_26477128dupACT		Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	15	15	1.000	NM_000183	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	In_Frame_Ins	INS	ENST00000317799.5	37	CCDS1722.1																																																																																			.	.	strong		0.312	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214050.2	NM_000183	
TMBIM4	51643	hgsc.bcm.edu	37	12	66531936	66531937	+	Frame_Shift_Ins	INS	-	-	A	rs199863727	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:66531936_66531937insA	ENST00000358230.3	-	7	640_641	c.520_521insT	c.(520-522)tatfs	p.Y174fs	TMBIM4_ENST00000539652.1_Intron|TMBIM4_ENST00000542724.1_Frame_Shift_Ins_p.Y143fs|TMBIM4_ENST00000398033.4_Frame_Shift_Ins_p.I159fs|TMBIM4_ENST00000544599.1_5'UTR|TMBIM4_ENST00000556010.1_Intron|TMBIM4_ENST00000286424.7_Frame_Shift_Ins_p.Y221fs	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	174					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		TATCTCACTATAAAAAAAAAAC	0.351																																					p.Y174fs		Pindel	.											.	TMBIM4	47	.	0			c.521_522insT						PASS	.																																			SO:0001589	frameshift_variant	51643	exon7			.	AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.521dupT	12.37:g.66531946_66531946dupA	ENSP00000350965:p.Tyr174fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	12	12	1.000	NM_016056	Q542Z6|Q9UHY5|Q9Y3C2	Frame_Shift_Ins	INS	ENST00000358230.3	37	CCDS41805.1																																																																																			.	.	none		0.351	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401832.2	NM_016056	
PIBF1	10464	hgsc.bcm.edu	37	13	73409508	73409509	+	Splice_Site	INS	-	-	AA	rs200683940		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr13:73409508_73409509insAA	ENST00000326291.6	+	9	1561		c.e9+2			NM_006346.2	NP_006337.2	Q8WXW3	PIBF1_HUMAN	progesterone immunomodulatory binding factor 1							centrosome (GO:0005813)		p.?(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		AGAAAACAGGTAAAAAAAAAAA	0.262																																					.		Pindel	.											.	PIBF1	65	.	1	Unknown(1)	ovary(1)	c.1223+2->AA						PASS	.																																			SO:0001630	splice_region_variant	10464	exon9			.	AF330046	CCDS31991.1	13q21.33	2014-02-20	2007-10-17	2007-10-17	ENSG00000083535	ENSG00000083535			23352	protein-coding gene	gene with protein product	"""progesterone-induced blocking factor 1"""	607532	"""chromosome 13 open reading frame 24"""	C13orf24		11935316	Standard	NM_006346		Approved	CEP90	uc001vjc.3	Q8WXW3	OTTHUMG00000017071	ENST00000326291.6:c.1223+2->AA	13.37:g.73409517_73409518dupAA		Somatic	0	0	0		WXS	Illumina HiSeq	Phase_I	23	23	1.000	NM_006346	O95664|Q6U9V2|Q6UG50|Q86V07|Q96SF4	Splice_Site	INS	ENST00000326291.6	37	CCDS31991.1																																																																																			.	.	weak		0.262	PIBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045255.1	NM_006346	Intron
CCDC144B	284047	hgsc.bcm.edu	37	17	18498497	18498498	+	RNA	INS	-	-	A	rs397961350|rs59933375|rs80104188	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:18498497_18498498insA	ENST00000442583.1	-	0	749							Q3MJ40	C144B_HUMAN	coiled-coil domain containing 144B (pseudogene)											NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(6)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	36						CTGCAGGCCTGAAAAAAAAAAA	0.243														2618	0.522764	0.528	0.4683	5008	,	,		15585	0.6756		0.4294	False		,,,				2504	0.4928				.		Pindel	.											.	CCDC144B	106	.	0			.						PASS	.																																					284047	.			.	AK093811		17p11.2	2012-11-19	2011-09-02		ENSG00000154874	ENSG00000154874			26704	pseudogene	pseudogene			"""coiled-coil domain containing 144B"""			11997339	Standard	NR_036647		Approved	FLJ36492	uc002guc.2	Q3MJ40	OTTHUMG00000059531		17.37:g.18498508_18498508dupA		Somatic	0	0	0		WXS	Illumina HiSeq	Phase_I	87	87	1.000	.	Q6P5Q3|Q8N200	RNA	INS	ENST00000442583.1	37																																																																																				.	.	weak		0.243	CCDC144B-006	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000132102.1	NM_182568	
NCAM1	4684	hgsc.bcm.edu	37	11	112832309	112832340	+	5'UTR	DEL	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	-	rs543798793|rs201772924|rs563686839|rs11284059	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:112832309_112832340delCATCCCTCCCAGCCAGCAGATTACAATGCTGC	ENST00000533760.1	+	0	220_251				RP11-629G13.1_ENST00000500537.2_RNA|NCAM1_ENST00000397957.4_3'UTR|RP11-629G13.1_ENST00000532002.1_RNA	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CGCGGCAAGACATCCCTCCCAGCCAGCAGATTACAATGCTGCCAAACTAAGG	0.487																																					.		Pindel	.											.	NCAM1	372	.	0			.						PASS	.																																			SO:0001623	5_prime_UTR_variant	4684	wholegene			.		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.-349CATCCCTCCCAGCCAGCAGATTACAATGCTGC>-	11.37:g.112832309_112832340delCATCCCTCCCAGCCAGCAGATTACAATGCTGC		Somatic	0	0	0		WXS	Illumina HiSeq	Phase_I	35	35	1.000	NM_001242607	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Frame_Shift_Del	DEL	ENST00000533760.1	37																																																																																				.	.	none		0.487	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
PIDD1	55367	hgsc.bcm.edu	37	11	804212	804212	+	Silent	SNP	C	C	A	rs7104785	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:804212C>A	ENST00000347755.5	-	2	318	c.177G>T	c.(175-177)ctG>ctT	p.L59L	PIDD_ENST00000534649.1_5'UTR|PIDD_ENST00000411829.2_Silent_p.L59L	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					GCAGCAGCTGCAGAGGCTGCT	0.672													A|||	1757	0.350839	0.292	0.6354	5008	,	,		16607	0.2728		0.493	False		,,,				2504	0.1626				p.L59L		Atlas-SNP	.											.	PIDD	76	.	0			c.G177T						PASS	.	A	,	1396,3010	648.5+/-398.7	216,964,1023	29.0	29.0	29.0		177,177	-7.2	0.0	11	dbSNP_116	29	4402,4196	537.7+/-383.3	1138,2126,1035	no	coding-synonymous,coding-synonymous	PIDD	NM_145886.3,NM_145887.3	,	1354,3090,2058	AA,AC,CC		48.802,31.6841,44.5863	,	59/911,59/894	804212	5798,7206	2203	4299	6502	SO:0001819	synonymous_variant	55367	exon2			CAGCTGCAGAGGC																												ENST00000347755.5:c.177G>T	11.37:g.804212C>A		Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	105	6	0.0571429	NM_145887		Silent	SNP	ENST00000347755.5	37	CCDS7716.1																																																																																			C|0.567;A|0.433	0.433	strong		0.672	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257103.1		
FRG1	2483	hgsc.bcm.edu	37	4	190878625	190878625	+	Missense_Mutation	SNP	A	A	G	rs373840195		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:190878625A>G	ENST00000226798.4	+	6	727	c.505A>G	c.(505-507)Agt>Ggt	p.S169G	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	169					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S169G(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AGAAGCAAAAAGTAAAACAGC	0.363																																					p.S169G		Atlas-SNP	.											FRG1,NS,carcinoma,0,3	FRG1	76	3	1	Substitution - Missense(1)	lung(1)	c.A505G						scavenged	.						49.0	46.0	47.0					4																	190878625		2183	4281	6464	SO:0001583	missense	2483	exon6			GCAAAAAGTAAAA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.505A>G	4.37:g.190878625A>G	ENSP00000226798:p.Ser169Gly	Somatic	522	6	0.0114943		WXS	Illumina HiSeq	Phase_I	548	5	0.00912409	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	21.2	4.112843	0.77210	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.49139	1.86;0.79	4.19	4.19	0.49359	Actin cross-linking (1);	0.160510	0.64402	D	0.000002	T	0.58750	0.2144	M	0.77103	2.36	0.49915	D	0.999832	D	0.55800	0.973	P	0.53102	0.718	T	0.61426	-0.7065	10	0.39692	T	0.17	0.1847	11.5749	0.50856	1.0:0.0:0.0:0.0	.	169	Q14331	FRG1_HUMAN	G	169;41;106	ENSP00000226798:S169G;ENSP00000435943:S106G	ENSP00000226798:S169G	S	+	1	0	FRG1	191115619	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.044000	0.93805	1.677000	0.50941	0.373000	0.22412	AGT	.	.	weak		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
MRPL35	51318	hgsc.bcm.edu	37	2	86433240	86433240	+	Missense_Mutation	SNP	C	C	T	rs10901	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:86433240C>T	ENST00000337109.4	+	2	89	c.55C>T	c.(55-57)Ccc>Tcc	p.P19S	MRPL35_ENST00000409180.1_Missense_Mutation_p.P19S|MRPL35_ENST00000605125.1_Missense_Mutation_p.P19S|MRPL35_ENST00000254644.8_Missense_Mutation_p.P19S	NM_016622.3	NP_057706.2	Q9NZE8	RM35_HUMAN	mitochondrial ribosomal protein L35	19			P -> S (in dbSNP:rs12714176). {ECO:0000269|PubMed:15489334}.		translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)	p.P19S(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(2)	14						AATCCTACGGCCCCTGAATAT	0.378													C|||	1225	0.244609	0.0552	0.2781	5008	,	,		17596	0.121		0.4751	False		,,,				2504	0.3671				p.P19S		Atlas-SNP	.											MRPL35,NS,adenoma,0,2	MRPL35	23	2	1	Substitution - Missense(1)	stomach(1)	c.C55T						scavenged	.	C	SER/PRO,SER/PRO	497,3909	231.0+/-245.0	30,437,1736	141.0	139.0	140.0		55,55	4.7	1.0	2	dbSNP_52	140	4343,4257	580.4+/-391.0	1090,2163,1047	yes	missense,missense	MRPL35	NM_016622.3,NM_145644.2	74,74	1120,2600,2783	TT,TC,CC		49.5,11.2801,37.2136	probably-damaging,probably-damaging	19/189,19/171	86433240	4840,8166	2203	4300	6503	SO:0001583	missense	51318	exon2			CTACGGCCCCTGA	AF208849	CCDS1987.1, CCDS1988.1	2p11.2	2012-09-13			ENSG00000132313	ENSG00000132313		"""Mitochondrial ribosomal proteins / large subunits"""	14489	protein-coding gene	gene with protein product		611841				11042152, 11551941	Standard	NM_016622		Approved		uc002srg.4	Q9NZE8	OTTHUMG00000037385	ENST00000337109.4:c.55C>T	2.37:g.86433240C>T	ENSP00000338389:p.Pro19Ser	Somatic	352	2	0.00568182		WXS	Illumina HiSeq	Phase_I	414	8	0.0193237	NM_016622	A6NKV6|B2RB93|Q658U7|Q8WWA2	Missense_Mutation	SNP	ENST00000337109.4	37	CCDS1988.1	571	0.26144688644688646	30	0.06097560975609756	121	0.3342541436464088	69	0.12062937062937062	351	0.4630606860158311	C	15.36	2.809597	0.50421	0.112801	0.505	ENSG00000132313	ENST00000254644;ENST00000337109;ENST00000409180	T;T;T	0.18174	2.24;2.65;2.23	5.62	4.74	0.60224	.	0.096882	0.64402	N	0.000001	T	0.00012	0.0000	M	0.75264	2.295	0.27111	P	0.9623878	B	0.27882	0.192	B	0.21151	0.033	T	0.43081	-0.9413	9	0.26408	T	0.33	-10.0043	10.6449	0.45615	0.0:0.912:0.0:0.088	rs12714176;rs17845611;rs17858541;rs52836017;rs57050204;rs12714176	19	Q9NZE8	RM35_HUMAN	S	19	ENSP00000254644:P19S;ENSP00000338389:P19S;ENSP00000386255:P19S	ENSP00000254644:P19S	P	+	1	0	MRPL35	86286751	0.330000	0.24705	0.987000	0.45799	0.922000	0.55478	2.399000	0.44495	1.527000	0.49086	0.650000	0.86243	CCC	T|0.269;G|0.143	0.269	strong		0.378	MRPL35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091002.2	NM_016622	
CCDC57	284001	hgsc.bcm.edu	37	17	80085633	80085633	+	Missense_Mutation	SNP	A	A	G	rs11077969	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:80085633A>G	ENST00000389641.4	-	17	2537	c.2501T>C	c.(2500-2502)aTg>aCg	p.M834T	CCDC57_ENST00000392346.2_Missense_Mutation_p.M191T|CCDC57_ENST00000392347.1_Missense_Mutation_p.M834T			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	834			M -> T (in dbSNP:rs11077969).							endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			CAACCTCCACATGTCCTGGAG	0.637													G|||	2112	0.421725	0.5613	0.3746	5008	,	,		18607	0.1369		0.5169	False		,,,				2504	0.4622				p.M833T		Atlas-SNP	.											CCDC57_ENST00000389641,NS,carcinoma,0,4	CCDC57	102	4	0			c.T2498C						PASS	.	G	THR/MET	2405,1601		711,983,309	77.0	82.0	80.0		2498	0.9	0.1	17	dbSNP_120	80	4753,3557		1379,1995,781	yes	missense	CCDC57	NM_198082.2	81	2090,2978,1090	GG,GA,AA		42.8039,39.9651,41.8805	benign	833/916	80085633	7158,5158	2003	4155	6158	SO:0001583	missense	284001	exon16			CTCCACATGTCCT	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.2501T>C	17.37:g.80085633A>G	ENSP00000374292:p.Met834Thr	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	67	4	0.0597015	NM_198082	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	37		868	0.3974358974358974	244	0.4959349593495935	147	0.40607734806629836	78	0.13636363636363635	399	0.5263852242744064	G	0.012	-1.673956	0.00758	0.600349	0.571961	ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000392346;ENST00000324808	T;T;T	0.11277	3.35;3.35;2.79	4.63	0.854	0.19007	.	1.070970	0.07363	N	0.884489	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42224	-0.9464	9	0.02654	T	1	-4.3155	6.5739	0.22553	0.565:0.0:0.435:0.0	rs11077969;rs59203051;rs11077969	140;834	E7ENZ0;Q2TAC2	.;CCD57_HUMAN	T	834;834;191;140	ENSP00000374292:M834T;ENSP00000376158:M834T;ENSP00000376157:M191T	ENSP00000315223:M140T	M	-	2	0	CCDC57	77678922	0.169000	0.23002	0.110000	0.21437	0.006000	0.05464	0.313000	0.19415	0.071000	0.16664	-0.320000	0.08662	ATG	A|0.582;G|0.418	0.418	strong		0.637	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082	
ZNF415	55786	hgsc.bcm.edu	37	19	53612745	53612745	+	Missense_Mutation	SNP	T	T	C	rs1133327	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:53612745T>C	ENST00000500065.4	-	4	886	c.553A>G	c.(553-555)Atc>Gtc	p.I185V	ZNF415_ENST00000243643.4_Missense_Mutation_p.I185V|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000455735.2_Missense_Mutation_p.I233V|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000448501.1_Missense_Mutation_p.I233V|ZNF415_ENST00000421033.1_Missense_Mutation_p.I197V|ZNF415_ENST00000601493.1_5'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.I172V	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	233					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		TGGGTTTTGATGGTAGAAGAA	0.363													C|||	2729	0.544928	0.4856	0.647	5008	,	,		21213	0.6131		0.497	False		,,,				2504	0.5317				p.I185V		Atlas-SNP	.											.	ZNF415	68	.	0			c.A553G						PASS	.	C	VAL/ILE,VAL/ILE,VAL/ILE	2216,2190	586.9+/-386.6	560,1096,547	100.0	96.0	97.0		553,553,553	1.7	0.0	19	dbSNP_86	97	4206,4394	585.0+/-391.8	1035,2136,1129	yes	missense,missense,missense	ZNF415	NM_001136038.2,NM_001164309.1,NM_018355.2	29,29,29	1595,3232,1676	CC,CT,TT		48.907,49.7049,49.3772	benign,benign,benign	185/556,185/556,185/556	53612745	6422,6584	2203	4300	6503	SO:0001583	missense	55786	exon4			TTTTGATGGTAGA	AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.553A>G	19.37:g.53612745T>C	ENSP00000439435:p.Ile185Val	Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	128	6	0.046875	NM_018355	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	ENST00000500065.4	37	CCDS54313.1	1211	0.5544871794871795	253	0.5142276422764228	234	0.6464088397790055	345	0.6031468531468531	379	0.5	C	0.331	-0.956230	0.02267	0.502951	0.48907	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.06768	3.26;3.26;3.26;3.26;3.26;3.26	2.74	1.68	0.24146	.	.	.	.	.	T	0.00012	0.0000	N	0.01188	-0.97	0.80722	P	0.0	B;B;B;B;B	0.13145	0.0;0.0;0.007;0.0;0.0	B;B;B;B;B	0.09377	0.0;0.0;0.004;0.0;0.0	T	0.10660	-1.0620	8	0.30854	T	0.27	.	5.2931	0.15737	0.0:0.7068:0.0:0.2932	rs1133327;rs1560098;rs3170112;rs16984463;rs60143060;rs1133327	185;233;185;172;197	F5H287;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;ZN415_HUMAN;.;.;.	V	185;185;233;197;233;172	ENSP00000243643:I185V;ENSP00000439435:I185V;ENSP00000396492:I233V;ENSP00000395055:I197V;ENSP00000388787:I233V;ENSP00000414601:I172V	ENSP00000243643:I185V	I	-	1	0	ZNF415	58304557	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.787000	0.01764	0.075000	0.16796	-1.741000	0.00685	ATC	T|0.490;C|0.510	0.510	strong		0.363	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
DHX38	9785	hgsc.bcm.edu	37	16	72135014	72135014	+	Silent	SNP	T	T	C	rs1050363	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:72135014T>C	ENST00000268482.3	+	10	1817	c.1308T>C	c.(1306-1308)gcT>gcC	p.A436A	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	436					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.A436A(1)		endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				TGAAGGATGCTACTTCTGACC	0.542													C|||	2794	0.557907	0.823	0.3963	5008	,	,		19009	0.3591		0.5	False		,,,				2504	0.5787				p.A436A	Melanoma(97;711 1442 7855 13832 28836)	Atlas-SNP	.											DHX38,NS,carcinoma,0,1	DHX38	91	1	1	Substitution - coding silent(1)	stomach(1)	c.T1308C						scavenged	.	C		3313,1083	392.6+/-328.5	1262,789,147	128.0	133.0	131.0		1308	2.3	1.0	16	dbSNP_86	131	4556,4044	558.4+/-387.2	1204,2148,948	no	coding-synonymous	DHX38	NM_014003.3		2466,2937,1095	CC,CT,TT		47.0233,24.636,39.4506		436/1228	72135014	7869,5127	2198	4300	6498	SO:0001819	synonymous_variant	9785	exon10			GGATGCTACTTCT	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.1308T>C	16.37:g.72135014T>C		Somatic	234	0	0		WXS	Illumina HiSeq	Phase_I	277	10	0.0361011	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Silent	SNP	ENST00000268482.3	37	CCDS10907.1																																																																																			T|0.421;C|0.579	0.579	strong		0.542	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
KLHL38	340359	hgsc.bcm.edu	37	8	124664792	124664792	+	Silent	SNP	C	C	T	rs7387544	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:124664792C>T	ENST00000325995.7	-	1	398	c.375G>A	c.(373-375)tcG>tcA	p.S125S	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	125										breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						TCTGCAAGTACGAGGAGCAGG	0.562													C|||	3548	0.708466	0.6657	0.6902	5008	,	,		20607	0.7113		0.8022	False		,,,				2504	0.68				p.S125S		Atlas-SNP	.											KLHL38,NS,carcinoma,-1,1	KLHL38	81	1	0			c.G375A						scavenged	.	C		2820,1162		994,832,165	47.0	52.0	51.0		375	-10.9	0.3	8	dbSNP_116	51	6554,1758		2596,1362,198	no	coding-synonymous	KLHL38	NM_001081675.2		3590,2194,363	TT,TC,CC		21.1501,29.1813,23.7514		125/582	124664792	9374,2920	1991	4156	6147	SO:0001819	synonymous_variant	340359	exon1			CAAGTACGAGGAG		CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.375G>A	8.37:g.124664792C>T		Somatic	85	1	0.0117647		WXS	Illumina HiSeq	Phase_I	69	6	0.0869565	NM_001081675	A0PK12	Silent	SNP	ENST00000325995.7	37	CCDS43766.1																																																																																			C|0.264;T|0.736	0.736	strong		0.562	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381288.1		
B3GALTL	145173	hgsc.bcm.edu	37	13	31891810	31891810	+	Missense_Mutation	SNP	C	C	T	rs144117014		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr13:31891810C>T	ENST00000343307.4	+	13	1321	c.1172C>T	c.(1171-1173)aCg>aTg	p.T391M		NM_194318.3	NP_919299.3	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like	391					fucose metabolic process (GO:0006004)|protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)		AGCTACATCACGGGAGGAGGA	0.522																																					p.T391M		Atlas-SNP	.											.	B3GALTL	48	.	0			c.C1172T						PASS	.	C	MET/THR	0,4406		0,0,2203	107.0	100.0	102.0		1172	4.9	0.9	13	dbSNP_134	102	2,8598	2.2+/-6.3	0,2,4298	no	missense	B3GALTL	NM_194318.3	81	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	391/499	31891810	2,13004	2203	4300	6503	SO:0001583	missense	145173	exon13			ACATCACGGGAGG	AB101481	CCDS9341.1	13q12.3	2014-03-24			ENSG00000187676	ENSG00000187676		"""Beta 3-glycosyltransferases"""	20207	protein-coding gene	gene with protein product		610308				12943678, 16899492, 17032646	Standard	NM_194318		Approved	B3GTL, B3Glc-T	uc010aaz.3	Q6Y288	OTTHUMG00000016688	ENST00000343307.4:c.1172C>T	13.37:g.31891810C>T	ENSP00000343002:p.Thr391Met	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	39	14	0.358974	NM_194318	A8K5F8|Q5W0H2|Q6NUI3	Missense_Mutation	SNP	ENST00000343307.4	37	CCDS9341.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700733	0.88924	0.0	2.33E-4	ENSG00000187676	ENST00000343307	T	0.72394	-0.65	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.82250	0.4996	M	0.64630	1.985	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.81430	-0.0936	10	0.39692	T	0.17	-18.4961	18.5122	0.90921	0.0:1.0:0.0:0.0	.	391	Q6Y288	B3GLT_HUMAN	M	391	ENSP00000343002:T391M	ENSP00000343002:T391M	T	+	2	0	B3GALTL	30789810	1.000000	0.71417	0.922000	0.36590	0.873000	0.50193	7.264000	0.78432	2.432000	0.82394	0.650000	0.86243	ACG	C|1.000;T|0.000	0.000	weak		0.522	B3GALTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044396.3	NM_194318	
MFSD6	54842	hgsc.bcm.edu	37	2	191300917	191300917	+	Silent	SNP	A	A	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:191300917A>C	ENST00000392328.1	+	3	486	c.162A>C	c.(160-162)atA>atC	p.I54I	MFSD6_ENST00000281416.7_Silent_p.I54I	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	54					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						AGGAGGAAATAGACTGGATAG	0.403																																					p.I54I		Atlas-SNP	.											.	MFSD6	58	.	0			c.A162C						PASS	.						108.0	110.0	109.0					2																	191300917		2203	4300	6503	SO:0001819	synonymous_variant	54842	exon3			GGAAATAGACTGG		CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.162A>C	2.37:g.191300917A>C		Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	188	84	0.446809	NM_017694	D3KSZ4|Q86TH2|Q9NXM3	Silent	SNP	ENST00000392328.1	37	CCDS2306.1																																																																																			.	.	none		0.403	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1		
PCDHB7	56129	hgsc.bcm.edu	37	5	140553994	140553994	+	Silent	SNP	G	G	T	rs374392843		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:140553994G>T	ENST00000231137.3	+	1	1752	c.1578G>T	c.(1576-1578)gcG>gcT	p.A526A		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A526A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGCAGGCGTTCGAGTTCC	0.706													g|||	1	0.000199681	0.0	0.0	5008	,	,		16269	0.0		0.001	False		,,,				2504	0.0				p.A526A		Atlas-SNP	.											PCDHB7,NS,carcinoma,0,4	PCDHB7	231	4	1	Substitution - coding silent(1)	lung(1)	c.G1578T						scavenged	.						62.0	68.0	66.0					5																	140553994		2203	4300	6503	SO:0001819	synonymous_variant	56129	exon1			GCAGGCGTTCGAG	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1578G>T	5.37:g.140553994G>T		Somatic	220	1	0.00454545		WXS	Illumina HiSeq	Phase_I	205	7	0.0341463	NM_018940	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																			.	.	weak		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
CFAP69	79846	hgsc.bcm.edu	37	7	89938680	89938680	+	Splice_Site	SNP	C	C	T	rs1134956	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:89938680C>T	ENST00000389297.4	+	22	2905	c.2654C>T	c.(2653-2655)aCg>aTg	p.T885M	C7orf63_ENST00000497910.1_Splice_Site_p.T867M|C7orf63_ENST00000316089.8_Splice_Site_p.T839M	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		885			T -> M (in dbSNP:rs17865475). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						CTTAACACAACGGTAAGATTC	0.323													C|||	1906	0.380591	0.2859	0.3991	5008	,	,		13101	0.2024		0.5577	False		,,,				2504	0.4969				p.T885M		Atlas-SNP	.											C7orf63_ENST00000389297,NS,carcinoma,+1,2	C7orf63	158	2	0			c.C2654T						scavenged	.	C	MET/THR,MET/THR	1255,2367		217,821,773	101.0	95.0	97.0		2654,2600	5.5	1.0	7	dbSNP_86	97	4661,3489		1333,1995,747	yes	missense-near-splice,missense-near-splice	C7orf63	NM_001039706.2,NM_001160138.1	81,81	1550,2816,1520	TT,TC,CC		42.8098,34.6494,49.7452	probably-damaging,probably-damaging	885/942,867/924	89938680	5916,5856	1811	4075	5886	SO:0001630	splice_region_variant	79846	exon22			ACACAACGGTAAG																												ENST00000389297.4:c.2655+1C>T	7.37:g.89938680C>T		Somatic	316	1	0.00316456		WXS	Illumina HiSeq	Phase_I	457	9	0.0196937	NM_001039706	A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Missense_Mutation	SNP	ENST00000389297.4	37	CCDS43613.2	827	0.37866300366300365	144	0.2926829268292683	149	0.4116022099447514	104	0.18181818181818182	430	0.5672823218997362	C	21.5	4.163953	0.78226	0.346494	0.571902	ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000449577	T;T;T;T	0.55234	1.49;0.91;1.55;0.53	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	M	0.78049	2.395	0.19945	P	0.9999490445	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.50180	-0.8858	9	0.72032	D	0.01	-10.4472	19.4207	0.94720	0.0:1.0:0.0:0.0	rs1134956;rs3178794;rs3197363;rs3208949;rs11544789;rs11563317;rs17689090;rs59337484;rs3178794	867;885	A5D8W1-5;A5D8W1	.;CG063_HUMAN	M	885;839;867;422	ENSP00000373948:T885M;ENSP00000321753:T839M;ENSP00000419549:T867M;ENSP00000391571:T422M	ENSP00000321753:T839M	T	+	2	0	C7orf63	89776616	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.335000	0.59298	2.601000	0.87937	0.585000	0.79938	ACG	C|0.596;N|0.000;T|0.404	0.404	strong		0.323	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139891.4		Missense_Mutation
PLG	5340	hgsc.bcm.edu	37	6	161139857	161139857	+	Silent	SNP	A	A	G	rs13231	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:161139857A>G	ENST00000308192.9	+	9	1146	c.1083A>G	c.(1081-1083)caA>caG	p.Q361Q		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	361				Q -> E (in Ref. 7; AA sequence and 9; AA sequence). {ECO:0000305}.	blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CCACGGAACAATTGGCTCCCA	0.498													G|||	683	0.136382	0.1452	0.1744	5008	,	,		17688	0.0		0.2922	False		,,,				2504	0.0777				p.Q361Q		Atlas-SNP	.											.	PLG	150	.	0			c.A1083G						PASS	.	G		777,3629	752.2+/-412.3	59,659,1485	76.0	72.0	73.0		1083	-8.7	0.0	6	dbSNP_52	73	2587,6013	689.3+/-404.3	365,1857,2078	no	coding-synonymous	PLG	NM_000301.3		424,2516,3563	GG,GA,AA		30.0814,17.635,25.865		361/811	161139857	3364,9642	2203	4300	6503	SO:0001819	synonymous_variant	5340	exon9			GGAACAATTGGCT	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.1083A>G	6.37:g.161139857A>G		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	73	6	0.0821918	NM_000301	Q15146|Q5TEH4|Q6PA00	Silent	SNP	ENST00000308192.9	37	CCDS5279.1																																																																																			A|0.787;G|0.213	0.213	strong		0.498	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
CACNA1H	8912	hgsc.bcm.edu	37	16	1252441	1252441	+	Missense_Mutation	SNP	T	T	C	rs4984636	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:1252441T>C	ENST00000348261.5	+	9	2239	c.1991T>C	c.(1990-1992)gTc>gCc	p.V664A	CACNA1H_ENST00000358590.4_Missense_Mutation_p.V664A|CACNA1H_ENST00000565831.1_Missense_Mutation_p.V664A	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	664			V -> A (in dbSNP:rs4984636). {ECO:0000269|PubMed:11751928, ECO:0000269|PubMed:12891677, ECO:0000269|PubMed:9670923}.		aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CCGCATGTGGTCGGGGAGCAT	0.682													T|||	530	0.105831	0.0091	0.1744	5008	,	,		16513	0.002		0.2863	False		,,,				2504	0.1094				p.V664A		Atlas-SNP	.											CACNA1H_ENST00000358590,rectum,carcinoma,0,2	CACNA1H	317	2	0			c.T1991C						scavenged	.	T	ALA/VAL,ALA/VAL	178,3466		11,156,1655	4.0	5.0	5.0		1991,1991	4.5	0.2	16	dbSNP_111	5	1823,5663		248,1327,2168	yes	missense,missense	CACNA1H	NM_001005407.1,NM_021098.2	64,64	259,1483,3823	CC,CT,TT		24.3521,4.8847,17.9784	possibly-damaging,possibly-damaging	664/2348,664/2354	1252441	2001,9129	1822	3743	5565	SO:0001583	missense	8912	exon9			ATGTGGTCGGGGA	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.1991T>C	16.37:g.1252441T>C	ENSP00000334198:p.Val664Ala	Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	58	3	0.0517241	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	287	0.13141025641025642	8	0.016260162601626018	63	0.17403314917127072	1	0.0017482517482517483	215	0.2836411609498681	T	17.49	3.403103	0.62288	0.048847	0.243521	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96619	-4.07;-4.01	4.47	4.47	0.54385	.	157.429000	0.00166	N	0.000000	T	0.00178	0.0005	L	0.50333	1.59	0.36796	P	0.11489499999999997	P;D	0.53151	0.571;0.958	B;P	0.46026	0.288;0.501	T	0.54669	-0.8259	9	0.51188	T	0.08	.	13.0686	0.59048	0.0:0.0:0.0:1.0	rs4984636;rs57010276;rs4984636	664;664	O95180-2;O95180	.;CAC1H_HUMAN	A	664	ENSP00000334198:V664A;ENSP00000351401:V664A	ENSP00000334198:V664A	V	+	2	0	CACNA1H	1192442	1.000000	0.71417	0.174000	0.22961	0.858000	0.48976	4.766000	0.62279	1.864000	0.54056	0.533000	0.62120	GTC	T|0.874;C|0.126	0.126	strong		0.682	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
MYOM3	127294	hgsc.bcm.edu	37	1	24421474	24421474	+	Missense_Mutation	SNP	G	G	A	rs6678540	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:24421474G>A	ENST00000374434.3	-	9	959	c.797C>T	c.(796-798)aCg>aTg	p.T266M	MYOM3_ENST00000329601.7_Missense_Mutation_p.T266M|MYOM3_ENST00000475306.1_5'UTR|MYOM3_ENST00000330966.7_Missense_Mutation_p.T267M	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	266			T -> M (in dbSNP:rs6678540). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:17974005}.			M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GGGGCCAAACGTCGATCCTGG	0.532													A|||	1602	0.319888	0.2746	0.2911	5008	,	,		18851	0.3383		0.4771	False		,,,				2504	0.2209				p.T266M		Atlas-SNP	.											.	MYOM3	131	.	0			c.C797T						PASS	.	A	MET/THR	1045,2801		156,733,1034	45.0	46.0	45.0		797	4.1	0.7	1	dbSNP_116	45	3747,4489		855,2037,1226	yes	missense	MYOM3	NM_152372.3	81	1011,2770,2260	AA,AG,GG		45.4954,27.1711,39.6623	benign	266/1438	24421474	4792,7290	1923	4118	6041	SO:0001583	missense	127294	exon9			CCAAACGTCGATC	AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.797C>T	1.37:g.24421474G>A	ENSP00000363557:p.Thr266Met	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	104	7	0.0673077	NM_152372	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	ENST00000374434.3	37	CCDS41281.1	820	0.37545787545787546	141	0.2865853658536585	116	0.32044198895027626	179	0.3129370629370629	384	0.5065963060686016	A	7.540	0.660523	0.14645	0.271711	0.454954	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	T;T;T	0.55930	0.53;0.53;0.49	5.18	4.06	0.47325	.	0.579783	0.19017	N	0.124919	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B;B	0.09022	0.001;0.002	B;B	0.09377	0.004;0.0	T	0.46484	-0.9188	9	0.12430	T	0.62	.	7.2915	0.26368	0.8218:0.0:0.1782:0.0	rs6678540;rs17184616;rs52794525;rs58002450;rs6678540	266;266	Q5VTT5-2;Q5VTT5	.;MYOM3_HUMAN	M	266;267;266	ENSP00000363557:T266M;ENSP00000332670:T267M;ENSP00000328415:T266M	ENSP00000328415:T266M	T	-	2	0	MYOM3	24294061	0.108000	0.22018	0.674000	0.29902	0.591000	0.36615	2.024000	0.41049	0.810000	0.34279	-0.381000	0.06696	ACG	G|0.633;A|0.367	0.367	strong		0.532	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008272.2	NM_152372	
MUC4	4585	hgsc.bcm.edu	37	3	195515078	195515078	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:195515078C>T	ENST00000463781.3	-	2	3832	c.3373G>A	c.(3373-3375)Gac>Aac	p.D1125N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D1125N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	564					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D1125N(3)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.562																																					p.D1125N		Atlas-SNP	.											MUC4_ENST00000463781,bladder,carcinoma,+1,5	MUC4	1505	5	3	Substitution - Missense(3)	endometrium(3)	c.G3373A						scavenged	.																																			SO:0001583	missense	4585	exon2			AAGTGTCGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3373G>A	3.37:g.195515078C>T	ENSP00000417498:p.Asp1125Asn	Somatic	103	2	0.0194175		WXS	Illumina HiSeq	Phase_I	85	4	0.0470588	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.951	0.359409	0.11239	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30182	1.56;1.54	0.814	-1.63	0.08345	.	.	.	.	.	T	0.18676	0.0448	N	0.19112	0.55	0.09310	N	1	D	0.59357	0.985	P	0.48738	0.588	T	0.05971	-1.0853	8	.	.	.	.	0.3671	0.00373	0.2014:0.3069:0.2014:0.2903	.	1125	E7ESK3	.	N	1125	ENSP00000417498:D1125N;ENSP00000420243:D1125N	.	D	-	1	0	MUC4	196999473	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	-3.293000	0.00523	-1.645000	0.01515	0.064000	0.15345	GAC	.	.	none		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DHRS3	9249	hgsc.bcm.edu	37	1	12640650	12640650	+	Silent	SNP	C	C	T	rs11540058	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:12640650C>T	ENST00000376223.2	-	2	623	c.240G>A	c.(238-240)acG>acA	p.T80T	DHRS3_ENST00000482265.1_5'UTR	NM_004753.4	NP_004744.2	O75911	DHRS3_HUMAN	dehydrogenase/reductase (SDR family) member 3	80					bone morphogenesis (GO:0060349)|cardiac septum morphogenesis (GO:0060411)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|phototransduction, visible light (GO:0007603)|regulation of ossification (GO:0030278)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|photoreceptor outer segment membrane (GO:0042622)	electron carrier activity (GO:0009055)|NADP-retinol dehydrogenase activity (GO:0052650)|nucleotide binding (GO:0000166)|retinol dehydrogenase activity (GO:0004745)			cervix(1)|large_intestine(4)|lung(2)|prostate(1)|skin(1)	9	Ovarian(185;0.249)	Lung NSC(185;4.11e-05)|all_lung(284;4.58e-05)|Renal(390;0.000147)|Colorectal(325;0.000585)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;9.25e-07)|COAD - Colon adenocarcinoma(227;0.000326)|BRCA - Breast invasive adenocarcinoma(304;0.000344)|Kidney(185;0.00235)|KIRC - Kidney renal clear cell carcinoma(229;0.00656)|STAD - Stomach adenocarcinoma(313;0.00798)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	GGATCTCCTCCGTCGTCTCCT	0.537													C|||	399	0.0796725	0.0446	0.0764	5008	,	,		17584	0.002		0.1918	False		,,,				2504	0.0941				p.T80T		Atlas-SNP	.											.	DHRS3	18	.	0			c.G240A						PASS	.	C		294,4112	161.1+/-193.3	10,274,1919	74.0	71.0	72.0		240	-4.2	0.4	1	dbSNP_120	72	1781,6819	321.8+/-315.3	194,1393,2713	no	coding-synonymous	DHRS3	NM_004753.4		204,1667,4632	TT,TC,CC		20.7093,6.6727,15.9542		80/303	12640650	2075,10931	2203	4300	6503	SO:0001819	synonymous_variant	9249	exon2			CTCCTCCGTCGTC	AF061741	CCDS146.1	1p36.1	2011-09-20			ENSG00000162496	ENSG00000162496	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	17693	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 1"""	612830				9705317, 12226107, 19027726	Standard	XM_005263533		Approved	retSDR1, Rsdr1, SDR1, RDH17, SDR16C1	uc001auc.3	O75911	OTTHUMG00000001885	ENST00000376223.2:c.240G>A	1.37:g.12640650C>T		Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	133	9	0.0676692	NM_004753	B2R7F3|Q5VUY3|Q6UY38|Q9BUC8	Silent	SNP	ENST00000376223.2	37	CCDS146.1																																																																																			C|0.868;T|0.132	0.132	strong		0.537	DHRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005318.1	NM_004753	
PRAMEF11	440560	hgsc.bcm.edu	37	1	12885059	12885059	+	Missense_Mutation	SNP	C	C	G	rs199623827	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:12885059C>G	ENST00000535591.1	-	4	1247	c.1052G>C	c.(1051-1053)tGc>tCc	p.C351S	RP5-845O24.8_ENST00000438401.1_lincRNA	NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	351					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.C351S(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GGTGGCCATGCAGATGGGATT	0.532													.|||	21	0.00419329	0.003	0.0072	5008	,	,		19682	0.001		0.0089	False		,,,				2504	0.002				p.C351S		Atlas-SNP	.											PRAMEF11,NS,carcinoma,0,5	PRAMEF11	72	5	1	Substitution - Missense(1)	kidney(1)	c.G1052C						scavenged	.						36.0	29.0	31.0					1																	12885059		692	1579	2271	SO:0001583	missense	440560	exon4			GCCATGCAGATGG	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.1052G>C	1.37:g.12885059C>G	ENSP00000439551:p.Cys351Ser	Somatic	264	3	0.0113636		WXS	Illumina HiSeq	Phase_I	204	6	0.0294118	NM_001146344		Missense_Mutation	SNP	ENST00000535591.1	37	CCDS53268.1	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.316351	0.00235	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.06371	3.31;3.31	1.52	1.52	0.23074	.	0.067349	0.64402	N	0.000012	T	0.00608	0.0020	N	0.00003	-3.455	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44907	-0.9297	10	0.02654	T	1	.	5.7253	0.18010	0.0:0.3438:0.6562:0.0	.	351	O60813	PRA11_HUMAN	S	351;392;351	ENSP00000439551:C351S;ENSP00000391839:C351S	ENSP00000328783:C392S	C	-	2	0	PRAMEF11	12807646	0.578000	0.26717	0.014000	0.15608	0.005000	0.04900	0.846000	0.27682	0.208000	0.20626	-0.483000	0.04790	TGC	C|0.973;G|0.027	0.027	strong		0.532	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341	
GABRG1	2565	hgsc.bcm.edu	37	4	46086060	46086060	+	Silent	SNP	T	T	C	rs976156	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:46086060T>C	ENST00000295452.4	-	3	431	c.264A>G	c.(262-264)acA>acG	p.T88T		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	88					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T88T(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTTCAATTACTGTGGGCCTCA	0.284													T|||	2549	0.508986	0.7209	0.562	5008	,	,		15395	0.3304		0.5517	False		,,,				2504	0.3252				p.T88T		Atlas-SNP	.											GABRG1,NS,carcinoma,0,1	GABRG1	172	1	1	Substitution - coding silent(1)	stomach(1)	c.A264G						scavenged	.	T		3079,1319		1085,909,205	40.0	40.0	40.0		264	-3.8	1.0	4	dbSNP_86	40	4741,3843		1345,2051,896	no	coding-synonymous	GABRG1	NM_173536.3		2430,2960,1101	CC,CT,TT		44.7693,29.9909,39.7627		88/466	46086060	7820,5162	2199	4292	6491	SO:0001819	synonymous_variant	2565	exon3			AATTACTGTGGGC	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.264A>G	4.37:g.46086060T>C		Somatic	567	2	0.00352734		WXS	Illumina HiSeq	Phase_I	569	11	0.0193322	NM_173536	Q5H9T8	Silent	SNP	ENST00000295452.4	37	CCDS3470.1																																																																																			T|0.435;C|0.565	0.565	strong		0.284	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
ZNF227	7770	hgsc.bcm.edu	37	19	44739399	44739399	+	Silent	SNP	T	T	C	rs2279072	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:44739399T>C	ENST00000313040.7	+	6	1021	c.816T>C	c.(814-816)caT>caC	p.H272H	ZNF227_ENST00000589005.1_Silent_p.H221H|ZNF227_ENST00000391961.2_Silent_p.H221H	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	272					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				CGAATGTTCATACAGGAGAAA	0.453													C|||	3183	0.635583	0.705	0.7104	5008	,	,		17959	0.5327		0.5706	False		,,,				2504	0.6616				p.H272H		Atlas-SNP	.											.	ZNF227	62	.	0			c.T816C						PASS	.	C		3121,1285	433.1+/-343.5	1116,889,198	47.0	47.0	47.0		816	1.7	0.0	19	dbSNP_100	47	4846,3754	528.6+/-381.4	1383,2080,837	no	coding-synonymous	ZNF227	NM_182490.1		2499,2969,1035	CC,CT,TT		43.6512,29.1648,38.7437		272/800	44739399	7967,5039	2203	4300	6503	SO:0001819	synonymous_variant	7770	exon6			TGTTCATACAGGA	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.816T>C	19.37:g.44739399T>C		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	99	7	0.0707071	NM_182490	B3KRU7|B7Z5P9	Silent	SNP	ENST00000313040.7	37	CCDS12636.1																																																																																			T|0.393;C|0.607	0.607	strong		0.453	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
DUOX1	53905	hgsc.bcm.edu	37	15	45444518	45444518	+	Silent	SNP	A	A	G	rs1706804	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:45444518A>G	ENST00000321429.4	+	26	3635	c.3228A>G	c.(3226-3228)acA>acG	p.T1076T	DUOX1_ENST00000389037.3_Silent_p.T1076T|CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000561166.1_Silent_p.T722T	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1076	Interaction with TXNDC11. {ECO:0000250}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)	p.T1076T(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CGGGCATCACAGACACCACCC	0.607													G|||	2888	0.576677	0.466	0.513	5008	,	,		18277	0.4921		0.665	False		,,,				2504	0.7679				p.T1076T		Atlas-SNP	.											DUOX1,NS,carcinoma,0,1	DUOX1	125	1	1	Substitution - coding silent(1)	stomach(1)	c.A3228G						PASS	.	G	,	2117,2279	598.5+/-389.1	518,1081,599	151.0	110.0	124.0		3228,3228	-8.1	0.3	15	dbSNP_89	124	5827,2769	440.1+/-359.4	1978,1871,449	no	coding-synonymous,coding-synonymous	DUOX1	NM_017434.3,NM_175940.1	,	2496,2952,1048	GG,GA,AA		32.2127,48.1574,38.8547	,	1076/1552,1076/1552	45444518	7944,5048	2198	4298	6496	SO:0001819	synonymous_variant	53905	exon26			CATCACAGACACC	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.3228A>G	15.37:g.45444518A>G		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	58	4	0.0689655	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Silent	SNP	ENST00000321429.4	37	CCDS32221.1																																																																																			A|0.405;G|0.595	0.595	strong		0.607	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
SMYD1	150572	hgsc.bcm.edu	37	2	88387391	88387391	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:88387391C>T	ENST00000419482.2	+	3	410	c.325C>T	c.(325-327)Cgc>Tgc	p.R109C	SMYD1_ENST00000444564.2_Missense_Mutation_p.R109C|SMYD1_ENST00000438570.1_Intron|SMYD1_ENST00000468008.1_3'UTR	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	109	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						GCTGGCGGCGCGCATCATGTG	0.607																																					p.R109C		Atlas-SNP	.											.	SMYD1	95	.	0			c.C325T						PASS	.						28.0	25.0	26.0					2																	88387391		2197	4297	6494	SO:0001583	missense	150572	exon3			GCGGCGCGCATCA	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.325C>T	2.37:g.88387391C>T	ENSP00000393453:p.Arg109Cys	Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	142	48	0.338028	NM_198274	A0AV30|A6NE13	Missense_Mutation	SNP	ENST00000419482.2	37	CCDS33240.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737350	0.69304	.	.	ENSG00000115593	ENST00000419482;ENST00000444564	T;T	0.36520	1.25;1.27	4.82	3.88	0.44766	SET domain (2);	0.000000	0.85682	D	0.000000	T	0.58878	0.2153	M	0.77406	2.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64007	-0.6508	10	0.87932	D	0	-22.6609	12.1981	0.54309	0.284:0.716:0.0:0.0	.	109	Q8NB12	SMYD1_HUMAN	C	109	ENSP00000393453:R109C;ENSP00000407888:R109C	ENSP00000393453:R109C	R	+	1	0	SMYD1	88168506	0.988000	0.35896	0.938000	0.37757	0.765000	0.43378	2.757000	0.47557	2.363000	0.80096	0.561000	0.74099	CGC	.	.	none		0.607	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	
CCHCR1	54535	hgsc.bcm.edu	37	6	31116210	31116210	+	Silent	SNP	G	G	A	rs130071	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:31116210G>A	ENST00000376266.5	-	10	1407	c.1285C>T	c.(1285-1287)Ctg>Ttg	p.L429L	CCHCR1_ENST00000451521.2_Silent_p.L482L|CCHCR1_ENST00000396268.3_Silent_p.L518L|CCHCR1_ENST00000480060.1_5'Flank|CCHCR1_ENST00000396263.2_Silent_p.L429L	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	429					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						ACAAGCCTCAGCTGCTCCTCG	0.622													G|||	979	0.195487	0.1815	0.2608	5008	,	,		17553	0.0575		0.2793	False		,,,				2504	0.2239				p.L518L		Atlas-SNP	.											.	CCHCR1	68	.	0			c.C1552T						PASS	.		,,	649,2367		69,511,928	114.0	112.0	113.0		1444,1552,1285	3.3	1.0	6	dbSNP_78	113	1572,3844		242,1088,1378	yes	coding-synonymous,coding-synonymous,coding-synonymous	CCHCR1	NM_001105563.1,NM_001105564.1,NM_019052.3	,,	311,1599,2306	AA,AG,GG		29.0251,21.5186,26.3401	,,	482/836,518/872,429/783	31116210	2221,6211	1508	2708	4216	SO:0001819	synonymous_variant	54535	exon10			GCCTCAGCTGCTC	AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.1285C>T	6.37:g.31116210G>A		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	125	6	0.048	NM_001105564	A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	Silent	SNP	ENST00000376266.5	37	CCDS4695.1																																																																																			G|0.746;A|0.254	0.254	strong		0.622	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076190.5	NM_019052	
HLA-DRB1	3123	hgsc.bcm.edu	37	6	32557461	32557461	+	Missense_Mutation	SNP	A	A	G	rs35053532	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:32557461A>G	ENST00000360004.5	-	1	164	c.59T>C	c.(58-60)aTg>aCg	p.M20T		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	20					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GCTCAGCACCATCAGTGTCAC	0.572										Multiple Myeloma(14;0.17)																											p.M20T		Atlas-SNP	.											HLA-DRB1,NS,carcinoma,0,1	HLA-DRB1	41	1	0			c.T59C						scavenged	.						83.0	99.0	93.0					6																	32557461		1511	2709	4220	SO:0001583	missense	3123	exon1			AGCACCATCAGTG	AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.59T>C	6.37:g.32557461A>G	ENSP00000353099:p.Met20Thr	Somatic	115	1	0.00869565		WXS	Illumina HiSeq	Phase_I	125	5	0.04	NM_002124	P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	.	.	.	.	.	.	.	.	.	.	.	4.424	0.078455	0.08533	.	.	ENSG00000196126	ENST00000360004	T	0.00253	8.43	4.4	2.05	0.26809	MHC classes I/II-like antigen recognition protein (1);	1.753860	0.02864	N	0.130685	T	0.00073	0.0002	L	0.51422	1.61	0.09310	N	0.999999	B	0.20887	0.049	B	0.21360	0.034	T	0.43097	-0.9412	10	0.59425	D	0.04	.	5.3115	0.15833	0.7604:0.0:0.2396:0.0	rs35053532	20	P01911	2B1F_HUMAN	T	20	ENSP00000353099:M20T	ENSP00000353099:M20T	M	-	2	0	HLA-DRB1	32665439	0.226000	0.23696	0.380000	0.26093	0.101000	0.19017	1.241000	0.32743	0.270000	0.21984	0.379000	0.24179	ATG	A|0.986;G|0.013	0.013	strong		0.572	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
ANXA10	11199	hgsc.bcm.edu	37	4	169083694	169083694	+	Missense_Mutation	SNP	A	A	C	rs6836994	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:169083694A>C	ENST00000359299.3	+	4	397	c.211A>C	c.(211-213)Atg>Ctg	p.M71L		NM_007193.4	NP_009124.2	Q9UJ72	ANX10_HUMAN	annexin A10	71			M -> L (in dbSNP:rs6836994). {ECO:0000269|PubMed:10458909}.			mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.M71L(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(2)	16		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)		GATTGGGGATATGAGGGAGCA	0.408													C|||	2670	0.533147	0.7436	0.4697	5008	,	,		19208	0.2431		0.5944	False		,,,				2504	0.5297				p.M71L		Atlas-SNP	.											ANXA10,NS,carcinoma,0,1	ANXA10	44	1	1	Substitution - Missense(1)	stomach(1)	c.A211C						PASS	.	C	LEU/MET	3149,1257	429.3+/-342.2	1135,879,189	83.0	74.0	77.0		211	2.6	0.5	4	dbSNP_116	77	5017,3583	518.7+/-379.3	1468,2081,751	yes	missense	ANXA10	NM_007193.4	15	2603,2960,940	CC,CA,AA		41.6628,28.5293,37.2136	benign	71/325	169083694	8166,4840	2203	4300	6503	SO:0001583	missense	11199	exon4			GGGGATATGAGGG	AJ238979	CCDS34096.1	4q32.3	2008-02-05			ENSG00000109511	ENSG00000109511		"""Annexins"""	534	protein-coding gene	gene with protein product		608008				10458909	Standard	NM_007193		Approved	ANX14	uc003irm.3	Q9UJ72	OTTHUMG00000161275	ENST00000359299.3:c.211A>C	4.37:g.169083694A>C	ENSP00000352248:p.Met71Leu	Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	161	8	0.0496894	NM_007193	Q96IQ5|Q9UJV4	Missense_Mutation	SNP	ENST00000359299.3	37	CCDS34096.1	1108	0.5073260073260073	342	0.6951219512195121	193	0.5331491712707183	135	0.23601398601398602	438	0.5778364116094987	C	0.016	-1.511852	0.00984	0.714707	0.583372	ENSG00000109511	ENST00000359299;ENST00000393751	T	0.03580	3.88	5.2	2.56	0.30785	.	0.000000	0.56097	N	0.000032	T	0.00012	0.0000	N	0.00024	-2.7	0.58432	P	1.999999999946489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.23833	-1.0177	9	0.02654	T	1	.	6.4784	0.22049	0.1276:0.6594:0.0:0.2129	rs6836994;rs17610675;rs52801942;rs60731173;rs6836994	71	Q9UJ72	ANX10_HUMAN	L	71	ENSP00000352248:M71L	ENSP00000352248:M71L	M	+	1	0	ANXA10	169320269	1.000000	0.71417	0.522000	0.27862	0.304000	0.27724	1.619000	0.36965	0.058000	0.16222	-0.883000	0.02948	ATG	A|0.419;C|0.580	0.580	strong		0.408	ANXA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364348.2	NM_007193	
PIK3C2A	5286	hgsc.bcm.edu	37	11	17191019	17191019	+	Silent	SNP	A	A	G	rs214936	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:17191019A>G	ENST00000265970.7	-	1	269	c.270T>C	c.(268-270)atT>atC	p.I90I	PIK3C2A_ENST00000540361.1_Intron|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	90	Interaction with clathrin; sufficient to induce clathrin assemby.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TTTCTACATCAATATCTAATG	0.378													a|||	1823	0.364018	0.3744	0.3847	5008	,	,		21861	0.1845		0.497	False		,,,				2504	0.3834				p.I90I		Atlas-SNP	.											.	PIK3C2A	148	.	0			c.T270C						PASS	.	A		1680,2720	509.6+/-367.3	318,1044,838	182.0	181.0	182.0		270	2.0	1.0	11	dbSNP_79	182	3973,4613	552.3+/-386.1	900,2173,1220	no	coding-synonymous	PIK3C2A	NM_002645.2		1218,3217,2058	GG,GA,AA		46.273,38.1818,43.5315		90/1687	17191019	5653,7333	2200	4293	6493	SO:0001819	synonymous_variant	5286	exon1			TACATCAATATCT	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.270T>C	11.37:g.17191019A>G		Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	162	7	0.0432099	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Silent	SNP	ENST00000265970.7	37	CCDS7824.1																																																																																			A|0.601;G|0.399	0.399	strong		0.378	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
COL11A1	1301	hgsc.bcm.edu	37	1	103379918	103379918	+	Missense_Mutation	SNP	G	G	A	rs3753841	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:103379918G>A	ENST00000370096.3	-	52	4280	c.3968C>T	c.(3967-3969)cCt>cTt	p.P1323L	COL11A1_ENST00000353414.4_Missense_Mutation_p.P1284L|COL11A1_ENST00000512756.1_Missense_Mutation_p.P1207L|COL11A1_ENST00000358392.2_Missense_Mutation_p.P1335L	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1323	Triple-helical region.		P -> L (in dbSNP:rs3753841). {ECO:0000269|PubMed:10486316, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:1690726}.		cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGCAGGGCCAGGTTCCCCAGG	0.318													G|||	2487	0.496605	0.0492	0.755	5008	,	,		14366	0.7034		0.6123	False		,,,				2504	0.5859				p.P1335L		Atlas-SNP	.											.	COL11A1	972	.	0			c.C4004T						PASS	.	G	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	615,3791	245.0+/-254.1	51,513,1639	33.0	34.0	34.0		3851,3968,4004,3620	5.8	1.0	1	dbSNP_107	34	5260,3340	623.3+/-397.4	1623,2014,663	yes	missense,missense,missense,missense	COL11A1	NM_001190709.1,NM_001854.3,NM_080629.2,NM_080630.3	98,98,98,98	1674,2527,2302	AA,AG,GG	http://www.ncbi.nlm.nih.gov/pubmed?term	38.8372,13.9582,45.1715	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	1284/1768,1323/1807,1335/1819,1207/1691	103379918	5875,7131	2203	4300	6503	SO:0001583	missense	1301	exon52			GGGCCAGGTTCCC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3968C>T	1.37:g.103379918G>A	ENSP00000359114:p.Pro1323Leu	Somatic	376	0	0		WXS	Illumina HiSeq	Phase_I	314	17	0.0541401	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	1163	0.5325091575091575	29	0.05894308943089431	266	0.7348066298342542	406	0.7097902097902098	462	0.6094986807387863	G	21.2	4.107244	0.77096	0.139582	0.611628	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.96685	-4.09;-4.09;-4.09;-4.09	5.75	5.75	0.90469	.	0.058834	0.64402	D	0.000001	D	0.97417	0.9155	M	0.85373	2.75	0.09310	P	0.999999999630763	B;B;P;B;B	0.50443	0.104;0.073;0.935;0.044;0.167	B;B;P;B;B	0.53006	0.024;0.053;0.715;0.024;0.053	D	0.96950	0.9694	9	0.49607	T	0.09	.	19.9598	0.97242	0.0:0.0:1.0:0.0	rs3753841;rs17446207;rs52824780;rs59687016;rs3753841	1207;1284;1335;1323;543	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	L	1323;1335;1284;543;1207	ENSP00000359114:P1323L;ENSP00000351163:P1335L;ENSP00000302551:P1284L;ENSP00000426533:P1207L	ENSP00000302551:P1284L	P	-	2	0	COL11A1	103152506	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	9.365000	0.97139	2.716000	0.92895	0.655000	0.94253	CCT	G|0.517;A|0.483	0.483	strong		0.318	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
MUC4	4585	hgsc.bcm.edu	37	3	195506569	195506569	+	Missense_Mutation	SNP	A	A	G	rs201891747	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:195506569A>G	ENST00000463781.3	-	2	12341	c.11882T>C	c.(11881-11883)gTa>gCa	p.V3961A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V3961A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAGT	0.592													.|||	988	0.197284	0.1755	0.2075	5008	,	,		8418	0.0804		0.336	False		,,,				2504	0.1973				p.V3961A		Atlas-SNP	.											MUC4_ENST00000463781,NS,lymphoid_neoplasm,0,1	MUC4	1505	1	0			c.T11882C						scavenged	.						17.0	11.0	13.0					3																	195506569		677	1513	2190	SO:0001583	missense	4585	exon2			GTGGATACTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11882T>C	3.37:g.195506569A>G	ENSP00000417498:p.Val3961Ala	Somatic	30	18	0.6		WXS	Illumina HiSeq	Phase_I	21	9	0.428571	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	0.974	-0.699236	0.03279	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.36;1.3	.	.	.	.	.	.	.	.	T	0.16642	0.0400	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.18935	-1.0321	7	.	.	.	6.9246	3.9397	0.09321	0.6657:0.0:0.3343:0.0	.	3833	E7ESK3	.	A	3961	ENSP00000417498:V3961A;ENSP00000420243:V3961A	.	V	-	2	0	MUC4	196991348	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-4.523000	0.00221	-2.036000	0.00922	-2.094000	0.00368	GTA	.	.	weak		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ZKSCAN3	80317	hgsc.bcm.edu	37	6	28327371	28327371	+	Missense_Mutation	SNP	G	G	C	rs733743	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:28327371G>C	ENST00000377255.3	+	3	305	c.8G>C	c.(7-9)aGa>aCa	p.R3T	ZKSCAN3_ENST00000341464.5_Intron|ZKSCAN3_ENST00000252211.2_Missense_Mutation_p.R3T	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	3			R -> T (in dbSNP:rs733743).		autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						AGGATGGCTAGAGAATTAAGT	0.488													G|||	533	0.10643	0.0598	0.1153	5008	,	,		17978	0.2381		0.0775	False		,,,				2504	0.0573				p.R3T		Atlas-SNP	.											.	ZKSCAN3	50	.	0			c.G8C						PASS	.	G	THR/ARG,,THR/ARG	265,4141		7,251,1945	67.0	67.0	67.0		8,,8	2.9	0.6	6	dbSNP_86	67	605,7995		23,559,3718	yes	missense,intron,missense	ZKSCAN3	NM_001242894.1,NM_001242895.1,NM_024493.3	71,,71	30,810,5663	CC,CG,GG		7.0349,6.0145,6.6892	possibly-damaging,,possibly-damaging	3/539,,3/539	28327371	870,12136	2203	4300	6503	SO:0001583	missense	80317	exon2			TGGCTAGAGAATT	U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.8G>C	6.37:g.28327371G>C	ENSP00000366465:p.Arg3Thr	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	93	5	0.0537634	NM_024493	B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Missense_Mutation	SNP	ENST00000377255.3	37	CCDS4650.1	268	0.1227106227106227	33	0.06707317073170732	36	0.09944751381215469	140	0.24475524475524477	59	0.07783641160949868	.	12.91	2.079483	0.36662	0.060145	0.070349	ENSG00000189298	ENST00000252211;ENST00000454413;ENST00000377255	T;T	0.04654	3.58;3.58	3.83	2.87	0.33458	.	.	.	.	.	T	0.00906	0.0030	N	0.24115	0.695	0.24376	P	0.99481107	P	0.43094	0.799	B	0.38562	0.276	T	0.26224	-1.0109	8	0.02654	T	1	.	7.0597	0.25119	0.1051:0.1792:0.7157:0.0	rs733743;rs52825469;rs733743	3	Q9BRR0	ZKSC3_HUMAN	T	3	ENSP00000252211:R3T;ENSP00000366465:R3T	ENSP00000252211:R3T	R	+	2	0	ZKSCAN3	28435350	0.167000	0.22975	0.603000	0.28903	0.193000	0.23685	1.544000	0.36158	2.139000	0.66308	0.557000	0.71058	AGA	G|0.892;C|0.108	0.108	strong		0.488	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040189.3	NM_024493	
IFT43	112752	hgsc.bcm.edu	37	14	76543004	76543004	+	Intron	SNP	G	G	A	rs17783366	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:76543004G>A	ENST00000314067.6	+	6	329				IFT43_ENST00000238628.6_Missense_Mutation_p.D94N	NM_001102564.1	NP_001096034.1	Q96FT9	IFT43_HUMAN	intraflagellar transport 43						cilium morphogenesis (GO:0060271)|intraciliary retrograde transport (GO:0035721)	cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)				endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						GCATCACAGAGATTTGGGGCT	0.468													G|||	846	0.16893	0.0794	0.2046	5008	,	,		20530	0.119		0.3111	False		,,,				2504	0.1697				p.D94N		Atlas-SNP	.											.	IFT43	63	.	0			c.G280A						PASS	.	G	,ASN/ASP	506,3900	231.4+/-245.2	32,442,1729	119.0	103.0	109.0		,280	-0.3	0.0	14	dbSNP_123	109	2739,5861	436.1+/-358.2	422,1895,1983	yes	intron,missense	IFT43	NM_001102564.1,NM_052873.2	,23	454,2337,3712	AA,AG,GG		31.8488,11.4843,24.95	,	,94/214	76543004	3245,9761	2203	4300	6503	SO:0001627	intron_variant	112752	exon4			CACAGAGATTTGG	BC010436	CCDS9847.1, CCDS41973.1, CCDS58330.1	14q24.3	2014-07-03	2014-07-03	2011-06-09				"""Intraflagellar transport homologs"""	29669	protein-coding gene	gene with protein product		614068	"""chromosome 14 open reading frame 179"", ""intraflagellar transport 43 homolog (Chlamydomonas)"""	C14orf179		21378380	Standard	NM_052873		Approved	FLJ32173, MGC16028	uc010asm.1	Q96FT9		ENST00000314067.6:c.296-5634G>A	14.37:g.76543004G>A		Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	92	5	0.0543478	NM_052873	B3KPT6|B4DZI9|G3V385|O95418|Q9ULA9	Missense_Mutation	SNP	ENST00000314067.6	37	CCDS41973.1	440	0.20146520146520147	56	0.11382113821138211	73	0.20165745856353592	81	0.14160839160839161	230	0.3034300791556728	G	13.47	2.247480	0.39697	0.114843	0.318488	ENSG00000119650	ENST00000238628	T	0.42513	0.97	3.98	-0.277	0.12898	.	1.421900	0.03796	N	0.263712	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.06405	0.002	T	0.31724	-0.9933	8	0.15066	T	0.55	-15.6523	1.0305	0.01537	0.2168:0.186:0.4208:0.1764	rs17783366;rs17850656;rs52814736;rs61208018;rs17783366	94	Q96FT9-2	.	N	94	ENSP00000238628:D94N	ENSP00000238628:D94N	D	+	1	0	IFT43	75612757	0.000000	0.05858	0.000000	0.03702	0.954000	0.61252	-0.309000	0.08145	-0.160000	0.11002	0.561000	0.74099	GAT	G|0.774;A|0.226	0.226	strong		0.468	IFT43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_052873	
EYS	346007	hgsc.bcm.edu	37	6	65301206	65301206	+	Silent	SNP	T	T	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:65301206T>G	ENST00000370621.3	-	26	5080	c.4554A>C	c.(4552-4554)acA>acC	p.T1518T	EYS_ENST00000503581.1_Silent_p.T1518T|EYS_ENST00000370616.2_Silent_p.T1518T			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1518					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TGAAGGCTTTTGTACTGAACC	0.423																																					p.T1518T		Atlas-SNP	.											.	EYS	527	.	0			c.A4554C						PASS	.						48.0	40.0	43.0					6																	65301206		692	1590	2282	SO:0001819	synonymous_variant	346007	exon26			GGCTTTTGTACTG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.4554A>C	6.37:g.65301206T>G		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	94	5	0.0531915	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	ENST00000370621.3	37																																																																																				.	.	none		0.423	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
CFHR1	3078	hgsc.bcm.edu	37	1	196801078	196801078	+	Silent	SNP	A	A	T	rs414628	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:196801078A>T	ENST00000320493.5	+	6	1030	c.942A>T	c.(940-942)cgA>cgT	p.R314R	CFHR1_ENST00000367424.4_Silent_p.R255R|CFHR2_ENST00000367421.3_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	314	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						ACACATTGCGAACAACATGTT	0.383													-|||	2122	0.423722	0.326	0.5072	5008	,	,		13037	0.5228		0.4433	False		,,,				2504	0.3742				p.R314R		Atlas-SNP	.											CFHR1,right_upper_lobe,carcinoma,+1,1	CFHR1	47	1	0			c.A942T						scavenged	.	A		1425,2329		530,365,982	77.0	82.0	80.0		942	1.1	0.0	1	dbSNP_80	80	3341,4909		1008,1325,1792	no	coding-synonymous	CFHR1	NM_002113.2		1538,1690,2774	TT,TA,AA		40.497,37.9595,39.7034		314/331	196801078	4766,7238	1877	4125	6002	SO:0001819	synonymous_variant	3078	exon6			ATTGCGAACAACA	M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.942A>T	1.37:g.196801078A>T		Somatic	335	1	0.00298507		WXS	Illumina HiSeq	Phase_I	280	7	0.025	NM_002113	A8K465|Q3B774|Q9UJ17	Silent	SNP	ENST00000320493.5	37	CCDS1386.1																																																																																			A|0.604;T|0.396	0.396	strong		0.383	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088251.2	NM_002113	
KIF1A	547	hgsc.bcm.edu	37	2	241685586	241685586	+	Silent	SNP	G	G	A	rs73102625	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:241685586G>A	ENST00000320389.7	-	28	2927	c.2769C>T	c.(2767-2769)tcC>tcT	p.S923S	KIF1A_ENST00000498729.2_Silent_p.S1024S	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	923					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGCAAGACTCGGACTGGAACT	0.682													G|||	252	0.0503195	0.0877	0.0504	5008	,	,		16642	0.0099		0.0527	False		,,,				2504	0.0389				p.S1024S		Atlas-SNP	.											.	KIF1A	152	.	0			c.C3072T						PASS	.	G		260,3782		10,240,1771	11.0	13.0	13.0		2769	-3.6	1.0	2	dbSNP_130	13	449,7889		9,431,3729	no	coding-synonymous	KIF1A	NM_004321.5		19,671,5500	AA,AG,GG		5.385,6.4325,5.727		923/1691	241685586	709,11671	2021	4169	6190	SO:0001819	synonymous_variant	547	exon30			AGACTCGGACTGG	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2769C>T	2.37:g.241685586G>A		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	95	5	0.0526316	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Silent	SNP	ENST00000320389.7	37	CCDS46561.1	103	0.04716117216117216	29	0.05894308943089431	22	0.06077348066298342	8	0.013986013986013986	44	0.05804749340369393	G	6.818	0.519965	0.13005	0.064325	0.05385	ENSG00000130294	ENST00000415042	.	.	.	3.97	-3.63	0.04529	.	.	.	.	.	T	0.06096	0.0158	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19582	-1.0301	4	.	.	.	.	3.6227	0.08101	0.5035:0.1041:0.2882:0.1042	.	.	.	.	L	50	.	.	P	-	2	0	KIF1A	241334259	0.000000	0.05858	0.990000	0.47175	0.733000	0.41908	-6.064000	0.00083	-0.654000	0.05394	-0.671000	0.03813	CCG	G|0.951;A|0.049	0.049	strong		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
CPNE8	144402	hgsc.bcm.edu	37	12	39087609	39087609	+	Silent	SNP	G	G	A	rs3759139	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:39087609G>A	ENST00000331366.5	-	15	1089	c.993C>T	c.(991-993)taC>taT	p.Y331Y	CPNE8_ENST00000360449.3_Silent_p.Y319Y|CPNE8_ENST00000538596.2_5'UTR	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	331	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular vesicular exosome (GO:0070062)		p.Y331Y(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				AAGGATTCATGTAGTGGAGGG	0.378													G|||	1314	0.26238	0.0477	0.2997	5008	,	,		17328	0.2331		0.4493	False		,,,				2504	0.364				p.Y331Y		Atlas-SNP	.											CPNE8,NS,carcinoma,0,1	CPNE8	66	1	1	Substitution - coding silent(1)	stomach(1)	c.C993T						PASS	.	G		450,3956	215.1+/-234.2	21,408,1774	120.0	99.0	106.0		993	-0.0	1.0	12	dbSNP_107	106	3855,4745	543.3+/-384.4	843,2169,1288	no	coding-synonymous	CPNE8	NM_153634.2		864,2577,3062	AA,AG,GG		44.8256,10.2133,33.1001		331/565	39087609	4305,8701	2203	4300	6503	SO:0001819	synonymous_variant	144402	exon15			ATTCATGTAGTGG	AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.993C>T	12.37:g.39087609G>A		Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	164	7	0.0426829	NM_153634	Q2TB41|Q86VY2	Silent	SNP	ENST00000331366.5	37	CCDS8733.1																																																																																			G|0.695;A|0.305	0.305	strong		0.378	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403856.1	NM_153634	
SOCS3	9021	hgsc.bcm.edu	37	17	76354835	76354835	+	Silent	SNP	C	C	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:76354835C>A	ENST00000330871.2	-	2	757	c.342G>T	c.(340-342)gtG>gtT	p.V114V	RP11-806H10.4_ENST00000592569.1_lincRNA	NM_003955.3	NP_003946.3	O14543	SOCS3_HUMAN	suppressor of cytokine signaling 3	114	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				branching involved in labyrinthine layer morphogenesis (GO:0060670)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase activity (GO:0006469)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|spongiotrophoblast differentiation (GO:0060708)|trophoblast giant cell differentiation (GO:0060707)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)	protein kinase inhibitor activity (GO:0004860)			kidney(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(99;0.000688)|OV - Ovarian serous cystadenocarcinoma(97;0.0554)			CGAAGCGGGGCACGGGCTGCG	0.667																																					p.V114V		Atlas-SNP	.											.	SOCS3	16	.	0			c.G342T						PASS	.						29.0	30.0	30.0					17																	76354835		2201	4298	6499	SO:0001819	synonymous_variant	9021	exon2			GCGGGGCACGGGC	AB004904	CCDS11756.1	17q25.3	2014-09-17						"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19391	protein-coding gene	gene with protein product		604176				9266833, 9344848	Standard	NM_003955		Approved	SSI-3, CIS3, SOCS-3, Cish3	uc002jvl.2	O14543		ENST00000330871.2:c.342G>T	17.37:g.76354835C>A		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	64	34	0.53125	NM_003955	O14509	Silent	SNP	ENST00000330871.2	37	CCDS11756.1																																																																																			.	.	none		0.667	SOCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437300.1		
MXRA5	25878	hgsc.bcm.edu	37	X	3241256	3241256	+	Missense_Mutation	SNP	T	T	C	rs5983119	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chrX:3241256T>C	ENST00000217939.6	-	5	2624	c.2470A>G	c.(2470-2472)Att>Gtt	p.I824V		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	824			I -> V (in dbSNP:rs5983119). {ECO:0000269|Ref.1}.			extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GGGGGAGAAATAGCAGGAAAA	0.488													C|||	2831	0.749934	0.6853	0.5216	3775	,	,		14207	0.5595		0.5288	False		,,,				2504	0.4775				p.I824V		Atlas-SNP	.											.	MXRA5	815	.	0			c.A2470G						PASS	.	C	VAL/ILE	3360,475		1270,329,491,33,80	128.0	127.0	128.0		2470	0.1	0.0	X	dbSNP_114	128	4339,2389		1019,1109,1192,300,680	yes	missense	MXRA5	NM_015419.3	29	2289,1438,1683,333,760	CC,CT,C,TT,T		35.5083,12.3859,27.1135	benign	824/2829	3241256	7699,2864	2203	4300	6503	SO:0001583	missense	25878	exon5			GAGAAATAGCAGG	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.2470A>G	X.37:g.3241256T>C	ENSP00000217939:p.Ile824Val	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	131	6	0.0458015	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	1233	0.7432188065099458	236	0.8251748251748252	131	0.5077519379844961	206	0.5885714285714285	272	0.5291828793774319	c	0.011	-1.733413	0.00687	0.876141	0.644917	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.61274	0.12	3.63	0.0923	0.14472	.	1.970240	0.02957	N	0.142505	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41893	-0.9483	9	0.02654	T	1	.	2.6272	0.04933	0.1281:0.4316:0.2503:0.1899	rs5983119;rs6420602;rs17259953;rs52798373;rs58224949;rs5983119	824	Q9NR99	MXRA5_HUMAN	V	824	ENSP00000217939:I824V	ENSP00000217939:I824V	I	-	1	0	MXRA5	3251256	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.202000	0.17295	0.025000	0.15241	-0.252000	0.11476	ATT	0|0.003;C|0.749	0.749	strong		0.488	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
ITGAE	3682	hgsc.bcm.edu	37	17	3657175	3657175	+	Missense_Mutation	SNP	T	T	C	rs220479	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:3657175T>C	ENST00000263087.4	-	13	1527	c.1429A>G	c.(1429-1431)Atc>Gtc	p.I477V		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	477			I -> V (in dbSNP:rs220479). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8119947}.		cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		GCCCCCGCGATGTAGGAGAGG	0.627													C|||	3557	0.710264	0.9887	0.6167	5008	,	,		16353	0.4058		0.8618	False		,,,				2504	0.5583				p.I477V	NSCLC(182;635 2928 8995 38788)	Atlas-SNP	.											.	ITGAE	96	.	0			c.A1429G						PASS	.	C	VAL/ILE	4210,196	121.7+/-159.2	2011,188,4	69.0	58.0	62.0		1429	-3.8	0.0	17	dbSNP_79	62	7022,1578	295.9+/-302.6	2874,1274,152	yes	missense	ITGAE	NM_002208.4	29	4885,1462,156	CC,CT,TT		18.3488,4.4485,13.6399	benign	477/1180	3657175	11232,1774	2203	4300	6503	SO:0001583	missense	3682	exon13			CCGCGATGTAGGA	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.1429A>G	17.37:g.3657175T>C	ENSP00000263087:p.Ile477Val	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	51	4	0.0784314	NM_002208	Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	CCDS32531.1	1615	0.7394688644688645	483	0.9817073170731707	249	0.6878453038674033	236	0.4125874125874126	647	0.8535620052770448	C	0.003	-2.501285	0.00157	0.955515	0.816512	ENSG00000083457	ENST00000263087	T	0.16073	2.37	4.56	-3.83	0.04269	.	.	.	.	.	T	0.00012	0.0000	N	0.00738	-1.235	0.80722	P	0.0	B	0.06786	0.001	B	0.06405	0.002	T	0.28170	-1.0052	8	0.02654	T	1	.	6.7004	0.23223	0.138:0.2507:0.0:0.6113	rs220479;rs60417346;rs220479	477	P38570	ITAE_HUMAN	V	477	ENSP00000263087:I477V	ENSP00000263087:I477V	I	-	1	0	ITGAE	3603924	0.001000	0.12720	0.002000	0.10522	0.003000	0.03518	-0.538000	0.06120	-0.905000	0.03871	-1.403000	0.01137	ATC	T|0.196;C|0.804	0.804	strong		0.627	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208	
ZCWPW2	152098	hgsc.bcm.edu	37	3	28476649	28476649	+	Silent	SNP	T	T	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:28476649T>G	ENST00000383768.2	+	4	569	c.381T>G	c.(379-381)acT>acG	p.T127T	ZCWPW2_ENST00000421010.1_Silent_p.T127T			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	127	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						AATATGTAACTTATGACCCGG	0.358																																					p.T127T		Atlas-SNP	.											.	ZCWPW2	49	.	0			c.T381G						PASS	.						96.0	97.0	97.0					3																	28476649		2203	4300	6503	SO:0001819	synonymous_variant	152098	exon3			TGTAACTTATGAC	BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.381T>G	3.37:g.28476649T>G		Somatic	364	1	0.00274725		WXS	Illumina HiSeq	Phase_I	363	129	0.355372	NM_001040432		Silent	SNP	ENST00000383768.2	37	CCDS33723.1	.	.	.	.	.	.	.	.	.	.	T	5.612	0.297711	0.10622	.	.	ENSG00000206559	ENST00000428875	.	.	.	6.06	1.1	0.20463	.	.	.	.	.	T	0.50565	0.1623	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33394	-0.9870	4	.	.	.	1.5734	4.335	0.11081	0.1458:0.5228:0.0:0.3314	.	.	.	.	V	111	.	.	L	+	1	2	ZCWPW2	28451653	0.463000	0.25799	0.677000	0.29947	0.479000	0.33129	-0.481000	0.06552	-0.073000	0.12842	-0.859000	0.03014	TTA	.	.	none		0.358	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	
DMBT1	1755	hgsc.bcm.edu	37	10	124352028	124352028	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:124352028A>G	ENST00000338354.3	+	20	2523	c.2417A>G	c.(2416-2418)gAg>gGg	p.E806G	DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000344338.3_Missense_Mutation_p.E796G|DMBT1_ENST00000368955.3_Missense_Mutation_p.E796G|DMBT1_ENST00000330163.4_Intron|DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000368909.3_Missense_Mutation_p.E806G			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	806	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCAGGACACGAGTCCTACCTG	0.617																																					p.E806G	Ovarian(182;93 2026 18125 22222 38972)	Atlas-SNP	.											.	DMBT1	677	.	0			c.A2417G						PASS	.						144.0	104.0	117.0					10																	124352028		2018	4109	6127	SO:0001583	missense	1755	exon20			GACACGAGTCCTA		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2417A>G	10.37:g.124352028A>G	ENSP00000342210:p.Glu806Gly	Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	15	14	0.933333	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	A	10.04	1.242226	0.22796	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000344338;ENST00000368909;ENST00000368955	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	3.75	2.6	0.31112	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	D	0.84365	0.5456	H	0.97852	4.09	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.996;0.996;0.998	D	0.84836	0.0805	9	0.87932	D	0	.	8.8898	0.35425	0.9078:0.0:0.0922:0.0	.	567;806;796;806	Q9UGM3-4;Q9UGM3-6;Q9UGM3-3;Q9UGM3	.;.;.;DMBT1_HUMAN	G	806;806;806;806;806;806;796;806;796	ENSP00000342210:E806G;ENSP00000343175:E796G;ENSP00000357905:E806G;ENSP00000357951:E796G	ENSP00000342210:E806G	E	+	2	0	DMBT1	124342018	1.000000	0.71417	0.022000	0.16811	0.047000	0.14425	6.948000	0.75965	0.438000	0.26450	0.460000	0.39030	GAG	.	.	none		0.617	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
ZNF74	7625	hgsc.bcm.edu	37	22	20761063	20761063	+	Silent	SNP	G	G	A	rs2228236	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr22:20761063G>A	ENST00000400451.2	+	5	2254	c.1740G>A	c.(1738-1740)gaG>gaA	p.E580E	ZNF74_ENST00000356671.5_Silent_p.E580E|ZNF74_ENST00000357502.5_3'UTR|ZNF74_ENST00000403682.3_3'UTR|ZNF74_ENST00000405993.1_Silent_p.E548E	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	580					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TGCACAGCGAGGGGAAGCCCT	0.572													G|||	547	0.109225	0.1899	0.1066	5008	,	,		20956	0.002		0.164	False		,,,				2504	0.0562				p.E580E		Atlas-SNP	.											.	ZNF74	54	.	0			c.G1740A						PASS	.	G		751,3543		63,625,1459	49.0	55.0	53.0		1740	-8.5	0.0	22	dbSNP_98	53	1315,7225		102,1111,3057	no	coding-synonymous	ZNF74	NM_003426.2		165,1736,4516	AA,AG,GG		15.3981,17.4895,16.0979		580/645	20761063	2066,10768	2147	4270	6417	SO:0001819	synonymous_variant	7625	exon5			CAGCGAGGGGAAG	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.1740G>A	22.37:g.20761063G>A		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	78	6	0.0769231	NM_003426	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Silent	SNP	ENST00000400451.2	37	CCDS42982.1																																																																																			G|0.859;A|0.141	0.141	strong		0.572	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319648.2	NM_003426	
PLA2G15	23659	hgsc.bcm.edu	37	16	68293320	68293320	+	Silent	SNP	T	T	C	rs3743739	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:68293320T>C	ENST00000219345.5	+	6	1082	c.999T>C	c.(997-999)ggT>ggC	p.G333G	PLA2G15_ENST00000444212.2_Silent_p.G133G|RP11-96D1.7_ENST00000563175.1_RNA|PLA2G15_ENST00000413021.2_Silent_p.G239G|PLA2G15_ENST00000566188.1_3'UTR|RP11-96D1.7_ENST00000569843.1_RNA	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	333					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)	p.G333G(1)		kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						GCCTCTATGGTACTGGCGTCC	0.562													C|||	1090	0.217652	0.3623	0.2032	5008	,	,		22081	0.1022		0.166	False		,,,				2504	0.2045				p.G333G		Atlas-SNP	.											PLA2G15,NS,carcinoma,0,1	PLA2G15	30	1	1	Substitution - coding silent(1)	prostate(1)	c.T999C						scavenged	.	C		1393,3003	687.0+/-404.8	228,937,1033	99.0	85.0	90.0		999	-1.3	0.9	16	dbSNP_107	90	1477,7123	749.3+/-407.4	162,1153,2985	no	coding-synonymous	PLA2G15	NM_012320.3		390,2090,4018	CC,CT,TT		17.1744,31.6879,22.0837		333/413	68293320	2870,10126	2198	4300	6498	SO:0001819	synonymous_variant	23659	exon6			CTATGGTACTGGC	AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	ENST00000219345.5:c.999T>C	16.37:g.68293320T>C		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	64	3	0.046875	NM_012320	B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Silent	SNP	ENST00000219345.5	37	CCDS10864.1																																																																																			T|0.778;C|0.222	0.222	strong		0.562	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268888.2	NM_012320	
RAP1GAP2	23108	hgsc.bcm.edu	37	17	2929392	2929392	+	Silent	SNP	G	G	A	rs55904912	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:2929392G>A	ENST00000254695.8	+	20	1932	c.1842G>A	c.(1840-1842)ccG>ccA	p.P614P	RAP1GAP2_ENST00000540393.2_Silent_p.P595P|RAP1GAP2_ENST00000542807.1_Silent_p.P614P|RAP1GAP2_ENST00000366401.4_Silent_p.P599P	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	614	Ser-rich.				negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)	p.P614P(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						CCAGCTCTCCGGAAATCTGCC	0.577													G|||	2146	0.428514	0.2451	0.4986	5008	,	,		16508	0.5466		0.4066	False		,,,				2504	0.5276				p.P614P		Atlas-SNP	.											RAP1GAP2_ENST00000254695,NS,carcinoma,0,2	RAP1GAP2	90	2	1	Substitution - coding silent(1)	stomach(1)	c.G1842A						scavenged	.	G	,	1082,2966		152,778,1094	45.0	48.0	47.0		1797,1842	-7.4	1.0	17	dbSNP_129	47	3415,4945		687,2041,1452	no	coding-synonymous,coding-synonymous	RAP1GAP2	NM_001100398.1,NM_015085.4	,	839,2819,2546	AA,AG,GG		40.8493,26.7292,36.2427	,	599/716,614/731	2929392	4497,7911	2024	4180	6204	SO:0001819	synonymous_variant	23108	exon20			CTCTCCGGAAATC	AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1842G>A	17.37:g.2929392G>A		Somatic	361	0	0		WXS	Illumina HiSeq	Phase_I	297	6	0.020202	NM_015085	B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Silent	SNP	ENST00000254695.8	37	CCDS45573.1																																																																																			G|0.579;A|0.421	0.421	strong		0.577	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438208.2		
CSMD2	114784	hgsc.bcm.edu	37	1	34071525	34071525	+	Intron	SNP	C	C	T	rs376790279|rs1874045	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:34071525C>T	ENST00000373380.1	-	21	3183				CSMD2_ENST00000373388.2_Intron|CSMD2_ENST00000373377.1_Intron|CSMD2_ENST00000373381.4_Intron			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGAGTTGGTTCTTTCCAACTC	0.478													C|||	2596	0.518371	0.323	0.6787	5008	,	,		21656	0.5516		0.5755	False		,,,				2504	0.5757				p.R2096K		Atlas-SNP	.											CSMD2,brain,glioma,0,1	CSMD2	946	1	0			c.G6287A						scavenged	.	C	LYS/ARG	1744,2662	520.1+/-370.2	344,1056,803	66.0	65.0	65.0		6287	3.0	0.0	1	dbSNP_92	65	4953,3647	623.0+/-397.4	1436,2081,783	yes	missense	CSMD2	NM_052896.3	26	1780,3137,1586	TT,TC,CC		42.407,39.5824,48.5084		2096/3488	34071525	6697,6309	2203	4300	6503	SO:0001627	intron_variant	114784	exon42			TTGGTTCTTTCCA	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2963-455G>A	1.37:g.34071525C>T		Somatic	86	2	0.0232558		WXS	Illumina HiSeq	Phase_I	103	7	0.0679612	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37																																																																																				C|0.479;T|0.521	0.521	strong		0.478	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
MUC4	4585	hgsc.bcm.edu	37	3	195515077	195515077	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:195515077T>C	ENST00000463781.3	-	2	3833	c.3374A>G	c.(3373-3375)gAc>gGc	p.D1125G	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D1125G	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	564					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D1125G(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGTCGGTGACAGG	0.557																																					p.D1125G		Atlas-SNP	.											MUC4_ENST00000463781,bladder,carcinoma,0,5	MUC4	1505	5	1	Substitution - Missense(1)	endometrium(1)	c.A3374G						scavenged	.						11.0	7.0	8.0					3																	195515077		662	1503	2165	SO:0001583	missense	4585	exon2			GAAGTGTCGGTGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3374A>G	3.37:g.195515077T>C	ENSP00000417498:p.Asp1125Gly	Somatic	101	2	0.019802		WXS	Illumina HiSeq	Phase_I	84	4	0.047619	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.527	0.465468	0.12402	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33438	1.42;1.41	0.814	-0.456	0.12190	.	.	.	.	.	T	0.16471	0.0396	N	0.19112	0.55	0.09310	N	1	P	0.44344	0.833	B	0.41374	0.355	T	0.13072	-1.0523	8	.	.	.	.	4.1432	0.10203	0.0:0.2489:0.0:0.7511	.	1125	E7ESK3	.	G	1125	ENSP00000417498:D1125G;ENSP00000420243:D1125G	.	D	-	2	0	MUC4	196999472	0.000000	0.05858	0.002000	0.10522	0.071000	0.16799	-1.004000	0.03678	-0.138000	0.11434	0.055000	0.15244	GAC	.	.	none		0.557	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MFF	56947	hgsc.bcm.edu	37	2	228197238	228197238	+	Silent	SNP	G	G	A	rs11557342	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:228197238G>A	ENST00000353339.3	+	5	804	c.363G>A	c.(361-363)acG>acA	p.T121T	MFF_ENST00000476924.1_3'UTR|MFF_ENST00000409565.1_Silent_p.T95T|MFF_ENST00000349901.7_Silent_p.T95T|MFF_ENST00000409616.1_Silent_p.T95T|MFF_ENST00000524634.1_De_novo_Start_InFrame|MFF_ENST00000304593.9_Silent_p.T95T|MFF_ENST00000354503.6_Silent_p.T95T|MFF_ENST00000392059.1_Silent_p.T121T|MFF_ENST00000337110.7_Silent_p.T95T	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	121					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)	p.T121T(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						GTGTACTTACGCTGAGTGAAA	0.393													G|||	446	0.0890575	0.0741	0.1081	5008	,	,		17428	0.1022		0.0716	False		,,,				2504	0.1002				p.T121T		Atlas-SNP	.											MFF,NS,carcinoma,0,1	MFF	48	1	1	Substitution - coding silent(1)	stomach(1)	c.G363A						scavenged	.	G		328,4078	171.6+/-201.8	4,320,1879	259.0	254.0	256.0		363	-10.2	0.5	2	dbSNP_120	256	749,7851	179.6+/-228.7	30,689,3581	no	coding-synonymous	MFF	NM_020194.4		34,1009,5460	AA,AG,GG		8.7093,7.4444,8.2808		121/343	228197238	1077,11929	2203	4300	6503	SO:0001819	synonymous_variant	56947	exon5			ACTTACGCTGAGT	AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.363G>A	2.37:g.228197238G>A		Somatic	378	1	0.0026455		WXS	Illumina HiSeq	Phase_I	382	5	0.013089	NM_020194	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Silent	SNP	ENST00000353339.3	37	CCDS2465.1																																																																																			G|0.922;A|0.078	0.078	strong		0.393	MFF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256887.2	NM_020194	
DSCAM	1826	hgsc.bcm.edu	37	21	41414420	41414420	+	Missense_Mutation	SNP	G	G	A	rs200410460		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr21:41414420G>A	ENST00000400454.1	-	32	6041	c.5564C>T	c.(5563-5565)aCg>aTg	p.T1855M		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1855					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CAGACTGTCCGTGTACTCATT	0.527																																					p.T1855M	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.C5564T						PASS	.	G	MET/THR	1,4227		0,1,2113	185.0	179.0	181.0		5564	5.3	1.0	21		181	1,8449		0,1,4224	yes	missense	DSCAM	NM_001389.3	81	0,2,6337	AA,AG,GG		0.0118,0.0237,0.0158	probably-damaging	1855/2013	41414420	2,12676	2114	4225	6339	SO:0001583	missense	1826	exon32			CTGTCCGTGTACT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.5564C>T	21.37:g.41414420G>A	ENSP00000383303:p.Thr1855Met	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	81	31	0.382716	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	g	18.87	3.716437	0.68844	2.37E-4	1.18E-4	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.60424	0.19;0.29	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.64789	0.2630	L	0.27053	0.805	0.36068	D	0.841933	D	0.89917	1.0	D	0.83275	0.996	T	0.73458	-0.3976	10	0.72032	D	0.01	.	14.4825	0.67592	0.0:0.1467:0.8533:0.0	.	1855	O60469	DSCAM_HUMAN	M	1855;1607	ENSP00000383303:T1855M;ENSP00000385342:T1607M	ENSP00000383303:T1855M	T	-	2	0	DSCAM	40336290	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.419000	0.73345	2.458000	0.83093	0.655000	0.94253	ACG	.	.	weak		0.527	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
TNC	3371	hgsc.bcm.edu	37	9	117797597	117797597	+	Silent	SNP	T	T	C	rs12347433	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:117797597T>C	ENST00000350763.4	-	22	6084	c.5673A>G	c.(5671-5673)agA>agG	p.R1891R	TNC_ENST00000537320.1_Silent_p.R1254R|TNC_ENST00000340094.3_Silent_p.R1527R|TNC_ENST00000346706.3_Silent_p.R1345R|TNC_ENST00000345230.3_Silent_p.R1254R|TNC_ENST00000423613.2_Silent_p.R1618R|TNC_ENST00000542877.1_Silent_p.R1528R|TNC_ENST00000535648.1_Silent_p.R1436R|TNC_ENST00000341037.4_Silent_p.R1709R	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1891	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.R1891R(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CAGTCAAGTCTCTTGGAGAAT	0.512													T|||	773	0.154353	0.0666	0.1484	5008	,	,		19335	0.129		0.2793	False		,,,				2504	0.1748				p.R1891R		Atlas-SNP	.											TNC,NS,carcinoma,0,1	TNC	282	1	1	Substitution - coding silent(1)	stomach(1)	c.A5673G						scavenged	.	T		404,4002	199.4+/-223.0	21,362,1820	72.0	72.0	72.0		5673	6.0	1.0	9	dbSNP_120	72	2313,6287	389.1+/-342.8	320,1673,2307	no	coding-synonymous	TNC	NM_002160.3		341,2035,4127	CC,CT,TT		26.8953,9.1693,20.8904		1891/2202	117797597	2717,10289	2203	4300	6503	SO:0001819	synonymous_variant	3371	exon22			CAAGTCTCTTGGA		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5673A>G	9.37:g.117797597T>C		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	69	3	0.0434783	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	ENST00000350763.4	37	CCDS6811.1	383	0.17536630036630035	40	0.08130081300813008	46	0.1270718232044199	85	0.1486013986013986	212	0.2796833773087071	T	10.49	1.365894	0.24684	0.091693	0.268953	ENSG00000041982	ENST00000544972	T	0.57436	0.4	5.97	5.97	0.96955	.	0.206129	0.51477	D	0.000084	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.22034	-1.0228	6	0.48119	T	0.1	.	10.4647	0.44600	0.0:0.1145:0.0:0.8855	rs12347433;rs17240303;rs12347433	.	.	.	G	454	ENSP00000445380:R454G	ENSP00000445380:R454G	R	-	1	2	TNC	116837418	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.042000	0.49815	2.274000	0.75844	0.533000	0.62120	AGA	T|0.813;C|0.187	0.187	strong		0.512	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
CASQ2	845	hgsc.bcm.edu	37	1	116310967	116310967	+	Missense_Mutation	SNP	T	T	C	rs4074536	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:116310967T>C	ENST00000261448.5	-	1	435	c.196A>G	c.(196-198)Acg>Gcg	p.T66A	CASQ2_ENST00000456138.2_Missense_Mutation_p.T66A	NM_001232.3	NP_001223.2	O14958	CASQ2_HUMAN	calsequestrin 2 (cardiac muscle)	66			T -> A (no effect on calcium-binding and calcium-dependent dimerization; dbSNP:rs4074536). {ECO:0000269|PubMed:14571276, ECO:0000269|PubMed:17881003}.		cardiac muscle contraction (GO:0060048)|cellular response to caffeine (GO:0071313)|detection of calcium ion (GO:0005513)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|protein polymerization (GO:0051258)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of heart rate (GO:0002027)|regulation of membrane repolarization (GO:0060306)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|sequestering of calcium ion (GO:0051208)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|junctional sarcoplasmic reticulum membrane (GO:0014701)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	18	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TGTTTTTGCGTGACCTTATCT	0.473													C|||	2009	0.401158	0.4856	0.3674	5008	,	,		19899	0.5159		0.2922	False		,,,				2504	0.3047				p.T66A		Atlas-SNP	.											CASQ2,colon,carcinoma,0,1	CASQ2	54	1	0			c.A196G						PASS	.	C	ALA/THR	1928,2478	622.1+/-393.9	416,1096,691	175.0	166.0	169.0	http://www.ncbi.nlm.nih.gov/pubmed?term	196	3.4	0.0	1	dbSNP_108	169	2486,6114	695.2+/-404.8	347,1792,2161	yes	missense	CASQ2	NM_001232.3	58	763,2888,2852	CC,CT,TT	http://www.ncbi.nlm.nih.gov/pubmed?term	28.907,43.7585,33.9382	benign	66/400	116310967	4414,8592	2203	4300	6503	SO:0001583	missense	845	exon1			TTTGCGTGACCTT	BC022288	CCDS884.1	1p13.1	2014-09-17			ENSG00000118729	ENSG00000118729		"""Protein disulfide isomerases"""	1513	protein-coding gene	gene with protein product		114251				8406504	Standard	NM_001232		Approved	PDIB2	uc001efx.4	O14958	OTTHUMG00000011970	ENST00000261448.5:c.196A>G	1.37:g.116310967T>C	ENSP00000261448:p.Thr66Ala	Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	100	4	0.04	NM_001232	B2R7M6|B4DIB0|Q5T1D2|Q8TBW8	Missense_Mutation	SNP	ENST00000261448.5	37	CCDS884.1	902	0.413003663003663	253	0.5142276422764228	133	0.3674033149171271	285	0.4982517482517482	231	0.30474934036939316	C	0.005	-2.171649	0.00315	0.437585	0.28907	ENSG00000118729	ENST00000261448;ENST00000456138;ENST00000446755	T;T	0.37752	1.18;1.18	5.49	3.44	0.39384	Thioredoxin-like fold (2);	0.442334	0.26300	N	0.025162	T	0.02047	0.0064	N	0.00289	-1.7	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43410	-0.9393	9	0.05959	T	0.93	-3.1292	8.6205	0.33857	0.3705:0.5482:0.0:0.0813	rs4074536;rs52800545;rs59883665;rs4074536	66;66	B4DIB0;O14958	.;CASQ2_HUMAN	A	66	ENSP00000261448:T66A;ENSP00000403858:T66A	ENSP00000261448:T66A	T	-	1	0	CASQ2	116112490	0.257000	0.24022	0.001000	0.08648	0.019000	0.09904	1.594000	0.36697	0.685000	0.31468	-0.186000	0.12905	ACG	T|0.631;C|0.369	0.369	strong		0.473	CASQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033091.1	NM_001232	
ZNF782	158431	hgsc.bcm.edu	37	9	99581542	99581542	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:99581542T>C	ENST00000481138.1	-	6	1424	c.763A>G	c.(763-765)Aaa>Gaa	p.K255E	ZNF782_ENST00000466833.1_5'Flank|ZNF782_ENST00000535338.1_Missense_Mutation_p.K123E	NM_001001662.1	NP_001001662.1	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(8)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)	33		Acute lymphoblastic leukemia(62;0.0527)				AAGGTTGATTTATCATATTTG	0.328																																					p.K255E		Atlas-SNP	.											.	ZNF782	64	.	0			c.A763G						PASS	.						81.0	86.0	84.0					9																	99581542		2202	4299	6501	SO:0001583	missense	158431	exon6			TTGATTTATCATA	AK131468	CCDS35075.1	9q22.33	2013-01-08			ENSG00000196597	ENSG00000196597		"""Zinc fingers, C2H2-type"", ""-"""	33110	protein-coding gene	gene with protein product							Standard	NM_001001662		Approved	FLJ16636	uc004awp.1	Q6ZMW2	OTTHUMG00000020310	ENST00000481138.1:c.763A>G	9.37:g.99581542T>C	ENSP00000419397:p.Lys255Glu	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	79	22	0.278481	NM_001001662	B2RNR0	Missense_Mutation	SNP	ENST00000481138.1	37	CCDS35075.1	.	.	.	.	.	.	.	.	.	.	T	11.88	1.770680	0.31320	.	.	ENSG00000196597	ENST00000481138;ENST00000535338	T;T	0.07021	3.44;3.23	3.53	2.39	0.29439	.	0.000000	0.35708	N	0.003027	T	0.05914	0.0154	L	0.48362	1.52	0.09310	N	1	B	0.32203	0.36	B	0.24269	0.052	T	0.31752	-0.9932	10	0.41790	T	0.15	.	3.0506	0.06168	0.2109:0.1157:0.0:0.6734	.	255	Q6ZMW2	ZN782_HUMAN	E	255;123	ENSP00000419397:K255E;ENSP00000440624:K123E	ENSP00000419397:K255E	K	-	1	0	ZNF782	98621363	0.009000	0.17119	0.003000	0.11579	0.035000	0.12851	0.984000	0.29565	0.730000	0.32425	0.529000	0.55759	AAA	.	.	none		0.328	ZNF782-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356810.1	NM_001001662	
TTC21A	199223	hgsc.bcm.edu	37	3	39161456	39161456	+	Missense_Mutation	SNP	G	G	A	rs1274972	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:39161456G>A	ENST00000431162.2	+	8	1003	c.869G>A	c.(868-870)aGg>aAg	p.R290K	TTC21A_ENST00000440121.1_Missense_Mutation_p.R241K|TTC21A_ENST00000301819.6_Missense_Mutation_p.R290K			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	290			R -> K (in dbSNP:rs1274972).							NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CTAGAGACAAGGGAACCCGAA	0.458													G|||	2282	0.455671	0.8495	0.3429	5008	,	,		18365	0.2738		0.334	False		,,,				2504	0.316				p.R290K		Atlas-SNP	.											.	TTC21A	96	.	0			c.G869A						PASS	.	G	LYS/ARG,LYS/ARG	2803,953		1044,715,119	114.0	123.0	120.0		722,869	1.8	0.4	3	dbSNP_87	120	2777,5435		486,1805,1815	yes	missense,missense	TTC21A	NM_001105513.2,NM_145755.2	26,26	1530,2520,1934	AA,AG,GG		33.8164,25.3727,46.6243	benign,benign	241/1273,290/1321	39161456	5580,6388	1878	4106	5984	SO:0001583	missense	199223	exon8			AGACAAGGGAACC	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.869G>A	3.37:g.39161456G>A	ENSP00000398211:p.Arg290Lys	Somatic	245	0	0		WXS	Illumina HiSeq	Phase_I	198	9	0.0454545	NM_145755	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	ENST00000431162.2	37	CCDS46800.1	959	0.4391025641025641	410	0.8333333333333334	133	0.3674033149171271	166	0.2902097902097902	250	0.32981530343007914	G	3.931	-0.016256	0.07681	0.746273	0.338164	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.34472	1.36;1.36;2.31	5.67	1.76	0.24704	.	0.359920	0.28989	N	0.013481	T	0.00012	0.0000	L	0.33485	1.01	0.80722	P	0.0	B;B;B	0.11235	0.001;0.004;0.002	B;B;B	0.14578	0.006;0.011;0.005	T	0.13872	-1.0493	9	0.27785	T	0.31	-0.8765	6.5884	0.22634	0.2034:0.2446:0.552:0.0	rs1274972;rs61530584;rs1274972	241;290;290	Q8NDW8-6;Q8NDW8-7;Q8NDW8	.;.;TT21A_HUMAN	K	290;282;290;241	ENSP00000301819:R290K;ENSP00000398211:R290K;ENSP00000410882:R241K	ENSP00000301819:R290K	R	+	2	0	TTC21A	39136460	0.007000	0.16637	0.354000	0.25760	0.288000	0.27193	0.778000	0.26732	0.315000	0.23110	-0.175000	0.13238	AGG	G|0.555;A|0.445	0.445	strong		0.458	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755	
DCAF4	26094	hgsc.bcm.edu	37	14	73404752	73404752	+	Missense_Mutation	SNP	G	G	C	rs2302588	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:73404752G>C	ENST00000358377.2	+	2	286	c.66G>C	c.(64-66)tgG>tgC	p.W22C	DCAF4_ENST00000509153.1_Missense_Mutation_p.W22C|DCAF4_ENST00000555042.1_Missense_Mutation_p.W22C|DCAF4_ENST00000553457.1_5'UTR|DCAF4_ENST00000353777.3_Missense_Mutation_p.W22C|DCAF4_ENST00000510612.1_3'UTR|DCAF4_ENST00000394234.2_Intron	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	22			W -> C (in dbSNP:rs2302588).		protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						AGAACCCTTGGTTCAGACTCC	0.473													G|||	471	0.0940495	0.0545	0.0677	5008	,	,		18716	0.1885		0.1133	False		,,,				2504	0.0491				p.W22C		Atlas-SNP	.											.	DCAF4	40	.	0			c.G66C						PASS	.	G	CYS/TRP,ALA/GLY,CYS/TRP,,CYS/TRP	258,4148	146.9+/-181.5	6,246,1951	124.0	127.0	126.0		66,32,66,,66	1.6	0.0	14	dbSNP_100	126	900,7700	201.3+/-244.8	51,798,3451	yes	missense,missense,missense,intron,missense	DCAF4	NM_001163508.1,NM_001163509.1,NM_015604.3,NM_181340.2,NM_181341.2	215,60,215,,215	57,1044,5402	CC,CG,GG		10.4651,5.8557,8.9036	probably-damaging,probably-damaging,probably-damaging,,probably-damaging	22/490,11/475,22/496,,22/436	73404752	1158,11848	2203	4300	6503	SO:0001583	missense	26094	exon2			CCCTTGGTTCAGA	BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.66G>C	14.37:g.73404752G>C	ENSP00000351147:p.Trp22Cys	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	24	4	0.166667	NM_001163508	B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Missense_Mutation	SNP	ENST00000358377.2	37	CCDS9809.1	249	0.11401098901098901	32	0.06504065040650407	27	0.07458563535911603	107	0.18706293706293706	83	0.10949868073878628	G	16.18	3.049136	0.55110	0.058557	0.104651	ENSG00000119599	ENST00000358377;ENST00000353777;ENST00000509153;ENST00000555042	T;T;T;T	0.70516	0.47;-0.49;0.32;0.08	4.63	1.63	0.23807	.	1.008970	0.07937	N	0.978622	T	0.00241	0.0007	L	0.46157	1.445	0.58432	P	1.999999999946489E-6	B;P;B;B;P	0.43094	0.0;0.799;0.001;0.0;0.553	B;P;B;B;B	0.47376	0.001;0.545;0.002;0.001;0.343	T	0.03545	-1.1026	9	0.87932	D	0	.	6.5995	0.22693	0.1017:0.3657:0.5326:0.0	rs2302588;rs52826343;rs61121083;rs2302588	22;22;22;22;22	B4DUT6;Q8WV16-2;G3V522;Q86SY2;Q8WV16	.;.;.;.;DCAF4_HUMAN	C	22	ENSP00000351147:W22C;ENSP00000345176:W22C;ENSP00000426178:W22C;ENSP00000452131:W22C	ENSP00000345176:W22C	W	+	3	0	DCAF4	72474505	0.156000	0.22821	0.000000	0.03702	0.833000	0.47200	1.141000	0.31528	0.032000	0.15435	0.313000	0.20887	TGG	G|0.900;C|0.100	0.100	strong		0.473	DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361058.1	NM_015604	
GSAP	54103	hgsc.bcm.edu	37	7	76991935	76991935	+	Missense_Mutation	SNP	C	C	T	rs1527263	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:76991935C>T	ENST00000257626.7	-	13	992	c.914G>A	c.(913-915)gGa>gAa	p.G305E		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	305			G -> E (in dbSNP:rs1527263).		positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										TGTGATTTGTCCCCAAGAGGC	0.303													T|||	1512	0.301917	0.5454	0.219	5008	,	,		21657	0.0883		0.2326	False		,,,				2504	0.3231				p.G305E		Atlas-SNP	.											PION,colon,carcinoma,+1,4	PION	74	4	0			c.G914A						scavenged	.	T	GLU/GLY	2189,2217	589.8+/-387.2	548,1093,562	98.0	100.0	100.0		914	4.5	0.9	7	dbSNP_88	100	2170,6430	712.4+/-405.9	260,1650,2390	yes	missense	PION	NM_017439.3	98	808,2743,2952	TT,TC,CC		25.2326,49.6823,33.5153	benign	305/855	76991935	4359,8647	2203	4300	6503	SO:0001583	missense	54103	exon13			ATTTGTCCCCAAG		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.914G>A	7.37:g.76991935C>T	ENSP00000257626:p.Gly305Glu	Somatic	265	1	0.00377358		WXS	Illumina HiSeq	Phase_I	410	13	0.0317073	NM_017439	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	ENST00000257626.7	37	CCDS34672.2	615	0.2815934065934066	288	0.5853658536585366	92	0.2541436464088398	52	0.09090909090909091	183	0.24142480211081793	T	0.009	-1.815517	0.00600	0.496823	0.252326	ENSG00000186088	ENST00000257626	T	0.15372	2.43	5.72	4.5	0.54988	.	0.533626	0.16507	N	0.211404	T	0.00012	0.0000	N	0.00926	-1.1	0.53688	P	2.5000000000052758E-5	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43540	-0.9385	9	0.02654	T	1	.	5.7871	0.18338	0.1477:0.0807:0.0:0.7717	rs1527263;rs57606158;rs1527263	305;305	A4D1B5-3;A4D1B5	.;GSAP_HUMAN	E	305	ENSP00000257626:G305E	ENSP00000257626:G305E	G	-	2	0	PION	76829871	0.005000	0.15991	0.947000	0.38551	0.060000	0.15804	1.184000	0.32053	0.999000	0.39023	-0.524000	0.04348	GGA	C|0.675;N|0.000	.	strong		0.303	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439	
AHNAK2	113146	hgsc.bcm.edu	37	14	105416167	105416167	+	Missense_Mutation	SNP	G	G	T	rs200366012	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:105416167G>T	ENST00000333244.5	-	7	5740	c.5621C>A	c.(5620-5622)cCg>cAg	p.P1874Q	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1874						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGAAGGGAGCGGAATGCAGAG	0.662													.|||	6	0.00119808	0.0015	0.0014	5008	,	,		15753	0.003		0.0	False		,,,				2504	0.0				p.P1874Q		Atlas-SNP	.											AHNAK2_ENST00000333244,NS,carcinoma,+1,1	AHNAK2	719	1	0			c.C5621A						scavenged	.	T	GLN/PRO	5,3855		1,3,1926	100.0	116.0	111.0		5621	1.5	0.0	14		111	0,8198		0,0,4099	no	missense	AHNAK2	NM_138420.2	76	1,3,6025	TT,TG,GG		0.0,0.1295,0.0415	benign	1874/5796	105416167	5,12053	1930	4099	6029	SO:0001583	missense	113146	exon7			GGGAGCGGAATGC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.5621C>A	14.37:g.105416167G>T	ENSP00000353114:p.Pro1874Gln	Somatic	90	7	0.0777778		WXS	Illumina HiSeq	Phase_I	69	7	0.101449	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	t	0.677	-0.799673	0.02841	0.001295	0.0	ENSG00000185567	ENST00000333244	T	0.01918	4.56	3.92	1.46	0.22682	.	.	.	.	.	T	0.00666	0.0022	N	0.00104	-2.125	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47156	-0.9139	9	0.13108	T	0.6	-9.2016	12.0521	0.53513	0.0:0.0:0.5486:0.4514	.	1874	Q8IVF2	AHNK2_HUMAN	Q	1874	ENSP00000353114:P1874Q	ENSP00000353114:P1874Q	P	-	2	0	AHNAK2	104487212	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.654000	0.24918	0.117000	0.18138	-0.376000	0.06991	CCG	G|0.999;T|0.001	0.001	strong		0.662	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
MUC16	94025	hgsc.bcm.edu	37	19	9047271	9047271	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:9047271G>A	ENST00000397910.4	-	5	34563	c.34360C>T	c.(34360-34362)Cct>Tct	p.P11454S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11456	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GATGCACCAGGGGAGACAGGG	0.493																																					p.P11454S		Atlas-SNP	.											.	MUC16	4315	.	0			c.C34360T						PASS	.						173.0	169.0	170.0					19																	9047271		2012	4170	6182	SO:0001583	missense	94025	exon5			CACCAGGGGAGAC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.34360C>T	19.37:g.9047271G>A	ENSP00000381008:p.Pro11454Ser	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	81	31	0.382716	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.483	0.274203	0.10403	.	.	ENSG00000181143	ENST00000397910	T	0.01947	4.54	3.21	-3.54	0.04653	.	.	.	.	.	T	0.02455	0.0075	L	0.55481	1.735	.	.	.	B	0.27166	0.17	B	0.28709	0.093	T	0.43475	-0.9389	8	0.87932	D	0	.	2.7963	0.05402	0.3391:0.0:0.2952:0.3658	.	11454	B5ME49	.	S	11454	ENSP00000381008:P11454S	ENSP00000381008:P11454S	P	-	1	0	MUC16	8908271	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-2.871000	0.00720	-0.590000	0.05866	-1.173000	0.01734	CCT	.	.	none		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF705A	440077	hgsc.bcm.edu	37	12	8329652	8329652	+	Missense_Mutation	SNP	A	A	G	rs10743251	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:8329652A>G	ENST00000359286.4	+	5	465	c.376A>G	c.(376-378)Act>Gct	p.T126A		NM_001004328.2|NM_001278713.1	NP_001004328.1|NP_001265642.1	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	126			T -> A (in dbSNP:rs10743251).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T126A(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(3)|stomach(4)	18				Kidney(36;0.0877)		AGAAGATTGCACTCACAGTTC	0.403																																					p.T126A		Atlas-SNP	.											ZNF705A,NS,carcinoma,0,1	ZNF705A	32	1	1	Substitution - Missense(1)	stomach(1)	c.A376G						scavenged	.						99.0	99.0	99.0					12																	8329652		2202	4291	6493	SO:0001583	missense	440077	exon5			GATTGCACTCACA	AK131339	CCDS31737.1	12p13.31	2014-02-12	2005-09-22		ENSG00000196946	ENSG00000196946		"""Zinc fingers, C2H2-type"", ""-"""	32281	protein-coding gene	gene with protein product							Standard	NM_001004328		Approved	FLJ16353	uc001qud.1	Q6ZN79	OTTHUMG00000168635	ENST00000359286.4:c.376A>G	12.37:g.8329652A>G	ENSP00000352233:p.Thr126Ala	Somatic	292	1	0.00342466		WXS	Illumina HiSeq	Phase_I	358	7	0.0195531	NM_001004328		Missense_Mutation	SNP	ENST00000359286.4	37	CCDS31737.1	1046	0.47893772893772896	208	0.42276422764227645	167	0.4613259668508287	276	0.4825174825174825	395	0.521108179419525	.	7.485	0.649440	0.14516	.	.	ENSG00000196946	ENST00000396570;ENST00000359286	T;T	0.07216	3.21;3.21	1.35	1.35	0.21983	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00012	0.0000	N	0.20807	0.61	0.80722	P	0.0	B	0.28850	0.225	B	0.17979	0.02	T	0.39121	-0.9629	8	0.28530	T	0.3	.	4.2628	0.10749	0.6373:0.3627:0.0:0.0	rs10743251;rs57777260	126	Q6ZN79	Z705A_HUMAN	A	126	ENSP00000379816:T126A;ENSP00000352233:T126A	ENSP00000352233:T126A	T	+	1	0	ZNF705A	8220919	0.067000	0.21026	0.047000	0.18901	0.094000	0.18550	2.005000	0.40864	0.891000	0.36235	0.329000	0.21502	ACT	A|0.527;G|0.473	0.473	strong		0.403	ZNF705A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400449.1	NM_001004328	
VPS13D	55187	hgsc.bcm.edu	37	1	12387807	12387807	+	Missense_Mutation	SNP	C	C	T	rs143572864		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:12387807C>T	ENST00000358136.3	+	36	8223	c.8093C>T	c.(8092-8094)gCg>gTg	p.A2698V	VPS13D_ENST00000356315.4_Missense_Mutation_p.A2698V	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GCTGTGGCAGCGCCATTGATC	0.502																																					p.A2698V		Atlas-SNP	.											VPS13D,NS,carcinoma,+1,1	VPS13D	316	1	0			c.C8093T						PASS	.	C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	155.0	149.0	151.0		8093,8093	5.5	0.1	1	dbSNP_134	151	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	VPS13D	NM_015378.2,NM_018156.2	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	2698/4389,2698/4364	12387807	1,13005	2203	4300	6503	SO:0001583	missense	55187	exon36			TGGCAGCGCCATT	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.8093C>T	1.37:g.12387807C>T	ENSP00000350854:p.Ala2698Val	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	120	51	0.425	NM_015378		Missense_Mutation	SNP	ENST00000358136.3	37	CCDS30588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.04|13.04	2.119674|2.119674	0.37436|0.37436	0.0|0.0	1.16E-4|1.16E-4	ENSG00000048707|ENSG00000048707	ENST00000356315;ENST00000358136|ENST00000011700	T;T|.	0.46451|.	0.87;0.87|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.368669|.	0.31290|.	N|.	0.007902|.	T|T	0.40423|0.40423	0.1116|0.1116	L|L	0.44542|0.44542	1.39|1.39	0.29599|0.29599	N|N	0.847863|0.847863	B;B;B|.	0.33857|.	0.041;0.429;0.303|.	B;B;B|.	0.27380|.	0.003;0.079;0.054|.	T|T	0.36744|0.36744	-0.9735|-0.9735	10|5	0.24483|.	T|.	0.36|.	.|.	7.5184|7.5184	0.27614|0.27614	0.0:0.8005:0.0:0.1995|0.0:0.8005:0.0:0.1995	.|.	605;2698;2698|.	B1AJZ2;Q5THJ4-2;Q5THJ4|.	.;.;VP13D_HUMAN|.	V|C	2698|1521	ENSP00000348666:A2698V;ENSP00000350854:A2698V|.	ENSP00000348666:A2698V|.	A|R	+|+	2|1	0|0	VPS13D|VPS13D	12310394|12310394	0.143000|0.143000	0.22626|0.22626	0.058000|0.058000	0.19502|0.19502	0.510000|0.510000	0.34073|0.34073	3.538000|3.538000	0.53597|0.53597	2.750000|2.750000	0.94351|0.94351	0.655000|0.655000	0.94253|0.94253	GCG|CGC	C|1.000;T|0.000	0.000	weak		0.502	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
SERPINE2	5270	hgsc.bcm.edu	37	2	224862842	224862842	+	Silent	SNP	A	A	G	rs12457	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:224862842A>G	ENST00000258405.4	-	3	719	c.477T>C	c.(475-477)aaT>aaC	p.N159N	SERPINE2_ENST00000409840.3_Silent_p.N159N|SERPINE2_ENST00000409304.1_Silent_p.N159N|SERPINE2_ENST00000447280.2_Silent_p.N171N	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	159				N -> D (in Ref. 4; BAG35401). {ECO:0000305}.	blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CCCTGGTTTCATTTTTAACCC	0.453													G|||	1272	0.253994	0.4826	0.2161	5008	,	,		20707	0.129		0.1909	False		,,,				2504	0.1656				p.N171N		Atlas-SNP	.											.	SERPINE2	103	.	0			c.T513C						PASS	.	G	,,	1957,2449	621.9+/-393.8	440,1077,686	71.0	66.0	68.0		477,513,477	-1.8	0.5	2	dbSNP_116	68	1679,6921	739.8+/-407.1	161,1357,2782	no	coding-synonymous,coding-synonymous,coding-synonymous	SERPINE2	NM_001136528.1,NM_001136530.1,NM_006216.3	,,	601,2434,3468	GG,GA,AA		19.5233,44.4167,27.9563	,,	159/398,171/410,159/399	224862842	3636,9370	2203	4300	6503	SO:0001819	synonymous_variant	5270	exon3			GGTTTCATTTTTA	M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.477T>C	2.37:g.224862842A>G		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	115	6	0.0521739	NM_001136530	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Silent	SNP	ENST00000258405.4	37	CCDS2460.1																																																																																			A|0.718;G|0.282	0.282	strong		0.453	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216	
PSG3	5671	hgsc.bcm.edu	37	19	43234049	43234049	+	Missense_Mutation	SNP	A	A	T	rs28698193	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:43234049A>T	ENST00000327495.5	-	4	1053	c.869T>A	c.(868-870)aTt>aAt	p.I290N	PSG3_ENST00000595140.1_Missense_Mutation_p.I290N	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	290	Ig-like C2-type 2.		I -> N (in dbSNP:rs28698193).		defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				CCTGTTTTCAATGGGTCGCTT	0.488													.|||	690	0.13778	0.3116	0.1225	5008	,	,		21813	0.0248		0.0706	False		,,,				2504	0.0992				p.I290N		Atlas-SNP	.											.	PSG3	82	.	0			c.T869A						PASS	.	T	ASN/ILE	845,2175		128,589,793	84.0	85.0	85.0		869	-2.2	0.0	19	dbSNP_125	85	372,5032		10,352,2340	no	missense	PSG3	NM_021016.3	149	138,941,3133	TT,TA,AA		6.8838,27.9801,14.4468	possibly-damaging	290/429	43234049	1217,7207	1510	2702	4212	SO:0001583	missense	5671	exon4			TTTTCAATGGGTC		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.869T>A	19.37:g.43234049A>T	ENSP00000332215:p.Ile290Asn	Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	53	5	0.0943396	NM_021016	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	ENST00000327495.5	37	CCDS12611.1	273	0.125	154	0.3130081300813008	52	0.143646408839779	8	0.013986013986013986	59	0.07783641160949868	t	0.001	-3.244528	0.00022	0.279801	0.068838	ENSG00000221826	ENST00000327495	T	0.09255	3.0	1.1	-2.21	0.06973	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00012	0.0000	N	0.00077	-2.24	0.80722	P	0.0	B;B	0.14012	0.009;0.001	B;B	0.17979	0.02;0.004	T	0.31752	-0.9932	8	0.12103	T	0.63	.	0.3073	0.00282	0.2656:0.215:0.3044:0.2151	rs28698193;rs60112374	268;290	Q08266;Q16557	.;PSG3_HUMAN	N	290	ENSP00000332215:I290N	ENSP00000332215:I290N	I	-	2	0	PSG3	47925889	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.576000	0.00112	-4.294000	0.00058	-4.092000	0.00011	ATT	A|0.879;T|0.121	0.121	strong		0.488	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016	
APOBEC1	339	hgsc.bcm.edu	37	12	7805236	7805236	+	Missense_Mutation	SNP	C	C	G	rs2302515	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:7805236C>G	ENST00000229304.4	-	3	260	c.240G>C	c.(238-240)atG>atC	p.M80I		NM_001644.3	NP_001635.2	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1	80			M -> I (in dbSNP:rs2302515). {ECO:0000269|PubMed:8078915, ECO:0000269|PubMed:8208612, ECO:0000269|PubMed:9186903, ECO:0000269|PubMed:9479499}.		cellular response to insulin stimulus (GO:0032869)|cytidine deamination (GO:0009972)|cytidine to uridine editing (GO:0016554)|defense response to virus (GO:0051607)|DNA demethylation (GO:0080111)|gene expression (GO:0010467)|lipid metabolic process (GO:0006629)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein transport (GO:0042953)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to osmotic stress (GO:0006970)|response to zinc ion (GO:0010043)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	AU-rich element binding (GO:0017091)|cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						TGGAGCAGCTCATGGATGGGT	0.478													G|||	3301	0.659145	0.4962	0.6225	5008	,	,		-128	0.5565		0.8946	False		,,,				2504	0.7689				p.M80I	Pancreas(135;929 1826 4531 10527 41012)	Atlas-SNP	.											APOBEC1,NS,carcinoma,-1,1	APOBEC1	43	1	0			c.G240C						scavenged	.	G	ILE/MET	2470,1936	550.5+/-378.0	689,1092,422	45.0	44.0	44.0		240	2.6	0.1	12	dbSNP_100	44	7658,942	207.3+/-249.1	3421,816,63	yes	missense	APOBEC1	NM_001644.3	10	4110,1908,485	GG,GC,CC		10.9535,43.9401,22.1282	benign	80/237	7805236	10128,2878	2203	4300	6503	SO:0001583	missense	339	exon3			GCAGCTCATGGAT	U72891	CCDS8579.1	12p13.1	2007-02-01			ENSG00000111701	ENSG00000111701		"""Apolipoprotein B mRNA editing enzymes"""	604	protein-coding gene	gene with protein product		600130					Standard	XM_005253355		Approved	BEDP, CDAR1, APOBEC-1, HEPR	uc001qtb.3	P41238	OTTHUMG00000141288	ENST00000229304.4:c.240G>C	12.37:g.7805236C>G	ENSP00000229304:p.Met80Ile	Somatic	123	1	0.00813008		WXS	Illumina HiSeq	Phase_I	161	4	0.0248447	NM_001644	Q9UE64|Q9UM71	Missense_Mutation	SNP	ENST00000229304.4	37	CCDS8579.1	1518	0.695054945054945	265	0.5386178861788617	253	0.6988950276243094	327	0.5716783216783217	673	0.8878627968337731	G	0.882	-0.728398	0.03135	0.560599	0.890465	ENSG00000111701	ENST00000229304	T	0.63255	-0.03	4.48	2.61	0.31194	APOBEC-like, N-terminal (1);APOBEC/CMP deaminase, zinc-binding (1);	1.098920	0.06892	N	0.804464	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37197	-0.9716	9	0.33141	T	0.24	-0.1288	4.4167	0.11459	0.2061:0.1881:0.6058:0.0	rs2302515;rs3181612;rs52811404;rs59440410;rs2302515	80	P41238	ABEC1_HUMAN	I	80	ENSP00000229304:M80I	ENSP00000229304:M80I	M	-	3	0	APOBEC1	7696503	0.000000	0.05858	0.068000	0.19968	0.290000	0.27261	-0.218000	0.09240	0.468000	0.27243	-0.357000	0.07601	ATG	C|0.248;G|0.752	0.752	strong		0.478	APOBEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280523.1	NM_001644	
ZNF705A	440077	hgsc.bcm.edu	37	12	8329700	8329700	+	Missense_Mutation	SNP	A	A	C	rs10743253	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:8329700A>C	ENST00000359286.4	+	5	513	c.424A>C	c.(424-426)Aaa>Caa	p.K142Q		NM_001004328.2|NM_001278713.1	NP_001004328.1|NP_001265642.1	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	142			K -> Q (in dbSNP:rs10743253).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K142Q(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(3)|stomach(4)	18				Kidney(36;0.0877)		CAGTGGAAAGAAACCCTATGT	0.373													a|||	2152	0.429712	0.2882	0.4683	5008	,	,		-128	0.5198		0.5616	False		,,,				2504	0.365				p.K142Q		Atlas-SNP	.											ZNF705A,NS,carcinoma,0,1	ZNF705A	32	1	1	Substitution - Missense(1)	stomach(1)	c.A424C						scavenged	.	A	GLN/LYS	1390,3016		224,942,1037	125.0	128.0	127.0		424	1.4	0.1	12	dbSNP_120	127	4659,3941		1319,2021,960	no	missense	ZNF705A	NM_001004328.2	53	1543,2963,1997	CC,CA,AA		45.8256,31.5479,46.5093	probably-damaging	142/301	8329700	6049,6957	2203	4300	6503	SO:0001583	missense	440077	exon5			GGAAAGAAACCCT	AK131339	CCDS31737.1	12p13.31	2014-02-12	2005-09-22		ENSG00000196946	ENSG00000196946		"""Zinc fingers, C2H2-type"", ""-"""	32281	protein-coding gene	gene with protein product							Standard	NM_001004328		Approved	FLJ16353	uc001qud.1	Q6ZN79	OTTHUMG00000168635	ENST00000359286.4:c.424A>C	12.37:g.8329700A>C	ENSP00000352233:p.Lys142Gln	Somatic	282	1	0.0035461		WXS	Illumina HiSeq	Phase_I	378	5	0.0132275	NM_001004328		Missense_Mutation	SNP	ENST00000359286.4	37	CCDS31737.1	1021	0.4674908424908425	136	0.2764227642276423	170	0.4696132596685083	300	0.5244755244755245	415	0.5474934036939314	.	16.40	3.111296	0.56398	0.315479	0.541744	ENSG00000196946	ENST00000396570;ENST00000359286	T;T	0.02280	4.36;4.36	1.35	1.35	0.21983	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00012	0.0000	M	0.88450	2.955	0.44309	P	0.0028200000000000447	D	0.57899	0.981	P	0.59221	0.854	T	0.39860	-0.9593	8	0.87932	D	0	.	6.8118	0.23809	1.0:0.0:0.0:0.0	rs10743253;rs17801815	142	Q6ZN79	Z705A_HUMAN	Q	142	ENSP00000379816:K142Q;ENSP00000352233:K142Q	ENSP00000352233:K142Q	K	+	1	0	ZNF705A	8220967	0.311000	0.24536	0.078000	0.20375	0.253000	0.25986	3.275000	0.51639	0.891000	0.36235	0.329000	0.21502	AAA	A|0.528;C|0.471	0.471	strong		0.373	ZNF705A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400449.1	NM_001004328	
FMO1	2326	hgsc.bcm.edu	37	1	171252287	171252287	+	Silent	SNP	A	A	G	rs1126692	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:171252287A>G	ENST00000354841.4	+	7	1319	c.1188A>G	c.(1186-1188)gtA>gtG	p.V396V	FMO1_ENST00000367750.3_Silent_p.V396V|FMO1_ENST00000402921.2_Silent_p.V333V|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	396					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	CTACAGGTGTAAATAAGTTAC	0.353													A|||	1255	0.250599	0.593	0.121	5008	,	,		15383	0.0367		0.1412	False		,,,				2504	0.2127				p.V396V		Atlas-SNP	.											FMO1,left_upper_lobe,carcinoma,+2,1	FMO1	79	1	0			c.A1188G						scavenged	.	A		2260,2146	595.1+/-388.4	580,1100,523	119.0	121.0	120.0		1188	-10.3	0.0	1	dbSNP_86	120	1166,7434	237.5+/-269.3	78,1010,3212	no	coding-synonymous	FMO1	NM_002021.1		658,2110,3735	GG,GA,AA		13.5581,48.7063,26.3417		396/533	171252287	3426,9580	2203	4300	6503	SO:0001819	synonymous_variant	2326	exon8			AGGTGTAAATAAG	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.1188A>G	1.37:g.171252287A>G		Somatic	520	1	0.00192308		WXS	Illumina HiSeq	Phase_I	452	6	0.0132743	NM_002021	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Silent	SNP	ENST00000354841.4	37	CCDS1294.1																																																																																			A|0.769;C|0.000;G|0.231	0.231	strong		0.353	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
CYP1B1	1545	hgsc.bcm.edu	37	2	38298139	38298139	+	Missense_Mutation	SNP	T	T	C	rs1800440	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:38298139T>C	ENST00000260630.3	-	3	1759	c.1358A>G	c.(1357-1359)aAc>aGc	p.N453S	CYP1B1_ENST00000494864.1_5'UTR|CYP1B1_ENST00000407341.1_Missense_Mutation_p.N453S	NM_000104.3	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B, polypeptide 1	453			N -> S (in allele CYP1B1*4; dbSNP:rs1800440). {ECO:0000269|PubMed:10655546, ECO:0000269|PubMed:11854439, ECO:0000269|PubMed:12036985, ECO:0000269|PubMed:12525557, ECO:0000269|PubMed:14635112, ECO:0000269|PubMed:15342693, ECO:0000269|PubMed:15475877, ECO:0000269|PubMed:16688110, ECO:0000269|PubMed:9823305, ECO:0000269|Ref.4, ECO:0000269|Ref.5}.		angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|blood vessel morphogenesis (GO:0048514)|cell adhesion (GO:0007155)|cellular aromatic compound metabolic process (GO:0006725)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to organic cyclic compound (GO:0071407)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell-cell adhesion (GO:0071603)|epoxygenase P450 pathway (GO:0019373)|estrogen metabolic process (GO:0008210)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|membrane lipid catabolic process (GO:0046466)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nitric oxide biosynthetic process (GO:0006809)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to toxic substance (GO:0009636)|retinal blood vessel morphogenesis (GO:0061304)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|toxin metabolic process (GO:0009404)|trabecular meshwork development (GO:0002930)|visual perception (GO:0007601)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	13		all_hematologic(82;0.21)			Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Biotin(DB00121)|Caffeine(DB00201)|Clozapine(DB00363)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Flutamide(DB00499)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Melatonin(DB01065)|Mitoxantrone(DB01204)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Primaquine(DB01087)|Procarbazine(DB01168)|Progesterone(DB00396)|Propofol(DB00818)|Tamoxifen(DB00675)|Testosterone(DB00624)|Theophylline(DB00277)	CAGGTCCTTGTTGATGAGGCC	0.473													T|||	499	0.0996406	0.0068	0.1311	5008	,	,		20848	0.005		0.1958	False		,,,				2504	0.2014				p.N453S		Atlas-SNP	.											CYP1B1,colon,carcinoma,0,3	CYP1B1	39	3	0			c.A1358G	GRCh37	CM994676	CYP1B1	M	rs1800440	scavenged	.	T	SER/ASN	147,4259	103.4+/-141.9	4,139,2060	82.0	77.0	78.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1358	5.9	0.9	2	dbSNP_89	78	1608,6992	298.6+/-304.0	143,1322,2835	yes	missense	CYP1B1	NM_000104.3	46	147,1461,4895	CC,CT,TT		18.6977,3.3364,13.4938	possibly-damaging	453/544	38298139	1755,11251	2203	4300	6503	SO:0001583	missense	1545	exon3			TCCTTGTTGATGA	U56438	CCDS1793.1	2p22.2	2008-02-05	2003-01-14		ENSG00000138061	ENSG00000138061		"""Cytochrome P450s"""	2597	protein-coding gene	gene with protein product		601771	"""cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile)"""	GLC3A		8175734, 15128046	Standard	NM_000104		Approved	CP1B	uc002rqo.2	Q16678	OTTHUMG00000100970	ENST00000260630.3:c.1358A>G	2.37:g.38298139T>C	ENSP00000260630:p.Asn453Ser	Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	160	6	0.0375	NM_000104	Q5TZW8|Q93089|Q9H316	Missense_Mutation	SNP	ENST00000260630.3	37	CCDS1793.1	216	0.0989010989010989	3	0.006097560975609756	58	0.16022099447513813	4	0.006993006993006993	151	0.19920844327176782	T	18.56	3.651256	0.67472	0.033364	0.186977	ENSG00000138061	ENST00000260630;ENST00000407341	T;T	0.66638	-0.22;-0.22	5.95	5.95	0.96441	.	0.172254	0.64402	D	0.000008	T	0.00144	0.0004	L	0.55103	1.725	0.20403	P	0.9999085855	P	0.37466	0.596	B	0.39660	0.306	T	0.08411	-1.0723	9	0.59425	D	0.04	.	14.3758	0.66874	0.0:0.0:0.0:1.0	rs1800440;rs4134586;rs4986886;rs17405302;rs56879535;rs1800440	453	Q53TK1	.	S	453	ENSP00000260630:N453S;ENSP00000384972:N453S	ENSP00000260630:N453S	N	-	2	0	CYP1B1	38151643	1.000000	0.71417	0.934000	0.37439	0.897000	0.52465	6.035000	0.70940	2.279000	0.76181	0.533000	0.62120	AAC	T|0.882;C|0.118	0.118	strong		0.473	CYP1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218580.3	NM_000104	
NBPF10	100132406	hgsc.bcm.edu	37	1	145301793	145301793	+	Silent	SNP	A	A	G	rs5020524	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:145301793A>G	ENST00000369339.3	+	4	502	c.249A>G	c.(247-249)gcA>gcG	p.A83A	NBPF10_ENST00000369338.1_Silent_p.A83A|NBPF10_ENST00000342960.5_Silent_p.A354A|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	354						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGAAGCTTGCAGAGCAGCTCA	0.532																																					p.A354A		Atlas-SNP	.											NBPF10_ENST00000369338,caecum,carcinoma,0,2	NBPF10	221	2	0			c.A1062G						scavenged	.																																			SO:0001819	synonymous_variant	100132406	exon7			GCTTGCAGAGCAG	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.249A>G	1.37:g.145301793A>G		Somatic	22	3	0.136364		WXS	Illumina HiSeq	Phase_I	22	6	0.272727	NM_001039703	Q5RHC0|Q9NWN6	Silent	SNP	ENST00000369339.3	37																																																																																				A|0.602;G|0.398	0.398	strong		0.532	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703	
PRG4	10216	hgsc.bcm.edu	37	1	186277277	186277277	+	Missense_Mutation	SNP	G	G	A	rs113308576		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:186277277G>A	ENST00000445192.2	+	7	2471	c.2426G>A	c.(2425-2427)gGg>gAg	p.G809E	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Missense_Mutation_p.G766E|PRG4_ENST00000367485.4_Missense_Mutation_p.G716E|PRG4_ENST00000367483.4_Missense_Mutation_p.G768E	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	809	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.G809E(2)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						ACCACCAAGGGGCCCACATCC	0.597																																					p.G809E		Atlas-SNP	.											PRG4,NS,carcinoma,0,2	PRG4	259	2	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G2426A						scavenged	.						215.0	240.0	232.0					1																	186277277		2203	4300	6503	SO:0001583	missense	10216	exon7			CCAAGGGGCCCAC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2426G>A	1.37:g.186277277G>A	ENSP00000399679:p.Gly809Glu	Somatic	136	4	0.0294118		WXS	Illumina HiSeq	Phase_I	109	9	0.0825688	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	A	4.604	0.112258	0.08831	.	.	ENSG00000116690	ENST00000367486;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T	0.04809	3.56;3.66;3.55;3.67	2.72	-2.01	0.07410	.	.	.	.	.	T	0.01661	0.0053	N	0.03115	-0.41	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.47947	-0.9077	8	.	.	.	0.0864	1.0004	0.01475	0.3795:0.2548:0.23:0.1358	.	675;716;809;768	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	E	766;675;768;716;809	ENSP00000356456:G766E;ENSP00000356453:G768E;ENSP00000356455:G716E;ENSP00000399679:G809E	.	G	+	2	0	PRG4	184543900	0.001000	0.12720	0.000000	0.03702	0.039000	0.13416	0.727000	0.25999	-0.259000	0.09432	-1.958000	0.00481	GGG	G|0.500;A|0.500	0.500	weak		0.597	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
ADCYAP1R1	117	hgsc.bcm.edu	37	7	31132339	31132339	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:31132339A>G	ENST00000304166.4	+	13	1325	c.1036A>G	c.(1036-1038)Agc>Ggc	p.S346G	ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.S346G|ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.S325G|ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.S346G	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	346					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						CAATGAGTCCAGCATCTACTT	0.488																																					p.S346G	Ovarian(44;225 1186 2158 11092)	Atlas-SNP	.											.	ADCYAP1R1	78	.	0			c.A1036G						PASS	.						96.0	90.0	92.0					7																	31132339		2203	4300	6503	SO:0001583	missense	117	exon13			GAGTCCAGCATCT		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.1036A>G	7.37:g.31132339A>G	ENSP00000306620:p.Ser346Gly	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	41	27	0.658537	NM_001118	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	ENST00000304166.4	37	CCDS5433.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.07|18.07	3.541658|3.541658	0.65085|0.65085	.|.	.|.	ENSG00000078549|ENSG00000078549	ENST00000436116|ENST00000304166;ENST00000381667;ENST00000409363;ENST00000396211;ENST00000409489	.|T;T;T;T	.|0.46063	.|1.15;1.17;0.88;1.09	5.72|5.72	5.72|5.72	0.89469|0.89469	.|GPCR, family 2-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57242|0.57242	0.2040|0.2040	L|L	0.52266|0.52266	1.64|1.64	0.80722|0.80722	D|D	1|1	.|P;B;D;B;B	.|0.71674	.|0.952;0.118;0.998;0.02;0.056	.|P;B;D;B;B	.|0.71184	.|0.792;0.082;0.972;0.033;0.056	T|T	0.54944|0.54944	-0.8217|-0.8217	5|10	.|0.41790	.|T	.|0.15	.|.	14.2607|14.2607	0.66083|0.66083	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|346;346;346;325;346	.|B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586	.|.;.;.;.;PACR_HUMAN	R|G	62|346;117;325;346;346	.|ENSP00000306620:S346G;ENSP00000387335:S325G;ENSP00000379514:S346G;ENSP00000386395:S346G	.|ENSP00000306620:S346G	Q|S	+|+	2|1	0|0	ADCYAP1R1|ADCYAP1R1	31098864|31098864	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.748000|8.748000	0.91615|0.91615	2.317000|2.317000	0.78254|0.78254	0.460000|0.460000	0.39030|0.39030	CAG|AGC	.	.	none		0.488	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118	
CAMK2G	818	hgsc.bcm.edu	37	10	75632760	75632760	+	Silent	SNP	C	C	T	rs2675671	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:75632760C>T	ENST00000351293.3	-	2	204	c.147G>A	c.(145-147)aaG>aaA	p.K49K	CAMK2G_ENST00000372765.1_Silent_p.K49K|CAMK2G_ENST00000423381.1_Silent_p.K49K|CAMK2G_ENST00000305762.7_Silent_p.K49K|CAMK2G_ENST00000444854.2_Silent_p.K49K|CAMK2G_ENST00000394762.2_Silent_p.K49K|CAMK2G_ENST00000472912.1_5'UTR|CAMK2G_ENST00000322680.3_Silent_p.K49K|CAMK2G_ENST00000322635.3_Silent_p.K49K	NM_001222.3|NM_172173.2	NP_001213.2|NP_751913.1	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II gamma	49	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|dephosphorylation (GO:0016311)|G1/S transition of mitotic cell cycle (GO:0000082)|insulin secretion (GO:0030073)|interferon-gamma-mediated signaling pathway (GO:0060333)|nervous system development (GO:0007399)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of calcium ion transport (GO:0051924)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of skeletal muscle adaptation (GO:0014733)|synaptic transmission (GO:0007268)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-dependent protein serine/threonine phosphatase activity (GO:0004723)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			kidney(2)|large_intestine(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	15	Prostate(51;0.0112)				Bosutinib(DB06616)	GGGCAGACAACTTCTTGGTAT	0.547													C|||	1424	0.284345	0.1936	0.3386	5008	,	,		18209	0.1121		0.5785	False		,,,				2504	0.2434				p.K49K		Atlas-SNP	.											CAMK2G_ENST00000322680,colon,carcinoma,0,2	CAMK2G	79	2	0			c.G147A						scavenged	.	C	,,,,,	1173,3233	411.5+/-335.8	154,865,1184	261.0	238.0	246.0		147,147,147,147,147,147	4.1	1.0	10	dbSNP_100	246	4866,3734	617.6+/-396.7	1356,2154,790	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CAMK2G	NM_001204492.1,NM_001222.3,NM_172169.2,NM_172170.4,NM_172171.2,NM_172173.2	,,,,,	1510,3019,1974	TT,TC,CC		43.4186,26.6228,46.4324	,,,,,	49/540,49/496,49/528,49/519,49/557,49/505	75632760	6039,6967	2203	4300	6503	SO:0001819	synonymous_variant	818	exon2			AGACAACTTCTTG	U81554	CCDS7336.1, CCDS7337.1, CCDS7338.1, CCDS73153.1	10q22	2008-10-30	2008-10-30		ENSG00000148660	ENSG00000148660			1463	protein-coding gene	gene with protein product		602123	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma"""	CAMKG		8287681	Standard	NM_001204492		Approved		uc001jvm.2	Q13555	OTTHUMG00000018492	ENST00000351293.3:c.147G>A	10.37:g.75632760C>T		Somatic	119	1	0.00840336		WXS	Illumina HiSeq	Phase_I	128	6	0.046875	NM_172170	O00561|O15378|Q13279|Q13282|Q13556|Q5SQZ3|Q5SQZ4|Q5SWX4|Q7KYX5|Q8N4I3|Q8NIA4	Silent	SNP	ENST00000351293.3	37	CCDS7336.1																																																																																			C|0.601;T|0.399	0.399	strong		0.547	CAMK2G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048715.1	NM_172169	
ABCC6	368	hgsc.bcm.edu	37	16	16248757	16248757	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:16248757C>T	ENST00000205557.7	-	28	4043	c.4014G>A	c.(4012-4014)ctG>ctA	p.L1338L		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1338	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	TCCTGGAGCGCAGTGTGTGCA	0.687																																					p.L1338L		Atlas-SNP	.											.	ABCC6	110	.	0			c.G4014A						PASS	.						29.0	27.0	28.0					16																	16248757		2197	4299	6496	SO:0001819	synonymous_variant	368	exon28			GGAGCGCAGTGTG	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.4014G>A	16.37:g.16248757C>T		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	93	33	0.354839	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Silent	SNP	ENST00000205557.7	37	CCDS10568.1																																																																																			.	.	none		0.687	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
DNTTIP2	30836	hgsc.bcm.edu	37	1	94343023	94343023	+	Silent	SNP	A	A	G	rs2391322	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:94343023A>G	ENST00000436063.2	-	2	525	c.468T>C	c.(466-468)ccT>ccC	p.P156P	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		TTTTTTCTGTAGGAAGCACAA	0.393													G|||	2188	0.436901	0.3782	0.3718	5008	,	,		20363	0.5585		0.3499	False		,,,				2504	0.5266				p.P156P		Atlas-SNP	.											.	DNTTIP2	59	.	0			c.T468C						PASS	.	G		1395,2271		250,895,688	112.0	104.0	106.0		468	-0.4	0.0	1	dbSNP_100	106	2925,5263		505,1915,1674	no	coding-synonymous	DNTTIP2	NM_014597.4		755,2810,2362	GG,GA,AA		35.723,38.0524,36.4434		156/757	94343023	4320,7534	1833	4094	5927	SO:0001819	synonymous_variant	30836	exon2			TTCTGTAGGAAGC	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.468T>C	1.37:g.94343023A>G		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	85	4	0.0470588	NM_014597	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Silent	SNP	ENST00000436063.2	37	CCDS44174.1																																																																																			A|0.587;G|0.413	0.413	strong		0.393	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597	
FOXD4	2298	hgsc.bcm.edu	37	9	117998	117998	+	Missense_Mutation	SNP	G	G	T	rs66612967	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:117998G>T	ENST00000382500.2	-	1	419	c.122C>A	c.(121-123)gCg>gAg	p.A41E		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	41					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A41E(1)		endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CTGGCTCGCCGCCTCCTCCTC	0.682													T|||	111	0.0221645	0.0749	0.013	5008	,	,		13954	0.001		0.002	False		,,,				2504	0.0				p.A41E		Atlas-SNP	.											FOXD4_ENST00000382500,NS,carcinoma,0,3	FOXD4	75	3	1	Substitution - Missense(1)	skin(1)	c.C122A						scavenged	.						38.0	53.0	48.0					9																	117998		2203	4298	6501	SO:0001583	missense	2298	exon1			CTCGCCGCCTCCT	U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.122C>A	9.37:g.117998G>T	ENSP00000371940:p.Ala41Glu	Somatic	374	28	0.0748663		WXS	Illumina HiSeq	Phase_I	406	64	0.157635	NM_207305	B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Missense_Mutation	SNP	ENST00000382500.2	37	CCDS34975.1	50	0.022893772893772892	43	0.08739837398373984	4	0.011049723756906077	3	0.005244755244755245	0	0.0	.	0.012	-1.673624	0.00758	.	.	ENSG00000170122	ENST00000382500	D	0.94457	-3.43	1.56	1.56	0.23342	.	.	.	.	.	T	0.13030	0.0316	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.57458	-0.7808	9	0.02654	T	1	.	4.5559	0.12136	0.0:0.0:0.3427:0.6573	.	41	Q12950	FOXD4_HUMAN	E	41	ENSP00000371940:A41E	ENSP00000371940:A41E	A	-	2	0	FOXD4	107998	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	-0.379000	0.07437	0.095000	0.17434	-1.316000	0.01300	GCG	G|0.977;T|0.023	0.023	strong		0.682	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055433.1	NM_207305	
MLLT3	4300	hgsc.bcm.edu	37	9	20414343	20414343	+	Silent	SNP	A	A	G	rs372894655	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:20414343A>G	ENST00000380338.4	-	5	787	c.501T>C	c.(499-501)agT>agC	p.S167S	MLLT3_ENST00000429426.2_Silent_p.S164S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	167	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S167S(19)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.532			T	MLL	ALL								A|||	612	0.122204	0.1505	0.1066	5008	,	,		12422	0.0833		0.0716	False		,,,				2504	0.1871				p.S167S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,bladder,carcinoma,0,25	MLLT3	125	25	19	Substitution - coding silent(19)	lung(8)|kidney(5)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|prostate(1)	c.T501C						scavenged	.						8.0	15.0	13.0					9																	20414343		1537	3257	4794	SO:0001819	synonymous_variant	4300	exon5			GCTGCTACTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.501T>C	9.37:g.20414343A>G		Somatic	37	1	0.027027		WXS	Illumina HiSeq	Phase_I	50	8	0.16	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.	.	weak		0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
F5	2153	hgsc.bcm.edu	37	1	169551682	169551682	+	Silent	SNP	T	T	C	rs6028	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:169551682T>C	ENST00000367797.3	-	2	438	c.237A>G	c.(235-237)caA>caG	p.Q79Q	F5_ENST00000546081.1_Intron|F5_ENST00000367796.3_Silent_p.Q79Q	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	79	F5/8 type A 1.|Plastocyanin-like 1.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.Q79Q(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	AAATGGTAGATTGTGGTTTTT	0.269													t|||	1134	0.226438	0.028	0.3501	5008	,	,		15692	0.2044		0.2942	False		,,,				2504	0.3599				p.Q79Q		Atlas-SNP	.											F5,NS,carcinoma,0,1	F5	301	1	1	Substitution - coding silent(1)	stomach(1)	c.A237G						scavenged	.	C		311,4043		14,283,1880	32.0	32.0	32.0		237	3.3	0.2	1	dbSNP_52	32	2331,6177		315,1701,2238	no	coding-synonymous	F5	NM_000130.4		329,1984,4118	CC,CT,TT	http://www.ncbi.nlm.nih.gov/pubmed?term	27.3977,7.1429,20.5411		79/2225	169551682	2642,10220	2177	4254	6431	SO:0001819	synonymous_variant	2153	exon2			GGTAGATTGTGGT	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.237A>G	1.37:g.169551682T>C		Somatic	575	0	0		WXS	Illumina HiSeq	Phase_I	587	11	0.0187394	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Silent	SNP	ENST00000367797.3	37	CCDS1281.1																																																																																			C|0.214;N|0.000	0.214	strong		0.269	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
RNF175	285533	hgsc.bcm.edu	37	4	154644537	154644537	+	Missense_Mutation	SNP	T	T	C	rs10517577	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:154644537T>C	ENST00000347063.4	-	5	847	c.475A>G	c.(475-477)Atg>Gtg	p.M159V	RNF175_ENST00000274068.4_Missense_Mutation_p.M31V|RP11-153M7.5_ENST00000505051.1_RNA|RNF175_ENST00000506505.1_5'UTR	NM_173662.2	NP_775933	Q8N4F7	RN175_HUMAN	ring finger protein 175	159			M -> V (in dbSNP:rs10517577).			integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	13	all_hematologic(180;0.093)	Renal(120;0.118)				ATTGTAAACATGATCGCCAAG	0.388													T|||	467	0.0932508	0.0053	0.1628	5008	,	,		16695	0.004		0.2247	False		,,,				2504	0.1196				p.M159V		Atlas-SNP	.											.	RNF175	40	.	0			c.A475G						PASS	.	T	VAL/MET	160,3704		4,152,1776	100.0	86.0	90.0		475	0.7	1.0	4	dbSNP_119	90	1923,6345		194,1535,2405	yes	missense	RNF175	NM_173662.2	21	198,1687,4181	CC,CT,TT		23.2583,4.1408,17.1695	benign	159/329	154644537	2083,10049	1932	4134	6066	SO:0001583	missense	285533	exon5			TAAACATGATCGC	BC034385	CCDS47149.1	4q31.3	2008-02-05			ENSG00000145428	ENSG00000145428		"""RING-type (C3HC4) zinc fingers"""	27735	protein-coding gene	gene with protein product							Standard	NM_173662		Approved	FLJ34190	uc003int.3	Q8N4F7	OTTHUMG00000161557	ENST00000347063.4:c.475A>G	4.37:g.154644537T>C	ENSP00000340979:p.Met159Val	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	102	8	0.0784314	NM_173662	C9JL66|Q8NB61	Missense_Mutation	SNP	ENST00000347063.4	37	CCDS47149.1	245	0.11217948717948718	2	0.0040650406504065045	61	0.1685082872928177	1	0.0017482517482517483	181	0.23878627968337732	T	13.82	2.350213	0.41599	0.041408	0.232583	ENSG00000145428	ENST00000347063;ENST00000274068;ENST00000508248	T;T;T	0.77229	-1.08;-1.08;-1.08	4.34	0.707	0.18139	.	0.198777	0.49916	N	0.000139	T	0.00039	0.0001	L	0.55481	1.735	0.25431	P	0.9881882	P;B	0.36683	0.565;0.002	B;B	0.36335	0.222;0.008	T	0.01894	-1.1252	9	0.30854	T	0.27	-5.8208	7.4098	0.27011	0.0:0.2644:0.0:0.7356	rs10517577;rs17370896;rs52808550;rs57008646;rs10517577	31;159	Q8NB61;Q8N4F7	.;RN175_HUMAN	V	159;31;99	ENSP00000340979:M159V;ENSP00000274068:M31V;ENSP00000427472:M99V	ENSP00000274068:M31V	M	-	1	0	RNF175	154863987	1.000000	0.71417	0.996000	0.52242	0.935000	0.57460	3.291000	0.51764	0.136000	0.18733	0.455000	0.32223	ATG	T|0.917;C|0.083	0.083	strong		0.388	RNF175-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365286.1	NM_173662	
P2RY1	5028	hgsc.bcm.edu	37	3	152554357	152554357	+	Silent	SNP	A	A	G	rs701265	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:152554357A>G	ENST00000305097.3	+	1	1622	c.786A>G	c.(784-786)gtA>gtG	p.V262V	RP11-38P22.2_ENST00000460407.1_lincRNA	NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	262					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			TTTACCTGGTAATCATTGTAC	0.433													G|||	1830	0.365415	0.7852	0.2651	5008	,	,		19943	0.248		0.163	False		,,,				2504	0.1984				p.V262V		Atlas-SNP	.											.	P2RY1	49	.	0			c.A786G						PASS	.	G		2983,1423	463.6+/-353.6	1010,963,230	109.0	107.0	108.0		786	-0.1	1.0	3	dbSNP_86	108	1271,7329	760.5+/-407.6	87,1097,3116	no	coding-synonymous	P2RY1	NM_002563.2		1097,2060,3346	GG,GA,AA		14.7791,32.2969,32.708		262/374	152554357	4254,8752	2203	4300	6503	SO:0001819	synonymous_variant	5028	exon1			CCTGGTAATCATT	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.786A>G	3.37:g.152554357A>G		Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	110	7	0.0636364	NM_002563		Silent	SNP	ENST00000305097.3	37	CCDS3169.1																																																																																			A|0.653;G|0.347	0.347	strong		0.433	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563	
DPM1	8813	hgsc.bcm.edu	37	20	49575721	49575721	+	5'Flank	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:49575721T>C	ENST00000371588.5	-	0	0				DPM1_ENST00000371583.5_5'Flank|MOCS3_ENST00000244051.1_Silent_p.Y114Y|DPM1_ENST00000371582.4_5'Flank|DPM1_ENST00000466152.1_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						TTGTGGACTATGACGTGGTAG	0.692																																					p.Y114Y		Atlas-SNP	.											.	MOCS3	44	.	0			c.T342C						PASS	.						46.0	57.0	53.0					20																	49575721		2192	4282	6474	SO:0001631	upstream_gene_variant	27304	exon1			GGACTATGACGTG	AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49575721T>C	Exception_encountered	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	52	17	0.326923	NM_014484	O15157|Q6IB78|Q96HK0	Silent	SNP	ENST00000371588.5	37	CCDS13434.1																																																																																			.	.	none		0.692	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859	
PARL	55486	hgsc.bcm.edu	37	3	183558402	183558402	+	Missense_Mutation	SNP	C	C	G	rs3732581	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:183558402C>G	ENST00000317096.4	-	7	844	c.784G>C	c.(784-786)Gtg>Ctg	p.V262L	PARL_ENST00000311101.5_Missense_Mutation_p.V212L|PARL_ENST00000435888.1_Missense_Mutation_p.V212L	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	262			V -> L (in dbSNP:rs3732581). {ECO:0000269|PubMed:12214059, ECO:0000269|Ref.3}.		membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.V262L(1)		endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ACTTTACCCACGTAACTGACA	0.259													C|||	2281	0.455471	0.4947	0.4971	5008	,	,		14534	0.4087		0.4781	False		,,,				2504	0.3978				p.V262L		Atlas-SNP	.											PARL,NS,carcinoma,0,1	PARL	32	1	1	Substitution - Missense(1)	stomach(1)	c.G784C						PASS	.	C	LEU/VAL,LEU/VAL	2166,2240	572.9+/-383.4	534,1098,571	49.0	48.0	49.0		634,784	2.3	0.9	3	dbSNP_107	49	4161,4437	561.4+/-387.8	1009,2143,1147	yes	missense,missense	PARL	NM_001037639.1,NM_018622.5	32,32	1543,3241,1718	GG,GC,CC		48.395,49.1602,48.6543	possibly-damaging,possibly-damaging	212/330,262/380	183558402	6327,6677	2203	4299	6502	SO:0001583	missense	55486	exon7			TACCCACGTAACT	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.784G>C	3.37:g.183558402C>G	ENSP00000325421:p.Val262Leu	Somatic	808	0	0		WXS	Illumina HiSeq	Phase_I	726	31	0.0426997	NM_018622	Q96CQ4|Q9BTJ6|Q9P1E3	Missense_Mutation	SNP	ENST00000317096.4	37	CCDS3248.1	1039|1039	0.4757326007326007|0.4757326007326007	232|232	0.4715447154471545|0.4715447154471545	192|192	0.5303867403314917|0.5303867403314917	258|258	0.45104895104895104|0.45104895104895104	357|357	0.470976253298153|0.470976253298153	C|C	11.77|11.77	1.738030|1.738030	0.30774|0.30774	0.491602|0.491602	0.48395|0.48395	ENSG00000175193|ENSG00000175193	ENST00000417784;ENST00000449306|ENST00000317096;ENST00000311101;ENST00000450375;ENST00000435888	.|T;T;T;T	.|0.11063	.|2.81;3.12;2.81;3.12	5.08|5.08	2.32|2.32	0.28847|0.28847	.|Peptidase S54, rhomboid domain (1);	.|0.372080	.|0.27544	.|N	.|0.018894	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.12611|0.12611	0.24|0.24	0.21064|0.21064	P|P	0.999791612|0.999791612	.|B;B	.|0.27732	.|0.187;0.002	.|B;B	.|0.31614	.|0.133;0.011	T|T	0.31194|0.31194	-0.9952|-0.9952	4|9	.|0.11485	.|T	.|0.65	-16.5729|-16.5729	10.5808|10.5808	0.45255|0.45255	0.0:0.7885:0.0:0.2115|0.0:0.7885:0.0:0.2115	rs3732581;rs17670811;rs52807469;rs3732581|rs3732581;rs17670811;rs52807469;rs3732581	.|212;262	.|Q9H300-2;Q9H300	.|.;PARL_HUMAN	P|L	53;125|262;212;42;212	.|ENSP00000325421:V262L;ENSP00000310676:V212L;ENSP00000402689:V42L;ENSP00000402137:V212L	.|ENSP00000310676:V212L	R|V	-|-	2|1	0|0	PARL|PARL	185041096|185041096	0.775000|0.775000	0.28604|0.28604	0.908000|0.908000	0.35775|0.35775	0.925000|0.925000	0.55904|0.55904	1.740000|1.740000	0.38228|0.38228	0.272000|0.272000	0.22027|0.22027	-0.253000|-0.253000	0.11424|0.11424	CGT|GTG	C|0.516;G|0.484	0.484	strong		0.259	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346465.1	NM_018622	
COL6A2	1292	hgsc.bcm.edu	37	21	47545823	47545823	+	Silent	SNP	G	G	A	rs13052956	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr21:47545823G>A	ENST00000300527.4	+	26	2198	c.2094G>A	c.(2092-2094)gcG>gcA	p.A698A	COL6A2_ENST00000357838.4_Silent_p.A698A|COL6A2_ENST00000409416.1_Silent_p.A698A|COL6A2_ENST00000310645.5_Silent_p.A698A|COL6A2_ENST00000397763.1_Silent_p.A698A	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	698	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		AGTGGATTGCGGGCGGCACCT	0.607													G|||	1974	0.394169	0.208	0.6398	5008	,	,		14604	0.4306		0.5109	False		,,,				2504	0.3139				p.A698A		Atlas-SNP	.											.	COL6A2	351	.	0			c.G2094A						PASS	.	G	,,	1065,3341	387.2+/-326.4	148,769,1286	76.0	69.0	72.0		2094,2094,2094	-8.4	0.0	21	dbSNP_121	72	4303,4297	576.5+/-390.4	1047,2209,1044	no	coding-synonymous,coding-synonymous,coding-synonymous	COL6A2	NM_001849.3,NM_058174.2,NM_058175.2	,,	1195,2978,2330	AA,AG,GG		49.9651,24.1716,41.2733	,,	698/1020,698/919,698/829	47545823	5368,7638	2203	4300	6503	SO:0001819	synonymous_variant	1292	exon26			GATTGCGGGCGGC	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2094G>A	21.37:g.47545823G>A		Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	121	5	0.0413223	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	ENST00000300527.4	37	CCDS13728.1																																																																																			G|0.578;A|0.422	0.422	strong		0.607	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
CYP26C1	340665	hgsc.bcm.edu	37	10	94824263	94824263	+	Silent	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:94824263G>T	ENST00000285949.5	+	4	831	c.831G>T	c.(829-831)ctG>ctT	p.L277L		NM_183374.2	NP_899230.2	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C, polypeptide 1	277					anterior/posterior pattern specification (GO:0009952)|central nervous system development (GO:0007417)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|organelle fusion (GO:0048284)|oxidation-reduction process (GO:0055114)|retinoic acid catabolic process (GO:0034653)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			central_nervous_system(1)|lung(3)|ovary(1)	5		Colorectal(252;0.122)				CAAGGGAGCTGGGCCATGAGC	0.587																																					p.L277L		Atlas-SNP	.											.	CYP26C1	25	.	0			c.G831T						PASS	.						96.0	90.0	92.0					10																	94824263		2203	4300	6503	SO:0001819	synonymous_variant	340665	exon4			GGAGCTGGGCCAT		CCDS7425.1	10q23.33	2003-11-20			ENSG00000187553	ENSG00000187553		"""Cytochrome P450s"""	20577	protein-coding gene	gene with protein product		608428					Standard	XR_246086		Approved		uc010qns.2	Q6V0L0	OTTHUMG00000018766	ENST00000285949.5:c.831G>T	10.37:g.94824263G>T		Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	97	5	0.0515464	NM_183374	Q5VXH6	Silent	SNP	ENST00000285949.5	37	CCDS7425.1																																																																																			.	.	none		0.587	CYP26C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049409.2	NM_183374	
PRSS3	5646	hgsc.bcm.edu	37	9	33797962	33797962	+	Silent	SNP	A	A	G	rs374178684		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:33797962A>G	ENST00000361005.5	+	3	507	c.507A>G	c.(505-507)aaA>aaG	p.K169K	PRSS3_ENST00000342836.4_Silent_p.K126K|PRSS3_ENST00000429677.3_Silent_p.K105K|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_Silent_p.K112K	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	169	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			TGCTGATCAAACTCTCCTCAC	0.567																																					p.K169K		Atlas-SNP	.											PRSS3_ENST00000361005,NS,neuroblastoma,0,3	PRSS3	79	3	0			c.A507G						scavenged	.						266.0	201.0	223.0					9																	33797962		2203	4300	6503	SO:0001819	synonymous_variant	5646	exon3			GATCAAACTCTCC		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.507A>G	9.37:g.33797962A>G		Somatic	157	5	0.0318471		WXS	Illumina HiSeq	Phase_I	133	5	0.037594	NM_007343	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Silent	SNP	ENST00000361005.5	37	CCDS47958.1																																																																																			.	.	weak		0.567	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
NUSAP1	51203	hgsc.bcm.edu	37	15	41634587	41634587	+	Missense_Mutation	SNP	A	A	G	rs386783399|rs7178634	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:41634587A>G	ENST00000559596.1	+	2	184	c.97A>G	c.(97-99)Acc>Gcc	p.T33A	NUSAP1_ENST00000450318.1_Missense_Mutation_p.T33A|NUSAP1_ENST00000558123.1_3'UTR|NUSAP1_ENST00000450592.2_Intron|NUSAP1_ENST00000560177.1_Missense_Mutation_p.T33A|NUSAP1_ENST00000414849.2_Missense_Mutation_p.T33A|NUSAP1_ENST00000560747.1_Missense_Mutation_p.T33A|NUSAP1_ENST00000260359.6_Missense_Mutation_p.T33A|RP11-16O9.2_ENST00000559959.1_RNA			Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	33			T -> A (in dbSNP:rs7178634).|T -> N (in dbSNP:rs7178777).	T -> D (in Ref. 6; AL833611). {ECO:0000305}.	establishment of mitotic spindle localization (GO:0040001)|mitotic chromosome condensation (GO:0007076)|mitotic cytokinesis (GO:0000281)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of mitosis (GO:0045840)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.T33A(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	13		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CTTGCAGGCAACCAAGTTGTT	0.338													G|||	1714	0.342252	0.5938	0.2781	5008	,	,		23594	0.1548		0.337	False		,,,				2504	0.2464				p.T33A		Atlas-SNP	.											NUSAP1,NS,carcinoma,0,2	NUSAP1	32	2	1	Substitution - Missense(1)	prostate(1)	c.A97G						scavenged	.	G	ALA/THR,ALA/THR,ALA/THR	91,3631		12,67,1782	70.0	66.0	67.0		97,97,97	4.6	1.0	15	dbSNP_116	67	59,8135		7,45,4045	yes	missense,missense,missense	NUSAP1	NM_001129897.1,NM_016359.4,NM_018454.7	58,58,58	19,112,5827	GG,GA,AA		0.72,2.4449,1.2588	benign,benign,benign	33/403,33/442,33/441	41634587	150,11766	1861	4097	5958	SO:0001583	missense	51203	exon2			CAGGCAACCAAGT	AF290612	CCDS45234.1, CCDS45236.1, CCDS58356.1, CCDS58357.1, CCDS58358.1, CCDS73708.1	15q14	2008-02-05				ENSG00000137804			18538	protein-coding gene	gene with protein product		612818				12963707	Standard	NM_016359		Approved	FLJ13421, LNP, ANKT, NuSAP1, SAPL, BM037, PRO0310p1, Q0310	uc001zns.4	Q9BXS6		ENST00000559596.1:c.97A>G	15.37:g.41634587A>G	ENSP00000453403:p.Thr33Ala	Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	157	2	0.0127389	NM_018454	B4DDF1|E7ERR5|J3KN21|Q53GW2|Q8TBT4|Q96E58|Q96FJ1|Q9GZM9|Q9NZ85|Q9UI70	Missense_Mutation	SNP	ENST00000559596.1	37	CCDS45234.1	577	0.2641941391941392	222	0.45121951219512196	97	0.26795580110497236	72	0.1258741258741259	186	0.24538258575197888	G	12.08	1.830706	0.32329	0.024449	0.0072	ENSG00000137804	ENST00000260359;ENST00000414849;ENST00000450318	T;T;T	0.30981	1.51;1.51;1.51	5.47	4.56	0.56223	.	0.426017	0.27797	N	0.017808	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B;B;B;B;B	0.12630	0.0;0.006;0.005;0.006;0.005	B;B;B;B;B	0.12837	0.0;0.008;0.006;0.008;0.006	T	0.43048	-0.9415	9	0.72032	D	0.01	.	10.0559	0.42244	0.1593:0.0:0.8407:0.0	rs7178634;rs57619738;rs7178634	33;33;33;33;33	E9PB35;Q9BXS6-3;Q9BXS6-5;Q9BXS6;Q9BXS6-2	.;.;.;NUSAP_HUMAN;.	A	33	ENSP00000260359:T33A;ENSP00000400746:T33A;ENSP00000401351:T33A	ENSP00000260359:T33A	T	+	1	0	NUSAP1	39421879	1.000000	0.71417	0.999000	0.59377	0.229000	0.25112	1.570000	0.36439	0.818000	0.34468	-0.227000	0.12334	ACC	A|0.684;G|0.316	0.316	strong		0.338	NUSAP1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419427.1	NM_016359	
PIGN	23556	hgsc.bcm.edu	37	18	59810563	59810563	+	Silent	SNP	A	A	G	rs34227891	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr18:59810563A>G	ENST00000357637.5	-	11	1354	c.939T>C	c.(937-939)aaT>aaC	p.N313N	PIGN_ENST00000400334.3_Silent_p.N313N	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	313					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				GCCTCTTCCAATTCTCCAATC	0.299													G|||	872	0.174121	0.1906	0.1671	5008	,	,		15670	0.0764		0.2972	False		,,,				2504	0.1309				p.N313N		Atlas-SNP	.											PIGN,NS,carcinoma,0,1	PIGN	62	1	0			c.T939C						scavenged	.	G	,	759,2851		79,601,1125	55.0	47.0	50.0		939,939	-3.0	0.0	18	dbSNP_126	50	2141,5965		283,1575,2195	no	coding-synonymous,coding-synonymous	PIGN	NM_012327.5,NM_176787.4	,	362,2176,3320	GG,GA,AA		26.4125,21.0249,24.7525	,	313/932,313/932	59810563	2900,8816	1805	4053	5858	SO:0001819	synonymous_variant	23556	exon11			CTTCCAATTCTCC	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.939T>C	18.37:g.59810563A>G		Somatic	369	0	0		WXS	Illumina HiSeq	Phase_I	446	5	0.0112108	NM_176787	Q7L8F8|Q8TC01|Q9NT05	Silent	SNP	ENST00000357637.5	37	CCDS45879.1																																																																																			A|0.789;G|0.211	0.211	strong		0.299	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787	
TTC14	151613	hgsc.bcm.edu	37	3	180326574	180326574	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:180326574G>A	ENST00000296015.4	+	11	1508	c.1376G>A	c.(1375-1377)cGt>cAt	p.R459H	TTC14_ENST00000412756.2_3'UTR|TTC14_ENST00000465625.1_3'UTR|TTC14_ENST00000382584.4_Missense_Mutation_p.R459H	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	459							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GAAAAGTTGCGTAAGCTCTTA	0.323																																					p.R459H		Atlas-SNP	.											TTC14,colon,carcinoma,+1,1	TTC14	112	1	0			c.G1376A						scavenged	.																																			SO:0001583	missense	151613	exon11			AGTTGCGTAAGCT	AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.1376G>A	3.37:g.180326574G>A	ENSP00000296015:p.Arg459His	Somatic	406	0	0		WXS	Illumina HiSeq	Phase_I	328	6	0.0182927	NM_133462	G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	CCDS3237.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402430	0.62288	.	.	ENSG00000163728	ENST00000296015;ENST00000382584	T;T	0.43294	0.95;2.17	5.66	5.66	0.87406	.	0.051989	0.85682	D	0.000000	T	0.63379	0.2506	M	0.68952	2.095	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.63703	0.917;0.745	T	0.64952	-0.6286	10	0.72032	D	0.01	-9.9043	19.3428	0.94350	0.0:0.0:1.0:0.0	.	459;459	Q96N46-2;Q96N46	.;TTC14_HUMAN	H	459	ENSP00000296015:R459H;ENSP00000372027:R459H	ENSP00000296015:R459H	R	+	2	0	TTC14	181809268	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.802000	0.91910	2.663000	0.90544	0.655000	0.94253	CGT	.	.	none		0.323	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462	
CHD1L	9557	hgsc.bcm.edu	37	1	146736092	146736092	+	Silent	SNP	C	C	T	rs4950315	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:146736092C>T	ENST00000369258.4	+	7	608	c.588C>T	c.(586-588)gtC>gtT	p.V196V	CHD1L_ENST00000369259.3_Intron|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000361293.5_Intron|CHD1L_ENST00000431239.1_Silent_p.V196V	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	196	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					TCTCAGTAGTCTTCAGTCTCC	0.438													C|||	737	0.147165	0.0076	0.1931	5008	,	,		17562	0.1111		0.2306	False		,,,				2504	0.2546				p.V196V		Atlas-SNP	.											.	CHD1L	72	.	0			c.C588T						PASS	.	C		208,4196	124.1+/-161.4	5,198,1999	53.0	47.0	49.0		588	2.4	1.0	1	dbSNP_111	49	2003,6597	328.2+/-318.2	225,1553,2522	no	coding-synonymous	CHD1L	NM_004284.3		230,1751,4521	TT,TC,CC		23.2907,4.723,17.0025		196/898	146736092	2211,10793	2202	4300	6502	SO:0001819	synonymous_variant	9557	exon7			AGTAGTCTTCAGT	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.588C>T	1.37:g.146736092C>T		Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	132	6	0.0454545	NM_004284	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Silent	SNP	ENST00000369258.4	37	CCDS927.1																																																																																			C|0.864;T|0.136	0.136	strong		0.438	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	
ME3	10873	hgsc.bcm.edu	37	11	86198437	86198437	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:86198437C>T	ENST00000393324.3	-	6	1004	c.751G>A	c.(751-753)Gtg>Atg	p.V251M	RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000543262.1_Missense_Mutation_p.V251M|ME3_ENST00000323418.6_Missense_Mutation_p.V189M|ME3_ENST00000359636.2_Missense_Mutation_p.V251M|ME3_ENST00000525957.1_5'UTR	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	251					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				TTCCCGTGCACGCGCTGGTGT	0.512																																					p.V251M		Atlas-SNP	.											.	ME3	70	.	0			c.G751A						PASS	.						132.0	106.0	115.0					11																	86198437		2202	4299	6501	SO:0001583	missense	10873	exon7			CGTGCACGCGCTG	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.751G>A	11.37:g.86198437C>T	ENSP00000376998:p.Val251Met	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	92	58	0.630435	NM_006680	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.596022	0.46318	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826;ENST00000545395;ENST00000323418	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	5.44	4.53	0.55603	Malic enzyme, N-terminal (2);	0.187074	0.46442	N	0.000290	T	0.69169	0.3081	M	0.87547	2.89	0.58432	D	0.999995	D	0.76494	0.999	D	0.63877	0.919	T	0.74423	-0.3670	9	.	.	.	.	12.7938	0.57549	0.0:0.92:0.0:0.08	.	251	Q16798	MAON_HUMAN	M	251;251;251;251;189;189	ENSP00000352657:V251M;ENSP00000440246:V251M;ENSP00000376998:V251M;ENSP00000431182:V251M;ENSP00000315255:V189M	.	V	-	1	0	ME3	85876085	0.978000	0.34361	0.230000	0.23976	0.322000	0.28314	2.358000	0.44134	1.287000	0.44583	0.655000	0.94253	GTG	.	.	none		0.512	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2		
ZNF469	84627	hgsc.bcm.edu	37	16	88504850	88504850	+	Missense_Mutation	SNP	G	G	C	rs1105066	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:88504850G>C	ENST00000437464.1	+	2	10888	c.10888G>C	c.(10888-10890)Gag>Cag	p.E3630Q	ZNF469_ENST00000565624.1_Missense_Mutation_p.E3658Q	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	3630			E -> Q (in dbSNP:rs1105066). {ECO:0000269|PubMed:11347906}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CATGGTGTCTGAGGGGGGGCC	0.642													G|||	1958	0.390974	0.531	0.3818	5008	,	,		13825	0.38		0.3926	False		,,,				2504	0.2178				p.E3630Q		Atlas-SNP	.											.	ZNF469	121	.	0			c.G10888C						PASS	.	G	GLN/GLU	729,639		200,329,155	7.0	11.0	10.0		10888	1.3	0.1	16	dbSNP_86	10	1311,1845		287,737,554	yes	missense	ZNF469	NM_001127464.1	29	487,1066,709	CC,CG,GG		41.5399,46.7105,45.0928	benign	3630/3926	88504850	2040,2484	684	1578	2262	SO:0001583	missense	84627	exon2			GTGTCTGAGGGGG	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.10888G>C	16.37:g.88504850G>C	ENSP00000402343:p.Glu3630Gln	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	89	5	0.0561798	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	886	0.4056776556776557	265	0.5386178861788617	133	0.3674033149171271	195	0.3409090909090909	293	0.3865435356200528	G	9.407	1.079583	0.20309	0.532895	0.415399	ENSG00000225614	ENST00000437464	T	0.09911	2.93	4.65	1.33	0.21861	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	P	0.34724	0.465	B	0.30572	0.117	T	0.38972	-0.9636	8	0.49607	T	0.09	-3.6085	6.1191	0.20144	0.1901:0.1577:0.6522:0.0	rs1105066;rs3812952;rs57863012;rs1105066	3630	Q96JG9	ZN469_HUMAN	Q	3630	ENSP00000402343:E3630Q	ENSP00000402343:E3630Q	E	+	1	0	ZNF469	87032351	0.000000	0.05858	0.122000	0.21767	0.019000	0.09904	-0.519000	0.06260	0.950000	0.37743	0.561000	0.74099	GAG	G|0.601;C|0.399	0.399	strong		0.642	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
FGD4	121512	hgsc.bcm.edu	37	12	32735236	32735236	+	Silent	SNP	C	C	T	rs904582	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:32735236C>T	ENST00000427716.2	+	4	859	c.435C>T	c.(433-435)gaC>gaT	p.D145D	FGD4_ENST00000472289.1_Silent_p.D145D|FGD4_ENST00000546442.1_Silent_p.D52D|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000525053.1_Silent_p.D257D|FGD4_ENST00000534526.2_Silent_p.D282D|FGD4_ENST00000531134.1_Silent_p.D230D	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	145	Actin filament-binding. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					CCACAACAGACAGCTGTGATG	0.488													T|||	2339	0.467053	0.7247	0.4928	5008	,	,		1102	0.2401		0.4036	False		,,,				2504	0.3998				p.D145D		Atlas-SNP	.											.	FGD4	86	.	0			c.C435T						PASS	.	T		3031,1375	434.7+/-344.0	1023,985,195	93.0	90.0	91.0		435	-0.2	0.0	12	dbSNP_86	91	3458,5142	637.0+/-399.2	710,2038,1552	no	coding-synonymous	FGD4	NM_139241.2		1733,3023,1747	TT,TC,CC		40.2093,31.2074,49.8924		145/767	32735236	6489,6517	2203	4300	6503	SO:0001819	synonymous_variant	121512	exon4			AACAGACAGCTGT	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.435C>T	12.37:g.32735236C>T		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	116	5	0.0431034	NM_139241	Q6ULS2|Q8TCP6	Silent	SNP	ENST00000427716.2	37	CCDS8727.1																																																																																			C|0.515;T|0.485	0.485	strong		0.488	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
PLEKHH1	57475	hgsc.bcm.edu	37	14	68045935	68045935	+	Silent	SNP	G	G	A	rs6573781	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:68045935G>A	ENST00000329153.5	+	21	3066	c.2934G>A	c.(2932-2934)tcG>tcA	p.S978S	PLEKHH1_ENST00000417684.2_5'UTR	NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	978	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CCAGGCCATCGCGCATGGAAG	0.597													G|||	3240	0.646965	0.5862	0.7579	5008	,	,		19141	0.503		0.7982	False		,,,				2504	0.6431				p.S978S		Atlas-SNP	.											.	PLEKHH1	118	.	0			c.G2934A						PASS	.	G		2760,1458		894,972,243	69.0	77.0	74.0		2934	-10.5	0.0	14	dbSNP_116	74	6697,1731		2676,1345,193	yes	coding-synonymous	PLEKHH1	NM_020715.2		3570,2317,436	AA,AG,GG		20.5387,34.5661,25.2175		978/1365	68045935	9457,3189	2109	4214	6323	SO:0001819	synonymous_variant	57475	exon21			GCCATCGCGCATG	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.2934G>A	14.37:g.68045935G>A		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	42	6	0.142857	NM_020715	A6H8X6|Q6PJL4|Q6ZWC7	Silent	SNP	ENST00000329153.5	37	CCDS45128.1																																																																																			G|0.332;A|0.668	0.668	strong		0.597	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3	XM_031054	
MXRA5	25878	hgsc.bcm.edu	37	X	3228411	3228411	+	Silent	SNP	G	G	A	rs1635233	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chrX:3228411G>A	ENST00000217939.6	-	7	7987	c.7833C>T	c.(7831-7833)gcC>gcT	p.A2611A		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2611	Ig-like C2-type 10.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GGTAGGCCCCGGCGTCCACCG	0.607													g|||	2802	0.742252	0.6672	0.5202	3775	,	,		10932	0.5565		0.5209	False		,,,				2504	0.4847				p.A2611A		Atlas-SNP	.											.	MXRA5	815	.	0			c.C7833T						PASS	.	A		3229,558		1206,350,467,58,92	17.0	18.0	18.0		7833	-8.5	0.0	X	dbSNP_89	18	4289,2368		1029,1084,1147,301,682	no	coding-synonymous	MXRA5	NM_015419.3		2235,1434,1614,359,774	AA,AG,A,GG,G		35.5716,14.7346,28.0161		2611/2829	3228411	7518,2926	2173	4243	6416	SO:0001819	synonymous_variant	25878	exon7			GGCCCCGGCGTCC	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7833C>T	X.37:g.3228411G>A		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	124	7	0.0564516	NM_015419	Q6P1M7|Q9Y3Y8	Silent	SNP	ENST00000217939.6	37	CCDS14124.1																																																																																			A|1.000;|0.000	1.000	weak		0.607	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
SPTBN4	57731	hgsc.bcm.edu	37	19	41009982	41009982	+	Silent	SNP	C	C	T	rs71358911	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:41009982C>T	ENST00000352632.3	+	12	1694	c.1608C>T	c.(1606-1608)gcC>gcT	p.A536A	SPTBN4_ENST00000598249.1_Silent_p.A536A|SPTBN4_ENST00000344104.3_Silent_p.A536A|SPTBN4_ENST00000595535.1_Silent_p.A536A|SPTBN4_ENST00000338932.3_Silent_p.A536A			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	536					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGAACCTTGCCCTGCAGAAGG	0.677													c|||	122	0.024361	0.0061	0.0259	5008	,	,		11341	0.0		0.0865	False		,,,				2504	0.0092				p.A536A		Atlas-SNP	.											.	SPTBN4	213	.	0			c.C1608T						PASS	.			80,4326	68.1+/-105.8	0,80,2123	44.0	52.0	50.0		1608	1.0	1.0	19	dbSNP_130	50	933,7667	203.5+/-246.5	50,833,3417	no	coding-synonymous	SPTBN4	NM_020971.2		50,913,5540	TT,TC,CC		10.8488,1.8157,7.7887		536/2565	41009982	1013,11993	2203	4300	6503	SO:0001819	synonymous_variant	57731	exon12			CCTTGCCCTGCAG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.1608C>T	19.37:g.41009982C>T		Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	171	7	0.0409357	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	CCDS12559.1																																																																																			C|0.938;T|0.062	0.062	strong		0.677	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
ITIH5	80760	hgsc.bcm.edu	37	10	7605146	7605146	+	Missense_Mutation	SNP	T	T	C	rs137874246	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:7605146T>C	ENST00000256861.6	-	14	2807	c.2729A>G	c.(2728-2730)aAt>aGt	p.N910S	ITIH5_ENST00000446830.2_Missense_Mutation_p.N692S|ITIH5_ENST00000298441.6_Missense_Mutation_p.N696S|ITIH5_ENST00000397146.2_Intron	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	910					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TTTGGCGGCATTGTTCCTGGC	0.532													T|||	46	0.0091853	0.0008	0.0591	5008	,	,		20378	0.0		0.0	False		,,,				2504	0.0041				p.N910S		Atlas-SNP	.											.	ITIH5	343	.	0			c.A2729G						PASS	.	T	SER/ASN,SER/ASN	2,4404	4.2+/-10.8	0,2,2201	195.0	156.0	169.0		2729,2087	1.9	0.9	10	dbSNP_134	169	5,8595	3.7+/-12.6	0,5,4295	yes	missense,missense	ITIH5	NM_030569.6,NM_032817.5	46,46	0,7,6496	CC,CT,TT		0.0581,0.0454,0.0538	probably-damaging,probably-damaging	910/943,696/729	7605146	7,12999	2203	4300	6503	SO:0001583	missense	80760	exon14			GCGGCATTGTTCC			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2729A>G	10.37:g.7605146T>C	ENSP00000256861:p.Asn910Ser	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	96	5	0.0520833	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		26	0.011904761904761904	1	0.0020325203252032522	25	0.06906077348066299	0	0.0	0	0.0	T	17.91	3.505233	0.64410	4.54E-4	5.81E-4	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.02498	4.45;4.27;4.29	5.62	1.91	0.25777	.	0.364959	0.32488	N	0.006028	T	0.00695	0.0023	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.04216	-1.0968	9	0.45353	T	0.12	-18.2376	6.6603	0.23011	0.0:0.1366:0.1298:0.7337	.	910;696	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	S	910;696;692	ENSP00000256861:N910S;ENSP00000298441:N696S;ENSP00000387969:N692S	ENSP00000256861:N910S	N	-	2	0	ITIH5	7645152	1.000000	0.71417	0.940000	0.37924	0.820000	0.46376	3.814000	0.55643	0.077000	0.16863	-0.297000	0.09499	AAT	T|0.996;C|0.004	0.004	strong		0.532	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
CSGALNACT2	55454	hgsc.bcm.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																					p.L362F		Atlas-SNP	.											CSGALNACT2,NS,carcinoma,0,5	CSGALNACT2	67	5	5	Substitution - Missense(5)	endometrium(4)|kidney(1)	c.G1086T						scavenged	.						223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454	exon5			GGTCTTGATGTTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe	Somatic	162	1	0.00617284		WXS	Illumina HiSeq	Phase_I	126	6	0.047619	NM_018590	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG	.	.	weak		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
TMEM177	80775	hgsc.bcm.edu	37	2	120438515	120438515	+	Missense_Mutation	SNP	G	G	C	rs11684353	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:120438515G>C	ENST00000424086.1	+	2	559	c.86G>C	c.(85-87)gGa>gCa	p.G29A	TMEM177_ENST00000272521.6_Missense_Mutation_p.G29A|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000401466.1_Missense_Mutation_p.G29A|TMEM177_ENST00000409951.1_Missense_Mutation_p.G29A	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	29			G -> A (in dbSNP:rs11684353).			integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					GGCCTGTTTGGAGTTCCAATC	0.612													G|||	701	0.139976	0.1589	0.134	5008	,	,		18151	0.119		0.1511	False		,,,				2504	0.1288				p.G29A		Atlas-SNP	.											.	TMEM177	26	.	0			c.G86C						PASS	.	G	ALA/GLY,ALA/GLY,ALA/GLY	758,3648	308.0+/-290.3	58,642,1503	70.0	69.0	70.0		86,86,86	4.0	1.0	2	dbSNP_120	70	1278,7322	253.9+/-279.4	100,1078,3122	yes	missense,missense,missense	TMEM177	NM_001105198.1,NM_001105199.1,NM_030577.2	60,60,60	158,1720,4625	CC,CG,GG		14.8605,17.2038,15.6543	possibly-damaging,possibly-damaging,possibly-damaging	29/312,29/312,29/312	120438515	2036,10970	2203	4300	6503	SO:0001583	missense	80775	exon2			TGTTTGGAGTTCC	BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.86G>C	2.37:g.120438515G>C	ENSP00000402661:p.Gly29Ala	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	71	5	0.0704225	NM_030577	Q9BT20	Missense_Mutation	SNP	ENST00000424086.1	37	CCDS2128.1	335	0.1533882783882784	82	0.16666666666666666	57	0.1574585635359116	79	0.1381118881118881	117	0.15435356200527706	G	2.536	-0.307404	0.05458	0.172038	0.148605	ENSG00000144120	ENST00000401466;ENST00000424086;ENST00000272521;ENST00000445518;ENST00000409951;ENST00000415646	T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11	3.95	3.95	0.45737	.	0.117634	0.56097	D	0.000034	T	0.00039	0.0001	L	0.27053	0.805	0.26645	P	0.972203	B;P	0.35745	0.202;0.518	B;B	0.32533	0.104;0.147	T	0.16748	-1.0392	9	0.07644	T	0.81	-1.8004	9.9146	0.41425	0.0:0.2076:0.7924:0.0	rs11684353;rs17609082	29;29	B8ZZT5;Q53S58	.;TM177_HUMAN	A	29	ENSP00000385966:G29A;ENSP00000402661:G29A;ENSP00000272521:G29A;ENSP00000405898:G29A;ENSP00000386430:G29A	ENSP00000272521:G29A	G	+	2	0	TMEM177	120154985	0.999000	0.42202	0.993000	0.49108	0.174000	0.22865	3.461000	0.53035	2.509000	0.84616	0.549000	0.68633	GGA	C|0.155;G|0.845;T|0.000	0.155	strong		0.612	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577	
TMA16	55319	hgsc.bcm.edu	37	4	164435265	164435265	+	Missense_Mutation	SNP	A	A	C	rs2304802	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:164435265A>C	ENST00000358572.5	+	4	535	c.194A>C	c.(193-195)cAa>cCa	p.Q65P	TMA16_ENST00000513134.1_Missense_Mutation_p.Q65P|TMA16_ENST00000511562.1_3'UTR|TMA16_ENST00000508268.1_Missense_Mutation_p.Q65P|TMA16_ENST00000513272.1_Missense_Mutation_p.Q65P	NM_018352.2	NP_060822.2	Q96EY4	TMA16_HUMAN	translation machinery associated 16 homolog (S. cerevisiae)	65			Q -> P (in dbSNP:rs2304802). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.			nucleus (GO:0005634)		p.Q65P(2)									CTTGATCCCCAAAAAAAGAGA	0.358													A|||	1903	0.379992	0.2504	0.6009	5008	,	,		19903	0.3423		0.4682	False		,,,				2504	0.3466				p.Q65P		Atlas-SNP	.											C4orf43,NS,carcinoma,0,2	.	.	2	2	Substitution - Missense(2)	prostate(1)|stomach(1)	c.A194C						scavenged	.	A	PRO/GLN	977,2675		145,687,994	95.0	86.0	89.0		194	3.0	0.1	4	dbSNP_100	89	3823,4325		962,1899,1213	yes	missense	C4orf43	NM_018352.2	76	1107,2586,2207	CC,CA,AA		46.9195,26.7525,40.678	benign	65/204	164435265	4800,7000	1826	4074	5900	SO:0001583	missense	55319	exon4			ATCCCCAAAAAAA		CCDS43278.1	4q32.3	2012-03-02	2012-03-02	2012-03-02	ENSG00000198498	ENSG00000198498			25638	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 43"""	C4orf43		12477932	Standard	NM_018352		Approved	FLJ11184	uc003iqq.4	Q96EY4	OTTHUMG00000161528	ENST00000358572.5:c.194A>C	4.37:g.164435265A>C	ENSP00000351380:p.Gln65Pro	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	55	3	0.0545455	NM_018352	Q0P6E4|Q0P6J1|Q9NUR7	Missense_Mutation	SNP	ENST00000358572.5	37	CCDS43278.1	901	0.4125457875457875	124	0.25203252032520324	216	0.5966850828729282	197	0.34440559440559443	364	0.48021108179419525	A	6.442	0.449727	0.12223	0.267525	0.469195	ENSG00000198498	ENST00000358572;ENST00000513272;ENST00000513134;ENST00000508268	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.39	2.96	0.34315	.	0.787793	0.12848	N	0.434179	T	0.00012	0.0000	L	0.36672	1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.40608	-0.9554	9	0.37606	T	0.19	-0.3681	8.7145	0.34403	0.8405:0.0:0.1595:0.0	rs2304802;rs3207214;rs17576322;rs17850804;rs52811362;rs2304802	65	Q96EY4	CD043_HUMAN	P	65	ENSP00000351380:Q65P;ENSP00000426933:Q65P;ENSP00000423901:Q65P;ENSP00000423375:Q65P	ENSP00000351380:Q65P	Q	+	2	0	C4orf43	164654715	0.002000	0.14202	0.068000	0.19968	0.570000	0.35934	1.401000	0.34589	0.978000	0.38470	0.528000	0.53228	CAA	C|0.418;N|0.000	0.418	strong		0.358	TMA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365208.1	NM_018352	
OR14C36	127066	hgsc.bcm.edu	37	1	248512749	248512749	+	Missense_Mutation	SNP	G	G	A	rs28377739	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:248512749G>A	ENST00000317861.1	+	1	673	c.673G>A	c.(673-675)Ggg>Agg	p.G225R		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	225			G -> R (in dbSNP:rs28377739).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						GACCGTGCTCGGGTTTCCAAG	0.498													a|||	2306	0.460463	0.3601	0.4885	5008	,	,		19309	0.4315		0.5239	False		,,,				2504	0.5409				p.G225R		Atlas-SNP	.											OR14C36,NS,adenoma,0,1	OR14C36	113	1	0			c.G673A						PASS	.	A	ARG/GLY	1764,2642	643.9+/-397.9	352,1060,791	191.0	146.0	161.0		673	1.2	0.0	1	dbSNP_125	161	4894,3706	530.1+/-381.7	1390,2114,796	yes	missense	OR14C36	NM_001001918.1	125	1742,3174,1587	AA,AG,GG		43.093,40.0363,48.8082	benign	225/313	248512749	6658,6348	2203	4300	6503	SO:0001583	missense	127066	exon1			GTGCTCGGGTTTC	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.673G>A	1.37:g.248512749G>A	ENSP00000324534:p.Gly225Arg	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	99	4	0.040404	NM_001001918	Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	37	CCDS31112.1	1006	0.4606227106227106	169	0.3434959349593496	179	0.494475138121547	253	0.4423076923076923	405	0.5343007915567283	A	0.005	-2.203520	0.00296	0.400363	0.56907	ENSG00000177174	ENST00000317861	T	0.00019	9.06	3.91	1.2	0.21068	GPCR, rhodopsin-like superfamily (1);	0.422559	0.19555	N	0.111462	T	0.00012	0.0000	N	0.00227	-1.8	0.80722	P	0.0	B	0.09022	0.002	B	0.01281	0.0	T	0.37776	-0.9691	9	0.02654	T	1	.	6.3589	0.21417	0.6176:0.2982:0.0841:0.0	rs28377739	225	Q8NHC7	O14CZ_HUMAN	R	225	ENSP00000324534:G225R	ENSP00000324534:G225R	G	+	1	0	OR14C36	246579372	0.000000	0.05858	0.035000	0.18076	0.144000	0.21451	0.145000	0.16157	0.101000	0.17610	-1.086000	0.02197	GGG	G|0.502;A|0.498	0.498	strong		0.498	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918	
HCAR3	8843	hgsc.bcm.edu	37	12	123200768	123200768	+	Missense_Mutation	SNP	T	T	G	rs386767126|rs1798192	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:123200768T>G	ENST00000528880.2	-	1	671	c.517A>C	c.(517-519)Act>Cct	p.T173P	RP11-324E6.6_ENST00000543611.1_lincRNA|HCAR1_ENST00000356987.2_Intron	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	173			T -> P (in dbSNP:rs1798192). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7505609, ECO:0000269|Ref.2}.		G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T173P(1)		endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	ACATTTGCAGTGCCATTCTGG	0.527													t|||	2324	0.464058	0.5008	0.4409	5008	,	,		21393	0.495		0.5716	False		,,,				2504	0.2883				p.T173P		Atlas-SNP	.											HCAR3_ENST00000528880,NS,carcinoma,0,1	HCAR3	49	1	1	Substitution - Missense(1)	stomach(1)	c.A517C						scavenged	.	T	PRO/THR	2231,2175	591.4+/-387.6	583,1065,555	99.0	95.0	96.0		517	-4.7	0.0	12	dbSNP_89	96	4921,3679	621.2+/-397.2	1410,2101,789	yes	missense	HCAR3	NM_006018.2	38	1993,3166,1344	GG,GT,TT		42.7791,49.3645,45.01	benign	173/388	123200768	7152,5854	2203	4300	6503	SO:0001583	missense	8843	exon1			TTGCAGTGCCATT	D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.517A>C	12.37:g.123200768T>G	ENSP00000436714:p.Thr173Pro	Somatic	98	2	0.0204082		WXS	Illumina HiSeq	Phase_I	83	6	0.0722892	NM_006018	A8K4G5|B2R830|E9PI97|Q8NGE4	Missense_Mutation	SNP	ENST00000528880.2	37	CCDS53842.1	1139	0.5215201465201466	251	0.5101626016260162	169	0.46685082872928174	304	0.5314685314685315	415	0.5474934036939314	T	0.572	-0.840675	0.02692	0.506355	0.572209	ENSG00000255398	ENST00000528880	T	0.37058	1.22	2.99	-4.69	0.03299	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.06786	0.001	B	0.10450	0.005	T	0.45963	-0.9225	7	0.49607	T	0.09	.	5.7314	0.18042	0.0:0.6545:0.1482:0.1973	rs1798192;rs3741539;rs17883771;rs60927003;rs1798192	173	E9PI97	.	P	173	ENSP00000436714:T173P	ENSP00000436714:T173P	T	-	1	0	HCAR3	121766721	0.000000	0.05858	0.000000	0.03702	0.138000	0.21146	-0.594000	0.05733	-1.206000	0.02641	0.155000	0.16302	ACT	T|0.481;G|0.519	0.519	strong		0.527	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387549.2	NM_006018	
CDH7	1005	hgsc.bcm.edu	37	18	63511176	63511176	+	Silent	SNP	T	T	C	rs2306675	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr18:63511176T>C	ENST00000397968.2	+	7	1536	c.1110T>C	c.(1108-1110)gaT>gaC	p.D370D	CDH7_ENST00000323011.3_Silent_p.D370D|CDH7_ENST00000536984.2_Silent_p.D370D	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	370	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.		D -> E (in dbSNP:rs2306675).		adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D370D(1)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TTGTGGAAGATGTAGATGAGC	0.502													T|||	932	0.186102	0.1528	0.2205	5008	,	,		12857	0.0377		0.3489	False		,,,				2504	0.1922				p.D370D		Atlas-SNP	.											CDH7,NS,carcinoma,0,1	CDH7	362	1	1	Substitution - coding silent(1)	stomach(1)	c.T1110C						scavenged	.	T	,	856,3550	334.9+/-303.7	88,680,1435	188.0	156.0	167.0		1110,1110	-7.5	0.8	18	dbSNP_100	167	2914,5686	455.7+/-363.9	488,1938,1874	no	coding-synonymous,coding-synonymous	CDH7	NM_004361.2,NM_033646.1	,	576,2618,3309	CC,CT,TT		33.8837,19.4281,28.9866	,	370/786,370/786	63511176	3770,9236	2203	4300	6503	SO:0001819	synonymous_variant	1005	exon7			GGAAGATGTAGAT	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1110T>C	18.37:g.63511176T>C		Somatic	155	1	0.00645161		WXS	Illumina HiSeq	Phase_I	183	6	0.0327869	NM_004361	Q9H157	Silent	SNP	ENST00000397968.2	37	CCDS11993.1																																																																																			T|0.756;C|0.244	0.244	strong		0.502	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
CDH12	1010	hgsc.bcm.edu	37	5	21752050	21752050	+	Silent	SNP	A	A	G	rs6451992	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:21752050A>G	ENST00000382254.1	-	15	3267	c.2181T>C	c.(2179-2181)gaT>gaC	p.D727D	RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000504376.2_Silent_p.D727D|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Silent_p.D687D	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	727					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D727D(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GGGCAGTTGGATCCACATCAT	0.493										HNSCC(59;0.17)			G|||	2748	0.548722	0.3782	0.6268	5008	,	,		15734	0.4355		0.7475	False		,,,				2504	0.636				p.D727D		Atlas-SNP	.											CDH12,NS,carcinoma,0,1	CDH12	238	1	1	Substitution - coding silent(1)	stomach(1)	c.T2181C						scavenged	.	G		2006,2400	614.5+/-392.4	454,1098,651	243.0	207.0	219.0		2181	0.3	0.6	5	dbSNP_116	219	6327,2273	383.0+/-340.6	2333,1661,306	no	coding-synonymous	CDH12	NM_004061.3		2787,2759,957	GG,GA,AA		26.4302,45.5288,35.9296		727/795	21752050	8333,4673	2203	4300	6503	SO:0001819	synonymous_variant	1010	exon15			AGTTGGATCCACA	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2181T>C	5.37:g.21752050A>G		Somatic	174	2	0.0114943		WXS	Illumina HiSeq	Phase_I	211	9	0.042654	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	ENST00000382254.1	37	CCDS3890.1																																																																																			A|0.382;G|0.618	0.618	strong		0.493	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
KCNH1	3756	hgsc.bcm.edu	37	1	211256200	211256200	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:211256200G>T	ENST00000271751.4	-	5	507	c.480C>A	c.(478-480)agC>agA	p.S160R	KCNH1_ENST00000367007.4_Missense_Mutation_p.S160R			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	160					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CACCCCTGCTGCTTGTCAGTG	0.557																																					p.S160R		Atlas-SNP	.											KCNH1,NS,carcinoma,0,1	KCNH1	199	1	0			c.C480A						PASS	.						95.0	77.0	84.0					1																	211256200		2203	4300	6503	SO:0001583	missense	3756	exon5			CCTGCTGCTTGTC	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.480C>A	1.37:g.211256200G>T	ENSP00000271751:p.Ser160Arg	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	43	18	0.418605	NM_172362	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	G	9.983	1.228687	0.22542	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98617	-5.01;-5.03	5.1	4.18	0.49190	.	0.075279	0.85682	D	0.000000	D	0.91469	0.7307	N	0.01009	-1.055	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.09377	0.004;0.004	D	0.88309	0.2955	10	0.02654	T	1	.	14.3963	0.67013	0.0:0.0:0.8514:0.1486	.	160;160	Q14CL3;O95259	.;KCNH1_HUMAN	R	160	ENSP00000271751:S160R;ENSP00000355974:S160R	ENSP00000271751:S160R	S	-	3	2	KCNH1	209322823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.252000	0.72447	1.275000	0.44379	0.655000	0.94253	AGC	.	.	none		0.557	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
FAM21A	387680	hgsc.bcm.edu	37	10	51853633	51853633	+	Missense_Mutation	SNP	C	C	T	rs199520696	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:51853633C>T	ENST00000282633.5	+	13	1181	c.1136C>T	c.(1135-1137)aCg>aTg	p.T379M	FAM21A_ENST00000399339.2_Missense_Mutation_p.T291M|FAM21A_ENST00000314664.7_Missense_Mutation_p.T379M|FAM21A_ENST00000351071.6_Missense_Mutation_p.T379M	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	379					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						GACCTCTTCACGGAAGCCCCC	0.488																																					p.T379M		Atlas-SNP	.											FAM21A,NS,carcinoma,0,4	FAM21A	32	4	0			c.C1136T						scavenged	.						1.0	1.0	1.0					10																	51853633		353	936	1289	SO:0001583	missense	387680	exon13			TCTTCACGGAAGC	BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1136C>T	10.37:g.51853633C>T	ENSP00000282633:p.Thr379Met	Somatic	683	133	0.194729		WXS	Illumina HiSeq	Phase_I	705	153	0.217021	NM_001005751	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	ENST00000282633.5	37	CCDS41527.1	.	.	.	.	.	.	.	.	.	.	C	6.414	0.444490	0.12164	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	3.88	-5.37	0.02681	.	0.781535	0.12699	N	0.446536	T	0.14527	0.0351	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.29253	0.05;0.02;0.005;0.02;0.239	B;B;B;B;B	0.16722	0.013;0.013;0.003;0.013;0.016	T	0.05767	-1.0865	9	0.42905	T	0.14	2.3495	2.2948	0.04147	0.3714:0.2592:0.2739:0.0955	.	379;379;291;379;273	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	M	379;379;273;379;291	.	ENSP00000282633:T379M	T	+	2	0	FAM21A	51523639	0.024000	0.19004	0.096000	0.21009	0.033000	0.12548	-0.884000	0.04166	-1.796000	0.01253	-1.109000	0.02080	ACG	C|0.796;T|0.205	0.205	strong		0.488	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276917.2	NM_001005751	
CDH9	1007	hgsc.bcm.edu	37	5	26988328	26988328	+	Missense_Mutation	SNP	G	G	A	rs2288466	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:26988328G>A	ENST00000231021.4	-	2	285	c.113C>T	c.(112-114)gCg>gTg	p.A38V		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	38			A -> V (in dbSNP:rs2288466). {ECO:0000269|PubMed:15489334}.		adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TGTCAGACCCGCTATCTTTTT	0.393													A|||	1910	0.38139	0.6936	0.2666	5008	,	,		15880	0.1508		0.4712	False		,,,				2504	0.1861				p.A38V	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											CDH9,NS,carcinoma,+1,1	CDH9	305	1	0			c.C113T						PASS	.	A	VAL/ALA	3019,1387	457.8+/-351.8	1046,927,230	139.0	135.0	136.0		113	3.3	0.0	5	dbSNP_100	136	4305,4295	576.0+/-390.3	1099,2107,1094	yes	missense	CDH9	NM_016279.3	64	2145,3034,1324	AA,AG,GG		49.9419,31.4798,43.6875	benign	38/790	26988328	7324,5682	2203	4300	6503	SO:0001583	missense	1007	exon2			AGACCCGCTATCT	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.113C>T	5.37:g.26988328G>A	ENSP00000231021:p.Ala38Val	Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	177	9	0.0508475	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	901	0.4125457875457875	324	0.6585365853658537	113	0.31215469613259667	98	0.17132867132867133	366	0.48284960422163586	A	3.005	-0.205196	0.06180	0.685202	0.500581	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	T;T;T	0.57436	0.51;0.4;1.94	5.64	3.28	0.37604	.	1.138130	0.06392	N	0.717309	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.46091	-0.9216	8	.	.	.	.	8.4322	0.32764	0.6064:0.0:0.3936:0.0	rs2288466;rs17565545;rs52826250;rs57578097;rs2288466	38;38	E7EPN0;Q9ULB4	.;CADH9_HUMAN	V	38	ENSP00000231021:A38V;ENSP00000426239:A38V;ENSP00000422538:A38V	.	A	-	2	0	CDH9	27024085	0.000000	0.05858	0.014000	0.15608	0.685000	0.39939	0.479000	0.22228	0.109000	0.17891	-0.332000	0.08345	GCG	G|0.501;A|0.499	0.499	strong		0.393	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
TAF1L	138474	hgsc.bcm.edu	37	9	32631196	32631196	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:32631196C>T	ENST00000242310.4	-	1	4471	c.4382G>A	c.(4381-4383)cGg>cAg	p.R1461Q	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1461	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GAACTCTTCCCGAGATGGGTA	0.443																																					p.R1461Q		Atlas-SNP	.											TAF1L,NS,carcinoma,0,1	TAF1L	382	1	0			c.G4382A						scavenged	.						202.0	178.0	186.0					9																	32631196		2203	4300	6503	SO:0001583	missense	138474	exon1			TCTTCCCGAGATG	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.4382G>A	9.37:g.32631196C>T	ENSP00000418379:p.Arg1461Gln	Somatic	265	0	0		WXS	Illumina HiSeq	Phase_I	301	6	0.0199336	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	C	33	5.208342	0.95033	.	.	ENSG00000122728	ENST00000242310	T	0.29142	1.58	1.17	1.17	0.20885	Bromodomain (5);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.52158	0.1717	M	0.83012	2.62	0.50171	D	0.999855	D	0.89917	1.0	D	0.79108	0.992	T	0.53788	-0.8389	10	0.87932	D	0	.	8.1775	0.31292	0.0:1.0:0.0:0.0	.	1461	Q8IZX4	TAF1L_HUMAN	Q	1461	ENSP00000418379:R1461Q	ENSP00000418379:R1461Q	R	-	2	0	TAF1L	32621196	1.000000	0.71417	0.998000	0.56505	0.925000	0.55904	5.098000	0.64548	0.514000	0.28300	0.205000	0.17691	CGG	.	.	none		0.443	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
C16orf46	123775	hgsc.bcm.edu	37	16	81095091	81095091	+	Missense_Mutation	SNP	A	A	G	rs7198494	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:81095091A>G	ENST00000299578.5	-	4	1098	c.863T>C	c.(862-864)aTa>aCa	p.I288T	C16orf46_ENST00000378611.4_Missense_Mutation_p.I288T|RP11-303E16.8_ENST00000564536.1_RNA|C16orf46_ENST00000444657.3_5'Flank	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	288			I -> T (in dbSNP:rs7198494).			cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						CAGCAGGGATATCTGGGCCGC	0.577													G|||	790	0.157748	0.2791	0.1643	5008	,	,		17378	0.0198		0.2048	False		,,,				2504	0.0828				p.I288T		Atlas-SNP	.											.	C16orf46	57	.	0			c.T863C						PASS	.	G	THR/ILE,THR/ILE	1168,3236	707.8+/-407.5	143,882,1177	112.0	107.0	108.0		863,863	2.4	0.0	16	dbSNP_116	108	1943,6657	716.5+/-406.1	224,1495,2581	yes	missense,missense	C16orf46	NM_001100873.1,NM_152337.2	89,89	367,2377,3758	GG,GA,AA		22.593,26.5213,23.9234	benign,benign	288/389,288/396	81095091	3111,9893	2202	4300	6502	SO:0001583	missense	123775	exon3			AGGGATATCTGGG	BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.863T>C	16.37:g.81095091A>G	ENSP00000299578:p.Ile288Thr	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	96	5	0.0520833	NM_001100873	Q96MA7	Missense_Mutation	SNP	ENST00000299578.5	37	CCDS10932.1	372	0.17032967032967034	140	0.2845528455284553	69	0.19060773480662985	13	0.022727272727272728	150	0.19788918205804748	G	0.004	-2.315748	0.00235	0.265213	0.22593	ENSG00000166455	ENST00000378611;ENST00000444657;ENST00000299578	T;T	0.12774	2.65;2.65	5.53	2.4	0.29515	.	0.813420	0.11056	N	0.604525	T	0.00012	0.0000	N	0.00289	-1.7	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46624	-0.9178	9	0.02654	T	1	.	3.4169	0.07378	0.1687:0.1419:0.5584:0.131	rs7198494;rs61064956;rs7198494	288;288	Q6P387-2;Q6P387	.;CP046_HUMAN	T	288;15;288	ENSP00000367874:I288T;ENSP00000299578:I288T	ENSP00000299578:I288T	I	-	2	0	C16orf46	79652592	0.008000	0.16893	0.003000	0.11579	0.036000	0.12997	1.169000	0.31871	0.717000	0.32145	-0.213000	0.12676	ATA	A|0.792;G|0.208	0.208	strong		0.577	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269054.2	NM_152337	
SEMA3D	223117	hgsc.bcm.edu	37	7	84628989	84628989	+	Missense_Mutation	SNP	T	T	G	rs7800072	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:84628989T>G	ENST00000284136.6	-	17	2144	c.2101A>C	c.(2101-2103)Aag>Cag	p.K701Q	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	701			K -> Q (in dbSNP:rs7800072). {ECO:0000269|PubMed:12975309}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TCCTTGACCTTCCCCTCCTCA	0.473													G|||	1430	0.285543	0.351	0.2421	5008	,	,		17893	0.2718		0.3201	False		,,,				2504	0.2065				p.K701Q	Ovarian(63;442 1191 17318 29975 31528)	Atlas-SNP	.											SEMA3D,rectum,carcinoma,0,1	SEMA3D	177	1	0			c.A2101C						scavenged	.	G	GLN/LYS	1642,2764	659.1+/-400.5	314,1014,875	144.0	119.0	128.0		2101	3.8	1.0	7	dbSNP_116	128	2814,5786	676.5+/-403.3	459,1896,1945	yes	missense	SEMA3D	NM_152754.2	53	773,2910,2820	GG,GT,TT		32.7209,37.2674,34.2611	benign	701/778	84628989	4456,8550	2203	4300	6503	SO:0001583	missense	223117	exon17			TGACCTTCCCCTC	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.2101A>C	7.37:g.84628989T>G	ENSP00000284136:p.Lys701Gln	Somatic	126	1	0.00793651		WXS	Illumina HiSeq	Phase_I	131	5	0.0381679	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	667	0.30540293040293043	191	0.3882113821138211	94	0.2596685082872928	139	0.243006993006993	243	0.32058047493403696	G	5.817	0.334982	0.11013	0.372674	0.327209	ENSG00000153993	ENST00000284136	T	0.30981	1.51	5.73	3.82	0.43975	.	0.959042	0.08767	N	0.896847	T	0.00012	0.0000	N	0.19112	0.55	0.09310	P	0.999999611851	B	0.02656	0.0	B	0.01281	0.0	T	0.44620	-0.9316	9	0.13108	T	0.6	.	15.0253	0.71667	0.0:0.0:0.6279:0.3721	rs7800072;rs10365892;rs7800072	701	O95025	SEM3D_HUMAN	Q	701	ENSP00000284136:K701Q	ENSP00000284136:K701Q	K	-	1	0	SEMA3D	84466925	0.865000	0.29922	0.998000	0.56505	0.986000	0.74619	1.502000	0.35704	0.759000	0.33084	-0.121000	0.15023	AAG	T|0.671;G|0.329	0.329	strong		0.473	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
KCTD20	222658	hgsc.bcm.edu	37	6	36442765	36442765	+	Silent	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:36442765G>T	ENST00000373731.2	+	3	751	c.360G>T	c.(358-360)acG>acT	p.T120T	KCTD20_ENST00000474988.1_Intron|KCTD20_ENST00000536244.1_Intron|KCTD20_ENST00000449081.2_Intron|KCTD20_ENST00000544295.1_Intron	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	120	BTB.				protein homooligomerization (GO:0051260)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						AGAAAGTGACGCTTCTTGTAG	0.423																																					p.T120T		Atlas-SNP	.											KCTD20,NS,carcinoma,+1,1	KCTD20	37	1	0			c.G360T						scavenged	.						130.0	125.0	127.0					6																	36442765		2203	4300	6503	SO:0001819	synonymous_variant	222658	exon3			AGTGACGCTTCTT	BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.360G>T	6.37:g.36442765G>T		Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	144	4	0.0277778	NM_173562	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Silent	SNP	ENST00000373731.2	37	CCDS4821.1																																																																																			.	.	none		0.423	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562	
KRT83	3889	hgsc.bcm.edu	37	12	52709883	52709883	+	Silent	SNP	T	T	C	rs2248473	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:52709883T>C	ENST00000293670.3	-	7	1118	c.1056A>G	c.(1054-1056)gaA>gaG	p.E352E		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	352	Coil 2.|Rod.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.E352E(1)		NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CCACCGCAGCTTCCAGCTTGG	0.567													N|||	1882	0.375799	0.5008	0.317	5008	,	,		16721	0.1885		0.4095	False		,,,				2504	0.407				p.E352E	GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	Atlas-SNP	.											KRT83,NS,carcinoma,0,1	KRT83	64	1	1	Substitution - coding silent(1)	stomach(1)	c.A1056G						scavenged	.	T		2084,2322		553,978,672	23.0	26.0	25.0		1056	3.0	0.9	12	dbSNP_100	25	3392,5208		718,1956,1626	no	coding-synonymous	KRT83	NM_002282.3		1271,2934,2298	CC,CT,TT		39.4419,47.2991,42.1036		352/494	52709883	5476,7530	2203	4300	6503	SO:0001819	synonymous_variant	3889	exon7			CGCAGCTTCCAGC	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.1056A>G	12.37:g.52709883T>C		Somatic	47	1	0.0212766		WXS	Illumina HiSeq	Phase_I	52	2	0.0384615	NM_002282	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Silent	SNP	ENST00000293670.3	37	CCDS8823.1																																																																																			T|0.629;C|0.371	0.371	strong		0.567	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282	
MS4A6A	64231	hgsc.bcm.edu	37	11	59945745	59945745	+	Silent	SNP	T	T	C	rs12453	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:59945745T>C	ENST00000530839.1	-	5	819	c.327A>G	c.(325-327)ttA>ttG	p.L109L	MS4A6A_ENST00000529054.1_Silent_p.L137L|MS4A6A_ENST00000528851.1_Silent_p.L109L|MS4A6A_ENST00000412309.2_Silent_p.L137L|MS4A6A_ENST00000533023.1_Intron|MS4A6A_ENST00000323961.3_Silent_p.L109L|MS4A6A_ENST00000426738.2_Silent_p.L64L|MS4A6A_ENST00000529906.1_5'UTR|MS4A6A_ENST00000420732.2_Silent_p.L109L	NM_152852.2	NP_690591.1	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member 6A	109						integral component of membrane (GO:0016021)		p.L109L(1)		endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AAAGCTTGGTTAACCTTTTCT	0.383													T|||	1539	0.307308	0.1581	0.2723	5008	,	,		18602	0.2252		0.4046	False		,,,				2504	0.5184				p.L137L		Atlas-SNP	.											MS4A6A_ENST00000529054,NS,carcinoma,0,3	MS4A6A	85	3	1	Substitution - coding silent(1)	stomach(1)	c.A411G						scavenged	.	T	,,	882,3520	343.8+/-307.8	79,724,1398	154.0	143.0	147.0		327,327,327	-5.8	0.0	11	dbSNP_52	147	3431,5159	506.1+/-376.5	702,2027,1566	no	coding-synonymous,coding-synonymous,coding-synonymous	MS4A6A	NM_022349.2,NM_152851.1,NM_152852.1	,,	781,2751,2964	CC,CT,TT		39.9418,20.0363,33.1974	,,	109/226,109/179,109/249	59945745	4313,8679	2201	4295	6496	SO:0001819	synonymous_variant	64231	exon5			CTTGGTTAACCTT	AB013104	CCDS7981.1, CCDS44615.1, CCDS44616.1, CCDS58134.1	11q12.1	2008-03-25			ENSG00000110077	ENSG00000110077			13375	protein-coding gene	gene with protein product		606548		MS4A6		11245982, 11401424	Standard	NM_152852		Approved	CD20L3	uc010rla.2	Q9H2W1	OTTHUMG00000167241	ENST00000530839.1:c.327A>G	11.37:g.59945745T>C		Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	199	3	0.0150754	NM_001247999	A8K755|F8W9K1|Q7Z4E8|Q8TBV7|Q8TEZ4|Q8TEZ5|Q96PG6|Q9H2L1|Q9H2N3|Q9H3V1|Q9HC76	Silent	SNP	ENST00000530839.1	37	CCDS7981.1																																																																																			T|0.688;C|0.312	0.312	strong		0.383	MS4A6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393848.1		
CFAP46	54777	hgsc.bcm.edu	37	10	134646988	134646988	+	Missense_Mutation	SNP	C	C	T	rs4880433	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:134646988C>T	ENST00000368586.5	-	50	7091	c.6991G>A	c.(6991-6993)Gca>Aca	p.A2331T	TTC40_ENST00000263170.5_Missense_Mutation_p.A492T	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TGTCTGTCTGCGACCAGGACT	0.547													C|||	1602	0.319888	0.1399	0.513	5008	,	,		15265	0.2788		0.3986	False		,,,				2504	0.3875				p.A2331T		Atlas-SNP	.											.	TTC40	100	.	0			c.G6991A						PASS	.	C	THR/ALA	771,3635	309.7+/-291.2	66,639,1498	117.0	117.0	117.0		1927	1.4	0.0	10	dbSNP_111	117	3461,5139	507.9+/-376.9	715,2031,1554	yes	missense	C10orf92	NM_001200049.1	58	781,2670,3052	TT,TC,CC		40.2442,17.4989,32.5388	benign	643/1028	134646988	4232,8774	2203	4300	6503	SO:0001583	missense	54777	exon50			TGTCTGCGACCAG																												ENST00000368586.5:c.6991G>A	10.37:g.134646988C>T	ENSP00000357575:p.Ala2331Thr	Somatic	201	0	0		WXS	Illumina HiSeq	Phase_I	119	6	0.0504202	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	37	CCDS58101.1	693	0.3173076923076923	68	0.13821138211382114	172	0.47513812154696133	155	0.270979020979021	298	0.39313984168865435	C	9.644	1.139755	0.21205	0.174989	0.402442	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.32023	1.47;1.47	4.32	1.39	0.22231	.	1.053680	0.07597	N	0.922951	T	0.00012	0.0000	L	0.28115	0.83	0.80722	P	0.0	B	0.23490	0.086	B	0.12837	0.008	T	0.46898	-0.9158	9	0.62326	D	0.03	.	7.7247	0.28753	0.0:0.7151:0.0:0.2849	rs4880433;rs17853281;rs52791356;rs56954370;rs4880433	492	Q8IYW2	CJ092_HUMAN	T	2331;492	ENSP00000357575:A2331T;ENSP00000263170:A492T	ENSP00000263170:A492T	A	-	1	0	C10orf93	134496978	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.199000	0.17237	0.305000	0.22832	-0.143000	0.13931	GCA	C|0.686;T|0.314	0.314	strong		0.547	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
VPS13B	157680	hgsc.bcm.edu	37	8	100133706	100133706	+	Intron	SNP	T	T	G	rs7460625	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:100133706T>G	ENST00000358544.2	+	8	1317				VPS13B_ENST00000395996.1_Intron|VPS13B_ENST00000441350.2_Nonsense_Mutation_p.Y413*|CTD-2340D6.1_ENST00000523226.1_RNA|VPS13B_ENST00000357162.2_Intron|VPS13B_ENST00000355155.1_Intron	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)						protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TATATCTCTATCAACTTTAAT	0.333													G|||	3531	0.705072	0.7088	0.5807	5008	,	,		19997	0.5337		0.7903	False		,,,				2504	0.8773				p.Y413X	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.T1239G						PASS	.	G	,,,stop/TYR	3001,1405	454.5+/-350.7	1032,937,234	113.0	117.0	115.0		,,,1239	3.3	0.0	8	dbSNP_116	115	6827,1773	320.0+/-314.4	2702,1423,175	yes	intron,intron,intron,stop-gained	VPS13B	NM_015243.2,NM_017890.3,NM_152564.3,NM_181661.2	,,,	3734,2360,409	GG,GT,TT		20.6163,31.8883,24.4349	,,,	,,,413/416	100133706	9828,3178	2203	4300	6503	SO:0001627	intron_variant	157680	exon8			TCTCTATCAACTT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1206+33T>G	8.37:g.100133706T>G		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	121	7	0.0578512	NM_181661	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Nonsense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	1450	0.6639194139194139	328	0.6666666666666666	232	0.6408839779005525	306	0.534965034965035	584	0.7704485488126649	G	14.97	2.693883	0.48202	0.681117	0.793837	ENSG00000132549	ENST00000441350	.	.	.	5.66	3.32	0.38043	.	.	.	.	.	.	.	.	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.265	0.10759	0.1639:0.0686:0.1109:0.6566	rs7460625;rs60785353;rs7460625	.	.	.	X	413	.	.	Y	+	3	2	VPS13B	100202882	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.041000	0.13927	0.119000	0.18210	-1.113000	0.02065	TAT	T|0.294;G|0.706	0.706	strong		0.333	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
TRPV3	162514	hgsc.bcm.edu	37	17	3436080	3436080	+	Silent	SNP	C	C	T	rs395357	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:3436080C>T	ENST00000576742.1	-	8	1257	c.936G>A	c.(934-936)acG>acA	p.T312T	TRPV3_ENST00000301365.4_Silent_p.T312T|TRPV3_ENST00000572519.1_Silent_p.T312T	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	312					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	AGTCATTCTGCGTCTTGAAGT	0.592													T|||	1783	0.35603	0.3328	0.281	5008	,	,		21646	0.254		0.4901	False		,,,				2504	0.408				p.T312T		Atlas-SNP	.											.	TRPV3	85	.	0			c.G936A						PASS	.	T		1524,2882	673.7+/-402.8	267,990,946	243.0	161.0	188.0		936	-8.1	0.3	17	dbSNP_80	188	4224,4376	583.4+/-391.6	1032,2160,1108	no	coding-synonymous	TRPV3	NM_145068.2		1299,3150,2054	TT,TC,CC		49.1163,34.5892,44.195		312/791	3436080	5748,7258	2203	4300	6503	SO:0001819	synonymous_variant	162514	exon8			ATTCTGCGTCTTG	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.936G>A	17.37:g.3436080C>T		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	105	6	0.0571429	NM_001258205	Q8NDW7|Q8NET9|Q8NFH2	Silent	SNP	ENST00000576742.1	37	CCDS11029.1																																																																																			C|0.601;T|0.399	0.399	strong		0.592	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
OR52N5	390075	hgsc.bcm.edu	37	11	5799468	5799468	+	Missense_Mutation	SNP	C	C	T	rs12360738	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:5799468C>T	ENST00000317093.2	-	1	429	c.397G>A	c.(397-399)Gta>Ata	p.V133I	TRIM5_ENST00000380027.1_Intron	NM_001001922.2	NP_001001922.2	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N, member 5	133			V -> I (in dbSNP:rs12360738). {ECO:0000269|Ref.1}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(1)|lung(17)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		CAAATGGCTACATAGCGGTCT	0.493													C|||	822	0.164137	0.0363	0.1455	5008	,	,		17035	0.2937		0.1481	False		,,,				2504	0.2331				p.V133I		Atlas-SNP	.											.	OR52N5	58	.	0			c.G397A						PASS	.	C	ILE/VAL	254,3992		58,138,1927	127.0	103.0	111.0		397	-0.6	0.7	11	dbSNP_120	111	1219,6953		280,659,3147	yes	missense	OR52N5	NM_001001922.2	29	338,797,5074	TT,TC,CC		14.9168,5.9821,11.8618	benign	133/325	5799468	1473,10945	2123	4086	6209	SO:0001583	missense	390075	exon1			TGGCTACATAGCG	AB065535	CCDS31397.1	11p15.4	2012-08-09			ENSG00000181009	ENSG00000181009		"""GPCR / Class A : Olfactory receptors"""	15231	protein-coding gene	gene with protein product							Standard	NM_001001922		Approved	OR52N5Q	uc010qzn.2	Q8NH56	OTTHUMG00000168799	ENST00000317093.2:c.397G>A	11.37:g.5799468C>T	ENSP00000322866:p.Val133Ile	Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	77	5	0.0649351	NM_001001922	B9EH12|Q6IFG2	Missense_Mutation	SNP	ENST00000317093.2	37	CCDS31397.1	382	0.1749084249084249	23	0.046747967479674794	65	0.17955801104972377	177	0.3094405594405594	117	0.15435356200527706	C	6.344	0.431618	0.12045	0.059821	0.149168	ENSG00000181009	ENST00000317093	T	0.19250	2.16	3.7	-0.614	0.11590	GPCR, rhodopsin-like superfamily (1);	0.522424	0.11533	N	0.554463	T	0.00012	0.0000	L	0.54863	1.705	0.45962	P	0.0012180000000000524	B	0.12630	0.006	B	0.14578	0.011	T	0.38564	-0.9655	9	0.52906	T	0.07	.	3.2057	0.06665	0.1217:0.5112:0.1197:0.2474	rs12360738	133	Q8NH56	O52N5_HUMAN	I	133	ENSP00000322866:V133I	ENSP00000322866:V133I	V	-	1	0	OR52N5	5756044	0.000000	0.05858	0.659000	0.29680	0.218000	0.24690	-0.802000	0.04545	-0.499000	0.06623	-1.409000	0.01127	GTA	C|0.824;T|0.176	0.176	strong		0.493	OR52N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401141.1	NM_001001922	
ITSN2	50618	hgsc.bcm.edu	37	2	24432839	24432839	+	Silent	SNP	A	A	G	rs2303296	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:24432839A>G	ENST00000355123.4	-	35	4764	c.4321T>C	c.(4321-4323)Tta>Cta	p.L1441L	ITSN2_ENST00000361999.3_Silent_p.L1414L	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	1441	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCTTGTATAATTTCCCACTG	0.443													A|||	707	0.141174	0.0197	0.1354	5008	,	,		19423	0.124		0.2634	False		,,,				2504	0.2014				p.L1441L		Atlas-SNP	.											.	ITSN2	224	.	0			c.T4321C						PASS	.	A	,	267,4139	149.2+/-183.4	9,249,1945	169.0	160.0	163.0		4321,4240	-5.1	0.0	2	dbSNP_100	163	2131,6469	367.2+/-334.6	264,1603,2433	no	coding-synonymous,coding-synonymous	ITSN2	NM_006277.2,NM_019595.3	,	273,1852,4378	GG,GA,AA		24.7791,6.0599,18.4376	,	1441/1698,1414/1671	24432839	2398,10608	2203	4300	6503	SO:0001819	synonymous_variant	50618	exon35			TGTATAATTTCCC	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.4321T>C	2.37:g.24432839A>G		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	85	7	0.0823529	NM_006277	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Silent	SNP	ENST00000355123.4	37	CCDS1710.2																																																																																			A|0.824;G|0.176	0.176	strong		0.443	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
RAI1	10743	hgsc.bcm.edu	37	17	17697102	17697102	+	Silent	SNP	G	G	A	rs398124422|rs34083643|rs398124421|rs587780431		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:17697102G>A	ENST00000353383.1	+	3	1309	c.840G>A	c.(838-840)caG>caA	p.Q280Q	RAI1_ENST00000261641.6_Silent_p.Q280Q	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	280	Gln-rich.|Poly-Gln.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)	p.Q280fs*84(1)		breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		ACcagcagcagcagcagcagc	0.627																																					p.Q280Q		Atlas-SNP	.											RAI1,colon,carcinoma,0,3	RAI1	121	3	1	Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)	c.G840A						scavenged	.						20.0	25.0	23.0					17																	17697102		2038	4033	6071	SO:0001819	synonymous_variant	10743	exon3			GCAGCAGCAGCAG	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.840G>A	17.37:g.17697102G>A		Somatic	63	3	0.047619		WXS	Illumina HiSeq	Phase_I	38	6	0.157895	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	ENST00000353383.1	37	CCDS11188.1																																																																																			.	.	none		0.627	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
SETD2	29072	hgsc.bcm.edu	37	3	47125385	47125385	+	Missense_Mutation	SNP	G	G	A	rs4082155	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:47125385G>A	ENST00000409792.3	-	12	5927	c.5885C>T	c.(5884-5886)cCc>cTc	p.P1962L	SETD2_ENST00000492397.1_5'UTR	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1962			P -> L (in dbSNP:rs4082155). {ECO:0000269|PubMed:11214970, ECO:0000269|PubMed:15489334}.		angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.P1962L(1)|p.P1459L(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GCTCTCTTTGGGCTCTATTTC	0.453			"""N, F, S, Mis"""		clear cell renal carcinoma								G|||	2353	0.469848	0.236	0.5187	5008	,	,		21360	0.5327		0.5825	False		,,,				2504	0.5706				p.P1962L		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	SETD2_ENST00000409792,NS,carcinoma,0,2	SETD2	721	2	2	Substitution - Missense(2)	stomach(2)	c.C5885T						scavenged	.	G	LEU/PRO	1261,3145	433.1+/-343.5	201,859,1143	248.0	213.0	225.0		5885	2.9	1.0	3	dbSNP_108	225	4869,3731	618.1+/-396.7	1380,2109,811	yes	missense	SETD2	NM_014159.6	98	1581,2968,1954	AA,AG,GG		43.3837,28.6201,47.1321	benign	1962/2565	47125385	6130,6876	2203	4300	6503	SO:0001583	missense	29072	exon12			TCTTTGGGCTCTA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5885C>T	3.37:g.47125385G>A	ENSP00000386759:p.Pro1962Leu	Somatic	152	2	0.0131579		WXS	Illumina HiSeq	Phase_I	148	7	0.0472973	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	1082	0.49542124542124544	143	0.29065040650406504	194	0.5359116022099447	304	0.5314685314685315	441	0.5817941952506597	G	11.54	1.669445	0.29693	0.286201	0.566163	ENSG00000181555	ENST00000451092;ENST00000409792	T	0.21932	1.98	5.69	2.94	0.34122	.	0.827297	0.10610	N	0.654637	T	0.00012	0.0000	N	0.14661	0.345	0.28580	P	0.9101621	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.42207	-0.9465	9	0.13108	T	0.6	.	5.2839	0.15690	0.266:0.0:0.5927:0.1413	rs4082155;rs52814353;rs4082155	1962;1962	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	1962	ENSP00000386759:P1962L	ENSP00000386759:P1962L	P	-	2	0	SETD2	47100389	0.764000	0.28473	0.986000	0.45419	0.925000	0.55904	0.529000	0.23019	0.333000	0.23563	-0.145000	0.13849	CCC	G|0.524;A|0.476	0.476	strong		0.453	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
GPR156	165829	hgsc.bcm.edu	37	3	119892302	119892302	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:119892302C>A	ENST00000464295.1	-	9	1394	c.949G>T	c.(949-951)Gca>Tca	p.A317S	GPR156_ENST00000315843.3_Missense_Mutation_p.A317S|GPR156_ENST00000461057.1_Missense_Mutation_p.A313S			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)	p.A317S(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		TCTTCAAATGCCTTCCATTGC	0.398																																					p.A317S		Atlas-SNP	.											GPR156,rectum,carcinoma,0,1	GPR156	85	1	1	Substitution - Missense(1)	large_intestine(1)	c.G949T						PASS	.						203.0	183.0	189.0					3																	119892302		2203	4300	6503	SO:0001583	missense	165829	exon8			CAAATGCCTTCCA	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.949G>T	3.37:g.119892302C>A	ENSP00000417261:p.Ala317Ser	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	109	36	0.330275	NM_153002	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	ENST00000464295.1	37	CCDS2997.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.866726	0.32977	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.23348	1.91;1.91;1.91	5.48	3.58	0.41010	.	0.317821	0.27792	N	0.017826	T	0.23806	0.0576	M	0.67953	2.075	0.27786	N	0.942993	P;P	0.35077	0.483;0.483	B;B	0.30943	0.122;0.122	T	0.13019	-1.0525	9	.	.	.	-5.8605	8.9517	0.35792	0.0:0.6408:0.2041:0.1551	.	313;317	E9PFZ4;Q8NFN8	.;GP156_HUMAN	S	317;317;313	ENSP00000417261:A317S;ENSP00000324553:A317S;ENSP00000418758:A313S	.	A	-	1	0	GPR156	121374992	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.641000	0.24720	1.324000	0.45282	0.462000	0.41574	GCA	.	.	none		0.398	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002	
SPATA16	83893	hgsc.bcm.edu	37	3	172835125	172835125	+	Missense_Mutation	SNP	T	T	C	rs1515442	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:172835125T>C	ENST00000351008.3	-	2	580	c.397A>G	c.(397-399)Atg>Gtg	p.M133V		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	133			M -> V (in dbSNP:rs1515442). {ECO:0000269|PubMed:17665087}.		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			CGAACACCCATTTCATCAATG	0.413													C|||	2146	0.428514	0.7247	0.3055	5008	,	,		22397	0.374		0.2465	False		,,,				2504	0.3589				p.M133V		Atlas-SNP	.											SPATA16,NS,carcinoma,+2,1	SPATA16	111	1	0			c.A397G						scavenged	.	C	VAL/MET	2875,1531	484.4+/-360.0	951,973,279	291.0	266.0	274.0		397	5.7	1.0	3	dbSNP_88	274	2381,6219	701.5+/-405.2	336,1709,2255	yes	missense	SPATA16	NM_031955.5	21	1287,2682,2534	CC,CT,TT		27.686,34.7481,40.4121	benign	133/570	172835125	5256,7750	2203	4300	6503	SO:0001583	missense	83893	exon2			CACCCATTTCATC	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.397A>G	3.37:g.172835125T>C	ENSP00000341765:p.Met133Val	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	108	3	0.0277778	NM_031955	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	37	CCDS3221.1	866	0.3965201465201465	336	0.6829268292682927	108	0.2983425414364641	233	0.40734265734265734	189	0.24934036939313983	C	4.300	0.054895	0.08291	0.652519	0.27686	ENSG00000144962	ENST00000351008	T	0.13901	2.55	5.67	5.67	0.87782	.	0.221006	0.31335	N	0.007839	T	0.00012	0.0000	N	0.08118	0	0.58432	P	2.9999999999752447E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.19031	-1.0318	9	0.37606	T	0.19	-8.0923	9.6819	0.40076	0.0:0.7837:0.1403:0.0761	rs1515442;rs52810826;rs57404795;rs1515442	133	Q9BXB7	SPT16_HUMAN	V	133	ENSP00000341765:M133V	ENSP00000341765:M133V	M	-	1	0	SPATA16	174317819	1.000000	0.71417	0.970000	0.41538	0.167000	0.22549	1.498000	0.35660	1.405000	0.46838	-0.227000	0.12334	ATG	T|0.604;C|0.396	0.396	strong		0.413	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
NBPF10	100132406	hgsc.bcm.edu	37	1	145293535	145293535	+	Missense_Mutation	SNP	C	C	G	rs55936365		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:145293535C>G	ENST00000369339.3	+	3	383	c.130C>G	c.(130-132)Cta>Gta	p.L44V	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000342960.5_Missense_Mutation_p.L44V|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	315						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L44V(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAAATGTTTTCTAACTCAACT	0.443																																					p.L44V		Atlas-SNP	.											NBPF10,NS,carcinoma,0,2	NBPF10	221	2	2	Substitution - Missense(2)	kidney(2)	c.C130G						scavenged	.																																			SO:0001583	missense	100132406	exon1			TGTTTTCTAACTC	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.130C>G	1.37:g.145293535C>G	ENSP00000358345:p.Leu44Val	Somatic	53	4	0.0754717		WXS	Illumina HiSeq	Phase_I	55	7	0.127273	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.027|0.027	-1.360141|-1.360141	0.01245|0.01245	.|.	.|.	ENSG00000163386|ENSG00000163386	ENST00000369339;ENST00000342960|ENST00000448873	T|.	0.02837|.	4.14|.	0.687|0.687	-1.37|-1.37	0.09056|0.09056	.|.	.|.	.|.	.|.	.|.	T|T	0.01765|0.01765	0.0056|0.0056	N|N	0.01122|0.01122	-1.005|-1.005	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.33007|0.33007	-0.9885|-0.9885	9|6	0.02654|0.33141	T|T	1|0.24	.|.	3.2142|3.2142	0.06692|0.06692	0.3787:0.2355:0.3858:0.0|0.3787:0.2355:0.3858:0.0	rs55936365|rs55936365	44|.	A8MQ30|.	.|.	V|C	44|3	ENSP00000345684:L44V|.	ENSP00000345684:L44V|ENSP00000414194:S3C	L|S	+|+	1|2	2|0	NBPF10|NBPF10	144004892|144004892	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-3.451000|-3.451000	0.00466|0.00466	-3.626000|-3.626000	0.00130|0.00130	-3.729000|-3.729000	0.00022|0.00022	CTA|TCT	.	.	weak		0.443	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703	
CSNK2B	1460	hgsc.bcm.edu	37	6	31637636	31637636	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:31637636C>T	ENST00000375882.2	+	7	737	c.581C>T	c.(580-582)cCg>cTg	p.P194L	CSNK2B-LY6G5B-1181_ENST00000375880.2_Intron|LY6G5B_ENST00000375864.4_5'Flank|CSNK2B_ENST00000375865.2_Missense_Mutation_p.P194L|LY6G5B_ENST00000409525.1_5'Flank|CSNK2B_ENST00000375885.4_Missense_Mutation_p.P213L|CSNK2B_ENST00000375866.2_Missense_Mutation_p.P194L	NM_001282385.1|NM_001320.5	NP_001269314.1|NP_001311.3	P67870	CSK2B_HUMAN	casein kinase 2, beta polypeptide	194				P -> A (in Ref. 3; AAA52123). {ECO:0000305}.	adiponectin-activated signaling pathway (GO:0033211)|axon guidance (GO:0007411)|cellular protein complex assembly (GO:0043623)|endothelial tube morphogenesis (GO:0061154)|mitotic cell cycle (GO:0000278)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell proliferation (GO:0008285)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|protein phosphorylation (GO:0006468)|regulation of DNA binding (GO:0051101)|regulation of protein kinase activity (GO:0045859)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein kinase CK2 complex (GO:0005956)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein kinase regulator activity (GO:0019887)|receptor binding (GO:0005102)|transcription factor binding (GO:0008134)			central_nervous_system(5)|endometrium(1)|large_intestine(2)|liver(1)|urinary_tract(1)	10						AAGATCCATCCGATGGCCTAC	0.597																																					p.P194L		Atlas-SNP	.											.	CSNK2B	15	.	0			c.C581T						PASS	.						117.0	84.0	96.0					6																	31637636		1511	2709	4220	SO:0001583	missense	1460	exon7			TCCATCCGATGGC	M30448	CCDS4712.1	6p21.33	2013-01-17			ENSG00000204435	ENSG00000204435	2.7.11.1		2460	protein-coding gene	gene with protein product		115441				2276748, 9503014	Standard	NM_001320		Approved		uc003nvr.1	P67870	OTTHUMG00000177888	ENST00000375882.2:c.581C>T	6.37:g.31637636C>T	ENSP00000365042:p.Pro194Leu	Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	23	11	0.478261	NM_001320	B0UXA9|P07312|P13862|Q4VX47	Missense_Mutation	SNP	ENST00000375882.2	37	CCDS4712.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.467278	0.84533	.	.	ENSG00000204435	ENST00000375885;ENST00000375882;ENST00000375865;ENST00000375866	.	.	.	5.52	5.52	0.82312	.	0.119582	0.56097	D	0.000022	T	0.52468	0.1736	M	0.84326	2.69	0.49051	D	0.999744	D	0.53462	0.96	B	0.40982	0.345	T	0.63166	-0.6698	8	0.41790	T	0.15	-20.7702	16.978	0.86319	0.0:1.0:0.0:0.0	.	194	P67870	CSK2B_HUMAN	L	213;194;194;194	.	ENSP00000365025:P194L	P	+	2	0	CSNK2B	31745615	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	6.664000	0.74437	2.873000	0.98535	0.563000	0.77884	CCG	.	.	none		0.597	CSNK2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076063.8	NM_001320	
OR8J1	219477	hgsc.bcm.edu	37	11	56127971	56127971	+	Missense_Mutation	SNP	T	T	G	rs62001034	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:56127971T>G	ENST00000303039.3	+	1	281	c.249T>G	c.(247-249)atT>atG	p.I83M		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					AAATGCTGATTAACTTTTTAG	0.408													T|||	78	0.0155751	0.0	0.0187	5008	,	,		20865	0.0		0.0109	False		,,,				2504	0.0552				p.I83M		Atlas-SNP	.											.	OR8J1	87	.	0			c.T249G						PASS	.	T	MET/ILE	15,4387	21.2+/-45.6	0,15,2186	145.0	136.0	139.0		249	-1.4	0.2	11	dbSNP_129	139	161,8431	75.7+/-138.4	0,161,4135	no	missense	OR8J1	NM_001005205.2	10	0,176,6321	GG,GT,TT		1.8738,0.3408,1.3545	benign	83/317	56127971	176,12818	2201	4296	6497	SO:0001583	missense	219477	exon1			GCTGATTAACTTT	AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.249T>G	11.37:g.56127971T>G	ENSP00000304060:p.Ile83Met	Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	162	8	0.0493827	NM_001005205	B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Missense_Mutation	SNP	ENST00000303039.3	37	CCDS31529.1	18	0.008241758241758242	1	0.0020325203252032522	9	0.024861878453038673	0	0.0	8	0.010554089709762533	T	2.407	-0.336198	0.05278	0.003408	0.018738	ENSG00000172487	ENST00000303039	T	0.00397	7.57	4.57	-1.42	0.08913	GPCR, rhodopsin-like superfamily (1);	1.322050	0.04846	N	0.441440	T	0.00109	0.0003	N	0.17345	0.48	0.09310	N	1	B	0.10296	0.003	B	0.14023	0.01	T	0.35624	-0.9781	10	0.48119	T	0.1	.	1.431	0.02333	0.1466:0.2709:0.1439:0.4386	rs62001034	83	Q8NGP2	OR8J1_HUMAN	M	83	ENSP00000304060:I83M	ENSP00000304060:I83M	I	+	3	3	OR8J1	55884547	0.000000	0.05858	0.239000	0.24122	0.077000	0.17291	-2.906000	0.00701	-0.125000	0.11703	-1.136000	0.01936	ATT	T|0.986;G|0.014	0.014	strong		0.408	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391606.2	NM_001005205	
BBS12	166379	hgsc.bcm.edu	37	4	123664881	123664881	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:123664881G>T	ENST00000314218.3	+	2	2027	c.1834G>T	c.(1834-1836)Gaa>Taa	p.E612*	BBS12_ENST00000542236.1_Nonsense_Mutation_p.E612*	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	612					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						TTACTCATCAGAATTTGAAGC	0.378									Bardet-Biedl syndrome																												p.E612X		Atlas-SNP	.											.	BBS12	63	.	0			c.G1834T						PASS	.						85.0	83.0	83.0					4																	123664881		2203	4300	6503	SO:0001587	stop_gained	166379	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TCATCAGAATTTG	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.1834G>T	4.37:g.123664881G>T	ENSP00000319062:p.Glu612*	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	91	5	0.0549451	NM_001178007	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Nonsense_Mutation	SNP	ENST00000314218.3	37	CCDS3728.1	.	.	.	.	.	.	.	.	.	.	G	40	8.505213	0.98841	.	.	ENSG00000181004	ENST00000314218;ENST00000542236	.	.	.	5.81	4.97	0.65823	.	0.282205	0.39274	N	0.001417	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-34.5508	16.4957	0.84242	0.0:0.1415:0.8585:0.0	.	.	.	.	X	612	.	ENSP00000319062:E612X	E	+	1	0	BBS12	123884331	1.000000	0.71417	0.698000	0.30274	0.872000	0.50106	3.556000	0.53734	1.427000	0.47276	0.591000	0.81541	GAA	.	.	none		0.378	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256710.1	NM_152618	
SPZ1	84654	hgsc.bcm.edu	37	5	79616573	79616573	+	Missense_Mutation	SNP	C	C	A	rs184214819	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:79616573C>A	ENST00000296739.4	+	1	784	c.539C>A	c.(538-540)gCc>gAc	p.A180D		NM_032567.3	NP_115956.3	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	180	Basic motif. {ECO:0000255}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(5)|large_intestine(4)|lung(12)|ovary(1)|skin(2)	26		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)		GTTAGTTTAGCCCCAGAGAAA	0.378													C|||	10	0.00199681	0.0008	0.0043	5008	,	,		19027	0.0		0.006	False		,,,				2504	0.0				p.A180D		Atlas-SNP	.											SPZ1,NS,carcinoma,0,1	SPZ1	60	1	0			c.C539A						scavenged	.	C	ASP/ALA	6,3620		0,6,1807	68.0	60.0	63.0		539	2.3	0.1	5		63	57,8105		1,55,4025	yes	missense	SPZ1	NM_032567.3	126	1,61,5832	AA,AC,CC		0.6984,0.1655,0.5344	benign	180/431	79616573	63,11725	1813	4081	5894	SO:0001583	missense	84654	exon1			GTTTAGCCCCAGA		CCDS43336.1	5q14.1	2014-06-13				ENSG00000164299			30721	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 148"""					11165476, 12778315, 15226296, 15829580, 15899793	Standard	NM_032567		Approved	NYD-TSP1, FLJ25709, PPP1R148	uc003kgn.3	Q9BXG8		ENST00000296739.4:c.539C>A	5.37:g.79616573C>A	ENSP00000369611:p.Ala180Asp	Somatic	386	4	0.0103627		WXS	Illumina HiSeq	Phase_I	372	8	0.0215054	NM_032567	B2RA21|Q8N4P1|Q8N7E9	Missense_Mutation	SNP	ENST00000296739.4	37	CCDS43336.1	9	0.004120879120879121	0	0.0	2	0.0055248618784530384	0	0.0	7	0.009234828496042216	C	0.426	-0.905788	0.02453	0.001655	0.006984	ENSG00000164299	ENST00000511881;ENST00000296739	T;T	0.36157	1.27;1.68	3.49	2.28	0.28536	.	0.848170	0.10050	N	0.722365	T	0.05823	0.0152	N	0.00446	-1.495	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34354	-0.9832	10	0.08837	T	0.75	-1.471	4.3657	0.11223	0.5276:0.2846:0.0:0.1878	.	180	Q9BXG8	SPZ1_HUMAN	D	180	ENSP00000426530:A180D;ENSP00000369611:A180D	ENSP00000369611:A180D	A	+	2	0	SPZ1	79652329	0.004000	0.15560	0.105000	0.21289	0.407000	0.30961	0.932000	0.28884	0.628000	0.30357	-0.563000	0.04171	GCC	C|0.995;A|0.005	0.005	strong		0.378	SPZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369322.1	NM_032567	
C10orf90	118611	hgsc.bcm.edu	37	10	128193433	128193433	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:128193433C>T	ENST00000284694.7	-	3	456	c.336G>A	c.(334-336)ccG>ccA	p.P112P	C10orf90_ENST00000454341.1_Silent_p.P112P|C10orf90_ENST00000356858.3_Silent_p.P65P|C10orf90_ENST00000392694.1_Silent_p.P65P|C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000544758.1_Silent_p.P209P	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	112					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		GCTCATCTGACGGTGCCGGGA	0.597											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P112P		Atlas-SNP	.											C10orf90,NS,carcinoma,-1,1	C10orf90	121	1	0			c.G336A						PASS	.						81.0	65.0	70.0					10																	128193433		2203	4300	6503	SO:0001819	synonymous_variant	118611	exon3			ATCTGACGGTGCC	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.336G>A	10.37:g.128193433C>T		Somatic	115	0	0	1563	WXS	Illumina HiSeq	Phase_I	98	39	0.397959	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Silent	SNP	ENST00000284694.7	37	CCDS31310.1																																																																																			.	.	none		0.597	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
OPN3	23596	hgsc.bcm.edu	37	1	241755414	241755414	+	IGR	SNP	G	G	A	rs55662927	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:241755414G>A	ENST00000366554.2	-	0	2620				KMO_ENST00000366559.4_Missense_Mutation_p.V474M|KMO_ENST00000366558.3_Missense_Mutation_p.V461M|KMO_ENST00000366557.4_Missense_Mutation_p.V440M|OPN3_ENST00000469376.1_5'Flank	NM_014322.2	NP_055137.2	Q9H1Y3	OPN3_HUMAN	opsin 3						detection of light stimulus (GO:0009583)|detection of visible light (GO:0009584)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|large_intestine(5)|lung(5)	11	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			CGCAAAGGCCGTGGACTCCCT	0.428													A|||	5	0.000998403	0.0	0.0058	5008	,	,		20044	0.0		0.001	False		,,,				2504	0.0				p.V474M		Atlas-SNP	.											.	KMO	69	.	0			c.G1420A						PASS	.	A	MET/VAL	2,4404	826.0+/-416.6	0,2,2201	92.0	80.0	84.0		1420	0.4	0.0	1	dbSNP_129	84	31,8569	817.9+/-406.9	0,31,4269	yes	missense	KMO	NM_003679.3	21	0,33,6470	AA,AG,GG		0.3605,0.0454,0.2537	benign	474/487	241755414	33,12973	2203	4300	6503	SO:0001628	intergenic_variant	8564	exon15			AAGGCCGTGGACT	AF140242	CCDS31072.1	1q43	2014-06-13	2008-04-16		ENSG00000054277	ENSG00000054277		"""GPCR / Class A : Opsin receptors"""	14007	protein-coding gene	gene with protein product	"""panopsin"", ""protein phosphatase 1, regulatory subunit 116"""	606695	"""encephalopsin"""	ECPN		10234000, 11401433	Standard	NM_014322		Approved	ERO, NMO-1, encephalopsin, PPP1R116	uc001hza.3	Q9H1Y3	OTTHUMG00000039691		1.37:g.241755414G>A		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	84	4	0.047619	NM_003679	Q8IX08|Q9Y344	Missense_Mutation	SNP	ENST00000366554.2	37	CCDS31072.1	2|2	9.157509157509158E-4|9.157509157509158E-4	0|0	0.0|0.0	2|2	0.0055248618784530384|0.0055248618784530384	0|0	0.0|0.0	0|0	0.0|0.0	A|A	8.760|8.760	0.923377|0.923377	0.18056|0.18056	4.54E-4|4.54E-4	0.003605|0.003605	ENSG00000117009|ENSG00000117009	ENST00000366555|ENST00000366559;ENST00000366558;ENST00000366557	.|T;T;T	.|0.46819	.|0.86;0.86;0.89	5.29|5.29	0.358|0.358	0.16084|0.16084	.|.	.|1.291470	.|0.04766	.|N	.|0.427200	T|T	0.13841|0.13841	0.0335|0.0335	N|N	0.02011|0.02011	-0.69|-0.69	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.08534|0.08534	-1.0717|-1.0717	5|10	.|0.28530	.|T	.|0.3	.|.	1.5986|1.5986	0.02669|0.02669	0.3891:0.2759:0.0789:0.2561|0.3891:0.2759:0.0789:0.2561	rs55662927|rs55662927	.|474	.|O15229	.|KMO_HUMAN	H|M	159|474;461;440	.|ENSP00000355517:V474M;ENSP00000355516:V461M;ENSP00000355515:V440M	.|ENSP00000355515:V440M	R|V	+|+	2|1	0|0	KMO|KMO	239822037|239822037	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.015000|0.015000	0.08874|0.08874	-0.164000|-0.164000	0.09983|0.09983	-0.351000|-0.351000	0.08249|0.08249	-0.269000|-0.269000	0.10298|0.10298	CGT|GTG	G|0.998;A|0.002	0.002	strong		0.428	OPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095713.1	NM_014322	
APOB	338	hgsc.bcm.edu	37	2	21232804	21232804	+	Silent	SNP	G	G	A	rs386643884|rs1041968	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:21232804G>A	ENST00000233242.1	-	26	7063	c.6936C>T	c.(6934-6936)gaC>gaT	p.D2312D		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2312					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTCAAGAATGTCATTTATTC	0.348													G|||	1248	0.249201	0.2095	0.3775	5008	,	,		20035	0.0615		0.4423	False		,,,				2504	0.2065				p.D2312D		Atlas-SNP	.											APOB,NS,malignant_melanoma,-2,1	APOB	761	1	0			c.C6936T						scavenged	.	G		1032,3374		139,754,1310	116.0	119.0	118.0		6936	-2.2	0.0	2	dbSNP_86	118	4118,4482		1092,1934,1274	no	coding-synonymous	APOB	NM_000384.2		1231,2688,2584	AA,AG,GG		47.8837,23.4226,39.5971		2312/4564	21232804	5150,7856	2203	4300	6503	SO:0001819	synonymous_variant	338	exon26			AAGAATGTCATTT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6936C>T	2.37:g.21232804G>A		Somatic	151	1	0.00662252		WXS	Illumina HiSeq	Phase_I	170	14	0.0823529	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																			G|0.640;A|0.360	0.360	strong		0.348	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
GOLGA6A	342096	hgsc.bcm.edu	37	15	74363379	74363379	+	Splice_Site	SNP	C	C	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:74363379C>A	ENST00000290438.3	-	18	1995		c.e18-1		RN7SL429P_ENST00000479090.2_RNA	NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A							Golgi apparatus (GO:0005794)		p.?(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						TCATAAAAAACTTCGGAGAGA	0.627																																					.		Atlas-SNP	.											GOLGA6A,NS,lymphoid_neoplasm,0,2	GOLGA6A	28	2	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.1955-1G>T						scavenged	.						44.0	51.0	48.0					15																	74363379		2141	4213	6354	SO:0001630	splice_region_variant	342096	exon19			AAAAAACTTCGGA	AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.1955-1G>T	15.37:g.74363379C>A		Somatic	1210	2	0.00165289		WXS	Illumina HiSeq	Phase_I	927	10	0.0107875	NM_001038640	A8K959|Q9NYA7	Splice_Site	SNP	ENST00000290438.3	37	CCDS32290.1	.	.	.	.	.	.	.	.	.	.	C	3.341	-0.134555	0.06711	.	.	ENSG00000159289	ENST00000290438	.	.	.	1.55	1.55	0.23275	.	.	.	.	.	.	.	.	.	.	.	0.26291	N	0.978129	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.6073	0.22731	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GOLGA6A	72150432	0.761000	0.28439	0.005000	0.12908	0.016000	0.09150	3.955000	0.56715	1.182000	0.42928	0.162000	0.16502	.	.	.	none		0.627	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421835.1	XM_292357	Intron
ACADL	33	hgsc.bcm.edu	37	2	211060050	211060050	+	Missense_Mutation	SNP	T	T	G	rs2286963	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:211060050T>G	ENST00000233710.3	-	9	1224	c.997A>C	c.(997-999)Aaa>Caa	p.K333Q	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	333			K -> Q (in dbSNP:rs2286963). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.7}.		carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		TCTGCTAATTTATGTTGCACT	0.353													T|||	1057	0.211062	0.0893	0.2248	5008	,	,		18082	0.1865		0.3131	False		,,,				2504	0.2863				p.K333Q		Atlas-SNP	.											.	ACADL	38	.	0			c.A997C						PASS	.	T	GLN/LYS	661,3745	280.5+/-275.4	53,555,1595	90.0	86.0	88.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	997	5.8	1.0	2	dbSNP_100	88	2936,5664	456.2+/-364.0	488,1960,1852	yes	missense	ACADL	NM_001608.3	53	541,2515,3447	GG,GT,TT	http://www.ncbi.nlm.nih.gov/pubmed?term	34.1395,15.0023,27.6565	probably-damaging	333/431	211060050	3597,9409	2203	4300	6503	SO:0001583	missense	33	exon9			CTAATTTATGTTG	M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.997A>C	2.37:g.211060050T>G	ENSP00000233710:p.Lys333Gln	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	101	5	0.049505	NM_001608	B2R8T3|Q8IUN8	Missense_Mutation	SNP	ENST00000233710.3	37	CCDS2389.1	500	0.22893772893772893	55	0.11178861788617886	100	0.27624309392265195	105	0.18356643356643357	240	0.316622691292876	T	18.22	3.576473	0.65878	0.150023	0.341395	ENSG00000115361	ENST00000233710	D	0.96232	-3.95	5.77	5.77	0.91146	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.041576	0.85682	D	0.000000	T	0.00039	0.0001	L	0.57130	1.785	0.09310	P	0.99999853838	D	0.56968	0.978	P	0.58577	0.841	T	0.00000	-1.5769	9	0.31617	T	0.26	.	16.1475	0.81580	0.0:0.0:0.0:1.0	rs2286963;rs17769161;rs56601090;rs59503505;rs2286963	333	P28330	ACADL_HUMAN	Q	333	ENSP00000233710:K333Q	ENSP00000233710:K333Q	K	-	1	0	ACADL	210768295	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	6.842000	0.75379	2.213000	0.71641	0.529000	0.55759	AAA	G|0.250;N|0.000	0.250	strong		0.353	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256561.2	NM_001608	
RGL4	266747	hgsc.bcm.edu	37	22	24038847	24038847	+	Missense_Mutation	SNP	T	T	C	rs1007298	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr22:24038847T>C	ENST00000290691.5	+	7	2303	c.1133T>C	c.(1132-1134)gTc>gCc	p.V378A	KB-1572G7.2_ENST00000421064.1_RNA|RGL4_ENST00000401461.1_Missense_Mutation_p.V242A	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4	378	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.		V -> A (in dbSNP:rs1007298). {ECO:0000269|PubMed:15489334}.		small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						CCCCAGAGAGTCCAGATGAGG	0.652													c|||	3849	0.76857	0.9228	0.7594	5008	,	,		15783	0.6964		0.6799	False		,,,				2504	0.7321				p.V378A		Atlas-SNP	.											RGL4,brain,glioma,0,1	RGL4	29	1	0			c.T1133C						scavenged	.	C	ALA/VAL	3925,481		1749,427,27	42.0	42.0	42.0		1133	-0.4	0.0	22	dbSNP_86	42	5944,2654		2048,1848,403	yes	missense	RGL4	NM_153615.1	64	3797,2275,430	CC,CT,TT		30.8676,10.9169,24.108	benign	378/474	24038847	9869,3135	2203	4299	6502	SO:0001583	missense	266747	exon7			AGAGAGTCCAGAT		CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.1133T>C	22.37:g.24038847T>C	ENSP00000290691:p.Val378Ala	Somatic	210	0	0		WXS	Illumina HiSeq	Phase_I	156	6	0.0384615	NM_153615	Q495L8	Missense_Mutation	SNP	ENST00000290691.5	37	CCDS13811.1	1648	0.7545787545787546	462	0.9390243902439024	261	0.7209944751381215	397	0.6940559440559441	528	0.6965699208443272	N	0.638	-0.814429	0.02798	0.890831	0.691324	ENSG00000159496	ENST00000401461;ENST00000290691;ENST00000382833;ENST00000423392	T;T;T	0.28895	1.59;1.59;1.59	2.02	-0.409	0.12378	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.779762	0.11007	N	0.609879	T	0.00012	0.0000	N	0.00116	-2.08	0.58432	P	4.000000000004E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.30592	-0.9973	9	0.02654	T	1	.	3.1695	0.06548	0.2063:0.5062:0.0:0.2875	rs1007298;rs52825200;rs58567223;rs1007298	242;378;378	E7EW79;E9PH87;Q8IZJ4	.;.;RGDSR_HUMAN	A	242;378;378;378	ENSP00000383951:V242A;ENSP00000290691:V378A;ENSP00000402142:V378A	ENSP00000290691:V378A	V	+	2	0	RGL4	22368847	0.976000	0.34144	0.027000	0.17364	0.385000	0.30292	0.711000	0.25764	-0.372000	0.07992	-0.246000	0.11932	GTC	T|0.235;C|0.765	0.765	strong		0.652	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319711.1	NM_153615	
MVK	4598	hgsc.bcm.edu	37	12	110019233	110019233	+	Silent	SNP	G	G	A	rs34368092|rs104895310	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:110019233G>A	ENST00000228510.3	+	5	481	c.405G>A	c.(403-405)tcG>tcA	p.S135S	MVK_ENST00000539696.1_Intron|MVK_ENST00000541384.1_Intron|MVK_ENST00000539575.1_Intron|MVK_ENST00000535044.1_Intron|MVK_ENST00000392727.3_Intron	NM_000431.2|NM_001114185.1	NP_000422.1|NP_001107657.1	Q03426	KIME_HUMAN	mevalonate kinase	135			S -> L (in HIDS). {ECO:0000269|PubMed:11313768}.		cholesterol biosynthetic process (GO:0006695)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|isoprenoid biosynthetic process (GO:0008299)|negative regulation of inflammatory response (GO:0050728)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|mevalonate kinase activity (GO:0004496)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8						TAGTGTGGTCGGAGCTGCCCC	0.662													G|||	161	0.0321486	0.0499	0.0389	5008	,	,		17071	0.0		0.0616	False		,,,				2504	0.0061				p.S135S		Atlas-SNP	.											MVK,colon,carcinoma,+1,1	MVK	42	1	0			c.G405A						PASS	.	G	,	164,4242	109.1+/-147.4	1,162,2040	68.0	69.0	68.0		405,405	-10.3	0.1	12	dbSNP_126	68	506,8094	144.2+/-200.1	18,470,3812	no	coding-synonymous,coding-synonymous	MVK	NM_000431.2,NM_001114185.1	,	19,632,5852	AA,AG,GG		5.8837,3.7222,5.1515	,	135/397,135/397	110019233	670,12336	2203	4300	6503	SO:0001819	synonymous_variant	4598	exon5			GTGGTCGGAGCTG	M88468	CCDS9132.1, CCDS73522.1	12q24	2014-09-17	2008-01-30		ENSG00000110921	ENSG00000110921	2.7.1.36		7530	protein-coding gene	gene with protein product	"""LH receptor mRNA-binding protein"", ""mevalonic aciduria"""	251170	"""mevalonate kinase (mevalonic aciduria)"""			1377680	Standard	XM_005253883		Approved	LRBP, MK	uc001toy.4	Q03426	OTTHUMG00000169256	ENST00000228510.3:c.405G>A	12.37:g.110019233G>A		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	75	6	0.08	NM_000431		Silent	SNP	ENST00000228510.3	37	CCDS9132.1																																																																																			G|0.950;A|0.050	0.050	strong		0.662	MVK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403143.1	NM_000431	
CTAGE5	4253	hgsc.bcm.edu	37	14	39818145	39818145	+	Missense_Mutation	SNP	G	G	A	rs1060878	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:39818145G>A	ENST00000280083.3	+	23	2526	c.2212G>A	c.(2212-2214)Ggg>Agg	p.G738R	CTAGE5_ENST00000348007.3_Missense_Mutation_p.G695R|CTAGE5_ENST00000556148.1_Missense_Mutation_p.G663R|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.G1273R|CTAGE5_ENST00000341749.3_Missense_Mutation_p.G726R|CTAGE5_ENST00000396158.2_Missense_Mutation_p.G743R|RP11-407N17.3_ENST00000603904.1_Missense_Mutation_p.G709R|CTAGE5_ENST00000553383.1_3'UTR|CTAGE5_ENST00000553352.1_Missense_Mutation_p.G709R|CTAGE5_ENST00000341502.5_Missense_Mutation_p.G738R|CTAGE5_ENST00000557038.1_Missense_Mutation_p.G658R|CTAGE5_ENST00000396165.4_Missense_Mutation_p.G709R			O15320	CTGE5_HUMAN	CTAGE family, member 5	738	Pro-rich.		G -> R (in dbSNP:rs1060878). {ECO:0000269|PubMed:12839582, ECO:0000269|PubMed:17974005, ECO:0000269|PubMed:9356211}.		positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TTTTCCACCAGGGGATTTCCC	0.438													A|||	1556	0.310703	0.2973	0.2839	5008	,	,		17576	0.1587		0.3837	False		,,,				2504	0.4294				p.G743R		Atlas-SNP	.											.	CTAGE5	75	.	0			c.G2227A						PASS	.	A	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	1388,3016		214,960,1028	69.0	75.0	73.0		2212,2176,2083,2125	3.8	1.0	14	dbSNP_86	73	3173,5425		612,1949,1738	yes	missense,missense,missense,missense	CTAGE5	NM_005930.3,NM_203354.2,NM_203355.2,NM_203356.2	125,125,125,125	826,2909,2766	AA,AG,GG		36.9039,31.5168,35.0792	benign,benign,benign,benign	738/805,726/793,695/762,709/776	39818145	4561,8441	2202	4299	6501	SO:0001583	missense	4253	exon23			CCACCAGGGGATT	U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.2212G>A	14.37:g.39818145G>A	ENSP00000280083:p.Gly738Arg	Somatic	235	0	0		WXS	Illumina HiSeq	Phase_I	219	14	0.0639269	NM_001247989	B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Missense_Mutation	SNP	ENST00000280083.3	37	CCDS9674.1	642	0.29395604395604397	156	0.3170731707317073	101	0.27900552486187846	95	0.1660839160839161	290	0.38258575197889183	A	0.424	-0.907019	0.02434	0.315168	0.369039	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000341749;ENST00000557038;ENST00000396165;ENST00000341502;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000348007;ENST00000553352	T;T;T;T;T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;1.91;1.91;1.91;1.91;1.91	4.95	3.81	0.43845	.	0.000000	0.36444	N	0.002599	T	0.00012	0.0000	N	0.00034	-2.56	0.58432	P	2.9999999999752447E-6	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.41805	-0.9488	8	.	.	.	.	4.5122	0.11917	0.6562:0.1657:0.1781:0.0	rs1060878;rs1804861;rs3201810;rs57745043	743;695;738;666;726	O15320-5;O15320-2;O15320;O15320-7;G3XAC5	.;.;CTGE5_HUMAN;.;.	R	1273;726;658;709;738;743;738;663;695;709	ENSP00000452252:G1273R;ENSP00000343897:G726R;ENSP00000450869:G658R;ENSP00000379468:G709R;ENSP00000339286:G738R;ENSP00000379462:G743R;ENSP00000280083:G738R;ENSP00000452562:G663R;ENSP00000343912:G695R;ENSP00000450449:G709R	.	G	+	1	0	CTAGE5;RP11-407N17.3	38887896	1.000000	0.71417	0.998000	0.56505	0.671000	0.39405	1.555000	0.36277	0.329000	0.23460	-0.254000	0.11334	GGG	G|0.654;A|0.346	0.346	strong		0.438	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276771.2	NM_005930	
CACNA2D1	781	hgsc.bcm.edu	37	7	81601100	81601100	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:81601100T>C	ENST00000356253.5	-	26	2425	c.2170A>G	c.(2170-2172)Aaa>Gaa	p.K724E	CACNA2D1_ENST00000535308.1_5'Flank|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.K712E			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	724					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TACATATTTTTCTGCTTACTC	0.303																																					p.K712E		Atlas-SNP	.											.	CACNA2D1	191	.	0			c.A2134G						PASS	.						58.0	61.0	60.0					7																	81601100		2202	4293	6495	SO:0001583	missense	781	exon26			TATTTTTCTGCTT	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2170A>G	7.37:g.81601100T>C	ENSP00000348589:p.Lys724Glu	Somatic	259	0	0		WXS	Illumina HiSeq	Phase_I	330	70	0.212121	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	T	2.518	-0.311456	0.05422	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	T;T	0.71698	-0.59;-0.59	4.69	4.69	0.59074	.	0.258919	0.39407	N	0.001374	T	0.45498	0.1345	N	0.19112	0.55	0.80722	D	1	B	0.10296	0.003	B	0.11329	0.006	T	0.40924	-0.9537	10	0.02654	T	1	-19.5396	4.1471	0.10220	0.1938:0.0948:0.0:0.7114	.	712	P54289-2	.	E	712;731;724	ENSP00000349320:K712E;ENSP00000348589:K724E	ENSP00000284088:K731E	K	-	1	0	CACNA2D1	81439036	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.983000	0.29552	1.953000	0.56701	0.477000	0.44152	AAA	.	.	none		0.303	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
SIGLEC12	89858	hgsc.bcm.edu	37	19	52000624	52000624	+	Missense_Mutation	SNP	T	T	G	rs3752135	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:52000624T>G	ENST00000291707.3	-	6	1536	c.1481A>C	c.(1480-1482)tAc>tCc	p.Y494S	SIGLEC12_ENST00000598614.1_Missense_Mutation_p.Y376S	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	494			Y -> S (in dbSNP:rs3752135).		cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GATGCAGAAGTACAGGAAGAC	0.557													N|||	4165	0.831669	0.9735	0.9063	5008	,	,		17451	0.5367		0.8588	False		,,,				2504	0.863				p.Y494S		Atlas-SNP	.											SIGLEC12,rectum,carcinoma,-1,1	SIGLEC12	243	1	0			c.A1481C						scavenged	.	G	SER/TYR,SER/TYR	4175,231		1980,215,8	164.0	143.0	150.0		1127,1481	-1.1	0.0	19	dbSNP_107	150	7376,1224		3164,1048,88	yes	missense,missense	SIGLEC12	NM_033329.1,NM_053003.2	144,144	5144,1263,96	GG,GT,TT		14.2326,5.2429,11.1871	benign,benign	376/478,494/596	52000624	11551,1455	2203	4300	6503	SO:0001583	missense	89858	exon6			CAGAAGTACAGGA	AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1481A>C	19.37:g.52000624T>G	ENSP00000291707:p.Tyr494Ser	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	109	4	0.0366972	NM_053003	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	1773	0.8118131868131868	478	0.9715447154471545	329	0.9088397790055248	318	0.5559440559440559	648	0.8548812664907651	.	1.409	-0.576156	0.03882	0.947571	0.857674	ENSG00000254521	ENST00000291707	T	0.35789	1.29	1.5	-1.13	0.09775	.	1.213390	0.06410	N	0.720387	T	0.00012	0.0000	N	0.00082	-2.215	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41106	-0.9527	9	0.06494	T	0.89	.	0.6347	0.00800	0.1757:0.2385:0.3442:0.2417	rs3752135;rs3752135	494;376	Q96PQ1;Q96PQ1-2	SIG12_HUMAN;.	S	494	ENSP00000291707:Y494S	ENSP00000291707:Y494S	Y	-	2	0	SIGLEC12	56692436	0.000000	0.05858	0.000000	0.03702	0.184000	0.23303	-1.244000	0.02902	-0.635000	0.05531	-0.527000	0.04329	TAC	T|0.148;G|0.852	0.852	strong		0.557	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
GBA	2629	hgsc.bcm.edu	37	1	155207245	155207245	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:155207245G>A	ENST00000327247.5	-	8	1118	c.886C>T	c.(886-888)Cga>Tga	p.R296*	AL713999.1_ENST00000401290.1_RNA|GBA_ENST00000493842.1_5'Flank|GBA_ENST00000427500.3_Nonsense_Mutation_p.R247*|GBA_ENST00000368373.3_Nonsense_Mutation_p.R296*|GBA_ENST00000428024.3_Nonsense_Mutation_p.R209*|GBA_ENST00000536770.1_Nonsense_Mutation_p.R183*	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	296			R -> Q (in GD; type 2; also found in a patient with Parkinson disease). {ECO:0000269|PubMed:10796875, ECO:0000269|PubMed:19286695, ECO:0000269|PubMed:8790604}.		carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	ATGAAGTCTCGCTGATGTTCA	0.557									Gaucher disease type I																												p.R296X		Atlas-SNP	.											GBA,NS,carcinoma,+1,1	GBA	46	1	0			c.C886T	GRCh37	CM980835	GBA	M		PASS	.						94.0	77.0	83.0					1																	155207245		2203	4300	6503	SO:0001587	stop_gained	2629	exon8	Familial Cancer Database	glucocerebrosidase insufficiency	AGTCTCGCTGATG	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.886C>T	1.37:g.155207245G>A	ENSP00000314508:p.Arg296*	Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	160	49	0.30625	NM_001005742	A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Nonsense_Mutation	SNP	ENST00000327247.5	37	CCDS1102.1	.	.	.	.	.	.	.	.	.	.	.	16.64	3.180530	0.57800	.	.	ENSG00000177628	ENST00000427500;ENST00000428024;ENST00000368373;ENST00000327247;ENST00000536770;ENST00000536555;ENST00000402928	.	.	.	3.51	1.41	0.22369	.	0.000000	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.3734	8.0076	0.30334	0.0:0.0:0.5612:0.4388	.	.	.	.	X	247;209;296;296;183;253;281	.	ENSP00000314508:R296X	R	-	1	2	GBA	153473869	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	2.133000	0.42093	0.216000	0.20781	0.313000	0.20887	CGA	.	.	none		0.557	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087204.1	NM_000157	
TGM4	7047	hgsc.bcm.edu	37	3	44943104	44943104	+	Missense_Mutation	SNP	G	G	C	rs937838	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:44943104G>C	ENST00000296125.4	+	7	814	c.746G>C	c.(745-747)aGt>aCt	p.S249T	RP11-272D20.2_ENST00000427258.1_RNA	NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	249			S -> T (in dbSNP:rs937838).		mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.S249T(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	TGGACAGGCAGTGCCCCGATC	0.567													G|||	352	0.0702875	0.0552	0.1225	5008	,	,		20649	0.0268		0.0855	False		,,,				2504	0.0828				p.S249T		Atlas-SNP	.											TGM4,NS,carcinoma,0,1	TGM4	82	1	1	Substitution - Missense(1)	stomach(1)	c.G746C						scavenged	.	G	THR/SER	263,4143	149.2+/-183.4	10,243,1950	119.0	108.0	112.0		746	2.8	0.0	3	dbSNP_86	112	781,7819	183.5+/-231.7	33,715,3552	yes	missense	TGM4	NM_003241.3	58	43,958,5502	CC,CG,GG		9.0814,5.9691,8.0271	probably-damaging	249/685	44943104	1044,11962	2203	4300	6503	SO:0001583	missense	7047	exon7			CAGGCAGTGCCCC	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.746G>C	3.37:g.44943104G>C	ENSP00000296125:p.Ser249Thr	Somatic	181	0	0		WXS	Illumina HiSeq	Phase_I	120	4	0.0333333	NM_003241	Q16707|Q96QN4	Missense_Mutation	SNP	ENST00000296125.4	37	CCDS2723.1	149	0.06822344322344322	26	0.052845528455284556	43	0.11878453038674033	14	0.024475524475524476	66	0.0870712401055409	G	19.07	3.755813	0.69648	0.059691	0.090814	ENSG00000163810	ENST00000296125	T	0.57907	0.37	2.84	2.84	0.33178	.	0.000000	0.52532	U	0.000062	T	0.03651	0.0104	M	0.89904	3.07	0.20307	P	0.9999149955	D	0.76494	0.999	D	0.91635	0.999	T	0.61212	-0.7108	9	0.87932	D	0	.	14.4392	0.67303	0.0:0.0:1.0:0.0	rs937838;rs52797165;rs937838	249	P49221	TGM4_HUMAN	T	249	ENSP00000296125:S249T	ENSP00000296125:S249T	S	+	2	0	TGM4	44918108	1.000000	0.71417	0.002000	0.10522	0.015000	0.08874	8.226000	0.89785	1.523000	0.49018	0.563000	0.77884	AGT	G|0.924;C|0.076	0.076	strong		0.567	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241	
PDILT	204474	hgsc.bcm.edu	37	16	20376755	20376755	+	Silent	SNP	T	T	C	rs8054266	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:20376755T>C	ENST00000302451.4	-	9	1472	c.1224A>G	c.(1222-1224)gtA>gtG	p.V408V		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	408	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						ACATCACAAATACGTCCTTTT	0.438													C|||	2361	0.471446	0.6331	0.4467	5008	,	,		20585	0.1925		0.5765	False		,,,				2504	0.4499				p.V408V		Atlas-SNP	.											.	PDILT	120	.	0			c.A1224G						PASS	.	C		2607,1799	530.1+/-372.8	775,1057,371	165.0	152.0	157.0		1224	-10.4	0.1	16	dbSNP_116	157	5214,3386	501.1+/-375.4	1603,2008,689	no	coding-synonymous	PDILT	NM_174924.1		2378,3065,1060	CC,CT,TT		39.3721,40.8307,39.8662		408/585	20376755	7821,5185	2203	4300	6503	SO:0001819	synonymous_variant	204474	exon9			CACAAATACGTCC		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.1224A>G	16.37:g.20376755T>C		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	111	5	0.045045	NM_174924	Q8IVQ5	Silent	SNP	ENST00000302451.4	37	CCDS10584.1																																																																																			T|0.448;C|0.552	0.552	strong		0.438	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924	
ADCYAP1R1	117	hgsc.bcm.edu	37	7	31132340	31132340	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:31132340G>C	ENST00000304166.4	+	13	1326	c.1037G>C	c.(1036-1038)aGc>aCc	p.S346T	ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.S346T|ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.S325T|ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.S346T	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	346					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						AATGAGTCCAGCATCTACTTG	0.488																																					p.S346T	Ovarian(44;225 1186 2158 11092)	Atlas-SNP	.											.	ADCYAP1R1	78	.	0			c.G1037C						PASS	.						95.0	88.0	91.0					7																	31132340		2203	4300	6503	SO:0001583	missense	117	exon13			AGTCCAGCATCTA		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.1037G>C	7.37:g.31132340G>C	ENSP00000306620:p.Ser346Thr	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	40	27	0.675	NM_001118	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	ENST00000304166.4	37	CCDS5433.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.524258|4.524258	0.85600|0.85600	.|.	.|.	ENSG00000078549|ENSG00000078549	ENST00000436116|ENST00000304166;ENST00000381667;ENST00000409363;ENST00000396211;ENST00000409489	.|T;T;T;T	.|0.42900	.|1.13;1.23;0.96;1.15	5.72|5.72	5.72|5.72	0.89469|0.89469	.|GPCR, family 2-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.48572|0.48572	0.1507|0.1507	L|L	0.37561|0.37561	1.115|1.115	0.80722|0.80722	D|D	1|1	.|P;P;P;B;B	.|0.46395	.|0.78;0.624;0.877;0.205;0.425	.|P;B;P;B;B	.|0.52646	.|0.604;0.42;0.705;0.215;0.324	T|T	0.29971|0.29971	-0.9994|-0.9994	5|10	.|0.44086	.|T	.|0.13	.|.	17.7518|17.7518	0.88436|0.88436	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|346;346;346;325;346	.|B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586	.|.;.;.;.;PACR_HUMAN	H|T	62|346;117;325;346;346	.|ENSP00000306620:S346T;ENSP00000387335:S325T;ENSP00000379514:S346T;ENSP00000386395:S346T	.|ENSP00000306620:S346T	Q|S	+|+	3|2	2|0	ADCYAP1R1|ADCYAP1R1	31098865|31098865	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.248000|9.248000	0.95456|0.95456	2.873000|2.873000	0.98535|0.98535	0.563000|0.563000	0.77884|0.77884	CAG|AGC	.	.	none		0.488	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118	
PIP5K1A	8394	hgsc.bcm.edu	37	1	151215011	151215011	+	Silent	SNP	A	A	G	rs61729862	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:151215011A>G	ENST00000368888.4	+	14	2030	c.1608A>G	c.(1606-1608)ctA>ctG	p.L536L	PIP5K1A_ENST00000409426.1_Silent_p.L524L|PIP5K1A_ENST00000441902.2_Silent_p.L496L|PIP5K1A_ENST00000368890.4_Silent_p.L474L|PIP5K1A_ENST00000414290.2_Intron	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	536					actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)	p.L523L(1)		breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			TCTCACCTCTAGTTGGAGAGA	0.453													A|||	188	0.0375399	0.0	0.1023	5008	,	,		19086	0.0863		0.0219	False		,,,				2504	0.0082				p.L536L	Pancreas(80;36 1443 2325 16095 21302)	Atlas-SNP	.											PIP5K1A,NS,carcinoma,0,1	PIP5K1A	61	1	1	Substitution - coding silent(1)	stomach(1)	c.A1608G						scavenged	.	A	,,,	26,4380	30.8+/-60.4	0,26,2177	96.0	96.0	96.0		1488,1422,1608,1569	3.2	1.0	1	dbSNP_129	96	188,8412	84.8+/-147.2	1,186,4113	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PIP5K1A	NM_001135636.1,NM_001135637.1,NM_001135638.1,NM_003557.2	,,,	1,212,6290	GG,GA,AA		2.186,0.5901,1.6454	,,,	496/523,474/501,536/563,523/550	151215011	214,12792	2203	4300	6503	SO:0001819	synonymous_variant	8394	exon14			ACCTCTAGTTGGA	U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.1608A>G	1.37:g.151215011A>G		Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	135	4	0.0296296	NM_001135638	A8K4Q0|B4DIN0|Q99754|Q99756	Silent	SNP	ENST00000368888.4	37	CCDS44219.1																																																																																			A|0.975;G|0.025	0.025	strong		0.453	PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034425.2	NM_003557	
CENPE	1062	hgsc.bcm.edu	37	4	104082349	104082349	+	Silent	SNP	C	C	T	rs2251634	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:104082349C>T	ENST00000265148.3	-	20	2114	c.2025G>A	c.(2023-2025)caG>caA	p.Q675Q	CENPE_ENST00000380026.3_Silent_p.Q650Q	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	675					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTGCCTCCAACTGGCTTTGAT	0.328													T|||	2254	0.45008	0.674	0.353	5008	,	,		15920	0.3006		0.4076	False		,,,				2504	0.4141				p.Q675Q		Atlas-SNP	.											.	CENPE	253	.	0			c.G2025A						PASS	.	T		2584,1820	528.4+/-372.4	753,1078,371	137.0	130.0	132.0		2025	-1.7	0.8	4	dbSNP_100	132	3376,5220	637.2+/-399.2	685,2006,1607	no	coding-synonymous	CENPE	NM_001813.2		1438,3084,1978	TT,TC,CC		39.2741,41.3261,45.8462		675/2702	104082349	5960,7040	2202	4298	6500	SO:0001819	synonymous_variant	1062	exon20			CTCCAACTGGCTT	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.2025G>A	4.37:g.104082349C>T		Somatic	185	0	0		WXS	Illumina HiSeq	Phase_I	220	10	0.0454545	NM_001813	A6NKY9|A8K2U7|Q4LE75	Silent	SNP	ENST00000265148.3	37	CCDS34042.1																																																																																			T|0.446;G|0.001	0.446	strong		0.328	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
GRAMD1A	57655	hgsc.bcm.edu	37	19	35510102	35510102	+	Silent	SNP	G	G	C	rs2290646	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:35510102G>C	ENST00000317991.5	+	12	1413	c.1221G>C	c.(1219-1221)acG>acC	p.T407T	GRAMD1A_ENST00000411896.2_Silent_p.T400T|GRAMD1A_ENST00000504615.2_Silent_p.T173T|GRAMD1A_ENST00000599564.1_Silent_p.T494T|CTD-2527I21.14_ENST00000605640.1_RNA	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	407						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			TAGACGTGACGCTGAGCCCCT	0.657													C|||	1867	0.372804	0.5484	0.3862	5008	,	,		14555	0.2212		0.3777	False		,,,				2504	0.2771				p.T407T		Atlas-SNP	.											.	GRAMD1A	39	.	0			c.G1221C						PASS	.	C	,	2206,2094		585,1036,529	50.0	59.0	56.0		1200,1221	2.4	1.0	19	dbSNP_100	56	3158,5364		585,1988,1688	no	coding-synonymous,coding-synonymous	GRAMD1A	NM_001136199.1,NM_020895.3	,	1170,3024,2217	CC,CG,GG		37.057,48.6977,41.8343	,	400/714,407/725	35510102	5364,7458	2150	4261	6411	SO:0001819	synonymous_variant	57655	exon12			CGTGACGCTGAGC	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.1221G>C	19.37:g.35510102G>C		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	83	4	0.0481928	NM_020895	A6NKY7|Q8NC77|Q9P1Z5	Silent	SNP	ENST00000317991.5	37	CCDS42546.1																																																																																			G|0.623;C|0.377	0.377	strong		0.657	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
LRRN1	57633	hgsc.bcm.edu	37	3	3887876	3887876	+	Silent	SNP	T	T	C	rs2120609	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:3887876T>C	ENST00000319331.3	+	2	2312	c.1551T>C	c.(1549-1551)aaT>aaC	p.N517N	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	517						integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		TTAAGGTTAATGGGACCCTTC	0.428													T|||	2396	0.478435	0.4274	0.572	5008	,	,		20997	0.254		0.7336	False		,,,				2504	0.4499				p.N517N		Atlas-SNP	.											.	LRRN1	82	.	0			c.T1551C						PASS	.	T		2009,2397	558.7+/-380.1	446,1117,640	79.0	80.0	80.0		1551	-1.2	1.0	3	dbSNP_96	80	6199,2401	697.4+/-404.9	2248,1703,349	no	coding-synonymous	LRRN1	NM_020873.5		2694,2820,989	CC,CT,TT		27.9186,45.5969,36.8907		517/717	3887876	8208,4798	2203	4300	6503	SO:0001819	synonymous_variant	57633	exon2			GGTTAATGGGACC	AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.1551T>C	3.37:g.3887876T>C		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	67	5	0.0746269	NM_020873	Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Silent	SNP	ENST00000319331.3	37	CCDS33685.1																																																																																			T|0.432;C|0.568	0.568	strong		0.428	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337704.2	NM_020873	
C22orf42	150297	hgsc.bcm.edu	37	22	32547000	32547000	+	Missense_Mutation	SNP	A	A	G	rs201521774		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr22:32547000A>G	ENST00000382097.3	-	6	544	c.472T>C	c.(472-474)Tct>Cct	p.S158P	C22orf42_ENST00000490640.1_5'Flank	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	158										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						TTGGCCTCAGATATTTCCTGC	0.378																																					p.S158P		Atlas-SNP	.											C22orf42,NS,carcinoma,0,1	C22orf42	37	1	0			c.T472C						scavenged	.																																			SO:0001583	missense	150297	exon6			CCTCAGATATTTC	BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.472T>C	22.37:g.32547000A>G	ENSP00000371529:p.Ser158Pro	Somatic	434	3	0.00691244		WXS	Illumina HiSeq	Phase_I	398	4	0.0100503	NM_001010859	A4QPH5	Missense_Mutation	SNP	ENST00000382097.3	37	CCDS33639.1	.	.	.	.	.	.	.	.	.	.	A	0.077	-1.190135	0.01607	.	.	ENSG00000205856	ENST00000382097	T	0.27890	1.64	0.859	-1.72	0.08107	.	.	.	.	.	T	0.16471	0.0396	N	0.08118	0	0.09310	N	1	P	0.42518	0.782	P	0.46110	0.504	T	0.12426	-1.0548	9	0.87932	D	0	.	2.195	0.03908	0.4211:0.3195:0.2594:0.0	.	158	Q6IC83	CV042_HUMAN	P	158	ENSP00000371529:S158P	ENSP00000371529:S158P	S	-	1	0	C22orf42	30877000	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.238000	0.18004	-1.072000	0.03141	-0.622000	0.04023	TCT	.	.	weak		0.378	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075268.2	NM_001010859	
TAS2R1	50834	hgsc.bcm.edu	37	5	9629529	9629529	+	Missense_Mutation	SNP	G	G	A	rs2234233	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:9629529G>A	ENST00000382492.2	-	1	934	c.616C>T	c.(616-618)Cgg>Tgg	p.R206W	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	206			R -> W (in dbSNP:rs2234233).		chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.R206W(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						CTCATTTGCCGGGTGTGCCTC	0.507													G|||	572	0.114217	0.028	0.1268	5008	,	,		17670	0.1071		0.1521	False		,,,				2504	0.1902				p.R206W		Atlas-SNP	.											TAS2R1,NS,carcinoma,0,1	TAS2R1	84	1	1	Substitution - Missense(1)	stomach(1)	c.C616T						scavenged	.	G	TRP/ARG	216,4190	121.3+/-158.8	8,200,1995	47.0	55.0	53.0		616	-11.3	0.0	5	dbSNP_98	53	1422,7178	266.3+/-286.6	113,1196,2991	yes	missense	TAS2R1	NM_019599.2	101	121,1396,4986	AA,AG,GG		16.5349,4.9024,12.5942	benign	206/300	9629529	1638,11368	2203	4300	6503	SO:0001583	missense	50834	exon1			TTTGCCGGGTGTG	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.616C>T	5.37:g.9629529G>A	ENSP00000371932:p.Arg206Trp	Somatic	90	1	0.0111111		WXS	Illumina HiSeq	Phase_I	110	3	0.0272727	NM_019599	Q646G8	Missense_Mutation	SNP	ENST00000382492.2	37	CCDS3876.1	255	0.11675824175824176	15	0.03048780487804878	48	0.13259668508287292	75	0.13111888111888112	117	0.15435356200527706	G	11.62	1.692461	0.30052	0.049024	0.165349	ENSG00000169777	ENST00000382492	T	0.00986	5.47	5.65	-11.3	0.00108	.	1.250620	0.06042	N	0.655136	T	0.00012	0.0000	N	0.05574	-0.02	0.80722	P	0.0	B	0.09022	0.002	B	0.04013	0.001	T	0.48559	-0.9025	8	.	.	.	.	2.3549	0.04293	0.2929:0.0693:0.3959:0.242	rs2234233;rs52805045;rs60592533;rs2234233	206	Q9NYW7	TA2R1_HUMAN	W	206	ENSP00000371932:R206W	.	R	-	1	2	TAS2R1	9682529	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.202000	0.09451	-2.320000	0.00642	-0.880000	0.02959	CGG	G|0.878;A|0.122	0.122	strong		0.507	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2		
THRAP3	9967	hgsc.bcm.edu	37	1	36752152	36752152	+	Silent	SNP	C	C	T	rs2242428	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:36752152C>T	ENST00000354618.5	+	4	545	c.321C>T	c.(319-321)taC>taT	p.Y107Y	THRAP3_ENST00000469141.2_Silent_p.Y107Y	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	107	Arg-rich.|Required for mRNA splicing activation.|Ser-rich.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.Y107Y(1)		breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ATGGAAACTACCGCTCAAATT	0.522			T	USP6	aneurysmal bone cysts								C|||	1240	0.247604	0.1036	0.2219	5008	,	,		17948	0.0754		0.4205	False		,,,				2504	0.4601				p.Y107Y	Pancreas(129;785 1795 20938 23278 32581)	Atlas-SNP	.		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	THRAP3,NS,carcinoma,+1,2	THRAP3	93	2	1	Substitution - coding silent(1)	stomach(1)	c.C321T						scavenged	.	C		615,3791	268.3+/-268.4	54,507,1642	116.0	117.0	116.0		321	3.9	1.0	1	dbSNP_98	116	3300,5300	493.9+/-373.7	624,2052,1624	no	coding-synonymous	THRAP3	NM_005119.3		678,2559,3266	TT,TC,CC		38.3721,13.9582,30.1015		107/956	36752152	3915,9091	2203	4300	6503	SO:0001819	synonymous_variant	9967	exon4			AAACTACCGCTCA	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.321C>T	1.37:g.36752152C>T		Somatic	167	1	0.00598802		WXS	Illumina HiSeq	Phase_I	135	5	0.037037	NM_005119	D3DPS5|Q5VTK6	Silent	SNP	ENST00000354618.5	37	CCDS405.1																																																																																			C|0.710;T|0.290	0.290	strong		0.522	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
PTCH2	8643	hgsc.bcm.edu	37	1	45292173	45292173	+	Missense_Mutation	SNP	G	G	A	rs11573590	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:45292173G>A	ENST00000372192.3	-	18	3093	c.2963C>T	c.(2962-2964)aCg>aTg	p.T988M	PTCH2_ENST00000447098.2_Missense_Mutation_p.T988M	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	988			T -> M (in dbSNP:rs11573590). {ECO:0000269|Ref.5}.		epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					GAGGCCAGCCGTCCAGGGGTT	0.637									Basal Cell Nevus syndrome				G|||	315	0.0628994	0.0015	0.0937	5008	,	,		19263	0.1677		0.0219	False		,,,				2504	0.0583				p.T988M		Atlas-SNP	.											PTCH2,NS,carcinoma,0,1	PTCH2	96	1	0			c.C2963T						PASS	.	G	MET/THR,MET/THR	31,4373	36.8+/-68.6	1,29,2172	35.0	35.0	35.0		2963,2963	0.3	0.4	1	dbSNP_120	35	178,8422	80.6+/-143.3	0,178,4122	yes	missense,missense	PTCH2	NM_001166292.1,NM_003738.4	81,81	1,207,6294	AA,AG,GG		2.0698,0.7039,1.6072	probably-damaging,probably-damaging	988/1147,988/1204	45292173	209,12795	2202	4300	6502	SO:0001583	missense	8643	exon18	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	CCAGCCGTCCAGG	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.2963C>T	1.37:g.45292173G>A	ENSP00000361266:p.Thr988Met	Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	107	6	0.0560748	NM_003738	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	37	CCDS516.1	126	0.057692307692307696	1	0.0020325203252032522	20	0.055248618784530384	84	0.14685314685314685	21	0.027704485488126648	G	14.13	2.444673	0.43429	0.007039	0.020698	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.86366	-2.11;-2.11	4.73	0.354	0.16063	.	0.122950	0.37577	N	0.002036	T	0.03390	0.0098	L	0.56199	1.76	0.28260	P	0.9248696	P;P	0.47106	0.843;0.89	B;P	0.55923	0.408;0.787	T	0.58640	-0.7601	9	0.66056	D	0.02	-28.2945	9.4813	0.38902	0.3114:0.0:0.6886:0.0	rs11573590;rs11573590	988;988	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	M	988	ENSP00000389703:T988M;ENSP00000361266:T988M	ENSP00000361266:T988M	T	-	2	0	PTCH2	45064760	1.000000	0.71417	0.364000	0.25888	0.984000	0.73092	3.651000	0.54431	-0.012000	0.14223	-0.137000	0.14449	ACG	G|0.962;A|0.038	0.038	strong		0.637	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	NM_003738	
TNPO2	30000	hgsc.bcm.edu	37	19	12822220	12822220	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:12822220C>A	ENST00000592287.1	-	11	1115	c.1007G>T	c.(1006-1008)cGc>cTc	p.R336L	TNPO2_ENST00000589956.1_5'UTR|TNPO2_ENST00000588216.1_Missense_Mutation_p.R336L|TNPO2_ENST00000441499.1_Missense_Mutation_p.R336L|TNPO2_ENST00000450764.2_Missense_Mutation_p.R336L|TNPO2_ENST00000425528.1_Missense_Mutation_p.R336L|TNPO2_ENST00000356861.5_Missense_Mutation_p.R336L	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	336					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)	p.R336H(2)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CTTGTGGAAGCGTGGCTTGAT	0.617																																					p.R336L		Atlas-SNP	.											TNPO2_ENST00000425528,NS,carcinoma,0,3	TNPO2	108	3	2	Substitution - Missense(2)	endometrium(2)	c.G1007T						scavenged	.						161.0	172.0	168.0					19																	12822220		2200	4290	6490	SO:0001583	missense	30000	exon11			TGGAAGCGTGGCT	AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.1007G>T	19.37:g.12822220C>A	ENSP00000468434:p.Arg336Leu	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	90	2	0.0222222	NM_013433	O14655|Q6IN77	Missense_Mutation	SNP	ENST00000592287.1	37	CCDS45991.1	.	.	.	.	.	.	.	.	.	.	C	34	5.327649	0.95733	.	.	ENSG00000105576	ENST00000536114;ENST00000425528;ENST00000441499;ENST00000450764;ENST00000356861;ENST00000420511;ENST00000546320	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	5.44	5.44	0.79542	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80401	0.4616	M	0.89534	3.04	0.80722	D	1	D;D	0.67145	0.996;0.975	P;P	0.56612	0.802;0.453	D	0.85015	0.0908	10	0.87932	D	0	-3.8122	18.0401	0.89316	0.0:1.0:0.0:0.0	.	500;336	Q4LE60;O14787	.;TNPO2_HUMAN	L	500;336;336;336;336;336;336	ENSP00000407182:R336L;ENSP00000389648:R336L;ENSP00000397379:R336L;ENSP00000349321:R336L	ENSP00000349321:R336L	R	-	2	0	TNPO2	12683220	1.000000	0.71417	0.991000	0.47740	0.916000	0.54674	7.487000	0.81328	2.556000	0.86216	0.561000	0.74099	CGC	.	.	none		0.617	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1	NM_013433	
ZNF584	201514	hgsc.bcm.edu	37	19	58928299	58928299	+	Silent	SNP	A	A	T	rs11668757	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:58928299A>T	ENST00000306910.4	+	4	937	c.414A>T	c.(412-414)gcA>gcT	p.A138A	ZNF584_ENST00000322834.7_3'UTR|CTD-2619J13.16_ENST00000596296.1_lincRNA|ZNF584_ENST00000593920.1_Silent_p.A93A|ZNF584_ENST00000599238.1_3'UTR|ZNF584_ENST00000596921.1_3'UTR	NM_173548.1	NP_775819.1	Q8IVC4	ZN584_HUMAN	zinc finger protein 584	138					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0271)		AGCATGGGGCAGCTTTCCCAC	0.517													A|||	647	0.129193	0.0401	0.1729	5008	,	,		18513	0.0546		0.2495	False		,,,				2504	0.1718				p.A138A		Atlas-SNP	.											.	ZNF584	31	.	0			c.A414T						PASS	.	A		268,4138	151.0+/-185.0	8,252,1943	148.0	112.0	124.0		414	0.7	0.0	19	dbSNP_120	124	1790,6810	322.9+/-315.8	186,1418,2696	no	coding-synonymous	ZNF584	NM_173548.1		194,1670,4639	TT,TA,AA		20.814,6.0826,15.8235		138/422	58928299	2058,10948	2203	4300	6503	SO:0001819	synonymous_variant	201514	exon4			TGGGGCAGCTTTC	AK097218	CCDS12979.1	19q13.43	2013-01-08			ENSG00000171574	ENSG00000171574		"""Zinc fingers, C2H2-type"", ""-"""	27318	protein-coding gene	gene with protein product							Standard	NM_173548		Approved	FLJ39899	uc002qsp.3	Q8IVC4		ENST00000306910.4:c.414A>T	19.37:g.58928299A>T		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	97	5	0.0515464	NM_173548	A8K203	Silent	SNP	ENST00000306910.4	37	CCDS12979.1																																																																																			A|0.846;T|0.154	0.154	strong		0.517	ZNF584-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467022.1	NM_173548	
BCL11B	64919	hgsc.bcm.edu	37	14	99642463	99642463	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:99642463A>G	ENST00000357195.3	-	4	719	c.710T>C	c.(709-711)cTg>cCg	p.L237P	BCL11B_ENST00000443726.2_Missense_Mutation_p.L43P|BCL11B_ENST00000345514.2_Missense_Mutation_p.L166P	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	237					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CGCGTGCTGCAGCAGGAACCA	0.637			T	TLX3	T-ALL																																p.L237P		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B	108	.	0			c.T710C						PASS	.						33.0	32.0	32.0					14																	99642463		2199	4298	6497	SO:0001583	missense	64919	exon4			TGCTGCAGCAGGA	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.710T>C	14.37:g.99642463A>G	ENSP00000349723:p.Leu237Pro	Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	43	14	0.325581	NM_138576	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	A	18.53	3.643442	0.67244	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.26223	1.81;1.75;1.8	4.68	4.68	0.58851	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.103621	0.38548	N	0.001653	T	0.48059	0.1479	M	0.64170	1.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.50303	-0.8844	10	0.66056	D	0.02	-12.3029	14.4247	0.67207	1.0:0.0:0.0:0.0	.	166;237	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	P	237;166;43	ENSP00000349723:L237P;ENSP00000280435:L166P;ENSP00000387419:L43P	ENSP00000280435:L166P	L	-	2	0	BCL11B	98712216	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.163000	0.94750	1.883000	0.54544	0.533000	0.62120	CTG	.	.	none		0.637	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
ABCA1	19	hgsc.bcm.edu	37	9	107620867	107620867	+	Missense_Mutation	SNP	C	C	T	rs2230806	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:107620867C>T	ENST00000374736.3	-	7	1050	c.656G>A	c.(655-657)aGg>aAg	p.R219K	ABCA1_ENST00000423487.2_Missense_Mutation_p.R219K	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	219			R -> K (common polymorphism; associated with a decreased severity of CAD; dbSNP:rs2230806). {ECO:0000269|PubMed:10938021, ECO:0000269|PubMed:11238261, ECO:0000269|PubMed:11257261, ECO:0000269|PubMed:11476965, ECO:0000269|PubMed:12624133, ECO:0000269|PubMed:12966036, ECO:0000269|PubMed:15520867}.		apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.R219K(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CAGTTTCTCCCTTGGTAGGCC	0.468													C|||	2202	0.439696	0.7103	0.3487	5008	,	,		19674	0.4147		0.2425	False		,,,				2504	0.3671				p.R219K		Atlas-SNP	.											ABCA1,NS,carcinoma,0,1	ABCA1	244	1	1	Substitution - Missense(1)	stomach(1)	c.G656A	GRCh37	CM030397	ABCA1	M	rs2230806	scavenged	.	C	LYS/ARG	2672,1734	648.2+/-398.7	820,1032,351	154.0	151.0	152.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	656	0.1	0.2	9	dbSNP_98	152	2420,6180	400.1+/-346.7	322,1776,2202	yes	missense	ABCA1	NM_005502.3	26	1142,2808,2553	TT,TC,CC		28.1395,39.3554,39.1512	benign	219/2262	107620867	5092,7914	2203	4300	6503	SO:0001583	missense	19	exon7			TTCTCCCTTGGTA	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.656G>A	9.37:g.107620867C>T	ENSP00000363868:p.Arg219Lys	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	117	3	0.025641	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	916	0.4194139194139194	356	0.7235772357723578	127	0.35082872928176795	250	0.4370629370629371	183	0.24142480211081793	C	7.792	0.711767	0.15306	0.606446	0.281395	ENSG00000165029	ENST00000374736;ENST00000423487	D;D	0.94931	-2.23;-3.56	6.17	0.0573	0.14322	.	0.632115	0.18950	N	0.126712	T	0.00012	0.0000	N	0.04880	-0.145	0.28835	P	0.896936	B	0.02656	0.0	B	0.01281	0.0	T	0.46119	-0.9214	9	0.16896	T	0.51	.	8.2419	0.31665	0.0:0.3764:0.0:0.6236	rs2230806;rs2234884;rs2853572;rs52801000;rs61696010;rs2230806	219	O95477	ABCA1_HUMAN	K	219	ENSP00000363868:R219K;ENSP00000416623:R219K	ENSP00000363868:R219K	R	-	2	0	ABCA1	106660688	0.825000	0.29262	0.227000	0.23927	0.534000	0.34807	0.318000	0.19504	0.083000	0.17047	0.655000	0.94253	AGG	C|0.587;T|0.413	0.413	strong		0.468	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
FOLH1	2346	hgsc.bcm.edu	37	11	49208267	49208267	+	Missense_Mutation	SNP	G	G	A	rs75940285	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:49208267G>A	ENST00000256999.2	-	5	828	c.568C>T	c.(568-570)Cgg>Tgg	p.R190W	FOLH1_ENST00000343844.4_De_novo_Start_InFrame|FOLH1_ENST00000533034.1_Missense_Mutation_p.R175W|FOLH1_ENST00000340334.7_Missense_Mutation_p.R175W|FOLH1_ENST00000356696.3_Missense_Mutation_p.R190W	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	190					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R190W(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TTCATGTCCCGTTCCAATTTA	0.348																																					p.R190W		Atlas-SNP	.											FOLH1,NS,carcinoma,+1,2	FOLH1	141	2	1	Substitution - Missense(1)	NS(1)	c.C568T						scavenged	.						80.0	84.0	82.0					11																	49208267		2201	4296	6497	SO:0001583	missense	2346	exon5			TGTCCCGTTCCAA	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.568C>T	11.37:g.49208267G>A	ENSP00000256999:p.Arg190Trp	Somatic	279	0	0		WXS	Illumina HiSeq	Phase_I	261	6	0.0229885	NM_004476	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889502	0.52014	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	3.05	0.979	0.19745	Protease-associated domain, PA (1);	0.000000	0.48286	D	0.000192	T	0.59985	0.2234	M	0.82056	2.57	0.80722	D	1	D;D;D;P	0.76494	0.999;0.998;0.987;0.941	D;P;P;B	0.70016	0.967;0.821;0.742;0.422	T	0.60250	-0.7300	10	0.87932	D	0	.	8.9034	0.35507	0.0:0.0:0.3751:0.6249	.	175;175;190;190	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	W	190;190;175;175;190	ENSP00000256999:R190W;ENSP00000349129:R190W;ENSP00000344131:R175W;ENSP00000431463:R175W	ENSP00000256999:R190W	R	-	1	2	FOLH1	49164843	0.953000	0.32496	0.991000	0.47740	0.964000	0.63967	1.623000	0.37008	0.120000	0.18254	0.430000	0.28490	CGG	G|0.877;A|0.123	0.123	strong		0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
SVIL	6840	hgsc.bcm.edu	37	10	29840164	29840164	+	Silent	SNP	A	A	G	rs3740002	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:29840164A>G	ENST00000355867.4	-	6	941	c.189T>C	c.(187-189)tcT>tcC	p.S63S	SVIL_ENST00000375398.2_Silent_p.S63S|SVIL_ENST00000375400.3_Silent_p.S63S	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	63	Interaction with MYLK. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				GAGAAGAATCAGAAGTTTCCT	0.453													A|||	1277	0.254992	0.2337	0.245	5008	,	,		21044	0.3462		0.2376	False		,,,				2504	0.2147				p.S63S		Atlas-SNP	.											.	SVIL	226	.	0			c.T189C						PASS	.	A	,	1160,3246	398.8+/-331.0	153,854,1196	55.0	46.0	49.0		189,189	-4.9	0.4	10	dbSNP_107	49	2233,6367	362.0+/-332.6	287,1659,2354	no	coding-synonymous,coding-synonymous	SVIL	NM_003174.3,NM_021738.2	,	440,2513,3550	GG,GA,AA		25.9651,26.3277,26.088	,	63/1789,63/2215	29840164	3393,9613	2203	4300	6503	SO:0001819	synonymous_variant	6840	exon8			AGAATCAGAAGTT	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.189T>C	10.37:g.29840164A>G		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	42	4	0.0952381	NM_003174	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	CCDS7164.1																																																																																			A|0.744;G|0.256	0.256	strong		0.453	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
SUPT16H	11198	hgsc.bcm.edu	37	14	21831419	21831419	+	Silent	SNP	C	C	T	rs61746713	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:21831419C>T	ENST00000216297.2	-	12	1706	c.1368G>A	c.(1366-1368)cgG>cgA	p.R456R		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	456					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		GTAATGCTGCCCGAGAACCTC	0.373													C|||	227	0.0453275	0.0076	0.0389	5008	,	,		18562	0.0		0.1203	False		,,,				2504	0.0706				p.R456R		Atlas-SNP	.											SUPT16H,NS,carcinoma,-1,1	SUPT16H	84	1	0			c.G1368A						scavenged	.	C		122,4284	88.2+/-126.9	4,114,2085	80.0	82.0	81.0		1368	-0.9	1.0	14	dbSNP_129	81	1025,7573	218.1+/-256.6	57,911,3331	no	coding-synonymous	SUPT16H	NM_007192.3		61,1025,5416	TT,TC,CC		11.9214,2.769,8.8204		456/1048	21831419	1147,11857	2203	4299	6502	SO:0001819	synonymous_variant	11198	exon12			TGCTGCCCGAGAA	AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.1368G>A	14.37:g.21831419C>T		Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	90	3	0.0333333	NM_007192	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Silent	SNP	ENST00000216297.2	37	CCDS9569.1																																																																																			C|0.925;T|0.075	0.075	strong		0.373	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074025.2		
SENP1	29843	hgsc.bcm.edu	37	12	48477422	48477422	+	Silent	SNP	A	A	G	rs886588	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:48477422A>G	ENST00000004980.5	-	6	982	c.504T>C	c.(502-504)ctT>ctC	p.L168L	SENP1_ENST00000547886.1_5'UTR|RNU6-1203P_ENST00000410703.1_RNA|SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000549518.1_Silent_p.L168L|SENP1_ENST00000549595.1_Silent_p.L168L|SENP1_ENST00000448372.1_Silent_p.L168L|SENP1_ENST00000551330.1_Silent_p.L168L			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	168	Ser-rich.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)	p.L168L(1)		large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				TGGGGCTCAAAAGACTTCGAC	0.408													A|||	803	0.160343	0.053	0.1744	5008	,	,		18083	0.2371		0.2177	False		,,,				2504	0.1575				p.L168L		Atlas-SNP	.											SENP1,NS,carcinoma,0,1	SENP1	44	1	1	Substitution - coding silent(1)	stomach(1)	c.T504C						scavenged	.	A		253,3463		11,231,1616	120.0	111.0	114.0		504	1.8	1.0	12	dbSNP_86	114	1803,6381		192,1419,2481	no	coding-synonymous	SENP1	NM_014554.2		203,1650,4097	GG,GA,AA		22.0308,6.8084,17.2773		168/644	48477422	2056,9844	1858	4092	5950	SO:0001819	synonymous_variant	29843	exon6			GCTCAAAAGACTT	AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.504T>C	12.37:g.48477422A>G		Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	142	3	0.0211268	NM_001267594	A8K7P5|Q86XC8	Silent	SNP	ENST00000004980.5	37	CCDS44868.2																																																																																			A|0.817;G|0.183	0.183	strong		0.408	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406471.1	NM_014554	
ZNF503	84858	hgsc.bcm.edu	37	10	77161102	77161102	+	Missense_Mutation	SNP	C	C	T	rs533859340|rs374168185	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:77161102C>T	ENST00000372524.4	-	1	562	c.76G>A	c.(76-78)Ggc>Agc	p.G26S	ZNF503-AS2_ENST00000425916.3_RNA|ZNF503_ENST00000535216.1_Missense_Mutation_p.G26S|ZNF503-AS2_ENST00000466942.2_RNA|RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503-AS2_ENST00000486015.1_RNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	26	Gly-rich.				G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					TCTGCAccgccgcctccgcct	0.711																																					p.G26S		Atlas-SNP	.											.	ZNF503	25	.	0			c.G76A						PASS	.						3.0	4.0	4.0					10																	77161102		1704	3476	5180	SO:0001583	missense	84858	exon1			CACCGCCGCCTCC	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.76G>A	10.37:g.77161102C>T	ENSP00000361602:p.Gly26Ser	Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	18	9	0.5	NM_032772	Q8NAC5|Q96E25|Q96IJ0	Missense_Mutation	SNP	ENST00000372524.4	37	CCDS7350.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.061|0.061	-1.224407|-1.224407	0.01530|0.01530	.|.	.|.	ENSG00000165655|ENSG00000233745	ENST00000372524;ENST00000535216;ENST00000372516|ENST00000438638	D;D|.	0.87334|.	-2.24;-2.24|.	1.32|1.32	-2.14|-2.14	0.07123|0.07123	.|.	1.267280|.	0.06383|.	N|.	0.715644|.	T|T	0.17023|0.17023	0.0409|0.0409	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999992|0.999992	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.25779|0.25779	-1.0122|-1.0122	9|6	.|0.87932	.|D	.|0	-4.8545|-4.8545	3.8606|3.8606	0.08994|0.08994	0.0:0.3276:0.2147:0.4577|0.0:0.3276:0.2147:0.4577	.|.	26|.	Q96F45|.	ZN503_HUMAN|.	S|L	26|115	ENSP00000361602:G26S;ENSP00000438988:G26S|.	.|ENSP00000391835:P115L	G|P	-|+	1|2	0|0	ZNF503|AC010997.1	76831108|76831108	0.437000|0.437000	0.25593|0.25593	0.723000|0.723000	0.30687|0.30687	0.115000|0.115000	0.19883|0.19883	-0.115000|-0.115000	0.10741|0.10741	-0.181000|-0.181000	0.10619|0.10619	0.000000|0.000000	0.15137|0.15137	GGC|CCG	.	.	none		0.711	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
SLC22A23	63027	hgsc.bcm.edu	37	6	3284179	3284179	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:3284179G>A	ENST00000406686.3	-	9	1609	c.1610C>T	c.(1609-1611)tCc>tTc	p.S537F	SLC22A23_ENST00000436008.2_Missense_Mutation_p.S545F|PSMG4_ENST00000451246.2_Intron|SLC22A23_ENST00000380302.4_Missense_Mutation_p.S256F|SLC22A23_ENST00000490273.1_Missense_Mutation_p.S256F	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	537					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				AAACGCGATGGAAAATTTGTC	0.597																																					p.S537F		Atlas-SNP	.											SLC22A23_ENST00000406686,NS,carcinoma,-1,2	SLC22A23	89	2	0			c.C1610T						scavenged	.						103.0	90.0	95.0					6																	3284179		2203	4300	6503	SO:0001583	missense	63027	exon9			GCGATGGAAAATT	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.1610C>T	6.37:g.3284179G>A	ENSP00000385028:p.Ser537Phe	Somatic	96	1	0.0104167		WXS	Illumina HiSeq	Phase_I	83	37	0.445783	NM_015482	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	ENST00000406686.3	37	CCDS47363.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681253	0.88542	.	.	ENSG00000137266	ENST00000436008;ENST00000406686;ENST00000380302;ENST00000490273;ENST00000485307;ENST00000467177	T;T;T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85;-0.85;-0.85	5.35	5.35	0.76521	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.054601	0.85682	D	0.000000	T	0.78336	0.4267	L	0.39898	1.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.987	T	0.79818	-0.1643	10	0.56958	D	0.05	-37.9193	18.0651	0.89388	0.0:0.0:1.0:0.0	.	545;537	C9J4Z0;A1A5C7	.;S22AN_HUMAN	F	545;537;256;256;365;363	ENSP00000410245:S545F;ENSP00000385028:S537F;ENSP00000369657:S256F;ENSP00000419463:S256F;ENSP00000418134:S365F;ENSP00000418985:S363F	ENSP00000369657:S256F	S	-	2	0	SLC22A23	3229178	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.303000	0.96183	2.491000	0.84063	0.655000	0.94253	TCC	.	.	none		0.597	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945	
ADAMTS13	11093	hgsc.bcm.edu	37	9	136287582	136287582	+	Missense_Mutation	SNP	C	C	T	rs34024143	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:136287582C>T	ENST00000371929.3	+	1	463	c.19C>T	c.(19-21)Cgg>Tgg	p.R7W	ADAMTS13_ENST00000371916.1_Missense_Mutation_p.R7W|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.R7W|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.R7W|ADAMTS13_ENST00000485925.1_Intron|ADAMTS13_ENST00000371911.3_Missense_Mutation_p.R7W	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	7			R -> W (does not affect protein secretion; dbSNP:rs34024143). {ECO:0000269|PubMed:11586351, ECO:0000269|Ref.6}.		cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCGTCACCCCCGGGCAAGATG	0.632													C|||	264	0.0527157	0.0356	0.0735	5008	,	,		16616	0.006		0.1262	False		,,,				2504	0.0337				p.R7W		Atlas-SNP	.											ADAMTS13,colon,carcinoma,-2,1	ADAMTS13	113	1	0			c.C19T						scavenged	.	C	TRP/ARG,TRP/ARG,TRP/ARG	228,4178	136.5+/-172.5	3,222,1978	84.0	78.0	80.0		19,19,19	-6.6	0.0	9	dbSNP_126	80	1071,7529	225.5+/-261.6	66,939,3295	yes	missense,missense,missense	ADAMTS13	NM_139025.3,NM_139026.3,NM_139027.3	101,101,101	69,1161,5273	TT,TC,CC		12.4535,5.1748,9.9877	benign,benign,benign	7/1428,7/1341,7/1372	136287582	1299,11707	2203	4300	6503	SO:0001583	missense	11093	exon1			CACCCCCGGGCAA	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.19C>T	9.37:g.136287582C>T	ENSP00000360997:p.Arg7Trp	Somatic	33	1	0.030303		WXS	Illumina HiSeq	Phase_I	29	3	0.103448	NM_139026	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	CCDS6970.1	153	0.07005494505494506	26	0.052845528455284556	26	0.0718232044198895	5	0.008741258741258742	96	0.1266490765171504	C	9.203	1.028867	0.19512	0.051748	0.124535	ENSG00000160323	ENST00000371929;ENST00000371916;ENST00000355699;ENST00000356589;ENST00000371911	T;T;T;T;D	0.85339	-0.13;-1.45;-0.17;-0.2;-1.97	3.35	-6.55	0.01854	.	.	.	.	.	T	0.01061	0.0035	N	0.04880	-0.145	0.80722	P	0.0	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.11421	-1.0588	8	0.45353	T	0.12	.	1.1031	0.01688	0.1589:0.3274:0.1622:0.3515	rs34024143;rs36218241	7;7;7;7	Q76LX8;Q76LX8-3;Q76LX8-2;E7EV88	ATS13_HUMAN;.;.;.	W	7	ENSP00000360997:R7W;ENSP00000360984:R7W;ENSP00000347927:R7W;ENSP00000348997:R7W;ENSP00000360979:R7W	ENSP00000347927:R7W	R	+	1	2	ADAMTS13	135277403	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.569000	0.02142	-1.237000	0.02539	-1.311000	0.01308	CGG	C|0.905;T|0.095	0.095	strong		0.632	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
SLC35G6	643664	hgsc.bcm.edu	37	17	7386176	7386176	+	Silent	SNP	G	G	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:7386176G>C	ENST00000412468.2	+	2	988	c.873G>C	c.(871-873)gtG>gtC	p.V291V	POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron|POLR2A_ENST00000572844.1_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	291	EamA 2.					integral component of membrane (GO:0016021)											CCGAGGTGGTGGTGGCCCTTA	0.582																																					p.V291V		Atlas-SNP	.											POLR2A_ENST00000412468,NS,haematopoietic_neoplasm,0,1	.	.	1	0			c.G873C						scavenged	.						197.0	182.0	187.0					17																	7386176		2203	4300	6503	SO:0001819	synonymous_variant	643664	exon2			GGTGGTGGTGGCC		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.873G>C	17.37:g.7386176G>C		Somatic	116	1	0.00862069		WXS	Illumina HiSeq	Phase_I	80	9	0.1125	NM_001102614		Silent	SNP	ENST00000412468.2	37	CCDS45603.1																																																																																			.	.	alt		0.582	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
SERPINB6	5269	hgsc.bcm.edu	37	6	2959513	2959513	+	Silent	SNP	C	C	T	rs2236277	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:2959513C>T	ENST00000380520.1	-	1	2048	c.54G>A	c.(52-54)acG>acA	p.T18T	SERPINB6_ENST00000380539.1_Silent_p.T18T|SERPINB6_ENST00000335686.5_Silent_p.T18T|SERPINB6_ENST00000380529.1_Silent_p.T18T|SERPINB6_ENST00000380546.3_Silent_p.T18T|SERPINB6_ENST00000380524.1_Silent_p.T18T			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	18					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T18T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	CTTTACCCAGCGTTTTCAAAA	0.468													C|||	1709	0.341254	0.1513	0.4539	5008	,	,		21942	0.4841		0.338	False		,,,				2504	0.3742				p.T37T		Atlas-SNP	.											SERPINB6,NS,carcinoma,0,1	SERPINB6	31	1	1	Substitution - coding silent(1)	stomach(1)	c.G111A						PASS	.	C	,	805,3601	323.7+/-298.2	76,653,1474	148.0	134.0	139.0		54,54	-1.1	0.3	6	dbSNP_98	139	2761,5839	439.8+/-359.3	427,1907,1966	no	coding-synonymous,coding-synonymous	SERPINB6	NM_001195291.1,NM_004568.5	,	503,2560,3440	TT,TC,CC		32.1047,18.2705,27.4181	,	18/377,18/377	2959513	3566,9440	2203	4300	6503	SO:0001819	synonymous_variant	5269	exon2			ACCCAGCGTTTTC	Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.54G>A	6.37:g.2959513C>T		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	100	6	0.06	NM_001271823	B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Silent	SNP	ENST00000380520.1	37	CCDS4479.1	735	0.33653846153846156	61	0.12398373983739837	162	0.44751381215469616	274	0.479020979020979	238	0.31398416886543534	C	7.310	0.614766	0.14129	0.182705	0.321047	ENSG00000124570	ENST00000380500	.	.	.	5.11	-1.14	0.09741	.	.	.	.	.	T	0.11879	0.0289	.	.	.	0.46185	P	0.0010879999999999779	.	.	.	.	.	.	T	0.24835	-1.0149	3	.	.	.	.	4.0275	0.09693	0.4755:0.2285:0.0:0.296	rs2236277;rs59298149;rs2236277	.	.	.	H	7	.	.	R	-	2	0	SERPINB6	2904512	0.000000	0.05858	0.317000	0.25265	0.860000	0.49131	-0.626000	0.05527	-0.034000	0.13713	0.591000	0.81541	CGC	C|0.691;A|0.002	.	strong		0.468	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043422.1		
SARDH	1757	hgsc.bcm.edu	37	9	136577806	136577806	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:136577806C>T	ENST00000371872.4	-	10	1520	c.1263G>A	c.(1261-1263)ggG>ggA	p.G421G	SARDH_ENST00000422262.2_Silent_p.G253G|SARDH_ENST00000439388.1_Silent_p.G421G	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	421					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CCAGCTCCTGCCCACAGCCAC	0.637																																					p.G421G		Atlas-SNP	.											.	SARDH	112	.	0			c.G1263A						PASS	.						55.0	56.0	55.0					9																	136577806		2203	4300	6503	SO:0001819	synonymous_variant	1757	exon10			CTCCTGCCCACAG		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1263G>A	9.37:g.136577806C>T		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	24	11	0.458333	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	ENST00000371872.4	37	CCDS6978.1																																																																																			.	.	none		0.637	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
ZNF844	284391	hgsc.bcm.edu	37	19	12186148	12186148	+	Silent	SNP	T	T	C	rs10424893	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:12186148T>C	ENST00000439326.3	+	4	388	c.213T>C	c.(211-213)gtT>gtC	p.V71V	ZNF844_ENST00000441304.2_Missense_Mutation_p.L51S	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	71	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						GAGAGAGAGTTGATGAAAATA	0.333													.|||	1421	0.283746	0.7035	0.1455	5008	,	,		15619	0.0863		0.161	False		,,,				2504	0.1442				p.V71V		Atlas-SNP	.											ZNF844,NS,NS,+2,1	ZNF844	69	1	0			c.T213C						PASS	.	C		839,545		256,327,109	64.0	61.0	62.0		213	-0.9	0.0	19	dbSNP_119	62	416,2766		25,366,1200	no	coding-synonymous	ZNF844	NM_001136501.1		281,693,1309	CC,CT,TT		13.0735,39.3786,27.4858		71/667	12186148	1255,3311	692	1591	2283	SO:0001819	synonymous_variant	284391	exon4			GAGAGTTGATGAA	AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.213T>C	19.37:g.12186148T>C		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	72	4	0.0555556	NM_001136501	Q5JPI8	Silent	SNP	ENST00000439326.3	37	CCDS45985.1	553	0.2532051282051282	319	0.6483739837398373	53	0.1464088397790055	54	0.0944055944055944	127	0.16754617414248021	t	0.777	-0.763841	0.02996	0.606214	0.130735	ENSG00000223547	ENST00000441304	T	0.01821	4.62	1.56	-0.936	0.10419	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.04551	-1.0943	5	0.45353	T	0.12	.	3.1725	0.06558	0.3397:0.4089:0.0:0.2514	rs10424893;rs10424893	.	.	.	S	51	ENSP00000402097:L51S	ENSP00000402097:L51S	L	+	2	0	ZNF844	12047148	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.757000	0.04772	-0.637000	0.05516	-1.222000	0.01597	TTG	T|0.725;C|0.275	0.275	strong		0.333	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344086.2		
CCDC88B	283234	hgsc.bcm.edu	37	11	64124515	64124515	+	Silent	SNP	T	T	C	rs612448	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:64124515T>C	ENST00000356786.5	+	27	4424	c.4380T>C	c.(4378-4380)ccT>ccC	p.P1460P	CCDC88B_ENST00000301897.4_Silent_p.P123P|CCDC88B_ENST00000359902.2_Missense_Mutation_p.L565P|RPS6KA4_ENST00000294261.4_5'Flank|RPS6KA4_ENST00000528057.1_5'Flank|CCDC88B_ENST00000463837.1_3'UTR|RPS6KA4_ENST00000334205.4_5'Flank	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	1460						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CTCTAGGCCCTGAGGTACAGG	0.632													C|||	1303	0.260184	0.0303	0.4107	5008	,	,		17803	0.1845		0.4334	False		,,,				2504	0.364				p.P1460P		Atlas-SNP	.											CCDC88B_ENST00000359902,NS,carcinoma,-1,1	CCDC88B	89	1	0			c.T4380C						scavenged	.	C		426,3976		23,380,1798	133.0	102.0	112.0		4380	0.6	0.0	11	dbSNP_83	112	3738,4856		794,2150,1353	no	coding-synonymous	CCDC88B	NM_032251.5		817,2530,3151	CC,CT,TT		43.4955,9.6774,32.0406		1460/1477	64124515	4164,8832	2201	4297	6498	SO:0001819	synonymous_variant	283234	exon27			AGGCCCTGAGGTA	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.4380T>C	11.37:g.64124515T>C		Somatic	141	1	0.0070922		WXS	Illumina HiSeq	Phase_I	169	5	0.0295858	NM_032251	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Silent	SNP	ENST00000356786.5	37	CCDS8072.2	605	0.27701465201465203	21	0.042682926829268296	141	0.38950276243093923	104	0.18181818181818182	339	0.4472295514511873	N	11.12	1.545644	0.27652	0.096774	0.434955	ENSG00000168071	ENST00000359902	T	0.57907	0.37	3.89	0.573	0.17363	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.46652	-0.9176	6	.	.	.	.	3.3622	0.07190	0.0:0.4118:0.2053:0.3829	rs612448;rs58613170;rs612448	549	A6NC98-5	.	P	565	ENSP00000352974:L565P	.	L	+	2	0	CCDC88B	63881091	0.000000	0.05858	0.010000	0.14722	0.161000	0.22273	-0.393000	0.07305	0.007000	0.14760	-0.511000	0.04467	CTG	T|0.706;C|0.294	0.294	strong		0.632	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251	
PRR23C	389152	hgsc.bcm.edu	37	3	138762875	138762875	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:138762875C>T	ENST00000413199.1	-	1	859	c.588G>A	c.(586-588)ggG>ggA	p.G196G	PRR23C_ENST00000502927.2_Silent_p.G196G|MRPS22_ENST00000495075.1_Intron	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	196	Pro-rich.									breast(2)|lung(7)|skin(2)	11						GAGCACAGGGCCCTCGGATGG	0.652																																					p.G196G		Atlas-SNP	.											.	PRR23C	31	.	0			c.G588A						PASS	.						37.0	44.0	42.0					3																	138762875		692	1591	2283	SO:0001819	synonymous_variant	389152	exon1			ACAGGGCCCTCGG		CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.588G>A	3.37:g.138762875C>T		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	94	39	0.414894	NM_001134657		Silent	SNP	ENST00000413199.1	37	CCDS46924.1																																																																																			.	.	none		0.652	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361502.1	NM_001134657	
SLC2A9	56606	hgsc.bcm.edu	37	4	9998440	9998440	+	Silent	SNP	C	C	T	rs10939650	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:9998440C>T	ENST00000264784.3	-	3	428	c.375G>A	c.(373-375)acG>acA	p.T125T	SLC2A9_ENST00000506583.1_Silent_p.T96T|SLC2A9_ENST00000309065.3_Silent_p.T96T	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	125			T -> M (in RHUC2; markedly reduced urate transport activity; dbSNP:rs181509591). {ECO:0000269|PubMed:21810765}.		glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)	p.T96T(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	TCACAATTAACGTCCCCACAA	0.488													C|||	3216	0.642173	0.6944	0.5821	5008	,	,		20048	0.506		0.7525	False		,,,				2504	0.6411				p.T125T		Atlas-SNP	.											SLC2A9,NS,carcinoma,0,1	SLC2A9	158	1	1	Substitution - coding silent(1)	stomach(1)	c.G375A						scavenged	.	C	,	3012,1394	687.7+/-404.9	1037,938,228	105.0	90.0	95.0		288,375	-7.7	0.0	4	dbSNP_120	95	6445,2155	713.8+/-406.0	2399,1647,254	no	coding-synonymous,coding-synonymous	SLC2A9	NM_001001290.1,NM_020041.2	,	3436,2585,482	TT,TC,CC		25.0581,31.6387,27.2874	,	96/512,125/541	9998440	9457,3549	2203	4300	6503	SO:0001819	synonymous_variant	56606	exon3			AATTAACGTCCCC	AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.375G>A	4.37:g.9998440C>T		Somatic	226	1	0.00442478		WXS	Illumina HiSeq	Phase_I	186	7	0.0376344	NM_020041	Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Silent	SNP	ENST00000264784.3	37	CCDS3407.1																																																																																			C|0.307;T|0.693	0.693	strong		0.488	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207055.1		
EPHA2	1969	hgsc.bcm.edu	37	1	16451767	16451767	+	Silent	SNP	G	G	A	rs3754334	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:16451767G>A	ENST00000358432.5	-	17	3028	c.2874C>T	c.(2872-2874)atC>atT	p.I958I		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	958	Negatively regulates interaction with ARHGEF16.|SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	GGCTGTAGGCGATGCGCTTCT	0.642													G|||	1185	0.236621	0.1135	0.3141	5008	,	,		12121	0.1548		0.3161	False		,,,				2504	0.3507				p.I958I		Atlas-SNP	.											.	EPHA2	102	.	0			c.C2874T						PASS	.	G		545,3861	244.3+/-253.7	32,481,1690	61.0	47.0	52.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2874	-6.9	0.8	1	dbSNP_107	52	2419,6181	396.7+/-345.5	344,1731,2225	yes	coding-synonymous	EPHA2	NM_004431.3		376,2212,3915	AA,AG,GG		28.1279,12.3695,22.7895		958/977	16451767	2964,10042	2203	4300	6503	SO:0001819	synonymous_variant	1969	exon17			GTAGGCGATGCGC	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2874C>T	1.37:g.16451767G>A		Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	122	10	0.0819672	NM_004431	B5A968|Q8N3Z2	Silent	SNP	ENST00000358432.5	37	CCDS169.1																																																																																			G|0.777;A|0.223	0.223	strong		0.642	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
LHX8	431707	hgsc.bcm.edu	37	1	75622616	75622616	+	Silent	SNP	C	C	T	rs941032	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:75622616C>T	ENST00000294638.5	+	9	1513	c.849C>T	c.(847-849)caC>caT	p.H283H	LHX8_ENST00000356261.3_Silent_p.H273H	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	283					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						ACAAGAAACACGTCAGTCCTA	0.502													C|||	1973	0.39397	0.4758	0.3026	5008	,	,		17790	0.2063		0.3907	False		,,,				2504	0.545				p.H283H		Atlas-SNP	.											.	LHX8	73	.	0			c.C849T						PASS	.	C		2044,2362	566.8+/-382.0	484,1076,643	291.0	261.0	272.0		849	-3.0	0.8	1	dbSNP_86	272	3551,5049	517.5+/-379.0	748,2055,1497	yes	coding-synonymous	LHX8	NM_001001933.1		1232,3131,2140	TT,TC,CC		41.2907,46.3913,43.0186		283/357	75622616	5595,7411	2203	4300	6503	SO:0001819	synonymous_variant	431707	exon9			GAAACACGTCAGT	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.849C>T	1.37:g.75622616C>T		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	85	4	0.0470588	NM_001001933	E9PGE3	Silent	SNP	ENST00000294638.5	37	CCDS30756.1																																																																																			C|0.598;N|0.000	.	strong		0.502	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933	
PALMD	54873	hgsc.bcm.edu	37	1	100159608	100159608	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:100159608A>G	ENST00000263174.4	+	8	2021	c.1646A>G	c.(1645-1647)aAg>aGg	p.K549R		NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	549					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		CTGGGAAAAAAGGTGATCTAA	0.299																																					p.K549R		Atlas-SNP	.											PALMD,colon,carcinoma,-1,1	PALMD	64	1	0			c.A1646G						scavenged	.						40.0	43.0	42.0					1																	100159608		2203	4299	6502	SO:0001583	missense	54873	exon8			GAAAAAAGGTGAT	AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.1646A>G	1.37:g.100159608A>G	ENSP00000263174:p.Lys549Arg	Somatic	512	0	0		WXS	Illumina HiSeq	Phase_I	562	6	0.0106762	NM_017734	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Missense_Mutation	SNP	ENST00000263174.4	37	CCDS758.1	.	.	.	.	.	.	.	.	.	.	A	10.63	1.404501	0.25378	.	.	ENSG00000099260	ENST00000263174	T	0.20881	2.04	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000001	T	0.12305	0.0299	M	0.61703	1.905	0.43693	D	0.996149	B	0.30664	0.289	B	0.28784	0.094	T	0.02983	-1.1086	10	0.46703	T	0.11	-33.5149	11.2648	0.49104	0.9294:0.0:0.0706:0.0	.	549	Q9NP74	PALMD_HUMAN	R	549	ENSP00000263174:K549R	ENSP00000263174:K549R	K	+	2	0	PALMD	99932196	1.000000	0.71417	0.998000	0.56505	0.261000	0.26267	2.749000	0.47492	2.240000	0.73641	0.528000	0.53228	AAG	.	.	none		0.299	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029672.1	NM_017734	
PKP4	8502	hgsc.bcm.edu	37	2	159389762	159389762	+	Silent	SNP	C	C	T	rs35112233	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:159389762C>T	ENST00000389759.3	+	2	178	c.66C>T	c.(64-66)gcC>gcT	p.A22A	snoZ5_ENST00000515912.1_RNA|PKP4_ENST00000389757.3_Silent_p.A22A	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	22					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						AGGAAGCTGCCTCCACTGGCC	0.552										HNSCC(62;0.18)			C|||	135	0.0269569	0.0113	0.0562	5008	,	,		16055	0.0		0.0676	False		,,,				2504	0.0133				p.A22A		Atlas-SNP	.											.	PKP4	133	.	0			c.C66T						PASS	.	C	,	87,4319	73.1+/-111.1	2,83,2118	49.0	46.0	47.0		66,66	5.3	1.0	2	dbSNP_126	47	560,8040	152.1+/-206.7	21,518,3761	no	coding-synonymous,coding-synonymous	PKP4	NM_001005476.1,NM_003628.3	,	23,601,5879	TT,TC,CC		6.5116,1.9746,4.9746	,	22/1150,22/1193	159389762	647,12359	2203	4300	6503	SO:0001819	synonymous_variant	8502	exon2			AGCTGCCTCCACT	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.66C>T	2.37:g.159389762C>T		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	89	7	0.0786517	NM_001005476	Q86W91	Silent	SNP	ENST00000389759.3	37	CCDS33305.1																																																																																			C|0.953;T|0.047	0.047	strong		0.552	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
OR11L1	391189	hgsc.bcm.edu	37	1	248004296	248004296	+	Silent	SNP	A	A	G	rs6681483	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:248004296A>G	ENST00000355784.2	-	1	958	c.903T>C	c.(901-903)gtT>gtC	p.V301V		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	301						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGACCTTTCTAACAGCTTCTT	0.383													A|||	746	0.148962	0.3616	0.1282	5008	,	,		22844	0.004		0.1014	False		,,,				2504	0.0746				p.V301V		Atlas-SNP	.											OR11L1,right_lower_lobe,carcinoma,-2,1	OR11L1	108	1	0			c.T903C						scavenged	.	A		1483,2923	476.3+/-357.6	239,1005,959	91.0	86.0	88.0		903	0.1	0.4	1	dbSNP_116	88	1023,7577	219.2+/-257.4	61,901,3338	no	coding-synonymous	OR11L1	NM_001001959.1		300,1906,4297	GG,GA,AA		11.8953,33.6586,19.268		301/323	248004296	2506,10500	2203	4300	6503	SO:0001819	synonymous_variant	391189	exon1			CTTTCTAACAGCT	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.903T>C	1.37:g.248004296A>G		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	144	3	0.0208333	NM_001001959		Silent	SNP	ENST00000355784.2	37	CCDS31098.1																																																																																			A|0.825;G|0.175	0.175	strong		0.383	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959	
ZNF705A	440077	hgsc.bcm.edu	37	12	8329676	8329676	+	Missense_Mutation	SNP	C	C	T	rs10743252	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:8329676C>T	ENST00000359286.4	+	5	489	c.400C>T	c.(400-402)Cgt>Tgt	p.R134C		NM_001004328.2|NM_001278713.1	NP_001004328.1|NP_001265642.1	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	134			R -> C (in dbSNP:rs10743252).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R134C(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(3)|stomach(4)	18				Kidney(36;0.0877)		AATAACTCAGCGTTTGTTAAC	0.388													t|||	2511	0.501398	0.4992	0.4914	5008	,	,		-128	0.5288		0.5845	False		,,,				2504	0.3978				p.R134C		Atlas-SNP	.											ZNF705A,NS,carcinoma,0,1	ZNF705A	32	1	1	Substitution - Missense(1)	stomach(1)	c.C400T						scavenged	.	T	CYS/ARG	1857,2549		567,723,913	112.0	110.0	111.0		400	-2.7	0.0	12	dbSNP_120	111	4182,4414		1355,1472,1471	no	missense	ZNF705A	NM_001004328.2	180	1922,2195,2384	TT,TC,CC		48.6505,42.1471,46.4467	benign	134/301	8329676	6039,6963	2203	4298	6501	SO:0001583	missense	440077	exon5			ACTCAGCGTTTGT	AK131339	CCDS31737.1	12p13.31	2014-02-12	2005-09-22		ENSG00000196946	ENSG00000196946		"""Zinc fingers, C2H2-type"", ""-"""	32281	protein-coding gene	gene with protein product							Standard	NM_001004328		Approved	FLJ16353	uc001qud.1	Q6ZN79	OTTHUMG00000168635	ENST00000359286.4:c.400C>T	12.37:g.8329676C>T	ENSP00000352233:p.Arg134Cys	Somatic	284	0	0		WXS	Illumina HiSeq	Phase_I	335	4	0.0119403	NM_001004328		Missense_Mutation	SNP	ENST00000359286.4	37	CCDS31737.1	996	0.45604395604395603	179	0.3638211382113821	164	0.4530386740331492	274	0.479020979020979	379	0.5	.	1.048	-0.676742	0.03378	0.421471	0.486505	ENSG00000196946	ENST00000396570;ENST00000359286	T;T	0.08634	3.07;3.07	1.35	-2.7	0.06004	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00012	0.0000	N	0.12182	0.205	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45220	-0.9276	8	0.56958	D	0.05	.	3.8537	0.08967	0.4174:0.3552:0.0:0.2273	rs10743252;rs61402447	134	Q6ZN79	Z705A_HUMAN	C	134	ENSP00000379816:R134C;ENSP00000352233:R134C	ENSP00000352233:R134C	R	+	1	0	ZNF705A	8220943	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.071000	0.03437	-2.873000	0.00322	-1.619000	0.00793	CGT	C|0.481;T|0.519	0.519	strong		0.388	ZNF705A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400449.1	NM_001004328	
RFPL2	10739	hgsc.bcm.edu	37	22	32587027	32587027	+	Missense_Mutation	SNP	G	G	C	rs136472	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr22:32587027G>C	ENST00000400237.1	-	5	1804	c.869C>G	c.(868-870)aCc>aGc	p.T290S	RFPL2_ENST00000400236.3_Missense_Mutation_p.T200S|RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000248980.4_Missense_Mutation_p.T229S|RFPL2_ENST00000248983.4_Missense_Mutation_p.T200S			O75678	RFPL2_HUMAN	ret finger protein-like 2	290	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.		T -> S (in dbSNP:rs136472). {ECO:0000269|PubMed:10508838, ECO:0000269|PubMed:15461802}.				zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						CGGCACCGTGGTGGCAGAGAG	0.527													.|||	2431	0.485423	0.8631	0.3804	5008	,	,		18985	0.1558		0.493	False		,,,				2504	0.3814				p.T290S		Atlas-SNP	.											.	RFPL2	81	.	0			c.C869G						PASS	.	C	SER/THR,SER/THR,SER/THR,SER/THR	3257,1149		1433,391,379	46.0	69.0	61.0		869,599,599,686	-0.6	0.0	22	dbSNP_78	61	3302,5294		1009,1284,2005	no	missense,missense,missense,missense	RFPL2	NM_001098527.2,NM_001159545.1,NM_001159546.1,NM_006605.3	58,58,58,58	2442,1675,2384	CC,CG,GG		38.4132,26.0781,49.5539	benign,benign,benign,benign	290/379,200/289,200/289,229/318	32587027	6559,6443	2203	4298	6501	SO:0001583	missense	10739	exon5			ACCGTGGTGGCAG	AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.869C>G	22.37:g.32587027G>C	ENSP00000383096:p.Thr290Ser	Somatic	252	0	0		WXS	Illumina HiSeq	Phase_I	179	8	0.0446927	NM_001098527		Missense_Mutation	SNP	ENST00000400237.1	37	CCDS43009.2	953	0.43635531135531136	409	0.8313008130081301	125	0.3453038674033149	74	0.12937062937062938	345	0.4551451187335092	C	0.001	-3.005017	0.00044	0.739219	0.384132	ENSG00000128253	ENST00000248980;ENST00000248983;ENST00000400236;ENST00000400237	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	0.311	-0.622	0.11560	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.00012	0.0000	N	0.00317	-1.655	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42498	-0.9448	8	0.02654	T	1	.	2.7132	0.05180	0.0:0.2836:0.261:0.4554	rs136472;rs13057808;rs16987632;rs56934845	290;229	O75678;O75678-3	RFPL2_HUMAN;.	S	229;200;200;290	ENSP00000248980:T229S;ENSP00000248983:T200S;ENSP00000383095:T200S;ENSP00000383096:T290S	ENSP00000248980:T229S	T	-	2	0	RFPL2	30917027	0.000000	0.05858	0.008000	0.14137	0.009000	0.06853	-2.483000	0.00980	-2.820000	0.00344	-2.755000	0.00123	ACC	C|1.000;|0.000	1.000	weak		0.527	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2	NM_006605	
DOCK2	1794	hgsc.bcm.edu	37	5	169127097	169127097	+	Silent	SNP	C	C	A	rs2112703	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:169127097C>A	ENST00000256935.8	+	13	1292	c.1212C>A	c.(1210-1212)acC>acA	p.T404T		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	404					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGACAGGACCACCGTGGTGG	0.567													C|||	609	0.121605	0.0363	0.0893	5008	,	,		17531	0.122		0.2048	False		,,,				2504	0.1738				p.T404T		Atlas-SNP	.											.	DOCK2	389	.	0			c.C1212A						PASS	.	C		323,4083	171.9+/-202.1	18,287,1898	160.0	146.0	151.0		1212	1.6	1.0	5	dbSNP_96	151	1783,6817	322.8+/-315.7	197,1389,2714	no	coding-synonymous	DOCK2	NM_004946.2		215,1676,4612	AA,AC,CC		20.7326,7.3309,16.1925		404/1831	169127097	2106,10900	2203	4300	6503	SO:0001819	synonymous_variant	1794	exon13			CAGGACCACCGTG	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1212C>A	5.37:g.169127097C>A		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	49	4	0.0816327	NM_004946	Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	CCDS4371.1																																																																																			C|0.852;A|0.148	0.148	strong		0.567	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
RNF207	388591	hgsc.bcm.edu	37	1	6279370	6279370	+	Missense_Mutation	SNP	G	G	C	rs846111	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:6279370G>C	ENST00000377939.4	+	18	1935	c.1808G>C	c.(1807-1809)gGc>gCc	p.G603A	ICMT_ENST00000495791.1_5'Flank|RNF207_ENST00000483336.1_3'UTR|RNF207_ENST00000377948.2_3'UTR	NM_207396.2	NP_997279.2	Q6ZRF8	RN207_HUMAN	ring finger protein 207	603			G -> A (in dbSNP:rs846111). {ECO:0000269|PubMed:19305409}.			intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(2)	16	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		GCTCCGAACGGCCTCTCAGAA	0.498													G|||	864	0.172524	0.0227	0.1758	5008	,	,		16230	0.1756		0.2604	False		,,,				2504	0.2791				p.G603A		Atlas-SNP	.											RNF207,caecum,carcinoma,0,2	RNF207	45	2	0			c.G1808C						scavenged	.	G	ALA/GLY	219,3517		9,201,1658	54.0	56.0	55.0	http://www.ncbi.nlm.nih.gov/pubmed?term	1808	1.0	0.0	1	dbSNP_86	55	2163,6045		285,1593,2226	yes	missense	RNF207	NM_207396.2	60	294,1794,3884	CC,CG,GG	http://www.ncbi.nlm.nih.gov/pubmed?term	26.3523,5.8619,19.9431	benign	603/635	6279370	2382,9562	1868	4104	5972	SO:0001583	missense	388591	exon18			CGAACGGCCTCTC	AK128246	CCDS59.2	1p36.31	2008-11-19			ENSG00000158286	ENSG00000158286		"""RING-type (C3HC4) zinc fingers"""	32947	protein-coding gene	gene with protein product	"""OTTHUMG00000001089"""		"""chromosome 1 open reading frame 188"""	C1orf188			Standard	NM_207396		Approved	FLJ46380, FLJ32096	uc001amg.3	Q6ZRF8	OTTHUMG00000001089	ENST00000377939.4:c.1808G>C	1.37:g.6279370G>C	ENSP00000367173:p.Gly603Ala	Somatic	445	0	0		WXS	Illumina HiSeq	Phase_I	337	6	0.0178042	NM_207396	A2VCM8|B4DFR6|Q5TGS6|Q6ZS63|Q96MP2	Missense_Mutation	SNP	ENST00000377939.4	37	CCDS59.2	380	0.17399267399267399	13	0.026422764227642278	70	0.19337016574585636	101	0.17657342657342656	196	0.25857519788918204	G	7.864	0.726640	0.15439	0.058619	0.263523	ENSG00000158286	ENST00000377939	T	0.15952	2.38	5.33	1.01	0.19927	.	0.326684	0.20268	U	0.095722	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.10296	0.003	B	0.06405	0.002	T	0.45264	-0.9273	9	0.13470	T	0.59	-0.5354	1.7254	0.02921	0.1818:0.1635:0.4863:0.1684	rs846111;rs3765570;rs17437807;rs846111	603	Q6ZRF8	RN207_HUMAN	A	603	ENSP00000367173:G603A	ENSP00000367173:G603A	G	+	2	0	RNF207	6201957	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.127000	0.10547	0.314000	0.23086	-0.140000	0.14226	GGC	G|0.803;C|0.197	0.197	strong		0.498	RNF207-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003669.2	NM_207396	
TMA16	55319	hgsc.bcm.edu	37	4	164440581	164440581	+	Missense_Mutation	SNP	T	T	C	rs1561736	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:164440581T>C	ENST00000358572.5	+	7	868	c.527T>C	c.(526-528)aTt>aCt	p.I176T	TMA16_ENST00000513134.1_Intron|TMA16_ENST00000513272.1_3'UTR	NM_018352.2	NP_060822.2	Q96EY4	TMA16_HUMAN	translation machinery associated 16 homolog (S. cerevisiae)	176			I -> T (in dbSNP:rs1561736). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.			nucleus (GO:0005634)		p.I176T(1)									AGGAAAACTATTATAACTGTA	0.373													T|||	1916	0.382588	0.2526	0.6052	5008	,	,		18042	0.3423		0.4742	False		,,,				2504	0.3476				p.I176T		Atlas-SNP	.											C4orf43,NS,carcinoma,0,1	.	.	1	1	Substitution - Missense(1)	stomach(1)	c.T527C						scavenged	.	T	THR/ILE	1026,2688		147,732,978	53.0	53.0	53.0		527	-0.5	0.0	4	dbSNP_88	53	3916,4252		965,1986,1133	no	missense	C4orf43	NM_018352.2	89	1112,2718,2111	CC,CT,TT		47.9432,27.6252,41.5923	benign	176/204	164440581	4942,6940	1857	4084	5941	SO:0001583	missense	55319	exon7			AAACTATTATAAC		CCDS43278.1	4q32.3	2012-03-02	2012-03-02	2012-03-02	ENSG00000198498	ENSG00000198498			25638	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 43"""	C4orf43		12477932	Standard	NM_018352		Approved	FLJ11184	uc003iqq.4	Q96EY4	OTTHUMG00000161528	ENST00000358572.5:c.527T>C	4.37:g.164440581T>C	ENSP00000351380:p.Ile176Thr	Somatic	441	0	0		WXS	Illumina HiSeq	Phase_I	455	17	0.0373626	NM_018352	Q0P6E4|Q0P6J1|Q9NUR7	Missense_Mutation	SNP	ENST00000358572.5	37	CCDS43278.1	901	0.4125457875457875	124	0.25203252032520324	216	0.5966850828729282	197	0.34440559440559443	364	0.48021108179419525	T	2.009	-0.427555	0.04701	0.276252	0.479432	ENSG00000198498	ENST00000358572	T	0.21734	1.99	5.05	-0.516	0.11950	.	1.344700	0.04600	N	0.398357	T	0.00012	0.0000	L	0.36672	1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.45041	-0.9288	9	0.07990	T	0.79	3.0277	3.462	0.07536	0.3859:0.1705:0.0:0.4436	rs1561736;rs3207217;rs17043749;rs17845311;rs17858149;rs1561736	176	Q96EY4	CD043_HUMAN	T	176	ENSP00000351380:I176T	ENSP00000351380:I176T	I	+	2	0	C4orf43	164660031	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.439000	0.06897	-0.127000	0.11661	0.533000	0.62120	ATT	T|0.582;C|0.418	0.418	strong		0.373	TMA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365208.1	NM_018352	
VCAN	1462	hgsc.bcm.edu	37	5	82834316	82834316	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:82834316T>C	ENST00000265077.3	+	8	6059	c.5494T>C	c.(5494-5496)Ttt>Ctt	p.F1832L	VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.F845L|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1832	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TGCCTCTGTCTTTATGGAGCA	0.498																																					p.F1832L		Atlas-SNP	.											.	VCAN	498	.	0			c.T5494C						PASS	.						78.0	86.0	83.0					5																	82834316		2203	4299	6502	SO:0001583	missense	1462	exon8			TCTGTCTTTATGG	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5494T>C	5.37:g.82834316T>C	ENSP00000265077:p.Phe1832Leu	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	89	34	0.382022	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.596304	0.46318	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.85484	-1.98;-1.99;3.27	5.82	3.13	0.36017	.	0.288191	0.30547	N	0.009390	T	0.79263	0.4416	L	0.49350	1.555	0.18873	N	0.999989	B;B	0.25390	0.037;0.125	B;B	0.22386	0.039;0.028	T	0.66532	-0.5900	10	0.31617	T	0.26	.	10.9593	0.47376	0.0:0.1464:0.0:0.8536	.	845;1832	P13611-2;P13611	.;CSPG2_HUMAN	L	1832;845;845	ENSP00000265077:F1832L;ENSP00000340062:F845L;ENSP00000426251:F845L	ENSP00000265077:F1832L	F	+	1	0	VCAN	82870072	0.111000	0.22076	0.003000	0.11579	0.350000	0.29205	2.000000	0.40816	1.035000	0.39972	0.533000	0.62120	TTT	.	.	none		0.498	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
PPP2R3A	5523	hgsc.bcm.edu	37	3	135722264	135722264	+	Missense_Mutation	SNP	A	A	G	rs17197552	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:135722264A>G	ENST00000264977.3	+	2	2541	c.1924A>G	c.(1924-1926)Agt>Ggt	p.S642G	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	642			S -> G (in dbSNP:rs17197552).		eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGTCTGTAGAAGTCCTGTTGG	0.423													A|||	865	0.172724	0.1505	0.1412	5008	,	,		17582	0.0288		0.2783	False		,,,				2504	0.2648				p.S642G		Atlas-SNP	.											.	PPP2R3A	114	.	0			c.A1924G						PASS	.	A	,GLY/SER	770,3634	291.0+/-281.2	64,642,1496	82.0	77.0	79.0		,1924	3.5	1.0	3	dbSNP_123	79	2708,5892	418.8+/-352.9	415,1878,2007	yes	intron,missense	PPP2R3A	NM_001190447.1,NM_002718.4	,56	479,2520,3503	GG,GA,AA		31.4884,17.4841,26.7456	,benign	,642/1151	135722264	3478,9526	2202	4300	6502	SO:0001583	missense	5523	exon2			TGTAGAAGTCCTG	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.1924A>G	3.37:g.135722264A>G	ENSP00000264977:p.Ser642Gly	Somatic	218	0	0		WXS	Illumina HiSeq	Phase_I	211	11	0.0521327	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	37	CCDS3087.1	340	0.15567765567765568	66	0.13414634146341464	57	0.1574585635359116	13	0.022727272727272728	204	0.2691292875989446	A	9.126	1.010279	0.19277	0.174841	0.314884	ENSG00000073711	ENST00000264977	T	0.06218	3.33	5.83	3.47	0.39725	.	0.643751	0.17330	N	0.178150	T	0.00012	0.0000	N	0.24115	0.695	0.09310	P	0.999999999742355	B	0.02656	0.0	B	0.04013	0.001	T	0.47636	-0.9102	9	0.44086	T	0.13	.	8.2194	0.31532	0.8457:0.0:0.1543:0.0	rs17197552;rs52827295;rs17197552	642	Q06190	P2R3A_HUMAN	G	642	ENSP00000264977:S642G	ENSP00000264977:S642G	S	+	1	0	PPP2R3A	137204954	0.878000	0.30173	0.996000	0.52242	0.962000	0.63368	1.520000	0.35899	0.481000	0.27557	0.460000	0.39030	AGT	A|0.779;G|0.221	0.221	strong		0.423	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
SH3RF2	153769	hgsc.bcm.edu	37	5	145393493	145393493	+	Missense_Mutation	SNP	C	C	T	rs149514957	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:145393493C>T	ENST00000511217.1	+	4	980	c.928C>T	c.(928-930)Cgg>Tgg	p.R310W	SH3RF2_ENST00000359120.4_Missense_Mutation_p.R310W			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	310					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACTCTCAACCGGATGGTCCA	0.582													C|||	8	0.00159744	0.0061	0.0	5008	,	,		20839	0.0		0.0	False		,,,				2504	0.0				p.R310W		Atlas-SNP	.											.	SH3RF2	58	.	0			c.C928T						PASS	.	C	TRP/ARG	25,4381	31.7+/-61.6	0,25,2178	116.0	111.0	113.0		928	3.1	1.0	5	dbSNP_134	113	5,8595	4.3+/-15.6	0,5,4295	yes	missense	SH3RF2	NM_152550.3	101	0,30,6473	TT,TC,CC		0.0581,0.5674,0.2307	probably-damaging	310/730	145393493	30,12976	2203	4300	6503	SO:0001583	missense	153769	exon5			CTCAACCGGATGG	AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.928C>T	5.37:g.145393493C>T	ENSP00000424497:p.Arg310Trp	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	171	7	0.0409357	NM_152550	A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Missense_Mutation	SNP	ENST00000511217.1	37	CCDS4280.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	19.88	3.908505	0.72868	0.005674	5.81E-4	ENSG00000156463	ENST00000359120;ENST00000511217	T;T	0.06933	3.24;3.24	5.32	3.13	0.36017	.	0.136685	0.47455	D	0.000225	T	0.05960	0.0155	N	0.24115	0.695	0.36239	D	0.853162	D	0.67145	0.996	P	0.46885	0.53	T	0.18967	-1.0320	10	0.87932	D	0	-19.15	13.4697	0.61276	0.651:0.349:0.0:0.0	.	310	Q8TEC5	SH3R2_HUMAN	W	310	ENSP00000352028:R310W;ENSP00000424497:R310W	ENSP00000352028:R310W	R	+	1	2	SH3RF2	145373686	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.596000	0.46205	0.529000	0.28599	-0.293000	0.09583	CGG	C|0.998;T|0.002	0.002	strong		0.582	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372804.1	NM_152550	
TLR2	7097	hgsc.bcm.edu	37	4	154625039	154625039	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:154625039A>T	ENST00000260010.6	+	1	2388	c.980A>T	c.(979-981)gAt>gTt	p.D327V		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	327					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)	p.D327V(2)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	TTATTTTATGATCTGAGCACT	0.318																																					p.D327V		Atlas-SNP	.											TLR2,NS,lymphoid_neoplasm,0,3	TLR2	84	3	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.A980T						PASS	.						58.0	63.0	62.0					4																	154625039		2203	4299	6502	SO:0001583	missense	7097	exon3			TTTATGATCTGAG	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.980A>T	4.37:g.154625039A>T	ENSP00000260010:p.Asp327Val	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	109	41	0.376147	NM_003264	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	ENST00000260010.6	37	CCDS3784.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.112000	0.56398	.	.	ENSG00000137462	ENST00000260010	T	0.16457	2.34	6.06	6.06	0.98353	.	0.366671	0.29165	N	0.012947	T	0.36635	0.0974	M	0.67397	2.05	0.28454	N	0.916221	D	0.61697	0.99	D	0.63113	0.911	T	0.35101	-0.9802	10	0.87932	D	0	.	11.615	0.51083	0.9314:0.0:0.0686:0.0	.	327	O60603	TLR2_HUMAN	V	327	ENSP00000260010:D327V	ENSP00000260010:D327V	D	+	2	0	TLR2	154844489	0.991000	0.36638	0.150000	0.22450	0.033000	0.12548	3.108000	0.50337	2.324000	0.78689	0.533000	0.62120	GAT	.	.	none		0.318	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365205.1		
L1TD1	54596	hgsc.bcm.edu	37	1	62676612	62676612	+	Silent	SNP	A	A	G	rs66958136	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:62676612A>G	ENST00000498273.1	+	4	2461	c.2166A>G	c.(2164-2166)aaA>aaG	p.K722K	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	722								p.K722K(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						acataattaaagaaataattg	0.358													G|||	792	0.158147	0.0825	0.3199	5008	,	,		20205	0.0704		0.2922	False		,,,				2504	0.0982				p.K722K		Atlas-SNP	.											L1TD1,NS,carcinoma,0,2	L1TD1	114	2	2	Substitution - coding silent(2)	ovary(1)|stomach(1)	c.A2166G						scavenged	.	G	,	314,2912		19,276,1318	36.0	38.0	37.0		2166,2166	-4.0	0.0	1	dbSNP_130	37	1482,4316		190,1102,1607	no	coding-synonymous,coding-synonymous	L1TD1	NM_001164835.1,NM_019079.4	,	209,1378,2925	GG,GA,AA		25.5605,9.7334,19.9025	,	722/866,722/866	62676612	1796,7228	1613	2899	4512	SO:0001819	synonymous_variant	54596	exon5			AATTAAAGAAATA	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.2166A>G	1.37:g.62676612A>G		Somatic	395	0	0		WXS	Illumina HiSeq	Phase_I	399	14	0.0350877	NM_001164835	Q8NDA1|Q9NUV8|Q9NV78	Silent	SNP	ENST00000498273.1	37	CCDS619.1																																																																																			A|0.804;G|0.196	0.196	strong		0.358	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079	
SLC9A3	6550	hgsc.bcm.edu	37	5	483564	483564	+	Silent	SNP	A	A	G	rs56098739	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:483564A>G	ENST00000264938.3	-	6	975	c.966T>C	c.(964-966)taT>taC	p.Y322Y	CTD-2228K2.7_ENST00000606288.1_RNA|SLC9A3_ENST00000514375.1_Silent_p.Y322Y|CTD-2228K2.7_ENST00000607286.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	322					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TGGCCTTCACATACTTCTGAC	0.632													a|||	512	0.102236	0.0068	0.2061	5008	,	,		17448	0.001		0.2793	False		,,,				2504	0.0798				p.Y322Y		Atlas-SNP	.											SLC9A3,NS,carcinoma,0,1	SLC9A3	89	1	0			c.T966C						scavenged	.	A		215,4179		4,207,1986	45.0	32.0	37.0		966	-2.6	1.0	5	dbSNP_129	37	2096,6494		276,1544,2475	no	coding-synonymous	SLC9A3	NM_004174.2		280,1751,4461	GG,GA,AA		24.4005,4.893,17.7988		322/835	483564	2311,10673	2197	4295	6492	SO:0001819	synonymous_variant	6550	exon6			CTTCACATACTTC		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.966T>C	5.37:g.483564A>G		Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	176	5	0.0284091	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Silent	SNP	ENST00000264938.3	37	CCDS3855.1																																																																																			A|0.839;G|0.161	0.161	strong		0.632	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
HYDIN	54768	hgsc.bcm.edu	37	16	71015329	71015329	+	Missense_Mutation	SNP	G	G	T	rs78763837	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:71015329G>T	ENST00000393567.2	-	29	4625	c.4475C>A	c.(4474-4476)cCc>cAc	p.P1492H		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1492					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCAGATTTGGGGAAAGATTCC	0.483													G|||	2340	0.467252	0.4455	0.5591	5008	,	,		18143	0.5645		0.328	False		,,,				2504	0.4744				p.P1492H		Atlas-SNP	.											LOC652153,NS,haematopoietic_neoplasm,0,2	HYDIN	788	2	0			c.C4475A						scavenged	.						66.0	66.0	66.0					16																	71015329		1844	4072	5916	SO:0001583	missense	54768	exon29			ATTTGGGGAAAGA	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4475C>A	16.37:g.71015329G>T	ENSP00000377197:p.Pro1492His	Somatic	151	1	0.00662252		WXS	Illumina HiSeq	Phase_I	170	6	0.0352941	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	964	0.4413919413919414	233	0.4735772357723577	184	0.5082872928176796	312	0.5454545454545454	235	0.3100263852242744	G	24.0	4.480970	0.84747	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01221	5.15	4.26	4.26	0.50523	.	0.000000	0.33023	U	0.005376	T	0.00012	0.0000	M	0.80183	2.485	0.09310	P	1.0	D	0.89917	1.0	D	0.91635	0.999	T	0.45056	-0.9287	9	0.49607	T	0.09	.	16.6224	0.84934	0.0:0.0:1.0:0.0	.	1491	F8WD23	.	H	1492;1491	ENSP00000377197:P1492H	ENSP00000313052:P1491H	P	-	2	0	HYDIN	69572830	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.105000	0.94246	2.083000	0.62718	0.603000	0.83216	CCC	.	.	weak		0.483	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
RYR1	6261	hgsc.bcm.edu	37	19	38994910	38994910	+	Silent	SNP	G	G	A	rs2229144	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:38994910G>A	ENST00000359596.3	+	50	7977	c.7977G>A	c.(7975-7977)acG>acA	p.T2659T	RYR1_ENST00000360985.3_Silent_p.T2659T|RYR1_ENST00000355481.4_Silent_p.T2659T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2659	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.T2659T(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCCTACCCACGGGCTGGGCCA	0.587													A|||	2065	0.41234	0.5182	0.3689	5008	,	,		17530	0.3532		0.2982	False		,,,				2504	0.4785				p.T2659T		Atlas-SNP	.											RYR1,NS,carcinoma,0,1	RYR1	708	1	1	Substitution - coding silent(1)	stomach(1)	c.G7977A						scavenged	.	A	,	2016,2390	613.2+/-392.1	457,1102,644	75.0	63.0	67.0		7977,7977	-7.9	0.3	19	dbSNP_98	67	2140,6460	715.0+/-406.0	286,1568,2446	no	coding-synonymous,coding-synonymous	RYR1	NM_000540.2,NM_001042723.1	,	743,2670,3090	AA,AG,GG		24.8837,45.7558,31.9545	,	2659/5039,2659/5034	38994910	4156,8850	2203	4300	6503	SO:0001819	synonymous_variant	6261	exon50			ACCCACGGGCTGG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7977G>A	19.37:g.38994910G>A		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	86	2	0.0232558	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																			G|0.657;A|0.343	0.343	strong		0.587	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
IFT22	64792	hgsc.bcm.edu	37	7	100958542	100958542	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:100958542T>G	ENST00000315322.4	-	5	524	c.431A>C	c.(430-432)aAg>aCg	p.K144T	RABL5_ENST00000495166.1_5'UTR|RABL5_ENST00000498704.2_Missense_Mutation_p.K67T|RABL5_ENST00000437644.2_Missense_Mutation_p.K114T|RABL5_ENST00000517481.1_Missense_Mutation_p.K67T	NM_022777.2	NP_073614.1	Q9H7X7	IFT22_HUMAN		144					small GTPase mediated signal transduction (GO:0007264)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7	Lung NSC(181;0.215)					GTGCACCAGCTTCAGCTTGTT	0.423											OREG0018221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K144T		Atlas-SNP	.											.	RABL5	15	.	0			c.A431C						PASS	.						86.0	83.0	84.0					7																	100958542		2203	4300	6503	SO:0001583	missense	64792	exon5			ACCAGCTTCAGCT																												ENST00000315322.4:c.431A>C	7.37:g.100958542T>G	ENSP00000320359:p.Lys144Thr	Somatic	90	0	0	1355	WXS	Illumina HiSeq	Phase_I	99	36	0.363636	NM_022777	Q49AG1|Q69YV5|Q9BSW4	Missense_Mutation	SNP	ENST00000315322.4	37	CCDS5719.1	.	.	.	.	.	.	.	.	.	.	T	8.424	0.846993	0.17034	.	.	ENSG00000128581	ENST00000517481;ENST00000315322;ENST00000498704;ENST00000437644	T	0.46451	0.87	5.41	3.03	0.35002	.	0.473361	0.23614	N	0.046303	T	0.24275	0.0588	L	0.27053	0.805	0.28871	N	0.894977	B;B	0.14438	0.01;0.004	B;B	0.12156	0.007;0.003	T	0.16070	-1.0415	10	0.21540	T	0.41	-21.9243	4.6961	0.12804	0.0:0.1701:0.1616:0.6684	.	114;144	Q9H7X7-2;Q9H7X7	.;RABL5_HUMAN	T	67;144;67;114	ENSP00000320359:K144T	ENSP00000320359:K144T	K	-	2	0	RABL5	100745262	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	0.568000	0.23623	0.360000	0.24265	0.533000	0.62120	AAG	.	.	none		0.423	RABL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347565.1		
AHCTF1	25909	hgsc.bcm.edu	37	1	247021085	247021085	+	Silent	SNP	G	G	C	rs41308162	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:247021085G>C	ENST00000391829.2	-	30	4287	c.4164C>G	c.(4162-4164)ctC>ctG	p.L1388L	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000366508.1_Silent_p.L1423L|AHCTF1_ENST00000326225.3_Silent_p.L1397L			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1388	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTGCAACTAAGAGATCCTTTG	0.343													G|||	913	0.182308	0.4728	0.0821	5008	,	,		17161	0.0079		0.0875	False		,,,				2504	0.138				p.L1397L	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											AHCTF1,NS,carcinoma,0,1	AHCTF1	187	1	0			c.C4191G						scavenged	.	G		1838,2568	522.5+/-370.8	388,1062,753	61.0	62.0	62.0		4191	2.3	0.0	1	dbSNP_127	62	738,7862	178.5+/-227.8	32,674,3594	no	coding-synonymous	AHCTF1	NM_015446.4		420,1736,4347	CC,CG,GG		8.5814,41.7158,19.8062		1397/2276	247021085	2576,10430	2203	4300	6503	SO:0001819	synonymous_variant	25909	exon30			AACTAAGAGATCC		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4164C>G	1.37:g.247021085G>C		Somatic	300	0	0		WXS	Illumina HiSeq	Phase_I	263	6	0.0228137	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	ENST00000391829.2	37																																																																																				G|0.826;C|0.174	0.174	strong		0.343	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
CENPE	1062	hgsc.bcm.edu	37	4	104102563	104102563	+	Silent	SNP	T	T	C	rs17217250	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:104102563T>C	ENST00000265148.3	-	12	1103	c.1014A>G	c.(1012-1014)gtA>gtG	p.V338V	CENPE_ENST00000380026.3_Silent_p.V338V|CENPE_ENST00000509120.1_5'UTR	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	338					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.V338V(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CATCAGTTGATACCTCATTAA	0.294													T|||	599	0.119609	0.0552	0.1153	5008	,	,		14600	0.1419		0.2207	False		,,,				2504	0.0828				p.V338V		Atlas-SNP	.											CENPE,NS,carcinoma,0,1	CENPE	253	1	1	Substitution - coding silent(1)	stomach(1)	c.A1014G						scavenged	.	T		250,4146	142.3+/-177.5	8,234,1956	62.0	62.0	62.0		1014	-3.2	1.0	4	dbSNP_123	62	1770,6810	313.0+/-311.1	193,1384,2713	no	coding-synonymous	CENPE	NM_001813.2		201,1618,4669	CC,CT,TT		20.6294,5.687,15.5672		338/2702	104102563	2020,10956	2198	4290	6488	SO:0001819	synonymous_variant	1062	exon12			AGTTGATACCTCA	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.1014A>G	4.37:g.104102563T>C		Somatic	592	3	0.00506757		WXS	Illumina HiSeq	Phase_I	549	20	0.0364299	NM_001813	A6NKY9|A8K2U7|Q4LE75	Silent	SNP	ENST00000265148.3	37	CCDS34042.1																																																																																			T|0.840;C|0.160	0.160	strong		0.294	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
LPPR1	54886	hgsc.bcm.edu	37	9	104079734	104079734	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:104079734G>T	ENST00000374874.3	+	7	1340	c.901G>T	c.(901-903)Gct>Tct	p.A301S	LPPR1_ENST00000395056.2_Missense_Mutation_p.A301S	NM_207299.1	NP_997182.1	Q8TBJ4	LPPR1_HUMAN		301					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)										ACCCCTAATGGCTTTCCCAAG	0.493																																					p.A301S		Atlas-SNP	.											.	.	.	.	0			c.G901T						PASS	.						115.0	121.0	119.0					9																	104079734		2203	4300	6503	SO:0001583	missense	0	exon7			CTAATGGCTTTCC																												ENST00000374874.3:c.901G>T	9.37:g.104079734G>T	ENSP00000364008:p.Ala301Ser	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	134	41	0.30597	NM_207299	Q5VX23|Q9NXE2	Missense_Mutation	SNP	ENST00000374874.3	37	CCDS6751.1	.	.	.	.	.	.	.	.	.	.	G	8.333	0.826970	0.16749	.	.	ENSG00000148123	ENST00000374874;ENST00000374871;ENST00000395056	T;T	0.28454	1.61;1.61	5.79	5.79	0.91817	.	0.062463	0.64402	D	0.000004	T	0.19167	0.0460	N	0.19112	0.55	0.53688	D	0.999973	B;B	0.29378	0.004;0.243	B;B	0.21917	0.005;0.037	T	0.06267	-1.0836	10	0.02654	T	1	-36.4594	19.0195	0.92908	0.0:0.0:1.0:0.0	.	285;301	B7Z8P4;Q8TBJ4	.;LPPR1_HUMAN	S	301	ENSP00000364008:A301S;ENSP00000378496:A301S	ENSP00000364005:A301S	A	+	1	0	RP11-35N6.1	103119555	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.250000	0.78287	2.746000	0.94184	0.655000	0.94253	GCT	.	.	none		0.493	LPPR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053425.1		
KRTAP9-4	85280	hgsc.bcm.edu	37	17	39406409	39406409	+	Missense_Mutation	SNP	C	C	A	rs2191379	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:39406409C>A	ENST00000334109.2	+	1	471	c.437C>A	c.(436-438)tCc>tAc	p.S146Y		NM_033191.2	NP_149461.2	Q9BYQ2	KRA94_HUMAN	keratin associated protein 9-4	146	15 X 5 AA repeats of C-C-[RQVGE]-[SPTN]- [TASPF].		S -> Y (in dbSNP:rs62065349). {ECO:0000269|PubMed:11279113, ECO:0000269|PubMed:15489334}.			keratin filament (GO:0045095)				breast(1)|large_intestine(1)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			ACCTGTGTGTCCAGCTGCTGT	0.552													.|||	3385	0.675919	0.5053	0.8012	5008	,	,		21709	0.631		0.7336	False		,,,				2504	0.8047				p.S146Y		Atlas-SNP	.											.	KRTAP9-4	30	.	0			c.C437A						PASS	.	C	TYR/SER	2292,2114		611,1070,522	169.0	170.0	170.0		437	1.4	0.0	17	dbSNP_96	170	6228,2372		2222,1784,294	no	missense	KRTAP9-4	NM_033191.2	144	2833,2854,816	AA,AC,CC		27.5814,47.98,34.4918	benign	146/155	39406409	8520,4486	2203	4300	6503	SO:0001583	missense	85280	exon1			GTGTGTCCAGCTG	AJ406948	CCDS11386.1	17q21.2	2013-06-25			ENSG00000241595	ENSG00000241595		"""Keratin associated proteins"""	18902	protein-coding gene	gene with protein product						11279113	Standard	NM_033191		Approved	KAP9.4	uc002hwi.3	Q9BYQ2	OTTHUMG00000133438	ENST00000334109.2:c.437C>A	17.37:g.39406409C>A	ENSP00000334922:p.Ser146Tyr	Somatic	246	0	0		WXS	Illumina HiSeq	Phase_I	242	12	0.0495868	NM_033191	Q0VAE3	Missense_Mutation	SNP	ENST00000334109.2	37	CCDS11386.1	1460	0.6684981684981685	257	0.5223577235772358	282	0.7790055248618785	368	0.6433566433566433	553	0.7295514511873351	.	10.72	1.429114	0.25726	0.5202	0.724186	ENSG00000241595	ENST00000334109	T	0.01126	5.3	2.38	1.38	0.22167	.	.	.	.	.	T	0.00012	0.0000	L	0.39898	1.24	0.80722	P	0.0	B	0.31769	0.339	B	0.28709	0.093	T	0.01382	-1.1369	8	0.39692	T	0.17	.	4.3378	0.11095	0.0:0.7905:0.0:0.2095	rs62065349	146	Q9BYQ2	KRA94_HUMAN	Y	146	ENSP00000334922:S146Y	ENSP00000334922:S146Y	S	+	2	0	KRTAP9-4	36659935	0.947000	0.32204	0.008000	0.14137	0.507000	0.33981	-0.100000	0.10990	0.535000	0.28714	0.393000	0.25936	TCC	C|0.336;A|0.664	0.664	strong		0.552	KRTAP9-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257306.1		
STEAP2	261729	hgsc.bcm.edu	37	7	89856644	89856644	+	Silent	SNP	C	C	T	rs2016903	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:89856644C>T	ENST00000287908.3	+	3	1245	c.852C>T	c.(850-852)taC>taT	p.Y284Y	STEAP2_ENST00000394629.2_Silent_p.Y284Y|STEAP2_ENST00000394632.1_Silent_p.Y284Y|STEAP2_ENST00000394626.1_Silent_p.Y284Y|STEAP2_ENST00000394622.2_Silent_p.Y284Y|STEAP2_ENST00000394621.2_Silent_p.Y284Y|STEAP2_ENST00000402625.2_Silent_p.Y284Y	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	284	Ferric oxidoreductase.				copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					AACTTTATTACGGCACCAAGT	0.408													C|||	392	0.0782748	0.0136	0.0821	5008	,	,		18256	0.0149		0.2097	False		,,,				2504	0.093				p.Y284Y		Atlas-SNP	.											STEAP2_ENST00000394626,NS,adenoma,0,2	STEAP2	78	2	0			c.C852T						scavenged	.	C	,,	251,4155	144.6+/-179.5	12,227,1964	87.0	85.0	86.0		852,852,852	-5.2	1.0	7	dbSNP_92	86	1939,6661	340.8+/-323.8	220,1499,2581	no	coding-synonymous,coding-synonymous,coding-synonymous	STEAP2	NM_001040665.1,NM_001040666.1,NM_152999.3	,,	232,1726,4545	TT,TC,CC		22.5465,5.6968,16.8384	,,	284/491,284/455,284/491	89856644	2190,10816	2203	4300	6503	SO:0001819	synonymous_variant	261729	exon4			TTATTACGGCACC	AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.852C>T	7.37:g.89856644C>T		Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	197	5	0.0253807	NM_001244946	A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Silent	SNP	ENST00000287908.3	37	CCDS5615.1																																																																																			C|0.869;T|0.131	0.131	strong		0.408	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059662.4	NM_152999	
SPNS3	201305	hgsc.bcm.edu	37	17	4351560	4351560	+	Silent	SNP	G	G	A	rs12450838	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:4351560G>A	ENST00000355530.2	+	6	1012	c.732G>A	c.(730-732)agG>agA	p.R244R	SPNS3_ENST00000333476.2_Silent_p.R117R|SPNS3_ENST00000576069.1_3'UTR	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	244					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						GAGGCTTCAGGAGCAGCTGGT	0.622													G|||	1251	0.2498	0.0794	0.4669	5008	,	,		18277	0.1151		0.3469	False		,,,				2504	0.365				p.R244R		Atlas-SNP	.											.	SPNS3	52	.	0			c.G732A						PASS	.	G		513,3893	231.4+/-245.2	30,453,1720	46.0	40.0	42.0		732	2.1	1.0	17	dbSNP_120	42	3190,5410	475.0+/-369.0	584,2022,1694	no	coding-synonymous	SPNS3	NM_182538.4		614,2475,3414	AA,AG,GG		37.093,11.6432,28.4715		244/513	4351560	3703,9303	2203	4300	6503	SO:0001819	synonymous_variant	201305	exon6			CTTCAGGAGCAGC		CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.732G>A	17.37:g.4351560G>A		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	77	6	0.0779221	NM_182538	Q8IZ31	Silent	SNP	ENST00000355530.2	37	CCDS11045.1																																																																																			G|0.750;A|0.250	0.250	strong		0.622	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438793.1	NM_182538	
ANKRD27	84079	hgsc.bcm.edu	37	19	33098632	33098632	+	Missense_Mutation	SNP	G	G	C	rs2302970	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:33098632G>C	ENST00000306065.4	-	23	2440	c.2282C>G	c.(2281-2283)cCc>cGc	p.P761R	SNORA68_ENST00000364518.1_RNA	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	761			P -> R (in dbSNP:rs2302970). {ECO:0000269|PubMed:11230166}.		early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CAGCAGGAGGGGGATGAGGTC	0.692													G|||	1328	0.265176	0.0537	0.3329	5008	,	,		15307	0.0923		0.5517	False		,,,				2504	0.3865				p.P761R		Atlas-SNP	.											.	ANKRD27	86	.	0			c.C2282G						PASS	.	G	ARG/PRO	593,3813	246.5+/-255.1	38,517,1648	38.0	34.0	35.0		2282	-0.6	0.2	19	dbSNP_100	35	4820,3780	578.0+/-390.6	1337,2146,817	yes	missense	ANKRD27	NM_032139.2	103	1375,2663,2465	CC,CG,GG		43.9535,13.4589,41.6193	benign	761/1051	33098632	5413,7593	2203	4300	6503	SO:0001583	missense	84079	exon23			AGGAGGGGGATGA	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2282C>G	19.37:g.33098632G>C	ENSP00000304292:p.Pro761Arg	Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	127	6	0.0472441	NM_032139	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	37	CCDS32986.1	644	0.2948717948717949	26	0.052845528455284556	138	0.3812154696132597	51	0.08916083916083917	429	0.5659630606860159	G	1.489	-0.555202	0.03967	0.134589	0.560465	ENSG00000105186	ENST00000306065	T	0.61627	0.09	5.7	-0.569	0.11756	Ankyrin repeat-containing domain (4);	0.316688	0.27379	N	0.019638	T	0.00012	0.0000	N	0.00453	-1.485	0.80722	P	0.0	B	0.11235	0.004	B	0.10450	0.005	T	0.48007	-0.9072	9	0.33141	T	0.24	-5.4917	2.458	0.04534	0.202:0.2284:0.4524:0.1172	rs2302970;rs2302970	761	Q96NW4	ANR27_HUMAN	R	761	ENSP00000304292:P761R	ENSP00000304292:P761R	P	-	2	0	ANKRD27	37790472	0.929000	0.31497	0.233000	0.24025	0.396000	0.30629	0.470000	0.22084	0.350000	0.24002	0.655000	0.94253	CCC	G|0.651;C|0.349	0.349	strong		0.692	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
FNDC3B	64778	hgsc.bcm.edu	37	3	172046861	172046861	+	Silent	SNP	T	T	C	rs2270568	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:172046861T>C	ENST00000336824.4	+	12	1473	c.1374T>C	c.(1372-1374)ggT>ggC	p.G458G	FNDC3B_ENST00000415807.2_Silent_p.G458G|FNDC3B_ENST00000416957.1_Silent_p.G458G	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	458	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.G458G(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		ACGACATTGGTACCAGGTATG	0.527													C|||	2898	0.578674	0.7194	0.4611	5008	,	,		18976	0.5109		0.4523	False		,,,				2504	0.6718				p.G458G		Atlas-SNP	.											FNDC3B,NS,carcinoma,0,1	FNDC3B	118	1	1	Substitution - coding silent(1)	stomach(1)	c.T1374C						scavenged	.	C	,	2953,1453	469.2+/-355.4	1005,943,255	172.0	162.0	165.0		1374,1374	4.8	1.0	3	dbSNP_100	165	3670,4930	622.1+/-397.3	750,2170,1380	yes	coding-synonymous,coding-synonymous	FNDC3B	NM_001135095.1,NM_022763.3	,	1755,3113,1635	CC,CT,TT		42.6744,32.9778,49.0773	,	458/1205,458/1205	172046861	6623,6383	2203	4300	6503	SO:0001819	synonymous_variant	64778	exon12			CATTGGTACCAGG	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1374T>C	3.37:g.172046861T>C		Somatic	187	1	0.00534759		WXS	Illumina HiSeq	Phase_I	178	8	0.0449438	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	ENST00000336824.4	37	CCDS3217.1																																																																																			T|0.483;C|0.517	0.517	strong		0.527	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
CCHCR1	54535	hgsc.bcm.edu	37	6	31116246	31116246	+	Missense_Mutation	SNP	G	G	A	rs130068	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:31116246G>A	ENST00000376266.5	-	10	1371	c.1249C>T	c.(1249-1251)Cgg>Tgg	p.R417W	CCHCR1_ENST00000451521.2_Missense_Mutation_p.R470W|CCHCR1_ENST00000396268.3_Missense_Mutation_p.R506W|CCHCR1_ENST00000480060.1_5'Flank|CCHCR1_ENST00000396263.2_Missense_Mutation_p.R417W	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	417			R -> Q (in dbSNP:rs130069). {ECO:0000269|PubMed:11348465, ECO:0000269|PubMed:14702039}.|R -> W (in dbSNP:rs130068). {ECO:0000269|PubMed:10545595, ECO:0000269|PubMed:10888604, ECO:0000269|PubMed:11348465, ECO:0000269|PubMed:11875053, ECO:0000269|PubMed:14574404, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						TGCTGCCACCGACGCCTGGCC	0.637													G|||	2053	0.409944	0.4175	0.4308	5008	,	,		17108	0.2966		0.4662	False		,,,				2504	0.4438				p.R506W		Atlas-SNP	.											.	CCHCR1	68	.	0			c.C1516T						PASS	.		TRP/ARG,TRP/ARG,TRP/ARG	1312,1710		280,752,479	96.0	95.0	95.0		1408,1516,1249	1.0	0.0	6	dbSNP_78	95	2408,3010		567,1274,868	yes	missense,missense,missense	CCHCR1	NM_001105563.1,NM_001105564.1,NM_019052.3	101,101,101	847,2026,1347	AA,AG,GG		44.4444,43.415,44.0758	benign,benign,benign	470/836,506/872,417/783	31116246	3720,4720	1511	2709	4220	SO:0001583	missense	54535	exon10			GCCACCGACGCCT	AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.1249C>T	6.37:g.31116246G>A	ENSP00000365442:p.Arg417Trp	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	99	7	0.0707071	NM_001105564	A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	Missense_Mutation	SNP	ENST00000376266.5	37	CCDS4695.1	894	0.40934065934065933	211	0.42886178861788615	157	0.43370165745856354	169	0.29545454545454547	357	0.470976253298153	g	3.862	-0.029722	0.07589	0.43415	0.444444	ENSG00000204536	ENST00000396268;ENST00000376266;ENST00000396263;ENST00000440185;ENST00000451521	T;T;T;T	0.04360	3.64;3.64;3.64;3.64	5.13	1.05	0.20165	.	0.626287	0.15688	N	0.249594	T	0.01189	0.0039	L	0.35288	1.05	0.80722	P	0.0	B;B;B;B	0.13145	0.0;0.001;0.007;0.003	B;B;B;B	0.10450	0.0;0.001;0.005;0.004	T	0.45220	-0.9276	9	0.41790	T	0.15	-24.6082	4.6098	0.12397	0.1777:0.0:0.5007:0.3217	rs130068;rs17190708;rs52790268	417;417;470;506	B4DIA2;Q8TD31;E9PE84;Q8TD31-2	.;CCHCR_HUMAN;.;.	W	506;417;417;417;470	ENSP00000379566:R506W;ENSP00000365442:R417W;ENSP00000379561:R417W;ENSP00000401039:R470W	ENSP00000365442:R417W	R	-	1	2	CCHCR1	31224225	0.001000	0.12720	0.010000	0.14722	0.097000	0.18754	0.281000	0.18810	0.209000	0.20645	-0.280000	0.10049	CGG	G|0.568;A|0.432	0.432	strong		0.637	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076190.5	NM_019052	
GEMIN5	25929	hgsc.bcm.edu	37	5	154300940	154300940	+	Silent	SNP	A	A	C	rs348739	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:154300940A>C	ENST00000285873.7	-	10	1500	c.1425T>G	c.(1423-1425)acT>acG	p.T475T		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	475					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CCCAGGCTAAAGTATATACAG	0.388													A|||	3950	0.788738	0.5711	0.7666	5008	,	,		15413	0.8919		0.8867	False		,,,				2504	0.8916				p.T475T		Atlas-SNP	.											GEMIN5,colon,carcinoma,-2,1	GEMIN5	120	1	0			c.T1425G						scavenged	.	A		2800,1606	661.5+/-400.9	905,990,308	78.0	89.0	85.0		1425	-10.9	0.0	5	dbSNP_79	85	7832,768	784.5+/-407.6	3562,708,30	no	coding-synonymous	GEMIN5	NM_015465.3		4467,1698,338	CC,CA,AA		8.9302,36.4503,18.2531		475/1509	154300940	10632,2374	2203	4300	6503	SO:0001819	synonymous_variant	25929	exon10			GGCTAAAGTATAT	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.1425T>G	5.37:g.154300940A>C		Somatic	84	1	0.0119048		WXS	Illumina HiSeq	Phase_I	91	3	0.032967	NM_015465	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Silent	SNP	ENST00000285873.7	37	CCDS4330.1																																																																																			A|0.188;C|0.812	0.812	strong		0.388	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		
STPG2	285555	hgsc.bcm.edu	37	4	98893437	98893437	+	Silent	SNP	A	A	G	rs783960	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:98893437A>G	ENST00000295268.3	-	7	1016	c.927T>C	c.(925-927)gaT>gaC	p.D309D		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	309								p.D309D(1)									TTACCTGATAATCAGCAGGTC	0.348													A|||	2048	0.408946	0.3707	0.5403	5008	,	,		15222	0.2431		0.4742	False		,,,				2504	0.4714				p.D309D		Atlas-SNP	.											C4orf37,NS,carcinoma,0,2	.	.	2	1	Substitution - coding silent(1)	prostate(1)	c.T927C						scavenged	.	A		1578,2828	489.9+/-361.6	297,984,922	73.0	74.0	74.0		927	-1.8	0.8	4	dbSNP_86	74	3999,4601	551.5+/-385.9	936,2127,1237	no	coding-synonymous	C4orf37	NM_174952.2		1233,3111,2159	GG,GA,AA		46.5,35.8148,42.8802		309/460	98893437	5577,7429	2203	4300	6503	SO:0001819	synonymous_variant	285555	exon7			CTGATAATCAGCA	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.927T>C	4.37:g.98893437A>G		Somatic	330	0	0		WXS	Illumina HiSeq	Phase_I	296	5	0.0168919	NM_174952		Silent	SNP	ENST00000295268.3	37	CCDS3645.1																																																																																			A|0.578;G|0.422	0.422	strong		0.348	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
L1TD1	54596	hgsc.bcm.edu	37	1	62675619	62675619	+	Silent	SNP	C	C	T	rs4625314	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:62675619C>T	ENST00000498273.1	+	4	1468	c.1173C>T	c.(1171-1173)gcC>gcT	p.A391A	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	391	Glu-rich.							p.A391A(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						ATGAAGAGGCCTCAGGGATGG	0.493													C|||	1495	0.298522	0.2769	0.3473	5008	,	,		16813	0.1091		0.492	False		,,,				2504	0.2894				p.A391A		Atlas-SNP	.											L1TD1,NS,carcinoma,0,1	L1TD1	114	1	1	Substitution - coding silent(1)	stomach(1)	c.C1173T						scavenged	.	C	,	1485,2921	448.1+/-348.6	247,991,965	60.0	67.0	64.0		1173,1173	-2.5	0.0	1	dbSNP_111	64	4405,4193	563.7+/-388.2	1145,2115,1039	no	coding-synonymous,coding-synonymous	L1TD1	NM_001164835.1,NM_019079.4	,	1392,3106,2004	TT,TC,CC		48.7672,33.704,45.2938	,	391/866,391/866	62675619	5890,7114	2203	4299	6502	SO:0001819	synonymous_variant	54596	exon5			AGAGGCCTCAGGG	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1173C>T	1.37:g.62675619C>T		Somatic	280	2	0.00714286		WXS	Illumina HiSeq	Phase_I	185	9	0.0486486	NM_001164835	Q8NDA1|Q9NUV8|Q9NV78	Silent	SNP	ENST00000498273.1	37	CCDS619.1																																																																																			C|0.605;T|0.395	0.395	strong		0.493	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079	
AATK	9625	hgsc.bcm.edu	37	17	79098602	79098602	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:79098602C>T	ENST00000326724.4	-	9	911	c.887G>A	c.(886-888)tGg>tAg	p.W296*	AATK_ENST00000572339.1_5'Flank|MIR338_ENST00000390137.2_RNA|AATK_ENST00000417379.1_Nonsense_Mutation_p.W193*|MIR657_ENST00000385003.1_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	296	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TGGCGCGATCCAGCGCAGAGG	0.667																																					p.W296X		Atlas-SNP	.											.	AATK	102	.	0			c.G887A						PASS	.						36.0	43.0	40.0					17																	79098602		2171	4255	6426	SO:0001587	stop_gained	9625	exon9			GCGATCCAGCGCA	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.887G>A	17.37:g.79098602C>T	ENSP00000324196:p.Trp296*	Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	92	5	0.0543478	NM_001080395	O75136|Q6ZN31|Q86X28	Nonsense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.718074|6.718074	0.97784|0.97784	.|.	.|.	ENSG00000181409|ENSG00000181409	ENST00000417379|ENST00000326724;ENST00000374792	.|.	.|.	.|.	3.86|3.86	3.86|3.86	0.44501|0.44501	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|.	0.34571|.	0.0902|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.33317|.	-0.9873|.	3|.	.|0.02654	.|T	.|1	.|.	14.7321|14.7321	0.69388|0.69388	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	R|X	249|296	.|.	.|ENSP00000324196:W296X	G|W	-|-	1|2	0|0	AATK|AATK	76713197|76713197	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.907000|0.907000	0.53573|0.53573	5.431000|5.431000	0.66507|0.66507	1.982000|1.982000	0.57802|0.57802	0.591000|0.591000	0.81541|0.81541	GGA|TGG	.	.	none		0.667	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
ZDBF2	57683	hgsc.bcm.edu	37	2	207172627	207172627	+	Silent	SNP	A	A	G	rs7582864	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:207172627A>G	ENST00000374423.3	+	5	3761	c.3375A>G	c.(3373-3375)caA>caG	p.Q1125Q		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1125							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TTTCTGTCCAATCTGTGGCTG	0.343													a|||	2293	0.457867	0.326	0.6066	5008	,	,		19868	0.3571		0.5636	False		,,,				2504	0.5256				p.Q1125Q		Atlas-SNP	.											ZDBF2_ENST00000374423,NS,carcinoma,0,2	ZDBF2	531	2	0			c.A3375G						scavenged	.	G		1460,2232		300,860,686	50.0	47.0	48.0		3375	-4.3	0.0	2	dbSNP_116	48	4868,3302		1450,1968,667	no	coding-synonymous	ZDBF2	NM_020923.1		1750,2828,1353	GG,GA,AA		40.4162,39.545,46.6532		1125/2355	207172627	6328,5534	1846	4085	5931	SO:0001819	synonymous_variant	57683	exon5			TGTCCAATCTGTG	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.3375A>G	2.37:g.207172627A>G		Somatic	237	0	0		WXS	Illumina HiSeq	Phase_I	208	5	0.0240385	NM_020923	Q6ZNP7|Q6ZSN8	Silent	SNP	ENST00000374423.3	37	CCDS46501.1																																																																																			A|0.540;G|0.460	0.460	strong		0.343	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
ZNF248	57209	hgsc.bcm.edu	37	10	38120720	38120720	+	Silent	SNP	C	C	T	rs1779132	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:38120720C>T	ENST00000395867.3	-	6	2113	c.1563G>A	c.(1561-1563)aaG>aaA	p.K521K	ZNF248_ENST00000494133.1_Intron|ZNF248_ENST00000374648.3_Intron|AL135791.1_ENST00000583461.1_RNA|ZNF248_ENST00000357328.4_Silent_p.K521K	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	521					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						ATTCATTACACTTATATGGTT	0.413													C|||	158	0.0315495	0.0015	0.0648	5008	,	,		20360	0.0		0.1024	False		,,,				2504	0.0082				p.K521K		Atlas-SNP	.											.	ZNF248	61	.	0			c.G1563A						PASS	.	C		79,4327	69.2+/-107.0	1,77,2125	115.0	107.0	110.0		1563	-0.5	1.0	10	dbSNP_89	110	756,7842	181.0+/-229.8	32,692,3575	no	coding-synonymous	ZNF248	NM_021045.1		33,769,5700	TT,TC,CC		8.7927,1.793,6.4211		521/580	38120720	835,12169	2203	4299	6502	SO:0001819	synonymous_variant	57209	exon6			ATTACACTTATAT	AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.1563G>A	10.37:g.38120720C>T		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	80	4	0.05	NM_001267597	Q8NDV8|Q9UMP3	Silent	SNP	ENST00000395867.3	37	CCDS7194.1																																																																																			C|0.937;T|0.063	0.063	strong		0.413	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047609.1	NM_021045	
RPAP1	26015	hgsc.bcm.edu	37	15	41826971	41826971	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:41826971A>G	ENST00000304330.4	-	6	820	c.704T>C	c.(703-705)cTg>cCg	p.L235P	RPAP1_ENST00000568413.1_5'Flank|RPAP1_ENST00000561603.1_Missense_Mutation_p.L235P	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	235						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CATGGCCTGCAGTCTTGCTAT	0.572																																					p.L235P		Atlas-SNP	.											.	RPAP1	111	.	0			c.T704C						PASS	.						123.0	98.0	107.0					15																	41826971		2203	4300	6503	SO:0001583	missense	26015	exon6			GCCTGCAGTCTTG	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.704T>C	15.37:g.41826971A>G	ENSP00000306123:p.Leu235Pro	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	43	15	0.348837	NM_015540	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.463125	0.84425	.	.	ENSG00000103932	ENST00000304330	T	0.35048	1.33	5.22	5.22	0.72569	RNA polymerase II-associated protein 1, N-terminal (1);	0.157253	0.43416	D	0.000570	T	0.67439	0.2893	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76000	-0.3119	10	0.87932	D	0	-14.2976	14.084	0.64944	1.0:0.0:0.0:0.0	.	235	Q9BWH6	RPAP1_HUMAN	P	235	ENSP00000306123:L235P	ENSP00000306123:L235P	L	-	2	0	RPAP1	39614263	1.000000	0.71417	0.743000	0.31040	0.974000	0.67602	8.707000	0.91367	1.977000	0.57605	0.402000	0.26972	CTG	.	.	none		0.572	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540	
OPA1	4976	hgsc.bcm.edu	37	3	193334991	193334991	+	Missense_Mutation	SNP	G	G	A	rs7624750	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:193334991G>A	ENST00000392438.3	+	4	707	c.473G>A	c.(472-474)aGt>aAt	p.S158N	OPA1_ENST00000361908.3_Missense_Mutation_p.S158N|OPA1-AS1_ENST00000444085.1_RNA|OPA1_ENST00000487986.1_3'UTR|OPA1_ENST00000361715.2_Intron|OPA1_ENST00000361510.2_Missense_Mutation_p.S158N|OPA1_ENST00000361828.2_Missense_Mutation_p.S158N|OPA1_ENST00000361150.2_Intron|OPA1-AS1_ENST00000433105.1_RNA	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	158			S -> N (in dbSNP:rs7624750). {ECO:0000269|PubMed:11440988, ECO:0000269|PubMed:11440989, ECO:0000269|PubMed:12036970, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:15948788, ECO:0000269|PubMed:16617242, ECO:0000269|PubMed:9628581}.		apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GCCCTTCCTAGTTCAGAAGAC	0.338													A|||	2344	0.468051	0.5847	0.4683	5008	,	,		16978	0.3681		0.4573	False		,,,				2504	0.4243				p.S158N		Atlas-SNP	.											OPA1,NS,carcinoma,0,1	OPA1	79	1	0			c.G473A						scavenged	.	A	ASN/SER,,,,ASN/SER,,ASN/SER,ASN/SER	2474,1930	539.4+/-375.3	696,1082,424	57.0	62.0	60.0		473,,,,473,,473,473	3.6	1.0	3	dbSNP_116	60	3988,4610	596.8+/-393.7	906,2176,1217	yes	missense,intron,intron,intron,missense,intron,missense,missense	OPA1	NM_015560.2,NM_130831.2,NM_130832.2,NM_130833.2,NM_130834.2,NM_130835.2,NM_130836.2,NM_130837.2	46,,,,46,,46,46	1602,3258,1641	AA,AG,GG		46.3829,43.8238,49.7	benign,,,,benign,,benign,benign	158/961,,,,158/979,,158/998,158/1016	193334991	6462,6540	2202	4299	6501	SO:0001583	missense	4976	exon4			TTCCTAGTTCAGA	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.473G>A	3.37:g.193334991G>A	ENSP00000376233:p.Ser158Asn	Somatic	410	0	0		WXS	Illumina HiSeq	Phase_I	459	10	0.0217865	NM_130836	D3DNW4	Missense_Mutation	SNP	ENST00000392438.3	37	CCDS43186.1	997|997	0.4565018315018315|0.4565018315018315	297|297	0.6036585365853658|0.6036585365853658	157|157	0.43370165745856354|0.43370165745856354	194|194	0.33916083916083917|0.33916083916083917	349|349	0.4604221635883905|0.4604221635883905	A|A	5.124|5.124	0.208417|0.208417	0.09757|0.09757	0.561762|0.561762	0.463829|0.463829	ENSG00000198836|ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361828;ENST00000419435;ENST00000392436|ENST00000434811	D;D;D;D;T;T|.	0.92965|.	-3.1;-3.14;-3.14;-3.13;1.97;-0.86|.	6.05|6.05	3.64|3.64	0.41730|0.41730	.|.	0.424265|.	0.28766|.	N|.	0.014207|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	P|P	0.999999999863361|0.999999999863361	B;B;B;B|.	0.06786|.	0.0;0.0;0.001;0.0|.	B;B;B;B|.	0.04013|.	0.001;0.0;0.001;0.0|.	T|T	0.44907|0.44907	-0.9297|-0.9297	9|4	0.16420|.	T|.	0.52|.	-8.8622|-8.8622	6.4094|6.4094	0.21682|0.21682	0.7267:0.1327:0.1406:0.0|0.7267:0.1327:0.1406:0.0	rs7624750;rs52806158;rs58655170;rs7624750|rs7624750;rs52806158;rs58655170;rs7624750	158;158;158;158|.	O60313;E5KLJ6;E5KLJ7;E5KLJ5|.	OPA1_HUMAN;.;.;.|.	N|I	158;158;158;158;34;158|58	ENSP00000354681:S158N;ENSP00000376233:S158N;ENSP00000355324:S158N;ENSP00000354429:S158N;ENSP00000399877:S34N;ENSP00000376231:S158N|.	ENSP00000355324:S158N|.	S|V	+|+	2|1	0|0	OPA1|OPA1	194817685|194817685	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.993000|0.993000	0.82548|0.82548	3.435000|3.435000	0.52849|0.52849	0.166000|0.166000	0.19597|0.19597	-0.269000|-0.269000	0.10298|0.10298	AGT|GTT	G|0.517;A|0.483	0.483	strong		0.338	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313812.2	NM_130837	
IFI44L	10964	hgsc.bcm.edu	37	1	79093818	79093818	+	Missense_Mutation	SNP	A	A	G	rs273259	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:79093818A>G	ENST00000370751.5	+	2	397	c.218A>G	c.(217-219)cAt>cGt	p.H73R	IFI44L_ENST00000476521.1_Intron|IFI44L_ENST00000342282.3_Intron	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	73			H -> R (in dbSNP:rs273259). {ECO:0000269|PubMed:17974005, ECO:0000269|Ref.1, ECO:0000269|Ref.2}.		defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						ATTAATTTACATGAAAGTTCT	0.328													G|||	2228	0.444888	0.3608	0.3545	5008	,	,		17848	0.751		0.3449	False		,,,				2504	0.41				p.H73R		Atlas-SNP	.											.	IFI44L	93	.	0			c.A218G						PASS	.	G	ARG/HIS	1658,2748	639.2+/-397.1	332,994,877	57.0	60.0	59.0		218	-6.2	0.0	1	dbSNP_79	59	2812,5788	669.2+/-402.6	463,1886,1951	yes	missense	IFI44L	NM_006820.2	29	795,2880,2828	GG,GA,AA		32.6977,37.6305,34.3688	benign	73/453	79093818	4470,8536	2203	4300	6503	SO:0001583	missense	10964	exon2			ATTTACATGAAAG	AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.218A>G	1.37:g.79093818A>G	ENSP00000359787:p.His73Arg	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	105	6	0.0571429	NM_006820	Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	ENST00000370751.5	37	CCDS687.2	979	0.4482600732600733	159	0.3231707317073171	115	0.31767955801104975	442	0.7727272727272727	263	0.3469656992084433	G	0.003	-2.572666	0.00133	0.376305	0.326977	ENSG00000137959	ENST00000452835;ENST00000370751;ENST00000450498	T;T;T	0.31510	1.49;3.18;2.58	3.1	-6.2	0.02072	.	4.699020	0.01184	N	0.007166	T	0.01558	0.0050	N	0.02011	-0.69	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.10590	-1.0623	9	0.13853	T	0.58	.	1.5275	0.02528	0.4325:0.2384:0.1325:0.1966	rs273259;rs481313;rs52793488;rs60945929;rs273259	73	Q53G44	IF44L_HUMAN	R	73;73;50	ENSP00000409914:H73R;ENSP00000359787:H73R;ENSP00000400784:H50R	ENSP00000359787:H73R	H	+	2	0	IFI44L	78866406	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.458000	0.00121	-6.276000	0.00005	-2.893000	0.00094	CAT	G|0.407;N|0.001	0.407	strong		0.328	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026834.3	NM_006820	
SPATA4	132851	hgsc.bcm.edu	37	4	177113836	177113836	+	Silent	SNP	C	C	T	rs6832177	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:177113836C>T	ENST00000280191.2	-	4	738	c.630G>A	c.(628-630)gcG>gcA	p.A210A	SPATA4_ENST00000515234.1_Silent_p.A37A	NM_144644.2	NP_653245.2	Q8NEY3	SPAT4_HUMAN	spermatogenesis associated 4	210						cytoplasm (GO:0005737)				NS(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)	22		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.9e-20)|Epithelial(43;1.99e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.58e-09)|GBM - Glioblastoma multiforme(59;0.000162)|STAD - Stomach adenocarcinoma(60;0.000543)|LUSC - Lung squamous cell carcinoma(193;0.096)		TGAGGAACTCCGCTTTAAGTT	0.373													c|||	1416	0.282748	0.2239	0.3646	5008	,	,		17787	0.255		0.3708	False		,,,				2504	0.2423				p.A210A		Atlas-SNP	.											SPATA4,NS,carcinoma,-1,1	SPATA4	44	1	0			c.G630A						scavenged	.	C		1120,3286	398.3+/-330.8	147,826,1230	88.0	91.0	90.0		630	-3.7	0.0	4	dbSNP_116	90	3042,5558	466.9+/-366.9	551,1940,1809	no	coding-synonymous	SPATA4	NM_144644.2		698,2766,3039	TT,TC,CC		35.3721,25.4199,32.0006		210/306	177113836	4162,8844	2203	4300	6503	SO:0001819	synonymous_variant	132851	exon4			GAACTCCGCTTTA	AY040204	CCDS3826.1	4q34.2	2008-02-05			ENSG00000150628	ENSG00000150628			17333	protein-coding gene	gene with protein product		609879					Standard	NM_144644		Approved	TSARG2, SPEF1B	uc003iuo.1	Q8NEY3	OTTHUMG00000160788	ENST00000280191.2:c.630G>A	4.37:g.177113836C>T		Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	212	3	0.0141509	NM_144644	Q8NCS5|Q8WW15	Silent	SNP	ENST00000280191.2	37	CCDS3826.1																																																																																			C|0.701;T|0.299	0.299	strong		0.373	SPATA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362326.1	NM_144644	
FBXO34	55030	hgsc.bcm.edu	37	14	55818517	55818517	+	Missense_Mutation	SNP	T	T	A	rs1045002	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:55818517T>A	ENST00000313833.4	+	2	1654	c.1409T>A	c.(1408-1410)aTt>aAt	p.I470N	FBXO34_ENST00000440021.1_Missense_Mutation_p.I470N	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	470			I -> N (in dbSNP:rs1045002). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.4}.					p.I470N(1)		breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						CAGCCTTCCATTTTAAACTCC	0.423													A|||	1661	0.331669	0.2322	0.3098	5008	,	,		20331	0.3185		0.4245	False		,,,				2504	0.3998				p.I470N		Atlas-SNP	.											FBXO34,NS,carcinoma,0,1	FBXO34	61	1	1	Substitution - Missense(1)	stomach(1)	c.T1409A						scavenged	.	A	ASN/ILE,ASN/ILE	1147,3259	713.6+/-408.3	154,839,1210	115.0	112.0	113.0		1409,1409	-0.8	0.0	14	dbSNP_86	113	3621,4979	624.3+/-397.6	780,2061,1459	yes	missense,missense	FBXO34	NM_017943.3,NM_152231.1	149,149	934,2900,2669	AA,AT,TT		42.1047,26.0327,36.66	benign,benign	470/712,470/712	55818517	4768,8238	2203	4300	6503	SO:0001583	missense	55030	exon2			CTTCCATTTTAAA	AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1409T>A	14.37:g.55818517T>A	ENSP00000313159:p.Ile470Asn	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	176	6	0.0340909	NM_017943	Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	ENST00000313833.4	37	CCDS32086.1	748	0.3424908424908425	118	0.23983739837398374	116	0.32044198895027626	191	0.3339160839160839	323	0.4261213720316623	A	0.013	-1.642727	0.00792	0.260327	0.421047	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.16457	2.34;2.34	5.48	-0.84	0.10755	.	1.461070	0.04686	N	0.413270	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.12837	0.008	T	0.48139	-0.9061	9	0.15499	T	0.54	-0.416	4.9015	0.13777	0.1197:0.4841:0.1548:0.2414	rs1045002;rs3168901;rs3742568;rs17674186;rs60147901;rs1045002	470	Q9NWN3	FBX34_HUMAN	N	470	ENSP00000313159:I470N;ENSP00000394117:I470N	ENSP00000313159:I470N	I	+	2	0	FBXO34	54888270	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-0.270000	0.08584	-0.639000	0.05502	-1.546000	0.00904	ATT	A|0.366;N|0.000	0.366	strong		0.423	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1		
ZSCAN20	7579	hgsc.bcm.edu	37	1	33960062	33960062	+	Silent	SNP	A	A	G	rs9943259	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:33960062A>G	ENST00000361328.3	+	8	2271	c.2118A>G	c.(2116-2118)gcA>gcG	p.A706A		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	706					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGTACCTTGCAGAGAAACCCT	0.478													G|||	3769	0.752596	0.8495	0.6239	5008	,	,		19525	0.7381		0.7376	False		,,,				2504	0.7434				p.A706A		Atlas-SNP	.											ZSCAN20,NS,carcinoma,+2,2	ZSCAN20	107	2	0			c.A2118G						scavenged	.	G		3487,663		1466,555,54	103.0	110.0	108.0		2118	-3.4	0.0	1	dbSNP_119	108	6701,1799		2643,1415,192	no	coding-synonymous	ZSCAN20	NM_145238.3		4109,1970,246	GG,GA,AA		21.1647,15.9759,19.4625		706/1044	33960062	10188,2462	2075	4250	6325	SO:0001819	synonymous_variant	7579	exon8			CCTTGCAGAGAAA	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.2118A>G	1.37:g.33960062A>G		Somatic	215	0	0		WXS	Illumina HiSeq	Phase_I	175	6	0.0342857	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	37	CCDS41300.1																																																																																			A|0.230;G|0.770	0.770	strong		0.478	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
NEB	4703	hgsc.bcm.edu	37	2	152499143	152499143	+	Missense_Mutation	SNP	C	C	T	rs35974308	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:152499143C>T	ENST00000172853.10	-	60	8465	c.8318G>A	c.(8317-8319)cGg>cAg	p.R2773Q	NEB_ENST00000604864.1_Missense_Mutation_p.R2773Q|NEB_ENST00000409198.1_Missense_Mutation_p.R2773Q|NEB_ENST00000603639.1_Missense_Mutation_p.R2773Q|NEB_ENST00000397345.3_Missense_Mutation_p.R2773Q|NEB_ENST00000427231.2_Missense_Mutation_p.R2773Q			P20929	NEBU_HUMAN	nebulin	2773			R -> Q (in dbSNP:rs35974308).		muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GGCATCTACCCGCATGTCATA	0.383													C|||	103	0.0205671	0.003	0.0086	5008	,	,		20553	0.0139		0.0258	False		,,,				2504	0.0542				p.R2773Q		Atlas-SNP	.											.	NEB	1697	.	0			c.G8318A						PASS	.	C	GLN/ARG,GLN/ARG,GLN/ARG	21,3741		0,21,1860	88.0	84.0	85.0		8318,8318,8318	6.2	0.9	2	dbSNP_126	85	234,7984		4,226,3879	yes	missense,missense,missense	NEB	NM_001164507.1,NM_001164508.1,NM_004543.4	43,43,43	4,247,5739	TT,TC,CC		2.8474,0.5582,2.1285	probably-damaging,probably-damaging,probably-damaging	2773/8526,2773/8526,2773/6670	152499143	255,11725	1881	4109	5990	SO:0001583	missense	4703	exon60			TCTACCCGCATGT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.8318G>A	2.37:g.152499143C>T	ENSP00000172853:p.Arg2773Gln	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	134	7	0.0522388	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		38	0.0173992673992674	2	0.0040650406504065045	6	0.016574585635359115	7	0.012237762237762238	23	0.030343007915567283	C	18.81	3.703758	0.68501	0.005582	0.028474	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.09723	3.19;3.13;3.13;2.95	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.21347	0.0514	M	0.91354	3.2	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.11792	-1.0573	10	0.36615	T	0.2	.	20.8794	0.99867	0.0:1.0:0.0:0.0	rs35974308	2773	P20929	NEBU_HUMAN	Q	2773	ENSP00000386259:R2773Q;ENSP00000380505:R2773Q;ENSP00000416578:R2773Q;ENSP00000172853:R2773Q	ENSP00000172853:R2773Q	R	-	2	0	NEB	152207389	0.992000	0.36948	0.925000	0.36789	0.006000	0.05464	3.918000	0.56432	2.941000	0.99782	0.655000	0.94253	CGG	C|0.981;T|0.019	0.019	strong		0.383	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
TLR2	7097	hgsc.bcm.edu	37	4	154624656	154624656	+	Silent	SNP	T	T	C	rs3804099	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:154624656T>C	ENST00000260010.6	+	1	2005	c.597T>C	c.(595-597)aaT>aaC	p.N199N		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	199					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	CAATTCAGAATGTAAGTCATC	0.378													C|||	2077	0.414736	0.6354	0.3329	5008	,	,		19466	0.2827		0.4354	False		,,,				2504	0.2894				p.N199N		Atlas-SNP	.											.	TLR2	84	.	0			c.T597C						PASS	.	C		2692,1714	515.0+/-368.8	812,1068,323	97.0	96.0	97.0		597	-5.9	0.0	4	dbSNP_107	97	3742,4858	615.9+/-396.4	796,2150,1354	no	coding-synonymous	TLR2	NM_003264.3		1608,3218,1677	CC,CT,TT		43.5116,38.9015,49.4695		199/785	154624656	6434,6572	2203	4300	6503	SO:0001819	synonymous_variant	7097	exon3			TCAGAATGTAAGT	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.597T>C	4.37:g.154624656T>C		Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	126	9	0.0714286	NM_003264	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Silent	SNP	ENST00000260010.6	37	CCDS3784.1																																																																																			T|0.532;C|0.468	0.468	strong		0.378	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365205.1		
SNAPC1	6617	hgsc.bcm.edu	37	14	62234030	62234030	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:62234030G>T	ENST00000216294.4	+	3	493	c.389G>T	c.(388-390)cGa>cTa	p.R130L	RP11-618G20.1_ENST00000555937.1_RNA	NM_003082.3	NP_003073.1	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex, polypeptide 1, 43kDa	130	SNAPC3-binding.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		AGGAAGCTACGACTAGACAGA	0.333																																					p.R130L	NSCLC(27;223 907 37180 39193 46568)	Atlas-SNP	.											SNAPC1,colon,carcinoma,0,1	SNAPC1	32	1	0			c.G389T						scavenged	.						95.0	95.0	95.0					14																	62234030		2203	4300	6503	SO:0001583	missense	6617	exon3			AGCTACGACTAGA	Z47542	CCDS9755.1	14q22	2008-08-11	2002-08-29		ENSG00000023608	ENSG00000023608			11134	protein-coding gene	gene with protein product		600591	"""small nuclear RNA activating complex, polypeptide 1, 43kD"""			9644240	Standard	NM_003082		Approved	SNAP43, PTFgamma	uc001xft.3	Q16533	OTTHUMG00000140343	ENST00000216294.4:c.389G>T	14.37:g.62234030G>T	ENSP00000216294:p.Arg130Leu	Somatic	182	2	0.010989		WXS	Illumina HiSeq	Phase_I	176	3	0.0170455	NM_003082		Missense_Mutation	SNP	ENST00000216294.4	37	CCDS9755.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.852236	0.51270	.	.	ENSG00000023608	ENST00000216294	.	.	.	5.87	5.87	0.94306	.	0.106538	0.64402	D	0.000004	T	0.58736	0.2143	L	0.29908	0.895	0.48762	D	0.999708	P	0.47604	0.898	P	0.55455	0.776	T	0.46555	-0.9183	9	0.02654	T	1	-0.0044	20.5827	0.99408	0.0:0.0:1.0:0.0	.	130	Q16533	SNPC1_HUMAN	L	130	.	ENSP00000216294:R130L	R	+	2	0	SNAPC1	61303783	0.993000	0.37304	1.000000	0.80357	0.999000	0.98932	5.101000	0.64566	2.941000	0.99782	0.655000	0.94253	CGA	.	.	none		0.333	SNAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276976.2	NM_003082	
MYC	4609	hgsc.bcm.edu	37	8	128750844	128750844	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:128750844C>T	ENST00000259523.6	+	2	1541	c.336C>T	c.(334-336)aaC>aaT	p.N112N	MYC_ENST00000524013.1_Silent_p.N126N|MYC_ENST00000377970.2_Silent_p.N127N			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	112					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACATGGTGAACCAGAGTTTCA	0.607		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N127N		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.C381T						PASS	.						65.0	65.0	65.0					8																	128750844		2203	4300	6503	SO:0001819	synonymous_variant	4609	exon2			GGTGAACCAGAGT		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.336C>T	8.37:g.128750844C>T		Somatic	118	0	0	1567	WXS	Illumina HiSeq	Phase_I	90	36	0.4	NM_002467	A8WFE7|P01107|Q14026	Silent	SNP	ENST00000259523.6	37																																																																																				.	.	none		0.607	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
ZNF280A	129025	hgsc.bcm.edu	37	22	22868776	22868776	+	Silent	SNP	G	G	A	rs362173	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr22:22868776G>A	ENST00000302097.3	-	2	1431	c.1179C>T	c.(1177-1179)ccC>ccT	p.P393P		NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GGCACACGTAGGGCATTTCGC	0.443													G|||	2379	0.47504	0.2405	0.7334	5008	,	,		19167	0.4137		0.7068	False		,,,				2504	0.4335				p.P393P		Atlas-SNP	.											ZNF280A,NS,adenoma,0,1	ZNF280A	67	1	0			c.C1179T						PASS	.	G		1355,3051	449.8+/-349.2	220,915,1068	123.0	102.0	109.0		1179	0.5	0.7	22	dbSNP_79	109	5846,2748	677.3+/-403.4	2005,1836,456	no	coding-synonymous	ZNF280A	NM_080740.3		2225,2751,1524	AA,AG,GG		31.9758,30.7535,44.6077		393/543	22868776	7201,5799	2203	4297	6500	SO:0001819	synonymous_variant	129025	exon2			CACGTAGGGCATT	D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.1179C>T	22.37:g.22868776G>A		Somatic	224	0	0		WXS	Illumina HiSeq	Phase_I	49	12	0.244898	NM_080740		Silent	SNP	ENST00000302097.3	37	CCDS13800.1																																																																																			G|0.454;A|0.546	0.546	strong		0.443	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075433.3	NM_080740	
FKBP15	23307	hgsc.bcm.edu	37	9	115931703	115931703	+	Silent	SNP	G	G	A	rs3810910	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:115931703G>A	ENST00000238256.3	-	26	3403	c.3286C>T	c.(3286-3288)Ctg>Ttg	p.L1096L		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	1096					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						GTCAGGGACAGTCTTGTGGAG	0.577													G|||	1420	0.283546	0.3351	0.2954	5008	,	,		17925	0.1617		0.3489	False		,,,				2504	0.2638				p.L1096L		Atlas-SNP	.											.	FKBP15	128	.	0			c.C3286T						PASS	.	G		1174,2710		177,820,945	96.0	98.0	98.0		3286	3.5	0.0	9	dbSNP_107	98	2704,5574		443,1818,1878	no	coding-synonymous	FKBP15	NM_015258.1		620,2638,2823	AA,AG,GG		32.6649,30.2266,31.8862		1096/1220	115931703	3878,8284	1942	4139	6081	SO:0001819	synonymous_variant	23307	exon26			GGGACAGTCTTGT	AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.3286C>T	9.37:g.115931703G>A		Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	121	7	0.0578512	NM_015258	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Silent	SNP	ENST00000238256.3	37	CCDS48007.1																																																																																			G|0.712;A|0.288	0.288	strong		0.577	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015258	
HLA-DRB5	3127	hgsc.bcm.edu	37	6	32487174	32487174	+	Missense_Mutation	SNP	C	C	G	rs112872773	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:32487174C>G	ENST00000374975.3	-	3	687	c.625G>C	c.(625-627)Gtg>Ctg	p.V209L		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						GGGCTCGTCACGCTTGGGTGC	0.498													C|||	573	0.114417	0.0454	0.2104	5008	,	,		12481	0.121		0.16	False		,,,				2504	0.0859				p.V209L		Atlas-SNP	.											HLA-DRB5,NS,carcinoma,0,1	HLA-DRB5	31	1	0			c.G625C						scavenged	.	C	LEU/VAL	203,3581		25,153,1714	73.0	83.0	80.0		625	-3.6	0.0	6	dbSNP_132	80	1085,6435		126,833,2801	no	missense	HLA-DRB5	NM_002125.3	32	151,986,4515	GG,GC,CC		14.4282,5.3647,11.3942	benign	209/267	32487174	1288,10016	1892	3760	5652	SO:0001583	missense	3127	exon3			TCGTCACGCTTGG		CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.625G>C	6.37:g.32487174C>G	ENSP00000364114:p.Val209Leu	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	65	2	0.0307692	NM_002125		Missense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	.	.	.	.	.	.	.	.	.	.	.	0.979	-0.697691	0.03279	0.053647	0.144282	ENSG00000198502	ENST00000374975	T	0.01629	4.72	4.36	-3.57	0.04612	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.816604	0.11096	N	0.600213	T	0.00073	0.0002	N	0.00008	-3.11	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.08055	0.002;0.003	T	0.38950	-0.9637	9	0.14656	T	0.56	.	1.4755	0.02425	0.3123:0.2462:0.3234:0.118	.	136;209	Q29973;Q30154	.;DRB5_HUMAN	L	209	ENSP00000364114:V209L	ENSP00000364114:V209L	V	-	1	0	HLA-DRB5	32595152	0.507000	0.26146	0.000000	0.03702	0.022000	0.10575	0.581000	0.23819	-0.961000	0.03609	-0.321000	0.08615	GTG	C|0.859;G|0.120;T|0.021	0.120	strong		0.498	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
ANGPT2	285	hgsc.bcm.edu	37	8	6377433	6377433	+	Silent	SNP	C	C	T	rs1961222	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:6377433C>T	ENST00000325203.5	-	5	1356	c.882G>A	c.(880-882)acG>acA	p.T294T	MCPH1_ENST00000344683.5_Intron|ANGPT2_ENST00000338312.6_Silent_p.T242T|ANGPT2_ENST00000523120.1_Silent_p.T293T|ANGPT2_ENST00000415216.1_Silent_p.T293T			O15123	ANGP2_HUMAN	angiopoietin 2	294	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to growth factor stimulus (GO:0071363)|germ cell development (GO:0007281)|glomerulus vasculature development (GO:0072012)|leukocyte migration (GO:0050900)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of positive chemotaxis (GO:0050928)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|Tie signaling pathway (GO:0048014)	cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(245;0.0663)		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)		AGATGCCATTCGTGGTGTGTC	0.433													C|||	750	0.14976	0.0121	0.2104	5008	,	,		19696	0.0516		0.3419	False		,,,				2504	0.1963				p.T294T		Atlas-SNP	.											.	ANGPT2	126	.	0			c.G882A						PASS	.	C	,,,	268,4138	151.0+/-185.0	7,254,1942	365.0	313.0	330.0		879,726,882,	-9.7	0.0	8	dbSNP_92	330	2903,5697	455.6+/-363.8	468,1967,1865	no	coding-synonymous,coding-synonymous,coding-synonymous,intron	ANGPT2,MCPH1	NM_001118887.1,NM_001118888.1,NM_001147.2,NM_024596.3	,,,	475,2221,3807	TT,TC,CC		33.7558,6.0826,24.3811	,,,	293/496,242/445,294/497,	6377433	3171,9835	2203	4300	6503	SO:0001819	synonymous_variant	285	exon5			GCCATTCGTGGTG	AF004327	CCDS5958.1, CCDS47761.1	8p23	2013-02-06			ENSG00000091879	ENSG00000091879		"""Fibrinogen C domain containing"""	485	protein-coding gene	gene with protein product		601922				9545648	Standard	NM_001147		Approved	Ang2	uc003wqj.4	O15123	OTTHUMG00000090365	ENST00000325203.5:c.882G>A	8.37:g.6377433C>T		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	96	7	0.0729167	NM_001147	A0AV38|A8K205|B7ZLM7|Q9NRR7|Q9P2Y7	Silent	SNP	ENST00000325203.5	37	CCDS5958.1																																																																																			C|0.786;T|0.214	0.214	strong		0.433	ANGPT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206737.1	NM_001147	
SH3BP5	9467	hgsc.bcm.edu	37	3	15311325	15311325	+	Silent	SNP	A	A	G	rs1287467	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:15311325A>G	ENST00000383791.3	-	4	610	c.390T>C	c.(388-390)cgT>cgC	p.R130R	SH3BP5_ENST00000465894.2_5'Flank|SH3BP5_ENST00000426925.1_5'UTR|SH3BP5_ENST00000253688.5_5'UTR|SH3BP5_ENST00000408919.3_5'UTR	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	130					intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						CCTTGGCGGCACGGAGCACCT	0.602													G|||	2550	0.509185	0.6248	0.4697	5008	,	,		18284	0.1895		0.6889	False		,,,				2504	0.5256				p.R130R		Atlas-SNP	.											.	SH3BP5	32	.	0			c.T390C						PASS	.	G	,	2696,1710	514.5+/-368.7	828,1040,335	110.0	114.0	113.0		,390	-10.8	0.0	3	dbSNP_87	113	5893,2707	433.4+/-357.4	2014,1865,421	no	utr-5,coding-synonymous	SH3BP5	NM_001018009.2,NM_004844.3	,	2842,2905,756	GG,GA,AA		31.4767,38.8107,33.9612	,	,130/456	15311325	8589,4417	2203	4300	6503	SO:0001819	synonymous_variant	9467	exon4			GGCGGCACGGAGC	AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.390T>C	3.37:g.15311325A>G		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	72	10	0.138889	NM_004844	B3KQW6|Q5JWV9	Silent	SNP	ENST00000383791.3	37	CCDS2625.2																																																																																			A|0.378;G|0.621	0.621	strong		0.602	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340740.2	NM_004844	
TLE6	79816	hgsc.bcm.edu	37	19	2989697	2989697	+	Silent	SNP	T	T	C	rs6510730	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:2989697T>C	ENST00000246112.4	+	13	1359	c.1158T>C	c.(1156-1158)gaT>gaC	p.D386D	TLE6_ENST00000478073.2_3'UTR|TLE6_ENST00000452088.1_Silent_p.D263D	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	386					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGCcctggatgccaacctgg	0.642													t|||	1482	0.295927	0.6679	0.2104	5008	,	,		18258	0.0149		0.2942	False		,,,				2504	0.1452				p.D386D		Atlas-SNP	.											.	TLE6	68	.	0			c.T1158C						PASS	.	C	,	2677,1729	649.1+/-398.8	807,1063,333	70.0	74.0	73.0		1158,789	-5.1	0.0	19	dbSNP_116	73	2392,6208	398.0+/-345.9	334,1724,2242	no	coding-synonymous,coding-synonymous	TLE6	NM_001143986.1,NM_024760.2	,	1141,2787,2575	CC,CT,TT		27.814,39.2419,38.9743	,	386/573,263/450	2989697	5069,7937	2203	4300	6503	SO:0001819	synonymous_variant	79816	exon13			CCTGGATGCCAAC	AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.1158T>C	19.37:g.2989697T>C		Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	116	5	0.0431034	NM_001143986	J3KMZ1	Silent	SNP	ENST00000246112.4	37	CCDS45910.1																																																																																			T|0.637;C|0.363	0.363	strong		0.642	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345996.3	NM_024760	
GABRD	2563	hgsc.bcm.edu	37	1	1957037	1957037	+	Silent	SNP	T	T	C	rs2229110	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:1957037T>C	ENST00000378585.4	+	4	413	c.330T>C	c.(328-330)ggT>ggC	p.G110G		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	110					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGACCCTGGGTCTGGACAGCC	0.617													C|||	2811	0.561302	0.7474	0.5101	5008	,	,		16340	0.3462		0.6809	False		,,,				2504	0.4448				p.G110G		Atlas-SNP	.											GABRD,colon,carcinoma,0,2	GABRD	49	2	0			c.T330C						scavenged	.	C		3220,1186	414.4+/-336.8	1183,854,166	98.0	97.0	97.0		330	2.5	1.0	1	dbSNP_98	97	5680,2920	455.2+/-363.7	1889,1902,509	no	coding-synonymous	GABRD	NM_000815.4		3072,2756,675	CC,CT,TT		33.9535,26.9178,31.57		110/453	1957037	8900,4106	2203	4300	6503	SO:0001819	synonymous_variant	2563	exon4			CCTGGGTCTGGAC	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.330T>C	1.37:g.1957037T>C		Somatic	186	1	0.00537634		WXS	Illumina HiSeq	Phase_I	179	9	0.0502793	NM_000815	Q8N4N9	Silent	SNP	ENST00000378585.4	37	CCDS36.1																																																																																			T|0.334;C|0.666	0.666	strong		0.617	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098493.1	NM_000815	
C5orf47	133491	hgsc.bcm.edu	37	5	173416306	173416306	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:173416306C>T	ENST00000340147.6	+	1	145	c.40C>T	c.(40-42)Cgc>Tgc	p.R14C	C5orf47_ENST00000522195.1_Intron	NM_001144954.1	NP_001138426.1	Q569G3	CE047_HUMAN	chromosome 5 open reading frame 47	14										kidney(1)|prostate(1)	2						GGACTCGGCGCGCTTCGTCTA	0.701																																					p.R14C		Atlas-SNP	.											.	C5orf47	14	.	0			c.C40T						PASS	.						21.0	36.0	31.0					5																	173416306		692	1590	2282	SO:0001583	missense	133491	exon1			TCGGCGCGCTTCG		CCDS47343.1	5q35.2	2012-02-24			ENSG00000185056	ENSG00000185056			27026	protein-coding gene	gene with protein product						12477932	Standard	NM_001144954		Approved	LOC133491	uc003mcw.4	Q569G3	OTTHUMG00000163349	ENST00000340147.6:c.40C>T	5.37:g.173416306C>T	ENSP00000340887:p.Arg14Cys	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	77	29	0.376623	NM_001144954	Q8IYU7	Missense_Mutation	SNP	ENST00000340147.6	37	CCDS47343.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.460826	0.43736	.	.	ENSG00000185056	ENST00000340147	.	.	.	2.46	2.46	0.29980	.	.	.	.	.	T	0.55049	0.1896	L	0.29908	0.895	0.36128	D	0.845921	D	0.89917	1.0	D	0.75020	0.985	T	0.62421	-0.6858	8	0.87932	D	0	-7.6926	6.5122	0.22228	0.2879:0.7121:0.0:0.0	.	14	Q569G3	CE047_HUMAN	C	14	.	ENSP00000340887:R14C	R	+	1	0	C5orf47	173348912	0.764000	0.28473	0.919000	0.36401	0.346000	0.29079	0.547000	0.23299	1.351000	0.45789	0.313000	0.20887	CGC	.	.	none		0.701	C5orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372926.1	NM_001144954	
ATG2B	55102	hgsc.bcm.edu	37	14	96771959	96771959	+	Missense_Mutation	SNP	A	A	G	rs2289622	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:96771959A>G	ENST00000359933.4	-	31	5593	c.4700T>C	c.(4699-4701)aTa>aCa	p.I1567T	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1567			I -> T (in dbSNP:rs2289622). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GGGAGGGACTATTCCAAAATC	0.383													G|||	4475	0.89357	0.9508	0.9294	5008	,	,		14156	0.7629		0.9881	False		,,,				2504	0.8282				p.I1567T		Atlas-SNP	.											ATG2B,NS,carcinoma,+1,1	ATG2B	169	1	0			c.T4700C						PASS	.	G	THR/ILE	4201,205	127.8+/-164.7	2002,197,4	66.0	62.0	64.0		4700	4.5	0.9	14	dbSNP_100	64	8529,71	43.1+/-100.9	4229,71,0	yes	missense	ATG2B	NM_018036.5	89	6231,268,4	GG,GA,AA		0.8256,4.6527,2.1221	benign	1567/2079	96771959	12730,276	2203	4300	6503	SO:0001583	missense	55102	exon31			GGGACTATTCCAA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.4700T>C	14.37:g.96771959A>G	ENSP00000353010:p.Ile1567Thr	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	96	7	0.0729167	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	1998	0.9148351648351648	466	0.9471544715447154	336	0.9281767955801105	447	0.7814685314685315	749	0.9881266490765171	G	1.683	-0.505895	0.04261	0.953473	0.991744	ENSG00000066739	ENST00000359933	T	0.07800	3.16	5.41	4.51	0.55191	.	0.683858	0.14989	N	0.286818	T	0.00012	0.0000	N	0.00159	-1.955	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.29212	-1.0019	9	0.06494	T	0.89	.	9.2721	0.37677	0.2242:0.0:0.7758:0.0	rs2289622;rs17845448;rs17858321;rs52827622;rs61242850;rs2289622	1567	Q96BY7	ATG2B_HUMAN	T	1567	ENSP00000353010:I1567T	ENSP00000261834:I211T	I	-	2	0	ATG2B	95841712	0.619000	0.27059	0.941000	0.38009	0.975000	0.68041	1.716000	0.37981	1.284000	0.44531	-0.186000	0.12905	ATA	A|0.056;G|0.944	0.944	strong		0.383	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
KRT83	3889	hgsc.bcm.edu	37	12	52710309	52710309	+	Silent	SNP	G	G	A	rs2257286	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:52710309G>A	ENST00000293670.3	-	6	1046	c.984C>T	c.(982-984)aaC>aaT	p.N328N		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	328	Coil 2.|Rod.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.N328N(1)		NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GGTTCAGCTCGTTGATCTCCT	0.602													g|||	1882	0.375799	0.5008	0.317	5008	,	,		19119	0.1885		0.4095	False		,,,				2504	0.407				p.N328N	GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	Atlas-SNP	.											KRT83,NS,carcinoma,0,1	KRT83	64	1	1	Substitution - coding silent(1)	stomach(1)	c.C984T						scavenged	.	G		2156,2250	582.3+/-385.5	551,1054,598	127.0	101.0	110.0		984	-1.3	1.0	12	dbSNP_100	110	3529,5067	514.6+/-378.4	722,2085,1491	no	coding-synonymous	KRT83	NM_002282.3		1273,3139,2089	AA,AG,GG		41.054,48.9333,43.724		328/494	52710309	5685,7317	2203	4298	6501	SO:0001819	synonymous_variant	3889	exon6			CAGCTCGTTGATC	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.984C>T	12.37:g.52710309G>A		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	76	2	0.0263158	NM_002282	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Silent	SNP	ENST00000293670.3	37	CCDS8823.1																																																																																			.	.	weak		0.602	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282	
MKI67	4288	hgsc.bcm.edu	37	10	129903802	129903802	+	Missense_Mutation	SNP	A	A	G	rs11016073	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:129903802A>G	ENST00000368654.3	-	13	6677	c.6302T>C	c.(6301-6303)aTa>aCa	p.I2101T	MKI67_ENST00000368653.3_Missense_Mutation_p.I1741T	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2101	16 X 122 AA approximate repeats.		I -> T (in dbSNP:rs11016073).		cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTTGCAGGCTATTTTGGTAGT	0.493													A|||	766	0.152955	0.0166	0.1542	5008	,	,		20790	0.2262		0.2276	False		,,,				2504	0.184				p.I2101T		Atlas-SNP	.											MKI67,NS,carcinoma,+1,1	MKI67	363	1	0			c.T6302C						scavenged	.	A	THR/ILE,THR/ILE	242,4164	141.9+/-177.2	6,230,1967	323.0	316.0	318.0		5222,6302	-8.9	0.0	10	dbSNP_120	318	1874,6726	334.2+/-320.9	205,1464,2631	yes	missense,missense	MKI67	NM_001145966.1,NM_002417.4	89,89	211,1694,4598	GG,GA,AA		21.7907,5.4925,16.2694	benign,benign	1741/2897,2101/3257	129903802	2116,10890	2203	4300	6503	SO:0001583	missense	4288	exon13			CAGGCTATTTTGG	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6302T>C	10.37:g.129903802A>G	ENSP00000357643:p.Ile2101Thr	Somatic	210	0	0		WXS	Illumina HiSeq	Phase_I	192	4	0.0208333	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	364	0.16666666666666666	11	0.022357723577235773	59	0.16298342541436464	116	0.20279720279720279	178	0.23482849604221637	A	14.06	2.423156	0.43020	0.054925	0.217907	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.03468	3.92;3.92	4.43	-8.87	0.00792	.	7.783340	0.00166	N	0.000004	T	0.00012	0.0000	L	0.40543	1.245	0.80722	P	0.0	B;B;B	0.15473	0.01;0.01;0.013	B;B;B	0.15870	0.008;0.008;0.014	T	0.41305	-0.9516	9	0.14252	T	0.57	.	7.1603	0.25661	0.1776:0.1033:0.5803:0.1388	rs11016073;rs52835413;rs59373454;rs11016073	2100;1741;2101	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	T	2101;1741;2100	ENSP00000357643:I2101T;ENSP00000357642:I1741T	ENSP00000357642:I1741T	I	-	2	0	MKI67	129793792	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.759000	0.04761	-2.820000	0.00344	-0.912000	0.02778	ATA	A|0.842;G|0.158	0.158	strong		0.493	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
CPB1	1360	hgsc.bcm.edu	37	3	148562310	148562310	+	Missense_Mutation	SNP	G	G	A	rs1059502	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:148562310G>A	ENST00000491148.1	+	8	956	c.622G>A	c.(622-624)Gac>Aac	p.D208N	CPB1_ENST00000282957.4_Missense_Mutation_p.D208N			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	208			D -> N (in dbSNP:rs1059502). {ECO:0000269|PubMed:9524066}.			extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			AGAGCTTCTCGACAAGTTAGA	0.413													G|||	1353	0.270168	0.3495	0.1412	5008	,	,		16749	0.2956		0.2048	False		,,,				2504	0.2955				p.D208N		Atlas-SNP	.											.	CPB1	74	.	0			c.G622A						PASS	.	G	ASN/ASP	1358,3048	452.4+/-350.0	197,964,1042	111.0	91.0	98.0		622	-2.8	0.0	3	dbSNP_86	98	1769,6831	320.3+/-314.5	169,1431,2700	yes	missense	CPB1	NM_001871.2	23	366,2395,3742	AA,AG,GG		20.5698,30.8216,24.0427	benign	208/418	148562310	3127,9879	2203	4300	6503	SO:0001583	missense	1360	exon7			CTTCTCGACAAGT	AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.622G>A	3.37:g.148562310G>A	ENSP00000417222:p.Asp208Asn	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	102	5	0.0490196	NM_001871	O60834|Q53XJ0|Q96BQ8	Missense_Mutation	SNP	ENST00000491148.1	37	CCDS33874.1	518	0.23717948717948717	166	0.33739837398373984	52	0.143646408839779	139	0.243006993006993	161	0.21240105540897097	G	0.010	-1.761315	0.00657	0.308216	0.205698	ENSG00000153002	ENST00000491148;ENST00000282957;ENST00000468341	T;T;T	0.32515	1.45;1.45;1.45	5.78	-2.76	0.05896	Peptidase M14, carboxypeptidase A (2);	0.697197	0.15191	N	0.275529	T	0.00012	0.0000	N	0.25094	0.71	0.58432	P	1.999999999946489E-6	B	0.12013	0.005	B	0.14023	0.01	T	0.42616	-0.9441	9	0.07482	T	0.82	.	10.2126	0.43150	0.3714:0.0838:0.5448:0.0	rs1059502;rs3200197;rs56471857;rs60324209;rs1059502	208	P15086	CBPB1_HUMAN	N	208;208;174	ENSP00000417222:D208N;ENSP00000282957:D208N;ENSP00000419427:D174N	ENSP00000282957:D208N	D	+	1	0	CPB1	150045000	0.000000	0.05858	0.000000	0.03702	0.114000	0.19823	-0.672000	0.05244	-0.671000	0.05274	-2.480000	0.00198	GAC	G|0.743;A|0.257	0.257	strong		0.413	CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355928.1	NM_001871	
ITSN2	50618	hgsc.bcm.edu	37	2	24507652	24507652	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:24507652T>C	ENST00000355123.4	-	17	2367	c.1924A>G	c.(1924-1926)Aac>Gac	p.N642D	ITSN2_ENST00000406921.3_Missense_Mutation_p.N642D|ITSN2_ENST00000361999.3_Intron	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	642					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)	p.N641Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGAAGAGGTTGTTGAGACAG	0.338																																					p.N642D		Atlas-SNP	.											ITSN2,NS,carcinoma,0,1	ITSN2	224	1	1	Substitution - Missense(1)	lung(1)	c.A1924G						scavenged	.						118.0	120.0	120.0					2																	24507652		2203	4300	6503	SO:0001583	missense	50618	exon17			AGAGGTTGTTGAG	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.1924A>G	2.37:g.24507652T>C	ENSP00000347244:p.Asn642Asp	Somatic	465	0	0		WXS	Illumina HiSeq	Phase_I	504	8	0.015873	NM_147152	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	37	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	T	14.40	2.523765	0.44866	.	.	ENSG00000198399	ENST00000355123;ENST00000406921	T;T	0.58358	0.34;0.74	5.55	1.39	0.22231	.	0.000000	0.33875	U	0.004479	T	0.30978	0.0782	N	0.08118	0	0.80722	D	1	B;B	0.32467	0.372;0.118	B;B	0.32805	0.153;0.037	T	0.10019	-1.0648	10	0.35671	T	0.21	.	13.3849	0.60791	0.0:0.0:0.3667:0.6333	.	642;642	Q9NZM3-3;Q9NZM3	.;ITSN2_HUMAN	D	642	ENSP00000347244:N642D;ENSP00000384499:N642D	ENSP00000347244:N642D	N	-	1	0	ITSN2	24361156	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.585000	0.67497	0.424000	0.26061	0.533000	0.62120	AAC	.	.	none		0.338	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
RECQL5	9400	hgsc.bcm.edu	37	17	73654377	73654377	+	Splice_Site	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:73654377C>T	ENST00000317905.5	-	7	1309		c.e7+1		RECQL5_ENST00000340830.5_Splice_Site|RECQL5_ENST00000584999.1_Splice_Site|RECQL5_ENST00000423245.2_Splice_Site|RECQL5_ENST00000420326.2_Splice_Site	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5						chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CCAAGCCTTACCTGGAGTTTT	0.502								Other identified genes with known or suspected DNA repair function																													.		Atlas-SNP	.											.	RECQL5	77	.	0			c.1149+1G>A						PASS	.						196.0	185.0	189.0					17																	73654377		2203	4300	6503	SO:0001630	splice_region_variant	9400	exon8			GCCTTACCTGGAG	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.1149+1G>A	17.37:g.73654377C>T		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	55	18	0.327273	NM_004259	Q9H0B1|Q9P1W7|Q9UNC8	Splice_Site	SNP	ENST00000317905.5	37	CCDS42380.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679018	0.47886	.	.	ENSG00000108469	ENST00000423245;ENST00000317905;ENST00000420326;ENST00000340830	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1346	0.98019	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RECQL5	71165972	1.000000	0.71417	0.999000	0.59377	0.594000	0.36715	7.003000	0.76310	2.765000	0.95021	0.655000	0.94253	.	.	.	none		0.502	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448207.1	NM_004259	Intron
STARD7	56910	hgsc.bcm.edu	37	2	96861159	96861159	+	Missense_Mutation	SNP	C	C	G	rs2276650	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:96861159C>G	ENST00000337288.5	-	2	802	c.419G>C	c.(418-420)cGt>cCt	p.R140P	STARD7_ENST00000462501.1_5'UTR	NM_020151.3	NP_064536.2	Q9NQZ5	STAR7_HUMAN	StAR-related lipid transfer (START) domain containing 7	140	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.		R -> P (in dbSNP:rs2276650). {ECO:0000269|PubMed:15489334}.			mitochondrion (GO:0005739)	lipid binding (GO:0008289)	p.R65P(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|stomach(2)	14						CATTTCCCAACGTTGCTCTTT	0.498													N|||	660	0.131789	0.0454	0.134	5008	,	,		19125	0.124		0.17	False		,,,				2504	0.2157				p.R140P		Atlas-SNP	.											STARD7,NS,carcinoma,0,1	STARD7	49	1	1	Substitution - Missense(1)	stomach(1)	c.G419C						scavenged	.	G	PRO/ARG	294,4112	797.8+/-415.4	10,274,1919	151.0	116.0	128.0		419	4.7	0.0	2	dbSNP_100	128	1418,7182	746.9+/-407.3	122,1174,3004	yes	missense	STARD7	NM_020151.3	103	132,1448,4923	GG,GC,CC		16.4884,6.6727,13.1632	benign	140/371	96861159	1712,11294	2203	4300	6503	SO:0001583	missense	56910	exon2			TCCCAACGTTGCT	AF270647	CCDS2017.2	2p11.1	2011-09-12	2007-08-16		ENSG00000084090	ENSG00000084090		"""StAR-related lipid transfer (START) domain containing"""	18063	protein-coding gene	gene with protein product			"""START domain containing 7"""				Standard	NM_020151		Approved	GTT1	uc002svm.4	Q9NQZ5	OTTHUMG00000130457	ENST00000337288.5:c.419G>C	2.37:g.96861159C>G	ENSP00000338030:p.Arg140Pro	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	129	5	0.0387597	NM_020151	D3DXG9|Q53T44|Q6GU43|Q969M6	Missense_Mutation	SNP	ENST00000337288.5	37	CCDS2017.2	266	0.12179487179487179	21	0.042682926829268296	46	0.1270718232044199	66	0.11538461538461539	133	0.17546174142480211	G	0.772	-0.765499	0.02996	0.066727	0.164884	ENSG00000084090	ENST00000337288;ENST00000443962	T;T	0.03094	4.05;4.05	5.62	4.73	0.59995	Lipid-binding START (3);START-like domain (1);	0.264075	0.36972	N	0.002307	T	0.00012	0.0000	N	0.02916	-0.46	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.48502	-0.9030	9	0.17832	T	0.49	-4.41	9.4979	0.38999	0.0:0.2954:0.5518:0.1529	rs2276650;rs17419527;rs17845138;rs17856446;rs17857941;rs17858069;rs52838299;rs2276650	140	Q9NQZ5	STAR7_HUMAN	P	140;39	ENSP00000338030:R140P;ENSP00000409410:R39P	ENSP00000338030:R140P	R	-	2	0	STARD7	96224886	0.927000	0.31430	0.014000	0.15608	0.676000	0.39594	2.586000	0.46119	0.708000	0.31955	-0.120000	0.15030	CGT	C|0.878;G|0.122	0.122	strong		0.498	STARD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252848.2		
CSGALNACT2	55454	hgsc.bcm.edu	37	10	43659372	43659372	+	Nonsense_Mutation	SNP	C	C	T	rs76607193	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:43659372C>T	ENST00000374466.3	+	5	1374	c.1039C>T	c.(1039-1041)Cga>Tga	p.R347*		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	347					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.R347*(1)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TAATCGTGGACGAGGACTAAA	0.408																																					p.R347X		Atlas-SNP	.											CSGALNACT2,trunk,malignant_melanoma,0,1	CSGALNACT2	67	1	1	Substitution - Nonsense(1)	skin(1)	c.C1039T						scavenged	.						191.0	181.0	184.0					10																	43659372		2203	4300	6503	SO:0001587	stop_gained	55454	exon5			CGTGGACGAGGAC	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1039C>T	10.37:g.43659372C>T	ENSP00000363590:p.Arg347*	Somatic	175	1	0.00571429		WXS	Illumina HiSeq	Phase_I	131	5	0.0381679	NM_018590	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Nonsense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	C	41	8.712957	0.98925	.	.	ENSG00000169826	ENST00000374466	.	.	.	6.08	4.19	0.49359	.	0.110120	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-3.2438	15.5126	0.75795	0.253:0.747:0.0:0.0	.	.	.	.	X	347	.	ENSP00000363590:R347X	R	+	1	2	CSGALNACT2	42979378	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	1.226000	0.32563	0.852000	0.35287	0.591000	0.81541	CGA	C|0.997;T|0.003	0.003	strong		0.408	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
NCOA3	8202	hgsc.bcm.edu	37	20	46279884	46279884	+	Silent	SNP	A	A	G	rs112355546		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:46279884A>G	ENST00000371998.3	+	20	4001	c.3810A>G	c.(3808-3810)caA>caG	p.Q1270Q	NCOA3_ENST00000372004.3_Silent_p.Q1266Q|NCOA3_ENST00000371997.3_Silent_p.Q1261Q|NCOA3_ENST00000341724.6_Silent_p.Q1196Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1270	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcaacagcaacagcagcaac	0.572																																					p.Q1270Q		Atlas-SNP	.											.	NCOA3	156	.	0			c.A3810G						PASS	.						92.0	92.0	92.0					20																	46279884		2203	4300	6503	SO:0001819	synonymous_variant	8202	exon20			ACAGCAACAGCAG	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3810A>G	20.37:g.46279884A>G		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	61	4	0.0655738	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			A|0.500;G|0.500	0.500	weak		0.572	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
EPPK1	83481	hgsc.bcm.edu	37	8	144941419	144941419	+	Silent	SNP	C	C	T	rs12681478	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:144941419C>T	ENST00000525985.1	-	2	6074	c.6003G>A	c.(6001-6003)gcG>gcA	p.A2001A				P58107	EPIPL_HUMAN	epiplakin 1	2001						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCAGTGCCTCCGCCTTCTCGA	0.642													C|||	1066	0.212859	0.0113	0.33	5008	,	,		18060	0.1399		0.3708	False		,,,				2504	0.3149				p.A2001A		Atlas-SNP	.											EPPK1,NS,carcinoma,0,1	EPPK1	199	1	0			c.G6003A						scavenged	.	C		369,3945		22,325,1810	35.0	39.0	37.0		6003	-3.7	0.0	8	dbSNP_120	37	3411,5111		676,2059,1526	no	coding-synonymous	EPPK1	NM_031308.1		698,2384,3336	TT,TC,CC		40.0258,8.5535,29.4484		2001/2420	144941419	3780,9056	2157	4261	6418	SO:0001819	synonymous_variant	83481	exon1			TGCCTCCGCCTTC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6003G>A	8.37:g.144941419C>T		Somatic	94	2	0.0212766		WXS	Illumina HiSeq	Phase_I	60	5	0.0833333	NM_031308	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				C|0.740;T|0.260	0.260	strong		0.642	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
DNAJB11	51726	hgsc.bcm.edu	37	3	186301703	186301703	+	Missense_Mutation	SNP	A	A	G	rs8147	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:186301703A>G	ENST00000439351.1	+	9	1719	c.790A>G	c.(790-792)Atc>Gtc	p.I264V	DNAJB11_ENST00000265028.3_Missense_Mutation_p.I264V			Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	264			I -> V (in dbSNP:rs8147). {ECO:0000269|PubMed:16303743, ECO:0000269|Ref.4}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|mRNA modification (GO:0016556)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|urinary_tract(2)	15	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		AAATGTGACAATCTCATTAGT	0.348													A|||	1484	0.296326	0.5461	0.2378	5008	,	,		22257	0.1498		0.1859	False		,,,				2504	0.2648				p.I264V		Atlas-SNP	.											.	DNAJB11	42	.	0			c.A790G						PASS	.	A	VAL/ILE	2043,2363	566.3+/-381.9	471,1101,631	190.0	170.0	177.0		790	-0.8	0.2	3	dbSNP_52	177	1448,7152	277.6+/-293.0	113,1222,2965	yes	missense	DNAJB11	NM_016306.4	29	584,2323,3596	GG,GA,AA		16.8372,46.3686,26.8415	possibly-damaging	264/359	186301703	3491,9515	2203	4300	6503	SO:0001583	missense	51726	exon8			GTGACAATCTCAT	AB028859	CCDS3277.1	3q27	2011-09-02			ENSG00000090520	ENSG00000090520		"""Heat shock proteins / DNAJ (HSP40)"""	14889	protein-coding gene	gene with protein product		611341				10827079, 11147971	Standard	NM_016306		Approved	EDJ, HEDJ, ERdj3	uc003fqi.3	Q9UBS4	OTTHUMG00000156614	ENST00000439351.1:c.790A>G	3.37:g.186301703A>G	ENSP00000414398:p.Ile264Val	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	127	6	0.0472441	NM_016306	Q542Y5|Q542Y9|Q6IAQ8|Q96JC6	Missense_Mutation	SNP	ENST00000439351.1	37	CCDS3277.1	578|578	0.26465201465201466|0.26465201465201466	257|257	0.5223577235772358|0.5223577235772358	101|101	0.27900552486187846|0.27900552486187846	82|82	0.14335664335664336|0.14335664335664336	138|138	0.1820580474934037|0.1820580474934037	A|A	16.71|16.71	3.199267|3.199267	0.58126|0.58126	0.463686|0.463686	0.168372|0.168372	ENSG00000090520|ENSG00000090520	ENST00000439351;ENST00000265028|ENST00000418776	T;T|.	0.53640|.	0.61;0.61|.	5.79|5.79	-0.818|-0.818	0.10833|0.10833	Chaperone DnaJ, C-terminal (1);HSP40/DnaJ peptide-binding (1);|.	0.192343|.	0.56097|.	N|.	0.000040|.	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.78285|0.78285	2.405|2.405	0.09310|0.09310	P|P	1.0|1.0	P|.	0.48589|.	0.912|.	P|.	0.51297|.	0.665|.	T|T	0.45862|0.45862	-0.9232|-0.9232	9|4	0.54805|.	T|.	0.06|.	-1.9249|-1.9249	9.7291|9.7291	0.40350|0.40350	0.583:0.0:0.417:0.0|0.583:0.0:0.417:0.0	rs8147;rs3193237;rs52831972;rs59580631;rs8147|rs8147;rs3193237;rs52831972;rs59580631;rs8147	264|.	Q9UBS4|.	DJB11_HUMAN|.	V|S	264|64	ENSP00000414398:I264V;ENSP00000265028:I264V|.	ENSP00000265028:I264V|.	I|N	+|+	1|2	0|0	DNAJB11|DNAJB11	187784397|187784397	0.978000|0.978000	0.34361|0.34361	0.220000|0.220000	0.23810|0.23810	0.973000|0.973000	0.67179|0.67179	2.653000|2.653000	0.46691|0.46691	-0.361000|-0.361000	0.08125|0.08125	-0.256000|-0.256000	0.11100|0.11100	ATC|AAT	A|0.723;G|0.277	0.277	strong		0.348	DNAJB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344779.1		
PKHD1	5314	hgsc.bcm.edu	37	6	51637536	51637536	+	Missense_Mutation	SNP	G	G	T	rs142522748	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:51637536G>T	ENST00000371117.3	-	55	8881	c.8606C>A	c.(8605-8607)aCa>aAa	p.T2869K	PKHD1_ENST00000340994.4_Missense_Mutation_p.T2869K	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2869	G8 2. {ECO:0000255|PROSITE- ProRule:PRU00817}.		T -> K (in dbSNP:rs142522748). {ECO:0000269|PubMed:12846734, ECO:0000269|PubMed:12874454, ECO:0000269|PubMed:15108281}.		cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TCCAAGATGTGTCCAGGAGTT	0.393													G|||	21	0.00419329	0.0	0.0173	5008	,	,		16874	0.0		0.0089	False		,,,				2504	0.0				p.T2869K		Atlas-SNP	.											.	PKHD1	927	.	0			c.C8606A	GRCh37	CM032328	PKHD1	M	rs142522748	PASS	.	G	LYS/THR,LYS/THR	8,4398	15.5+/-35.6	0,8,2195	133.0	135.0	134.0		8606,8606	4.9	0.9	6	dbSNP_134	134	115,8485	61.7+/-123.6	2,111,4187	yes	missense,missense	PKHD1	NM_138694.3,NM_170724.2	78,78	2,119,6382	TT,TG,GG		1.3372,0.1816,0.9457	probably-damaging,probably-damaging	2869/4075,2869/3397	51637536	123,12883	2203	4300	6503	SO:0001583	missense	5314	exon55			AGATGTGTCCAGG	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.8606C>A	6.37:g.51637536G>T	ENSP00000360158:p.Thr2869Lys	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	64	4	0.0625	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	14	0.00641025641025641	0	0.0	7	0.019337016574585635	0	0.0	7	0.009234828496042216	G	19.80	3.894738	0.72639	0.001816	0.013372	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.95588	-3.75;-3.75	5.79	4.91	0.64330	G8 domain (2);	0.139116	0.49916	D	0.000136	D	0.96144	0.8743	M	0.74258	2.255	0.28231	N	0.926129	D;D;D	0.76494	0.997;0.999;0.982	D;D;P	0.73380	0.98;0.976;0.767	D	0.92739	0.6206	10	0.87932	D	0	.	11.3691	0.49690	0.0846:0.0:0.9154:0.0	.	2869;2869;2869	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	K	2869	ENSP00000360158:T2869K;ENSP00000341097:T2869K	ENSP00000341097:T2869K	T	-	2	0	PKHD1	51745495	1.000000	0.71417	0.945000	0.38365	0.929000	0.56500	4.420000	0.59841	1.427000	0.47276	0.591000	0.81541	ACA	G|0.991;T|0.009	0.009	strong		0.393	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
USP15	9958	hgsc.bcm.edu	37	12	62785663	62785663	+	Silent	SNP	T	T	C	rs11174457	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:62785663T>C	ENST00000280377.5	+	17	2359	c.2301T>C	c.(2299-2301)gcT>gcC	p.A767A	USP15_ENST00000393654.3_Silent_p.A742A|USP15_ENST00000353364.3_Silent_p.A738A	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	767	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		AAAATGCTGCTGAGGTAAGTC	0.318													T|||	302	0.0603035	0.0635	0.0836	5008	,	,		15367	0.006		0.0875	False		,,,				2504	0.0675				p.A767A	Melanoma(181;615 2041 39364 49691 50001)	Atlas-SNP	.											USP15,NS,carcinoma,0,1	USP15	105	1	0			c.T2301C						scavenged	.	T		249,4153	138.8+/-174.5	6,237,1958	65.0	63.0	63.0		2214	0.4	1.0	12	dbSNP_120	63	707,7877	169.3+/-220.7	33,641,3618	no	coding-synonymous	USP15	NM_006313.1		39,878,5576	CC,CT,TT		8.2363,5.6565,7.3618		738/953	62785663	956,12030	2201	4292	6493	SO:0001819	synonymous_variant	9958	exon17			TGCTGCTGAGGTA	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.2301T>C	12.37:g.62785663T>C		Somatic	447	1	0.00223714		WXS	Illumina HiSeq	Phase_I	591	6	0.0101523	NM_001252078	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Silent	SNP	ENST00000280377.5	37	CCDS58251.1																																																																																			T|0.933;C|0.067	0.067	strong		0.318	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313	
ANLN	54443	hgsc.bcm.edu	37	7	36438709	36438709	+	Missense_Mutation	SNP	C	C	G	rs3735400	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:36438709C>G	ENST00000265748.2	+	3	415	c.194C>G	c.(193-195)tCg>tGg	p.S65W	ANLN_ENST00000396068.2_Missense_Mutation_p.S65W	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	65	Interaction with CD2AP.|Nuclear localization.		S -> W (in dbSNP:rs3735400).		hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.S65W(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						ACAAAACCATCGCCATCAAAA	0.333													C|||	636	0.126997	0.1036	0.1686	5008	,	,		19134	0.1806		0.0984	False		,,,				2504	0.1033				p.S65W		Atlas-SNP	.											ANLN,NS,carcinoma,0,1	ANLN	101	1	1	Substitution - Missense(1)	prostate(1)	c.C194G						scavenged	.	C	TRP/SER	536,3870	240.3+/-251.1	31,474,1698	57.0	59.0	58.0		194	4.6	1.0	7	dbSNP_107	58	974,7626	211.5+/-252.1	59,856,3385	yes	missense	ANLN	NM_018685.2	177	90,1330,5083	GG,GC,CC		11.3256,12.1652,11.61	probably-damaging	65/1125	36438709	1510,11496	2203	4300	6503	SO:0001583	missense	54443	exon3			AACCATCGCCATC	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.194C>G	7.37:g.36438709C>G	ENSP00000265748:p.Ser65Trp	Somatic	228	0	0		WXS	Illumina HiSeq	Phase_I	324	6	0.0185185	NM_018685	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	37	CCDS5447.1	265	0.12133699633699634	44	0.08943089430894309	46	0.1270718232044199	91	0.1590909090909091	84	0.11081794195250659	C	17.81	3.481073	0.63849	0.121652	0.113256	ENSG00000011426	ENST00000265748;ENST00000396068;ENST00000424865	T;T;T	0.50277	0.75;0.75;3.82	5.46	4.59	0.56863	.	0.105878	0.64402	D	0.000003	T	0.00524	0.0017	M	0.74258	2.255	0.09310	P	0.9999999986779	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.17899	-1.0354	9	0.87932	D	0	-8.9128	14.3125	0.66424	0.0:0.9288:0.0:0.0712	rs3735400;rs10386162;rs52819922;rs3735400	65;65;65	A8K5D9;Q9NQW6-2;Q9NQW6	.;.;ANLN_HUMAN	W	65;65;43	ENSP00000265748:S65W;ENSP00000379380:S65W;ENSP00000404979:S43W	ENSP00000265748:S65W	S	+	2	0	ANLN	36405234	0.999000	0.42202	0.999000	0.59377	0.660000	0.38997	4.346000	0.59367	1.453000	0.47775	0.655000	0.94253	TCG	C|0.882;G|0.118	0.118	strong		0.333	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685	
HTR5A	3361	hgsc.bcm.edu	37	7	154862621	154862621	+	Silent	SNP	T	T	A	rs6320	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:154862621T>A	ENST00000287907.2	+	1	588	c.12T>A	c.(10-12)ccT>ccA	p.P4P	HTR5A-AS1_ENST00000493904.1_Intron|HTR5A-AS1_ENST00000395731.2_Intron|HTR5A-AS1_ENST00000543018.1_Intron	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	4					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)	p.P4P(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	TGGATTTACCTGTGAACCTAA	0.612													T|||	1287	0.256989	0.211	0.2075	5008	,	,		17998	0.3492		0.2734	False		,,,				2504	0.2423				p.P4P		Atlas-SNP	.											HTR5A,NS,carcinoma,+1,2	HTR5A	114	2	1	Substitution - coding silent(1)	stomach(1)	c.T12A						scavenged	.	T		922,3484	353.1+/-312.0	99,724,1380	115.0	124.0	121.0		12	-2.8	0.0	7	dbSNP_52	121	2429,6171	402.8+/-347.6	358,1713,2229	no	coding-synonymous	HTR5A	NM_024012.2		457,2437,3609	AA,AT,TT		28.2442,20.926,25.765		4/358	154862621	3351,9655	2203	4300	6503	SO:0001819	synonymous_variant	3361	exon1			TTTACCTGTGAAC		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.12T>A	7.37:g.154862621T>A		Somatic	10	1	0.1		WXS	Illumina HiSeq	Phase_I	18	11	0.611111	NM_024012	Q2M2D2	Silent	SNP	ENST00000287907.2	37	CCDS5936.1																																																																																			T|0.726;A|0.274	0.274	strong		0.612	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012	
IFI44L	10964	hgsc.bcm.edu	37	1	79095581	79095581	+	Missense_Mutation	SNP	T	T	C	rs987495	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:79095581T>C	ENST00000370751.5	+	4	883	c.704T>C	c.(703-705)aTc>aCc	p.I235T	IFI44L_ENST00000476521.1_3'UTR|IFI44L_ENST00000342282.3_5'UTR	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	235			I -> T (in dbSNP:rs987495). {ECO:0000269|Ref.1}.		defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						GGGTCTGATATCACCAGCATA	0.408													T|||	1074	0.214457	0.1195	0.2709	5008	,	,		15403	0.245		0.2505	False		,,,				2504	0.2342				p.I235T		Atlas-SNP	.											IFI44L,NS,carcinoma,-1,1	IFI44L	93	1	0			c.T704C						scavenged	.	T	THR/ILE	638,3768	274.9+/-272.2	44,550,1609	81.0	82.0	81.0		704	-5.6	0.0	1	dbSNP_86	81	2111,6489	364.0+/-333.3	259,1593,2448	yes	missense	IFI44L	NM_006820.2	89	303,2143,4057	CC,CT,TT		24.5465,14.4803,21.1364	benign	235/453	79095581	2749,10257	2203	4300	6503	SO:0001583	missense	10964	exon4			CTGATATCACCAG	AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.704T>C	1.37:g.79095581T>C	ENSP00000359787:p.Ile235Thr	Somatic	121	1	0.00826446		WXS	Illumina HiSeq	Phase_I	127	4	0.0314961	NM_006820	Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	ENST00000370751.5	37	CCDS687.2	468	0.21428571428571427	45	0.09146341463414634	84	0.23204419889502761	141	0.2465034965034965	198	0.2612137203166227	T	0.144	-1.098806	0.01843	0.144803	0.245465	ENSG00000137959	ENST00000370751;ENST00000450498	T;T	0.13196	2.82;2.61	2.82	-5.64	0.02466	.	1.995390	0.02289	N	0.070148	T	0.00936	0.0031	N	0.02539	-0.55	0.58432	P	1.999999999946489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.35699	-0.9778	9	0.12430	T	0.62	3.8519	4.0787	0.09916	0.406:0.1735:0.0:0.4204	rs987495;rs3766326;rs52810523;rs58826484;rs987495	235	Q53G44	IF44L_HUMAN	T	235;212	ENSP00000359787:I235T;ENSP00000400784:I212T	ENSP00000359787:I235T	I	+	2	0	IFI44L	78868169	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.687000	0.01927	-2.136000	0.00810	-2.622000	0.00156	ATC	T|0.785;G|0.001	.	strong		0.408	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026834.3	NM_006820	
AHNAK2	113146	hgsc.bcm.edu	37	14	105412163	105412163	+	Missense_Mutation	SNP	C	C	G	rs201181175		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:105412163C>G	ENST00000333244.5	-	7	9744	c.9625G>C	c.(9625-9627)Gtg>Ctg	p.V3209L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3209						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGAGCTTCACGTCCACCTGG	0.607																																					p.V3209L		Atlas-SNP	.											AHNAK2_ENST00000333244,NS,carcinoma,0,1	AHNAK2	719	1	0			c.G9625C						scavenged	.						108.0	70.0	83.0					14																	105412163		1920	3847	5767	SO:0001583	missense	113146	exon7			GCTTCACGTCCAC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9625G>C	14.37:g.105412163C>G	ENSP00000353114:p.Val3209Leu	Somatic	134	2	0.0149254		WXS	Illumina HiSeq	Phase_I	105	6	0.0571429	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	9.043	0.990179	0.18966	.	.	ENSG00000185567	ENST00000333244	T	0.01119	5.31	2.98	-2.26	0.06867	.	.	.	.	.	T	0.00906	0.0030	L	0.35723	1.085	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.48875	-0.8996	9	0.22109	T	0.4	.	0.8864	0.01245	0.2903:0.3589:0.1435:0.2074	.	3209	Q8IVF2	AHNK2_HUMAN	L	3209	ENSP00000353114:V3209L	ENSP00000353114:V3209L	V	-	1	0	AHNAK2	104483208	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.193000	0.00564	-0.054000	0.13266	0.313000	0.20887	GTG	.	.	weak		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
PTX4	390667	hgsc.bcm.edu	37	16	1536466	1536466	+	Missense_Mutation	SNP	C	C	T	rs61751878	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:1536466C>T	ENST00000447419.2	-	3	936	c.911G>A	c.(910-912)cGc>cAc	p.R304H	PTX4_ENST00000293922.1_Missense_Mutation_p.R299H|PTX4_ENST00000440447.2_Missense_Mutation_p.A156T			Q96A99	PTX4_HUMAN	pentraxin 4, long	304	Pentaxin.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						GGAGGCCGTGCGGACCCAGCT	0.662													C|||	9	0.00179712	0.0	0.0029	5008	,	,		16505	0.0		0.006	False		,,,				2504	0.001				p.R299H		Atlas-SNP	.											.	PTX4	46	.	0			c.G896A						PASS	.	C	HIS/ARG	2,4396	4.2+/-10.8	0,2,2197	51.0	57.0	55.0		896	4.6	0.2	16	dbSNP_129	55	71,8529	42.6+/-100.3	0,71,4229	yes	missense	PTX4	NM_001013658.1	29	0,73,6426	TT,TC,CC		0.8256,0.0455,0.5616	probably-damaging	299/474	1536466	73,12925	2199	4300	6499	SO:0001583	missense	390667	exon3			GCCGTGCGGACCC		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.911G>A	16.37:g.1536466C>T	ENSP00000445277:p.Arg304His	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	134	7	0.0522388	NM_001013658		Missense_Mutation	SNP	ENST00000447419.2	37		3	0.0013736263736263737	0	0.0	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	C	11.23	1.577860	0.28180	4.55E-4	0.008256	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.67345	-0.26;-0.26	5.58	4.62	0.57501	.	0.132733	0.46145	D	0.000314	T	0.55862	0.1947	M	0.79475	2.455	0.26244	N	0.978822	P	0.50443	0.935	B	0.38020	0.263	T	0.64863	-0.6307	10	0.48119	T	0.1	.	12.7379	0.57236	0.0:0.9178:0.0:0.0822	.	299	Q96A99-2	.	H	304;299	ENSP00000445277:R304H;ENSP00000293922:R299H	ENSP00000293922:R299H	R	-	2	0	PTX4	1476467	0.000000	0.05858	0.234000	0.24042	0.010000	0.07245	0.554000	0.23407	2.638000	0.89438	0.655000	0.94253	CGC	C|0.995;T|0.005	0.005	strong		0.662	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658	
MRS2	57380	hgsc.bcm.edu	37	6	24418786	24418786	+	Silent	SNP	T	T	C	rs79527965	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:24418786T>C	ENST00000378386.3	+	9	1180	c.1087T>C	c.(1087-1089)Ttg>Ctg	p.L363L	MRS2_ENST00000274747.7_3'UTR|MRS2_ENST00000535061.1_Silent_p.L313L|MRS2_ENST00000443868.2_Silent_p.L366L|MRS2_ENST00000543597.1_Silent_p.L72L|MRS2_ENST00000378353.1_Silent_p.L363L|MRS2_ENST00000483634.1_3'UTR	NM_020662.2	NP_065713.1	Q9HD23	MRS2_HUMAN	MRS2 magnesium transporter	363						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	magnesium ion transmembrane transporter activity (GO:0015095)	p.L363L(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	12						TGGAATGAATTTGGAATCTTC	0.443													T|||	582	0.116214	0.0159	0.0965	5008	,	,		15455	0.1478		0.1938	False		,,,				2504	0.1534				p.L363L		Atlas-SNP	.											MRS2,NS,carcinoma,0,1	MRS2	31	1	1	Substitution - coding silent(1)	stomach(1)	c.T1087C						scavenged	.	T		170,4236	109.5+/-147.8	5,160,2038	158.0	156.0	157.0		1087	1.8	1.0	6	dbSNP_131	157	1234,7366	247.6+/-275.6	84,1066,3150	no	coding-synonymous	MRS2	NM_020662.2		89,1226,5188	CC,CT,TT		14.3488,3.8584,10.795		363/444	24418786	1404,11602	2203	4300	6503	SO:0001819	synonymous_variant	57380	exon9			ATGAATTTGGAAT	AF288288	CCDS4552.1, CCDS69055.1, CCDS69056.1, CCDS75408.1	6p22.3-p22.1	2013-05-03	2013-05-03	2008-01-18	ENSG00000124532	ENSG00000124532			13785	protein-coding gene	gene with protein product			"""MRS2-like, magnesium homeostasis factor (S. cerevisiae)"", ""MRS2 magnesium homeostasis factor homolog (S. cerevisiae)"""	MRS2L			Standard	XM_005249242		Approved		uc003neb.3	Q9HD23	OTTHUMG00000014355	ENST00000378386.3:c.1087T>C	6.37:g.24418786T>C		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	123	4	0.0325203	NM_020662	A8K4U3|B3KNN2|B4DQL2|Q5T3Y1|Q6NTG4|Q96KF8|Q9BVP1	Silent	SNP	ENST00000378386.3	37	CCDS4552.1																																																																																			T|0.887;C|0.113	0.113	strong		0.443	MRS2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040002.1		
TACC3	10460	hgsc.bcm.edu	37	4	1730215	1730215	+	Silent	SNP	C	C	G	rs798757	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:1730215C>G	ENST00000313288.4	+	4	1192	c.1086C>G	c.(1084-1086)ggC>ggG	p.G362G		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	362					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			AGAGGTCCGGCCTCAAGCCTC	0.612													C|||	682	0.136182	0.1914	0.1225	5008	,	,		19034	0.0119		0.1759	False		,,,				2504	0.1585				p.G362G	Ovarian(120;482 2294 11894 35824)	Atlas-SNP	.											.	TACC3	69	.	0			c.C1086G						PASS	.	C		873,3533	335.5+/-303.9	100,673,1430	52.0	61.0	58.0		1086	0.7	0.0	4	dbSNP_86	58	1734,6866	310.2+/-309.8	180,1374,2746	no	coding-synonymous	TACC3	NM_006342.1		280,2047,4176	GG,GC,CC		20.1628,19.8139,20.0446		362/839	1730215	2607,10399	2203	4300	6503	SO:0001819	synonymous_variant	10460	exon4			GTCCGGCCTCAAG	AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.1086C>G	4.37:g.1730215C>G		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	143	6	0.041958	NM_006342	Q2NKK4|Q3KQS5|Q9UMQ1	Silent	SNP	ENST00000313288.4	37	CCDS3352.1	275	0.1259157509157509	89	0.18089430894308944	47	0.1298342541436464	8	0.013986013986013986	131	0.17282321899736147	C	3.894	-0.023378	0.07634	0.198139	0.201628	ENSG00000013810	ENST00000470136	.	.	.	4.1	0.669	0.17918	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.58432	P	2.9999999999752447E-6	.	.	.	.	.	.	T	0.20107	-1.0285	3	.	.	.	-2.1506	3.3079	0.07006	0.29:0.3119:0.0:0.3981	rs798757;rs1665369;rs798757	.	.	.	A	29	.	.	P	+	1	0	TACC3	1700013	0.000000	0.05858	0.010000	0.14722	0.039000	0.13416	0.159000	0.16442	0.190000	0.20209	-0.373000	0.07131	CCT	C|0.830;G|0.170	0.170	strong		0.612	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2		
MUC17	140453	hgsc.bcm.edu	37	7	100679366	100679366	+	Missense_Mutation	SNP	A	A	G	rs74209688	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:100679366A>G	ENST00000306151.4	+	3	4733	c.4669A>G	c.(4669-4671)Act>Gct	p.T1557A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1557	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T1557A(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ATCTCCTACAACTGCTGACGG	0.493																																					p.T1557A		Atlas-SNP	.											MUC17,NS,carcinoma,0,1	MUC17	804	1	1	Substitution - Missense(1)	stomach(1)	c.A4669G						scavenged	.	A	ALA/THR	348,4058	180.1+/-208.5	15,318,1870	261.0	243.0	249.0		4669	-1.3	0.0	7	dbSNP_130	249	2280,6320	385.7+/-341.6	299,1682,2319	no	missense	MUC17	NM_001040105.1	58	314,2000,4189	GG,GA,AA		26.5116,7.8983,20.2061	possibly-damaging	1557/4494	100679366	2628,10378	2203	4300	6503	SO:0001583	missense	140453	exon3			CCTACAACTGCTG	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4669A>G	7.37:g.100679366A>G	ENSP00000302716:p.Thr1557Ala	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	154	4	0.025974	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	538	0.24633699633699635	23	0.046747967479674794	76	0.20994475138121546	230	0.4020979020979021	209	0.2757255936675462	A	2.243	-0.373277	0.05034	0.078983	0.265116	ENSG00000169876	ENST00000306151	T	0.01981	4.52	0.922	-1.27	0.09347	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	P	0.40476	0.718	B	0.32805	0.153	T	0.22765	-1.0207	8	0.07030	T	0.85	.	3.075	0.06243	0.5662:0.0:0.0:0.4338	.	1557	Q685J3	MUC17_HUMAN	A	1557	ENSP00000302716:T1557A	ENSP00000302716:T1557A	T	+	1	0	MUC17	100466086	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	0.057000	0.14279	-0.205000	0.10219	0.102000	0.15555	ACT	A|0.784;G|0.216	0.216	strong		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
DNAH5	1767	hgsc.bcm.edu	37	5	13762972	13762972	+	Silent	SNP	T	T	C	rs6554812	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:13762972T>C	ENST00000265104.4	-	60	10244	c.10140A>G	c.(10138-10140)gaA>gaG	p.E3380E	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3380	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GACTCAAAAATTCTATCACCT	0.373									Kartagener syndrome				C|||	1554	0.310304	0.3722	0.2709	5008	,	,		21726	0.1052		0.3012	False		,,,				2504	0.4755				p.E3380E		Atlas-SNP	.											DNAH5,NS,carcinoma,-2,1	DNAH5	868	1	0			c.A10140G						scavenged	.	C		1601,2805	665.6+/-401.6	294,1013,896	77.0	74.0	75.0		10140	-5.2	0.7	5	dbSNP_116	75	2272,6328	707.4+/-405.6	306,1660,2334	no	coding-synonymous	DNAH5	NM_001369.2		600,2673,3230	CC,CT,TT		26.4186,36.3368,29.7786		3380/4625	13762972	3873,9133	2203	4300	6503	SO:0001819	synonymous_variant	1767	exon60	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CAAAAATTCTATC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.10140A>G	5.37:g.13762972T>C		Somatic	101	1	0.00990099		WXS	Illumina HiSeq	Phase_I	120	5	0.0416667	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																			T|0.714;C|0.286	0.286	strong		0.373	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
CNTN1	1272	hgsc.bcm.edu	37	12	41337435	41337435	+	Silent	SNP	C	C	T	rs1056019	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:41337435C>T	ENST00000551295.2	+	13	1533	c.1416C>T	c.(1414-1416)aaC>aaT	p.N472N	CNTN1_ENST00000547702.1_Silent_p.N472N|CNTN1_ENST00000348761.2_Silent_p.N461N|CNTN1_ENST00000547849.1_Silent_p.N472N|CNTN1_ENST00000360099.3_Silent_p.N472N|CNTN1_ENST00000347616.1_Silent_p.N472N	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	472	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TGGAAATCAACAACATTACAA	0.313													T|||	2862	0.571486	0.5862	0.6628	5008	,	,		15700	0.4365		0.6571	False		,,,				2504	0.5378				p.N472N		Atlas-SNP	.											CNTN1,NS,carcinoma,0,1	CNTN1	207	1	0			c.C1416T						scavenged	.	T	,	2584,1822	532.2+/-373.4	740,1104,359	101.0	100.0	101.0		1416,1383	-1.7	1.0	12	dbSNP_86	101	5499,3099	472.1+/-368.3	1742,2015,542	no	coding-synonymous,coding-synonymous	CNTN1	NM_001843.2,NM_175038.1	,	2482,3119,901	TT,TC,CC		36.0433,41.3527,37.8422	,	472/1019,461/1008	41337435	8083,4921	2203	4299	6502	SO:0001819	synonymous_variant	1272	exon13			AATCAACAACATT	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1416C>T	12.37:g.41337435C>T		Somatic	371	2	0.00539084		WXS	Illumina HiSeq	Phase_I	471	11	0.0233546	NM_001256063	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Silent	SNP	ENST00000551295.2	37	CCDS8737.1																																																																																			C|0.397;T|0.603	0.603	strong		0.313	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
TTN	7273	hgsc.bcm.edu	37	2	179400129	179400129	+	Missense_Mutation	SNP	C	C	T	rs192391568	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:179400129C>T	ENST00000591111.1	-	308	96514	c.96290G>A	c.(96289-96291)cGt>cAt	p.R32097H	TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R24673H|TTN_ENST00000342175.6_Missense_Mutation_p.R24865H|TTN_ENST00000359218.5_Missense_Mutation_p.R24798H|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R31170H|TTN-AS1_ENST00000442329.2_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R33738H|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32097	Fibronectin type-III 132. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> C. {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTCCTACACGGAGCCATCT	0.433													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		23700	0.0		0.0	False		,,,				2504	0.0				p.R33738H		Atlas-SNP	.											.	TTN	18412	.	0			c.G101213A						PASS	.						98.0	96.0	97.0					2																	179400129		1951	4152	6103	SO:0001583	missense	7273	exon358			CCTACACGGAGCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.96290G>A	2.37:g.179400129C>T	ENSP00000465570:p.Arg32097His	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	69	38	0.550725	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	18.13	3.556169	0.65425	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	5.52	5.52	0.82312	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68165	0.2971	L	0.45285	1.41	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.69405	-0.5154	9	0.87932	D	0	.	19.8108	0.96545	0.0:1.0:0.0:0.0	.	24673;24798;24865;32097	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	31170;24673;24865;24798;24670	ENSP00000343764:R31170H;ENSP00000434586:R24673H;ENSP00000340554:R24865H;ENSP00000352154:R24798H	ENSP00000340554:R24865H	R	-	2	0	TTN	179108375	1.000000	0.71417	0.971000	0.41717	0.961000	0.63080	7.776000	0.85560	2.754000	0.94517	0.557000	0.71058	CGT	C|1.000;T|0.000	0.000	strong		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SMIM5	643008	hgsc.bcm.edu	37	17	73636368	73636368	+	Silent	SNP	C	C	T	rs117954398	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:73636368C>T	ENST00000537494.1	+	1	3694	c.87C>T	c.(85-87)ccC>ccT	p.P29P	SMIM5_ENST00000375215.3_Silent_p.P29P|RECQL5_ENST00000317905.5_Intron|RECQL5_ENST00000423245.2_Intron			Q71RC9	SMIM5_HUMAN	small integral membrane protein 5	29						integral component of membrane (GO:0016021)											AGGCTGAGCCCGTGGAGATCG	0.627													C|||	19	0.00379393	0.0	0.0	5008	,	,		18017	0.0		0.0189	False		,,,				2504	0.0				p.P29P		Atlas-SNP	.											.	.	.	.	0			c.C87T						PASS	.	C	,	9,1375		0,9,683	104.0	108.0	107.0		87,	-7.9	0.9	17	dbSNP_132	107	43,3139		0,43,1548	no	coding-synonymous,intron	RECQL5,C17orf109	NM_001162995.2,NM_004259.6	,	0,52,2231	TT,TC,CC		1.3514,0.6503,1.1389	,	29/78,	73636368	52,4514	692	1591	2283	SO:0001819	synonymous_variant	643008	exon2			TGAGCCCGTGGAG		CCDS54165.1	17q25.1	2014-01-02	2012-10-23	2012-10-23	ENSG00000204323	ENSG00000204323			40030	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 109"""	C17orf109		24318988	Standard	NM_001162995		Approved		uc002jow.2	Q71RC9	OTTHUMG00000167882	ENST00000537494.1:c.87C>T	17.37:g.73636368C>T		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	49	5	0.102041	NM_001162995		Silent	SNP	ENST00000537494.1	37	CCDS54165.1																																																																																			C|0.994;T|0.006	0.006	strong		0.627	SMIM5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396808.2	NM_001162995	
KCNN3	3782	hgsc.bcm.edu	37	1	154842244	154842244	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:154842244A>T	ENST00000271915.4	-	1	512	c.197T>A	c.(196-198)cTt>cAt	p.L66H	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ctgctgctgaagctgcggagg	0.701																																					p.L66H		Atlas-SNP	.											KCNN3,NS,carcinoma,+1,3	KCNN3	141	3	0			c.T197A						scavenged	.																																			SO:0001583	missense	3782	exon1			TGCTGAAGCTGCG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.197T>A	1.37:g.154842244A>T	ENSP00000271915:p.Leu66His	Somatic	54	2	0.037037		WXS	Illumina HiSeq	Phase_I	52	21	0.403846	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	37	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	a	9.986	1.229557	0.22542	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.58060	0.36	4.47	-1.06	0.10002	.	2.530250	0.01603	N	0.022141	T	0.17152	0.0412	N	0.08118	0	0.35103	D	0.765442	.	.	.	.	.	.	T	0.03807	-1.1002	8	0.72032	D	0.01	-1.1381	4.5154	0.11932	0.5982:0.0:0.2622:0.1396	.	.	.	.	H	66;161	ENSP00000271915:L66H	ENSP00000271915:L66H	L	-	2	0	KCNN3	153108868	0.001000	0.12720	0.839000	0.33178	0.980000	0.70556	0.019000	0.13444	0.013000	0.14918	0.460000	0.39030	CTT	.	.	none		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
VWCE	220001	hgsc.bcm.edu	37	11	61048187	61048187	+	Silent	SNP	G	G	A	rs375996793		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:61048187G>A	ENST00000335613.5	-	9	1619	c.1233C>T	c.(1231-1233)gaC>gaT	p.D411D		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	411	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TCACCTTCCCGTCCTAGAAGC	0.592																																					p.D411D		Atlas-SNP	.											.	VWCE	84	.	0			c.C1233T						PASS	.	G		0,4406		0,0,2203	96.0	79.0	85.0		1233	-6.0	0.5	11		85	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	VWCE	NM_152718.2		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		411/956	61048187	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	220001	exon9			CTTCCCGTCCTAG	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1233C>T	11.37:g.61048187G>A		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	67	34	0.507463	NM_152718	A5PKV0|Q7Z7L6|Q86WK8	Silent	SNP	ENST00000335613.5	37	CCDS8002.1																																																																																			.	.	weak		0.592	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
HCAR3	8843	hgsc.bcm.edu	37	12	123200693	123200693	+	Missense_Mutation	SNP	A	A	G	rs17884481	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:123200693A>G	ENST00000528880.2	-	1	746	c.592T>C	c.(592-594)Ttc>Ctc	p.F198L	RP11-324E6.6_ENST00000543611.1_lincRNA|HCAR1_ENST00000356987.2_Intron	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	198			F -> L (in dbSNP:rs17884481). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7505609, ECO:0000269|Ref.2}.		G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	AGGGGCAGGAAGAACTCCAGG	0.532													a|||	2323	0.463858	0.5008	0.4409	5008	,	,		21080	0.495		0.5716	False		,,,				2504	0.2873				p.F198L		Atlas-SNP	.											HCAR3_ENST00000528880,colon,carcinoma,0,3	HCAR3	49	3	0			c.T592C						PASS	.						81.0	83.0	82.0					12																	123200693		2203	4300	6503	SO:0001583	missense	8843	exon1			GCAGGAAGAACTC	D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.592T>C	12.37:g.123200693A>G	ENSP00000436714:p.Phe198Leu	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	103	6	0.0582524	NM_006018	A8K4G5|B2R830|E9PI97|Q8NGE4	Missense_Mutation	SNP	ENST00000528880.2	37	CCDS53842.1	1139	0.5215201465201466	251	0.5101626016260162	169	0.46685082872928174	304	0.5314685314685315	415	0.5474934036939314	A	12.20	1.867061	0.32977	.	.	ENSG00000255398	ENST00000528880	T	0.70164	-0.46	3.41	2.2	0.27929	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.37167	P	0.09715600000000002	P	0.39782	0.688	B	0.39617	0.305	T	0.40194	-0.9576	7	0.07325	T	0.83	.	7.2126	0.25941	0.8006:0.0:0.0:0.1994	rs17884481	198	E9PI97	.	L	198	ENSP00000436714:F198L	ENSP00000436714:F198L	F	-	1	0	HCAR3	121766646	0.368000	0.25031	0.996000	0.52242	0.626000	0.37791	0.279000	0.18771	0.289000	0.22422	0.155000	0.16302	TTC	A|0.479;G|0.521	0.521	strong		0.532	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387549.2	NM_006018	
CACNA1G	8913	hgsc.bcm.edu	37	17	48674136	48674136	+	Missense_Mutation	SNP	C	C	T	rs573756072		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:48674136C>T	ENST00000359106.5	+	16	3110	c.3110C>T	c.(3109-3111)cCg>cTg	p.P1037L	CACNA1G_ENST00000514079.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000507609.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000515165.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000352832.5_Missense_Mutation_p.P1014L|CACNA1G_ENST00000515765.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000514181.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000442258.2_Missense_Mutation_p.P1014L|CACNA1G_ENST00000429973.2_Missense_Mutation_p.P1037L|CACNA1G_ENST00000507510.2_Missense_Mutation_p.P1037L|CACNA1G_ENST00000360761.4_Missense_Mutation_p.P1014L|CACNA1G_ENST00000512389.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000354983.4_Missense_Mutation_p.P1014L|CACNA1G_ENST00000510366.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000507336.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000358244.5_Missense_Mutation_p.P1014L|CACNA1G_ENST00000513689.2_Missense_Mutation_p.P1037L|CACNA1G_ENST00000513964.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000514717.1_Missense_Mutation_p.P1014L|CACNA1G_ENST00000502264.1_Missense_Mutation_p.P1014L|CACNA1G_ENST00000510115.1_Missense_Mutation_p.P1014L|CACNA1G_ENST00000515411.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000507896.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000503485.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000416767.4_Missense_Mutation_p.P1037L|CACNA1G_ENST00000505165.1_Missense_Mutation_p.P1037L	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1037					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	AGCCTGCTGCCGCCTCTCATC	0.711													C|||	1	0.000199681	0.0	0.0	5008	,	,		13405	0.0		0.001	False		,,,				2504	0.0				p.P1037L		Atlas-SNP	.											.	CACNA1G	659	.	0			c.C3110T						PASS	.						17.0	21.0	20.0					17																	48674136		2090	4220	6310	SO:0001583	missense	8913	exon16			TGCTGCCGCCTCT	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.3110C>T	17.37:g.48674136C>T	ENSP00000352011:p.Pro1037Leu	Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	37	13	0.351351	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	37	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	c	22.2	4.262675	0.80358	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69	4.78	4.78	0.61160	.	0.494671	0.21871	N	0.067899	D	0.92971	0.7763	L	0.47716	1.5	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;P;D;D;D;P;D;D;D;P	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.998;1.0;0.99;1.0;0.999;0.627;0.827;0.995;1.0;1.0;0.953;1.0;0.98;0.982;0.744	D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;B;B;P;D;D;P;D;P;P;B	0.91635	0.994;0.957;0.999;0.997;0.999;0.999;0.996;0.999;0.996;0.957;0.999;0.926;0.971;0.87;0.999;0.952;0.053;0.18;0.867;0.995;0.992;0.481;0.999;0.579;0.459;0.115	D	0.93116	0.6521	10	0.62326	D	0.03	.	12.8738	0.57980	0.1627:0.8373:0.0:0.0	.	1014;1037;1037;1037;1037;1037;1037;1037;1037;1037;1037;1014;1037;1037;1037;1037;1037;1014;1037;1014;1014;1014;1014;1037;1014;1037	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	L	1014;1014;1037;1014;1014;1014;1037;1037;1014;1037;1037;1037;1037;1037;1037;1014;1037;1037;1037;1037;1014;1037;1037;1037;1037;1037	ENSP00000353990:P1014L;ENSP00000339302:P1014L;ENSP00000392390:P1037L;ENSP00000347078:P1014L;ENSP00000409759:P1014L;ENSP00000425522:P1014L;ENSP00000426261:P1037L;ENSP00000425451:P1037L;ENSP00000422407:P1014L;ENSP00000426814:P1037L;ENSP00000427238:P1037L;ENSP00000423112:P1037L;ENSP00000420918:P1037L;ENSP00000426172:P1037L;ENSP00000423045:P1037L;ENSP00000427173:P1014L;ENSP00000426098:P1037L;ENSP00000425698:P1037L;ENSP00000426232:P1037L;ENSP00000423317:P1037L;ENSP00000350979:P1014L;ENSP00000352011:P1037L;ENSP00000414388:P1037L;ENSP00000423155:P1037L;ENSP00000422268:P1037L;ENSP00000421518:P1037L	ENSP00000339302:P1014L	P	+	2	0	CACNA1G	46029135	1.000000	0.71417	0.592000	0.28758	0.943000	0.58893	7.487000	0.81328	2.210000	0.71456	0.491000	0.48974	CCG	.	.	none		0.711	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
ABHD12	26090	hgsc.bcm.edu	37	20	25288632	25288632	+	Silent	SNP	G	G	A	rs6107027	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:25288632G>A	ENST00000339157.5	-	9	1109	c.837C>T	c.(835-837)cgC>cgT	p.R279R	ABHD12_ENST00000481556.1_5'UTR|ABHD12_ENST00000376542.3_Silent_p.R279R	NM_001042472.2	NP_001035937.1	Q8N2K0	ABD12_HUMAN	abhydrolase domain containing 12	279					adult walking behavior (GO:0007628)|phosphatidylserine catabolic process (GO:0006660)|response to auditory stimulus (GO:0010996)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)	acylglycerol lipase activity (GO:0047372)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	12						TAGCTTCTTCGCGGATATTAG	0.368													g|||	1683	0.336062	0.211	0.5836	5008	,	,		13675	0.0228		0.5089	False		,,,				2504	0.4744				p.R279R		Atlas-SNP	.											.	ABHD12	46	.	0			c.C837T						PASS	.	A	,	1183,3223	415.2+/-337.1	157,869,1177	73.0	72.0	72.0		837,837	-11.1	0.0	20	dbSNP_114	72	4470,4130	589.2+/-392.5	1153,2164,983	no	coding-synonymous,coding-synonymous	ABHD12	NM_001042472.2,NM_015600.4	,	1310,3033,2160	AA,AG,GG		48.0233,26.8498,43.4646	,	279/399,279/405	25288632	5653,7353	2203	4300	6503	SO:0001819	synonymous_variant	26090	exon9			TTCTTCGCGGATA	AL117442	CCDS13172.1, CCDS42857.1	20p11.21	2007-04-24	2006-03-10	2006-03-10	ENSG00000100997	ENSG00000100997		"""Abhydrolase domain containing"""	15868	protein-coding gene	gene with protein product		613599	"""chromosome 20 open reading frame 22"""	C20orf22			Standard	NM_015600		Approved	DKFZP434P106, dJ965G21.2, BEM46L2, ABHD12A	uc002wuq.3	Q8N2K0	OTTHUMG00000032121	ENST00000339157.5:c.837C>T	20.37:g.25288632G>A		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	77	5	0.0649351	NM_001042472	A6NED4|A6NJ90|A8K450|B4DE71|Q5T710|Q5T711|Q96CR1|Q9BX05|Q9NPX7|Q9UFV6	Silent	SNP	ENST00000339157.5	37	CCDS42857.1																																																																																			G|0.608;A|0.392	0.392	strong		0.368	ABHD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078423.2	NM_015600	
ANAPC4	29945	hgsc.bcm.edu	37	4	25408838	25408838	+	Missense_Mutation	SNP	G	G	A	rs34811474	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:25408838G>A	ENST00000315368.3	+	20	1536	c.1394G>A	c.(1393-1395)cGa>cAa	p.R465Q	ANAPC4_ENST00000510092.1_Missense_Mutation_p.R466Q	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	465			R -> Q (in dbSNP:rs34811474).		anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				CTTTATAATCGAAAAGGAAAA	0.323													G|||	371	0.0740815	0.0189	0.1239	5008	,	,		16203	0.0		0.2167	False		,,,				2504	0.0429				p.R465Q		Atlas-SNP	.											ANAPC4,NS,carcinoma,+1,1	ANAPC4	61	1	0			c.G1394A						scavenged	.	G	GLN/ARG	180,4226	101.6+/-140.2	7,166,2030	53.0	56.0	55.0		1394	5.1	1.0	4	dbSNP_126	55	1886,6710	323.5+/-316.1	207,1472,2619	yes	missense	ANAPC4	NM_013367.2	43	214,1638,4649	AA,AG,GG		21.9404,4.0853,15.8899	benign	465/809	25408838	2066,10936	2203	4298	6501	SO:0001583	missense	29945	exon20			ATAATCGAAAAGG	AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.1394G>A	4.37:g.25408838G>A	ENSP00000318775:p.Arg465Gln	Somatic	252	1	0.00396825		WXS	Illumina HiSeq	Phase_I	313	13	0.0415335	NM_013367	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Missense_Mutation	SNP	ENST00000315368.3	37	CCDS3434.1	223	0.1021062271062271	10	0.02032520325203252	54	0.14917127071823205	0	0.0	159	0.20976253298153033	G	13.01	2.110474	0.37242	0.040853	0.219404	ENSG00000053900	ENST00000315368;ENST00000510092	T;T	0.32023	1.47;1.47	5.13	5.13	0.70059	.	0.059354	0.64402	D	0.000001	T	0.00012	0.0000	L	0.27053	0.805	0.21445	P	0.999685615	B	0.25312	0.123	B	0.13407	0.009	T	0.21143	-1.0254	9	0.10377	T	0.69	-6.5303	12.3291	0.55028	0.078:0.0:0.922:0.0	rs34811474;rs61748742	465	Q9UJX5	APC4_HUMAN	Q	465;466	ENSP00000318775:R465Q;ENSP00000426654:R466Q	ENSP00000318775:R465Q	R	+	2	0	ANAPC4	25017936	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.177000	0.71961	2.569000	0.86673	0.591000	0.81541	CGA	G|0.858;A|0.142	0.142	strong		0.323	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1	NM_013367	
MXRA5	25878	hgsc.bcm.edu	37	X	3238733	3238733	+	Missense_Mutation	SNP	G	G	A	rs1974522	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chrX:3238733G>A	ENST00000217939.6	-	5	5147	c.4993C>T	c.(4993-4995)Cca>Tca	p.P1665S		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1665			P -> S (in dbSNP:rs1974522).			extracellular vesicular exosome (GO:0070062)		p.P1665S(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GATAATCTTGGAGTTGTAAAC	0.423													G|||	1629	0.431523	0.2118	0.3905	3775	,	,		16126	0.2728		0.4573	False		,,,				2504	0.3507				p.P1665S		Atlas-SNP	.											.	MXRA5	815	.	2	Substitution - Missense(2)	stomach(2)	c.C4993T						PASS	.	G	SER/PRO	1167,2668		139,714,175,779,396	166.0	158.0	161.0		4993	2.3	0.0	X	dbSNP_92	161	3839,2889		793,1187,1066,448,806	yes	missense	MXRA5	NM_015419.3	74	932,1901,1241,1227,1202	AA,AG,A,GG,G		42.94,30.4302,47.3918	probably-damaging	1665/2829	3238733	5006,5557	2203	4300	6503	SO:0001583	missense	25878	exon5			ATCTTGGAGTTGT	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.4993C>T	X.37:g.3238733G>A	ENSP00000217939:p.Pro1665Ser	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	140	6	0.0428571	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	743	0.4478601567209162	70	0.16203703703703703	89	0.31338028169014087	105	0.23863636363636365	240	0.43636363636363634	g	9.833	1.188977	0.21954	0.304302	0.5706	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.63096	-0.02	3.2	2.3	0.28687	.	0.184807	0.26149	U	0.026059	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	P	0.39809	0.689	B	0.31547	0.132	T	0.46965	-0.9153	9	0.51188	T	0.08	.	11.4118	0.49929	0.0:0.0:0.8176:0.1824	rs1974522;rs3752335;rs17335205;rs57959586;rs1974522	1665	Q9NR99	MXRA5_HUMAN	S	1665	ENSP00000217939:P1665S	ENSP00000217939:P1665S	P	-	1	0	MXRA5	3248733	0.091000	0.21658	0.004000	0.12327	0.040000	0.13550	1.291000	0.33330	0.345000	0.23873	0.431000	0.28591	CCA	0|0.015;A|0.441;C|0.000;G|0.544;N|0.000	0.441	strong		0.423	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
SPATA18	132671	hgsc.bcm.edu	37	4	52938302	52938302	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:52938302G>T	ENST00000295213.4	+	6	1112	c.738G>T	c.(736-738)gaG>gaT	p.E246D	SPATA18_ENST00000506829.1_3'UTR|SPATA18_ENST00000419395.2_Missense_Mutation_p.E214D	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	246					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)		p.E246E(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TGTCTGCTGAGAAAAGTGCAC	0.453																																					p.E246D		Atlas-SNP	.											SPATA18_ENST00000295213,colon,carcinoma,+2,5	SPATA18	222	5	1	Substitution - coding silent(1)	ovary(1)	c.G738T						PASS	.						79.0	75.0	76.0					4																	52938302		2203	4300	6503	SO:0001583	missense	132671	exon6			TGCTGAGAAAAGT	BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.738G>T	4.37:g.52938302G>T	ENSP00000295213:p.Glu246Asp	Somatic	203	0	0		WXS	Illumina HiSeq	Phase_I	203	78	0.384236	NM_145263	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	ENST00000295213.4	37	CCDS3489.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507772	0.27036	.	.	ENSG00000163071	ENST00000295213;ENST00000419395	T;D	0.88354	0.43;-2.37	4.97	-1.64	0.08318	.	0.047408	0.85682	D	0.000000	D	0.92499	0.7618	M	0.78049	2.395	0.43080	D	0.994736	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.80764	0.994;0.994;0.99	D	0.90626	0.4563	10	0.72032	D	0.01	-26.6162	11.075	0.48025	0.3755:0.0:0.6245:0.0	.	214;246;246	Q8TC71-2;Q8TC71;Q96M13	.;MIEAP_HUMAN;.	D	246;214	ENSP00000295213:E246D;ENSP00000415309:E214D	ENSP00000295213:E246D	E	+	3	2	SPATA18	52633059	1.000000	0.71417	0.464000	0.27143	0.008000	0.06430	0.397000	0.20883	-0.461000	0.06993	-0.355000	0.07637	GAG	.	.	none		0.453	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263	
SPP2	6694	hgsc.bcm.edu	37	2	234967539	234967539	+	Silent	SNP	T	T	A	rs593668	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:234967539T>A	ENST00000168148.3	+	3	358	c.270T>A	c.(268-270)acT>acA	p.T90T	SPP2_ENST00000373368.1_Silent_p.T90T	NM_006944.2	NP_008875.1	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa	90					bone remodeling (GO:0046849)|negative regulation of endopeptidase activity (GO:0010951)|protein complex assembly (GO:0006461)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	endopeptidase inhibitor activity (GO:0004866)			breast(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		TCCGGGAGACTACATGCAGGA	0.443													T|||	3458	0.690495	0.6097	0.6772	5008	,	,		20784	0.629		0.7187	False		,,,				2504	0.8436				p.T90T		Atlas-SNP	.											.	SPP2	35	.	0			c.T270A						PASS	.	T		2722,1684	655.5+/-399.9	856,1010,337	120.0	108.0	112.0		270	-8.0	0.0	2	dbSNP_83	112	6202,2398	700.9+/-405.2	2213,1776,311	no	coding-synonymous	SPP2	NM_006944.2		3069,2786,648	AA,AT,TT		27.8837,38.2206,31.3855		90/212	234967539	8924,4082	2203	4300	6503	SO:0001819	synonymous_variant	6694	exon3			GGAGACTACATGC		CCDS2511.1	2q37.1	2012-08-14	2002-08-29		ENSG00000072080	ENSG00000072080			11256	protein-coding gene	gene with protein product		602637	"""secreted phosphoprotein 2, 24kD"""			9533032	Standard	XM_005246102		Approved	SPP24	uc002vvk.1	Q13103	OTTHUMG00000059208	ENST00000168148.3:c.270T>A	2.37:g.234967539T>A		Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	116	6	0.0517241	NM_006944	A4QMV3|Q3B892|Q546M5	Silent	SNP	ENST00000168148.3	37	CCDS2511.1																																																																																			T|0.324;A|0.676	0.676	strong		0.443	SPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131313.3	NM_006944	
MUC16	94025	hgsc.bcm.edu	37	19	9059232	9059232	+	Missense_Mutation	SNP	T	T	C	rs12710265	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:9059232T>C	ENST00000397910.4	-	3	28417	c.28214A>G	c.(28213-28215)cAg>cGg	p.Q9405R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9407	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CACCACTGACTGTGGAAATCT	0.537													T|||	907	0.18111	0.149	0.2075	5008	,	,		20338	0.0099		0.3121	False		,,,				2504	0.2474				p.Q9405R		Atlas-SNP	.											.	MUC16	4315	.	0			c.A28214G						PASS	.	T	ARG/GLN	633,3363		46,541,1411	121.0	118.0	119.0		28214	-0.0	0.0	19	dbSNP_121	119	2825,5559		498,1829,1865	yes	missense	MUC16	NM_024690.2	43	544,2370,3276	CC,CT,TT		33.6951,15.8408,27.9321	benign	9405/14508	9059232	3458,8922	1998	4192	6190	SO:0001583	missense	94025	exon3			ACTGACTGTGGAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28214A>G	19.37:g.9059232T>C	ENSP00000381008:p.Gln9405Arg	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	112	5	0.0446429	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	390	0.17857142857142858	68	0.13821138211382114	78	0.2154696132596685	5	0.008741258741258742	239	0.3153034300791557	t	4.217	0.039079	0.08148	0.158408	0.336951	ENSG00000181143	ENST00000397910	T	0.21932	1.98	2.14	-0.0415	0.13867	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	.	.	.	B	0.16603	0.018	B	0.17722	0.019	T	0.44636	-0.9315	8	0.87932	D	0	.	4.3999	0.11381	0.0:0.3505:0.0:0.6495	rs12710265;rs12710265	9405	B5ME49	.	R	9405	ENSP00000381008:Q9405R	ENSP00000381008:Q9405R	Q	-	2	0	MUC16	8920232	0.000000	0.05858	0.001000	0.08648	0.038000	0.13279	-0.483000	0.06536	-0.076000	0.12775	0.255000	0.18592	CAG	T|0.786;C|0.214	0.214	strong		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CORT	1325	hgsc.bcm.edu	37	1	10511544	10511544	+	Silent	SNP	C	C	T	rs628462	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:10511544C>T	ENST00000377049.3	+	2	715	c.210C>T	c.(208-210)gcC>gcT	p.A70A	APITD1-CORT_ENST00000400900.2_Silent_p.A129A|APITD1_ENST00000602296.1_3'UTR|APITD1-CORT_ENST00000470413.2_3'UTR|CORT_ENST00000320498.4_Silent_p.A120A|APITD1-CORT_ENST00000465026.1_3'UTR|APITD1_ENST00000602787.1_Silent_p.A129A	NM_001302.4	NP_001293.3	O00230	CORT_HUMAN	cortistatin	70					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)	G-protein coupled receptor binding (GO:0001664)|neuropeptide hormone activity (GO:0005184)			breast(1)|endometrium(1)|stomach(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0487)		GAGAGGAAGCCCGGGAGGTGG	0.627													C|||	1440	0.28754	0.0212	0.3112	5008	,	,		14123	0.4871		0.3907	False		,,,				2504	0.319				p.A129A		Atlas-SNP	.											CORT,colon,carcinoma,0,2	.	.	2	0			c.C387T						scavenged	.	C	,,	351,4051		21,309,1871	24.0	30.0	28.0		210,387,	-2.3	0.0	1	dbSNP_83	28	3414,5182		682,2050,1566	no	coding-synonymous,coding-synonymous,utr-3	CORT,APITD1-CORT	NM_001302.4,NM_198544.3,NM_199006.2	,,	703,2359,3437	TT,TC,CC		39.7161,7.9736,28.966	,,	70/106,129/165,	10511544	3765,9233	2201	4298	6499	SO:0001819	synonymous_variant	100526739	exon5			GGAAGCCCGGGAG	AF013252	CCDS117.1, CCDS117.2	1p36.22	2013-02-25			ENSG00000241563	ENSG00000241563		"""Endogenous ligands"""	2257	protein-coding gene	gene with protein product	"""prepro-cortistatin"""	602784				9205124	Standard	NM_001302		Approved	MGC32686		O00230	OTTHUMG00000001906	ENST00000377049.3:c.210C>T	1.37:g.10511544C>T		Somatic	239	0	0		WXS	Illumina HiSeq	Phase_I	189	7	0.037037	NM_198544	Q5T6G0|Q6UX11	Silent	SNP	ENST00000377049.3	37	CCDS117.2																																																																																			C|0.685;T|0.315	0.315	strong		0.627	CORT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005410.3	NM_001302	
EPHA5	2044	hgsc.bcm.edu	37	4	66467586	66467586	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:66467586A>G	ENST00000273854.3	-	3	1283	c.683T>C	c.(682-684)gTa>gCa	p.V228A	EPHA5_ENST00000432638.2_Missense_Mutation_p.V228A|EPHA5_ENST00000354839.4_Missense_Mutation_p.V228A|EPHA5_ENST00000511294.1_Missense_Mutation_p.V228A	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	228	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TTTATAGTATACACGCACAGA	0.453										TSP Lung(17;0.13)																											p.V228A		Atlas-SNP	.											EPHA5,colon,carcinoma,0,1	EPHA5	315	1	0			c.T683C						PASS	.						70.0	67.0	68.0					4																	66467586		2203	4300	6503	SO:0001583	missense	2044	exon3			TAGTATACACGCA	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.683T>C	4.37:g.66467586A>G	ENSP00000273854:p.Val228Ala	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	110	39	0.354545	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.044907	0.75732	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.07327	3.2;3.2;3.2;3.2	5.83	5.83	0.93111	Tyrosine-protein kinase, receptor class V, conserved site (1);Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.56097	D	0.000038	T	0.33118	0.0852	M	0.84326	2.69	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;1.0;0.998;0.999	D;D;D;D	0.91635	0.998;0.999;0.997;0.997	T	0.06303	-1.0834	10	0.52906	T	0.07	.	16.1982	0.82046	1.0:0.0:0.0:0.0	.	228;228;228;228	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	A	228	ENSP00000273854:V228A;ENSP00000389208:V228A;ENSP00000346899:V228A;ENSP00000427638:V228A	ENSP00000273854:V228A	V	-	2	0	EPHA5	66150181	1.000000	0.71417	0.997000	0.53966	0.941000	0.58515	9.339000	0.96797	2.226000	0.72624	0.533000	0.62120	GTA	.	.	none		0.453	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
YEATS2	55689	hgsc.bcm.edu	37	3	183476685	183476685	+	Missense_Mutation	SNP	G	G	A	rs262993	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:183476685G>A	ENST00000305135.5	+	13	1783	c.1588G>A	c.(1588-1590)Gtc>Atc	p.V530I		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	530			V -> I (in dbSNP:rs262993).		chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GGCTTCTCAGGTCTCCCAAGG	0.363													G|||	2132	0.425719	0.261	0.4467	5008	,	,		18474	0.5188		0.4533	False		,,,				2504	0.5092				p.V530I		Atlas-SNP	.											YEATS2,NS,carcinoma,-1,1	YEATS2	111	1	0			c.G1588A						scavenged	.	G	ILE/VAL	1039,2615		149,741,937	129.0	118.0	121.0		1588	4.2	1.0	3	dbSNP_79	121	3602,4572		784,2034,1269	yes	missense	YEATS2	NM_018023.4	29	933,2775,2206	AA,AG,GG		44.0666,28.4346,39.2374	benign	530/1423	183476685	4641,7187	1827	4087	5914	SO:0001583	missense	55689	exon13			TCTCAGGTCTCCC	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.1588G>A	3.37:g.183476685G>A	ENSP00000306983:p.Val530Ile	Somatic	445	0	0		WXS	Illumina HiSeq	Phase_I	423	7	0.0165485	NM_018023	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	37	CCDS43175.1	927	0.42445054945054944	117	0.23780487804878048	164	0.4530386740331492	309	0.5402097902097902	337	0.4445910290237467	G	16.01	3.001348	0.54254	0.284346	0.440666	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.28895	1.59	5.22	4.15	0.48705	.	0.448888	0.20667	N	0.087912	T	0.00012	0.0000	N	0.08118	0	0.53005	P	3.100000000000325E-5	B	0.23937	0.094	B	0.14023	0.01	T	0.40308	-0.9570	9	0.72032	D	0.01	-1.2302	14.6752	0.68975	0.082:0.0:0.918:0.0	rs262993;rs58123380;rs262993	530	Q9ULM3	YETS2_HUMAN	I	530	ENSP00000306983:V530I	ENSP00000306983:V530I	V	+	1	0	YEATS2	184959379	1.000000	0.71417	0.990000	0.47175	0.979000	0.70002	5.373000	0.66162	2.449000	0.82847	0.585000	0.79938	GTC	G|0.576;A|0.424	0.424	strong		0.363	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023	
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12907358	12907358	+	Missense_Mutation	SNP	T	T	C	rs74587302|rs559905244	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:12907358T>C	ENST00000317869.6	-	2	1010	c.785A>G	c.(784-786)cAg>cGg	p.Q262R		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	262						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						GTCATCCCCCTGATCTTCATT	0.498																																					p.Q262R		Atlas-SNP	.											HNRNPCL1,NS,neuroblastoma,0,1	HNRNPCL1	68	1	0			c.A785G						scavenged	.						143.0	157.0	152.0					1																	12907358		2203	4300	6503	SO:0001583	missense	343069	exon2			TCCCCCTGATCTT	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.785A>G	1.37:g.12907358T>C	ENSP00000365370:p.Gln262Arg	Somatic	56	1	0.0178571		WXS	Illumina HiSeq	Phase_I	55	4	0.0727273	NM_001013631	B2RP44	Missense_Mutation	SNP	ENST00000317869.6	37	CCDS30591.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.089806	0.00367	.	.	ENSG00000179172	ENST00000317869	T	0.09445	2.98	0.343	-0.686	0.11324	.	2.239460	0.02976	N	0.145045	T	0.04724	0.0128	N	0.02830	-0.485	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33650	-0.9860	10	0.33940	T	0.23	.	3.9448	0.09344	0.0:0.3889:0.0:0.6111	.	262	O60812	HNRCL_HUMAN	R	262	ENSP00000365370:Q262R	ENSP00000365370:Q262R	Q	-	2	0	HNRNPCL1	12829945	0.213000	0.23551	0.005000	0.12908	0.003000	0.03518	0.096000	0.15147	-0.605000	0.05753	-0.620000	0.04034	CAG	.	.	weak		0.498	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
TNFSF12	8742	hgsc.bcm.edu	37	17	7452542	7452542	+	Silent	SNP	C	C	T	rs77711855	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:7452542C>T	ENST00000293825.6	+	1	335	c.72C>T	c.(70-72)ctC>ctT	p.L24L	TNFSF12_ENST00000557233.1_Silent_p.L24L|TNFSF12-TNFSF13_ENST00000293826.4_Silent_p.L24L	NM_003809.2	NP_003800.1	O43508	TNF12_HUMAN	tumor necrosis factor (ligand) superfamily, member 12	24					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|endothelial cell migration (GO:0043542)|immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|prostate(2)	11		Prostate(122;0.157)				TGGTCCCGCTCGCGCTGGGCC	0.791													C|||	560	0.111821	0.1944	0.0706	5008	,	,		9326	0.1151		0.0825	False		,,,				2504	0.0562				p.L24L		Atlas-SNP	.											.	TNFSF12	20	.	0			c.C72T						PASS	.	C	,	215,1795		0,215,790	1.0	1.0	1.0		72,72	-4.8	0.7	17	dbSNP_132	1	261,3683		4,253,1715	no	coding-synonymous,coding-synonymous	TNFSF12,TNFSF12-TNFSF13	NM_003809.2,NM_172089.3	,	4,468,2505	TT,TC,CC		6.6176,10.6965,7.9946	,	24/250,24/331	7452542	476,5478	1005	1972	2977	SO:0001819	synonymous_variant	8742	exon1			CCCGCTCGCGCTG	AF030099	CCDS11109.1	17p13.1	2008-02-01			ENSG00000239697	ENSG00000239697		"""Tumor necrosis factor (ligand) superfamily"""	11927	protein-coding gene	gene with protein product		602695				9405449, 9560343	Standard	NM_003809		Approved	TWEAK, DR3LG, APO3L		O43508	OTTHUMG00000108148	ENST00000293825.6:c.72C>T	17.37:g.7452542C>T		Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	9	6	0.666667	NM_003809	Q8IZK7|Q8WUZ7	Silent	SNP	ENST00000293825.6	37	CCDS11109.1																																																																																			C|0.883;T|0.117	0.117	strong		0.791	TNFSF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226951.2	NM_003809	
SCUBE1	80274	hgsc.bcm.edu	37	22	43610207	43610207	+	Missense_Mutation	SNP	A	A	G	rs138993	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr22:43610207A>G	ENST00000360835.4	-	16	2068	c.1942T>C	c.(1942-1944)Tca>Cca	p.S648P	Z82214.3_ENST00000420269.1_RNA	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	648			S -> P (in dbSNP:rs138993). {ECO:0000269|PubMed:12270931}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				GGCATACATGACACACACTGG	0.642													G|||	2176	0.434505	0.3797	0.5865	5008	,	,		14946	0.0784		0.6789	False		,,,				2504	0.5164				p.S648P		Atlas-SNP	.											SCUBE1,NS,carcinoma,0,1	SCUBE1	105	1	0			c.T1942C						PASS	.		PRO/SER	1954,2452	620.6+/-393.6	448,1058,697	79.0	59.0	66.0		1942	3.8	1.0	22	dbSNP_78	66	5931,2669	428.4+/-355.9	2033,1865,402	yes	missense	SCUBE1	NM_173050.3	74	2481,2923,1099	GG,GA,AA		31.0349,44.3486,39.3741	benign	648/989	43610207	7885,5121	2203	4300	6503	SO:0001583	missense	80274	exon16			TACATGACACACA		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.1942T>C	22.37:g.43610207A>G	ENSP00000354080:p.Ser648Pro	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	92	6	0.0652174	NM_173050	Q5R336	Missense_Mutation	SNP	ENST00000360835.4	37	CCDS14048.1	952	0.4358974358974359	185	0.37601626016260165	219	0.6049723756906077	55	0.09615384615384616	493	0.6503957783641161	g	1.626	-0.520336	0.04171	0.443486	0.689651	ENSG00000159307	ENST00000360835;ENST00000381243	T	0.12255	2.7	3.81	3.81	0.43845	Tyrosine-protein kinase ephrin type A/B receptor-like (1);Growth factor, receptor (1);	0.160270	0.56097	N	0.000023	T	0.00012	0.0000	N	0.01003	-1.06	0.09310	P	0.9999999999999984	B	0.02656	0.0	B	0.01281	0.0	T	0.25152	-1.0140	9	0.07813	T	0.8	.	11.924	0.52808	0.0866:0.0:0.9134:0.0	rs138993;rs60843257;rs138993	648	Q8IWY4	SCUB1_HUMAN	P	648;278	ENSP00000354080:S648P	ENSP00000354080:S648P	S	-	1	0	SCUBE1	41940151	1.000000	0.71417	0.976000	0.42696	0.167000	0.22549	4.576000	0.60915	0.958000	0.37956	-0.246000	0.11932	TCA	A|0.489;G|0.511	0.511	strong		0.642	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050	
HIST1H2AE	3012	hgsc.bcm.edu	37	6	26217398	26217398	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:26217398C>G	ENST00000303910.2	+	1	234	c.196C>G	c.(196-198)Cta>Gta	p.L66V	HIST1H2BG_ENST00000244601.3_5'Flank	NM_021052.2	NP_066390.1	P04908	H2A1B_HUMAN	histone cluster 1, H2ae	66						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	10		all_hematologic(11;0.196)				GATCTTAGAGCTAGCTGGCAA	0.607																																					p.L66V		Atlas-SNP	.											.	HIST1H2AE	25	.	0			c.C196G						PASS	.						57.0	57.0	57.0					6																	26217398		2203	4300	6503	SO:0001583	missense	3012	exon1			TTAGAGCTAGCTG	M60752	CCDS4595.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000168274	ENSG00000277075		"""Histones / Replication-dependent"""	4724	protein-coding gene	gene with protein product		602786	"""H2A histone family, member A"", ""histone 1, H2ae"""	H2AFA		9119399, 1916825, 12408966	Standard	NM_021052		Approved	H2A/a, H2A.1	uc003nha.1	P04908	OTTHUMG00000014440	ENST00000303910.2:c.196C>G	6.37:g.26217398C>G	ENSP00000303373:p.Leu66Val	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	124	52	0.419355	NM_021052	P28001|Q76P63	Missense_Mutation	SNP	ENST00000303910.2	37	CCDS4595.1	.	.	.	.	.	.	.	.	.	.	.	10.95	1.494701	0.26774	.	.	ENSG00000168274	ENST00000303910	T	0.70631	-0.5	4.07	4.07	0.47477	.	0.000000	0.27886	U	0.017441	D	0.84311	0.5444	H	0.95884	3.735	0.38725	D	0.953543	.	.	.	.	.	.	D	0.87649	0.2527	8	0.87932	D	0	.	9.5775	0.39468	0.0:0.9023:0.0:0.0977	.	.	.	.	V	66	ENSP00000303373:L66V	ENSP00000303373:L66V	L	+	1	2	HIST1H2AE	26325377	0.997000	0.39634	1.000000	0.80357	0.029000	0.11900	0.500000	0.22562	2.263000	0.75096	0.650000	0.86243	CTA	.	.	none		0.607	HIST1H2AE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040103.1	NM_021052	
CBWD1	55871	hgsc.bcm.edu	37	9	163985	163985	+	Silent	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:163985A>G	ENST00000356521.4	-	5	571	c.483T>C	c.(481-483)taT>taC	p.Y161Y	CBWD1_ENST00000382447.4_Silent_p.Y161Y|CBWD1_ENST00000377447.3_Silent_p.Y161Y|CBWD1_ENST00000377400.4_Silent_p.Y161Y|CBWD1_ENST00000314367.10_Silent_p.Y125Y|CBWD1_ENST00000431099.2_Silent_p.Y125Y	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1	161							ATP binding (GO:0005524)			kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TACCATCAAGATAAATATCAC	0.323																																					p.Y161Y		Atlas-SNP	.											CBWD1,NS,carcinoma,0,4	CBWD1	24	4	0			c.T483C						scavenged	.						52.0	80.0	70.0					9																	163985		1501	2702	4203	SO:0001819	synonymous_variant	55871	exon5			ATCAAGATAAATA	AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.483T>C	9.37:g.163985A>G		Somatic	550	8	0.0145455		WXS	Illumina HiSeq	Phase_I	605	19	0.031405	NM_001145356	A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	Silent	SNP	ENST00000356521.4	37	CCDS6438.1																																																																																			.	.	weak		0.323	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051463.1	NM_018491	
SLC30A5	64924	hgsc.bcm.edu	37	5	68419054	68419054	+	Silent	SNP	A	A	T	rs164572	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:68419054A>T	ENST00000396591.3	+	14	2410	c.1800A>T	c.(1798-1800)acA>acT	p.T600T	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	600					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TGGCAGATACACTTGGCAGCA	0.318													A|||	2015	0.402356	0.2519	0.4107	5008	,	,		18363	0.5397		0.4225	False		,,,				2504	0.4376				p.T600T		Atlas-SNP	.											.	SLC30A5	54	.	0			c.A1800T						PASS	.	A		1157,3249	410.2+/-335.3	142,873,1188	129.0	114.0	119.0		1800	-1.5	1.0	5	dbSNP_79	119	3721,4879	533.2+/-382.4	829,2063,1408	no	coding-synonymous	SLC30A5	NM_022902.3		971,2936,2596	TT,TA,AA		43.2674,26.2596,37.5058		600/766	68419054	4878,8128	2203	4300	6503	SO:0001819	synonymous_variant	64924	exon14			AGATACACTTGGC	AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.1800A>T	5.37:g.68419054A>T		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	84	5	0.0595238	NM_022902	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Silent	SNP	ENST00000396591.3	37	CCDS3996.1																																																																																			A|0.607;T|0.393	0.393	strong		0.318	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254017.2		
OSBP2	23762	hgsc.bcm.edu	37	22	31091139	31091139	+	Silent	SNP	A	A	G	rs13053290	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr22:31091139A>G	ENST00000332585.6	+	1	347	c.243A>G	c.(241-243)gaA>gaG	p.E81E	OSBP2_ENST00000407373.1_Intron|OSBP2_ENST00000446658.2_Silent_p.E81E|OSBP2_ENST00000382310.3_Silent_p.E81E|OSBP2_ENST00000403222.3_Intron	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	81					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						CAAGATCGGAACCTGTGTCCG	0.682													g|||	1261	0.251797	0.525	0.2104	5008	,	,		11206	0.004		0.2972	False		,,,				2504	0.1207				p.E81E		Atlas-SNP	.											OSBP2,NS,carcinoma,0,1	OSBP2	52	1	0			c.A243G						scavenged	.	T		1980,2314		487,1006,654	30.0	40.0	37.0		243	-0.1	0.0	22	dbSNP_121	37	2443,6075		333,1777,2149	no	coding-synonymous	OSBP2	NM_030758.3		820,2783,2803	GG,GA,AA		28.6804,46.1109,34.5223		81/917	31091139	4423,8389	2147	4259	6406	SO:0001819	synonymous_variant	23762	exon1			ATCGGAACCTGTG		CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.243A>G	22.37:g.31091139A>G		Somatic	172	3	0.0174419		WXS	Illumina HiSeq	Phase_I	143	5	0.034965	NM_030758	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Silent	SNP	ENST00000332585.6	37	CCDS43002.1																																																																																			A|0.726;G|0.274	0.274	strong		0.682	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321547.2	NM_030758	
FAR2	55711	hgsc.bcm.edu	37	12	29423460	29423460	+	Silent	SNP	G	G	A	rs2216854	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:29423460G>A	ENST00000536681.3	+	2	324	c.78G>A	c.(76-78)ctG>ctA	p.L26L	FAR2_ENST00000182377.4_Silent_p.L26L|FAR2_ENST00000547116.1_Intron	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	26					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)	p.L26L(1)		central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						GCAAAGTGCTGATGGAGAAGC	0.522													G|||	2143	0.427915	0.6399	0.2781	5008	,	,		19075	0.4058		0.3459	False		,,,				2504	0.3548				p.L26L		Atlas-SNP	.											FAR2,NS,carcinoma,0,1	FAR2	60	1	1	Substitution - coding silent(1)	stomach(1)	c.G78A						scavenged	.	G		2631,1775	643.9+/-397.9	785,1061,357	79.0	77.0	78.0		78	2.2	1.0	12	dbSNP_96	78	3261,5339	489.3+/-372.6	641,1979,1680	no	coding-synonymous	FAR2	NM_018099.3		1426,3040,2037	AA,AG,GG		37.9186,40.286,45.3022		26/516	29423460	5892,7114	2203	4300	6503	SO:0001819	synonymous_variant	55711	exon2			AGTGCTGATGGAG	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.78G>A	12.37:g.29423460G>A		Somatic	191	0	0		WXS	Illumina HiSeq	Phase_I	259	7	0.027027	NM_018099	F8VV73|Q9H0D5|Q9NVW8	Silent	SNP	ENST00000536681.3	37	CCDS8717.1																																																																																			G|0.554;A|0.446	0.446	strong		0.522	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099	
CELF5	60680	hgsc.bcm.edu	37	19	3224896	3224896	+	Silent	SNP	G	G	C	rs17852497	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:3224896G>C	ENST00000292672.2	+	1	196	c.159G>C	c.(157-159)ccG>ccC	p.P53P	CELF5_ENST00000541430.2_Silent_p.P53P	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	53	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						GCCAGATCCCGCGGCACCTGG	0.677													G|||	873	0.174321	0.1104	0.1671	5008	,	,		3684	0.1984		0.2256	False		,,,				2504	0.1881				p.P53P		Atlas-SNP	.											CELF5,NS,carcinoma,0,1	CELF5	32	1	0			c.G159C						scavenged	.	G	,	632,3772		46,540,1616	21.0	20.0	20.0		159,159	-0.6	0.9	19	dbSNP_123	20	1751,6843		186,1379,2732	no	coding-synonymous,coding-synonymous	CELF5	NM_001172673.1,NM_021938.3	,	232,1919,4348	CC,CG,GG		20.3747,14.3506,18.3336	,	53/410,53/486	3224896	2383,10615	2202	4297	6499	SO:0001819	synonymous_variant	60680	exon1			GATCCCGCGGCAC	AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.159G>C	19.37:g.3224896G>C		Somatic	230	5	0.0217391		WXS	Illumina HiSeq	Phase_I	173	13	0.0751445	NM_021938	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Silent	SNP	ENST00000292672.2	37	CCDS12106.1																																																																																			G|0.815;C|0.185	0.185	strong		0.677	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1	NM_021938	
ATG14	22863	hgsc.bcm.edu	37	14	55864146	55864146	+	Silent	SNP	G	G	A	rs61743178	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:55864146G>A	ENST00000247178.5	-	2	263	c.228C>T	c.(226-228)atC>atT	p.I76I		NM_014924.4	NP_055739.2	Q6ZNE5	BAKOR_HUMAN	autophagy related 14	76					autophagic vacuole assembly (GO:0000045)|endosome to lysosome transport (GO:0008333)|positive regulation of autophagy (GO:0010508)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|pre-autophagosomal structure membrane (GO:0034045)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(2)	13						CCTTCTTGTCGATAAACCTGT	0.338													A|||	125	0.0249601	0.0038	0.0231	5008	,	,		20578	0.003		0.0437	False		,,,				2504	0.0583				p.I76I		Atlas-SNP	.											.	ATG14	36	.	0			c.C228T						PASS	.	A		50,4354	817.7+/-416.3	0,50,2152	116.0	99.0	105.0		228	3.0	1.0	14	dbSNP_129	105	472,8126	796.2+/-407.5	14,444,3841	no	coding-synonymous	ATG14	NM_014924.4		14,494,5993	AA,AG,GG		5.4896,1.1353,4.0148		76/493	55864146	522,12480	2202	4299	6501	SO:0001819	synonymous_variant	22863	exon2			CTTGTCGATAAAC	AB020638	CCDS32087.1	14q22.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000126775	ENSG00000126775			19962	protein-coding gene	gene with protein product	"""Barkor"", ""beclin 1-associated autophagy-related key regulator"""	613515	"""KIAA0831"", ""ATG14 autophagy related 14 homolog (S. cerevisiae)"""	KIAA0831		18843052	Standard	NM_014924		Approved	ATG14L	uc001xbx.2	Q6ZNE5	OTTHUMG00000172129	ENST00000247178.5:c.228C>T	14.37:g.55864146G>A		Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	116	5	0.0431034	NM_014924	A6NJE4|A8K9U5|B7ZWP5|O94920|Q32MK7|Q32MK8	Silent	SNP	ENST00000247178.5	37	CCDS32087.1																																																																																			G|0.966;A|0.034	0.034	strong		0.338	ATG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416992.1	NM_014924	
PSD3	23362	hgsc.bcm.edu	37	8	18725428	18725428	+	Silent	SNP	A	A	G	rs17127370	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:18725428A>G	ENST00000327040.8	-	4	1492	c.1390T>C	c.(1390-1392)Tta>Cta	p.L464L	PSD3_ENST00000440756.2_Silent_p.L464L|PSD3_ENST00000523619.1_Silent_p.L399L	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	464					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		TCTGAGTATAATGTCTCCAGG	0.458													A|||	503	0.100439	0.2269	0.098	5008	,	,		18498	0.006		0.0507	False		,,,				2504	0.0798				p.L464L		Atlas-SNP	.											.	PSD3	142	.	0			c.T1390C						PASS	.	A		755,3095		77,601,1247	149.0	145.0	146.0		1390	1.6	0.0	8	dbSNP_123	146	453,7845		18,417,3714	no	coding-synonymous	PSD3	NM_015310.3		95,1018,4961	GG,GA,AA		5.4591,19.6104,9.944		464/1048	18725428	1208,10940	1925	4149	6074	SO:0001819	synonymous_variant	23362	exon4			AGTATAATGTCTC	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.1390T>C	8.37:g.18725428A>G		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	82	4	0.0487805	NM_015310	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Silent	SNP	ENST00000327040.8	37	CCDS43720.1																																																																																			A|0.898;G|0.102	0.102	strong		0.458	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310	
ZNF280A	129025	hgsc.bcm.edu	37	22	22868773	22868773	+	Silent	SNP	G	G	A	rs361737	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr22:22868773G>A	ENST00000302097.3	-	2	1434	c.1182C>T	c.(1180-1182)taC>taT	p.Y394Y		NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	394					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CCTGGCACACGTAGGGCATTT	0.433													A|||	2379	0.47504	0.2405	0.7334	5008	,	,		19326	0.4137		0.7068	False		,,,				2504	0.4335				p.Y394Y		Atlas-SNP	.											ZNF280A,NS,adenoma,0,1	ZNF280A	67	1	0			c.C1182T						PASS	.	A		1356,3050	691.9+/-405.5	220,916,1067	124.0	103.0	110.0		1182	-2.9	0.1	22	dbSNP_79	110	5850,2746	436.8+/-358.4	2005,1840,453	no	coding-synonymous	ZNF280A	NM_080740.3		2225,2756,1520	AA,AG,GG		31.9451,30.7762,44.5778		394/543	22868773	7206,5796	2203	4298	6501	SO:0001819	synonymous_variant	129025	exon2			GCACACGTAGGGC	D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.1182C>T	22.37:g.22868773G>A		Somatic	232	0	0		WXS	Illumina HiSeq	Phase_I	49	12	0.244898	NM_080740		Silent	SNP	ENST00000302097.3	37	CCDS13800.1																																																																																			G|0.453;A|0.547	0.547	strong		0.433	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075433.3	NM_080740	
CDC27	996	hgsc.bcm.edu	37	17	45234725	45234725	+	Silent	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:45234725T>C	ENST00000066544.3	-	6	594	c.501A>G	c.(499-501)acA>acG	p.T167T	CDC27_ENST00000446365.2_Silent_p.T106T|CDC27_ENST00000527547.1_Silent_p.T167T|CDC27_ENST00000531206.1_Silent_p.T167T|CDC27_ENST00000528748.1_5'UTR	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	167					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.T167T(7)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGAATTTAAATGTTTGGTCAG	0.368																																					p.T167T		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,0,10	CDC27	337	10	7	Substitution - coding silent(7)	large_intestine(4)|prostate(3)	c.A501G						scavenged	.						74.0	74.0	74.0					17																	45234725		2203	4300	6503	SO:0001819	synonymous_variant	996	exon6			TTTAAATGTTTGG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.501A>G	17.37:g.45234725T>C		Somatic	203	6	0.0295567		WXS	Illumina HiSeq	Phase_I	201	14	0.0696517	NM_001114091	G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	37	CCDS11509.1																																																																																			.	.	none		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12907513	12907513	+	Silent	SNP	T	T	C	rs201121299		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:12907513T>C	ENST00000317869.6	-	2	855	c.630A>G	c.(628-630)aaA>aaG	p.K210K		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	210						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K210N(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						CTACCTCTTGTTTGCTCTGTT	0.448																																					p.K210K		Atlas-SNP	.											HNRNPCL1,NS,carcinoma,0,1	HNRNPCL1	68	1	1	Substitution - Missense(1)	lung(1)	c.A630G						scavenged	.						91.0	98.0	96.0					1																	12907513		2197	4264	6461	SO:0001819	synonymous_variant	343069	exon2			CTCTTGTTTGCTC	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.630A>G	1.37:g.12907513T>C		Somatic	108	6	0.0555556		WXS	Illumina HiSeq	Phase_I	113	3	0.0265487	NM_001013631	B2RP44	Silent	SNP	ENST00000317869.6	37	CCDS30591.1																																																																																			C|1.000;|0.000	1.000	weak		0.448	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
FCGBP	8857	hgsc.bcm.edu	37	19	40408532	40408532	+	Missense_Mutation	SNP	G	G	A	rs36106401	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:40408532G>A	ENST00000221347.6	-	8	4314	c.4307C>T	c.(4306-4308)cCg>cTg	p.P1436L		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1436	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.		P -> L (in dbSNP:rs36106401).			extracellular vesicular exosome (GO:0070062)		p.P1436L(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CTCGCTCCCCGGCGGGCAAGG	0.642													G|||	562	0.11222	0.0363	0.2003	5008	,	,		17719	0.0387		0.1839	False		,,,				2504	0.1544				p.P1436L		Atlas-SNP	.											FCGBP,NS,carcinoma,0,1	FCGBP	416	1	1	Substitution - Missense(1)	stomach(1)	c.C4307T						scavenged	.	G	LEU/PRO	356,4050	181.9+/-209.8	15,326,1862	53.0	57.0	55.0		4307	4.8	0.0	19	dbSNP_126	55	1750,6850	318.2+/-313.6	182,1386,2732	no	missense	FCGBP	NM_003890.2	98	197,1712,4594	AA,AG,GG		20.3488,8.0799,16.1925	probably-damaging	1436/5406	40408532	2106,10900	2203	4300	6503	SO:0001583	missense	8857	exon8			CTCCCCGGCGGGC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4307C>T	19.37:g.40408532G>A	ENSP00000221347:p.Pro1436Leu	Somatic	299	0	0		WXS	Illumina HiSeq	Phase_I	225	8	0.0355556	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	237	0.10851648351648352	21	0.042682926829268296	50	0.13812154696132597	19	0.033216783216783216	147	0.19393139841688653	G	13.46	2.242442	0.39598	0.080799	0.203488	ENSG00000090920	ENST00000221347	T	0.19532	2.14	4.8	4.8	0.61643	von Willebrand factor, type D domain (1);	.	.	.	.	T	0.00012	0.0000	L	0.39566	1.225	0.80722	P	0.0	P	0.37864	0.61	B	0.24701	0.055	T	0.30707	-0.9969	8	0.12103	T	0.63	.	11.0692	0.47993	0.0916:0.0:0.9084:0.0	rs36106401	1436	Q9Y6R7	FCGBP_HUMAN	L	1436	ENSP00000221347:P1436L	ENSP00000221347:P1436L	P	-	2	0	FCGBP	45100372	.	.	0.046000	0.18839	0.004000	0.04260	.	.	2.240000	0.73641	0.644000	0.83932	CCG	G|0.853;A|0.147	0.147	strong		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
TIMELESS	8914	hgsc.bcm.edu	37	12	56814653	56814653	+	Missense_Mutation	SNP	G	G	A	rs2291739	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:56814653G>A	ENST00000553532.1	-	25	3203	c.3053C>T	c.(3052-3054)cCg>cTg	p.P1018L	TIMELESS_ENST00000229201.4_Missense_Mutation_p.P1017L|TIMELESS_ENST00000554616.1_Missense_Mutation_p.P515L					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CCATAGGAGCGGGATAGAAAA	0.532													G|||	1961	0.391573	0.3124	0.3703	5008	,	,		19667	0.2768		0.5636	False		,,,				2504	0.455				p.P1018L		Atlas-SNP	.											.	TIMELESS	107	.	0			c.C3053T						PASS	.	G	LEU/PRO	1561,2845	490.8+/-361.9	285,991,927	85.0	86.0	85.0		3053	5.4	0.9	12	dbSNP_100	85	4786,3814	612.1+/-395.9	1319,2148,833	yes	missense	TIMELESS	NM_003920.3	98	1604,3139,1760	AA,AG,GG		44.3488,35.429,48.8006	possibly-damaging	1018/1209	56814653	6347,6659	2203	4300	6503	SO:0001583	missense	8914	exon25			AGGAGCGGGATAG	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.3053C>T	12.37:g.56814653G>A	ENSP00000450607:p.Pro1018Leu	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	88	5	0.0568182	NM_003920		Missense_Mutation	SNP	ENST00000553532.1	37	CCDS8918.1	912	0.4175824175824176	157	0.31910569105691056	144	0.39779005524861877	185	0.32342657342657344	426	0.5620052770448549	G	18.07	3.541190	0.65085	0.35429	0.556512	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.59364	2.69;2.69;0.27	5.4	5.4	0.78164	Timeless C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	M	0.63843	1.955	0.09310	P	0.99999396782	D	0.89917	1.0	D	0.72338	0.977	T	0.51379	-0.8713	9	0.54805	T	0.06	-20.2551	18.3181	0.90227	0.0:0.0:1.0:0.0	rs2291739;rs11551824;rs17118587;rs58784244;rs2291739	1018	Q9UNS1	TIM_HUMAN	L	1017;1018;515	ENSP00000229201:P1017L;ENSP00000450607:P1018L;ENSP00000450848:P515L	ENSP00000229201:P1018L	P	-	2	0	TIMELESS	55100920	1.000000	0.71417	0.907000	0.35723	0.019000	0.09904	9.170000	0.94795	2.708000	0.92522	0.561000	0.74099	CCG	G|0.548;A|0.452	0.452	strong		0.532	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
RYR1	6261	hgsc.bcm.edu	37	19	38995438	38995438	+	Silent	SNP	T	T	C	rs2960340	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:38995438T>C	ENST00000359596.3	+	51	8118	c.8118T>C	c.(8116-8118)atT>atC	p.I2706I	RYR1_ENST00000360985.3_Silent_p.I2706I|RYR1_ENST00000355481.4_Silent_p.I2706I			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2706	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.I2706I(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGTGCGCCATTGCCGGGGCTC	0.572													C|||	2079	0.415136	0.5182	0.3689	5008	,	,		16810	0.3532		0.2992	False		,,,				2504	0.4918				p.I2706I		Atlas-SNP	.											RYR1,NS,carcinoma,0,1	RYR1	708	1	1	Substitution - coding silent(1)	stomach(1)	c.T8118C						scavenged	.	C	,	2016,2390	612.3+/-391.9	458,1100,645	59.0	56.0	57.0		8118,8118	0.2	1.0	19	dbSNP_101	57	2143,6457	713.9+/-406.0	289,1565,2446	no	coding-synonymous,coding-synonymous	RYR1	NM_000540.2,NM_001042723.1	,	747,2665,3091	CC,CT,TT		24.9186,45.7558,31.9775	,	2706/5039,2706/5034	38995438	4159,8847	2203	4300	6503	SO:0001819	synonymous_variant	6261	exon51			CGCCATTGCCGGG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.8118T>C	19.37:g.38995438T>C		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	71	4	0.056338	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																			T|0.657;C|0.343	0.343	strong		0.572	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
PLEC	5339	hgsc.bcm.edu	37	8	145024578	145024578	+	Silent	SNP	G	G	A	rs190222339	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:145024578G>A	ENST00000322810.4	-	1	466	c.297C>T	c.(295-297)cgC>cgT	p.R99R	PLEC_ENST00000356346.3_Intron|PLEC_ENST00000354958.2_Intron|PLEC_ENST00000527096.1_Intron|PLEC_ENST00000436759.2_Intron	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	99	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GGCGGCGCACGCGCTGCAGAG	0.706													G|||	16	0.00319489	0.0	0.0	5008	,	,		14710	0.0		0.0089	False		,,,				2504	0.0072				p.R99R		Atlas-SNP	.											.	PLEC	1144	.	0			c.C297T						PASS	.	G	,,,	7,4153		0,7,2073	21.0	33.0	29.0		,,,297	-8.1	0.6	8		29	82,8238		0,82,4078	no	intron,intron,intron,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2	,,,	0,89,6151	AA,AG,GG		0.9856,0.1683,0.7131	,,,	,,,99/4685	145024578	89,12391	2080	4160	6240	SO:0001819	synonymous_variant	5339	exon1			GCGCACGCGCTGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.297C>T	8.37:g.145024578G>A		Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	117	7	0.0598291	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.997;A|0.003	0.003	strong		0.706	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
MEP1A	4224	hgsc.bcm.edu	37	6	46766884	46766884	+	Silent	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:46766884G>T	ENST00000230588.4	+	5	237	c.228G>T	c.(226-228)acG>acT	p.T76T		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	76	Metalloprotease.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			CCAGGTGGACGTTCCCCATTC	0.438																																					p.T76T		Atlas-SNP	.											.	MEP1A	93	.	0			c.G228T						PASS	.						162.0	152.0	155.0					6																	46766884		2203	4300	6503	SO:0001819	synonymous_variant	4224	exon5			GTGGACGTTCCCC		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.228G>T	6.37:g.46766884G>T		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	135	43	0.318519	NM_005588	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Silent	SNP	ENST00000230588.4	37	CCDS4918.1																																																																																			.	.	none		0.438	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588	
ERO1LB	56605	hgsc.bcm.edu	37	1	236413230	236413230	+	Missense_Mutation	SNP	T	T	A	rs2477599	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:236413230T>A	ENST00000354619.5	-	5	587	c.386A>T	c.(385-387)gAt>gTt	p.D129V	ERO1LB_ENST00000327333.8_Missense_Mutation_p.D129V	NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)	129			D -> V (in dbSNP:rs2477599). {ECO:0000269|PubMed:15489334}.		4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	TTGCTCACAATCTTCTAATTC	0.279													T|||	1680	0.335463	0.1354	0.3646	5008	,	,		15154	0.1329		0.6014	False		,,,				2504	0.5204				p.D129V		Atlas-SNP	.											.	ERO1LB	48	.	0			c.A386T						PASS	.	T	VAL/ASP	858,3546	337.6+/-304.9	86,686,1430	146.0	130.0	136.0		386	4.7	0.8	1	dbSNP_100	136	5117,3469	632.1+/-398.6	1514,2089,690	yes	missense	ERO1LB	NM_019891.3	152	1600,2775,2120	AA,AT,TT		40.403,19.4823,45.9969	benign	129/468	236413230	5975,7015	2202	4293	6495	SO:0001583	missense	56605	exon5			TCACAATCTTCTA	AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.386A>T	1.37:g.236413230T>A	ENSP00000346635:p.Asp129Val	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	145	6	0.0413793	NM_019891	B4DF57|Q5T1H4|Q8IZ11|Q9NR62	Missense_Mutation	SNP	ENST00000354619.5	37	CCDS31064.1	754	0.34523809523809523	75	0.1524390243902439	131	0.36187845303867405	75	0.13111888111888112	473	0.6240105540897097	T	16.85	3.236060	0.58886	0.194823	0.59597	ENSG00000086619	ENST00000354619;ENST00000327333;ENST00000366589	D;T;D	0.82255	-1.59;0.88;-1.59	5.85	4.72	0.59763	.	0.217492	0.49916	D	0.000135	T	0.00012	0.0000	L	0.50333	1.59	0.09310	P	0.99999810693	P;B	0.49185	0.92;0.1	P;B	0.45712	0.491;0.042	T	0.49844	-0.8896	9	0.56958	D	0.05	-17.6697	11.2036	0.48756	0.0:0.0:0.2933:0.7067	rs2477599;rs17853094;rs17854313;rs2477599	129;129	B4DF57;Q86YB8	.;ERO1B_HUMAN	V	129;129;10	ENSP00000346635:D129V;ENSP00000377574:D129V;ENSP00000355548:D10V	ENSP00000377574:D129V	D	-	2	0	ERO1LB	234479853	1.000000	0.71417	0.809000	0.32408	0.980000	0.70556	4.282000	0.58971	1.025000	0.39708	-0.475000	0.04921	GAT	T|0.570;A|0.430	0.430	strong		0.279	ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096371.1	NM_019891	
UGT2A1	10941	hgsc.bcm.edu	37	4	70512773	70512773	+	Missense_Mutation	SNP	A	A	G	rs41292307	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:70512773A>G	ENST00000503640.1	-	1	645	c.590T>C	c.(589-591)tTa>tCa	p.L197S	UGT2A1_ENST00000512704.1_Missense_Mutation_p.L197S|UGT2A1_ENST00000286604.4_Missense_Mutation_p.L197S|UGT2A1_ENST00000514019.1_Missense_Mutation_p.L197S	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	197					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						GAGTTCTGATAAAACAGCAGG	0.423													A|||	351	0.0700879	0.0038	0.0807	5008	,	,		18794	0.001		0.161	False		,,,				2504	0.1299				p.L197S		Atlas-SNP	.											.	UGT2A1	131	.	0			c.T590C						PASS	.	A	SER/LEU	167,4239	109.9+/-148.2	4,159,2040	92.0	80.0	84.0		590	5.8	0.4	4	dbSNP_127	84	1581,7017	294.8+/-302.1	136,1309,2854	yes	missense	UGT2A1	NM_006798.2	145	140,1468,4894	GG,GA,AA		18.388,3.7903,13.442	possibly-damaging	197/528	70512773	1748,11256	2203	4299	6502	SO:0001583	missense	10941	exon2			TCTGATAAAACAG	AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.590T>C	4.37:g.70512773A>G	ENSP00000424478:p.Leu197Ser	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	79	5	0.0632911	NM_001252274	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Missense_Mutation	SNP	ENST00000503640.1	37	CCDS3529.1	149	0.06822344322344322	3	0.006097560975609756	31	0.0856353591160221	0	0.0	115	0.1517150395778364	A	14.39	2.519890	0.44866	0.037903	0.18388	ENSG00000173610	ENST00000503640;ENST00000512704;ENST00000514019;ENST00000286604	T;T;T;T	0.64803	-0.12;0.02;-0.12;-0.12	5.78	5.78	0.91487	.	0.378699	0.25762	N	0.028474	T	0.00384	0.0012	L	0.49350	1.555	.	.	.	D;P;D;D	0.89917	1.0;0.92;1.0;0.999	D;B;D;D	0.79784	0.993;0.388;0.993;0.986	T	0.08146	-1.0736	9	0.54805	T	0.06	.	14.0552	0.64764	1.0:0.0:0.0:0.0	rs41292307	197;197;197;197	E9PDM7;B4E2F4;D6RFW5;Q9Y4X1	.;.;.;UD2A1_HUMAN	S	197	ENSP00000424478:L197S;ENSP00000421432:L197S;ENSP00000425497:L197S;ENSP00000286604:L197S	ENSP00000286604:L197S	L	-	2	0	UGT2A1	70547362	0.949000	0.32298	0.364000	0.25888	0.503000	0.33858	4.429000	0.59901	2.215000	0.71742	0.482000	0.46254	TTA	A|0.882;G|0.118	0.118	strong		0.423	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251554.3	NM_006798	
SIGLEC11	114132	hgsc.bcm.edu	37	19	50463670	50463670	+	Missense_Mutation	SNP	T	T	G	rs77553517	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:50463670T>G	ENST00000447370.2	-	3	559	c.469A>C	c.(469-471)Aag>Cag	p.K157Q	CTC-326K19.6_ENST00000451973.1_5'Flank|SIGLEC11_ENST00000426971.2_Missense_Mutation_p.K157Q	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	157					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		TCAGGCTTCTTAGTCAGGGCT	0.607																																					p.K157Q		Atlas-SNP	.											.	SIGLEC11	70	.	0			c.A469C						PASS	.	G	GLN/LYS,GLN/LYS	840,2990		167,506,1242	35.0	54.0	48.0		469,469	-0.6	0.0	19	dbSNP_131	48	1503,7087		54,1395,2846	yes	missense,missense	SIGLEC11	NM_001135163.1,NM_052884.2	53,53	221,1901,4088	GG,GT,TT		17.4971,21.9321,18.8647	benign,benign	157/603,157/699	50463670	2343,10077	1915	4295	6210	SO:0001583	missense	114132	exon3			GCTTCTTAGTCAG	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.469A>C	19.37:g.50463670T>G	ENSP00000412361:p.Lys157Gln	Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	140	11	0.0785714	NM_052884		Missense_Mutation	SNP	ENST00000447370.2	37	CCDS12790.2	363	0.1662087912087912	102	0.2073170731707317	48	0.13259668508287292	112	0.1958041958041958	101	0.13324538258575197	G	0.021	-1.424972	0.01126	0.219321	0.174971	ENSG00000161640	ENST00000447370;ENST00000458019	T	0.03124	4.04	3.28	-0.577	0.11727	Immunoglobulin-like fold (1);	0.404011	0.21813	N	0.068733	T	0.00012	0.0000	N	0.00036	-2.54	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38950	-0.9637	9	0.16420	T	0.52	.	1.9279	0.03321	0.1102:0.1707:0.3701:0.349	.	157;157	Q96RL6-2;Q96RL6	.;SIG11_HUMAN	Q	157	ENSP00000412361:K157Q	ENSP00000412361:K157Q	K	-	1	0	SIGLEC11	55155482	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-0.174000	0.09839	-0.459000	0.07013	-0.217000	0.12591	AAG	T|0.840;G|0.160	0.160	strong		0.607	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884	
CBWD3	445571	hgsc.bcm.edu	37	9	70871836	70871836	+	Splice_Site	SNP	C	C	G	rs376362566		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:70871836C>G	ENST00000360171.6	+	5	981		c.e5-1		CBWD3_ENST00000377342.5_Intron	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3								ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		TATATTTTCACGTGCAGTGGC	0.289																																					.		Atlas-SNP	.											CBWD3,rectum,carcinoma,-1,1	CBWD3	10	1	0			c.431-1C>G						scavenged	.						25.0	31.0	29.0					9																	70871836		2190	4250	6440	SO:0001630	splice_region_variant	445571	exon5			TTTTCACGTGCAG	BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.431-1C>G	9.37:g.70871836C>G		Somatic	987	6	0.00607903		WXS	Illumina HiSeq	Phase_I	964	19	0.0197095	NM_201453	B4DNG9|Q6VB91	Splice_Site	SNP	ENST00000360171.6	37	CCDS35038.1	.	.	.	.	.	.	.	.	.	.	c	14.78	2.637800	0.47049	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344	.	.	.	3.38	3.38	0.38709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.714	0.51641	0.0:0.1812:0.8188:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBWD3	70061656	1.000000	0.71417	0.991000	0.47740	0.802000	0.45316	7.061000	0.76699	0.543000	0.28864	-0.676000	0.03789	.	C|0.500;G|0.500	0.500	weak		0.289	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1	NM_201453	Intron
LAMP3	27074	hgsc.bcm.edu	37	3	182871600	182871600	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:182871600G>T	ENST00000265598.3	-	2	884	c.629C>A	c.(628-630)aCg>aAg	p.T210K	LAMP3_ENST00000466939.1_Missense_Mutation_p.T186K	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	210	Thr-rich.				cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)		p.T210M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			CCCAGGAACCGTGGAGGCAGG	0.557																																					p.T210K		Atlas-SNP	.											LAMP3,NS,carcinoma,0,1	LAMP3	48	1	1	Substitution - Missense(1)	kidney(1)	c.C629A						scavenged	.						101.0	100.0	100.0					3																	182871600		2203	4300	6503	SO:0001583	missense	27074	exon2			GGAACCGTGGAGG	AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.629C>A	3.37:g.182871600G>T	ENSP00000265598:p.Thr210Lys	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	131	3	0.0229008	NM_014398	D3DNS4|O94781|Q8NEC8	Missense_Mutation	SNP	ENST00000265598.3	37	CCDS3242.1	.	.	.	.	.	.	.	.	.	.	g	16.71	3.198085	0.58126	.	.	ENSG00000078081	ENST00000265598;ENST00000466939	T;T	0.35789	1.29;1.29	5.81	-3.86	0.04230	.	1.431570	0.04239	N	0.336618	T	0.37812	0.1017	L	0.56769	1.78	0.09310	N	1	P	0.39920	0.695	B	0.42916	0.402	T	0.45131	-0.9282	10	0.51188	T	0.08	4.6752	7.935	0.29925	0.5882:0.1196:0.2922:0.0	.	210	Q9UQV4	LAMP3_HUMAN	K	210;186	ENSP00000265598:T210K;ENSP00000418912:T186K	ENSP00000265598:T210K	T	-	2	0	LAMP3	184354294	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.123000	0.10611	-1.317000	0.02292	-0.136000	0.14681	ACG	.	.	none		0.557	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350863.1		
OR51E1	143503	hgsc.bcm.edu	37	11	4674575	4674575	+	Missense_Mutation	SNP	G	G	A	rs3817098	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:4674575G>A	ENST00000530215.1	+	2	190	c.149G>A	c.(148-150)cGc>cAc	p.R50H	OR51E1_ENST00000396952.5_Silent_p.P273P			Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGACTCTCCGCTGCCCGTCA	0.493													C|||	1470	0.29353	0.2012	0.4179	5008	,	,		19913	0.0556		0.499	False		,,,				2504	0.364				p.P273P		Atlas-SNP	.											.	OR51E1	67	.	0			c.G819A						PASS	.	C		1066,3336		145,776,1280	176.0	166.0	170.0		819	-0.3	1.0	11	dbSNP_107	170	4662,3934		1269,2124,905	no	coding-synonymous	OR51E1	NM_152430.3		1414,2900,2185	AA,AG,GG		45.7655,24.2163,44.0683		273/319	4674575	5728,7270	2201	4298	6499	SO:0001583	missense	143503	exon2			CTCTCCGCTGCCC	AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000530215.1:c.149G>A	11.37:g.4674575G>A	ENSP00000431593:p.Arg50His	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	57	6	0.105263	NM_152430	A8KAM6|Q5S4P5|Q66X57|Q6IF93	Silent	SNP	ENST00000530215.1	37		667	0.30540293040293043	104	0.21138211382113822	156	0.430939226519337	38	0.06643356643356643	369	0.4868073878627968	C	12.62	1.992606	0.35131	0.242163	0.542345	ENSG00000180785	ENST00000530215	T	0.37058	1.22	4.77	-0.309	0.12769	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.44922	-0.9296	5	0.34782	T	0.22	.	2.4516	0.04519	0.1184:0.434:0.2315:0.2162	rs3817098;rs17224511;rs56919705;rs3817098	.	.	.	H	50	ENSP00000431593:R50H	ENSP00000431593:R50H	R	+	2	0	OR51E1	4631151	0.000000	0.05858	0.952000	0.39060	0.220000	0.24768	-1.771000	0.01789	-0.131000	0.11578	-0.120000	0.15030	CGC	G|0.615;A|0.385	0.385	strong		0.493	OR51E1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000385957.1	NM_152430	
IFIT2	3433	hgsc.bcm.edu	37	10	91066075	91066075	+	Missense_Mutation	SNP	A	A	G	rs2070845	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:91066075A>G	ENST00000371826.3	+	2	531	c.362A>G	c.(361-363)aAa>aGa	p.K121R	LIPA_ENST00000371837.1_Intron|LIPA_ENST00000487618.1_Intron	NM_001547.4	NP_001538.4	P09913	IFIT2_HUMAN	interferon-induced protein with tetratricopeptide repeats 2	121			K -> R (in dbSNP:rs2070845).		apoptotic mitochondrial changes (GO:0008637)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of protein binding (GO:0032091)|positive regulation of apoptotic process (GO:0043065)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	12		Colorectal(252;0.0161)				GACAAGGTGAAACATGTCTGT	0.468													A|||	980	0.195687	0.27	0.1945	5008	,	,		20614	0.127		0.2485	False		,,,				2504	0.1125				p.K121R		Atlas-SNP	.											.	IFIT2	39	.	0			c.A362G						PASS	.	A	ARG/LYS	1062,3170		134,794,1188	74.0	78.0	77.0		362	2.2	0.2	10	dbSNP_96	77	2063,6471		249,1565,2453	yes	missense	IFIT2	NM_001547.4	26	383,2359,3641	GG,GA,AA		24.1739,25.0945,24.4791	benign	121/473	91066075	3125,9641	2116	4267	6383	SO:0001583	missense	3433	exon2			AGGTGAAACATGT	M14660	CCDS41548.1	10q23.31	2013-01-11			ENSG00000119922	ENSG00000119922		"""Tetratricopeptide (TTC) repeat domain containing"""	5409	protein-coding gene	gene with protein product		147040		IFI54, G10P2		3175763, 3360121	Standard	NM_001547		Approved	IFI-54, ISG-54K, cig42, GARG-39	uc009xts.3	P09913	OTTHUMG00000018707	ENST00000371826.3:c.362A>G	10.37:g.91066075A>G	ENSP00000360891:p.Lys121Arg	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	93	5	0.0537634	NM_001547	Q5T767	Missense_Mutation	SNP	ENST00000371826.3	37	CCDS41548.1	453	0.20741758241758243	119	0.241869918699187	74	0.20441988950276244	80	0.13986013986013987	180	0.23746701846965698	A	2.500	-0.315343	0.05422	0.250945	0.241739	ENSG00000119922	ENST00000371826	T	0.73575	-0.76	4.58	2.22	0.28083	.	0.395490	0.24433	N	0.038566	T	0.00012	0.0000	N	0.12961	0.28	0.39373	P	0.03388899999999995	B	0.18461	0.028	B	0.13407	0.009	T	0.05099	-1.0906	9	0.15066	T	0.55	-9.6022	8.4323	0.32766	0.8333:0.0:0.1667:0.0	rs2070845;rs17468767;rs17846023;rs17859007;rs52806847;rs58270854;rs2070845	121	P09913	IFIT2_HUMAN	R	121	ENSP00000360891:K121R	ENSP00000360891:K121R	K	+	2	0	IFIT2	91056055	0.830000	0.29337	0.152000	0.22495	0.007000	0.05969	2.051000	0.41307	0.495000	0.27882	0.533000	0.62120	AAA	A|0.781;G|0.219	0.219	strong		0.468	IFIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049293.1	NM_001547	
NEK9	91754	hgsc.bcm.edu	37	14	75590846	75590846	+	Silent	SNP	A	A	T	rs175449	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:75590846A>T	ENST00000238616.5	-	2	458	c.300T>A	c.(298-300)atT>atA	p.I100I		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	100	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		CCAGAATAACAATCTCATTCA	0.453													A|||	2143	0.427915	0.5847	0.3631	5008	,	,		20412	0.1528		0.4911	False		,,,				2504	0.4806				p.I100I		Atlas-SNP	.											.	NEK9	64	.	0			c.T300A						PASS	.	A		2461,1945	622.2+/-393.9	686,1089,428	202.0	155.0	171.0		300	3.8	1.0	14	dbSNP_79	171	4358,4242	581.7+/-391.3	1105,2148,1047	no	coding-synonymous	NEK9	NM_033116.4		1791,3237,1475	TT,TA,AA		49.3256,44.1443,47.5704		100/980	75590846	6819,6187	2203	4300	6503	SO:0001819	synonymous_variant	91754	exon2			AATAACAATCTCA	AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.300T>A	14.37:g.75590846A>T		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	80	6	0.075	NM_033116	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Silent	SNP	ENST00000238616.5	37	CCDS9839.1																																																																																			A|0.436;T|0.564	0.564	strong		0.453	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1	NM_033116	
SLC35E1	79939	hgsc.bcm.edu	37	19	16666101	16666101	+	Silent	SNP	G	G	C	rs2287869	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:16666101G>C	ENST00000595753.1	-	5	881	c.864C>G	c.(862-864)ccC>ccG	p.P288P	CTD-3222D19.11_ENST00000597357.1_RNA|CTD-3222D19.2_ENST00000409035.1_Intron|SLC35E1_ENST00000593812.1_5'Flank	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	288					transport (GO:0006810)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						AGTAGCTCAGGGGGCTAACGA	0.572													G|||	2016	0.402556	0.0356	0.5058	5008	,	,		21284	0.5149		0.5368	False		,,,				2504	0.5716				p.P288P		Atlas-SNP	.											.	SLC35E1	48	.	0			c.C864G						PASS	.	G		520,3886	237.1+/-249.0	30,460,1713	150.0	111.0	124.0		864	-6.4	1.0	19	dbSNP_100	124	4939,3661	622.0+/-397.3	1436,2067,797	no	coding-synonymous	SLC35E1	NM_024881.4		1466,2527,2510	CC,CG,GG		42.5698,11.8021,41.9729		288/411	16666101	5459,7547	2203	4300	6503	SO:0001819	synonymous_variant	79939	exon5			GCTCAGGGGGCTA	AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.864C>G	19.37:g.16666101G>C		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	86	5	0.0581395	NM_024881	Q8NBQ2|Q96JV7	Silent	SNP	ENST00000595753.1	37	CCDS12346.2																																																																																			G|0.568;C|0.432	0.432	strong		0.572	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881	
IFI30	10437	hgsc.bcm.edu	37	19	18285944	18285944	+	Missense_Mutation	SNP	G	G	A	rs11554159	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:18285944G>A	ENST00000407280.3	+	2	402	c.227G>A	c.(226-228)cGa>cAa	p.R76Q	PIK3R2_ENST00000593731.1_3'UTR	NM_006332.3	NP_006323.2	P13284	GILT_HUMAN	interferon, gamma-inducible protein 30	76				R -> Q (in Ref. 7; AAH31020). {ECO:0000305}.	antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of fibroblast proliferation (GO:0048147)|protein stabilization (GO:0050821)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	oxidoreductase activity, acting on a sulfur group of donors (GO:0016667)			endometrium(1)|kidney(2)|large_intestine(1)|stomach(1)	5						GGTGGCTGCCGAGCCTTCCTG	0.582													G|||	910	0.181709	0.2398	0.1816	5008	,	,		19461	0.0655		0.2704	False		,,,				2504	0.1319				p.R76Q		Atlas-SNP	.											.	IFI30	12	.	0			c.G227A						PASS	.	G	GLN/ARG	905,3225		94,717,1254	41.0	46.0	44.0		227	4.2	0.5	19	dbSNP_120	44	2157,6253		274,1609,2322	yes	missense	IFI30	NM_006332.3	43	368,2326,3576	AA,AG,GG		25.648,21.9128,24.4179	probably-damaging	76/251	18285944	3062,9478	2065	4205	6270	SO:0001583	missense	10437	exon2			GCTGCCGAGCCTT	J03909	CCDS46015.1	19p13.1	2008-07-16				ENSG00000216490			5398	protein-coding gene	gene with protein product	"""gamma-interferon-inducible lysosomal thiol reductase"", ""interferon gamma-inducible protein 30 preproprotein"""	604664				3136170, 10639150	Standard	NM_006332		Approved	IFI-30, GILT, IP30, MGC32056	uc002nic.1	P13284		ENST00000407280.3:c.227G>A	19.37:g.18285944G>A	ENSP00000384886:p.Arg76Gln	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	96	5	0.0520833	NM_006332	Q76MF9|Q8NEI4|Q8WU77|Q9UL08	Missense_Mutation	SNP	ENST00000407280.3	37	CCDS46015.1	424	0.19413919413919414	110	0.22357723577235772	74	0.20441988950276244	39	0.06818181818181818	201	0.26517150395778366	G	17.49	3.402221	0.62288	0.219128	0.25648	ENSG00000216490	ENST00000407280	.	.	.	5.25	4.22	0.49857	.	.	.	.	.	T	0.00012	0.0000	L	0.48642	1.525	0.20403	P	0.9999051197	D	0.69078	0.997	P	0.54629	0.757	T	0.05289	-1.0894	7	0.41790	T	0.15	-50.735	12.4977	0.55937	0.082:0.0:0.918:0.0	rs11554159;rs17852874;rs11554159	76	P13284	GILT_HUMAN	Q	76	.	ENSP00000384886:R76Q	R	+	2	0	IFI30	18146944	1.000000	0.71417	0.476000	0.27291	0.000000	0.00434	5.701000	0.68325	1.230000	0.43646	-0.339000	0.08088	CGA	G|0.789;A|0.211	0.211	strong		0.582	IFI30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466396.3	NM_006332	
MAGEA8	4107	hgsc.bcm.edu	37	X	149013727	149013727	+	Silent	SNP	A	A	G	rs5983916	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chrX:149013727A>G	ENST00000542674.1	+	3	1202	c.681A>G	c.(679-681)gcA>gcG	p.A227A	MAGEA8_ENST00000535454.1_Silent_p.A227A|MAGEA8_ENST00000286482.1_Silent_p.A227A	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	227	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					TCTGGGAAGCATTGAGTGTGA	0.567													N|||	3349	0.887152	0.7383	0.683	3775	,	,		13626	0.6736		0.6103	False		,,,				2504	0.6196				p.A227A		Atlas-SNP	.											.	MAGEA8	40	.	0			c.A681G						PASS	.	G	,,	3674,161		1491,140,552,1,19	96.0	86.0	89.0		681,681,681	-2.0	0.0	X	dbSNP_114	89	5346,1380		1535,786,1490,107,380	no	coding-synonymous,coding-synonymous,coding-synonymous	MAGEA8	NM_001166400.1,NM_001166401.1,NM_005364.4	,,	3026,926,2042,108,399	GG,GA,G,AA,A		20.5174,4.1982,14.5914	,,	227/319,227/319,227/319	149013727	9020,1541	2203	4298	6501	SO:0001819	synonymous_variant	4107	exon3			GGAAGCATTGAGT		CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.681A>G	X.37:g.149013727A>G		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	121	8	0.0661157	NM_005364	Q9BUN9	Silent	SNP	ENST00000542674.1	37	CCDS14692.1																																																																																			A|0.130;0|0.004	.	strong		0.567	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058728.1	NM_005364	
OR12D2	26529	hgsc.bcm.edu	37	6	29364951	29364951	+	Missense_Mutation	SNP	G	G	A	rs2073151	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:29364951G>A	ENST00000383555.2	+	1	536	c.475G>A	c.(475-477)Gta>Ata	p.V159I	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	159			V -> I (in dbSNP:rs2073151).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						GCTGCACTCCGTAATGACTTC	0.483													G|||	1598	0.319089	0.1921	0.3473	5008	,	,		22625	0.3641		0.4523	False		,,,				2504	0.2873				p.V159I		Atlas-SNP	.											.	OR12D2	42	.	0			c.G475A						PASS	.	G	ILE/VAL	670,2352		75,520,916	164.0	159.0	160.0		475	-3.1	0.0	6	dbSNP_96	160	2412,3006		536,1340,833	yes	missense	OR12D2	NM_013936.3	29	611,1860,1749	AA,AG,GG		44.5183,22.1707,36.5166	benign	159/308	29364951	3082,5358	1511	2709	4220	SO:0001583	missense	26529	exon1			CACTCCGTAATGA		CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.475G>A	6.37:g.29364951G>A	ENSP00000373047:p.Val159Ile	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	99	5	0.050505	NM_013936	B0S862|Q5SUN9|Q6IET9	Missense_Mutation	SNP	ENST00000383555.2	37	CCDS4659.1	787	0.36034798534798534	101	0.20528455284552846	123	0.3397790055248619	208	0.36363636363636365	355	0.4683377308707124	G	0.020	-1.445958	0.01089	0.221707	0.445183	ENSG00000168787	ENST00000383555	T	0.37058	1.22	3.94	-3.14	0.05250	GPCR, rhodopsin-like superfamily (1);	0.634583	0.15162	N	0.277100	T	0.05364	0.0142	N	0.17082	0.46	0.80722	P	0.0	B	0.17268	0.021	B	0.24006	0.05	T	0.38845	-0.9642	9	0.06494	T	0.89	.	9.2814	0.37731	0.2203:0.1535:0.6262:0.0	rs2073151;rs56462678;rs60511171;rs2073151	159	P58182	O12D2_HUMAN	I	159	ENSP00000373047:V159I	ENSP00000373047:V159I	V	+	1	0	OR12D2	29472930	0.000000	0.05858	0.000000	0.03702	0.237000	0.25408	-3.504000	0.00449	-0.890000	0.03945	0.205000	0.17691	GTA	G|0.639;A|0.361	0.361	strong		0.483	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076054.2		
LRRIQ3	127255	hgsc.bcm.edu	37	1	74648408	74648408	+	Missense_Mutation	SNP	C	C	T	rs17094900	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:74648408C>T	ENST00000395089.1	-	2	386	c.387G>A	c.(385-387)atG>atA	p.M129I	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.M129I|LRRIQ3_ENST00000370911.3_Missense_Mutation_p.M129I|LRRIQ3_ENST00000370909.2_Intron			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	129			M -> I (in dbSNP:rs17094900).							NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						GACAATCAAACATAGTGAGGG	0.373													C|||	348	0.0694888	0.0189	0.0576	5008	,	,		14103	0.1012		0.0368	False		,,,				2504	0.1472				p.M129I		Atlas-SNP	.											.	LRRIQ3	146	.	0			c.G387A						PASS	.	C	ILE/MET	79,4327	65.8+/-103.3	2,75,2126	107.0	102.0	104.0		387	5.7	1.0	1	dbSNP_123	104	358,8240	119.5+/-178.9	10,338,3951	yes	missense	LRRIQ3	NM_001105659.1	10	12,413,6077	TT,TC,CC		4.1638,1.793,3.3605	benign	129/625	74648408	437,12567	2203	4299	6502	SO:0001583	missense	127255	exon3			ATCAAACATAGTG	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.387G>A	1.37:g.74648408C>T	ENSP00000378524:p.Met129Ile	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	111	5	0.045045	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	CCDS41350.1	117	0.05357142857142857	10	0.02032520325203252	26	0.0718232044198895	58	0.10139860139860139	23	0.030343007915567283	C	16.63	3.175996	0.57692	0.01793	0.041638	ENSG00000162620	ENST00000395089;ENST00000354431;ENST00000388972;ENST00000370911	T;T;T	0.21543	2.0;2.0;2.0	5.65	5.65	0.86999	.	0.494621	0.21245	N	0.077749	T	0.16385	0.0394	M	0.64997	1.995	0.38532	D	0.948998	B	0.19445	0.036	B	0.17979	0.02	T	0.01729	-1.1286	10	0.49607	T	0.09	.	18.4988	0.90874	0.0:1.0:0.0:0.0	rs17094900;rs17094900	129	A6PVS8	LRIQ3_HUMAN	I	129	ENSP00000378524:M129I;ENSP00000346414:M129I;ENSP00000359948:M129I	ENSP00000346414:M129I	M	-	3	0	LRRIQ3	74420996	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.510000	0.67018	2.653000	0.90120	0.650000	0.86243	ATG	C|0.956;T|0.044	0.044	strong		0.373	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
HSPD1	3329	hgsc.bcm.edu	37	2	198363534	198363534	+	Silent	SNP	C	C	T	rs565153254		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:198363534C>T	ENST00000388968.3	-	2	306	c.39G>A	c.(37-39)ccG>ccA	p.P13P	HSPD1_ENST00000544407.1_Silent_p.P13P|HSPE1_ENST00000409468.1_5'Flank|HSPD1_ENST00000345042.2_Silent_p.P13P|HSPE1_ENST00000409729.1_5'Flank|HSPE1_ENST00000233893.5_5'Flank|HSPE1-MOB4_ENST00000604458.1_5'Flank	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	13					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)	p.P13P(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			CCCTGGACACCGGTCTCATCT	0.502																																					p.P13P		Atlas-SNP	.											HSPD1_ENST00000426480,NS,haematopoietic_neoplasm,0,3	HSPD1	68	3	1	Substitution - coding silent(1)	breast(1)	c.G39A						scavenged	.						52.0	49.0	50.0					2																	198363534		2203	4300	6503	SO:0001819	synonymous_variant	3329	exon2			GGACACCGGTCTC	M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.39G>A	2.37:g.198363534C>T		Somatic	361	0	0		WXS	Illumina HiSeq	Phase_I	438	7	0.0159817	NM_002156	B2R5M6|B7Z712|Q38L19|Q9UCR6	Silent	SNP	ENST00000388968.3	37	CCDS33357.1																																																																																			.	.	none		0.502	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335324.2	NM_002156	
OR4D5	219875	hgsc.bcm.edu	37	11	123811056	123811056	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:123811056G>A	ENST00000307033.2	+	1	807	c.733G>A	c.(733-735)Gct>Act	p.A245T		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CTCTCACATTGCTGTGGTGAC	0.532																																					p.A245T		Atlas-SNP	.											.	OR4D5	94	.	0			c.G733A						PASS	.						235.0	188.0	204.0					11																	123811056		2202	4299	6501	SO:0001583	missense	219875	exon1			CACATTGCTGTGG	BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.733G>A	11.37:g.123811056G>A	ENSP00000305970:p.Ala245Thr	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	139	35	0.251799	NM_001001965	B9EGZ4|Q6IFE6	Missense_Mutation	SNP	ENST00000307033.2	37	CCDS31699.1	.	.	.	.	.	.	.	.	.	.	G	2.022	-0.424500	0.04734	.	.	ENSG00000171014	ENST00000307033	T	0.36520	1.25	4.96	4.03	0.46877	GPCR, rhodopsin-like superfamily (1);	0.437967	0.19315	N	0.117284	T	0.08891	0.0220	N	0.00462	-1.47	0.22521	N	0.999028	B	0.02656	0.0	B	0.06405	0.002	T	0.28586	-1.0039	10	0.02654	T	1	-6.2297	9.8887	0.41276	0.1608:0.0:0.8392:0.0	.	245	Q8NGN0	OR4D5_HUMAN	T	245	ENSP00000305970:A245T	ENSP00000305970:A245T	A	+	1	0	OR4D5	123316266	0.000000	0.05858	1.000000	0.80357	0.983000	0.72400	0.241000	0.18065	1.275000	0.44379	0.650000	0.86243	GCT	.	.	none		0.532	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387263.1	NM_001001965	
SEMA6D	80031	hgsc.bcm.edu	37	15	48056958	48056958	+	Silent	SNP	C	C	T	rs3743281	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:48056958C>T	ENST00000316364.5	+	12	1660	c.1221C>T	c.(1219-1221)gcC>gcT	p.A407A	SEMA6D_ENST00000358066.4_Silent_p.A407A|SEMA6D_ENST00000558014.1_Silent_p.A407A|SEMA6D_ENST00000389432.2_Silent_p.A407A|SEMA6D_ENST00000389433.2_Silent_p.A407A|SEMA6D_ENST00000558816.1_Silent_p.A407A|SEMA6D_ENST00000354744.4_Silent_p.A407A|SEMA6D_ENST00000389428.3_Silent_p.A407A|SEMA6D_ENST00000389425.3_Silent_p.A407A|SEMA6D_ENST00000355997.3_Silent_p.A407A|SEMA6D_ENST00000536845.2_Silent_p.A407A|SEMA6D_ENST00000537942.1_Silent_p.A407A	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	407	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CACCCATTGCCGATGAGCCCT	0.502													C|||	945	0.188698	0.0431	0.2075	5008	,	,		21013	0.1746		0.2724	False		,,,				2504	0.3006				p.A407A		Atlas-SNP	.											.	SEMA6D	322	.	0			c.C1221T						PASS	.	C	,,,,,,	305,4091	165.8+/-197.2	10,285,1903	78.0	74.0	75.0		1221,1221,1221,1221,1221,1221,1221	-4.9	0.4	15	dbSNP_107	75	2174,6420	370.8+/-336.0	268,1638,2391	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SEMA6D	NM_001198999.1,NM_020858.1,NM_024966.2,NM_153616.1,NM_153617.1,NM_153618.1,NM_153619.1	,,,,,,	278,1923,4294	TT,TC,CC		25.2967,6.9381,19.0839	,,,,,,	407/1012,407/1012,407/477,407/999,407/1018,407/1074,407/598	48056958	2479,10511	2198	4297	6495	SO:0001819	synonymous_variant	80031	exon12			CATTGCCGATGAG	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1221C>T	15.37:g.48056958C>T		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	65	5	0.0769231	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	37	CCDS32225.1																																																																																			C|0.814;T|0.186	0.186	strong		0.502	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
BCKDHA	593	hgsc.bcm.edu	37	19	41932420	41932420	+	IGR	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:41932420G>A	ENST00000269980.2	+	0	2103				B3GNT8_ENST00000601379.1_Intron|B3GNT8_ENST00000321702.2_Silent_p.S88S|CTC-435M10.6_ENST00000598887.1_RNA	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						CCGTTTCAGTGCTGTCCCCAC	0.682																																					p.S88S		Atlas-SNP	.											.	B3GNT8	20	.	0			c.C264T						PASS	.						11.0	11.0	11.0					19																	41932420		2181	4275	6456	SO:0001628	intergenic_variant	374907	exon3			TTCAGTGCTGTCC	J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128		19.37:g.41932420G>A		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	52	13	0.25	NM_198540	B4DP47|E7EW46|Q16034|Q16472	Silent	SNP	ENST00000269980.2	37	CCDS12581.1																																																																																			.	.	none		0.682	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398313.3	NM_000709	
MURC	347273	hgsc.bcm.edu	37	9	103348634	103348634	+	Silent	SNP	G	G	A	rs2780956	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:103348634G>A	ENST00000307584.5	+	2	1061	c.996G>A	c.(994-996)agG>agA	p.R332R		NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	332					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)				endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				ATGAAGGAAGGGAAATCCCCA	0.483													G|||	1469	0.293331	0.2405	0.4784	5008	,	,		15010	0.0804		0.4254	False		,,,				2504	0.317				p.R332R		Atlas-SNP	.											.	MURC	43	.	0			c.G996A						PASS	.	G		1353,3053	445.9+/-347.8	209,935,1059	48.0	51.0	50.0		996	3.4	0.2	9	dbSNP_100	50	3583,5017	516.7+/-378.9	729,2125,1446	no	coding-synonymous	MURC	NM_001018116.1		938,3060,2505	AA,AG,GG		41.6628,30.7081,37.9517		332/365	103348634	4936,8070	2203	4300	6503	SO:0001819	synonymous_variant	347273	exon2			AGGAAGGGAAATC	BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.996G>A	9.37:g.103348634G>A		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	52	5	0.0961538	NM_001018116	B1PRL3|B4DT88	Silent	SNP	ENST00000307584.5	37	CCDS35083.1																																																																																			G|0.649;A|0.351	0.351	strong		0.483	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053419.2	NM_001018116	
EIF5B	9669	hgsc.bcm.edu	37	2	99995517	99995517	+	Silent	SNP	C	C	T	rs11896520	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:99995517C>T	ENST00000289371.6	+	11	2080	c.1878C>T	c.(1876-1878)acC>acT	p.T626T		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	626					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ATGTAAACACCGAAAAGCTAA	0.299													C|||	758	0.151358	0.09	0.3012	5008	,	,		14631	0.0149		0.2753	False		,,,				2504	0.1411				p.T626T	Colon(162;2388 2567 2705 3444)	Atlas-SNP	.											EIF5B,caecum,carcinoma,0,1	EIF5B	95	1	0			c.C1878T						scavenged	.	C		362,3280		12,338,1471	75.0	66.0	69.0		1878	-3.9	1.0	2	dbSNP_120	69	2231,5933		284,1663,2135	no	coding-synonymous	EIF5B	NM_015904.3		296,2001,3606	TT,TC,CC		27.3273,9.9396,21.9634		626/1221	99995517	2593,9213	1821	4082	5903	SO:0001819	synonymous_variant	9669	exon11			AAACACCGAAAAG	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.1878C>T	2.37:g.99995517C>T		Somatic	497	2	0.00402414		WXS	Illumina HiSeq	Phase_I	547	7	0.0127971	NM_015904	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Silent	SNP	ENST00000289371.6	37	CCDS42721.1																																																																																			C|0.813;T|0.187	0.187	strong		0.299	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904	
ZNF700	90592	hgsc.bcm.edu	37	19	12059467	12059467	+	Missense_Mutation	SNP	C	C	G	rs73509026	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:12059467C>G	ENST00000254321.5	+	4	771	c.628C>G	c.(628-630)Cga>Gga	p.R210G	ZNF763_ENST00000591944.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000538752.1_Intron|ZNF763_ENST00000590798.1_Intron|ZNF700_ENST00000482090.1_Missense_Mutation_p.R192G	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	210					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						TTCAAGCATTCGAAGACACAT	0.383													c|||	318	0.0634984	0.1505	0.0288	5008	,	,		21685	0.0218		0.0378	False		,,,				2504	0.0399				p.R213G		Atlas-SNP	.											ZNF700,NS,carcinoma,-1,1	ZNF700	81	1	0			c.C637G						scavenged	.	C	GLY/ARG	584,3822	254.0+/-259.7	38,508,1657	89.0	93.0	92.0		628	0.6	0.0	19	dbSNP_130	92	256,8344	99.7+/-161.2	2,252,4046	yes	missense	ZNF700	NM_144566.1	125	40,760,5703	GG,GC,CC		2.9767,13.2547,6.4586	probably-damaging	210/743	12059467	840,12166	2203	4300	6503	SO:0001583	missense	90592	exon4			AGCATTCGAAGAC	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.628C>G	19.37:g.12059467C>G	ENSP00000254321:p.Arg210Gly	Somatic	164	0	0		WXS	Illumina HiSeq	Phase_I	155	4	0.0258065	NM_001271848	B9EGU4	Missense_Mutation	SNP	ENST00000254321.5	37	CCDS32915.1	123	0.05631868131868132	67	0.13617886178861788	13	0.03591160220994475	16	0.027972027972027972	27	0.03562005277044855	c	9.486	1.099434	0.20552	0.132547	0.029767	ENSG00000196757	ENST00000254321	T	0.07114	3.22	0.554	0.554	0.17241	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00073	0.0002	M	0.63169	1.94	0.09310	N	1	P	0.51057	0.941	P	0.50708	0.648	T	0.31110	-0.9955	9	0.21540	T	0.41	.	3.5609	0.07882	0.4412:0.5587:1.0E-4:0.0	.	210	Q9H0M5	ZN700_HUMAN	G	210	ENSP00000254321:R210G	ENSP00000254321:R210G	R	+	1	2	ZNF700	11920467	0.000000	0.05858	0.032000	0.17829	0.334000	0.28698	-1.823000	0.01710	0.535000	0.28714	0.305000	0.20034	CGA	C|0.940;G|0.060	0.060	strong		0.383	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344126.2	NM_144566	
MUC2	4583	hgsc.bcm.edu	37	11	1092885	1092885	+	Silent	SNP	G	G	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:1092885G>C	ENST00000441003.2	+	30	4731	c.4704G>C	c.(4702-4704)acG>acC	p.T1568T	MUC2_ENST00000359061.5_Silent_p.T1569T|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCACCACCACGGTGaccccaa	0.637																																					p.T1568T		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,+1,8	MUC2	614	8	0			c.G4704C						scavenged	.						124.0	160.0	148.0					11																	1092885		1964	3666	5630	SO:0001819	synonymous_variant	4583	exon30			CACCACGGTGACC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4704G>C	11.37:g.1092885G>C		Somatic	69	3	0.0434783		WXS	Illumina HiSeq	Phase_I	40	7	0.175	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.	.	none		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MLLT3	4300	hgsc.bcm.edu	37	9	20414376	20414376	+	Silent	SNP	A	A	G	rs1761445|rs373338988	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:20414376A>G	ENST00000380338.4	-	5	754	c.468T>C	c.(466-468)agT>agC	p.S156S	MLLT3_ENST00000429426.2_Silent_p.S153S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	156	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.527			T	MLL	ALL								A|||	608	0.121406	0.1354	0.1037	5008	,	,		12979	0.0774		0.1282	False		,,,				2504	0.1534				p.S156S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,colon,carcinoma,0,3	MLLT3	125	3	0			c.T468C						scavenged	.						9.0	14.0	13.0					9																	20414376		1854	3811	5665	SO:0001819	synonymous_variant	4300	exon5			GCTGCTACTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.468T>C	9.37:g.20414376A>G		Somatic	31	1	0.0322581		WXS	Illumina HiSeq	Phase_I	48	6	0.125	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			A|0.906;G|0.094	0.094	strong		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
SLC13A3	64849	hgsc.bcm.edu	37	20	45204266	45204266	+	Silent	SNP	G	G	A	rs1880898	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:45204266G>A	ENST00000279027.4	-	10	1296	c.1278C>T	c.(1276-1278)ccC>ccT	p.P426P	SLC13A3_ENST00000290317.5_Silent_p.P379P|SLC13A3_ENST00000396360.1_Silent_p.P344P|SLC13A3_ENST00000413164.2_Silent_p.P376P|SLC13A3_ENST00000472148.1_Silent_p.P344P|SLC13A3_ENST00000435032.1_Intron|SLC13A3_ENST00000495082.1_Silent_p.P379P	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	426					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	TGATGTTCCAGGGCACTGTCT	0.617													G|||	2774	0.553914	0.4796	0.5692	5008	,	,		19600	0.5625		0.6093	False		,,,				2504	0.5777				p.P426P		Atlas-SNP	.											.	SLC13A3	88	.	0			c.C1278T						PASS	.	G	,,,,	2183,2223	576.3+/-384.2	531,1121,551	90.0	71.0	77.0		1137,1128,1032,984,1278	0.4	1.0	20	dbSNP_92	77	5474,3126	645.5+/-400.2	1732,2010,558	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SLC13A3	NM_001011554.2,NM_001193339.1,NM_001193340.1,NM_001193342.1,NM_022829.5	,,,,	2263,3131,1109	AA,AG,GG		36.3488,49.5461,41.1272	,,,,	379/556,376/553,344/521,328/505,426/603	45204266	7657,5349	2203	4300	6503	SO:0001819	synonymous_variant	64849	exon10			GTTCCAGGGCACT	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1278C>T	20.37:g.45204266G>A		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	106	5	0.0471698	NM_022829	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Silent	SNP	ENST00000279027.4	37	CCDS13400.1																																																																																			G|0.419;T|0.006	.	strong		0.617	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
SPATA31E1	286234	hgsc.bcm.edu	37	9	90501448	90501448	+	Missense_Mutation	SNP	C	C	A	rs4076795	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:90501448C>A	ENST00000325643.5	+	4	2112	c.2046C>A	c.(2044-2046)gaC>gaA	p.D682E		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	682			D -> E (in dbSNP:rs4076795). {ECO:0000269|PubMed:14702039}.		cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGCCTTCTGACTTTGCAGGGA	0.612													.|||	3810	0.760783	0.9493	0.719	5008	,	,		18296	0.877		0.5666	False		,,,				2504	0.6155				p.D682E		Atlas-SNP	.											C9orf79,caecum,carcinoma,0,1	.	.	1	0			c.C2046A						PASS	.	A	GLU/ASP	3876,530	229.1+/-243.8	1714,448,41	46.0	60.0	55.0		2046	-4.9	0.0	9	dbSNP_108	55	4640,3958	541.8+/-384.1	1274,2092,933	yes	missense	C9orf79	NM_178828.4	45	2988,2540,974	AA,AC,CC		46.034,12.0291,34.5125	benign	682/1446	90501448	8516,4488	2203	4299	6502	SO:0001583	missense	286234	exon4			TTCTGACTTTGCA	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2046C>A	9.37:g.90501448C>A	ENSP00000322640:p.Asp682Glu	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	73	6	0.0821918	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	1642	0.7518315018315018	461	0.9369918699186992	255	0.7044198895027625	499	0.8723776223776224	427	0.5633245382585752	a	0.008	-1.902883	0.00512	0.879709	0.53966	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.05925	3.37	2.43	-4.86	0.03132	.	11.086800	0.00834	N	0.001682	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31251	-0.9950	9	0.02654	T	1	.	5.9254	0.19110	0.4823:0.3453:0.1724:0.0	rs4076795;rs17536349;rs57937710;rs4076795	682;334	Q6ZUB1;Q8NA33	CI079_HUMAN;.	E	682;334	ENSP00000322640:D682E	ENSP00000322640:D682E	D	+	3	2	C9orf79	89691268	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.165000	0.01274	-2.299000	0.00659	-1.398000	0.01145	GAC	C|0.297;N|0.002	.	strong		0.612	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
USP6	9098	hgsc.bcm.edu	37	17	5058808	5058808	+	Missense_Mutation	SNP	G	G	A	rs9899177	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:5058808G>A	ENST00000574788.1	+	31	4965	c.2735G>A	c.(2734-2736)cGg>cAg	p.R912Q	USP6_ENST00000250066.6_Missense_Mutation_p.R912Q|USP6_ENST00000304328.5_Missense_Mutation_p.R595Q|USP6_ENST00000332776.4_3'UTR			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	912	USP.		R -> Q (in dbSNP:rs9899177). {ECO:0000269|PubMed:1565468}.		cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						GTGCATACCCGGAAGAAAGAC	0.478			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts								G|||	1688	0.337061	0.1936	0.6052	5008	,	,		15543	0.1706		0.6034	False		,,,				2504	0.2382				p.R912Q		Atlas-SNP	.		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	USP6_ENST00000250066,NS,carcinoma,-1,1	USP6	213	1	0			c.G2735A						scavenged	.	G	GLN/ARG	1292,3114	438.4+/-345.3	189,914,1100	178.0	155.0	163.0		2735	2.9	1.0	17	dbSNP_119	163	5474,3126	657.7+/-401.5	1744,1986,570	yes	missense	USP6	NM_004505.2	43	1933,2900,1670	AA,AG,GG		36.3488,29.3236,47.9779	probably-damaging	912/1407	5058808	6766,6240	2203	4300	6503	SO:0001583	missense	9098	exon23			ATACCCGGAAGAA	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.2735G>A	17.37:g.5058808G>A	ENSP00000460380:p.Arg912Gln	Somatic	220	0	0		WXS	Illumina HiSeq	Phase_I	221	4	0.0180995	NM_004505	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	37	CCDS11069.2	867	0.39697802197802196	106	0.21544715447154472	220	0.6077348066298343	92	0.16083916083916083	449	0.5923482849604221	G	17.49	3.402406	0.62288	0.293236	0.636512	ENSG00000129204	ENST00000250066;ENST00000304328	T;T	0.13420	2.99;2.59	2.91	2.91	0.33838	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.099183	0.64402	D	0.000002	T	0.00012	0.0000	L	0.55990	1.75	0.31282	P	0.69051	D;D	0.76494	0.996;0.999	P;P	0.60541	0.755;0.876	T	0.02966	-1.1088	9	0.07990	T	0.79	.	11.6235	0.51132	0.0:0.0:1.0:0.0	rs9899177;rs58814329;rs9899177	595;912	P35125-2;P35125	.;UBP6_HUMAN	Q	912;595	ENSP00000250066:R912Q;ENSP00000305473:R595Q	ENSP00000250066:R912Q	R	+	2	0	USP6	4999532	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	6.359000	0.73060	1.614000	0.50241	0.398000	0.26397	CGG	G|0.541;A|0.459	0.459	strong		0.478	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
LCE3D	84648	hgsc.bcm.edu	37	1	152552285	152552285	+	Missense_Mutation	SNP	C	C	A	rs512208	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:152552285C>A	ENST00000368787.3	-	2	184	c.128G>T	c.(127-129)gGc>gTc	p.G43V		NM_032563.1	NP_115952.1	Q9BYE3	LCE3D_HUMAN	late cornified envelope 3D	43			G -> V (in dbSNP:rs512208). {ECO:0000269|PubMed:15489334}.		keratinization (GO:0031424)			p.G43V(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|stomach(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)		AGGGCCACAGCCCCCAGAGCT	0.662													C|||	1386	0.276757	0.1384	0.2853	5008	,	,		15854	0.3264		0.3827	False		,,,				2504	0.2975				p.G43V		Atlas-SNP	.											LCE3D,NS,carcinoma,0,1	LCE3D	28	1	1	Substitution - Missense(1)	stomach(1)	c.G128T						scavenged	.	C	VAL/GLY	789,3617	316.1+/-294.4	78,633,1492	57.0	66.0	63.0		128	0.3	0.6	1	dbSNP_83	63	3138,5454	473.4+/-368.6	598,1942,1756	no	missense	LCE3D	NM_032563.1	109	676,2575,3248	AA,AC,CC		36.5223,17.9074,30.2123	benign	43/93	152552285	3927,9071	2203	4296	6499	SO:0001583	missense	84648	exon2			CCACAGCCCCCAG	BI670519	CCDS1014.1	1q21	2008-02-05	2004-05-21	2004-10-15	ENSG00000163202	ENSG00000163202		"""Late cornified envelopes"""	16615	protein-coding gene	gene with protein product		612616	"""small proline rich-like (epidermal differentiation complex) 6B"""	SPRL6B, SPRL6A		11698679	Standard	NM_032563		Approved	LEP16	uc001fab.3	Q9BYE3	OTTHUMG00000012384	ENST00000368787.3:c.128G>T	1.37:g.152552285C>A	ENSP00000357776:p.Gly43Val	Somatic	191	0	0		WXS	Illumina HiSeq	Phase_I	147	4	0.0272109	NM_032563	Q3MIL1	Missense_Mutation	SNP	ENST00000368787.3	37	CCDS1014.1	655	0.2999084249084249	68	0.13821138211382114	103	0.2845303867403315	188	0.32867132867132864	296	0.39050131926121373	C	0.190	-1.053864	0.01965	0.179074	0.365223	ENSG00000163202	ENST00000368787	T	0.03982	3.74	3.63	0.259	0.15583	.	.	.	.	.	T	0.01222	0.0040	.	.	.	0.48135	P	4.089999999999927E-4	B	0.34181	0.44	B	0.33750	0.169	T	0.50294	-0.8845	7	0.34782	T	0.22	.	6.4364	0.21825	0.1979:0.4157:0.3864:0.0	rs512208	43	Q9BYE3	LCE3D_HUMAN	V	43	ENSP00000357776:G43V	ENSP00000357776:G43V	G	-	2	0	LCE3D	150818909	0.111000	0.22076	0.642000	0.29436	0.005000	0.04900	0.010000	0.13242	0.318000	0.23185	-0.929000	0.02709	GGC	C|0.986;A|0.014	0.014	weak		0.662	LCE3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034504.1	NM_032563	
P2RX5	5026	hgsc.bcm.edu	37	17	3599205	3599205	+	Missense_Mutation	SNP	A	A	T	rs142863822	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:3599205A>T	ENST00000225328.5	-	1	493	c.95T>A	c.(94-96)cTg>cAg	p.L32Q	P2RX5_ENST00000547178.1_Missense_Mutation_p.L32Q|P2RX5-TAX1BP3_ENST00000550383.1_Missense_Mutation_p.L32Q|P2RX5_ENST00000345901.3_Missense_Mutation_p.L32Q|P2RX5_ENST00000552276.1_Missense_Mutation_p.L32Q|P2RX5_ENST00000551178.1_Missense_Mutation_p.L32Q|P2RX5_ENST00000435558.1_Missense_Mutation_p.L32Q	NM_001204519.1|NM_002561.3	NP_001191448.1|NP_002552.2	Q93086	P2RX5_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 5	32					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transport (GO:0006810)	integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|ion channel activity (GO:0005216)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						CAGCCGGTACAGCAGGCCCAC	0.652													A|||	8	0.00159744	0.0008	0.0014	5008	,	,		13290	0.0		0.005	False		,,,				2504	0.001				p.L32Q		Atlas-SNP	.											.	P2RX5	36	.	0			c.T95A						PASS	.	A	GLN/LEU,GLN/LEU,GLN/LEU,GLN/LEU	5,4401	8.1+/-20.4	0,5,2198	77.0	67.0	71.0		95,95,95,95	3.3	1.0	17	dbSNP_134	71	54,8546	33.3+/-86.6	0,54,4246	yes	missense,missense,missense,missense	P2RX5	NM_001204519.1,NM_001204520.1,NM_002561.3,NM_175080.2	113,113,113,113	0,59,6444	TT,TA,AA		0.6279,0.1135,0.4536	probably-damaging,probably-damaging,probably-damaging,probably-damaging	32/422,32/399,32/423,32/398	3599205	59,12947	2203	4300	6503	SO:0001583	missense	5026	exon1			CGGTACAGCAGGC	AF016709	CCDS11034.1, CCDS11035.1, CCDS56014.1, CCDS56015.1	17p13.3	2012-01-17			ENSG00000083454	ENSG00000083454		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8536	protein-coding gene	gene with protein product		602836				9414125	Standard	NM_002561		Approved	P2X5	uc002fwi.3	Q93086	OTTHUMG00000090700	ENST00000225328.5:c.95T>A	17.37:g.3599205A>T	ENSP00000225328:p.Leu32Gln	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	98	6	0.0612245	NM_001204519	G5E981|O43450|O75540|Q308M5|Q59F38|Q8IXW4|Q93087|Q9NZV0	Missense_Mutation	SNP	ENST00000225328.5	37	CCDS11034.1	4	0.0018315018315018315	0	0.0	1	0.0027624309392265192	0	0.0	3	0.00395778364116095	A	19.59	3.855604	0.71834	0.001135	0.006279	ENSG00000083454	ENST00000435558;ENST00000551178;ENST00000547178;ENST00000225328;ENST00000345901;ENST00000440619	T;T;T;T;T	0.06068	3.35;3.35;3.35;3.35;3.35	3.33	3.33	0.38152	.	.	.	.	.	T	0.19765	0.0475	M	0.86953	2.85	0.58432	D	0.999993	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.992;0.998;0.995;0.992	T	0.03354	-1.1045	9	0.87932	D	0	.	11.3327	0.49485	1.0:0.0:0.0:0.0	.	32;32;32;32;32	G5E981;Q93086-1;Q93086-2;Q93086;Q93086-4	.;.;.;P2RX5_HUMAN;.	Q	32	ENSP00000415370:L32Q;ENSP00000447545:L32Q;ENSP00000448355:L32Q;ENSP00000225328:L32Q;ENSP00000342161:L32Q	ENSP00000225328:L32Q	L	-	2	0	P2RX5	3545954	1.000000	0.71417	1.000000	0.80357	0.464000	0.32679	8.769000	0.91742	1.529000	0.49120	0.260000	0.18958	CTG	A|0.996;T|0.004	0.004	strong		0.652	P2RX5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207388.3	NM_002561, NM_175080, NM_175081	
ADAMTS3	9508	hgsc.bcm.edu	37	4	73205310	73205310	+	Silent	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:73205310G>A	ENST00000286657.4	-	5	798	c.762C>T	c.(760-762)aaC>aaT	p.N254N		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	254					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TATTGTAATCGTTTTCTCCCG	0.498																																					p.N254N	NSCLC(168;1941 2048 2918 13048 43078)	Atlas-SNP	.											.	ADAMTS3	164	.	0			c.C762T						PASS	.						284.0	272.0	276.0					4																	73205310		2203	4300	6503	SO:0001819	synonymous_variant	9508	exon5			GTAATCGTTTTCT	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.762C>T	4.37:g.73205310G>A		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	108	41	0.37963	NM_014243	A1L3U9|Q9BXZ8	Silent	SNP	ENST00000286657.4	37	CCDS3553.1																																																																																			.	.	none		0.498	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2		
CHIA	27159	hgsc.bcm.edu	37	1	111861841	111861841	+	Missense_Mutation	SNP	A	A	G	rs2275253	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:111861841A>G	ENST00000369740.1	+	10	1118	c.1015A>G	c.(1015-1017)Atc>Gtc	p.I339V	CHIA_ENST00000353665.6_Missense_Mutation_p.I178V|CHIA_ENST00000451398.2_Missense_Mutation_p.I178V|CHIA_ENST00000430615.1_Missense_Mutation_p.I231V|RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000483391.1_Missense_Mutation_p.I178V|CHIA_ENST00000343320.6_Missense_Mutation_p.I339V	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	339			I -> V (in dbSNP:rs2275253). {ECO:0000269|PubMed:10548734, ECO:0000269|PubMed:19435888}.		apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		CTATGACAACATCAAGAGCTT	0.483													G|||	3301	0.659145	0.7958	0.4251	5008	,	,		19240	0.4802		0.7107	False		,,,				2504	0.772				p.I339V		Atlas-SNP	.											CHIA_ENST00000369740,NS,adenoma,0,2	CHIA	115	2	0			c.A1015G						scavenged	.	G	VAL/ILE,VAL/ILE	3404,1002	373.7+/-320.9	1306,792,105	144.0	133.0	137.0		691,1015	-3.2	0.0	1	dbSNP_100	137	5991,2609	423.7+/-354.4	2072,1847,381	yes	missense,missense	CHIA	NM_021797.2,NM_201653.2	29,29	3378,2639,486	GG,GA,AA		30.3372,22.7417,27.7641	benign,benign	231/369,339/477	111861841	9395,3611	2203	4300	6503	SO:0001583	missense	27159	exon10			GACAACATCAAGA	AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.1015A>G	1.37:g.111861841A>G	ENSP00000358755:p.Ile339Val	Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	145	5	0.0344828	NM_201653	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	ENST00000369740.1	37	CCDS41368.1	1349	0.6176739926739927	381	0.774390243902439	181	0.5	243	0.42482517482517484	544	0.7176781002638523	G	0.005	-2.143235	0.00332	0.772583	0.696628	ENSG00000134216	ENST00000422815;ENST00000483391;ENST00000369740;ENST00000343320;ENST00000451398;ENST00000353665;ENST00000489524;ENST00000430615	T;T;T;T;T;T;T;T	0.04809	3.55;3.55;3.55;3.55;3.55;3.55;3.55;3.55	5.07	-3.21	0.05140	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, superfamily (1);	1.502070	0.04586	N	0.395946	T	0.00468	0.0015	N	0.01417	-0.88	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.48340	-0.9044	9	0.12430	T	0.62	-7.1983	8.0421	0.30527	0.4942:0.1047:0.4011:0.0	rs2275253;rs2820091;rs17027422;rs59924337;rs2275253	339	Q9BZP6	CHIA_HUMAN	V	283;178;339;339;178;178;178;231	ENSP00000387671:I283V;ENSP00000436946:I178V;ENSP00000358755:I339V;ENSP00000341828:I339V;ENSP00000390476:I178V;ENSP00000338970:I178V;ENSP00000433309:I178V;ENSP00000391132:I231V	ENSP00000341828:I339V	I	+	1	0	CHIA	111663364	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.478000	0.06575	-0.795000	0.04462	-0.119000	0.15052	ATC	A|0.322;G|0.678	0.678	strong		0.483	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030710.1		
KRT13	3860	hgsc.bcm.edu	37	17	39661359	39661359	+	Silent	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:39661359A>G	ENST00000246635.3	-	1	490	c.444T>C	c.(442-444)ccT>ccC	p.P148P	KRT13_ENST00000336861.3_Silent_p.P148P|KRT13_ENST00000587118.1_5'Flank|AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587544.1_Silent_p.P148P	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	148	Linker 1.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				AGTCCCGCTCAGGGCTAGCTG	0.617																																					p.P148P		Atlas-SNP	.											.	KRT13	72	.	0			c.T444C						PASS	.						100.0	92.0	94.0					17																	39661359		2203	4300	6503	SO:0001819	synonymous_variant	3860	exon1			CCGCTCAGGGCTA		CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.444T>C	17.37:g.39661359A>G		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	58	20	0.344828	NM_002274	Q53G54|Q6AZK5|Q8N240	Silent	SNP	ENST00000246635.3	37	CCDS11396.1																																																																																			.	.	none		0.617	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490	
CNR1	1268	hgsc.bcm.edu	37	6	88853635	88853635	+	Silent	SNP	C	C	T	rs1049353	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:88853635C>T	ENST00000537554.1	-	2	4921	c.1359G>A	c.(1357-1359)acG>acA	p.T453T	CNR1_ENST00000549716.1_Silent_p.T392T|CNR1_ENST00000369501.2_Silent_p.T453T|CNR1_ENST00000369499.2_Silent_p.T453T|CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000468898.1_Silent_p.T420T|CNR1_ENST00000549890.1_Silent_p.T453T|CNR1_ENST00000428600.2_Silent_p.T453T|CNR1_ENST00000535130.1_Silent_p.T453T	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	453					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	CAATCTTGACCGTGCTCTTGA	0.537													C|||	648	0.129393	0.0287	0.147	5008	,	,		20357	0.0764		0.2584	False		,,,				2504	0.1748				p.T453T		Atlas-SNP	.											CNR1,NS,carcinoma,-1,1	CNR1	91	1	0			c.G1359A	GRCh37	CM074755	CNR1	M	rs1049353	PASS	.	C	,,,,	314,4092	168.0+/-198.9	16,282,1905	226.0	204.0	212.0		1359,1359,1359,1359,1260	-7.6	0.6	6	dbSNP_86	212	2330,6270	390.2+/-343.2	338,1654,2308	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CNR1	NM_001160226.1,NM_001160258.1,NM_001160259.1,NM_016083.4,NM_033181.3	,,,,	354,1936,4213	TT,TC,CC		27.093,7.1266,20.3291	,,,,	453/473,453/473,453/473,453/473,420/440	88853635	2644,10362	2203	4300	6503	SO:0001819	synonymous_variant	1268	exon4			CTTGACCGTGCTC	AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.1359G>A	6.37:g.88853635C>T		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	38	5	0.131579	NM_001160258	B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Silent	SNP	ENST00000537554.1	37	CCDS5015.1																																																																																			C|0.840;T|0.160	0.160	strong		0.537	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354204.2		
KLHL14	57565	hgsc.bcm.edu	37	18	30257203	30257203	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr18:30257203C>T	ENST00000359358.4	-	8	2117	c.1679G>A	c.(1678-1680)cGa>cAa	p.R560Q		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	560						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						AGGGCCACTTCGACCCTCCAA	0.473																																					p.R560Q		Atlas-SNP	.											KLHL14,colon,carcinoma,-1,2	KLHL14	92	2	0			c.G1679A						scavenged	.						164.0	137.0	146.0					18																	30257203		2203	4300	6503	SO:0001583	missense	57565	exon8			CCACTTCGACCCT	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1679G>A	18.37:g.30257203C>T	ENSP00000352314:p.Arg560Gln	Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	166	3	0.0180723	NM_020805	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	37	CCDS32813.1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004839	0.54254	.	.	ENSG00000197705	ENST00000359358	D	0.85773	-2.03	5.73	5.73	0.89815	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.90967	0.7160	L	0.60904	1.88	0.80722	D	1	D	0.69078	0.997	D	0.72982	0.979	D	0.88070	0.2800	10	0.30854	T	0.27	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	560	Q9P2G3	KLH14_HUMAN	Q	560	ENSP00000352314:R560Q	ENSP00000352314:R560Q	R	-	2	0	KLHL14	28511201	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.439000	0.80444	2.854000	0.98071	0.655000	0.94253	CGA	.	.	none		0.473	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1		
CFAP61	26074	hgsc.bcm.edu	37	20	20257958	20257958	+	Silent	SNP	C	C	T	rs2424317	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:20257958C>T	ENST00000245957.5	+	22	2728	c.2652C>T	c.(2650-2652)agC>agT	p.S884S	C20orf26_ENST00000377309.2_Silent_p.S240S	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		884										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		CGGTGGAGAGCGCCGTGGCGG	0.652													C|||	671	0.133986	0.0976	0.2089	5008	,	,		15156	0.004		0.2296	False		,,,				2504	0.1656				p.S884S		Atlas-SNP	.											.	C20orf26	188	.	0			c.C2652T						PASS	.	C		562,3844	251.2+/-258.0	39,484,1680	57.0	57.0	57.0		2652	-8.6	0.0	20	dbSNP_100	57	2112,6488	363.5+/-333.2	258,1596,2446	no	coding-synonymous	C20orf26	NM_015585.3		297,2080,4126	TT,TC,CC		24.5581,12.7553,20.5597		884/1238	20257958	2674,10332	2203	4300	6503	SO:0001819	synonymous_variant	26074	exon22			GGAGAGCGCCGTG																												ENST00000245957.5:c.2652C>T	20.37:g.20257958C>T		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	61	4	0.0655738	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	ENST00000245957.5	37	CCDS33447.1																																																																																			C|0.824;T|0.176	0.176	strong		0.652	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
FHAD1	114827	hgsc.bcm.edu	37	1	15668319	15668319	+	Missense_Mutation	SNP	G	G	A	rs12126178	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:15668319G>A	ENST00000375998.4	+	14	1994	c.1994G>A	c.(1993-1995)cGa>cAa	p.R665Q	FHAD1_ENST00000358897.4_Missense_Mutation_p.R665Q|RP3-467K16.2_ENST00000428747.1_RNA|FHAD1_ENST00000471347.1_3'UTR|FHAD1_ENST00000375999.3_Missense_Mutation_p.R665Q|FHAD1_ENST00000417793.1_Missense_Mutation_p.R665Q			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	665								p.R665Q(1)|p.E380K(1)		skin(1)|stomach(1)	2						GAAGCTGAACGAGGAGAGGCT	0.493													G|||	250	0.0499201	0.1036	0.0447	5008	,	,		19553	0.0		0.0477	False		,,,				2504	0.0348				p.R665Q		Atlas-SNP	.											FHAD1_ENST00000375999,NS,carcinoma,0,2	FHAD1	78	2	2	Substitution - Missense(2)	stomach(2)	c.G1994A						scavenged	.	G	GLN/ARG	146,1238		10,126,556	115.0	105.0	108.0		1994	-3.3	0.0	1	dbSNP_120	108	220,2962		4,212,1375	yes	missense	FHAD1	NM_052929.1	43	14,338,1931	AA,AG,GG		6.9139,10.5491,8.0158	benign	665/1413	15668319	366,4200	692	1591	2283	SO:0001583	missense	114827	exon15			CTGAACGAGGAGA	AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.1994G>A	1.37:g.15668319G>A	ENSP00000365166:p.Arg665Gln	Somatic	210	2	0.00952381		WXS	Illumina HiSeq	Phase_I	153	5	0.0326797	NM_052929	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	ENST00000375998.4	37		112	0.05128205128205128	57	0.11585365853658537	19	0.052486187845303865	0	0.0	36	0.047493403693931395	G	3.210	-0.161861	0.06502	0.105491	0.069139	ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998	D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94	4.49	-3.3	0.05003	.	3.151500	0.01328	N	0.011174	T	0.01695	0.0054	N	0.03608	-0.345	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.36407	-0.9749	9	0.14252	T	0.57	8.5824	2.6167	0.04906	0.1772:0.4109:0.2724:0.1395	rs12126178;rs52808140;rs59045252;rs12126178	665	B1AJZ9	FHAD1_HUMAN	Q	665	ENSP00000351770:R665Q;ENSP00000407615:R665Q;ENSP00000365167:R665Q;ENSP00000365166:R665Q	ENSP00000351770:R665Q	R	+	2	0	FHAD1	15540906	0.000000	0.05858	0.007000	0.13788	0.100000	0.18952	-2.620000	0.00879	-0.479000	0.06813	-1.355000	0.01225	CGA	G|0.930;A|0.070	0.070	strong		0.493	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000393400.2	NM_052929	
KCNN3	3782	hgsc.bcm.edu	37	1	154842243	154842243	+	Silent	SNP	A	A	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:154842243A>C	ENST00000271915.4	-	1	513	c.198T>G	c.(196-198)ctT>ctG	p.L66L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgaagctgcggag	0.701																																					p.L66L		Atlas-SNP	.											KCNN3,NS,carcinoma,0,3	KCNN3	141	3	0			c.T198G						scavenged	.						6.0	4.0	5.0					1																	154842243		1926	3811	5737	SO:0001819	synonymous_variant	3782	exon1			CTGCTGAAGCTGC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.198T>G	1.37:g.154842243A>C		Somatic	54	3	0.0555556		WXS	Illumina HiSeq	Phase_I	52	20	0.384615	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			.	.	none		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
BTG2	7832	hgsc.bcm.edu	37	1	203274847	203274847	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:203274847T>G	ENST00000290551.4	+	1	184	c.113T>G	c.(112-114)tTc>tGc	p.F38C	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	38					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			CTTAAGGTCTTCAGCGGGGCG	0.692																																					p.F38C		Atlas-SNP	.											.	BTG2	16	.	0			c.T113G						PASS	.						14.0	15.0	15.0					1																	203274847		2115	4145	6260	SO:0001583	missense	7832	exon1			AGGTCTTCAGCGG		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.113T>G	1.37:g.203274847T>G	ENSP00000290551:p.Phe38Cys	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	95	38	0.4	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.936706	0.92458	.	.	ENSG00000159388	ENST00000290551	T	0.42513	0.97	4.65	4.65	0.58169	Anti-proliferative protein (3);	0.000000	0.85682	D	0.000000	T	0.73313	0.3571	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81814	-0.0760	10	0.87932	D	0	-41.2615	13.0222	0.58794	0.0:0.0:0.0:1.0	.	38	P78543	BTG2_HUMAN	C	38	ENSP00000290551:F38C	ENSP00000290551:F38C	F	+	2	0	BTG2	201541470	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.827000	0.75303	1.958000	0.56883	0.386000	0.25728	TTC	.	.	none		0.692	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
DDX60	55601	hgsc.bcm.edu	37	4	169197297	169197297	+	Missense_Mutation	SNP	C	C	T	rs550625	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:169197297C>T	ENST00000393743.3	-	15	2305	c.2014G>A	c.(2014-2016)Gtg>Atg	p.V672M		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	672			V -> M (in dbSNP:rs550625).		defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CTTTTCATCACCTGAACAGCT	0.318													T|||	668	0.133387	0.2284	0.1671	5008	,	,		17475	0.12		0.0815	False		,,,				2504	0.0481				p.V672M		Atlas-SNP	.											DDX60_ENST00000393743,NS,carcinoma,+2,2	DDX60	304	2	0			c.G2014A						scavenged	.	T	MET/VAL	838,3568	743.6+/-411.5	82,674,1447	118.0	116.0	116.0		2014	2.7	0.9	4	dbSNP_83	116	535,8065	794.2+/-407.5	19,497,3784	yes	missense	DDX60	NM_017631.5	21	101,1171,5231	TT,TC,CC		6.2209,19.0195,10.5567	benign	672/1713	169197297	1373,11633	2203	4300	6503	SO:0001583	missense	55601	exon15			TCATCACCTGAAC	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.2014G>A	4.37:g.169197297C>T	ENSP00000377344:p.Val672Met	Somatic	121	1	0.00826446		WXS	Illumina HiSeq	Phase_I	133	4	0.0300752	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	312	0.14285714285714285	127	0.258130081300813	52	0.143646408839779	72	0.1258741258741259	61	0.08047493403693931	T	0.061	-1.224366	0.01530	0.190195	0.062209	ENSG00000137628	ENST00000393743	T	0.19806	2.12	5.15	2.67	0.31697	.	0.351400	0.28420	N	0.015411	T	0.00012	0.0000	N	0.00237	-1.79	0.80722	P	0.0	B	0.06786	0.001	B	0.04013	0.001	T	0.37502	-0.9703	9	0.06365	T	0.9	.	1.8745	0.03215	0.1217:0.2224:0.1257:0.5302	rs550625;rs52803136;rs58603390;rs550625	672	Q8IY21	DDX60_HUMAN	M	672	ENSP00000377344:V672M	ENSP00000377344:V672M	V	-	1	0	DDX60	169433872	0.016000	0.18221	0.857000	0.33713	0.730000	0.41778	-0.133000	0.10451	0.353000	0.24079	-0.381000	0.06696	GTG	C|0.882;T|0.118	0.118	strong		0.318	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
BRIP1	83990	hgsc.bcm.edu	37	17	59763465	59763465	+	Silent	SNP	T	T	C	rs4986765	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:59763465T>C	ENST00000259008.2	-	19	2904	c.2637A>G	c.(2635-2637)gaA>gaG	p.E879E	BRIP1_ENST00000577598.1_Silent_p.E879E	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	879					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						CAGCCAAGGATTCCAGTGCAC	0.383			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks					C|||	4082	0.815096	0.941	0.8285	5008	,	,		18241	0.9127		0.6531	False		,,,				2504	0.7014				p.E879E		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	BRIP1_ENST00000259008,NS,carcinoma,0,2	BRIP1	237	2	0			c.A2637G						scavenged	.	C		3913,493	225.9+/-241.6	1734,445,24	96.0	106.0	103.0		2637	2.8	1.0	17	dbSNP_111	103	5637,2963	459.2+/-364.8	1859,1919,522	no	coding-synonymous	BRIP1	NM_032043.2		3593,2364,546	CC,CT,TT		34.4535,11.1893,26.5724		879/1250	59763465	9550,3456	2203	4300	6503	SO:0001819	synonymous_variant	83990	exon19			CAAGGATTCCAGT	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.2637A>G	17.37:g.59763465T>C		Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	183	6	0.0327869	NM_032043	Q3MJE2|Q8NCI5	Silent	SNP	ENST00000259008.2	37	CCDS11631.1																																																																																			T|0.221;C|0.779	0.779	strong		0.383	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043	
SYNE1	23345	hgsc.bcm.edu	37	6	152640110	152640110	+	Missense_Mutation	SNP	G	G	A	rs2306914	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:152640110G>A	ENST00000367255.5	-	85	16878	c.16277C>T	c.(16276-16278)aCg>aTg	p.T5426M	SYNE1_ENST00000448038.1_Missense_Mutation_p.T5355M|SYNE1_ENST00000356820.4_5'Flank|SYNE1_ENST00000341594.5_Missense_Mutation_p.T5099M|SYNE1_ENST00000265368.4_Missense_Mutation_p.T5426M|SYNE1_ENST00000423061.1_Missense_Mutation_p.T5355M	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5426			T -> M (in dbSNP:rs2306914).		cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.T5426M(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCCTGGCTCGTGGCCTTGCT	0.373										HNSCC(10;0.0054)			G|||	232	0.0463259	0.0015	0.0331	5008	,	,		17552	0.1419		0.0288	False		,,,				2504	0.0358				p.T5426M		Atlas-SNP	.											SYNE1_ENST00000423061,NS,carcinoma,+1,5	SYNE1	3227	5	2	Substitution - Missense(2)	stomach(2)	c.C16277T						PASS	.	G	MET/THR,MET/THR	26,4380	32.6+/-62.9	0,26,2177	93.0	86.0	88.0		16064,16277	0.3	1.0	6	dbSNP_100	88	234,8366	95.9+/-157.7	1,232,4067	yes	missense,missense	SYNE1	NM_033071.3,NM_182961.3	81,81	1,258,6244	AA,AG,GG		2.7209,0.5901,1.9991	benign,benign	5355/8750,5426/8798	152640110	260,12746	2203	4300	6503	SO:0001583	missense	23345	exon85			TGGCTCGTGGCCT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16277C>T	6.37:g.152640110G>A	ENSP00000356224:p.Thr5426Met	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	90	8	0.0888889	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	116	0.05311355311355311	0	0.0	11	0.03038674033149171	85	0.1486013986013986	20	0.026385224274406333	G	10.63	1.403979	0.25291	0.005901	0.027209	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.51325	0.81;0.83;0.71;0.83;0.88	5.43	0.286	0.15710	.	0.264282	0.32736	N	0.005720	T	0.06735	0.0172	N	0.01267	-0.92	0.09310	P	0.99999999696508	B;B;B;B	0.11235	0.001;0.001;0.001;0.004	B;B;B;B	0.06405	0.001;0.0;0.0;0.002	T	0.22417	-1.0217	9	0.44086	T	0.13	.	9.4523	0.38734	0.7303:0.0:0.2697:0.0	rs2306914;rs52815326;rs57164592;rs2306914	5426;5426;5426;5355	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	M	5426;5355;5426;5355;5099	ENSP00000356224:T5426M;ENSP00000396024:T5355M;ENSP00000265368:T5426M;ENSP00000390975:T5355M;ENSP00000341887:T5099M	ENSP00000265368:T5426M	T	-	2	0	SYNE1	152681803	0.997000	0.39634	0.995000	0.50966	0.991000	0.79684	0.892000	0.28322	-0.170000	0.10816	-0.238000	0.12139	ACG	G|0.962;A|0.038	0.038	strong		0.373	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
IQCF6	440956	hgsc.bcm.edu	37	3	51812952	51812952	+	Missense_Mutation	SNP	C	C	T	rs11130296|rs35586812	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:51812952C>T	ENST00000398780.3	-	1	57	c.11G>A	c.(10-12)cGg>cAg	p.R4Q		NM_001143833.3	NP_001137305.2	A8MYZ5	IQCF6_HUMAN	IQ motif containing F6	4										breast(1)	1						CAGTAACGTCCGGCGCACCAT	0.547													C|||	663	0.132388	0.0098	0.1787	5008	,	,		20767	0.0764		0.2873	False		,,,				2504	0.1636				p.R4Q		Atlas-SNP	.											.	IQCF6	2	.	0			c.G11A						PASS	.	C	GLN/ARG	64,1320		0,64,628	19.0	17.0	18.0		11	1.8	0.8	3	dbSNP_120	18	853,2329		111,631,849	yes	missense	IQCF6	NM_001143833.3	43	111,695,1477	TT,TC,CC		26.807,4.6243,20.0832	probably-damaging	4/108	51812952	917,3649	692	1591	2283	SO:0001583	missense	440956	exon2			AACGTCCGGCGCA		CCDS54590.1	3p21.1	2008-10-16			ENSG00000214686	ENSG00000214686			35158	protein-coding gene	gene with protein product							Standard	NM_001143833		Approved		uc021wyv.1	A8MYZ5		ENST00000398780.3:c.11G>A	3.37:g.51812952C>T	ENSP00000381760:p.Arg4Gln	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	75	5	0.0666667	NM_001143833		Missense_Mutation	SNP	ENST00000398780.3	37	CCDS54590.1	355	0.16254578754578755	5	0.01016260162601626	70	0.19337016574585636	53	0.09265734265734266	227	0.2994722955145119	C	15.40	2.822346	0.50739	0.046243	0.26807	ENSG00000214686	ENST00000398780	T	0.57595	0.39	4.9	1.79	0.24919	.	.	.	.	.	T	0.00012	0.0000	M	0.66939	2.045	0.43267	P	0.004781999999999953	B	0.02656	0.0	B	0.06405	0.002	T	0.09596	-1.0667	8	0.66056	D	0.02	-28.0976	6.1264	0.20182	0.0:0.6293:0.0:0.3707	rs11130296;rs60424990;rs11130296	27	A8MYZ5	IQCF6_HUMAN	Q	4	ENSP00000381760:R4Q	ENSP00000381760:R4Q	R	-	2	0	IQCF6	51787992	0.081000	0.21417	0.777000	0.31699	0.943000	0.58893	0.131000	0.15870	0.156000	0.19299	0.655000	0.94253	CGG	C|0.837;T|0.163	0.163	strong		0.547	IQCF6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496643	
CMKLR1	1240	hgsc.bcm.edu	37	12	108686008	108686008	+	Silent	SNP	C	C	G	rs1057401	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:108686008C>G	ENST00000312143.7	-	3	1095	c.732G>C	c.(730-732)gtG>gtC	p.V244V	CMKLR1_ENST00000412676.1_Silent_p.V244V|CMKLR1_ENST00000552995.1_Silent_p.V242V|CMKLR1_ENST00000550402.1_Silent_p.V244V|CMKLR1_ENST00000397688.2_Silent_p.V242V	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	244					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						GCAGTTTGCACACGATGGTGA	0.552													G|||	1855	0.370407	0.6513	0.3156	5008	,	,		21024	0.0119		0.4473	False		,,,				2504	0.32				p.V244V		Atlas-SNP	.											CMKLR1,NS,carcinoma,-2,1	CMKLR1	67	1	0			c.G732C						scavenged	.		,,,	2563,1707		803,957,375	69.0	76.0	74.0		732,732,732,726	4.5	1.0	12	dbSNP_86	74	3973,4507		948,2077,1215	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CMKLR1	NM_001142343.1,NM_001142344.1,NM_001142345.1,NM_004072.2	,,,	1751,3034,1590	GG,GC,CC		46.8514,39.9766,48.7373	,,,	244/374,244/374,244/374,242/372	108686008	6536,6214	2135	4240	6375	SO:0001819	synonymous_variant	1240	exon3			TTTGCACACGATG	U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.732G>C	12.37:g.108686008C>G		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	67	2	0.0298507	NM_001142344	A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Silent	SNP	ENST00000312143.7	37	CCDS44965.1																																																																																			C|0.627;G|0.373	0.373	strong		0.552	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404867.1		
CELA3A	10136	hgsc.bcm.edu	37	1	22336308	22336308	+	Silent	SNP	G	G	A	rs12908	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:22336308G>A	ENST00000290122.3	+	7	772	c.753G>A	c.(751-753)acG>acA	p.T251T	RN7SL186P_ENST00000466485.2_RNA|RNU6-776P_ENST00000364403.1_RNA	NM_005747.4	NP_005738.4	P09093	CEL3A_HUMAN	chymotrypsin-like elastase family, member 3A	251	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|digestion (GO:0007586)|proteolysis (GO:0006508)		serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GGAAGCCCACGGTGTTCACTC	0.607													G|||	1430	0.285543	0.2307	0.4078	5008	,	,		16710	0.3998		0.2207	False		,,,				2504	0.2219				p.T251T		Atlas-SNP	.											CELA3A,NS,carcinoma,+2,1	CELA3A	35	1	0			c.G753A						scavenged	.	G		1140,3266	383.0+/-324.7	180,780,1243	74.0	68.0	70.0		753	-7.3	0.5	1	dbSNP_52	70	1939,6661	311.3+/-310.3	232,1475,2593	no	coding-synonymous	CELA3A	NM_005747.4		412,2255,3836	AA,AG,GG		22.5465,25.8738,23.6737		251/271	22336308	3079,9927	2203	4300	6503	SO:0001819	synonymous_variant	10136	exon7			GCCCACGGTGTTC	D00306	CCDS220.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000142789	ENSG00000142789			15944	protein-coding gene	gene with protein product	"""protease E"""		"""elastase 3A, pancreatic (protease E)"", ""elastase 3A, pancreatic"""	ELA3A		2826474, 2460440	Standard	NM_005747		Approved	ELA3		P09093	OTTHUMG00000002755	ENST00000290122.3:c.753G>A	1.37:g.22336308G>A		Somatic	214	0	0		WXS	Illumina HiSeq	Phase_I	184	4	0.0217391	NM_005747	B1AQ53|Q9BRW4	Silent	SNP	ENST00000290122.3	37	CCDS220.1																																																																																			G|0.745;A|0.255	0.255	strong		0.607	CELA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007791.1	NM_005747	
ACTG1	71	hgsc.bcm.edu	37	17	79478007	79478007	+	Silent	SNP	G	G	A	rs1135989	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:79478007G>A	ENST00000575842.1	-	4	1356	c.930C>T	c.(928-930)gcC>gcT	p.A310A	AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000575087.1_Silent_p.A310A|ACTG1_ENST00000573283.1_Silent_p.A310A|ACTG1_ENST00000331925.2_Silent_p.A310A			P63261	ACTG_HUMAN	actin, gamma 1	310					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			GCATCCTGTCGGCAATGCCCG	0.612													g|||	928	0.185304	0.1505	0.2522	5008	,	,		20969	0.005		0.3966	False		,,,				2504	0.1534				p.A310A		Atlas-SNP	.											.	ACTG1	55	.	0			c.C930T						PASS	.	G	,	852,3554	331.0+/-301.8	89,674,1440	67.0	64.0	65.0		930,930	-6.6	0.6	17	dbSNP_86	65	3263,5337	483.9+/-371.3	603,2057,1640	no	coding-synonymous,coding-synonymous	ACTG1	NM_001199954.1,NM_001614.3	,	692,2731,3080	AA,AG,GG		37.9419,19.3373,31.6392	,	310/376,310/376	79478007	4115,8891	2203	4300	6503	SO:0001819	synonymous_variant	71	exon5			CCTGTCGGCAATG		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.930C>T	17.37:g.79478007G>A		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	66	4	0.0606061	NM_001614	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Silent	SNP	ENST00000575842.1	37	CCDS11782.1																																																																																			G|0.711;A|0.289	0.289	strong		0.612	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614	
DDX11	1663	hgsc.bcm.edu	37	12	31250830	31250830	+	Missense_Mutation	SNP	C	C	G	rs2911826		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:31250830C>G	ENST00000407793.2	+	18	2025	c.1774C>G	c.(1774-1776)Cag>Gag	p.Q592E	DDX11_ENST00000539673.1_3'UTR|DDX11_ENST00000545668.1_Missense_Mutation_p.Q592E|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000542838.1_Missense_Mutation_p.Q592E|DDX11_ENST00000228264.6_Missense_Mutation_p.Q566E|DDX11_ENST00000350437.4_Missense_Mutation_p.Q592E	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	592					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.Q592E(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAGCCTCAGTCAGAGCACCCT	0.582										Multiple Myeloma(12;0.14)																											p.Q592E		Atlas-SNP	.											DDX11,extremity,malignant_melanoma,0,1	DDX11	188	1	1	Substitution - Missense(1)	skin(1)	c.C1774G						scavenged	.						81.0	80.0	81.0					12																	31250830		2203	4300	6503	SO:0001583	missense	1663	exon18			CTCAGTCAGAGCA	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1774C>G	12.37:g.31250830C>G	ENSP00000384703:p.Gln592Glu	Somatic	133	12	0.0902256		WXS	Illumina HiSeq	Phase_I	183	9	0.0491803	NM_030653	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	C	5.933	0.356089	0.11239	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	3.23	3.23	0.37069	.	0.250227	0.40728	N	0.001040	T	0.21550	0.0519	L	0.54965	1.715	0.80722	D	1	B;B;B;B	0.22909	0.048;0.077;0.023;0.048	B;B;B;B	0.18871	0.023;0.017;0.015;0.023	T	0.04481	-1.0948	10	0.11794	T	0.64	.	12.0234	0.53356	0.0:1.0:0.0:0.0	rs2911826	566;592;592;592	Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	E	592;592;317;566;592;592	ENSP00000443426:Q592E;ENSP00000384703:Q592E;ENSP00000228264:Q566E;ENSP00000440402:Q592E;ENSP00000309965:Q592E	ENSP00000228264:Q566E	Q	+	1	0	DDX11	31142097	1.000000	0.71417	0.998000	0.56505	0.511000	0.34104	3.091000	0.50199	1.632000	0.50472	0.505000	0.49811	CAG	.	.	weak		0.582	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
GUF1	60558	hgsc.bcm.edu	37	4	44682465	44682465	+	Missense_Mutation	SNP	T	T	C	rs6447368	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:44682465T>C	ENST00000281543.5	+	2	367	c.173T>C	c.(172-174)cTt>cCt	p.L58P	GUF1_ENST00000506793.1_Intron	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)									p.L58P(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						TAGGAAAAACTTGACATGTCT	0.338													T|||	2205	0.440296	0.2897	0.5202	5008	,	,		14515	0.4018		0.6014	False		,,,				2504	0.4611				p.L58P		Atlas-SNP	.											GUF1,NS,carcinoma,0,1	GUF1	72	1	1	Substitution - Missense(1)	stomach(1)	c.T173C						scavenged	.	T	PRO/LEU	1523,2883	461.5+/-352.9	267,989,947	56.0	54.0	54.0		173	2.8	0.4	4	dbSNP_116	54	5468,3132	637.2+/-399.2	1747,1974,579	yes	missense	GUF1	NM_021927.2	98	2014,2963,1526	CC,CT,TT		36.4186,34.5665,46.2479	benign	58/670	44682465	6991,6015	2203	4300	6503	SO:0001583	missense	60558	exon2			AAAAACTTGACAT		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.173T>C	4.37:g.44682465T>C	ENSP00000281543:p.Leu58Pro	Somatic	253	0	0		WXS	Illumina HiSeq	Phase_I	246	9	0.0365854	NM_021927		Missense_Mutation	SNP	ENST00000281543.5	37	CCDS3468.1	1004	0.4597069597069597	144	0.2926829268292683	188	0.5193370165745856	226	0.3951048951048951	446	0.5883905013192612	T	9.377	1.072042	0.20147	0.345665	0.635814	ENSG00000151806	ENST00000281543	T	0.70045	-0.45	5.17	2.83	0.33086	.	1.148940	0.06297	N	0.700199	T	0.00012	0.0000	N	0.08118	0	0.47094	P	6.840000000000179E-4	B	0.02656	0.0	B	0.04013	0.001	T	0.46762	-0.9168	9	0.49607	T	0.09	-0.1341	7.0188	0.24902	0.0:0.2122:0.0:0.7878	rs6447368;rs11556168;rs6447368	58	Q8N442	GUF1_HUMAN	P	58	ENSP00000281543:L58P	ENSP00000281543:L58P	L	+	2	0	GUF1	44377222	0.824000	0.29247	0.358000	0.25811	0.746000	0.42486	4.783000	0.62403	0.412000	0.25729	-0.388000	0.06559	CTT	T|0.484;C|0.516	0.516	strong		0.338	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3	NM_021927	
PLXNA3	55558	hgsc.bcm.edu	37	X	153692374	153692374	+	Missense_Mutation	SNP	G	G	A	rs150546014	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chrX:153692374G>A	ENST00000369682.3	+	7	1803	c.1628G>A	c.(1627-1629)cGg>cAg	p.R543Q		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	543					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTCCAGGTGCGGGTCCGGCCC	0.677													g|||	4	0.0010596	0.0023	0.0	3775	,	,		11949	0.0		0.001	False		,,,				2504	0.0				p.R543Q		Atlas-SNP	.											.	PLXNA3	156	.	0			c.G1628A						PASS	.		GLN/ARG	19,3813		0,15,4,1617,564	48.0	36.0	40.0		1628	2.0	1.0	X	dbSNP_134	40	14,6712		0,9,5,2419,1865	yes	missense	PLXNA3	NM_017514.3	43	0,24,9,4036,2429	AA,AG,A,GG,G		0.2081,0.4958,0.3126	benign	543/1872	153692374	33,10525	2200	4298	6498	SO:0001583	missense	55558	exon7			AGGTGCGGGTCCG	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.1628G>A	X.37:g.153692374G>A	ENSP00000358696:p.Arg543Gln	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	110	5	0.0454545	NM_017514	Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	CCDS14752.1	3	0.0018083182640144665	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	g	10.66	1.413812	0.25465	0.004958	0.002081	ENSG00000130827	ENST00000369682	T	0.00873	5.59	4.84	1.99	0.26369	.	0.457771	0.21675	N	0.070816	T	0.00666	0.0022	N	0.19112	0.55	0.21416	N	0.999696	B	0.09022	0.002	B	0.01281	0.0	T	0.48570	-0.9024	10	0.25751	T	0.34	.	3.926	0.09263	0.3255:0.1948:0.4798:0.0	.	543	P51805	PLXA3_HUMAN	Q	543	ENSP00000358696:R543Q	ENSP00000358696:R543Q	R	+	2	0	PLXNA3	153345568	0.000000	0.05858	0.999000	0.59377	0.934000	0.57294	0.077000	0.14738	0.477000	0.27464	-0.175000	0.13238	CGG	G|0.997;A|0.003	0.003	strong		0.677	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	
ANKRD30B	374860	hgsc.bcm.edu	37	18	14848820	14848820	+	Missense_Mutation	SNP	C	C	T	rs4090319	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr18:14848820C>T	ENST00000358984.4	+	34	3110	c.2930C>T	c.(2929-2931)aCg>aTg	p.T977M		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	977				T -> M (in Ref. 3; AAK27326 and 4; BAG57852). {ECO:0000305}.				p.T977M(1)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						ATGGAACAAACGAAAAATAAG	0.348													C|||	2007	0.400759	0.0257	0.5173	5008	,	,		15920	0.5685		0.4801	False		,,,				2504	0.5706				p.T977M		Atlas-SNP	.											ANKRD30B_ENST00000358984,NS,carcinoma,0,1	ANKRD30B	237	1	1	Substitution - Missense(1)	kidney(1)	c.C2930T						scavenged	.						76.0	56.0	62.0					18																	14848820		692	1587	2279	SO:0001583	missense	374860	exon34			AACAAACGAAAAA	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2930C>T	18.37:g.14848820C>T	ENSP00000351875:p.Thr977Met	Somatic	494	1	0.00202429		WXS	Illumina HiSeq	Phase_I	302	13	0.0430464	NM_001145029	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	777	0.3557692307692308	21	0.042682926829268296	165	0.4558011049723757	281	0.49125874125874125	310	0.40897097625329815	C	0.001	-3.829587	0.00004	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.15952	2.38	1.48	0.0525	0.14302	.	.	.	.	.	T	0.00012	0.0000	N	0.01048	-1.04	0.09310	P	0.999999854054	B;B	0.12630	0.0;0.006	B;B	0.04013	0.0;0.001	T	0.45469	-0.9259	8	0.02654	T	1	.	4.8651	0.13604	0.0:0.1894:0.0:0.8106	rs4090319	1062;977	Q9BXX2;F8WAG3	AN30B_HUMAN;.	M	977;371;397	ENSP00000351875:T977M	ENSP00000277669:T397M	T	+	2	0	ANKRD30B	14838820	0.992000	0.36948	0.027000	0.17364	0.012000	0.07955	2.178000	0.42519	0.068000	0.16574	-1.169000	0.01745	ACG	.	.	weak		0.348	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
BAI3	577	hgsc.bcm.edu	37	6	70042873	70042873	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:70042873T>C	ENST00000370598.1	+	24	3982	c.3161T>C	c.(3160-3162)cTa>cCa	p.L1054P	BAI3_ENST00000546190.1_Missense_Mutation_p.L18P|BAI3_ENST00000238918.8_Missense_Mutation_p.L260P	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1054					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L1054R(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GATGGAATCCTAGATAAAAAG	0.373																																					p.L1054P		Atlas-SNP	.											BAI3,NS,carcinoma,+1,2	BAI3	451	2	1	Substitution - Missense(1)	liver(1)	c.T3161C						PASS	.						105.0	105.0	105.0					6																	70042873		2203	4299	6502	SO:0001583	missense	577	exon24			GAATCCTAGATAA	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3161T>C	6.37:g.70042873T>C	ENSP00000359630:p.Leu1054Pro	Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	134	41	0.30597	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	T	19.52	3.842563	0.71488	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.40476	1.03;1.03;1.03	5.28	5.28	0.74379	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000001	T	0.48696	0.1514	L	0.52011	1.625	0.80722	D	1	B;B;D	0.71674	0.098;0.004;0.998	B;B;D	0.66351	0.114;0.01;0.943	T	0.51180	-0.8738	10	0.56958	D	0.05	.	15.5917	0.76534	0.0:0.0:0.0:1.0	.	260;1054;1054	B7Z356;A8K0Y1;O60242	.;.;BAI3_HUMAN	P	1054;260;18	ENSP00000359630:L1054P;ENSP00000238918:L260P;ENSP00000441821:L18P	ENSP00000238918:L260P	L	+	2	0	BAI3	70099594	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.147000	0.58078	2.138000	0.66242	0.524000	0.50904	CTA	.	.	none		0.373	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
ANKRD33	341405	hgsc.bcm.edu	37	12	52284586	52284586	+	Missense_Mutation	SNP	C	C	T	rs200291062		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:52284586C>T	ENST00000340970.4	+	5	852	c.481C>T	c.(481-483)Cgg>Tgg	p.R161W	ANKRD33_ENST00000538991.1_Missense_Mutation_p.R92W|ANKRD33_ENST00000301190.6_Missense_Mutation_p.R286W|ANKRD33_ENST00000547119.1_3'UTR			Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33	161					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.0969)		ACTCCTAGAACGGCTGCAGGC	0.662																																					p.R286W		Atlas-SNP	.											.	ANKRD33	33	.	0			c.C856T						PASS	.	C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	25.0	24.0	24.0		481,856	0.1	0.6	12		24	4,8590		0,4,4293	yes	missense,missense	ANKRD33	NM_001130015.1,NM_182608.3	101,101	0,4,6496	TT,TC,CC		0.0465,0.0,0.0308	probably-damaging,probably-damaging	161/273,286/453	52284586	4,12996	2203	4297	6500	SO:0001583	missense	341405	exon5			CTAGAACGGCTGC		CCDS8815.1, CCDS44892.1	12q13.13	2013-01-10	2005-01-07	2005-01-07		ENSG00000167612		"""Ankyrin repeat domain containing"""	13788	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 7"""	C12orf7		20026326	Standard	NM_182608		Approved	DKFZp686O1689, PANKY	uc001rzd.3	Q7Z3H0	OTTHUMG00000169506	ENST00000340970.4:c.481C>T	12.37:g.52284586C>T	ENSP00000344690:p.Arg161Trp	Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	44	19	0.431818	NM_182608	Q0VAA7|Q5K619|Q5K621|Q5K622|Q5K623|Q5K624|Q6ZUN0	Missense_Mutation	SNP	ENST00000340970.4	37	CCDS44892.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.419121	0.42918	0.0	4.65E-4	ENSG00000167612	ENST00000301190;ENST00000538991;ENST00000340970	T;T;T	0.24908	1.93;1.83;2.28	4.7	0.0507	0.14294	.	0.080339	0.47455	D	0.000234	T	0.39655	0.1086	L	0.55481	1.735	0.21473	N	0.999672	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74674	0.965;0.984;0.977	T	0.22836	-1.0205	10	0.37606	T	0.19	-7.9632	11.629	0.51162	0.7308:0.2692:0.0:0.0	.	161;92;286	Q7Z3H0;Q0VAA8;Q7Z3H0-2	ANR33_HUMAN;.;.	W	286;92;161	ENSP00000301190:R286W;ENSP00000443722:R92W;ENSP00000344690:R161W	ENSP00000301190:R286W	R	+	1	2	ANKRD33	50570853	0.279000	0.24239	0.605000	0.28930	0.607000	0.37147	0.456000	0.21859	0.192000	0.20272	0.561000	0.74099	CGG	.	.	weak		0.662	ANKRD33-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404515.1	NM_182608	
ZNF573	126231	hgsc.bcm.edu	37	19	38229824	38229824	+	Missense_Mutation	SNP	T	T	C	rs3095726	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:38229824T>C	ENST00000590414.2	-	4	1588	c.1567A>G	c.(1567-1569)Atg>Gtg	p.M523V	ZNF573_ENST00000536220.1_Missense_Mutation_p.M435V|ZNF573_ENST00000357309.3_Missense_Mutation_p.M435V|ZNF573_ENST00000339503.4_Missense_Mutation_p.M465V|ZNF573_ENST00000392138.1_Missense_Mutation_p.M436V			Q86YE8	ZN573_HUMAN	zinc finger protein 573	523				M -> V (in Ref. 3; AAH15418/AAH42170/ AAH51263/AAH64962). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TAGGGTTTCATACCAGTATGA	0.328													c|||	3635	0.725839	0.9917	0.7579	5008	,	,		19641	0.3472		0.833	False		,,,				2504	0.6237				p.M523V		Atlas-SNP	.											ZNF573,colon,carcinoma,0,1	ZNF573	63	1	0			c.A1567G						PASS	.	T	VAL/MET,VAL/MET,VAL/MET,VAL/MET,VAL/MET	4251,155		2052,147,4	54.0	56.0	55.0		1303,1567,1561,1303,1393	-0.2	0.6	19	dbSNP_103	55	7021,1579		2864,1293,143	no	missense,missense,missense,missense,missense	ZNF573	NM_001172689.1,NM_001172690.1,NM_001172691.1,NM_001172692.1,NM_152360.3	21,21,21,21,21	4916,1440,147	CC,CT,TT		18.3605,3.5179,13.3323	benign,benign,benign,benign,benign	435/578,523/666,521/664,435/578,465/608	38229824	11272,1734	2203	4300	6503	SO:0001583	missense	126231	exon5			GTTTCATACCAGT	AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.1567A>G	19.37:g.38229824T>C	ENSP00000465020:p.Met523Val	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	62	4	0.0645161	NM_001172690	B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Missense_Mutation	SNP	ENST00000590414.2	37	CCDS59381.1	1606	0.7353479853479854	485	0.9857723577235772	284	0.7845303867403315	201	0.3513986013986014	636	0.8390501319261213	-	7.201	0.593398	0.13875	0.964821	0.816395	ENSG00000189144	ENST00000392138;ENST00000536220;ENST00000357309;ENST00000339503;ENST00000427026	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	2.25	-0.193	0.13244	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00012	0.0000	N	0.00525	-1.395	0.58432	P	2.9999999999752447E-6	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.21484	-1.0244	8	0.66056	D	0.02	.	5.6351	0.17532	0.0:0.6715:0.1995:0.129	rs3095726;rs17845462;rs17855938;rs17857264;rs17858340;rs52789917;rs3095726	436;465;503;435	Q86YE8-4;Q86YE8-3;Q86YE8;Q86YE8-2	.;.;ZN573_HUMAN;.	V	436;435;435;465;435	ENSP00000375983:M436V;ENSP00000440464:M435V;ENSP00000349861:M435V;ENSP00000340171:M465V	ENSP00000340171:M465V	M	-	1	0	ZNF573	42921664	0.001000	0.12720	0.602000	0.28890	0.755000	0.42902	1.410000	0.34691	-0.269000	0.09298	-0.221000	0.12465	ATG	T|0.180;C|0.820	0.820	strong		0.328	ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459773.2	NM_152360	
DPY19L2	283417	hgsc.bcm.edu	37	12	63954304	63954304	+	Silent	SNP	T	T	C	rs1054891	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:63954304T>C	ENST00000324472.4	-	22	2448	c.2265A>G	c.(2263-2265)ttA>ttG	p.L755L	DPY19L2_ENST00000413230.2_Silent_p.L202L	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	755					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		AGTTAACCTTTAATACTCTGT	0.418													N|||	2174	0.434105	0.7057	0.4568	5008	,	,		16369	0.2857		0.4245	False		,,,				2504	0.2137				p.L755L		Atlas-SNP	.											DPY19L2,colon,carcinoma,0,1	DPY19L2	97	1	0			c.A2265G						scavenged	.	C		2776,1630	500.0+/-364.6	884,1008,311	85.0	80.0	82.0		2265	-1.3	0.3	12	dbSNP_86	82	3491,5109	633.6+/-398.7	694,2103,1503	no	coding-synonymous	DPY19L2	NM_173812.4		1578,3111,1814	CC,CT,TT		40.593,36.995,48.1855		755/759	63954304	6267,6739	2203	4300	6503	SO:0001819	synonymous_variant	283417	exon22			AACCTTTAATACT		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.2265A>G	12.37:g.63954304T>C		Somatic	186	0	0		WXS	Illumina HiSeq	Phase_I	271	5	0.0184502	NM_173812	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Silent	SNP	ENST00000324472.4	37	CCDS31851.1																																																																																			T|0.532;C|0.468	0.468	strong		0.418	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812	
TLR3	7098	hgsc.bcm.edu	37	4	187004217	187004217	+	Silent	SNP	C	C	T	rs3775290	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:187004217C>T	ENST00000296795.3	+	4	1481	c.1377C>T	c.(1375-1377)ttC>ttT	p.F459F	TLR3_ENST00000504367.1_Silent_p.F182F	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	459					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		AAAATATTTTCGAAATCTATC	0.478													C|||	1363	0.272165	0.1861	0.2738	5008	,	,		19762	0.3363		0.2734	False		,,,				2504	0.32				p.F459F		Atlas-SNP	.											TLR3,caecum,carcinoma,0,1	TLR3	83	1	0			c.C1377T						scavenged	.	C		869,3537	325.6+/-299.2	91,687,1425	61.0	61.0	61.0		1377	0.3	0.5	4	dbSNP_107	61	2661,5939	415.9+/-351.9	396,1869,2035	yes	coding-synonymous	TLR3	NM_003265.2		487,2556,3460	TT,TC,CC		30.9419,19.7231,27.1413		459/905	187004217	3530,9476	2203	4300	6503	SO:0001819	synonymous_variant	7098	exon4			TATTTTCGAAATC	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1377C>T	4.37:g.187004217C>T		Somatic	178	1	0.00561798		WXS	Illumina HiSeq	Phase_I	198	9	0.0454545	NM_003265	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Silent	SNP	ENST00000296795.3	37	CCDS3846.1																																																																																			C|0.727;T|0.273	0.273	strong		0.478	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
LRP4	4038	hgsc.bcm.edu	37	11	46897446	46897446	+	Missense_Mutation	SNP	G	G	A	rs2306033	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:46897446G>A	ENST00000378623.1	-	26	3850	c.3608C>T	c.(3607-3609)gCg>gTg	p.A1203V	LRP4-AS1_ENST00000502049.2_RNA|LRP4-AS1_ENST00000531719.1_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1203			A -> V (in dbSNP:rs2306033).		dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		GATGAGCACCGCGCGGTCTGA	0.542													G|||	1098	0.219249	0.0045	0.2781	5008	,	,		20112	0.6101		0.1193	False		,,,				2504	0.1677				p.A1203V		Atlas-SNP	.											.	LRP4	160	.	0			c.C3608T						PASS	.	G	VAL/ALA	148,4254	101.6+/-140.2	3,142,2056	131.0	99.0	110.0		3608	5.7	0.0	11	dbSNP_100	110	1051,7547	222.0+/-259.2	55,941,3303	yes	missense	LRP4	NM_002334.3	64	58,1083,5359	AA,AG,GG		12.2238,3.3621,9.2231	benign	1203/1906	46897446	1199,11801	2201	4299	6500	SO:0001583	missense	4038	exon26			AGCACCGCGCGGT	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.3608C>T	11.37:g.46897446G>A	ENSP00000367888:p.Ala1203Val	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	87	5	0.0574713	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	537	0.24587912087912087	4	0.008130081300813009	98	0.27071823204419887	332	0.5804195804195804	103	0.1358839050131926	G	0.720	-0.783875	0.02907	0.033621	0.122238	ENSG00000134569	ENST00000378623	D	0.93811	-3.29	5.71	5.71	0.89125	Six-bladed beta-propeller, TolB-like (1);	0.497398	0.23189	N	0.050940	T	0.00012	0.0000	N	0.02202	-0.64	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.36187	-0.9758	9	0.20046	T	0.44	.	7.4774	0.27385	0.1975:0.0:0.8025:0.0	rs2306033;rs17197332;rs52799813;rs56867112;rs2306033	1203	O75096	LRP4_HUMAN	V	1203	ENSP00000367888:A1203V	ENSP00000367888:A1203V	A	-	2	0	LRP4	46854022	0.599000	0.26891	0.021000	0.16686	0.212000	0.24457	3.696000	0.54757	2.704000	0.92352	0.555000	0.69702	GCG	G|0.848;A|0.152	0.152	strong		0.542	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
CPXM2	119587	hgsc.bcm.edu	37	10	125557598	125557598	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:125557598C>T	ENST00000241305.3	-	6	937	c.783G>A	c.(781-783)gaG>gaA	p.E261E	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	261	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		GGACGGGTAGCTCATTGAGAA	0.473																																					p.E261E		Atlas-SNP	.											.	CPXM2	120	.	0			c.G783A						PASS	.						130.0	111.0	118.0					10																	125557598		2203	4300	6503	SO:0001819	synonymous_variant	119587	exon6			GGGTAGCTCATTG	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.783G>A	10.37:g.125557598C>T		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	100	29	0.29	NM_198148	B4E3Q2	Silent	SNP	ENST00000241305.3	37	CCDS7637.1																																																																																			.	.	none		0.473	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148	
PRDM1	639	hgsc.bcm.edu	37	6	106543518	106543518	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:106543518T>A	ENST00000369096.4	+	3	554	c.320T>A	c.(319-321)aTa>aAa	p.I107K	PRDM1_ENST00000369091.2_Missense_Mutation_p.I71K	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	107	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		AAAGAATACATACCAAAGGGC	0.343			"""D, N, Mis, F, S"""		DLBCL																																p.I107K		Atlas-SNP	.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	PRDM1	195	.	0			c.T320A						PASS	.						94.0	89.0	91.0					6																	106543518		2203	4300	6503	SO:0001583	missense	639	exon3			AATACATACCAAA		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.320T>A	6.37:g.106543518T>A	ENSP00000358092:p.Ile107Lys	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	61	30	0.491803	NM_001198	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	ENST00000369096.4	37	CCDS5054.2	.	.	.	.	.	.	.	.	.	.	T	31	5.093722	0.94149	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278	D;D	0.89196	-2.48;-2.48	6.06	6.06	0.98353	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.95671	0.8592	H	0.94582	3.555	0.80722	D	1	D	0.61697	0.99	D	0.69824	0.966	D	0.96716	0.9529	10	0.87932	D	0	-24.395	16.6093	0.84858	0.0:0.0:0.0:1.0	.	107	O75626	PRDM1_HUMAN	K	71;107;71	ENSP00000358087:I71K;ENSP00000358092:I107K	ENSP00000358087:I71K	I	+	2	0	PRDM1	106650211	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.040000	0.89188	2.324000	0.78689	0.533000	0.62120	ATA	.	.	none		0.343	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
TTC21A	199223	hgsc.bcm.edu	37	3	39161464	39161464	+	Missense_Mutation	SNP	G	G	A	rs1274971	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:39161464G>A	ENST00000431162.2	+	8	1011	c.877G>A	c.(877-879)Gaa>Aaa	p.E293K	TTC21A_ENST00000440121.1_Missense_Mutation_p.E244K|TTC21A_ENST00000301819.6_Missense_Mutation_p.E293K			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	293			E -> K (in dbSNP:rs1274971).							NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		AAGGGAACCCGAAAATCCAAG	0.443													G|||	2282	0.455671	0.8495	0.3429	5008	,	,		18210	0.2738		0.334	False		,,,				2504	0.316				p.E293K		Atlas-SNP	.											.	TTC21A	96	.	0			c.G877A						PASS	.	G	LYS/GLU,LYS/GLU	2790,932		1038,714,109	106.0	114.0	111.0		730,877	3.9	0.9	3	dbSNP_87	111	2786,5410		485,1816,1797	yes	missense,missense	TTC21A	NM_001105513.2,NM_145755.2	56,56	1523,2530,1906	AA,AG,GG		33.9922,25.0403,46.7864	benign,benign	244/1273,293/1321	39161464	5576,6342	1861	4098	5959	SO:0001583	missense	199223	exon8			GAACCCGAAAATC	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.877G>A	3.37:g.39161464G>A	ENSP00000398211:p.Glu293Lys	Somatic	226	0	0		WXS	Illumina HiSeq	Phase_I	186	9	0.0483871	NM_145755	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	ENST00000431162.2	37	CCDS46800.1	959	0.4391025641025641	410	0.8333333333333334	133	0.3674033149171271	166	0.2902097902097902	250	0.32981530343007914	G	11.56	1.675769	0.29783	0.749597	0.339922	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.56941	0.43;0.43;2.34	5.67	3.86	0.44501	.	0.701416	0.13630	N	0.373771	T	0.00012	0.0000	N	0.02916	-0.46	0.47094	P	6.859999999999644E-4	B;B;B	0.27498	0.01;0.18;0.113	B;B;B	0.16722	0.004;0.016;0.007	T	0.39781	-0.9597	9	0.02654	T	1	-0.0123	15.4035	0.74861	0.0:0.7314:0.2686:0.0	rs1274971;rs17735053;rs57380373;rs1274971	244;293;293	Q8NDW8-6;Q8NDW8-7;Q8NDW8	.;.;TT21A_HUMAN	K	293;285;293;244	ENSP00000301819:E293K;ENSP00000398211:E293K;ENSP00000410882:E244K	ENSP00000301819:E293K	E	+	1	0	TTC21A	39136468	0.956000	0.32656	0.881000	0.34555	0.486000	0.33341	1.922000	0.40045	0.746000	0.32786	-0.147000	0.13772	GAA	G|0.552;A|0.448	0.448	strong		0.443	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755	
PFN1	5216	hgsc.bcm.edu	37	17	4851557	4851557	+	Splice_Site	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:4851557C>T	ENST00000225655.5	-	1	752		c.e1+1		ENO3_ENST00000323997.6_5'Flank|ENO3_ENST00000519584.1_5'Flank|PFN1_ENST00000574872.1_5'Flank	NM_005022.3	NP_005013.1	P07737	PROF1_HUMAN	profilin 1						actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cell death (GO:0008219)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of ATPase activity (GO:0032781)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of ruffle assembly (GO:1900029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	actin binding (GO:0003779)|adenyl-nucleotide exchange factor activity (GO:0000774)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|proline-rich region binding (GO:0070064)			NS(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5						CCTCGCAGTACCGTGATGTTG	0.706																																					.		Atlas-SNP	.											.	PFN1	6	.	0			c.132+1G>A						PASS	.						50.0	46.0	48.0					17																	4851557		2203	4300	6503	SO:0001630	splice_region_variant	5216	exon2			GCAGTACCGTGAT	BC057828	CCDS11061.1	17p13.2	2010-07-09			ENSG00000108518	ENSG00000108518			8881	protein-coding gene	gene with protein product		176610				3356709, 1968707	Standard	NM_005022		Approved		uc002gaa.4	P07737	OTTHUMG00000099396	ENST00000225655.5:c.132+1G>A	17.37:g.4851557C>T		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	23	10	0.434783	NM_005022	Q53Y44	Splice_Site	SNP	ENST00000225655.5	37	CCDS11061.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986323	0.74589	.	.	ENSG00000108518	ENST00000225655	.	.	.	3.79	3.79	0.43588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1965	0.59740	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PFN1	4792302	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.338000	0.59316	1.953000	0.56701	0.563000	0.77884	.	.	.	none		0.706	PFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216853.1	NM_005022	Intron
CDH12	1010	hgsc.bcm.edu	37	5	21752056	21752056	+	Silent	SNP	A	A	G	rs6451993	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:21752056A>G	ENST00000382254.1	-	15	3261	c.2175T>C	c.(2173-2175)gaT>gaC	p.D725D	RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000504376.2_Silent_p.D725D|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Silent_p.D685D	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	725					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D725D(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TTGGATCCACATCATTTTCCT	0.478										HNSCC(59;0.17)			A|||	2750	0.549121	0.3775	0.6282	5008	,	,		16061	0.4365		0.7485	False		,,,				2504	0.636				p.D725D		Atlas-SNP	.											CDH12,NS,carcinoma,0,1	CDH12	238	1	1	Substitution - coding silent(1)	stomach(1)	c.T2175C						scavenged	.	A		2000,2406	560.5+/-380.5	451,1098,654	257.0	218.0	231.0		2175	-7.7	0.0	5	dbSNP_116	231	6333,2267	708.1+/-405.6	2338,1657,305	no	coding-synonymous	CDH12	NM_004061.3		2789,2755,959	GG,GA,AA		26.3605,45.3926,35.9296		725/795	21752056	8333,4673	2203	4300	6503	SO:0001819	synonymous_variant	1010	exon15			ATCCACATCATTT	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2175T>C	5.37:g.21752056A>G		Somatic	180	1	0.00555556		WXS	Illumina HiSeq	Phase_I	202	7	0.0346535	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	ENST00000382254.1	37	CCDS3890.1																																																																																			A|0.402;G|0.598	0.598	strong		0.478	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
TMEM171	134285	hgsc.bcm.edu	37	5	72419267	72419267	+	Missense_Mutation	SNP	T	T	C	rs638333	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:72419267T>C	ENST00000454765.2	+	2	540	c.67T>C	c.(67-69)Ttc>Ctc	p.F23L	TMEM171_ENST00000287773.5_Missense_Mutation_p.F23L			Q8WVE6	TM171_HUMAN	transmembrane protein 171	23			F -> L (in dbSNP:rs638333). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)	15		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)		CAAACTCATCTTCTGCTTCTT	0.592													T|||	846	0.16893	0.0855	0.3458	5008	,	,		18441	0.0962		0.2883	False		,,,				2504	0.1084				p.F23L	NSCLC(112;638 2280 27369 30736)	Atlas-SNP	.											.	TMEM171	41	.	0			c.T67C						PASS	.	T	LEU/PHE,LEU/PHE	512,3894	235.2+/-247.8	35,442,1726	124.0	117.0	120.0		67,67	5.1	1.0	5	dbSNP_83	120	2437,6163	404.7+/-348.2	336,1765,2199	yes	missense,missense	TMEM171	NM_001161342.1,NM_173490.6	22,22	371,2207,3925	CC,CT,TT		28.3372,11.6205,22.6742	probably-damaging,probably-damaging	23/324,23/325	72419267	2949,10057	2203	4300	6503	SO:0001583	missense	134285	exon2			CTCATCTTCTGCT	BC018083	CCDS4017.1, CCDS54869.1	5q13.2	2008-02-05			ENSG00000157111	ENSG00000157111			27031	protein-coding gene	gene with protein product						12477932	Standard	NM_173490		Approved	PRP2	uc003kcm.2	Q8WVE6	OTTHUMG00000131269	ENST00000454765.2:c.67T>C	5.37:g.72419267T>C	ENSP00000415030:p.Phe23Leu	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	78	5	0.0641026	NM_173490	Q8N0S1|Q8TDT7	Missense_Mutation	SNP	ENST00000454765.2	37	CCDS4017.1	456	0.2087912087912088	47	0.09552845528455285	122	0.3370165745856354	67	0.11713286713286714	220	0.29023746701846964	T	22.2	4.257271	0.80246	0.116205	0.283372	ENSG00000157111	ENST00000454765;ENST00000287773	T;T	0.34072	1.38;1.38	5.09	5.09	0.68999	.	0.074689	0.56097	N	0.000028	T	0.00012	0.0000	M	0.76002	2.32	0.23933	P	0.99642717	B;B	0.23540	0.087;0.087	B;B	0.19946	0.027;0.027	T	0.19943	-1.0290	9	0.66056	D	0.02	-23.8583	14.8705	0.70453	0.0:0.0:0.0:1.0	rs638333;rs17851615;rs59015469;rs638333	23;23	Q8WVE6-2;Q8WVE6	.;TM171_HUMAN	L	23	ENSP00000415030:F23L;ENSP00000287773:F23L	ENSP00000287773:F23L	F	+	1	0	TMEM171	72455023	1.000000	0.71417	0.990000	0.47175	0.720000	0.41350	5.398000	0.66308	1.922000	0.55676	0.379000	0.24179	TTC	T|0.791;C|0.209	0.209	strong		0.592	TMEM171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254037.2	NM_173490	
SHROOM1	134549	hgsc.bcm.edu	37	5	132159134	132159134	+	Silent	SNP	C	C	T	rs4705870	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:132159134C>T	ENST00000378679.3	-	9	2838	c.2034G>A	c.(2032-2034)gcG>gcA	p.A678A	SHROOM1_ENST00000488072.1_5'UTR|SHROOM1_ENST00000378676.1_Silent_p.A609A|SHROOM1_ENST00000319854.3_Silent_p.A678A	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	678	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCCTGGCCCACGCTTGTGCCT	0.682													C|||	557	0.111222	0.053	0.085	5008	,	,		14199	0.1171		0.1262	False		,,,				2504	0.1871				p.A678A		Atlas-SNP	.											.	SHROOM1	35	.	0			c.G2034A						PASS	.	C	,	255,4131		9,237,1947	16.0	20.0	19.0		2034,2034	-9.5	0.0	5	dbSNP_111	19	1207,7361		90,1027,3167	no	coding-synonymous,coding-synonymous	SHROOM1	NM_001172700.1,NM_133456.2	,	99,1264,5114	TT,TC,CC		14.0873,5.814,11.2861	,	678/853,678/848	132159134	1462,11492	2193	4284	6477	SO:0001819	synonymous_variant	134549	exon6			GGCCCACGCTTGT	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.2034G>A	5.37:g.132159134C>T		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	66	5	0.0757576	NM_133456	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Silent	SNP	ENST00000378679.3	37	CCDS54902.1																																																																																			C|0.888;T|0.112	0.112	strong		0.682	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1	NM_133456	
MST1L	11223	hgsc.bcm.edu	37	1	17083782	17083782	+	RNA	SNP	A	A	C	rs200844502	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:17083782A>C	ENST00000455405.2	-	0	806							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										GACACGCGTGAAGACGGCTGG	0.542																																					p.F672C		Atlas-SNP	.											Q13209_HUMAN,NS,carcinoma,0,2	.	.	2	0			c.T2015G						scavenged	.																																					11223	exon15			CGCGTGAAGACGG	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083782A>C		Somatic	354	1	0.00282486		WXS	Illumina HiSeq	Phase_I	310	9	0.0290323	NM_001271733	B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37		.	.	.	.	.	.	.	.	.	.	.	12.47	1.948793	0.34377	.	.	ENSG00000186715	ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.44483	D	0.000459	T	0.65333	0.2681	.	.	.	.	.	.	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.69903	-0.5019	6	0.87932	D	0	.	5.2253	0.15391	0.9998:0.0:2.0E-4:0.0	.	672;698	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	C	672;698	.	ENSP00000439273:F672C	F	-	2	0	MST1P9	16956369	1.000000	0.71417	0.928000	0.36995	0.000000	0.00434	3.843000	0.55865	0.419000	0.25927	0.000000	0.15137	TTC	A|0.972;C|0.029	0.029	strong		0.542	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733	
KRT6A	3853	hgsc.bcm.edu	37	12	52885485	52885485	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:52885485T>G	ENST00000330722.6	-	2	644	c.576A>C	c.(574-576)gaA>gaC	p.E192D		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	192	Coil 1A.|Rod.			E -> D (in Ref. 1; AAB60696). {ECO:0000305}.	cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCACTTTGTTTCCAGAACCT	0.532																																					p.E192D		Atlas-SNP	.											KRT6A,NS,haematopoietic_neoplasm,0,1	KRT6A	89	1	0			c.A576C						scavenged	.						66.0	67.0	67.0					12																	52885485		2203	4300	6503	SO:0001583	missense	3853	exon2			CTTTGTTTCCAGA	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.576A>C	12.37:g.52885485T>G	ENSP00000369317:p.Glu192Asp	Somatic	129	1	0.00775194		WXS	Illumina HiSeq	Phase_I	136	4	0.0294118	NM_005554	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	t	15.33	2.801841	0.50315	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	T	0.78595	-1.19	5.26	-1.41	0.08941	Filament (1);	0.298035	0.28414	N	0.015426	T	0.76772	0.4034	M	0.92555	3.32	0.31174	N	0.70282	B	0.24651	0.108	B	0.31016	0.123	T	0.68059	-0.5509	10	0.40728	T	0.16	.	2.0814	0.03635	0.1319:0.2762:0.2398:0.352	.	192	P02538	K2C6A_HUMAN	D	192;148	ENSP00000369317:E192D	ENSP00000369317:E192D	E	-	3	2	KRT6A	51171752	0.999000	0.42202	0.994000	0.49952	0.965000	0.64279	0.625000	0.24477	-0.197000	0.10350	-0.302000	0.09304	GAA	.	.	none		0.532	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
ZNF485	220992	hgsc.bcm.edu	37	10	44112245	44112245	+	Missense_Mutation	SNP	G	G	A	rs12354886	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:44112245G>A	ENST00000361807.3	+	5	948	c.754G>A	c.(754-756)Gct>Act	p.A252T	ZNF485_ENST00000374435.3_Missense_Mutation_p.A252T|ZNF485_ENST00000374437.2_Missense_Mutation_p.A161T	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	252			A -> T (in dbSNP:rs12354886).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						GAAAGCCTTCGCTCAGAATGC	0.393													G|||	926	0.184904	0.2943	0.2133	5008	,	,		21170	0.003		0.2177	False		,,,				2504	0.1708				p.A252T		Atlas-SNP	.											.	ZNF485	102	.	0			c.G754A						PASS	.	G	THR/ALA	1183,3223	413.7+/-336.6	169,845,1189	70.0	74.0	73.0		754	0.5	0.0	10	dbSNP_120	73	1995,6605	348.3+/-327.0	222,1551,2527	yes	missense	ZNF485	NM_145312.3	58	391,2396,3716	AA,AG,GG		23.1977,26.8498,24.4349	benign	252/442	44112245	3178,9828	2203	4300	6503	SO:0001583	missense	220992	exon5			GCCTTCGCTCAGA	AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.754G>A	10.37:g.44112245G>A	ENSP00000354694:p.Ala252Thr	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	105	5	0.047619	NM_145312	B4DSE6|Q96CL0	Missense_Mutation	SNP	ENST00000361807.3	37	CCDS7205.2	366	0.16758241758241757	136	0.2764227642276423	77	0.212707182320442	0	0.0	153	0.20184696569920843	G	0.238	-1.015652	0.02078	0.268498	0.231977	ENSG00000198298	ENST00000361807;ENST00000374437;ENST00000374435	T;T;T	0.07567	3.18;3.18;3.18	2.46	0.496	0.16896	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00012	0.0000	N	0.04655	-0.195	0.80722	P	0.0	B	0.06786	0.001	B	0.13407	0.009	T	0.47699	-0.9097	8	0.10902	T	0.67	.	2.3447	0.04269	0.2826:0.0:0.4752:0.2422	rs12354886;rs52806454;rs59867017;rs12354886	252	Q8NCK3	ZN485_HUMAN	T	252;161;252	ENSP00000354694:A252T;ENSP00000363560:A161T;ENSP00000363558:A252T	ENSP00000354694:A252T	A	+	1	0	ZNF485	43432251	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.058000	0.11750	0.119000	0.18210	-0.521000	0.04368	GCT	G|0.786;A|0.214	0.214	strong		0.393	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047719.2	NM_145312	
PDE4C	5143	hgsc.bcm.edu	37	19	18329240	18329240	+	Silent	SNP	T	T	C	rs1042050	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:18329240T>C	ENST00000355502.3	-	14	2005	c.1134A>G	c.(1132-1134)gaA>gaG	p.E378E	PDE4C_ENST00000597297.1_Silent_p.E148E|PDE4C_ENST00000598111.2_Intron|PDE4C_ENST00000594465.3_Silent_p.E378E|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000594617.3_Silent_p.E378E|PDE4C_ENST00000447275.3_Silent_p.E272E|PDE4C_ENST00000262805.12_Silent_p.E346E|PDE4C_ENST00000539010.1_Silent_p.E147E			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	378					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)	p.E378>?(1)|p.E378E(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GGTAGTGACCTTCCAGCATCA	0.622													C|||	2103	0.419928	0.4516	0.5461	5008	,	,		18861	0.1687		0.6501	False		,,,				2504	0.3098				p.E378E		Atlas-SNP	.											PDE4C,NS,carcinoma,0,1	PDE4C	80	1	2	Complex(1)|Substitution - coding silent(1)	large_intestine(1)|stomach(1)	c.A1134G						PASS	.	C	,,	2088,2318	604.5+/-390.4	490,1108,605	161.0	155.0	157.0		1134,1038,816	1.4	0.1	19	dbSNP_86	157	5315,3285	491.7+/-373.1	1657,2001,642	no	coding-synonymous,coding-synonymous,coding-synonymous	PDE4C	NM_000923.4,NM_001098818.2,NM_001098819.2	,,	2147,3109,1247	CC,CT,TT		38.1977,47.3899,43.0801	,,	378/713,346/681,272/607	18329240	7403,5603	2203	4300	6503	SO:0001819	synonymous_variant	5143	exon11			GTGACCTTCCAGC		CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1134A>G	19.37:g.18329240T>C		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	83	5	0.060241	NM_000923	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Silent	SNP	ENST00000355502.3	37	CCDS12373.1																																																																																			T|0.483;C|0.517	0.517	strong		0.622	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1		
AMBN	258	hgsc.bcm.edu	37	4	71468348	71468348	+	Missense_Mutation	SNP	G	G	T	rs368655454|rs141384720|rs199556863	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:71468348G>T	ENST00000322937.6	+	7	642	c.539G>T	c.(538-540)gGa>gTa	p.G180V	AMBN_ENST00000449493.2_Missense_Mutation_p.G165V	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	180				G -> R (in Ref. 3; AAG35772 and 4; AAG27036). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			TAGCTCCCAGGAGTAGATTTT	0.264																																					p.G180V		Atlas-SNP	.											.	AMBN	73	.	0			c.G539T						PASS	.						42.0	49.0	47.0					4																	71468348		2161	4276	6437	SO:0001583	missense	258	exon7			TCCCAGGAGTAGA	AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.539G>T	4.37:g.71468348G>T	ENSP00000313809:p.Gly180Val	Somatic	303	0	0		WXS	Illumina HiSeq	Phase_I	381	17	0.0446194	NM_016519	Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	ENST00000322937.6	37	CCDS3543.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.097|0.097	-1.157535|-1.157535	0.01686|0.01686	.|.	.|.	ENSG00000178522|ENSG00000178522	ENST00000322937;ENST00000449493|ENST00000538728	T;T|.	0.27890|.	1.64;1.64|.	3.34|3.34	-2.84|-2.84	0.05751|0.05751	.|.	2.543920|.	0.02234|.	U|.	0.065161|.	T|T	0.18002|0.18002	0.0432|0.0432	N|N	0.22421|0.22421	0.69|0.69	0.19575|0.19575	N|N	0.999964|0.999964	B|.	0.17268|.	0.021|.	B|.	0.12837|.	0.008|.	T|T	0.24190|0.24190	-1.0167|-1.0167	10|6	0.22706|0.29301	T|T	0.39|0.29	.|.	0.3396|0.3396	0.00331|0.00331	0.3712:0.1546:0.2472:0.227|0.3712:0.1546:0.2472:0.227	.|.	180|.	Q9NP70|.	AMBN_HUMAN|.	V|L	180;165|179	ENSP00000313809:G180V;ENSP00000391234:G165V|.	ENSP00000313809:G180V|ENSP00000445605:R179L	G|R	+|+	2|2	0|0	AMBN|AMBN	71502937|71502937	0.095000|0.095000	0.21747|0.21747	0.002000|0.002000	0.10522|0.10522	0.194000|0.194000	0.23727|0.23727	-0.066000|-0.066000	0.11598|0.11598	-0.545000|-0.545000	0.06224|0.06224	0.305000|0.305000	0.20034|0.20034	GGA|CGA	.	.	weak		0.264	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252165.1	NM_016519	
ANXA10	11199	hgsc.bcm.edu	37	4	169086441	169086441	+	Silent	SNP	A	A	G	rs4405979	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:169086441A>G	ENST00000359299.3	+	6	630	c.444A>G	c.(442-444)tcA>tcG	p.S148S		NM_007193.4	NP_009124.2	Q9UJ72	ANX10_HUMAN	annexin A10	148						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.S148S(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(2)	16		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)		CAGAGACCTCAGGACACTTCA	0.343													G|||	2669	0.532947	0.7443	0.4697	5008	,	,		15966	0.2421		0.5934	False		,,,				2504	0.5297				p.S148S		Atlas-SNP	.											ANXA10,NS,carcinoma,0,1	ANXA10	44	1	1	Substitution - coding silent(1)	stomach(1)	c.A444G						scavenged	.	G		3148,1258	427.6+/-341.6	1135,878,190	80.0	83.0	82.0		444	-10.5	0.7	4	dbSNP_111	82	5018,3580	518.1+/-379.2	1469,2080,750	no	coding-synonymous	ANXA10	NM_007193.4		2604,2958,940	GG,GA,AA		41.6376,28.552,37.2039		148/325	169086441	8166,4838	2203	4299	6502	SO:0001819	synonymous_variant	11199	exon6			GACCTCAGGACAC	AJ238979	CCDS34096.1	4q32.3	2008-02-05			ENSG00000109511	ENSG00000109511		"""Annexins"""	534	protein-coding gene	gene with protein product		608008				10458909	Standard	NM_007193		Approved	ANX14	uc003irm.3	Q9UJ72	OTTHUMG00000161275	ENST00000359299.3:c.444A>G	4.37:g.169086441A>G		Somatic	263	0	0		WXS	Illumina HiSeq	Phase_I	223	6	0.0269058	NM_007193	Q96IQ5|Q9UJV4	Silent	SNP	ENST00000359299.3	37	CCDS34096.1																																																																																			A|0.421;G|0.579	0.579	strong		0.343	ANXA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364348.2	NM_007193	
B4GALNT4	338707	hgsc.bcm.edu	37	11	372700	372700	+	Silent	SNP	G	G	C	rs35475866	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:372700G>C	ENST00000329962.6	+	3	294	c.294G>C	c.(292-294)ggG>ggC	p.G98G		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	98					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTCCTGGGGGGGCTGGGAGGC	0.647													.|||	1656	0.330671	0.3253	0.2997	5008	,	,		10061	0.3839		0.2952	False		,,,				2504	0.3415				p.G98G		Atlas-SNP	.											B4GALNT4,rectum,carcinoma,0,1	B4GALNT4	83	1	0			c.G294C						PASS	.	G		1430,2946		245,940,1003	18.0	21.0	20.0		294	-1.3	0.0	11	dbSNP_126	20	2375,6187		331,1713,2237	no	coding-synonymous	B4GALNT4	NM_178537.4		576,2653,3240	CC,CG,GG		27.7388,32.6782,29.4095		98/1040	372700	3805,9133	2188	4281	6469	SO:0001819	synonymous_variant	338707	exon3			TGGGGGGGCTGGG	AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.294G>C	11.37:g.372700G>C		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	41	5	0.121951	NM_178537	Q96LV2	Silent	SNP	ENST00000329962.6	37	CCDS7694.1																																																																																			G|0.714;C|0.286	0.286	strong		0.647	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239289.2	NM_178537	
AMACR	23600	hgsc.bcm.edu	37	5	34004707	34004707	+	Missense_Mutation	SNP	C	C	T	rs10941112	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:34004707C>T	ENST00000335606.6	-	3	612	c.524G>A	c.(523-525)gGc>gAc	p.G175D	AMACR_ENST00000502637.1_Missense_Mutation_p.G175D|AMACR_ENST00000512079.1_Missense_Mutation_p.G175D|AMACR_ENST00000382085.3_Missense_Mutation_p.G175D|AMACR_ENST00000441713.2_Intron|AMACR_ENST00000382072.2_Intron|AMACR_ENST00000382068.3_Intron|AMACR_ENST00000426255.2_Missense_Mutation_p.G175D|AMACR_ENST00000514195.1_Intron|RP11-1084J3.4_ENST00000382079.3_Intron	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	175			G -> D (in dbSNP:rs10941112). {ECO:0000269|PubMed:11060344, ECO:0000269|Ref.4}.		bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						CTGACCCTTGCCAGTGCGTGT	0.458													C|||	1265	0.252596	0.0242	0.4006	5008	,	,		16552	0.3472		0.504	False		,,,				2504	0.1002				p.G175D		Atlas-SNP	.											.	AMACR	38	.	0			c.G524A						PASS	.	C	ASP/GLY,ASP/GLY,	483,3923	227.2+/-242.5	32,419,1752	151.0	133.0	139.0		524,524,	5.9	1.0	5	dbSNP_120	139	4514,4086	593.3+/-393.1	1170,2174,956	yes	missense,missense,intron	AMACR	NM_001167595.1,NM_014324.5,NM_203382.2	94,94,	1202,2593,2708	TT,TC,CC		47.5116,10.9623,38.4207	probably-damaging,probably-damaging,	175/395,175/383,	34004707	4997,8009	2203	4300	6503	SO:0001583	missense	23600	exon3			CCCTTGCCAGTGC	AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.524G>A	5.37:g.34004707C>T	ENSP00000334424:p.Gly175Asp	Somatic	345	0	0		WXS	Illumina HiSeq	Phase_I	324	15	0.0462963	NM_014324	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Missense_Mutation	SNP	ENST00000335606.6	37	CCDS3902.1	768	0.3516483516483517	16	0.032520325203252036	160	0.4419889502762431	202	0.3531468531468531	390	0.5145118733509235	C	35	5.477865	0.96291	0.109623	0.524884	ENSG00000242110	ENST00000335606;ENST00000382085;ENST00000502637	T;T;T	0.72505	-0.66;-0.66;-0.66	5.92	5.92	0.95590	CoA-transferase family III domain (2);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	H	0.98786	4.33	0.09310	P	1.0	P;P;P	0.50066	0.915;0.931;0.931	P;P;P	0.56434	0.622;0.798;0.798	T	0.25950	-1.0117	9	0.56958	D	0.05	-21.7172	20.3206	0.98668	0.0:1.0:0.0:0.0	rs10941112;rs52822382;rs59795499;rs10941112	175;175;175	F8W9N1;D6RB81;Q9UHK6	.;.;AMACR_HUMAN	D	175	ENSP00000334424:G175D;ENSP00000371517:G175D;ENSP00000424351:G175D	ENSP00000334424:G175D	G	-	2	0	AMACR	34040464	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.414000	0.59802	2.809000	0.96659	0.655000	0.94253	GGC	C|0.655;T|0.345	0.345	strong		0.458	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207467.1	NM_014324	
ABCA7	10347	hgsc.bcm.edu	37	19	1046827	1046827	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:1046827T>C	ENST00000263094.6	+	14	1880	c.1649T>C	c.(1648-1650)cTg>cCg	p.L550P	ABCA7_ENST00000435683.2_Missense_Mutation_p.L412P|ABCA7_ENST00000533574.1_Intron|ABCA7_ENST00000433129.1_Missense_Mutation_p.L550P	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	550					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCCGGTCGCTGCCGCTCTTC	0.697																																					p.L550P		Atlas-SNP	.											.	ABCA7	174	.	0			c.T1649C						PASS	.						18.0	16.0	17.0					19																	1046827		2119	4178	6297	SO:0001583	missense	10347	exon14			GGTCGCTGCCGCT	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1649T>C	19.37:g.1046827T>C	ENSP00000263094:p.Leu550Pro	Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	23	6	0.26087	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	t	24.2	4.506096	0.85282	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.89270	-2.49;-2.49	5.06	5.06	0.68205	.	.	.	.	.	D	0.94988	0.8378	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.992	D	0.95706	0.8753	9	0.87932	D	0	.	12.7496	0.57300	0.0:0.0:0.0:1.0	.	412;550	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	P	550	ENSP00000263094:L550P;ENSP00000414062:L550P	ENSP00000263094:L550P	L	+	2	0	ABCA7	997827	1.000000	0.71417	0.999000	0.59377	0.857000	0.48899	7.824000	0.86668	1.915000	0.55452	0.454000	0.30748	CTG	.	.	none		0.697	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
SNX13	23161	hgsc.bcm.edu	37	7	17879484	17879484	+	Silent	SNP	T	T	C	rs35507251	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:17879484T>C	ENST00000409389.1	-	13	1477	c.1305A>G	c.(1303-1305)aaA>aaG	p.K435K	SNX13_ENST00000428135.3_Silent_p.K435K			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	435	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TTAAAAGACCTTTGGTTTGGT	0.383													T|||	103	0.0205671	0.0038	0.0216	5008	,	,		17621	0.0		0.0368	False		,,,				2504	0.047				p.K435K		Atlas-SNP	.											.	SNX13	113	.	0			c.A1305G						PASS	.	T		12,3694		0,12,1841	149.0	136.0	140.0		1305	5.2	1.0	7	dbSNP_126	140	202,7994		5,192,3901	no	coding-synonymous	SNX13	NM_015132.4		5,204,5742	CC,CT,TT		2.4646,0.3238,1.798		435/958	17879484	214,11688	1853	4098	5951	SO:0001819	synonymous_variant	23161	exon13			AAGACCTTTGGTT	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.1305A>G	7.37:g.17879484T>C		Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	119	5	0.0420168	NM_015132	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Silent	SNP	ENST00000409389.1	37																																																																																				T|0.975;C|0.025	0.025	strong		0.383	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132	
SEMA3C	10512	hgsc.bcm.edu	37	7	80433481	80433481	+	Missense_Mutation	SNP	G	G	T	rs143347984		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:80433481G>T	ENST00000265361.3	-	8	1303	c.742C>A	c.(742-744)Ctg>Atg	p.L248M	SEMA3C_ENST00000544525.1_Missense_Mutation_p.L266M|SEMA3C_ENST00000419255.2_Missense_Mutation_p.L248M|SEMA3C_ENST00000536800.1_Missense_Mutation_p.L100M	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	248	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TTGTCAGTCAGTTTTTCTTTG	0.368																																					p.L248M		Atlas-SNP	.											.	SEMA3C	106	.	0			c.C742A						PASS	.	G	MET/LEU	0,4406		0,0,2203	160.0	150.0	153.0		742	3.7	1.0	7	dbSNP_134	153	1,8599	1.2+/-3.3	0,1,4299	no	missense	SEMA3C	NM_006379.3	15	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign	248/752	80433481	1,13005	2203	4300	6503	SO:0001583	missense	10512	exon8			CAGTCAGTTTTTC	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.742C>A	7.37:g.80433481G>T	ENSP00000265361:p.Leu248Met	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	147	48	0.326531	NM_006379	B4DRL8	Missense_Mutation	SNP	ENST00000265361.3	37	CCDS5596.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437638	0.43224	0.0	1.16E-4	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525;ENST00000536800	T;T;T;T	0.10860	2.83;2.83;2.83;2.83	5.62	3.68	0.42216	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.064498	0.64402	D	0.000005	T	0.11452	0.0279	L	0.51422	1.61	0.52099	D	0.999948	B;B;B	0.16396	0.017;0.008;0.01	B;B;B	0.25614	0.016;0.037;0.062	T	0.05533	-1.0879	10	0.72032	D	0.01	.	7.7762	0.29039	0.1417:0.0:0.7252:0.1332	.	100;266;248	B4DRL8;F5H1Z7;Q99985	.;.;SEM3C_HUMAN	M	248;248;266;100	ENSP00000265361:L248M;ENSP00000411193:L248M;ENSP00000445649:L266M;ENSP00000438258:L100M	ENSP00000265361:L248M	L	-	1	2	SEMA3C	80271417	1.000000	0.71417	0.999000	0.59377	0.861000	0.49209	3.527000	0.53517	1.334000	0.45468	0.585000	0.79938	CTG	G|1.000;T|0.000	0.000	weak		0.368	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1	NM_006379	
AKR1B15	441282	hgsc.bcm.edu	37	7	134264286	134264286	+	Silent	SNP	C	C	T	rs6467538	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:134264286C>T	ENST00000457545.2	+	12	1280	c.1020C>T	c.(1018-1020)ttC>ttT	p.F340F	AKR1B15_ENST00000423958.1_Silent_p.F312F	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	340							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						ACTTTCCCTTCGATGCAGAAT	0.408													C|||	1681	0.335663	0.559	0.3084	5008	,	,		20009	0.1438		0.339	False		,,,				2504	0.2474				p.F340F		Atlas-SNP	.											.	AKR1B15	105	.	0			c.C1020T						PASS	.	C		2235,2169	554.5+/-379.0	576,1083,543	87.0	88.0	87.0		1020	-1.6	0.0	7	dbSNP_116	87	2959,5641	449.5+/-362.1	520,1919,1861	no	coding-synonymous	AKR1B15	NM_001080538.2		1096,3002,2404	TT,TC,CC		34.407,49.2507,39.9416		340/345	134264286	5194,7810	2202	4300	6502	SO:0001819	synonymous_variant	441282	exon12			TCCCTTCGATGCA		CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.1020C>T	7.37:g.134264286C>T		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	77	8	0.103896	NM_001080538	C9J3V2	Silent	SNP	ENST00000457545.2	37	CCDS47715.2																																																																																			C|0.651;T|0.349	0.349	strong		0.408	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2		
ZNF286B	729288	hgsc.bcm.edu	37	17	18565423	18565423	+	Missense_Mutation	SNP	G	G	A	rs9912852	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:18565423G>A	ENST00000545289.1	-	5	1646	c.1396C>T	c.(1396-1398)Ccg>Tcg	p.P466S	ZNF286B_ENST00000285274.5_3'UTR	NM_001145045.1	NP_001138517.1	P0CG31	Z286B_HUMAN	zinc finger protein 286B	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(1)	2						CATTTGTACGGTTTCTTTCCA	0.393													.|||	1375	0.274561	0.2027	0.4496	5008	,	,		22033	0.1935		0.4066	False		,,,				2504	0.1953				p.P466S		Atlas-SNP	.											ZNF286B_ENST00000545289,colon,carcinoma,+2,2	ZNF286B	75	2	0			c.C1396T						scavenged	.	G	SER/PRO	333,1051		41,251,400	137.0	131.0	133.0		1396	2.6	1.0	17	dbSNP_119	133	1243,1939		237,769,585	no	missense	ZNF286B	NM_001145045.1	74	278,1020,985	AA,AG,GG		39.0635,24.0607,34.516	probably-damaging	466/523	18565423	1576,2990	692	1591	2283	SO:0001583	missense	729288	exon5			TGTACGGTTTCTT		CCDS58523.1	17p11.2	2013-01-08			ENSG00000249459	ENSG00000249459		"""Zinc fingers, C2H2-type"""	33241	protein-coding gene	gene with protein product	"""zinc finger protein 590"""		"""zinc finger protein 286-like"", ""zinc finger 286C pseudogene"""	ZNF286L, ZNF286C			Standard	NM_001145045		Approved	ZNF590	uc010vyd.1	P0CG31	OTTHUMG00000178136	ENST00000545289.1:c.1396C>T	17.37:g.18565423G>A	ENSP00000461413:p.Pro466Ser	Somatic	211	0	0		WXS	Illumina HiSeq	Phase_I	215	5	0.0232558	NM_001145045		Missense_Mutation	SNP	ENST00000545289.1	37	CCDS58523.1																																																																																			G|0.698;A|0.302	0.302	strong		0.393	ZNF286B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_001723047	
INO80D	54891	hgsc.bcm.edu	37	2	206882530	206882530	+	Silent	SNP	G	G	C	rs41272653	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:206882530G>C	ENST00000403263.1	-	8	1820	c.1416C>G	c.(1414-1416)ctC>ctG	p.L472L		NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	472					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						AGTGGTTCAAGAGGATATCTG	0.373													G|||	125	0.0249601	0.0038	0.0202	5008	,	,		16770	0.0308		0.0239	False		,,,				2504	0.0521				p.L472L		Atlas-SNP	.											.	INO80D	134	.	0			c.C1416G						PASS	.	G		29,3673		0,29,1822	110.0	109.0	109.0		1416	3.5	1.0	2	dbSNP_127	109	267,7951		0,267,3842	no	coding-synonymous	INO80D	NM_017759.4		0,296,5664	CC,CG,GG		3.249,0.7834,2.4832		472/1028	206882530	296,11624	1851	4109	5960	SO:0001819	synonymous_variant	54891	exon8			GTTCAAGAGGATA		CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.1416C>G	2.37:g.206882530G>C		Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	152	9	0.0592105	NM_017759	B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Silent	SNP	ENST00000403263.1	37	CCDS46500.1																																																																																			G|0.978;C|0.022	0.022	strong		0.373	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336459.1	NM_017759	
PLXNA4	91584	hgsc.bcm.edu	37	7	132070054	132070054	+	Intron	SNP	T	T	C	rs741664	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:132070054T>C	ENST00000359827.3	-	4	2334				PLXNA4_ENST00000423507.2_Splice_Site_p.M458V|PLXNA4_ENST00000321063.4_Intron			Q9HCM2	PLXA4_HUMAN	plexin A4						anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GTACCAGGCATCTGGAAAAGA	0.498													T|||	1277	0.254992	0.0333	0.3112	5008	,	,		18793	0.129		0.5865	False		,,,				2504	0.3037				p.M458V		Atlas-SNP	.											.	PLXNA4	873	.	0			c.A1372G						PASS	.	T	VAL/MET,	427,3411		25,377,1517	61.0	60.0	60.0		1372,	-4.6	0.0	7	dbSNP_86	60	4805,3475		1405,1995,740	yes	missense-near-splice,intron	PLXNA4	NM_001105543.1,NM_020911.1	21,	1430,2372,2257	CC,CT,TT		41.9686,11.1256,43.1754	,	458/493,	132070054	5232,6886	1919	4140	6059	SO:0001627	intron_variant	91584	exon4			CAGGCATCTGGAA	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1372-87073A>G	7.37:g.132070054T>C		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	60	5	0.0833333	NM_001105543	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	661	0.30265567765567764	20	0.04065040650406504	120	0.3314917127071823	82	0.14335664335664336	439	0.579155672823219	T	0.022	-1.413205	0.01145	0.111256	0.580314	ENSG00000221866	ENST00000423507	T	0.02631	4.22	4.38	-4.6	0.03390	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44452	-0.9327	7	0.02654	T	1	.	0.4898	0.00562	0.3174:0.1444:0.3025:0.2357	rs741664;rs17820148;rs60373167;rs741664	458	Q9HCM2-2	.	V	458	ENSP00000392772:M458V	ENSP00000392772:M458V	M	-	1	0	PLXNA4	131720594	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.474000	0.06607	-0.485000	0.06754	0.383000	0.25322	ATG	C|0.318;N|0.000	0.318	strong		0.498	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
SOX17	64321	hgsc.bcm.edu	37	8	55372347	55372347	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:55372347C>T	ENST00000297316.4	+	2	1241	c.1037C>T	c.(1036-1038)aCg>aTg	p.T346M		NM_022454.3	NP_071899.1	Q9H6I2	SOX17_HUMAN	SRY (sex determining region Y)-box 17	346	Gln/Pro-rich.|Sox C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00849}.				angiogenesis (GO:0001525)|canonical Wnt signaling pathway (GO:0060070)|cardiac cell fate determination (GO:0060913)|cardiogenic plate morphogenesis (GO:0003142)|cell migration involved in gastrulation (GO:0042074)|common bile duct development (GO:0061009)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|endoderm formation (GO:0001706)|endodermal cell fate determination (GO:0007493)|endodermal digestive tract morphogenesis (GO:0061031)|gall bladder development (GO:0061010)|heart formation (GO:0060914)|heart looping (GO:0001947)|inner cell mass cellular morphogenesis (GO:0001828)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth (GO:0030308)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell differentiation (GO:0045597)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein destabilization (GO:0031648)|protein stabilization (GO:0050821)|regulation of cardiac cell fate specification (GO:2000043)|regulation of embryonic development (GO:0045995)|regulation of stem cell division (GO:2000035)|regulation of stem cell proliferation (GO:0072091)|regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification (GO:0060807)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|rostrocaudal neural tube patterning (GO:0021903)|signal transduction involved in regulation of gene expression (GO:0023019)|spermatogenesis (GO:0007283)|stem cell fate specification (GO:0048866)|vasculogenesis (GO:0001570)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)	18		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			CGGGACGGCACGGACCCCAGT	0.692																																					p.T346M		Atlas-SNP	.											.	SOX17	37	.	0			c.C1037T						PASS	.						17.0	20.0	19.0					8																	55372347		2201	4297	6498	SO:0001583	missense	64321	exon2			ACGGCACGGACCC	AB073988	CCDS6159.1	8q11.23	2014-09-04			ENSG00000164736	ENSG00000164736		"""SRY (sex determining region Y)-boxes"""	18122	protein-coding gene	gene with protein product		610928				11786926	Standard	NM_022454		Approved		uc003xsb.4	Q9H6I2	OTTHUMG00000164377	ENST00000297316.4:c.1037C>T	8.37:g.55372347C>T	ENSP00000297316:p.Thr346Met	Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	18	9	0.5	NM_022454		Missense_Mutation	SNP	ENST00000297316.4	37	CCDS6159.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.100586	0.37048	.	.	ENSG00000164736	ENST00000297316	T	0.75938	-0.98	4.72	1.31	0.21738	.	0.746294	0.12225	N	0.487973	T	0.52240	0.1722	N	0.14661	0.345	0.27685	N	0.946303	B	0.18310	0.027	B	0.14023	0.01	T	0.41645	-0.9497	10	0.44086	T	0.13	.	3.8408	0.08914	0.0:0.4588:0.2057:0.3356	.	346	Q9H6I2	SOX17_HUMAN	M	346	ENSP00000297316:T346M	ENSP00000297316:T346M	T	+	2	0	SOX17	55534900	0.971000	0.33674	0.666000	0.29783	0.578000	0.36192	1.665000	0.37449	0.392000	0.25172	0.455000	0.32223	ACG	.	.	none		0.692	SOX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378526.2		
RNF123	63891	hgsc.bcm.edu	37	3	49751585	49751585	+	Silent	SNP	C	C	T	rs2291542	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:49751585C>T	ENST00000327697.6	+	31	3132	c.2988C>T	c.(2986-2988)gaC>gaT	p.D996D	RNF123_ENST00000433785.1_Silent_p.D108D	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	996					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		AACTTGAGGACGCCAATTTGC	0.597													C|||	1254	0.250399	0.2519	0.2061	5008	,	,		19901	0.1538		0.3091	False		,,,				2504	0.319				p.D996D		Atlas-SNP	.											RNF123,caecum,carcinoma,0,1	RNF123	100	1	0			c.C2988T						PASS	.	C		1113,3293	399.2+/-331.1	143,827,1233	90.0	90.0	90.0		2988	-4.6	0.9	3	dbSNP_100	90	2588,6012	421.6+/-353.8	391,1806,2103	no	coding-synonymous	RNF123	NM_022064.2		534,2633,3336	TT,TC,CC		30.093,25.261,28.4561		996/1315	49751585	3701,9305	2203	4300	6503	SO:0001819	synonymous_variant	63891	exon31			TGAGGACGCCAAT	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.2988C>T	3.37:g.49751585C>T		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	64	4	0.0625	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Silent	SNP	ENST00000327697.6	37	CCDS33758.1																																																																																			C|0.736;T|0.264	0.264	strong		0.597	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
FREM1	158326	hgsc.bcm.edu	37	9	14846036	14846036	+	Missense_Mutation	SNP	C	C	G	rs2779500	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:14846036C>G	ENST00000380880.3	-	8	2098	c.1315G>C	c.(1315-1317)Gtt>Ctt	p.V439L	FREM1_ENST00000422223.2_Missense_Mutation_p.V439L|FREM1_ENST00000380881.4_Missense_Mutation_p.V440L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	439			V -> L (in dbSNP:rs2779500). {ECO:0000269|PubMed:15878328}.		cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.V440L(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TTGTCGACAACCTGAAACTGT	0.488													C|||	2508	0.500799	0.4576	0.5	5008	,	,		19643	0.2708		0.6233	False		,,,				2504	0.6708				p.V439L		Atlas-SNP	.											FREM1,NS,carcinoma,0,1	FREM1	261	1	1	Substitution - Missense(1)	stomach(1)	c.G1315C						scavenged	.	C	LEU/VAL	2038,2146		517,1004,571	60.0	65.0	63.0		1315	1.0	1.0	9	dbSNP_100	63	5134,3328		1564,2006,661	yes	missense	FREM1	NM_144966.5	32	2081,3010,1232	GG,GC,CC		39.3288,48.7094,43.2864	benign	439/2180	14846036	7172,5474	2092	4231	6323	SO:0001583	missense	158326	exon9			CGACAACCTGAAA	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.1315G>C	9.37:g.14846036C>G	ENSP00000370262:p.Val439Leu	Somatic	170	1	0.00588235		WXS	Illumina HiSeq	Phase_I	178	3	0.0168539	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	1053	0.48214285714285715	219	0.4451219512195122	187	0.5165745856353591	175	0.30594405594405594	472	0.6226912928759895	C	8.581	0.882357	0.17467	0.487094	0.606712	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.42131	0.98;0.98;0.98	4.65	0.988	0.19796	.	0.353172	0.31221	N	0.008034	T	0.00012	0.0000	N	0.25201	0.72	0.32668	P	0.5171399999999999	B	0.15141	0.012	B	0.19391	0.025	T	0.42982	-0.9419	9	0.41790	T	0.15	-6.7469	10.5066	0.44836	0.0:0.2214:0.0:0.7786	rs2779500;rs2779500	439	Q5H8C1	FREM1_HUMAN	L	440;439;439	ENSP00000370263:V440L;ENSP00000412940:V439L;ENSP00000370262:V439L	ENSP00000370257:V442L	V	-	1	0	FREM1	14836036	1.000000	0.71417	0.994000	0.49952	0.112000	0.19704	1.299000	0.33424	-0.017000	0.14103	-1.214000	0.01621	GTT	C|0.496;G|0.504	0.504	strong		0.488	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
SCN3A	6328	hgsc.bcm.edu	37	2	165987772	165987772	+	Silent	SNP	T	T	G	rs62174900	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:165987772T>G	ENST00000360093.3	-	16	3038	c.2547A>C	c.(2545-2547)gtA>gtC	p.V849V	SCN3A_ENST00000409101.3_Silent_p.V800V|SCN3A_ENST00000283254.7_Silent_p.V849V	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	849					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGATCGCAGTACAGACAATC	0.333													T|||	910	0.181709	0.0234	0.1787	5008	,	,		11002	0.2728		0.1968	False		,,,				2504	0.2883				p.V849V		Atlas-SNP	.											.	SCN3A	544	.	0			c.A2547C						PASS	.	T	,,	284,4122	155.9+/-189.0	13,258,1932	103.0	100.0	101.0		2400,2400,2547	-1.7	1.0	2	dbSNP_129	101	1835,6765	328.5+/-318.3	208,1419,2673	no	coding-synonymous,coding-synonymous,coding-synonymous	SCN3A	NM_001081676.1,NM_001081677.1,NM_006922.3	,,	221,1677,4605	GG,GT,TT		21.3372,6.4458,16.2925	,,	800/1952,800/1952,849/2001	165987772	2119,10887	2203	4300	6503	SO:0001819	synonymous_variant	6328	exon16			TCGCAGTACAGAC	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.2547A>C	2.37:g.165987772T>G		Somatic	191	0	0		WXS	Illumina HiSeq	Phase_I	278	16	0.057554	NM_006922	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37																																																																																				T|0.828;G|0.172	0.172	strong		0.333	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
ATG14	22863	hgsc.bcm.edu	37	14	55864130	55864130	+	Silent	SNP	A	A	G	rs8003279	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:55864130A>G	ENST00000247178.5	-	2	279	c.244T>C	c.(244-246)Tta>Cta	p.L82L		NM_014924.4	NP_055739.2	Q6ZNE5	BAKOR_HUMAN	autophagy related 14	82					autophagic vacuole assembly (GO:0000045)|endosome to lysosome transport (GO:0008333)|positive regulation of autophagy (GO:0010508)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|pre-autophagosomal structure membrane (GO:0034045)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(2)	13						AGTCGGCTTAACCTTTCCTTC	0.333													A|||	1045	0.208666	0.1142	0.1902	5008	,	,		21063	0.1617		0.329	False		,,,				2504	0.274				p.L82L		Atlas-SNP	.											.	ATG14	36	.	0			c.T244C						PASS	.	A		657,3747	277.8+/-273.9	45,567,1590	137.0	114.0	122.0		244	2.1	1.0	14	dbSNP_116	122	2762,5836	435.0+/-357.9	469,1824,2006	no	coding-synonymous	ATG14	NM_014924.4		514,2391,3596	GG,GA,AA		32.1237,14.9183,26.296		82/493	55864130	3419,9583	2202	4299	6501	SO:0001819	synonymous_variant	22863	exon2			GGCTTAACCTTTC	AB020638	CCDS32087.1	14q22.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000126775	ENSG00000126775			19962	protein-coding gene	gene with protein product	"""Barkor"", ""beclin 1-associated autophagy-related key regulator"""	613515	"""KIAA0831"", ""ATG14 autophagy related 14 homolog (S. cerevisiae)"""	KIAA0831		18843052	Standard	NM_014924		Approved	ATG14L	uc001xbx.2	Q6ZNE5	OTTHUMG00000172129	ENST00000247178.5:c.244T>C	14.37:g.55864130A>G		Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	128	8	0.0625	NM_014924	A6NJE4|A8K9U5|B7ZWP5|O94920|Q32MK7|Q32MK8	Silent	SNP	ENST00000247178.5	37	CCDS32087.1																																																																																			A|0.760;G|0.240	0.240	strong		0.333	ATG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416992.1	NM_014924	
VEZT	55591	hgsc.bcm.edu	37	12	95660182	95660182	+	Missense_Mutation	SNP	A	A	G	rs17855933	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:95660182A>G	ENST00000436874.1	+	5	589	c.484A>G	c.(484-486)Act>Gct	p.T162A	VEZT_ENST00000261219.6_Missense_Mutation_p.T114A|VEZT_ENST00000356859.4_3'UTR	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein	162			T -> A (in dbSNP:rs17855933).		chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)				endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						TATGCTTCCCACTTGGTGGAT	0.418													A|||	362	0.0722843	0.084	0.0893	5008	,	,		16651	0.001		0.1074	False		,,,				2504	0.0818				p.T162A		Atlas-SNP	.											.	VEZT	106	.	0			c.A484G						PASS	.	A	ALA/THR	283,3519		10,263,1628	295.0	282.0	286.0		484	2.9	1.0	12	dbSNP_123	286	860,7408		46,768,3320	yes	missense	VEZT	NM_017599.3	58	56,1031,4948	GG,GA,AA		10.4015,7.4435,9.4698	possibly-damaging	162/780	95660182	1143,10927	1901	4134	6035	SO:0001583	missense	55591	exon5			CTTCCCACTTGGT	AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.484A>G	12.37:g.95660182A>G	ENSP00000410083:p.Thr162Ala	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	97	5	0.0515464	NM_017599	Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	Missense_Mutation	SNP	ENST00000436874.1	37	CCDS44954.1	153	0.07005494505494506	34	0.06910569105691057	35	0.09668508287292818	1	0.0017482517482517483	83	0.10949868073878628	A	3.498	-0.102452	0.06967	0.074435	0.104015	ENSG00000028203	ENST00000436874;ENST00000549002;ENST00000261219;ENST00000551472;ENST00000546445;ENST00000397792;ENST00000397796	T;T;T;T;T;T	0.45668	0.99;0.94;0.99;0.89;0.94;0.99	5.39	2.88	0.33553	.	0.295485	0.37012	N	0.002285	T	0.00356	0.0011	N	0.12182	0.205	0.35718	P	0.18310700000000002	B;B;B;B	0.09022	0.002;0.001;0.0;0.0	B;B;B;B	0.09377	0.003;0.004;0.003;0.003	T	0.05209	-1.0899	9	0.23891	T	0.37	-14.0809	4.0882	0.09957	0.497:0.0:0.1039:0.3991	rs17855933;rs17855933	162;162;114;114	C9J154;Q9HBM0;F8W8C2;F2Z3A6	.;VEZA_HUMAN;.;.	A	162;132;114;181;84;114;162	ENSP00000410083:T162A;ENSP00000449591:T132A;ENSP00000261219:T114A;ENSP00000449701:T181A;ENSP00000447151:T84A;ENSP00000380894:T114A	ENSP00000261219:T114A	T	+	1	0	VEZT	94184313	0.747000	0.28283	0.991000	0.47740	0.024000	0.10985	1.007000	0.29860	2.023000	0.59567	0.528000	0.53228	ACT	A|0.925;G|0.075	0.075	strong		0.418	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407804.2	NM_017599	
TPO	7173	hgsc.bcm.edu	37	2	1459995	1459995	+	Missense_Mutation	SNP	G	G	A	rs371917329		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:1459995G>A	ENST00000345913.4	+	7	851	c.760G>A	c.(760-762)Ggg>Agg	p.G254R	TPO_ENST00000337415.3_Missense_Mutation_p.G254R|TPO_ENST00000382198.1_Missense_Mutation_p.G254R|TPO_ENST00000382201.3_Missense_Mutation_p.G254R|TPO_ENST00000346956.3_Missense_Mutation_p.G254R|TPO_ENST00000329066.4_Missense_Mutation_p.G254R|TPO_ENST00000497517.2_Intron|TPO_ENST00000349624.3_Missense_Mutation_p.G254R	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	254					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	AGCTGCCTTCGGGGGAGGGGC	0.473													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21539	0.0		0.0	False		,,,				2504	0.0				p.G254R		Atlas-SNP	.											TPO,NS,carcinoma,-2,1	TPO	224	1	0			c.G760A						PASS	.	G	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	80.0	71.0	74.0		760,760,760,760,760,760	-8.7	0.0	2		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	125,125,125,125,125,125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign	254/934,254/934,254/877,254/877,254/890,254/761	1459995	1,13005	2203	4300	6503	SO:0001583	missense	7173	exon7			GCCTTCGGGGGAG		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.760G>A	2.37:g.1459995G>A	ENSP00000318820:p.Gly254Arg	Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	96	36	0.375	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	G	0.071	-1.202813	0.01581	0.0	1.16E-4	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T	0.68025	-0.26;-0.27;-0.23;0.0;-0.27;-0.2;0.0;-0.3	4.81	-8.66	0.00866	.	1.631860	0.02746	N	0.116912	T	0.40473	0.1118	N	0.21142	0.635	0.09310	N	1	B;B;B;B	0.19073	0.011;0.008;0.027;0.033	B;B;B;B	0.14578	0.006;0.002;0.006;0.011	T	0.26950	-1.0088	10	0.15952	T	0.53	-0.1794	0.5679	0.00690	0.2306:0.1941:0.2969:0.2783	.	254;254;254;254	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	R	254;254;254;254;254;254;254;183	ENSP00000337263:G254R;ENSP00000318820:G254R;ENSP00000263886:G254R;ENSP00000332044:G254R;ENSP00000329869:G254R;ENSP00000371636:G254R;ENSP00000371633:G254R;ENSP00000405788:G183R	ENSP00000329869:G254R	G	+	1	0	TPO	1439002	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.061000	0.03472	-1.603000	0.01597	-1.571000	0.00872	GGG	.	.	weak		0.473	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
GSAP	54103	hgsc.bcm.edu	37	7	76990178	76990178	+	Silent	SNP	C	C	G	rs4727366	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:76990178C>G	ENST00000257626.7	-	14	1068	c.990G>C	c.(988-990)ggG>ggC	p.G330G		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	330					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										TCATGTGTGACCCAACATTCT	0.458													G|||	1512	0.301917	0.5461	0.219	5008	,	,		22232	0.0873		0.2326	False		,,,				2504	0.3231				p.G330G		Atlas-SNP	.											PION,caecum,carcinoma,0,1	PION	74	1	0			c.G990C						scavenged	.	G		2185,2221	590.3+/-387.3	546,1093,564	227.0	187.0	200.0		990	2.1	0.1	7	dbSNP_111	200	2174,6426	712.8+/-405.9	261,1652,2387	no	coding-synonymous	PION	NM_017439.3		807,2745,2951	GG,GC,CC		25.2791,49.5915,33.5153		330/855	76990178	4359,8647	2203	4300	6503	SO:0001819	synonymous_variant	54103	exon14			GTGTGACCCAACA		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.990G>C	7.37:g.76990178C>G		Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	165	3	0.0181818	NM_017439	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Silent	SNP	ENST00000257626.7	37	CCDS34672.2																																																																																			C|0.688;G|0.312	0.312	strong		0.458	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439	
ATAD3B	83858	hgsc.bcm.edu	37	1	1417994	1417994	+	Splice_Site	SNP	G	G	A	rs142344235	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:1417994G>A	ENST00000308647.7	+	7	866	c.750G>A	c.(748-750)acG>acA	p.T250T	ATAD3B_ENST00000378736.3_3'UTR|ATAD3B_ENST00000378741.3_Silent_p.T82T	NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	250						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TGACAGCCACGGTAAACATAT	0.607													N|||	3	0.000599042	0.0	0.0	5008	,	,		17044	0.0		0.001	False		,,,				2504	0.002				p.T250T		Atlas-SNP	.											ATAD3B_ENST00000378741,NS,carcinoma,+1,2	ATAD3B	68	2	0			c.G750A						scavenged	.	G		1,4405		0,1,2202	60.0	100.0	87.0		750	2.7	1.0	1	dbSNP_134	87	8,8590		0,8,4291	no	coding-synonymous-near-splice	ATAD3B	NM_031921.4		0,9,6493	AA,AG,GG		0.093,0.0227,0.0692		250/649	1417994	9,12995	2203	4299	6502	SO:0001630	splice_region_variant	83858	exon7			AGCCACGGTAAAC	AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.750+1G>A	1.37:g.1417994G>A		Somatic	363	1	0.00275482		WXS	Illumina HiSeq	Phase_I	308	6	0.0194805	NM_031921	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Silent	SNP	ENST00000308647.7	37	CCDS30.1																																																																																			G|0.999;A|0.001	0.001	strong		0.607	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001369.2	NM_031921	Silent
CFHR1	3078	hgsc.bcm.edu	37	1	196801042	196801042	+	Silent	SNP	G	G	T	rs4230	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:196801042G>T	ENST00000320493.5	+	6	994	c.906G>T	c.(904-906)cgG>cgT	p.R302R	CFHR1_ENST00000367424.4_Silent_p.R243R|CFHR2_ENST00000367421.3_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	302	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						TGTGTAAACGGGGATATCGTC	0.383													-|||	2541	0.507388	0.6157	0.5187	5008	,	,		12798	0.5437		0.4463	False		,,,				2504	0.3783				p.R302R		Atlas-SNP	.											CFHR1,right_upper_lobe,carcinoma,+1,2	CFHR1	47	2	0			c.G906T						scavenged	.	T		2442,1332		1044,354,489	117.0	131.0	127.0		906	0.1	0.0	1	dbSNP_36	127	3358,4906		1015,1328,1789	no	coding-synonymous	CFHR1	NM_002113.2		2059,1682,2278	TT,TG,GG		40.6341,35.2941,48.1808		302/331	196801042	5800,6238	1887	4132	6019	SO:0001819	synonymous_variant	3078	exon6			TAAACGGGGATAT	M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.906G>T	1.37:g.196801042G>T		Somatic	346	0	0		WXS	Illumina HiSeq	Phase_I	309	12	0.038835	NM_002113	A8K465|Q3B774|Q9UJ17	Silent	SNP	ENST00000320493.5	37	CCDS1386.1																																																																																			G|0.519;T|0.481	0.481	strong		0.383	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088251.2	NM_002113	
MXRA5	25878	hgsc.bcm.edu	37	X	3240343	3240343	+	Missense_Mutation	SNP	G	G	A	rs1635246	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chrX:3240343G>A	ENST00000217939.6	-	5	3537	c.3383C>T	c.(3382-3384)gCa>gTa	p.A1128V		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1128			A -> V (in dbSNP:rs1635246). {ECO:0000269|Ref.1}.			extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGTTGTTGTTGCTGTTGTGGT	0.502													G|||	1964	0.520265	0.447	0.415	3775	,	,		15049	0.2728		0.4602	False		,,,				2504	0.3548				p.A1128V		Atlas-SNP	.											.	MXRA5	815	.	0			c.C3383T						PASS	.	-	VAL/ALA	2239,1596		552,796,339,284,232	107.0	88.0	94.0		3383	-6.3	0.0	X	dbSNP_89	94	3847,2881		796,1188,1067,444,805	yes	missense	MXRA5	NM_015419.3	64	1348,1984,1406,728,1037	AA,AG,A,GG,G		42.821,41.6167,42.3838	benign	1128/2829	3240343	6086,4477	2203	4300	6503	SO:0001583	missense	25878	exon5			GTTGTTGCTGTTG	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.3383C>T	X.37:g.3240343G>A	ENSP00000217939:p.Ala1128Val	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	138	6	0.0434783	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	878	0.5292344786015672	159	0.4441340782122905	93	0.33214285714285713	105	0.23863636363636365	242	0.4416058394160584	g	9.113	1.007028	0.19199	0.583833	0.57179	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.70399	-0.48	3.61	-6.31	0.02001	.	0.667190	0.12097	N	0.499817	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.06786	0.001	B	0.06405	0.002	T	0.39187	-0.9626	9	0.23302	T	0.38	.	3.9428	0.09334	0.1509:0.1155:0.6164:0.1172	rs1635246;rs3764755;rs56693232;rs1635246	1128	Q9NR99	MXRA5_HUMAN	V	1128	ENSP00000217939:A1128V	ENSP00000217939:A1128V	A	-	2	0	MXRA5	3250343	0.005000	0.15991	0.000000	0.03702	0.017000	0.09413	1.488000	0.35551	-1.519000	0.01775	0.519000	0.50382	GCA	G|0.441;A|0.559	0.559	strong		0.502	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
PLEKHA8	84725	hgsc.bcm.edu	37	7	30113706	30113706	+	Silent	SNP	A	A	G	rs11977829	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:30113706A>G	ENST00000449726.1	+	13	1670	c.1320A>G	c.(1318-1320)acA>acG	p.T440T	PLEKHA8_ENST00000396259.1_Intron|AC007285.7_ENST00000433088.1_RNA|PLEKHA8_ENST00000396257.2_Silent_p.T440T|PLEKHA8_ENST00000258679.7_Intron	NM_001197027.1	NP_001183956.1	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8	440	Glycolipid transfer protein homology domain.				ER to Golgi ceramide transport (GO:0035621)|lipid transport (GO:0006869)|protein transport (GO:0015031)	membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ceramide binding (GO:0097001)|glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	17						ATGGTAAAACATTGCGGCAAC	0.378													G|||	1244	0.248403	0.4228	0.2378	5008	,	,		18953	0.1141		0.2396	False		,,,				2504	0.1677				p.T440T		Atlas-SNP	.											PLEKHA8_ENST00000449726,NS,carcinoma,0,2	PLEKHA8	68	2	0			c.A1320G						scavenged	.	G	,,	722,1030		155,412,309	72.0	68.0	69.0		1320,1320,	-11.5	0.0	7	dbSNP_120	69	942,3040		107,728,1156	no	coding-synonymous,coding-synonymous,intron	PLEKHA8	NM_001197026.1,NM_001197027.1,NM_032639.3	,,	262,1140,1465	GG,GA,AA		23.6565,41.21,29.0199	,,	440/520,440/460,	30113706	1664,4070	876	1991	2867	SO:0001819	synonymous_variant	84725	exon13			TAAAACATTGCGG	BC053990	CCDS5424.1, CCDS56473.1, CCDS75574.1	7p21-p11.2	2013-01-10			ENSG00000106086	ENSG00000106086		"""Pleckstrin homology (PH) domain containing"""	30037	protein-coding gene	gene with protein product		608639				11001876	Standard	NM_001197027		Approved	FAPP2, MGC3358	uc003taq.3	Q96JA3	OTTHUMG00000097751	ENST00000449726.1:c.1320A>G	7.37:g.30113706A>G		Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	180	6	0.0333333	NM_001197027	B4DH00|Q7Z5V8|Q9BU78|Q9H274|Q9H8Z7	Silent	SNP	ENST00000449726.1	37	CCDS56473.1																																																																																			A|0.748;G|0.252	0.252	strong		0.378	PLEKHA8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032639	
MLLT3	4300	hgsc.bcm.edu	37	9	20414310	20414310	+	Silent	SNP	A	A	G	rs148318848	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:20414310A>G	ENST00000380338.4	-	5	820	c.534T>C	c.(532-534)agT>agC	p.S178S	MLLT3_ENST00000429426.2_Silent_p.S175S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	178	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.527			T	MLL	ALL								A|||	169	0.033746	0.0272	0.0231	5008	,	,		12860	0.0169		0.0308	False		,,,				2504	0.0706				p.S178S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,caecum,carcinoma,0,1	MLLT3	125	1	0			c.T534C						scavenged	.						25.0	33.0	30.0					9																	20414310		2142	4195	6337	SO:0001819	synonymous_variant	4300	exon5			GCTGCTACTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.534T>C	9.37:g.20414310A>G		Somatic	50	3	0.06		WXS	Illumina HiSeq	Phase_I	68	7	0.102941	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.	.	weak		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
HTR3D	200909	hgsc.bcm.edu	37	3	183752964	183752964	+	Silent	SNP	A	A	C	rs77099580	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:183752964A>C	ENST00000382489.3	+	2	238	c.238A>C	c.(238-240)Agg>Cgg	p.R80R	HTR3D_ENST00000334128.2_5'UTR|HTR3D_ENST00000453435.1_5'UTR|HTR3D_ENST00000428798.2_Splice_Site	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	80					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	CTGCTATTCCAGGATTCACAC	0.478													A|||	71	0.0141773	0.0015	0.0259	5008	,	,		18381	0.0		0.0447	False		,,,				2504	0.0061				p.R80R		Atlas-SNP	.											.	HTR3D	65	.	0			c.A238C						PASS	.	A	,,	15,1369		0,15,677	275.0	226.0	241.0		,238,	3.4	0.2	3	dbSNP_132	241	130,3052		3,124,1464	yes	splice-3,coding-synonymous,utr-5	HTR3D	NM_001145143.1,NM_001163646.1,NM_182537.2	,,	3,139,2141	CC,CA,AA		4.0855,1.0838,3.1756	,,	,80/455,	183752964	145,4421	692	1591	2283	SO:0001819	synonymous_variant	200909	exon2			TATTCCAGGATTC	AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.238A>C	3.37:g.183752964A>C		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	71	5	0.0704225	NM_001163646	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Silent	SNP	ENST00000382489.3	37	CCDS54685.1	50	0.022893772893772892	1	0.0020325203252032522	10	0.027624309392265192	0	0.0	39	0.051451187335092345	A	9.519	1.107887	0.20714	0.010838	0.040855	ENSG00000186090	ENST00000428798	.	.	.	4.59	3.43	0.39272	.	.	.	.	.	.	.	.	.	.	.	0.33821	D	0.629031	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9507	0.24544	0.8957:0.0:0.1043:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HTR3D	185235658	0.995000	0.38212	0.164000	0.22755	0.164000	0.22412	3.449000	0.52950	0.903000	0.36546	0.533000	0.62120	.	A|0.974;C|0.026	0.026	strong		0.478	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346289.1	NM_182537	
HERC1	8925	hgsc.bcm.edu	37	15	63922752	63922752	+	Silent	SNP	T	T	A	rs10851731	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:63922752T>A	ENST00000443617.2	-	69	12966	c.12879A>T	c.(12877-12879)atA>atT	p.I4293I		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4293					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.I4293I(1)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CCACATCTTCTATGATTACTC	0.468													A|||	3189	0.636781	0.8744	0.6484	5008	,	,		18519	0.0972		0.8976	False		,,,				2504	0.5951				p.I4293I		Atlas-SNP	.											HERC1_ENST00000443617,NS,carcinoma,0,1	HERC1	624	1	1	Substitution - coding silent(1)	stomach(1)	c.A12879T						PASS	.	A		3365,569		1441,483,43	160.0	161.0	160.0		12879	-0.9	1.0	15	dbSNP_120	160	7320,994		3215,890,52	no	coding-synonymous	HERC1	NM_003922.3		4656,1373,95	AA,AT,TT		11.9557,14.4637,12.7613		4293/4862	63922752	10685,1563	1967	4157	6124	SO:0001819	synonymous_variant	8925	exon69			ATCTTCTATGATT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.12879A>T	15.37:g.63922752T>A		Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	128	6	0.046875	NM_003922	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1																																																																																			T|0.342;A|0.658	0.658	strong		0.468	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
GRHL3	57822	hgsc.bcm.edu	37	1	24668667	24668667	+	Silent	SNP	C	C	G	rs11576645	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:24668667C>G	ENST00000350501.5	+	9	1237	c.1110C>G	c.(1108-1110)gtC>gtG	p.V370V	GRHL3_ENST00000236255.4_Silent_p.V375V|GRHL3_ENST00000342072.4_Silent_p.V277V|GRHL3_ENST00000361548.4_Silent_p.V370V|GRHL3_ENST00000356046.2_Silent_p.V324V	NM_198174.2	NP_937817.3	Q8TE85	GRHL3_HUMAN	grainyhead-like 3 (Drosophila)	370					central nervous system development (GO:0007417)|cochlea morphogenesis (GO:0090103)|ectoderm development (GO:0007398)|epidermis development (GO:0008544)|establishment of planar polarity (GO:0001736)|eyelid development in camera-type eye (GO:0061029)|pattern specification process (GO:0007389)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		TGAAGGGTGTCCCCCTGAACC	0.572													C|||	790	0.157748	0.0772	0.1527	5008	,	,		20035	0.123		0.2068	False		,,,				2504	0.2556				p.V375V		Atlas-SNP	.											.	GRHL3	69	.	0			c.C1125G						PASS	.	C	,,,	424,3982	206.5+/-228.1	21,382,1800	105.0	106.0	106.0		972,1125,1110,1110	3.7	1.0	1	dbSNP_120	106	1942,6658	342.3+/-324.4	219,1504,2577	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	GRHL3	NM_001195010.1,NM_021180.3,NM_198173.2,NM_198174.2	,,,	240,1886,4377	GG,GC,CC		22.5814,9.6232,18.1916	,,,	324/557,375/608,370/603,370/627	24668667	2366,10640	2203	4300	6503	SO:0001819	synonymous_variant	57822	exon9			GGGTGTCCCCCTG	AY231161	CCDS251.1, CCDS252.1, CCDS44088.1, CCDS252.2, CCDS53284.1	1p36	2008-02-05	2005-07-11	2005-07-11	ENSG00000158055	ENSG00000158055			25839	protein-coding gene	gene with protein product		608317	"""transcription factor CP2-like 4"""	TFCP2L4		12549979	Standard	NM_021180		Approved	SOM	uc021oiw.1	Q8TE85	OTTHUMG00000003040	ENST00000350501.5:c.1110C>G	1.37:g.24668667C>G		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	120	5	0.0416667	NM_021180	A2A297|B2RCL1|G3XAF0|Q5TH78|Q86Y06|Q8N407	Silent	SNP	ENST00000350501.5	37	CCDS252.2																																																																																			C|0.832;G|0.168	0.168	strong		0.572	GRHL3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000009047.2	NM_021180	
SLC25A26	115286	hgsc.bcm.edu	37	3	66293688	66293688	+	Silent	SNP	A	A	G	rs3772197	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:66293688A>G	ENST00000354883.6	+	4	980	c.252A>G	c.(250-252)tcA>tcG	p.S84S	SLC25A26_ENST00000413054.1_5'UTR|SLC25A26_ENST00000536651.1_3'UTR|SLC25A26_ENST00000336733.6_5'UTR			Q70HW3	SAMC_HUMAN	solute carrier family 25 (S-adenosylmethionine carrier), member 26	84					S-adenosyl-L-methionine transmembrane transport (GO:1901962)|S-adenosyl-L-methionine transport (GO:0015805)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	S-adenosyl-L-methionine transmembrane transporter activity (GO:0000095)	p.S84S(1)		endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)|stomach(2)|urinary_tract(1)	8		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)		ATTCATCTTCATATTTGACAC	0.343													A|||	287	0.0573083	0.0295	0.0548	5008	,	,		15466	0.0377		0.0746	False		,,,				2504	0.0992				p.S84S		Atlas-SNP	.											SLC25A26,NS,carcinoma,0,1	SLC25A26	12	1	1	Substitution - coding silent(1)	stomach(1)	c.A252G						scavenged	.	A	,	181,4225	116.7+/-154.6	5,171,2027	160.0	159.0	159.0		,252	-9.6	0.1	3	dbSNP_107	159	619,7981	161.0+/-214.0	15,589,3696	no	utr-5,coding-synonymous	SLC25A26	NM_001164796.1,NM_173471.3	,	20,760,5723	GG,GA,AA		7.1977,4.108,6.151	,	,84/275	66293688	800,12206	2203	4300	6503	SO:0001819	synonymous_variant	115286	exon4			ATCTTCATATTTG	AJ580932	CCDS54604.1, CCDS2905.2	3p14.2	2013-05-22	2012-03-29		ENSG00000144741	ENSG00000144741		"""Solute carriers"""	20661	protein-coding gene	gene with protein product		611037	"""solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 26"""			14674884	Standard	NM_173471		Approved		uc011bfq.2	Q70HW3	OTTHUMG00000149917	ENST00000354883.6:c.252A>G	3.37:g.66293688A>G		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	79	3	0.0379747	NM_173471	A8K758|B3KRZ7|Q7Z786|Q96E68	Silent	SNP	ENST00000354883.6	37	CCDS2905.2	138	0.06318681318681318	23	0.046747967479674794	33	0.09116022099447514	30	0.05244755244755245	52	0.06860158311345646	A	5.590	0.293637	0.10567	0.04108	0.071977	ENSG00000144741	ENST00000413054	.	.	.	5.67	-9.63	0.00544	.	.	.	.	.	T	0.00580	0.0019	.	.	.	0.09310	P	0.9999999999221516	.	.	.	.	.	.	T	0.15867	-1.0422	3	.	.	.	-28.0729	4.8763	0.13658	0.1925:0.3735:0.3461:0.0879	rs3772197;rs17823209;rs56630729;rs3772197	.	.	.	R	21	.	.	H	+	2	0	SLC25A26	66376379	0.000000	0.05858	0.121000	0.21740	0.526000	0.34562	-1.203000	0.03019	-0.938000	0.03714	-0.441000	0.05720	CAT	A|0.941;G|0.059	0.059	strong		0.343	SLC25A26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313894.2	NM_173471	
CES5A	221223	hgsc.bcm.edu	37	16	55890347	55890347	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:55890347G>A	ENST00000290567.9	-	9	1188	c.1067C>T	c.(1066-1068)cCt>cTt	p.P356L	CES5A_ENST00000521992.1_Missense_Mutation_p.P385L|CES5A_ENST00000518005.1_Missense_Mutation_p.P250L|CES5A_ENST00000520435.1_Missense_Mutation_p.P326L|CES5A_ENST00000541580.1_5'UTR|CES5A_ENST00000319165.9_Missense_Mutation_p.P356L	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	356						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						GAGGATCTCAGGAGCCTCCTT	0.547																																					p.P385L		Atlas-SNP	.											.	CES5A	206	.	0			c.C1154T						PASS	.						135.0	115.0	122.0					16																	55890347		2198	4300	6498	SO:0001583	missense	221223	exon10			ATCTCAGGAGCCT	AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.1067C>T	16.37:g.55890347G>A	ENSP00000290567:p.Pro356Leu	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	60	42	0.7	NM_001190158	B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	ENST00000290567.9	37	CCDS45490.1	.	.	.	.	.	.	.	.	.	.	G	4.176	0.031232	0.08101	.	.	ENSG00000159398	ENST00000521992;ENST00000319165;ENST00000518005;ENST00000290567;ENST00000520435;ENST00000541580	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	3.18	3.18	0.36537	Carboxylesterase, type B (1);	0.794542	0.10319	N	0.688955	T	0.51669	0.1688	L	0.33753	1.03	0.30761	N	0.744061	B;B	0.32245	0.1;0.361	B;B	0.34242	0.066;0.178	T	0.54794	-0.8240	10	0.42905	T	0.14	.	10.1997	0.43075	0.0:0.0:1.0:0.0	.	356;356	Q6NT32;Q6NT32-2	EST5A_HUMAN;.	L	385;356;250;356;326;136	ENSP00000428864:P385L;ENSP00000324271:P356L;ENSP00000428571:P250L;ENSP00000290567:P356L;ENSP00000428887:P326L	ENSP00000290567:P356L	P	-	2	0	CES5A	54447848	0.998000	0.40836	0.399000	0.26333	0.068000	0.16541	3.777000	0.55364	2.100000	0.63781	0.449000	0.29647	CCT	.	.	none		0.547	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024	
PARP4	143	hgsc.bcm.edu	37	13	25052261	25052261	+	Silent	SNP	C	C	T	rs4770696	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr13:25052261C>T	ENST00000381989.3	-	13	1707	c.1602G>A	c.(1600-1602)tcG>tcA	p.S534S		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	534	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AGGCTGTTTGCGAAACTCCAT	0.443													.|||	2727	0.544529	0.4289	0.5677	5008	,	,		16176	0.5992		0.5	False		,,,				2504	0.6738				p.S534S		Atlas-SNP	.											PARP4,mouth,carcinoma,-1,1	PARP4	142	1	0			c.G1602A						scavenged	.	T		1900,2506	626.8+/-394.8	410,1080,713	74.0	65.0	68.0		1602	-0.2	0.0	13	dbSNP_111	68	4549,4051	557.5+/-387.1	1197,2155,948	no	coding-synonymous	PARP4	NM_006437.3		1607,3235,1661	TT,TC,CC		47.1047,43.123,49.5848		534/1725	25052261	6449,6557	2203	4300	6503	SO:0001819	synonymous_variant	143	exon13			TGTTTGCGAAACT	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1602G>A	13.37:g.25052261C>T		Somatic	101	3	0.029703		WXS	Illumina HiSeq	Phase_I	102	3	0.0294118	NM_006437	O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	ENST00000381989.3	37	CCDS9307.1																																																																																			C|0.494;T|0.506	0.506	strong		0.443	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
IHH	3549	hgsc.bcm.edu	37	2	219920412	219920412	+	Silent	SNP	A	A	G	rs3731881	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:219920412A>G	ENST00000295731.6	-	3	752	c.753T>C	c.(751-753)ccT>ccC	p.P251P	MIR3131_ENST00000583592.1_RNA	NM_002181.3	NP_002172.2	Q14623	IHH_HUMAN	indian hedgehog	251					bone resorption (GO:0045453)|camera-type eye photoreceptor cell fate commitment (GO:0060220)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|chondrocyte proliferation (GO:0035988)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint development (GO:0072498)|epithelial cell morphogenesis (GO:0003382)|epithelial cell-cell adhesion (GO:0090136)|head morphogenesis (GO:0060323)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intein-mediated protein splicing (GO:0016539)|maternal process involved in female pregnancy (GO:0060135)|multicellular organism growth (GO:0035264)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of eye pigmentation (GO:0048074)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell differentiation in thymus (GO:0033085)|neuron development (GO:0048666)|osteoblast differentiation (GO:0001649)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteoglycan metabolic process (GO:0006029)|regulation of growth (GO:0040008)|response to estradiol (GO:0032355)|retinal pigment epithelium development (GO:0003406)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|somite development (GO:0061053)|vitelline membrane formation (GO:0030704)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|patched binding (GO:0005113)|peptidase activity (GO:0008233)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000188)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCAGCCTGTGAGGCTCGCGGT	0.642													G|||	2428	0.484824	0.4395	0.5331	5008	,	,		15926	0.2788		0.672	False		,,,				2504	0.5317				p.P251P		Atlas-SNP	.											.	IHH	33	.	0			c.T753C						PASS	.	G		1999,2407	613.7+/-392.2	456,1087,660	56.0	58.0	58.0		753	-5.8	0.0	2	dbSNP_107	58	5732,2868	449.0+/-362.0	1881,1970,449	yes	coding-synonymous	IHH	NM_002181.3		2337,3057,1109	GG,GA,AA		33.3488,45.37,40.5582		251/412	219920412	7731,5275	2203	4300	6503	SO:0001819	synonymous_variant	3549	exon3			CCTGTGAGGCTCG	L38517	CCDS33380.1	2q33-q35	2013-02-15	2013-02-15		ENSG00000163501	ENSG00000163501			5956	protein-coding gene	gene with protein product		600726	"""Indian hedgehog (Drosophila) homolog"", ""Indian hedgehog homolog (Drosophila)"""			7590746, 14770182	Standard	NM_002181		Approved	HHG2, BDA1	uc002vjo.2	Q14623	OTTHUMG00000154631	ENST00000295731.6:c.753T>C	2.37:g.219920412A>G		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	97	10	0.103093	NM_002181	B9EGM5|O43322|Q8N4B9	Silent	SNP	ENST00000295731.6	37	CCDS33380.1																																																																																			A|0.454;G|0.546	0.546	strong		0.642	IHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336408.2	NM_002181	
CCDC6	8030	hgsc.bcm.edu	37	10	61552774	61552774	+	Silent	SNP	C	C	T	rs1053265	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:61552774C>T	ENST00000263102.6	-	9	1557	c.1326G>A	c.(1324-1326)ccG>ccA	p.P442P		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	442	Poly-Pro.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		GAGGTGGAGGCGGAGGTGGCT	0.632			T	RET	NSCLC								C|||	3063	0.611621	0.3381	0.7795	5008	,	,		15566	0.6647		0.7505	False		,,,				2504	0.6646				p.P442P		Atlas-SNP	.		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	CCDC6,caecum,carcinoma,0,2	CCDC6	44	2	0			c.G1326A						scavenged	.	C		1872,2534	541.4+/-375.8	403,1066,734	161.0	151.0	154.0		1326	-11.2	0.0	10	dbSNP_86	154	6615,1985	723.1+/-406.4	2551,1513,236	no	coding-synonymous	CCDC6	NM_005436.4		2954,2579,970	TT,TC,CC		23.0814,42.4875,34.7455		442/475	61552774	8487,4519	2203	4300	6503	SO:0001819	synonymous_variant	8030	exon9			TGGAGGCGGAGGT	S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.1326G>A	10.37:g.61552774C>T		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	75	3	0.04	NM_005436	Q15250|Q6GSG7	Silent	SNP	ENST00000263102.6	37	CCDS7257.1																																																																																			C|0.350;T|0.650	0.650	strong		0.632	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436	
ZNF804A	91752	hgsc.bcm.edu	37	2	185801559	185801559	+	Missense_Mutation	SNP	A	A	G	rs35676856	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:185801559A>G	ENST00000302277.6	+	4	2030	c.1436A>G	c.(1435-1437)gAc>gGc	p.D479G		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	479			D -> G (in dbSNP:rs35676856). {ECO:0000269|PubMed:15489334}.				metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AATAAGCCAGACTTAAAAGAT	0.338													A|||	177	0.0353435	0.0159	0.0331	5008	,	,		17452	0.0159		0.0666	False		,,,				2504	0.0511				p.D479G		Atlas-SNP	.											ZNF804A,NS,carcinoma,+1,1	ZNF804A	322	1	0			c.A1436G						scavenged	.	A	GLY/ASP	115,4289	81.9+/-120.4	1,113,2088	76.0	80.0	79.0		1436	1.5	0.0	2	dbSNP_126	79	669,7931	162.9+/-215.5	33,603,3664	yes	missense	ZNF804A	NM_194250.1	94	34,716,5752	GG,GA,AA		7.7791,2.6113,6.0289	benign	479/1210	185801559	784,12220	2202	4300	6502	SO:0001583	missense	91752	exon4			AGCCAGACTTAAA	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1436A>G	2.37:g.185801559A>G	ENSP00000303252:p.Asp479Gly	Somatic	292	0	0		WXS	Illumina HiSeq	Phase_I	317	9	0.0283912	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	72	0.03296703296703297	3	0.006097560975609756	12	0.03314917127071823	9	0.015734265734265736	48	0.0633245382585752	A	0.808	-0.753030	0.03041	0.026113	0.077791	ENSG00000170396	ENST00000302277	T	0.05996	3.36	5.69	1.48	0.22813	.	1.391250	0.04406	N	0.365125	T	0.00210	0.0006	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.42849	-0.9427	10	0.22706	T	0.39	0.1455	2.8485	0.05550	0.4077:0.37:0.1275:0.0948	rs35676856	479	Q7Z570	Z804A_HUMAN	G	479	ENSP00000303252:D479G	ENSP00000303252:D479G	D	+	2	0	ZNF804A	185509804	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.058000	0.14301	0.713000	0.32060	-0.144000	0.13903	GAC	A|0.947;G|0.053	0.053	strong		0.338	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
SMC2	10592	hgsc.bcm.edu	37	9	106889642	106889642	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:106889642G>T	ENST00000286398.7	+	20	2959	c.2671G>T	c.(2671-2673)Gct>Tct	p.A891S	SMC2_ENST00000374787.3_Missense_Mutation_p.A891S|SMC2_ENST00000303219.8_Missense_Mutation_p.A891S|SMC2_ENST00000374793.3_Missense_Mutation_p.A891S	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	891					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						TGTAATTAAAGCTAAATATGC	0.353																																					p.A891S		Atlas-SNP	.											SMC2L1,NS,carcinoma,0,2	SMC2	127	2	0			c.G2671T						scavenged	.						148.0	141.0	144.0					9																	106889642		2203	4300	6503	SO:0001583	missense	10592	exon20			ATTAAAGCTAAAT	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.2671G>T	9.37:g.106889642G>T	ENSP00000286398:p.Ala891Ser	Somatic	349	0	0		WXS	Illumina HiSeq	Phase_I	377	5	0.0132626	NM_006444	Q6IEE0|Q9P1P2	Missense_Mutation	SNP	ENST00000286398.7	37	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.328521	0.24167	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000374787	T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82	6.05	1.84	0.25277	RecF/RecN/SMC (1);	0.447307	0.26871	N	0.022064	T	0.51719	0.1691	N	0.16833	0.445	0.27672	N	0.946729	B	0.09022	0.002	B	0.10450	0.005	T	0.31779	-0.9931	10	0.09843	T	0.71	0.554	8.4486	0.32858	0.4182:0.0:0.5818:0.0	.	891	O95347	SMC2_HUMAN	S	891	ENSP00000286398:A891S;ENSP00000363925:A891S;ENSP00000306152:A891S;ENSP00000363919:A891S	ENSP00000286398:A891S	A	+	1	0	SMC2	105929463	0.831000	0.29352	0.996000	0.52242	0.998000	0.95712	0.210000	0.17455	0.057000	0.16193	0.650000	0.86243	GCT	.	.	none		0.353	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1		
EVPLL	645027	hgsc.bcm.edu	37	17	18291559	18291559	+	Silent	SNP	T	T	C	rs9890369	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:18291559T>C	ENST00000399134.4	+	10	1261	c.903T>C	c.(901-903)caT>caC	p.H301H	EVPLL_ENST00000583003.1_3'UTR|RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like	301										NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CCTCTCCTCATTGACTCTGCA	0.463													.|||	1328	0.265176	0.4342	0.2032	5008	,	,		12834	0.1637		0.1849	False		,,,				2504	0.2679				p.H301H		Atlas-SNP	.											EVPLL,NS,NS,+2,1	EVPLL	10	1	0			c.T903C						scavenged	.	T		503,881		91,321,280	73.0	63.0	66.0		903	0.1	0.0	17	dbSNP_119	66	659,2523		64,531,996	no	coding-synonymous	EVPLL	NM_001145127.1		155,852,1276	CC,CT,TT		20.7102,36.3439,25.449		301/302	18291559	1162,3404	692	1591	2283	SO:0001819	synonymous_variant	645027	exon10			TCCTCATTGACTC		CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.903T>C	17.37:g.18291559T>C		Somatic	687	4	0.00582242		WXS	Illumina HiSeq	Phase_I	545	7	0.012844	NM_001145127	B4DPD4	Silent	SNP	ENST00000399134.4	37	CCDS45626.1																																																																																			T|0.770;C|0.230	0.230	strong		0.463	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000130836.2	NM_001145127	
MYO3A	53904	hgsc.bcm.edu	37	10	26462790	26462790	+	Silent	SNP	G	G	A	rs3740232	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:26462790G>A	ENST00000265944.5	+	30	3763	c.3597G>A	c.(3595-3597)gaG>gaA	p.E1199E	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1199					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E1199E(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						ATGAGGAAGAGGTTAAGCAAG	0.418													G|||	1648	0.329073	0.2262	0.317	5008	,	,		19882	0.3532		0.3429	False		,,,				2504	0.4376				p.E1199E		Atlas-SNP	.											MYO3A,colon,carcinoma,0,2	MYO3A	371	2	1	Substitution - coding silent(1)	stomach(1)	c.G3597A						scavenged	.	G		1105,3301	396.7+/-330.2	139,827,1237	87.0	86.0	86.0		3597	0.0	0.0	10	dbSNP_107	86	2884,5716	452.0+/-362.8	486,1912,1902	no	coding-synonymous	MYO3A	NM_017433.4		625,2739,3139	AA,AG,GG		33.5349,25.0794,30.6705		1199/1617	26462790	3989,9017	2203	4300	6503	SO:0001819	synonymous_variant	53904	exon30			GGAAGAGGTTAAG	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3597G>A	10.37:g.26462790G>A		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	176	3	0.0170455	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Silent	SNP	ENST00000265944.5	37	CCDS7148.1																																																																																			G|0.681;A|0.319	0.319	strong		0.418	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
CKAP2	26586	hgsc.bcm.edu	37	13	53047966	53047966	+	Missense_Mutation	SNP	G	G	A	rs41292820	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr13:53047966G>A	ENST00000378037.5	+	8	1642	c.1552G>A	c.(1552-1554)Gaa>Aaa	p.E518K	CKAP2_ENST00000258607.5_Missense_Mutation_p.E517K|CKAP2_ENST00000490903.1_Missense_Mutation_p.E469K	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2											breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		TTCTATAGGAGAAAATATGGA	0.333													g|||	13	0.00259585	0.0	0.0072	5008	,	,		15915	0.0		0.008	False		,,,				2504	0.0				p.E518K		Atlas-SNP	.											.	CKAP2	51	.	0			c.G1552A						PASS	.	G	LYS/GLU,LYS/GLU	4,4402		0,4,2199	61.0	70.0	67.0		1552,1549	2.3	0.7	13	dbSNP_127	67	53,8545		0,53,4246	yes	missense,missense	CKAP2	NM_001098525.1,NM_018204.3	56,56	0,57,6445	AA,AG,GG		0.6164,0.0908,0.4383	possibly-damaging,possibly-damaging	518/684,517/683	53047966	57,12947	2203	4299	6502	SO:0001583	missense	26586	exon8			ATAGGAGAAAATA	AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.1552G>A	13.37:g.53047966G>A	ENSP00000367276:p.Glu518Lys	Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	182	8	0.043956	NM_001098525		Missense_Mutation	SNP	ENST00000378037.5	37	CCDS41893.1	10	0.004578754578754579	0	0.0	4	0.011049723756906077	0	0.0	6	0.0079155672823219	.	12.42	1.931190	0.34096	9.08E-4	0.006164	ENSG00000136108	ENST00000258607;ENST00000378037;ENST00000490903	T;T;T	0.23754	1.89;1.89;1.89	5.91	2.29	0.28610	.	0.387988	0.26349	N	0.024882	T	0.14013	0.0339	L	0.48877	1.53	0.26638	N	0.97234	B;B;B	0.27351	0.176;0.005;0.011	B;B;B	0.24541	0.054;0.004;0.009	T	0.15037	-1.0451	10	0.66056	D	0.02	-5.4027	6.0479	0.19770	0.2228:0.1351:0.6421:0.0	rs41292820	469;518;517	E9PD90;Q8WWK9;B2RMQ4	.;CKAP2_HUMAN;.	K	517;518;469	ENSP00000258607:E517K;ENSP00000367276:E518K;ENSP00000417830:E469K	ENSP00000258607:E517K	E	+	1	0	CKAP2	51945967	0.832000	0.29368	0.722000	0.30670	0.626000	0.37791	0.189000	0.17037	0.119000	0.18210	0.655000	0.94253	GAA	G|0.996;A|0.004	0.004	strong		0.333	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355010.2		
FNDC1	84624	hgsc.bcm.edu	37	6	159653635	159653635	+	Silent	SNP	C	C	G	rs381639	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:159653635C>G	ENST00000297267.9	+	11	2291	c.2091C>G	c.(2089-2091)gcC>gcG	p.A697A	FNDC1_ENST00000340366.6_Silent_p.A634A	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	697	Ser-rich.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CCTCGCCGGCCCGGAGGACCC	0.697													G|||	2471	0.493411	0.295	0.6542	5008	,	,		14853	0.2768		0.7724	False		,,,				2504	0.5838				p.A697A		Atlas-SNP	.											.	FNDC1	250	.	0			c.C2091G						PASS	.	G		1399,2427		256,887,770	12.0	15.0	14.0		2091	-9.5	0.0	6	dbSNP_80	14	6323,1889		2432,1459,215	no	coding-synonymous	FNDC1	NM_032532.2		2688,2346,985	GG,GC,CC		23.0029,36.5656,35.8531		697/1895	159653635	7722,4316	1913	4106	6019	SO:0001819	synonymous_variant	84624	exon11			GCCGGCCCGGAGG	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2091C>G	6.37:g.159653635C>G		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	63	4	0.0634921	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Silent	SNP	ENST00000297267.9	37	CCDS47512.1	1155	0.5288461538461539	156	0.3170731707317073	251	0.6933701657458563	151	0.263986013986014	597	0.787598944591029	G	5.187	0.220096	0.09863	0.365656	0.769971	ENSG00000164694	ENST00000329629	.	.	.	4.73	-9.46	0.00597	.	.	.	.	.	T	0.03305	0.0096	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.03981	-1.0987	3	.	.	.	-2.6834	1.5451	0.02563	0.3073:0.2085:0.3602:0.1239	rs381639;rs3814436;rs58100918	.	.	.	A	593	.	.	P	+	1	0	FNDC1	159573625	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.864000	0.01650	-4.965000	0.00025	-0.736000	0.03550	CCG	C|0.423;G|0.577	0.577	strong		0.697	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
MAT2A	4144	hgsc.bcm.edu	37	2	85769711	85769711	+	Silent	SNP	C	C	G	rs1078004	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:85769711C>G	ENST00000306434.3	+	7	915	c.792C>G	c.(790-792)cgC>cgG	p.R264R	MAT2A_ENST00000409017.1_Silent_p.R201R	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	264					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)	p.R264R(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TGACTGGACGCAAAATCATTG	0.453													G|||	2468	0.492812	0.7194	0.3934	5008	,	,		20209	0.3859		0.494	False		,,,				2504	0.3661				p.R264R		Atlas-SNP	.											MAT2A,NS,carcinoma,0,1	MAT2A	23	1	1	Substitution - coding silent(1)	stomach(1)	c.C792G						scavenged	.	G		2978,1428	464.2+/-353.8	1016,946,241	132.0	141.0	138.0		792	2.8	1.0	2	dbSNP_86	138	3955,4645	602.6+/-394.5	911,2133,1256	yes	coding-synonymous	MAT2A	NM_005911.5		1927,3079,1497	GG,GC,CC		45.9884,32.4103,46.6938		264/396	85769711	6933,6073	2203	4300	6503	SO:0001819	synonymous_variant	4144	exon7			TGGACGCAAAATC		CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.792C>G	2.37:g.85769711C>G		Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	161	5	0.0310559	NM_005911	A8K511|B4DN45|D6W5L1|Q53SP5	Silent	SNP	ENST00000306434.3	37	CCDS1977.1																																																																																			C|0.483;G|0.517	0.517	strong		0.453	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252491.2	NM_005911	
OR52E6	390078	hgsc.bcm.edu	37	11	5862984	5862984	+	Missense_Mutation	SNP	G	G	C	rs10769272	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:5862984G>C	ENST00000329322.5	-	1	143	c.144C>G	c.(142-144)ttC>ttG	p.F48L	TRIM5_ENST00000380027.1_Intron|OR52E6_ENST00000379946.2_Missense_Mutation_p.F52L	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	48			F -> L (in dbSNP:rs10769272).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F52L(1)|p.F48L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGATCACAAAGAAGATAGCAG	0.483													C|||	1924	0.384185	0.379	0.3184	5008	,	,		20915	0.4593		0.3728	False		,,,				2504	0.3722				p.F48L		Atlas-SNP	.											OR52E6,NS,carcinoma,0,1	OR52E6	70	1	2	Substitution - Missense(2)	prostate(2)	c.C144G						PASS	.	C	LEU/PHE	1620,2782	652.3+/-399.4	294,1032,875	120.0	120.0	120.0		144	-7.3	0.0	11	dbSNP_120	120	3010,5582	662.7+/-402.0	533,1944,1819	yes	missense	OR52E6	NM_001005167.1	22	827,2976,2694	CC,CG,GG		35.0326,36.8015,35.6318	benign	48/314	5862984	4630,8364	2201	4296	6497	SO:0001583	missense	390078	exon1			CACAAAGAAGATA	AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.144C>G	11.37:g.5862984G>C	ENSP00000328878:p.Phe48Leu	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	124	5	0.0403226	NM_001005167	Q6IFF8	Missense_Mutation	SNP	ENST00000329322.5	37	CCDS53597.1	879	0.4024725274725275	201	0.40853658536585363	120	0.3314917127071823	264	0.46153846153846156	294	0.38786279683377306	C	0.015	-1.558484	0.00910	0.368015	0.350326	ENSG00000205409	ENST00000329322;ENST00000379946	T;T	0.00482	8.17;7.1	3.64	-7.27	0.01461	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	N	0.000475	T	0.00012	0.0000	N	0.00022	-2.74	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33085	-0.9882	9	0.02654	T	1	.	4.0047	0.09595	0.163:0.1201:0.4805:0.2364	rs10769272;rs52812932;rs10769272	48	Q96RD3	O52E6_HUMAN	L	48;52	ENSP00000328878:F48L;ENSP00000369279:F52L	ENSP00000328878:F48L	F	-	3	2	OR52E6	5819560	0.000000	0.05858	0.001000	0.08648	0.436000	0.31835	-7.918000	0.00027	-1.655000	0.01497	-0.231000	0.12243	TTC	G|0.607;C|0.393	0.393	strong		0.483	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401144.1	NM_001005167	
ERBB3	2065	hgsc.bcm.edu	37	12	56494991	56494991	+	Silent	SNP	G	G	A	rs2271189	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:56494991G>A	ENST00000267101.3	+	27	3788	c.3348G>A	c.(3346-3348)agG>agA	p.R1116R	ERBB3_ENST00000549832.1_Silent_p.R236R|ERBB3_ENST00000450146.2_Silent_p.R473R|ERBB3_ENST00000415288.2_Silent_p.R1057R|ERBB3_ENST00000553131.1_Silent_p.R357R|RP11-603J24.9_ENST00000548861.1_5'Flank	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1116					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CAATGTGTAGGAGCCGGAGCA	0.617													G|||	1263	0.252196	0.0734	0.3718	5008	,	,		13537	0.2887		0.4036	False		,,,				2504	0.2157				p.R1116R		Atlas-SNP	.											.	ERBB3	350	.	0			c.G3348A						PASS	.	G		620,3786	269.8+/-269.2	44,532,1627	54.0	52.0	52.0		3348	-0.8	1.0	12	dbSNP_100	52	3413,5187	503.3+/-375.9	692,2029,1579	no	coding-synonymous	ERBB3	NM_001982.3		736,2561,3206	AA,AG,GG		39.686,14.0717,31.0088		1116/1343	56494991	4033,8973	2203	4300	6503	SO:0001819	synonymous_variant	2065	exon27			GTGTAGGAGCCGG	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3348G>A	12.37:g.56494991G>A		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	92	7	0.076087	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Silent	SNP	ENST00000267101.3	37	CCDS31833.1																																																																																			G|0.703;A|0.297	0.297	strong		0.617	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
OR51S1	119692	hgsc.bcm.edu	37	11	4869649	4869649	+	Missense_Mutation	SNP	G	G	A	rs12361955	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:4869649G>A	ENST00000322101.2	-	1	865	c.790C>T	c.(790-792)Ctc>Ttc	p.L264F	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	264			L -> F (in dbSNP:rs12361955).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGTGCCAGGAGGATCATAGGG	0.498													G|||	1499	0.299321	0.3411	0.2608	5008	,	,		19746	0.0675		0.4046	False		,,,				2504	0.4008				p.L264F		Atlas-SNP	.											OR51S1,NS,carcinoma,+2,1	OR51S1	83	1	0			c.C790T						scavenged	.	G	PHE/LEU	1535,2867	485.3+/-360.3	273,989,939	112.0	96.0	102.0		790	3.3	1.0	11	dbSNP_120	102	3700,4896	528.7+/-381.4	805,2090,1403	yes	missense	OR51S1	NM_001004758.1	22	1078,3079,2342	AA,AG,GG		43.0433,34.8705,40.2754	benign	264/324	4869649	5235,7763	2201	4298	6499	SO:0001583	missense	119692	exon1			CCAGGAGGATCAT	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.790C>T	11.37:g.4869649G>A	ENSP00000322754:p.Leu264Phe	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	119	3	0.0252101	NM_001004758	B9EGZ1|Q6IFI2	Missense_Mutation	SNP	ENST00000322101.2	37	CCDS31362.1	621	0.28434065934065933	168	0.34146341463414637	120	0.3314917127071823	32	0.055944055944055944	301	0.3970976253298153	G	8.217	0.801715	0.16397	0.348705	0.430433	ENSG00000176922	ENST00000322101	T	0.73363	-0.74	5.25	3.29	0.37713	GPCR, rhodopsin-like superfamily (1);	0.176237	0.27469	N	0.019222	T	0.00012	0.0000	N	0.04746	-0.17	0.58432	P	1.0000000000287557E-6	B	0.10296	0.003	B	0.12156	0.007	T	0.31668	-0.9935	9	0.87932	D	0	-11.6636	8.9594	0.35838	0.0843:0.295:0.6207:0.0	rs12361955;rs58301091;rs12361955	264	Q8NGJ8	O51S1_HUMAN	F	264	ENSP00000322754:L264F	ENSP00000322754:L264F	L	-	1	0	OR51S1	4826225	0.000000	0.05858	1.000000	0.80357	0.400000	0.30750	0.704000	0.25661	1.445000	0.47624	0.655000	0.94253	CTC	G|0.658;A|0.342	0.342	strong		0.498	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758	
UGT2B28	54490	hgsc.bcm.edu	37	4	70160277	70160277	+	Missense_Mutation	SNP	T	T	G	rs6843900	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:70160277T>G	ENST00000335568.5	+	6	1342	c.1340T>G	c.(1339-1341)aTa>aGa	p.I447R	UGT2B28_ENST00000511240.1_3'UTR	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	447			I -> R (in dbSNP:rs6843900). {ECO:0000269|PubMed:19054851}.		metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.I447R(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						AAATTATCAATAATTCAACAT	0.373													N|||	1888	0.376997	0.2678	0.4524	5008	,	,		13055	0.3819		0.4771	False		,,,				2504	0.363				p.I447R		Atlas-SNP	.											UGT2B28,NS,carcinoma,0,1	UGT2B28	101	1	1	Substitution - Missense(1)	stomach(1)	c.T1340G						scavenged	.	G	,ARG/ILE	1389,2641		443,503,1069	39.0	46.0	44.0		,1340	2.2	0.0	4	dbSNP_116	44	4242,4208		1321,1600,1304	no	utr-3,missense	UGT2B28	NM_001207004.1,NM_053039.1	,97	1764,2103,2373	GG,GT,TT		49.7988,34.4665,45.1202	,benign	,447/530	70160277	5631,6849	2015	4225	6240	SO:0001583	missense	54490	exon6			TATCAATAATTCA	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.1340T>G	4.37:g.70160277T>G	ENSP00000334276:p.Ile447Arg	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	130	5	0.0384615	NM_053039	B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	ENST00000335568.5	37	CCDS3528.1	804	0.36813186813186816	101	0.20528455284552846	146	0.40331491712707185	198	0.34615384615384615	359	0.4736147757255937	-	0	-2.861548	0.00064	0.344665	0.502012	ENSG00000135226	ENST00000335568	T	0.60040	0.22	2.17	2.17	0.27698	.	0.310296	0.24102	N	0.041536	T	0.00012	0.0000	N	0.00504	-1.425	0.09310	P	0.999999892799	B	0.02656	0.0	B	0.01281	0.0	T	0.46148	-0.9212	9	0.02654	T	1	.	7.8253	0.29311	0.0:0.0:0.7495:0.2504	rs6843900;rs52813205	447	Q9BY64	UDB28_HUMAN	R	447	ENSP00000334276:I447R	ENSP00000334276:I447R	I	+	2	0	UGT2B28	70194866	0.000000	0.05858	0.001000	0.08648	0.032000	0.12392	0.223000	0.17719	0.254000	0.21573	-1.122000	0.02009	ATA	T|0.630;G|0.370	0.370	strong		0.373	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	
STPG2	285555	hgsc.bcm.edu	37	4	98893476	98893476	+	Silent	SNP	C	C	T	rs783959	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:98893476C>T	ENST00000295268.3	-	7	977	c.888G>A	c.(886-888)tcG>tcA	p.S296S		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	296								p.S296S(2)									CTTTCTGAACCGAGAAGAAAG	0.363													C|||	2050	0.409345	0.3714	0.5403	5008	,	,		15237	0.2431		0.4751	False		,,,				2504	0.4714				p.S296S		Atlas-SNP	.											C4orf37,NS,carcinoma,0,2	.	.	2	2	Substitution - coding silent(2)	prostate(1)|stomach(1)	c.G888A						scavenged	.	C		1577,2829	492.5+/-362.4	296,985,922	82.0	82.0	82.0		888	0.3	0.0	4	dbSNP_86	82	4000,4600	552.9+/-386.2	937,2126,1237	no	coding-synonymous	C4orf37	NM_174952.2		1233,3111,2159	TT,TC,CC		46.5116,35.7921,42.8802		296/460	98893476	5577,7429	2203	4300	6503	SO:0001819	synonymous_variant	285555	exon7			CTGAACCGAGAAG	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.888G>A	4.37:g.98893476C>T		Somatic	400	1	0.0025		WXS	Illumina HiSeq	Phase_I	331	8	0.0241692	NM_174952		Silent	SNP	ENST00000295268.3	37	CCDS3645.1																																																																																			C|0.581;T|0.419	0.419	strong		0.363	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
DEPDC4	120863	hgsc.bcm.edu	37	12	100657658	100657658	+	Silent	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:100657658A>G	ENST00000416321.1	-	2	173	c.171T>C	c.(169-171)ccT>ccC	p.P57P		NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	57					intracellular signal transduction (GO:0035556)					NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						TAGCTTGAAAAGGACCAGAGC	0.333																																					p.P57P		Atlas-SNP	.											DEPDC4,NS,malignant_melanoma,-2,1	DEPDC4	34	1	0			c.T171C						scavenged	.						77.0	76.0	76.0					12																	100657658		2203	4300	6503	SO:0001819	synonymous_variant	120863	exon2			TTGAAAAGGACCA	AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.171T>C	12.37:g.100657658A>G		Somatic	319	1	0.0031348		WXS	Illumina HiSeq	Phase_I	313	4	0.0127796	NM_152317	Q496C8|Q96BW0	Silent	SNP	ENST00000416321.1	37	CCDS9075.1																																																																																			.	.	none		0.333	DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408482.1	NM_152317	
C17orf97	400566	hgsc.bcm.edu	37	17	263442	263442	+	Missense_Mutation	SNP	G	G	A	rs200834723		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:263442G>A	ENST00000360127.6	+	2	824	c.808G>A	c.(808-810)Gag>Aag	p.E270K	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	300	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.							p.E270K(1)		breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCCCGACCCTGAGGCCCTCAA	0.687																																					p.E270K		Atlas-SNP	.											C17orf97,extremity,malignant_melanoma,0,1	C17orf97	76	1	1	Substitution - Missense(1)	skin(1)	c.G808A						scavenged	.						17.0	19.0	18.0					17																	263442		2169	4241	6410	SO:0001583	missense	400566	exon2			GACCCTGAGGCCC	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.808G>A	17.37:g.263442G>A	ENSP00000353245:p.Glu270Lys	Somatic	436	2	0.00458716		WXS	Illumina HiSeq	Phase_I	351	4	0.011396	NM_001013672	A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	ENST00000360127.6	37	CCDS32519.2	.	.	.	.	.	.	.	.	.	.	G	0.210	-1.037086	0.02013	.	.	ENSG00000187624	ENST00000360127	T	0.31510	1.49	2.04	-4.08	0.03963	.	.	.	.	.	T	0.09158	0.0226	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.12837	0.008	T	0.29971	-0.9994	9	0.06494	T	0.89	.	1.3996	0.02268	0.1558:0.3108:0.3505:0.1829	.	270	Q6ZQX7-4	.	K	270	ENSP00000353245:E270K	ENSP00000353245:E270K	E	+	1	0	C17orf97	263788	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	1.107000	0.31110	-1.216000	0.02607	0.195000	0.17529	GAG	.	.	weak		0.687	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255648.4	NM_001013672	
INTS3	65123	hgsc.bcm.edu	37	1	153719461	153719461	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:153719461G>A	ENST00000318967.2	+	4	915	c.347G>A	c.(346-348)cGt>cAt	p.R116H	RP11-216N14.8_ENST00000453778.1_RNA|INTS3_ENST00000435409.2_Missense_Mutation_p.R116H|INTS3_ENST00000456435.1_5'UTR	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	116					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTGGTGAGTCGTGATGGCATG	0.488																																					p.R116H		Atlas-SNP	.											.	INTS3	83	.	0			c.G347A						PASS	.						109.0	108.0	108.0					1																	153719461		2203	4300	6503	SO:0001583	missense	65123	exon4			TGAGTCGTGATGG	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.347G>A	1.37:g.153719461G>A	ENSP00000318641:p.Arg116His	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	100	34	0.34	NM_023015	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	ENST00000318967.2	37	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	G	33	5.246806	0.95305	.	.	ENSG00000143624	ENST00000318967;ENST00000435409	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.70500	0.3231	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.72235	-0.4352	9	0.59425	D	0.04	.	15.856	0.78977	0.0:0.0:1.0:0.0	.	116	Q68E01-2	.	H	116	.	ENSP00000318641:R116H	R	+	2	0	INTS3	151986085	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.867000	0.92314	2.608000	0.88229	0.561000	0.74099	CGT	.	.	none		0.488	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
QSOX1	5768	hgsc.bcm.edu	37	1	180148012	180148012	+	Missense_Mutation	SNP	G	G	C	rs17855475	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:180148012G>C	ENST00000367602.3	+	5	673	c.599G>C	c.(598-600)gGt>gCt	p.G200A	QSOX1_ENST00000367600.5_Missense_Mutation_p.G200A			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	200			G -> A (in dbSNP:rs17855475). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16806532, ECO:0000269|Ref.4}.		cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						TCCTACCTGGGTAGAGAGGTG	0.507											OREG0014018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	497	0.0992412	0.0968	0.1081	5008	,	,		18248	0.003		0.1421	False		,,,				2504	0.1513				p.G200A		Atlas-SNP	.											.	QSOX1	79	.	0			c.G599C						PASS	.	G	ALA/GLY,ALA/GLY	557,3849	249.3+/-256.8	41,475,1687	99.0	104.0	102.0		599,599	5.9	1.0	1	dbSNP_123	102	1365,7235	264.6+/-285.7	119,1127,3054	yes	missense,missense	QSOX1	NM_001004128.2,NM_002826.4	60,60	160,1602,4741	CC,CG,GG		15.8721,12.6419,14.7778	probably-damaging,probably-damaging	200/605,200/748	180148012	1922,11084	2203	4300	6503	SO:0001583	missense	5768	exon5			ACCTGGGTAGAGA	U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.599G>C	1.37:g.180148012G>C	ENSP00000356574:p.Gly200Ala	Somatic	106	0	0	1959	WXS	Illumina HiSeq	Phase_I	89	6	0.0674157	NM_002826	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	ENST00000367602.3	37	CCDS1337.1	209	0.09569597069597069	48	0.0975609756097561	44	0.12154696132596685	1	0.0017482517482517483	116	0.15303430079155672	G	26.9	4.780744	0.90195	0.126419	0.158721	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.07800	3.19;3.16	5.91	5.91	0.95273	.	0.144731	0.64402	D	0.000007	T	0.00144	0.0004	M	0.79805	2.47	0.09310	P	0.99999999989847	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.954	T	0.00044	-1.2222	9	0.38643	T	0.18	-15.3101	17.2153	0.86941	0.0:0.0:1.0:0.0	rs17855475;rs17855475	200;200	O00391;O00391-2	QSOX1_HUMAN;.	A	200	ENSP00000356574:G200A;ENSP00000356572:G200A	ENSP00000356572:G200A	G	+	2	0	QSOX1	178414635	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.654000	0.83653	2.793000	0.96121	0.655000	0.94253	GGT	G|0.866;C|0.134	0.134	strong		0.507	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085289.1	NM_002826	
POM121	9883	hgsc.bcm.edu	37	7	72412427	72412427	+	Missense_Mutation	SNP	G	G	A	rs201876140		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:72412427G>A	ENST00000434423.2	+	11	1895	c.1895G>A	c.(1894-1896)aGc>aAc	p.S632N	POM121_ENST00000358357.3_Missense_Mutation_p.S367N|POM121_ENST00000446813.1_Missense_Mutation_p.S367N|POM121_ENST00000257622.4_Missense_Mutation_p.S367N|POM121_ENST00000395270.1_Missense_Mutation_p.S367N			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	632	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.S367N(2)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				AAGACACCCAGCCTCCTACCC	0.547																																					p.S367N		Atlas-SNP	.											POM121,NS,malignant_melanoma,0,2	POM121	131	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.G1100A						scavenged	.						3.0	3.0	3.0					7																	72412427		1270	2943	4213	SO:0001583	missense	9883	exon11			CACCCAGCCTCCT	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.1895G>A	7.37:g.72412427G>A	ENSP00000405562:p.Ser632Asn	Somatic	362	21	0.0580111		WXS	Illumina HiSeq	Phase_I	415	37	0.0891566	NM_172020	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000434423.2	37		.	.	.	.	.	.	.	.	.	.	G	7.496	0.651738	0.14516	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.08102	3.13;3.17;3.13;3.17;3.39	2.7	2.7	0.31948	.	0.155531	0.31257	N	0.007975	T	0.09862	0.0242	L	0.58969	1.84	0.43263	D	0.995207	P;P	0.36535	0.557;0.554	B;B	0.35971	0.215;0.157	T	0.12066	-1.0562	10	0.49607	T	0.09	.	10.9555	0.47356	0.0:0.0:1.0:0.0	.	367;632	A8MXF9;Q96HA1	.;P121A_HUMAN	N	367;367;367;367;632	ENSP00000393020:S367N;ENSP00000257622:S367N;ENSP00000378687:S367N;ENSP00000351124:S367N;ENSP00000405562:S632N	ENSP00000257622:S367N	S	+	2	0	POM121	72050363	0.502000	0.26107	0.893000	0.35052	0.018000	0.09664	1.430000	0.34914	1.503000	0.48686	0.173000	0.16961	AGC	.	.	weak		0.547	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
CALU	813	hgsc.bcm.edu	37	7	128394606	128394606	+	Intron	SNP	C	C	T	rs2307040	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:128394606C>T	ENST00000249364.4	+	3	517				CALU_ENST00000535011.2_Intron|CALU_ENST00000542996.2_Missense_Mutation_p.A90V|CALU_ENST00000449187.2_Missense_Mutation_p.A82V|CALU_ENST00000538546.1_Intron|CALU_ENST00000535623.1_3'UTR|CALU_ENST00000479257.1_Intron	NM_001219.4	NP_001210.1	O43852	CALU_HUMAN	calumenin						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)	p.A90V(1)		kidney(2)|large_intestine(3)|lung(5)	10						AAAATAGACGCGGATAAAGAT	0.443													C|||	888	0.177316	0.1127	0.2233	5008	,	,		19129	0.0585		0.3728	False		,,,				2504	0.1534				p.A90V		Atlas-SNP	.											CALU_ENST00000542996,NS,carcinoma,0,1	CALU	42	1	1	Substitution - Missense(1)	stomach(1)	c.C269T						scavenged	.	C	VAL/ALA,,VAL/ALA,,,	181,1203		11,159,522	83.0	74.0	76.0		245,,269,,,	0.2	1.0	7	dbSNP_100	76	1182,2000		224,734,633	yes	missense,intron,missense,intron,intron,intron	CALU	NM_001130674.2,NM_001199671.1,NM_001199672.1,NM_001199673.1,NM_001199674.1,NM_001219.4	64,,64,,,	235,893,1155	TT,TC,CC		37.1464,13.078,29.8511	,,,,,	82/316,,90/324,,,	128394606	1363,3203	692	1591	2283	SO:0001627	intron_variant	813	exon4			TAGACGCGGATAA	AF013759	CCDS5805.1, CCDS47703.1, CCDS56506.1, CCDS56507.1, CCDS56508.1	7q32	2013-01-10			ENSG00000128595	ENSG00000128595		"""EF-hand domain containing"""	1458	protein-coding gene	gene with protein product		603420				9598325	Standard	NM_001219		Approved		uc003vnq.3	O43852	OTTHUMG00000158274	ENST00000249364.4:c.415+97C>T	7.37:g.128394606C>T		Somatic	193	0	0		WXS	Illumina HiSeq	Phase_I	336	4	0.0119048	NM_001199672	B3KPG9|D6QS48|D6QS49|D6QS50|D6QS51|D6QS52|D6QS53|D6QS54|D6QS55|D6QS56|D6QS57|D6QS58|D6QS59|F5H1Q9|F5H879|O60456|Q6FHB9|Q96RL3|Q9NR43	Missense_Mutation	SNP	ENST00000249364.4	37	CCDS5805.1	459	0.21016483516483517	62	0.12601626016260162	95	0.26243093922651933	28	0.04895104895104895	274	0.36147757255936674	C	10.84	1.465452	0.26335	0.13078	0.371464	ENSG00000128595	ENST00000542996;ENST00000537667;ENST00000537014;ENST00000449187	T;T	0.70399	-0.48;-0.48	5.96	0.244	0.15507	.	.	.	.	.	T	0.00012	0.0000	N	0.11201	0.11	0.80722	P	0.0	B	0.13145	0.007	B	0.12837	0.008	T	0.32693	-0.9897	8	0.22109	T	0.4	.	5.664	0.17684	0.0:0.4412:0.1377:0.4211	rs2307040;rs11545530;rs52803804;rs2307040	90	D6QS48	.	V	90;82;82;82	ENSP00000438248:A90V;ENSP00000408838:A82V	ENSP00000408838:A82V	A	+	2	0	CALU	128181842	0.000000	0.05858	0.959000	0.39883	0.990000	0.78478	-0.365000	0.07573	0.092000	0.17331	-0.136000	0.14681	GCG	C|0.785;T|0.215	0.215	strong		0.443	CALU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350533.1	NM_001219	
C2orf71	388939	hgsc.bcm.edu	37	2	29296870	29296870	+	Silent	SNP	C	C	T	rs62132765	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:29296870C>T	ENST00000331664.5	-	1	257	c.258G>A	c.(256-258)agG>agA	p.R86R		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	86					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						CCATATCTTTCCTTTTGCCTG	0.512													C|||	557	0.111222	0.0129	0.1527	5008	,	,		20671	0.123		0.2137	False		,,,				2504	0.0971				p.R86R		Atlas-SNP	.											C2orf71,rectum,carcinoma,-1,1	C2orf71	146	1	0			c.G258A						scavenged	.	C		189,3673		4,181,1746	213.0	196.0	202.0		258	1.3	0.0	2	dbSNP_129	202	1854,6434		192,1470,2482	no	coding-synonymous	C2orf71	NM_001029883.1		196,1651,4228	TT,TC,CC		22.3697,4.8938,16.8148		86/1289	29296870	2043,10107	1931	4144	6075	SO:0001819	synonymous_variant	388939	exon1			ATCTTTCCTTTTG		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.258G>A	2.37:g.29296870C>T		Somatic	174	1	0.00574713		WXS	Illumina HiSeq	Phase_I	183	5	0.0273224	NM_001029883		Silent	SNP	ENST00000331664.5	37	CCDS42669.1																																																																																			C|0.825;T|0.175	0.175	strong		0.512	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
EFEMP2	30008	hgsc.bcm.edu	37	11	65638719	65638719	+	Silent	SNP	G	G	A	rs633800	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:65638719G>A	ENST00000307998.6	-	4	506	c.276C>T	c.(274-276)caC>caT	p.H92H	EFEMP2_ENST00000528176.1_Silent_p.H92H	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	92					blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		GTCCCTCGCCGTGTAGGTCGT	0.647													G|||	1608	0.321086	0.0953	0.3127	5008	,	,		17334	0.2262		0.503	False		,,,				2504	0.5429				p.H92H		Atlas-SNP	.											.	EFEMP2	42	.	0			c.C276T						PASS	.	G		703,3699	293.0+/-282.3	52,599,1550	95.0	105.0	102.0		276	-2.5	0.7	11	dbSNP_83	102	4451,4141	588.0+/-392.3	1139,2173,984	no	coding-synonymous	EFEMP2	NM_016938.4		1191,2772,2534	AA,AG,GG		48.196,15.97,39.6645		92/444	65638719	5154,7840	2201	4296	6497	SO:0001819	synonymous_variant	30008	exon4			CTCGCCGTGTAGG	AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.276C>T	11.37:g.65638719G>A		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	133	7	0.0526316	NM_016938	A8K7R4|B3KM31|B3KQT1|O75967	Silent	SNP	ENST00000307998.6	37	CCDS8116.1																																																																																			G|0.642;A|0.358	0.358	strong		0.647	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4	NM_016938	
LGMN	5641	hgsc.bcm.edu	37	14	93171022	93171022	+	Silent	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:93171022G>A	ENST00000393218.2	-	14	1559	c.1222C>T	c.(1222-1224)Ctg>Ttg	p.L408L	LGMN_ENST00000555699.1_Intron|LGMN_ENST00000334869.4_Silent_p.L408L|LGMN_ENST00000557434.1_Silent_p.L351L	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	408					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		AGGTTGACCAGCACGTACAAA	0.468																																					p.L408L		Atlas-SNP	.											.	LGMN	28	.	0			c.C1222T						PASS	.						183.0	172.0	175.0					14																	93171022		2203	4300	6503	SO:0001819	synonymous_variant	5641	exon13			TGACCAGCACGTA	D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.1222C>T	14.37:g.93171022G>A		Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	125	8	0.064	NM_005606	O00123|Q86TV2|Q86TV3|Q9BTY1	Silent	SNP	ENST00000393218.2	37	CCDS9904.1																																																																																			.	.	none		0.468	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412288.1	NM_005606	
OPRK1	4986	hgsc.bcm.edu	37	8	54142312	54142312	+	Missense_Mutation	SNP	C	C	T	rs186551684		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:54142312C>T	ENST00000265572.3	-	4	985	c.688G>A	c.(688-690)Gtc>Atc	p.V230I	OPRK1_ENST00000524278.1_Missense_Mutation_p.V141I|OPRK1_ENST00000520287.1_Missense_Mutation_p.V230I|RP11-162D9.3_ENST00000524425.1_RNA	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	230					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AAGATGAAGACGCAGATCTTC	0.527													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19957	0.0		0.0	False		,,,				2504	0.0				p.V230I		Atlas-SNP	.											OPRK1,colon,carcinoma,0,1	OPRK1	90	1	0			c.G688A						PASS	.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	76.0	82.0	80.0		688	5.7	1.0	8		80	0,8600		0,0,4300	no	missense	OPRK1	NM_000912.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	230/381	54142312	1,13005	2203	4300	6503	SO:0001583	missense	4986	exon4			TGAAGACGCAGAT		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.688G>A	8.37:g.54142312C>T	ENSP00000265572:p.Val230Ile	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	122	41	0.336066	NM_000912	E5RHC9|Q499G4	Missense_Mutation	SNP	ENST00000265572.3	37	CCDS6152.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	21.7	4.189259	0.78789	2.27E-4	0.0	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.71817	-0.6;-0.6;-0.6	5.7	5.7	0.88788	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.76681	0.4021	L	0.31664	0.95	0.80722	D	1	D	0.76494	0.999	D	0.64595	0.927	T	0.75572	-0.3271	10	0.41790	T	0.15	.	19.8351	0.96655	0.0:1.0:0.0:0.0	.	230	P41145	OPRK_HUMAN	I	230;141;230;216	ENSP00000265572:V230I;ENSP00000430923:V141I;ENSP00000429706:V230I	ENSP00000265572:V230I	V	-	1	0	OPRK1	54304865	1.000000	0.71417	0.973000	0.42090	0.620000	0.37586	7.818000	0.86416	2.693000	0.91896	0.650000	0.86243	GTC	C|1.000;T|0.000	0.000	strong		0.527	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
NANOG	79923	hgsc.bcm.edu	37	12	7945559	7945559	+	Silent	SNP	T	T	C	rs386760025|rs4294629	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:7945559T>C	ENST00000229307.4	+	2	384	c.165T>C	c.(163-165)ccT>ccC	p.P55P	NANOG_ENST00000526286.1_Silent_p.P55P	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	55					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		CTCCTCTTCCTTCCTCCATGG	0.373													T|||	1901	0.379593	0.3313	0.5259	5008	,	,		-128	0.0536		0.5915	False		,,,				2504	0.4591				p.P55P		Atlas-SNP	.											NANOG,NS,malignant_melanoma,+2,1	NANOG	30	1	0			c.T165C						scavenged	.	T		1599,2807		285,1029,889	106.0	109.0	108.0		165	0.5	0.9	12	dbSNP_111	108	4981,3619		1448,2085,767	no	coding-synonymous	NANOG	NM_024865.2		1733,3114,1656	CC,CT,TT		42.0814,36.2914,49.408		55/306	7945559	6580,6426	2203	4300	6503	SO:0001819	synonymous_variant	79923	exon2			TCTTCCTTCCTCC	AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		ENST00000229307.4:c.165T>C	12.37:g.7945559T>C		Somatic	394	0	0		WXS	Illumina HiSeq	Phase_I	464	6	0.012931	NM_024865	D3DUU4|Q2TTG0|Q6JZS5	Silent	SNP	ENST00000229307.4	37	CCDS31736.1																																																																																			T|0.548;C|0.452	0.452	strong		0.373	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387480.2	NM_024865	
BRAT1	221927	hgsc.bcm.edu	37	7	2583328	2583328	+	Silent	SNP	C	C	T	rs61753095	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:2583328C>T	ENST00000340611.4	-	5	955	c.699G>A	c.(697-699)acG>acA	p.T233T	BRAT1_ENST00000473879.1_5'Flank	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	233					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						ACAGGGCTTCCGTCCAGGGGC	0.662													C|||	482	0.096246	0.0106	0.1859	5008	,	,		13569	0.0079		0.1819	False		,,,				2504	0.1513				p.T233T		Atlas-SNP	.											BRAT1,NS,carcinoma,0,1	BRAT1	57	1	0			c.G699A						scavenged	.	C		207,4199	122.1+/-159.5	7,193,2003	35.0	42.0	40.0		699	-11.4	0.0	7	dbSNP_129	40	1761,6837	307.3+/-308.3	179,1403,2717	no	coding-synonymous	BRAT1	NM_152743.3		186,1596,4720	TT,TC,CC		20.4815,4.6981,15.1338		233/822	2583328	1968,11036	2203	4299	6502	SO:0001819	synonymous_variant	221927	exon5			GGCTTCCGTCCAG	BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.699G>A	7.37:g.2583328C>T		Somatic	141	1	0.0070922		WXS	Illumina HiSeq	Phase_I	177	5	0.0282486	NM_152743	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Silent	SNP	ENST00000340611.4	37	CCDS5334.1																																																																																			C|0.871;T|0.129	0.129	strong		0.662	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239305.2	NM_152743	
PLG	5340	hgsc.bcm.edu	37	6	161132146	161132146	+	Silent	SNP	C	C	T	rs4757	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:161132146C>T	ENST00000308192.9	+	4	393	c.330C>T	c.(328-330)aaC>aaT	p.N110N	PLG_ENST00000462918.1_3'UTR|PLG_ENST00000366924.2_Silent_p.N110N	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	110	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ATGGAAAGAACTACAGAGGGA	0.453													C|||	1249	0.249401	0.5083	0.2248	5008	,	,		21058	0.001		0.3012	False		,,,				2504	0.1196				p.N110N		Atlas-SNP	.											.	PLG	150	.	0			c.C330T						PASS	.	C	,	2084,2322	573.3+/-383.5	478,1128,597	111.0	98.0	103.0		330,330	1.2	0.9	6	dbSNP_52	103	2713,5883	434.7+/-357.8	407,1899,1992	no	coding-synonymous,coding-synonymous	PLG	NM_000301.3,NM_001168338.1	,	885,3027,2589	TT,TC,CC		31.5612,47.2991,36.8943	,	110/811,110/137	161132146	4797,8205	2203	4298	6501	SO:0001819	synonymous_variant	5340	exon4			AAAGAACTACAGA	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.330C>T	6.37:g.161132146C>T		Somatic	192	0	0		WXS	Illumina HiSeq	Phase_I	220	10	0.0454545	NM_001168338	Q15146|Q5TEH4|Q6PA00	Silent	SNP	ENST00000308192.9	37	CCDS5279.1																																																																																			C|0.671;T|0.329	0.329	strong		0.453	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
WDR43	23160	hgsc.bcm.edu	37	2	29152456	29152456	+	Silent	SNP	A	A	G	rs1140697	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:29152456A>G	ENST00000407426.3	+	11	1373	c.1317A>G	c.(1315-1317)gaA>gaG	p.E439E	SNORD53_ENST00000579969.1_RNA|Y_RNA_ENST00000410292.1_RNA|SNORD53_SNORD92_ENST00000577887.1_RNA	NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	439						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					TTAGCATTGAAGAACGTCTGG	0.348													A|||	2092	0.417732	0.3601	0.4265	5008	,	,		16718	0.0704		0.6889	False		,,,				2504	0.5685				p.E439E		Atlas-SNP	.											WDR43,NS,carcinoma,+2,1	WDR43	38	1	0			c.A1317G						scavenged	.	A		1579,2091		342,895,598	83.0	80.0	81.0		1317	3.5	1.0	2	dbSNP_86	81	5890,2302		2106,1678,312	no	coding-synonymous	WDR43	NM_015131.1		2448,2573,910	GG,GA,AA		28.1006,43.0245,37.0342		439/678	29152456	7469,4393	1835	4096	5931	SO:0001819	synonymous_variant	23160	exon11			CATTGAAGAACGT	D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.1317A>G	2.37:g.29152456A>G		Somatic	283	1	0.00353357		WXS	Illumina HiSeq	Phase_I	318	12	0.0377358	NM_015131	Q15395|Q92577	Silent	SNP	ENST00000407426.3	37	CCDS46251.1																																																																																			A|0.564;G|0.436	0.436	strong		0.348	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324865.1	XM_087089	
DHX38	9785	hgsc.bcm.edu	37	16	72130815	72130815	+	Silent	SNP	C	C	A	rs1050362	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:72130815C>A	ENST00000268482.3	+	3	927	c.418C>A	c.(418-420)Cgg>Agg	p.R140R	TXNL4B_ENST00000426362.2_5'Flank|DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	140					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				GCGGGAGCGGCGGGAACATGG	0.537													C|||	2395	0.478235	0.7874	0.3156	5008	,	,		19363	0.3105		0.3549	False		,,,				2504	0.4755				p.R140R	Melanoma(97;711 1442 7855 13832 28836)	Atlas-SNP	.											DHX38,right_upper_lobe,carcinoma,-2,2	DHX38	91	2	0			c.C418A						scavenged	.	C		3048,1348	692.2+/-405.5	1072,904,222	151.0	146.0	148.0		418	4.1	1.0	16	dbSNP_86	148	3214,5386	484.9+/-371.5	591,2032,1677	no	coding-synonymous	DHX38	NM_014003.3		1663,2936,1899	AA,AC,CC		37.3721,30.6642,48.1841		140/1228	72130815	6262,6734	2198	4300	6498	SO:0001819	synonymous_variant	9785	exon3			GAGCGGCGGGAAC	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.418C>A	16.37:g.72130815C>A		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	130	5	0.0384615	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Silent	SNP	ENST00000268482.3	37	CCDS10907.1																																																																																			C|0.529;A|0.471	0.471	strong		0.537	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
ARID3B	10620	hgsc.bcm.edu	37	15	74836319	74836319	+	Silent	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:74836319A>G	ENST00000346246.5	+	2	273	c.42A>G	c.(40-42)caA>caG	p.Q14Q		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	14	Gln-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						agcagcaacaacagaagcagc	0.562																																					p.Q14Q		Atlas-SNP	.											ARID3B,right_lower_lobe,carcinoma,0,1	ARID3B	35	1	0			c.A42G						scavenged	.						18.0	21.0	20.0					15																	74836319		2196	4294	6490	SO:0001819	synonymous_variant	10620	exon2			GCAACAACAGAAG		CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.42A>G	15.37:g.74836319A>G		Somatic	100	5	0.05		WXS	Illumina HiSeq	Phase_I	92	9	0.0978261	NM_006465	O95443|Q59HC9|Q6P9C9	Silent	SNP	ENST00000346246.5	37	CCDS10264.1																																																																																			.	.	none		0.562	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280688.2	NM_006465	
TCF3	6929	hgsc.bcm.edu	37	19	1646364	1646364	+	Silent	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:1646364G>A	ENST00000262965.5	-	3	479	c.135C>T	c.(133-135)ttC>ttT	p.F45F	TCF3_ENST00000395423.3_Silent_p.F45F|TCF3_ENST00000588136.1_Silent_p.F45F|TCF3_ENST00000344749.5_Silent_p.F45F	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0	CTNNB1-binding. {ECO:0000250}.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGAACCTCCGAACTGCGCCC	0.697			T	"""PBX1, HLF, TFPT"""	pre B-ALL																																p.F45F		Atlas-SNP	.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3	72	.	0			c.C135T						PASS	.						18.0	15.0	16.0					19																	1646364		1788	3411	5199	SO:0001819	synonymous_variant	6929	exon3			ACCTCCGAACTGC	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.135C>T	19.37:g.1646364G>A		Somatic	204	0	0		WXS	Illumina HiSeq	Phase_I	145	6	0.0413793	NM_003200	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			.	.	none		0.697	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
ZNF45	7596	hgsc.bcm.edu	37	19	44417575	44417575	+	Silent	SNP	A	A	G	rs417699	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:44417575A>G	ENST00000269973.5	-	10	3103	c.2013T>C	c.(2011-2013)ttT>ttC	p.F671F	RP11-15A1.2_ENST00000586247.1_RNA|ZNF45_ENST00000589703.1_Silent_p.F671F	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	671					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						CTGATGAAGGAAAGTCCTTGT	0.398													A|||	2712	0.541534	0.388	0.6585	5008	,	,		21581	0.8046		0.5149	False		,,,				2504	0.4223				p.F671F		Atlas-SNP	.											ZNF45,NS,carcinoma,-2,2	ZNF45	51	2	0			c.T2013C						PASS	.	A		1758,2648		357,1044,802	75.0	69.0	71.0		2013	-3.6	0.0	19	dbSNP_80	71	4342,4258		1118,2106,1076	no	coding-synonymous	ZNF45	NM_003425.3		1475,3150,1878	GG,GA,AA		49.5116,39.9001,46.9014		671/683	44417575	6100,6906	2203	4300	6503	SO:0001819	synonymous_variant	7596	exon10			TGAAGGAAAGTCC	M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.2013T>C	19.37:g.44417575A>G		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	63	6	0.0952381	NM_003425	P17016|P78472|Q9P1U9	Silent	SNP	ENST00000269973.5	37	CCDS12632.1																																																																																			A|0.474;G|0.526	0.526	strong		0.398	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459919.1	NM_003425	
HLA-C	3107	hgsc.bcm.edu	37	6	31239501	31239501	+	Missense_Mutation	SNP	G	G	T	rs1050409	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:31239501G>T	ENST00000376228.5	-	2	232	c.218C>A	c.(217-219)gCg>gAg	p.A73E	HLA-C_ENST00000383329.3_Missense_Mutation_p.A73E	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	73	Alpha-1.		A -> E (in dbSNP:rs1050409).		antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CACCCACGGCGCCCGCGGCTC	0.692													g|||	711	0.141973	0.2436	0.1873	5008	,	,		12237	0.0367		0.1382	False		,,,				2504	0.0849				p.A73E		Atlas-SNP	.											HLA-C_ENST00000383329,NS,carcinoma,0,2	HLA-C	92	2	0			c.C218A						scavenged	.	G	GLU/ALA	574,2448		59,456,996	39.0	41.0	41.0		218	1.9	1.0	6	dbSNP_86	41	610,4806		35,540,2133	no	missense	HLA-C	NM_002117.5	107	94,996,3129	TT,TG,GG		11.2629,18.994,14.0318	probably-damaging	73/367	31239501	1184,7254	1511	2708	4219	SO:0001583	missense	3107	exon2			CACGGCGCCCGCG	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.218C>A	6.37:g.31239501G>T	ENSP00000365402:p.Ala73Glu	Somatic	203	0	0		WXS	Illumina HiSeq	Phase_I	179	4	0.0223464	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	304	0.1391941391941392	107	0.21747967479674796	70	0.19337016574585636	28	0.04895104895104895	99	0.13060686015831136	-	11.77	1.738587	0.30774	0.18994	0.112629	ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	T;T	0.00902	5.56;5.56	2.81	1.93	0.25924	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.819950	0.09843	U	0.748660	T	0.02047	0.0064	H	0.99825	4.815	0.40039	P	0.02437199999999995	B;B;B;B	0.21309	0.054;0.022;0.022;0.022	B;B;B;B	0.29267	0.068;0.042;0.068;0.1	T	0.11717	-1.0576	9	0.66056	D	0.02	.	5.723	0.17998	0.1547:0.0:0.8453:0.0	rs1050409;rs2308553;rs3173349;rs16895974	73;73;73;73	A2AEA4;A6H578;A2AEA2;P10321	.;.;.;1C07_HUMAN	E	73;73;73;110	ENSP00000365402:A73E;ENSP00000372819:A73E	ENSP00000365402:A73E	A	-	2	0	HLA-C	31347480	0.000000	0.05858	0.998000	0.56505	0.176000	0.22953	0.281000	0.18810	0.751000	0.32900	0.305000	0.20034	GCG	T|0.136;G|0.864	0.136	strong		0.692	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
SPRR3	6707	hgsc.bcm.edu	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000331860.3_Silent_p.G73G|SPRR3_ENST00000542696.1_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		Atlas-SNP	.											SPRR3,colon,carcinoma,0,3	SPRR3	45	3	0			c.C219T						PASS	.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	48	9	0.1875	NM_001097589	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			.	.	none		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
CCDC157	550631	hgsc.bcm.edu	37	22	30765502	30765502	+	Silent	SNP	G	G	A	rs5749080	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr22:30765502G>A	ENST00000405659.1	+	4	1039	c.330G>A	c.(328-330)gcG>gcA	p.A110A	CCDC157_ENST00000338306.3_Silent_p.A110A			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	110										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						CACAGGCTGCGGGGCCCTGCA	0.652													G|||	768	0.153355	0.1324	0.1571	5008	,	,		17743	0.1458		0.2545	False		,,,				2504	0.0828				p.A110A		Atlas-SNP	.											.	CCDC157	86	.	0			c.G330A						PASS	.	G		680,3726	280.2+/-275.2	69,542,1592	41.0	40.0	41.0		330	-10.6	0.0	22	dbSNP_114	41	2211,6389	372.6+/-336.7	289,1633,2378	no	coding-synonymous	CCDC157	NM_001017437.2		358,2175,3970	AA,AG,GG		25.7093,15.4335,22.2282		110/753	30765502	2891,10115	2203	4300	6503	SO:0001819	synonymous_variant	550631	exon4			GGCTGCGGGGCCC	BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.330G>A	22.37:g.30765502G>A		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	51	5	0.0980392	NM_001017437	Q0VD76|Q9BYA4	Silent	SNP	ENST00000405659.1	37	CCDS33632.2																																																																																			A|0.198;C|0.000;G|0.802	0.198	strong		0.652	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320936.1	NM_001017437	
KRTAP27-1	643812	hgsc.bcm.edu	37	21	31709691	31709691	+	Missense_Mutation	SNP	G	G	A	rs2244485	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr21:31709691G>A	ENST00000382835.2	-	1	321	c.296C>T	c.(295-297)gCg>gTg	p.A99V		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	99			A -> V (in dbSNP:rs2244485).			intermediate filament (GO:0005882)				endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						TGATTGGCACGCTGTCCTTTC	0.502													G|||	1609	0.321286	0.1793	0.3473	5008	,	,		20460	0.2639		0.4503	False		,,,				2504	0.4213				p.A99V		Atlas-SNP	.											KRTAP27-1,NS,carcinoma,-1,1	KRTAP27-1	53	1	0			c.C296T						scavenged	.	G	VAL/ALA	979,3427	367.8+/-318.4	108,763,1332	133.0	133.0	133.0		296	0.3	0.0	21	dbSNP_100	133	4174,4426	568.2+/-389.0	1012,2150,1138	yes	missense	KRTAP27-1	NM_001077711.1	64	1120,2913,2470	AA,AG,GG		48.5349,22.2197,39.6202	benign	99/208	31709691	5153,7853	2203	4300	6503	SO:0001583	missense	643812	exon1			TGGCACGCTGTCC	AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.296C>T	21.37:g.31709691G>A	ENSP00000372286:p.Ala99Val	Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	131	4	0.0305344	NM_001077711		Missense_Mutation	SNP	ENST00000382835.2	37	CCDS33532.1	674	0.3086080586080586	81	0.16463414634146342	127	0.35082872928176795	126	0.2202797202797203	340	0.44854881266490765	G	5.791	0.330292	0.10956	0.222197	0.485349	ENSG00000206107	ENST00000382835	T	0.03301	3.98	4.44	0.262	0.15597	.	2.953730	0.01681	N	0.026127	T	0.00012	0.0000	L	0.36672	1.1	0.80722	P	0.0	P	0.40032	0.699	B	0.32677	0.15	T	0.44019	-0.9355	9	0.34782	T	0.22	2.1633	4.478	0.11753	0.2144:0.3548:0.4308:0.0	rs2244485;rs17593215;rs56539537;rs2244485	99	Q3LI81	KR271_HUMAN	V	99	ENSP00000372286:A99V	ENSP00000372286:A99V	A	-	2	0	KRTAP27-1	30631562	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.536000	0.23129	0.039000	0.15632	0.591000	0.81541	GCG	G|0.654;A|0.346	0.346	strong		0.502	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711	
SALL2	6297	hgsc.bcm.edu	37	14	21991626	21991626	+	Missense_Mutation	SNP	C	C	G	rs1263810	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:21991626C>G	ENST00000327430.3	-	2	2530	c.2236G>C	c.(2236-2238)Ggg>Cgg	p.G746R	SALL2_ENST00000450879.2_Missense_Mutation_p.G609R|SALL2_ENST00000538754.1_Intron|SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	746			G -> R (in dbSNP:rs1263810). {ECO:0000269|PubMed:8975705, ECO:0000269|PubMed:9205841, ECO:0000269|Ref.6}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GGGAAACTCCCTGCCCCGGAG	0.597													C|||	1223	0.244209	0.1059	0.1556	5008	,	,		18594	0.2579		0.3549	False		,,,				2504	0.3661				p.G746R		Atlas-SNP	.											.	SALL2	95	.	0			c.G2236C						PASS	.	C	ARG/GLY	650,3756	277.5+/-273.7	51,548,1604	56.0	49.0	51.0		2236	4.8	1.0	14	dbSNP_87	51	2904,5696	453.1+/-363.1	496,1912,1892	yes	missense	SALL2	NM_005407.1	125	547,2460,3496	GG,GC,CC		33.7674,14.7526,27.3258	probably-damaging	746/1008	21991626	3554,9452	2203	4300	6503	SO:0001583	missense	6297	exon2			AACTCCCTGCCCC	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2236G>C	14.37:g.21991626C>G	ENSP00000333537:p.Gly746Arg	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	54	4	0.0740741	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	552|552	0.25274725274725274|0.25274725274725274	52|52	0.10569105691056911|0.10569105691056911	70|70	0.19337016574585636|0.19337016574585636	157|157	0.2744755244755245|0.2744755244755245	273|273	0.36015831134564646|0.36015831134564646	C|C	15.46|15.46	2.840915|2.840915	0.51057|0.51057	0.147526|0.147526	0.337674|0.337674	ENSG00000165821|ENSG00000165821	ENST00000327430;ENST00000450879|ENST00000546363	T;T|.	0.04551|.	3.66;3.6|.	4.76|4.76	4.76|4.76	0.60689|0.60689	.|.	0.000000|.	0.39687|.	N|.	0.001296|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.27053|0.27053	0.805|0.805	0.24034|0.24034	P|P	0.99610114|0.99610114	B;B;B|.	0.17667|.	0.023;0.023;0.023|.	B;B;B|.	0.18263|.	0.021;0.021;0.021|.	T|T	0.43861|0.43861	-0.9365|-0.9365	9|4	0.38643|.	T|.	0.18|.	-27.9051|-27.9051	8.8209|8.8209	0.35025|0.35025	0.0:0.8999:0.0:0.1001|0.0:0.8999:0.0:0.1001	rs1263810;rs1754631;rs17792718;rs1263810|rs1263810;rs1754631;rs17792718;rs1263810	609;507;746|.	E7EW59;B4DFD9;Q9Y467|.	.;.;SALL2_HUMAN|.	R|H	746;609|604	ENSP00000333537:G746R;ENSP00000396773:G609R|.	ENSP00000333537:G746R|.	G|Q	-|-	1|3	0|2	SALL2|SALL2	21061466|21061466	0.008000|0.008000	0.16893|0.16893	0.964000|0.964000	0.40570|0.40570	0.128000|0.128000	0.20619|0.20619	0.893000|0.893000	0.28336|0.28336	2.468000|2.468000	0.83385|0.83385	0.563000|0.563000	0.77884|0.77884	GGG|CAG	C|0.711;G|0.289	0.289	strong		0.597	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
SLC38A6	145389	hgsc.bcm.edu	37	14	61550378	61550378	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:61550378G>A	ENST00000354886.2	+	17	1678	c.1514G>A	c.(1513-1515)cGt>cAt	p.R505H	SLC38A6_ENST00000456840.2_Missense_Mutation_p.V484M	NM_001172702.1	NP_001166173.1	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6	0					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		agaaccaaacgtgtccacacc	0.478																																					p.R505H		Atlas-SNP	.											.	SLC38A6	87	.	0			c.G1514A						PASS	.																																			SO:0001583	missense	145389	exon17			CCAAACGTGTCCA	AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335	ENST00000354886.2:c.1514G>A	14.37:g.61550378G>A	ENSP00000346959:p.Arg505His	Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	24	15	0.625	NM_001172702	C9JWA6|Q86SY5	Missense_Mutation	SNP	ENST00000354886.2	37	CCDS53900.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.89|14.89	2.670972|2.670972	0.47781|0.47781	.|.	.|.	ENSG00000139974|ENSG00000139974	ENST00000354886;ENST00000451406|ENST00000456840	T;T|T	0.06294|0.06608	3.32;3.32|3.28	2.8|2.8	-0.176|-0.176	0.13311|0.13311	.|.	.|.	.|.	.|.	.|.	T|T	0.04137|0.04137	0.0115|0.0115	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.01281	0.0|0.0	T|T	0.44298|0.44298	-0.9337|-0.9337	8|8	0.87932|0.56958	D|D	0|0.05	.|.	0.479|0.479	0.00544|0.00544	0.2013:0.35:0.1969:0.2518|0.2013:0.35:0.1969:0.2518	.|.	505|484	Q8IZM9-2|E7ETF2	.|.	H|M	505;500|484	ENSP00000346959:R505H;ENSP00000395851:R500H|ENSP00000413863:V484M	ENSP00000346959:R505H|ENSP00000413863:V484M	R|V	+|+	2|1	0|0	SLC38A6|SLC38A6	60620131|60620131	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.119000|-0.119000	0.10676|0.10676	-0.303000|-0.303000	0.08856|0.08856	-1.816000|-1.816000	0.00601|0.00601	CGT|GTG	.	.	none		0.478	SLC38A6-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
MGAM	8972	hgsc.bcm.edu	37	7	141756637	141756637	+	Silent	SNP	G	G	A	rs181422456	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:141756637G>A	ENST00000549489.2	+	30	3683	c.3588G>A	c.(3586-3588)acG>acA	p.T1196T	MGAM_ENST00000475668.2_Silent_p.T1196T	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1196	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CAGATGTGACGTTCCAGCCCC	0.522													g|||	3	0.000599042	0.0008	0.0029	5008	,	,		14732	0.0		0.0	False		,,,				2504	0.0				p.T1196T		Atlas-SNP	.											.	MGAM	767	.	0			c.G3588A						PASS	.						78.0	77.0	77.0					7																	141756637		1990	4160	6150	SO:0001819	synonymous_variant	8972	exon30			TGTGACGTTCCAG	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3588G>A	7.37:g.141756637G>A		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	69	15	0.217391	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	37	CCDS47727.1																																																																																			G|1.000;A|0.000	0.000	strong		0.522	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
TROAP	10024	hgsc.bcm.edu	37	12	49723963	49723963	+	Silent	SNP	A	A	G	rs4243545	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:49723963A>G	ENST00000257909.3	+	13	1411	c.1335A>G	c.(1333-1335)gaA>gaG	p.E445E	TROAP_ENST00000547923.1_Silent_p.E153E|TROAP_ENST00000551245.1_Silent_p.E445E	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	445					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)		p.E445E(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						TGAGACAGGAAGTAGAGGGGC	0.532													G|||	972	0.194089	0.4123	0.1138	5008	,	,		19065	0.0407		0.1531	False		,,,				2504	0.1564				p.E445E		Atlas-SNP	.											TROAP,NS,carcinoma,0,1	TROAP	80	1	1	Substitution - coding silent(1)	stomach(1)	c.A1335G						scavenged	.	G		1686,2720	629.2+/-395.2	314,1058,831	105.0	110.0	108.0		1335	1.6	0.8	12	dbSNP_111	108	1408,7188	725.2+/-406.5	122,1164,3012	no	coding-synonymous	TROAP	NM_005480.3		436,2222,3843	GG,GA,AA		16.3797,38.266,23.7963		445/779	49723963	3094,9908	2203	4298	6501	SO:0001819	synonymous_variant	10024	exon13			ACAGGAAGTAGAG	U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.1335A>G	12.37:g.49723963A>G		Somatic	189	1	0.00529101		WXS	Illumina HiSeq	Phase_I	183	7	0.0382514	NM_005480	F8VSF9|Q6PJU7|Q8N5B2	Silent	SNP	ENST00000257909.3	37	CCDS8784.1																																																																																			A|0.789;G|0.211	0.211	strong		0.532	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480	
ZNF585A	199704	hgsc.bcm.edu	37	19	37642917	37642917	+	Silent	SNP	G	G	A	rs77675231	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:37642917G>A	ENST00000356958.4	-	5	2142	c.1884C>T	c.(1882-1884)caC>caT	p.H628H	ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000292841.5_Silent_p.H573H|ZNF585A_ENST00000392157.2_Silent_p.H573H|ZNF585A_ENST00000355533.2_Intron			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	628					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCTCTCCTGTGTGAACTGGCT	0.493													G|||	2519	0.502995	0.8086	0.5778	5008	,	,		19421	0.1944		0.497	False		,,,				2504	0.3609				p.H573H		Atlas-SNP	.											.	ZNF585A	117	.	0			c.C1719T						PASS	.						38.0	37.0	37.0					19																	37642917		2203	4300	6503	SO:0001819	synonymous_variant	199704	exon6			TCCTGTGTGAACT	AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1884C>T	19.37:g.37642917G>A		Somatic	264	0	0		WXS	Illumina HiSeq	Phase_I	234	15	0.0641026	NM_199126	Q8TE95|Q96MV3	Silent	SNP	ENST00000356958.4	37																																																																																				G|0.497;A|0.503	0.503	strong		0.493	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000457980.2	NM_152655	
GUCA1C	9626	hgsc.bcm.edu	37	3	108639423	108639423	+	Missense_Mutation	SNP	C	C	T	rs2715687	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:108639423C>T	ENST00000261047.3	-	2	346	c.214G>A	c.(214-216)Gtt>Att	p.V72I	GUCA1C_ENST00000393963.3_Missense_Mutation_p.V72I|GUCA1C_ENST00000471108.1_Missense_Mutation_p.V72I	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	72	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.		V -> I (in dbSNP:rs2715687). {ECO:0000269|PubMed:10037746}.		phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						AAAAAGTCAACAAATCCATCC	0.303													T|||	3113	0.621605	0.7057	0.6268	5008	,	,		18843	0.379		0.7237	False		,,,				2504	0.6493				p.V72I	NSCLC(157;1360 1999 30631 40189 44208)	Atlas-SNP	.											.	GUCA1C	39	.	0			c.G214A						PASS	.	T	ILE/VAL	3123,1283	423.4+/-340.1	1094,935,174	51.0	49.0	50.0		214	4.0	1.0	3	dbSNP_100	50	6030,2562	408.7+/-349.6	2127,1776,393	yes	missense	GUCA1C	NM_005459.3	29	3221,2711,567	TT,TC,CC		29.8184,29.1194,29.5815	benign	72/210	108639423	9153,3845	2203	4296	6499	SO:0001583	missense	9626	exon2			AGTCAACAAATCC	AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.214G>A	3.37:g.108639423C>T	ENSP00000261047:p.Val72Ile	Somatic	264	0	0		WXS	Illumina HiSeq	Phase_I	252	11	0.0436508	NM_005459	O95844|Q9UNM0	Missense_Mutation	SNP	ENST00000261047.3	37	CCDS2954.1	1347	0.6167582417582418	347	0.7052845528455285	233	0.643646408839779	205	0.3583916083916084	562	0.741424802110818	T	1.402	-0.577954	0.03854	0.708806	0.701816	ENSG00000138472	ENST00000393963;ENST00000261047;ENST00000471108	T;T;T	0.76186	-1.0;-1.0;-1.0	5.17	4.0	0.46444	EF-hand-like domain (1);	0.101830	0.64402	N	0.000003	T	0.00012	0.0000	N	0.00608	-1.33	0.52501	P	4.999999999999449E-5	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46582	-0.9181	9	0.02654	T	1	.	8.2139	0.31499	0.0:0.1685:0.0:0.8315	rs2715687;rs3749284;rs52812479;rs61275317;rs2715687	72;72	C9JNI2;O95843	.;GUC1C_HUMAN	I	72	ENSP00000377535:V72I;ENSP00000261047:V72I;ENSP00000417761:V72I	ENSP00000261047:V72I	V	-	1	0	GUCA1C	110122113	1.000000	0.71417	0.998000	0.56505	0.624000	0.37722	4.443000	0.59994	0.302000	0.22762	-0.332000	0.08345	GTT	C|0.337;T|0.662	0.662	strong		0.303	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353819.1	NM_005459	
MUC16	94025	hgsc.bcm.edu	37	19	9090531	9090531	+	Silent	SNP	T	T	C	rs12976721	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:9090531T>C	ENST00000397910.4	-	1	1487	c.1284A>G	c.(1282-1284)gaA>gaG	p.E428E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	428	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.E428E(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCCTTCTGTTTCCTTTCCAC	0.502													T|||	1082	0.216054	0.27	0.2248	5008	,	,		21630	0.0228		0.3091	False		,,,				2504	0.2403				p.E428E		Atlas-SNP	.											MUC16_ENST00000397910,NS,carcinoma,0,2	MUC16	4315	2	2	Substitution - coding silent(2)	prostate(2)	c.A1284G						scavenged	.	T		1019,2945		145,729,1108	152.0	141.0	145.0		1284	-2.8	0.0	19	dbSNP_121	145	2733,5603		459,1815,1894	no	coding-synonymous	MUC16	NM_024690.2		604,2544,3002	CC,CT,TT		32.7855,25.7064,30.5041		428/14508	9090531	3752,8548	1982	4168	6150	SO:0001819	synonymous_variant	94025	exon1			TTCTGTTTCCTTT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1284A>G	19.37:g.9090531T>C		Somatic	110	1	0.00909091		WXS	Illumina HiSeq	Phase_I	78	3	0.0384615	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			T|0.772;C|0.228	0.228	strong		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
RPTN	126638	hgsc.bcm.edu	37	1	152127455	152127455	+	Missense_Mutation	SNP	T	T	C	rs75957773	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:152127455T>C	ENST00000316073.3	-	3	2184	c.2120A>G	c.(2119-2121)gAa>gGa	p.E707G		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	707	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						GCCCTGCTCTTCCTCTGCCCA	0.562													T|||	281	0.0561102	0.0053	0.0965	5008	,	,		21543	0.001		0.1362	False		,,,				2504	0.0706				p.E707G		Atlas-SNP	.											RPTN,NS,carcinoma,0,1	RPTN	123	1	0			c.A2120G						scavenged	.	T	GLY/GLU	79,3057		0,79,1489	306.0	251.0	268.0		2120	2.8	0.0	1	dbSNP_131	268	981,6183		62,857,2663	yes	missense	RPTN	NM_001122965.1	98	62,936,4152	CC,CT,TT		13.6935,2.5191,10.2913	probably-damaging	707/785	152127455	1060,9240	1568	3582	5150	SO:0001583	missense	126638	exon3			TGCTCTTCCTCTG	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.2120A>G	1.37:g.152127455T>C	ENSP00000317895:p.Glu707Gly	Somatic	87	1	0.0114943		WXS	Illumina HiSeq	Phase_I	67	4	0.0597015	NM_001122965	B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	37	CCDS41397.1	149	0.06822344322344322	3	0.006097560975609756	40	0.11049723756906077	0	0.0	106	0.13984168865435356	T	11.43	1.636369	0.29068	0.025191	0.136935	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.23147	1.92	5.15	2.82	0.32997	.	.	.	.	.	T	0.10035	0.0246	M	0.61703	1.905	0.80722	P	0.0	B	0.32101	0.356	B	0.30855	0.121	T	0.13335	-1.0513	8	0.25751	T	0.34	0.1107	7.9769	0.30159	0.0:0.1718:0.0:0.8282	.	707	Q6XPR3	RPTN_HUMAN	G	707;362	ENSP00000317895:E707G	ENSP00000317895:E707G	E	-	2	0	RPTN	150394079	.	.	0.007000	0.13788	0.104000	0.19210	.	.	0.300000	0.22699	0.523000	0.50628	GAA	T|0.884;C|0.116	0.116	strong		0.562	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
THBS3	7059	hgsc.bcm.edu	37	1	155172725	155172725	+	Missense_Mutation	SNP	T	T	C	rs35154152	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:155172725T>C	ENST00000368378.3	-	8	855	c.835A>G	c.(835-837)Agc>Ggc	p.S279G	THBS3_ENST00000541576.1_5'Flank|THBS3_ENST00000541990.1_5'UTR|RP11-263K19.4_ENST00000430312.1_RNA|RP11-263K19.4_ENST00000447623.1_RNA|RP11-263K19.4_ENST00000422665.1_RNA|RP11-263K19.4_ENST00000453136.1_RNA|THBS3_ENST00000486260.1_5'UTR|RP11-263K19.4_ENST00000454348.1_RNA|THBS3_ENST00000457183.2_Missense_Mutation_p.S159G|RP11-263K19.4_ENST00000436772.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	279			S -> G (in dbSNP:rs35154152).		bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGATTGGGGCTGCAGTGGGAA	0.612													T|||	634	0.126597	0.2595	0.0706	5008	,	,		19705	0.0218		0.1272	False		,,,				2504	0.0941				p.S279G		Atlas-SNP	.											.	THBS3	70	.	0			c.A835G						PASS	.	T	GLY/SER	1068,3338	387.7+/-326.6	131,806,1266	43.0	47.0	46.0		835	5.2	1.0	1	dbSNP_126	46	946,7654	207.5+/-249.2	47,852,3401	yes	missense	THBS3	NM_007112.3	56	178,1658,4667	CC,CT,TT		11.0,24.2397,15.4852	benign	279/957	155172725	2014,10992	2203	4300	6503	SO:0001583	missense	7059	exon8			TGGGGCTGCAGTG	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.835A>G	1.37:g.155172725T>C	ENSP00000357362:p.Ser279Gly	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	74	6	0.0810811	NM_007112	B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	ENST00000368378.3	37	CCDS1099.1	265	0.12133699633699634	137	0.2784552845528455	22	0.06077348066298342	14	0.024475524475524476	92	0.12137203166226913	T	13.41	2.228504	0.39399	0.242397	0.11	ENSG00000169231	ENST00000368378;ENST00000457183;ENST00000428962	D;D;T	0.82255	-1.54;-1.59;1.58	5.24	5.24	0.73138	Epidermal growth factor-like (1);	0.234814	0.48286	D	0.000198	T	0.62208	0.2409	L	0.31476	0.935	0.29923	P	0.822577	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.08055	0.003;0.001;0.002;0.001	T	0.59899	-0.7367	9	0.31617	T	0.26	-35.8628	13.4093	0.60933	0.0:0.0:0.0:1.0	rs35154152;rs35154152	159;279;279;279	B4DQ20;Q53FK6;Q2HIZ0;P49746	.;.;.;TSP3_HUMAN	G	279;159;129	ENSP00000357362:S279G;ENSP00000392207:S159G;ENSP00000404040:S129G	ENSP00000357362:S279G	S	-	1	0	THBS3	153439349	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.777000	0.47717	2.326000	0.78906	0.533000	0.62120	AGC	T|0.857;C|0.143	0.143	strong		0.612	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	
PLEK	5341	hgsc.bcm.edu	37	2	68592512	68592512	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:68592512A>T	ENST00000234313.7	+	1	208	c.29A>T	c.(28-30)tAc>tTc	p.Y10F	AC015969.3_ENST00000366218.2_RNA	NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	10	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		AGAGAGGGCTACCTTGTGAAG	0.577																																					p.Y10F		Atlas-SNP	.											.	PLEK	64	.	0			c.A29T						PASS	.						136.0	114.0	122.0					2																	68592512		2203	4300	6503	SO:0001583	missense	5341	exon1			AGGGCTACCTTGT	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.29A>T	2.37:g.68592512A>T	ENSP00000234313:p.Tyr10Phe	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	91	25	0.274725	NM_002664	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	ENST00000234313.7	37	CCDS1887.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.454506	0.26161	.	.	ENSG00000115956	ENST00000234313	T	0.14640	2.49	5.85	5.85	0.93711	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.14056	0.0340	L	0.52573	1.65	0.58432	D	0.999999	B;B	0.02656	0.0;0.0	B;B	0.12837	0.008;0.003	T	0.08046	-1.0741	10	0.19590	T	0.45	.	12.6189	0.56592	1.0:0.0:0.0:0.0	.	28;10	Q59GZ2;P08567	.;PLEK_HUMAN	F	10	ENSP00000234313:Y10F	ENSP00000234313:Y10F	Y	+	2	0	PLEK	68446016	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.687000	0.61708	2.234000	0.73211	0.460000	0.39030	TAC	.	.	none		0.577	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664	
ATR	545	hgsc.bcm.edu	37	3	142277575	142277575	+	Silent	SNP	A	A	T	rs2227930	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:142277575A>T	ENST00000350721.4	-	8	1897	c.1776T>A	c.(1774-1776)ggT>ggA	p.G592G	ATR_ENST00000383101.3_Silent_p.G528G	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	592					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G592G(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GTGAGAGCATACCACATAAAT	0.333								Other conserved DNA damage response genes					T|||	2995	0.598043	0.8533	0.5058	5008	,	,		12509	0.4732		0.5865	False		,,,				2504	0.4591				p.G592G		Atlas-SNP	.											ATR,NS,carcinoma,0,1	ATR	285	1	1	Substitution - coding silent(1)	stomach(1)	c.T1776A						scavenged	.	T		3506,900	347.2+/-309.4	1397,712,94	205.0	217.0	213.0		1776	1.8	1.0	3	dbSNP_98	213	5117,3483	510.5+/-377.5	1497,2123,680	no	coding-synonymous	ATR	NM_001184.3		2894,2835,774	TT,TA,AA		40.5,20.4267,33.6998		592/2645	142277575	8623,4383	2203	4300	6503	SO:0001819	synonymous_variant	545	exon8			GAGCATACCACAT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.1776T>A	3.37:g.142277575A>T		Somatic	265	2	0.00754717		WXS	Illumina HiSeq	Phase_I	279	11	0.0394265	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	37	CCDS3124.1																																																																																			A|0.359;T|0.641	0.641	strong		0.333	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
PLEKHG6	55200	hgsc.bcm.edu	37	12	6427052	6427052	+	Silent	SNP	C	C	T	rs1468603	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:6427052C>T	ENST00000396988.3	+	10	1277	c.1047C>T	c.(1045-1047)caC>caT	p.H349H	PLEKHG6_ENST00000449001.2_Silent_p.H317H|PLEKHG6_ENST00000011684.7_Silent_p.H349H|PLEKHG6_ENST00000536531.1_Silent_p.H349H|PLEKHG6_ENST00000304581.8_5'Flank	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	349	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						TCCTGCGACACATCAATGGGC	0.637													C|||	1872	0.373802	0.2375	0.353	5008	,	,		17730	0.2817		0.6203	False		,,,				2504	0.4141				p.H349H		Atlas-SNP	.											.	PLEKHG6	62	.	0			c.C1047T						PASS	.	C	,,	1218,3128		206,806,1161	31.0	28.0	29.0		1047,951,1047	3.8	1.0	12	dbSNP_88	29	5153,3401		1591,1971,715	no	coding-synonymous,coding-synonymous,coding-synonymous	PLEKHG6	NM_001144856.1,NM_001144857.1,NM_018173.3	,,	1797,2777,1876	TT,TC,CC		39.7592,28.0258,49.3876	,,	349/791,317/759,349/791	6427052	6371,6529	2173	4277	6450	SO:0001819	synonymous_variant	55200	exon10			GCGACACATCAAT	AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.1047C>T	12.37:g.6427052C>T		Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	124	11	0.0887097	NM_001144856	Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Silent	SNP	ENST00000396988.3	37	CCDS8541.1																																																																																			C|0.580;T|0.420	0.420	strong		0.637	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399031.1	NM_018173	
BCL6	604	hgsc.bcm.edu	37	3	187443314	187443314	+	Silent	SNP	G	G	A	rs61732778	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:187443314G>A	ENST00000406870.2	-	8	2178	c.1812C>T	c.(1810-1812)tgC>tgT	p.C604C	BCL6_ENST00000232014.4_Silent_p.C604C|BCL6_ENST00000450123.2_Silent_p.C548C|RP11-211G3.3_ENST00000449623.1_Intron|RP11-211G3.3_ENST00000437407.1_Intron	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	604					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		CGCAGGTTTCGCATTTGTAGG	0.612			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""								G|||	342	0.0682907	0.0726	0.0432	5008	,	,		14770	0.0903		0.0736	False		,,,				2504	0.0521				p.C604C		Atlas-SNP	.		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	BCL6,caecum,carcinoma,0,1	BCL6	107	1	0			c.C1812T						scavenged	.	G	,,	270,4136	153.3+/-186.9	6,258,1939	101.0	104.0	103.0		1812,1644,1812	1.7	1.0	3	dbSNP_129	103	627,7973	163.0+/-215.7	24,579,3697	no	coding-synonymous,coding-synonymous,coding-synonymous	BCL6	NM_001130845.1,NM_001134738.1,NM_001706.4	,,	30,837,5636	AA,AG,GG		7.2907,6.128,6.8968	,,	604/707,548/651,604/707	187443314	897,12109	2203	4300	6503	SO:0001819	synonymous_variant	604	exon8			GGTTTCGCATTTG		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1812C>T	3.37:g.187443314G>A		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	67	3	0.0447761	NM_001706	A7E241|B8PSA7|D3DNV5	Silent	SNP	ENST00000406870.2	37	CCDS3289.1																																																																																			G|0.930;A|0.070	0.070	strong		0.612	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
COL6A2	1292	hgsc.bcm.edu	37	21	47545826	47545826	+	Silent	SNP	C	C	T	rs13046639	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr21:47545826C>T	ENST00000300527.4	+	26	2201	c.2097C>T	c.(2095-2097)ggC>ggT	p.G699G	COL6A2_ENST00000357838.4_Silent_p.G699G|COL6A2_ENST00000409416.1_Silent_p.G699G|COL6A2_ENST00000310645.5_Silent_p.G699G|COL6A2_ENST00000397763.1_Silent_p.G699G	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	699	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGATTGCGGGCGGCACCTGGA	0.612													C|||	1973	0.39397	0.208	0.6383	5008	,	,		14617	0.4306		0.5109	False		,,,				2504	0.3139				p.G699G		Atlas-SNP	.											.	COL6A2	351	.	0			c.C2097T						PASS	.	C	,,	1062,3344	387.2+/-326.4	148,766,1289	76.0	70.0	72.0		2097,2097,2097	-8.4	0.0	21	dbSNP_121	72	4304,4296	576.8+/-390.4	1048,2208,1044	no	coding-synonymous,coding-synonymous,coding-synonymous	COL6A2	NM_001849.3,NM_058174.2,NM_058175.2	,,	1196,2974,2333	TT,TC,CC		49.9535,24.1035,41.2579	,,	699/1020,699/919,699/829	47545826	5366,7640	2203	4300	6503	SO:0001819	synonymous_variant	1292	exon26			TGCGGGCGGCACC	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2097C>T	21.37:g.47545826C>T		Somatic	185	0	0		WXS	Illumina HiSeq	Phase_I	119	6	0.0504202	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	ENST00000300527.4	37	CCDS13728.1																																																																																			C|0.584;T|0.416	0.416	strong		0.612	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
HOXD11	3237	hgsc.bcm.edu	37	2	176972104	176972104	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:176972104C>T	ENST00000249504.5	+	1	91	c.21C>T	c.(19-21)tgC>tgT	p.C7C	HOXD11_ENST00000498438.1_Intron|AC009336.1_ENST00000401374.2_RNA	NM_021192.2	NP_067015.2	P31277	HXD11_HUMAN	homeobox D11	7					anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|single fertilization (GO:0007338)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)							OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		TTGACGAGTGCGGCCAGAGCG	0.642			T	NUP98	AML																																p.C7C		Atlas-SNP	.		Dom	yes		2	2q31-q32	3237	homeo box D11		L	.	HOXD11	26	.	0			c.C21T						PASS	.						22.0	19.0	20.0					2																	176972104		2190	4275	6465	SO:0001819	synonymous_variant	3237	exon1			CGAGTGCGGCCAG		CCDS2265.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128713	ENSG00000128713		"""Homeoboxes / ANTP class : HOXL subclass"""	5134	protein-coding gene	gene with protein product		142986	"""homeo box D11"""	HOX4, HOX4F		1973146, 1358459	Standard	NM_021192		Approved		uc002uki.3	P31277	OTTHUMG00000132510	ENST00000249504.5:c.21C>T	2.37:g.176972104C>T		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	124	34	0.274194	NM_021192	A6NIS4|Q9NS02	Silent	SNP	ENST00000249504.5	37	CCDS2265.1																																																																																			.	.	none		0.642	HOXD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359250.2		
ZFHX4	79776	hgsc.bcm.edu	37	8	77690572	77690572	+	Silent	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:77690572T>C	ENST00000521891.2	+	4	3670	c.3222T>C	c.(3220-3222)acT>acC	p.T1074T	ZFHX4_ENST00000517683.1_3'UTR|ZFHX4_ENST00000050961.6_Silent_p.T1048T|ZFHX4_ENST00000518282.1_Silent_p.T1048T|ZFHX4_ENST00000455469.2_Silent_p.T1048T	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1048					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATCAGCAGACTGAGGGCCTAC	0.507										HNSCC(33;0.089)																											p.T1074T		Atlas-SNP	.											.	ZFHX4	878	.	0			c.T3222C						PASS	.						148.0	158.0	154.0					8																	77690572		2068	4205	6273	SO:0001819	synonymous_variant	79776	exon4			GCAGACTGAGGGC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3222T>C	8.37:g.77690572T>C		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	80	29	0.3625	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																			.	.	none		0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
NXPE3	91775	hgsc.bcm.edu	37	3	101540387	101540387	+	Missense_Mutation	SNP	T	T	G	rs35598292	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:101540387T>G	ENST00000491511.2	+	8	2225	c.1269T>G	c.(1267-1269)caT>caG	p.H423Q	NXPE3_ENST00000273347.5_Missense_Mutation_p.H423Q|NXPE3_ENST00000477909.1_Missense_Mutation_p.H423Q|NXPE3_ENST00000422132.1_Missense_Mutation_p.H423Q|RP11-49I4.3_ENST00000490324.2_RNA	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	423						extracellular region (GO:0005576)											ATGAGCTCCATTATGTGGCGA	0.512													T|||	57	0.0113818	0.0	0.0231	5008	,	,		20493	0.001		0.0368	False		,,,				2504	0.0031				p.H423Q		Atlas-SNP	.											.	.	.	.	0			c.T1269G						PASS	.	T	GLN/HIS,GLN/HIS	34,4372	39.2+/-71.8	0,34,2169	130.0	98.0	109.0		1269,1269	-5.0	0.1	3	dbSNP_126	109	404,8196	128.5+/-186.7	11,382,3907	yes	missense,missense	FAM55C	NM_001134456.1,NM_145037.2	24,24	11,416,6076	GG,GT,TT		4.6977,0.7717,3.3677	benign,benign	423/560,423/560	101540387	438,12568	2203	4300	6503	SO:0001583	missense	91775	exon8			GCTCCATTATGTG	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.1269T>G	3.37:g.101540387T>G	ENSP00000417485:p.His423Gln	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	96	4	0.0416667	NM_145037	A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	CCDS2945.1	33	0.01510989010989011	0	0.0	10	0.027624309392265192	0	0.0	23	0.030343007915567283	T	9.492	1.100921	0.20552	0.007717	0.046977	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	5.83	-4.96	0.03038	.	0.366329	0.36066	N	0.002814	T	0.02230	0.0069	L	0.46157	1.445	0.19945	N	0.999941	B	0.26258	0.145	B	0.23419	0.046	T	0.29822	-0.9999	10	0.15066	T	0.55	-0.2416	9.7523	0.40483	0.2155:0.5939:0.0:0.1906	rs35598292;rs35598292	423	Q969Y0	FA55C_HUMAN	Q	423	ENSP00000273347:H423Q;ENSP00000417485:H423Q;ENSP00000418369:H423Q;ENSP00000396421:H423Q	ENSP00000273347:H423Q	H	+	3	2	FAM55C	103023077	0.014000	0.17966	0.084000	0.20598	0.359000	0.29487	-0.414000	0.07114	-0.655000	0.05387	-0.899000	0.02877	CAT	T|0.974;G|0.026	0.026	strong		0.512	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037	
TEKT4	150483	hgsc.bcm.edu	37	2	95542418	95542418	+	Silent	SNP	T	T	C	rs199648585	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:95542418T>C	ENST00000295201.4	+	6	1349	c.1212T>C	c.(1210-1212)atT>atC	p.I404I	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	404					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						AGAAGGACATTGCCGCCATGA	0.582													C|||	59	0.0117812	0.0045	0.0072	5008	,	,		18872	0.0188		0.005	False		,,,				2504	0.0245				p.I404I		Atlas-SNP	.											TEKT4,NS,neuroblastoma,0,1	TEKT4	72	1	0			c.T1212C						scavenged	.						79.0	58.0	65.0					2																	95542418		2203	4300	6503	SO:0001819	synonymous_variant	150483	exon6			GGACATTGCCGCC	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.1212T>C	2.37:g.95542418T>C		Somatic	33	1	0.030303		WXS	Illumina HiSeq	Phase_I	32	6	0.1875	NM_144705		Silent	SNP	ENST00000295201.4	37	CCDS2005.1																																																																																			.	.	alt		0.582	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	
PDE1C	5137	hgsc.bcm.edu	37	7	31855569	31855569	+	Silent	SNP	G	G	A	rs2302450	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:31855569G>A	ENST00000396191.1	-	15	2237	c.1782C>T	c.(1780-1782)gcC>gcT	p.A594A	PDE1C_ENST00000396182.2_Silent_p.A594A|PDE1C_ENST00000396193.1_Silent_p.A654A|PDE1C_ENST00000479980.1_5'UTR|PDE1C_ENST00000396184.3_Silent_p.A594A|PDE1C_ENST00000321453.7_Silent_p.A594A	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	594					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.A594A(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	ATGACTTCTCGGCTTTGGAGT	0.448													A|||	1175	0.234625	0.2451	0.2046	5008	,	,		22184	0.1667		0.2704	False		,,,				2504	0.2751				p.A654A		Atlas-SNP	.											PDE1C_ENST00000396191,NS,carcinoma,0,2	PDE1C	465	2	2	Substitution - coding silent(2)	stomach(2)	c.C1962T						scavenged	.	A	,,,,	1024,3382	727.8+/-409.9	133,758,1312	230.0	222.0	225.0		1782,1782,1962,1782,1782	-8.8	0.4	7	dbSNP_100	225	2092,6508	717.1+/-406.1	254,1584,2462	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PDE1C	NM_001191056.1,NM_001191057.1,NM_001191058.1,NM_001191059.1,NM_005020.2	,,,,	387,2342,3774	AA,AG,GG		24.3256,23.241,23.9582	,,,,	594/635,594/710,654/770,594/710,594/635	31855569	3116,9890	2203	4300	6503	SO:0001819	synonymous_variant	5137	exon16			CTTCTCGGCTTTG	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1782C>T	7.37:g.31855569G>A		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	162	6	0.037037	NM_001191058	B3KPC6|E9PE92|Q14124|Q8NB10	Silent	SNP	ENST00000396191.1	37	CCDS55099.1																																																																																			G|0.761;A|0.239	0.239	strong		0.448	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
NWD1	284434	hgsc.bcm.edu	37	19	16860860	16860860	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:16860860C>T	ENST00000552788.1	+	4	1407	c.1407C>T	c.(1405-1407)tgC>tgT	p.C469C	NWD1_ENST00000549814.1_Silent_p.C469C|NWD1_ENST00000523826.1_Silent_p.C263C|NWD1_ENST00000339803.6_Silent_p.C334C|NWD1_ENST00000379808.3_Silent_p.C469C|NWD1_ENST00000524140.2_Silent_p.C469C			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	469	NACHT.						ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCTCAGCTTGCTCGGGGGCAC	0.637																																					p.C469C		Atlas-SNP	.											NWD1_ENST00000524140,NS,neuroblastoma,+2,2	NWD1	303	2	0			c.C1407T						PASS	.						65.0	68.0	67.0					19																	16860860		2203	4300	6503	SO:0001819	synonymous_variant	284434	exon6			AGCTTGCTCGGGG	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.1407C>T	19.37:g.16860860C>T		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	82	22	0.268293	NM_001007525	C9J021|Q68CT3	Silent	SNP	ENST00000552788.1	37																																																																																				.	.	none		0.637	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
CHRNA3	1136	hgsc.bcm.edu	37	15	78894447	78894447	+	Silent	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:78894447G>A	ENST00000326828.5	-	5	921	c.537C>T	c.(535-537)tcC>tcT	p.S179S	CHRNA3_ENST00000348639.3_Silent_p.S179S	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	179					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	CGTAGGACCAGGAACCGAACT	0.502																																					p.S179S		Atlas-SNP	.											.	CHRNA3	56	.	0			c.C537T						PASS	.						187.0	169.0	175.0					15																	78894447		2196	4293	6489	SO:0001819	synonymous_variant	1136	exon5			GGACCAGGAACCG		CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.537C>T	15.37:g.78894447G>A		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	107	38	0.35514	NM_000743	Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Silent	SNP	ENST00000326828.5	37	CCDS10305.1																																																																																			.	.	none		0.502	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290111.3		
TAS2R38	5726	hgsc.bcm.edu	37	7	141672705	141672705	+	Missense_Mutation	SNP	G	G	A	rs1726866	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:141672705G>A	ENST00000547270.1	-	1	868	c.785C>T	c.(784-786)gCt>gTt	p.A262V		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	262			A -> V (in dbSNP:rs1726866). {ECO:0000269|PubMed:12379855, ECO:0000269|PubMed:12690205, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:15496549, ECO:0000269|Ref.6}.		detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.A262V(1)		NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					GATGAAGGCAGCACAGGATGA	0.512													G|||	2131	0.425519	0.3328	0.2853	5008	,	,		20513	0.3244		0.5388	False		,,,				2504	0.638				p.A262V		Atlas-SNP	.											TAS2R38,NS,carcinoma,-1,2	TAS2R38	51	2	1	Substitution - Missense(1)	stomach(1)	c.C785T	GRCh37	CM031369	TAS2R38	M	rs1726866	PASS	.	G	VAL/ALA	1504,2902	479.7+/-358.6	257,990,956	65.0	64.0	64.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	785	2.9	0.0	7	dbSNP_89	64	4683,3917	603.1+/-394.6	1267,2149,884	yes	missense	TAS2R38	NM_176817.4	64	1524,3139,1840	AA,AG,GG		45.5465,34.1353,47.5704	benign	262/334	141672705	6187,6819	2203	4300	6503	SO:0001583	missense	5726	exon1			AAGGCAGCACAGG	AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.785C>T	7.37:g.141672705G>A	ENSP00000448219:p.Ala262Val	Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	175	8	0.0457143	NM_176817	A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Missense_Mutation	SNP	ENST00000547270.1	37	CCDS34765.1	892	0.4084249084249084	151	0.30691056910569103	123	0.3397790055248619	203	0.3548951048951049	415	0.5474934036939314	G	8.762	0.923749	0.18056	0.341353	0.544535	ENSG00000257138	ENST00000547270	T	0.37058	1.22	4.77	2.94	0.34122	.	0.359425	0.24122	N	0.041347	T	0.00012	0.0000	L	0.55990	1.75	0.80722	P	0.0	B	0.24092	0.097	B	0.30572	0.117	T	0.42103	-0.9471	9	0.56958	D	0.05	.	6.5818	0.22598	0.0973:0.182:0.7207:0.0	rs1726866;rs17712758;rs61111288;rs1726866	262	P59533	T2R38_HUMAN	V	262	ENSP00000448219:A262V	ENSP00000331291:A262V	A	-	2	0	TAS2R38	141319174	0.001000	0.12720	0.001000	0.08648	0.182000	0.23217	0.902000	0.28459	0.712000	0.32039	0.655000	0.94253	GCT	G|0.560;A|0.440	0.440	strong		0.512	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350810.2	NM_176817	
PNPO	55163	hgsc.bcm.edu	37	17	46020698	46020698	+	Silent	SNP	C	C	T	rs11079804	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:46020698C>T	ENST00000225573.4	+	2	270	c.165C>T	c.(163-165)tcC>tcT	p.S55S	AC003665.1_ENST00000451140.2_RNA|AC003665.1_ENST00000585280.1_RNA|AC003665.1_ENST00000433001.1_RNA|AC003665.1_ENST00000411573.2_RNA|PNPO_ENST00000534893.1_Intron|RP11-6N17.9_ENST00000582262.1_RNA|PNPO_ENST00000434554.2_Silent_p.S55S|PNPO_ENST00000544840.1_Silent_p.S55S	NM_018129.3	NP_060599.1	Q9NVS9	PNPO_HUMAN	pyridoxamine 5'-phosphate oxidase	55					pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	FMN binding (GO:0010181)|pyridoxamine-phosphate oxidase activity (GO:0004733)			endometrium(2)|large_intestine(1)|lung(1)|urinary_tract(1)	5						ATCTGACCTCCCTTGACCCAG	0.463													C|||	814	0.16254	0.0537	0.2176	5008	,	,		20122	0.1617		0.162	False		,,,				2504	0.272				p.S55S		Atlas-SNP	.											PNPO,NS,adenoma,0,1	PNPO	18	1	0			c.C165T						scavenged	.	C		330,4076	176.6+/-205.7	19,292,1892	140.0	111.0	120.0		165	-3.7	1.0	17	dbSNP_120	120	1469,7131	279.4+/-293.9	137,1195,2968	no	coding-synonymous	PNPO	NM_018129.3		156,1487,4860	TT,TC,CC		17.0814,7.4898,13.8321		55/262	46020698	1799,11207	2203	4300	6503	SO:0001819	synonymous_variant	55163	exon2			GACCTCCCTTGAC	AF468030	CCDS11522.1	17q21.32	2008-11-27	2006-07-12			ENSG00000108439	1.4.3.5		30260	protein-coding gene	gene with protein product		603287	"""pyridoxine 5'-phosphate oxidase"""			9601034, 15182361	Standard	NM_018129		Approved	PDXPO	uc002imo.3	Q9NVS9		ENST00000225573.4:c.165C>T	17.37:g.46020698C>T		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	88	3	0.0340909	NM_018129	B4E0V0|B4E152|B4E1D7|D3DTT9	Silent	SNP	ENST00000225573.4	37	CCDS11522.1																																																																																			C|0.855;T|0.145	0.145	strong		0.463	PNPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441407.1	NM_018129	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2751T						PASS	.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	2.37:g.241696843C>A		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	88	6	0.0681818	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.	.	none		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
DGCR2	9993	hgsc.bcm.edu	37	22	19026613	19026613	+	Missense_Mutation	SNP	A	A	G	rs2072123	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr22:19026613A>G	ENST00000263196.7	-	10	1665	c.1418T>C	c.(1417-1419)gTg>gCg	p.V473A	DGCR2_ENST00000545799.1_3'UTR|DGCR2_ENST00000537045.1_Missense_Mutation_p.V432A	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	473			V -> A (in dbSNP:rs2072123). {ECO:0000269|PubMed:7655455}.		cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					GCTGACCTCCACAGGCTCAAA	0.642													G|||	2161	0.43151	0.5696	0.4078	5008	,	,		16113	0.3442		0.3559	False		,,,				2504	0.4294				p.V473A		Atlas-SNP	.											.	DGCR2	45	.	0			c.T1418C						PASS	.	G	ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL	2235,2169		580,1075,547	36.0	37.0	37.0		1295,1286,1409,1418	-4.4	0.0	22	dbSNP_96	37	3254,5346		636,1982,1682	yes	missense,missense,missense,missense	DGCR2	NM_001173533.1,NM_001173534.1,NM_001184781.1,NM_005137.2	64,64,64,64	1216,3057,2229	GG,GA,AA		37.8372,49.2507,42.2101	benign,benign,benign,benign	432/510,429/507,470/548,473/551	19026613	5489,7515	2202	4300	6502	SO:0001583	missense	9993	exon10			ACCTCCACAGGCT	D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.1418T>C	22.37:g.19026613A>G	ENSP00000263196:p.Val473Ala	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	94	5	0.0531915	NM_005137	A6NIB5|A8K6K5|B5TY34|B7Z935	Missense_Mutation	SNP	ENST00000263196.7	37	CCDS33598.1	862	0.3946886446886447	254	0.516260162601626	145	0.4005524861878453	193	0.3374125874125874	270	0.3562005277044855	G	0.469	-0.885473	0.02511	0.507493	0.378372	ENSG00000070413	ENST00000537045;ENST00000263196	T;T	0.41400	1.0;1.0	5.61	-4.41	0.03590	.	0.768784	0.12964	N	0.424762	T	0.00012	0.0000	N	0.04043	-0.29	0.51012	P	9.300000000000974E-5	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.35895	-0.9770	9	0.07175	T	0.84	.	2.7147	0.05184	0.4604:0.0899:0.2668:0.1829	rs2072123;rs17743390;rs56724907;rs2072123	429;473	B7Z3T5;P98153	.;IDD_HUMAN	A	432;473	ENSP00000440062:V432A;ENSP00000263196:V473A	ENSP00000263196:V473A	V	-	2	0	DGCR2	17406613	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.707000	0.05041	-1.523000	0.01767	-1.714000	0.00712	GTG	T|0.004;G|0.408	0.408	strong		0.642	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316504.1	NM_005137	
OPTN	10133	hgsc.bcm.edu	37	10	13152400	13152400	+	Missense_Mutation	SNP	T	T	A	rs11258194	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:13152400T>A	ENST00000378748.3	+	5	655	c.293T>A	c.(292-294)aTg>aAg	p.M98K	OPTN_ENST00000378764.2_Missense_Mutation_p.M98K|OPTN_ENST00000378757.2_Missense_Mutation_p.M98K|OPTN_ENST00000482140.1_Intron|OPTN_ENST00000263036.5_Missense_Mutation_p.M98K|OPTN_ENST00000378752.3_Missense_Mutation_p.M98K|OPTN_ENST00000378747.3_Missense_Mutation_p.M98K	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	98	Interaction with Rab8.		M -> K (may modify intraocular pressure and increase risk of GLC1E and NPG, induces TFRC degradation leading to autophagic death in retinal ganglion cells; may be a common polymorphism; dbSNP:rs11258194). {ECO:0000269|PubMed:11834836, ECO:0000269|PubMed:14627677, ECO:0000269|PubMed:15498064, ECO:0000269|PubMed:15557444}.		cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						GAGCGTCTAATGGCCTTGAGT	0.433													T|||	394	0.0786741	0.1301	0.0259	5008	,	,		22408	0.1359		0.0308	False		,,,				2504	0.0368				p.M98K		Atlas-SNP	.											OPTN,NS,carcinoma,-1,1	OPTN	57	1	0			c.T293A	GRCh37	CM020163	OPTN	M	rs11258194	scavenged	.	T	LYS/MET,LYS/MET,LYS/MET,LYS/MET	518,3888	236.8+/-248.8	27,464,1712	105.0	117.0	113.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	293,293,293,293	3.6	0.4	10	dbSNP_120	113	277,8323	103.8+/-164.8	6,265,4029	yes	missense,missense,missense,missense	OPTN	NM_001008211.1,NM_001008212.1,NM_001008213.1,NM_021980.4	95,95,95,95	33,729,5741	AA,AT,TT		3.2209,11.7567,6.1126	benign,benign,benign,benign	98/578,98/578,98/578,98/578	13152400	795,12211	2203	4300	6503	SO:0001583	missense	10133	exon4			GTCTAATGGCCTT	AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.293T>A	10.37:g.13152400T>A	ENSP00000368022:p.Met98Lys	Somatic	248	2	0.00806452		WXS	Illumina HiSeq	Phase_I	145	4	0.0275862	NM_001008212	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	ENST00000378748.3	37	CCDS7094.1	148	0.06776556776556776	54	0.10975609756097561	11	0.03038674033149171	63	0.11013986013986014	20	0.026385224274406333	T	0.187	-1.056960	0.01965	0.117567	0.032209	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000430081;ENST00000378747	T;T;T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41	5.98	3.62	0.41486	NF-kappa-B essential modulator NEMO, N-terminal (1);	0.586858	0.21037	N	0.081226	T	0.00875	0.0029	N	0.02011	-0.69	0.80722	P	0.0	B;B	0.06786	0.001;0.001	B;B	0.11329	0.004;0.006	T	0.10753	-1.0616	9	0.06099	T	0.92	-3.4751	4.5064	0.11891	0.1498:0.1647:0.0:0.6855	rs11258194;rs45467004;rs52829303	98;98	Q96CV9-2;Q96CV9	.;OPTN_HUMAN	K	98;98;98;98;98;41;98	ENSP00000263036:M98K;ENSP00000368040:M98K;ENSP00000368032:M98K;ENSP00000368027:M98K;ENSP00000368022:M98K;ENSP00000414747:M41K;ENSP00000368021:M98K	ENSP00000263036:M98K	M	+	2	0	OPTN	13192406	0.000000	0.05858	0.405000	0.26409	0.498000	0.33706	0.084000	0.14891	0.492000	0.27815	0.533000	0.62120	ATG	T|0.937;A|0.063	0.063	strong		0.433	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980	
GLT6D1	360203	hgsc.bcm.edu	37	9	138516128	138516128	+	Missense_Mutation	SNP	C	C	T	rs61739510	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:138516128C>T	ENST00000371763.1	-	5	899	c.646G>A	c.(646-648)Gct>Act	p.A216T		NM_182974.2	NP_892019.2	Q7Z4J2	GL6D1_HUMAN	glycosyltransferase 6 domain containing 1	216					carbohydrate metabolic process (GO:0005975)	integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	15		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)		GGGATGCAAGCTGCTGAGGTC	0.517													C|||	221	0.0441294	0.0038	0.0706	5008	,	,		19738	0.0675		0.0477	False		,,,				2504	0.0521				p.A216T		Atlas-SNP	.											.	GLT6D1	56	.	0			c.G646A						PASS	.	C	THR/ALA	44,3796		0,44,1876	98.0	98.0	98.0		646	3.5	0.0	9	dbSNP_129	98	558,7702		22,514,3594	yes	missense	GLT6D1	NM_182974.2	58	22,558,5470	TT,TC,CC		6.7554,1.1458,4.9752	probably-damaging	216/277	138516128	602,11498	1920	4130	6050	SO:0001583	missense	360203	exon5			TGCAAGCTGCTGA	AY336054	CCDS43900.1	9q34.3	2013-02-22	2004-09-16	2004-09-17	ENSG00000204007	ENSG00000204007		"""Glycosyltransferase family 6 domain containing"""	23671	protein-coding gene	gene with protein product		613699	"""galactosyltransferase family 6 domain containing 1"""	GLTDC1			Standard	NM_182974		Approved		uc010nbd.1	Q7Z4J2	OTTHUMG00000020911	ENST00000371763.1:c.646G>A	9.37:g.138516128C>T	ENSP00000360829:p.Ala216Thr	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	86	4	0.0465116	NM_182974		Missense_Mutation	SNP	ENST00000371763.1	37	CCDS43900.1	112	0.05128205128205128	4	0.008130081300813009	25	0.06906077348066299	39	0.06818181818181818	44	0.05804749340369393	C	21.7	4.192627	0.78902	0.011458	0.067554	ENSG00000204007	ENST00000371763	T	0.02140	4.43	3.49	3.49	0.39957	.	0.000000	0.53938	D	0.000045	T	0.01061	0.0035	M	0.90922	3.16	0.43874	D	0.996482	D	0.89917	1.0	D	0.97110	1.0	T	0.00202	-1.1925	10	0.87932	D	0	-40.4359	13.325	0.60454	0.0:1.0:0.0:0.0	rs61739510	216	Q7Z4J2	GL6D1_HUMAN	T	216	ENSP00000360829:A216T	ENSP00000360829:A216T	A	-	1	0	GLT6D1	137655949	0.995000	0.38212	0.048000	0.18961	0.008000	0.06430	4.249000	0.58766	2.268000	0.75426	0.655000	0.94253	GCT	C|0.947;T|0.053	0.053	strong		0.517	GLT6D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055005.2	NM_182974	
PCDHGA2	56113	hgsc.bcm.edu	37	5	140720954	140720954	+	Missense_Mutation	SNP	T	T	C	rs66823521	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:140720954T>C	ENST00000394576.2	+	1	2416	c.2416T>C	c.(2416-2418)Ttt>Ctt	p.F806L	PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_5'Flank	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	806					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAAGAAACGTTTTCTCAGGT	0.393													t|||	223	0.0445288	0.0076	0.085	5008	,	,		21252	0.001		0.1292	False		,,,				2504	0.0235				p.F806L		Atlas-SNP	.											PCDHG_cluster,NS,carcinoma,-2,2	PCDHGA2	205	2	0			c.T2416C						scavenged	.	T	,LEU/PHE,LEU/PHE	119,4283		1,117,2083	60.0	64.0	63.0		,2416,2416	-0.9	0.0	5	dbSNP_130	63	1136,7464		65,1006,3229	yes	intron,missense,missense	PCDHGA2,PCDHGA1	NM_018912.2,NM_018915.2,NM_032009.1	,22,22	66,1123,5312	CC,CT,TT		13.2093,2.7033,9.6524	,,	,806/933,806/824	140720954	1255,11747	2201	4300	6501	SO:0001583	missense	56113	exon1			GAAACGTTTTCTC	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.2416T>C	5.37:g.140720954T>C	ENSP00000378077:p.Phe806Leu	Somatic	276	1	0.00362319		WXS	Illumina HiSeq	Phase_I	225	5	0.0222222	NM_018915	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	123	0.05631868131868132	4	0.008130081300813009	29	0.08011049723756906	0	0.0	90	0.11873350923482849	.	0.234	-1.018508	0.02078	0.027033	0.132093	ENSG00000081853	ENST00000394576	T	0.42900	0.96	3.35	-0.876	0.10624	.	1.381570	0.05478	N	0.554274	T	0.00109	0.0003	N	0.00666	-1.275	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.12863	-1.0531	9	0.06099	T	0.92	.	1.4049	0.02279	0.2755:0.0896:0.1576:0.4774	.	806;806	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	L	806	ENSP00000378077:F806L	ENSP00000378077:F806L	F	+	1	0	PCDHGA2	140701138	0.003000	0.15002	0.004000	0.12327	0.030000	0.12068	0.938000	0.28965	-0.250000	0.09555	0.402000	0.26972	TTT	T|0.910;C|0.090	0.090	strong		0.393	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
MYT1	4661	hgsc.bcm.edu	37	20	62839368	62839368	+	Missense_Mutation	SNP	G	G	T	rs369047925		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:62839368G>T	ENST00000328439.1	+	7	1183	c.819G>T	c.(817-819)gaG>gaT	p.E273D	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Missense_Mutation_p.E273D	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E273D(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					aggaggaggaggatgaagaag	0.572																																					p.E273D	GBM(59;481 1041 20555 21139 33705)	Atlas-SNP	.											MYT1,NS,carcinoma,0,1	MYT1	152	1	1	Substitution - Missense(1)	endometrium(1)	c.G819T						scavenged	.						21.0	21.0	21.0					20																	62839368		2203	4299	6502	SO:0001583	missense	4661	exon7			GGAGGAGGATGAA	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.819G>T	20.37:g.62839368G>T	ENSP00000327465:p.Glu273Asp	Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	22	4	0.181818	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	g	6.948	0.544734	0.13312	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.74526	-0.85;-0.85	4.12	-4.11	0.03928	.	0.319667	0.24102	N	0.041536	T	0.40272	0.1110	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.03761	-1.1006	10	0.17832	T	0.49	.	1.4958	0.02466	0.2938:0.235:0.3514:0.1198	.	273	Q01538	MYT1_HUMAN	D	273	ENSP00000327465:E273D;ENSP00000442412:E273D	ENSP00000327465:E273D	E	+	3	2	MYT1	62309812	0.048000	0.20356	0.073000	0.20177	0.034000	0.12701	-1.232000	0.02936	-0.392000	0.07751	-0.260000	0.10688	GAG	.	.	alt		0.572	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
IL4R	3566	hgsc.bcm.edu	37	16	27374180	27374180	+	Missense_Mutation	SNP	T	T	C	rs1805015	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:27374180T>C	ENST00000395762.2	+	11	1766	c.1507T>C	c.(1507-1509)Tcc>Ccc	p.S503P	IL4R_ENST00000543915.2_Missense_Mutation_p.S503P|IL4R_ENST00000380922.3_Missense_Mutation_p.S488P|IL4R_ENST00000170630.2_Missense_Mutation_p.S503P	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	503	Required for IRS1 activation and IL4- induced cell growth.		S -> P (lowered total IgE concentration; dbSNP:rs1805015). {ECO:0000269|PubMed:10233717, ECO:0000269|PubMed:11285129, ECO:0000269|Ref.5}.		defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						CTTCAGCAACTCCCTGAGCCA	0.622													T|||	1010	0.201677	0.4251	0.1614	5008	,	,		19105	0.0843		0.1521	False		,,,				2504	0.1002				p.S503P		Atlas-SNP	.											IL4R,colon,carcinoma,0,1	IL4R	70	1	0			c.T1507C	GRCh37	CM993667	IL4R	M	rs1805015	scavenged	.	T	PRO/SER	1595,2799	491.1+/-362.0	292,1011,894	78.0	83.0	81.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1507	1.6	0.0	16	dbSNP_89	81	1391,7209	265.3+/-286.1	110,1171,3019	yes	missense	IL4R	NM_000418.2	74	402,2182,3913	CC,CT,TT		16.1744,36.2995,22.9798	possibly-damaging	503/826	27374180	2986,10008	2197	4300	6497	SO:0001583	missense	3566	exon11			AGCAACTCCCTGA	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.1507T>C	16.37:g.27374180T>C	ENSP00000379111:p.Ser503Pro	Somatic	57	2	0.0350877		WXS	Illumina HiSeq	Phase_I	61	4	0.0655738	NM_000418	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	ENST00000395762.2	37	CCDS10629.1	458	0.2097069597069597	227	0.4613821138211382	62	0.1712707182320442	43	0.07517482517482517	126	0.1662269129287599	T	12.87	2.068150	0.36470	0.362995	0.161744	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.09255	3.0;3.0;3.0;3.0	4.99	1.57	0.23409	.	10.161500	0.00166	N	0.000000	T	0.00012	0.0000	L	0.36672	1.1	0.80722	P	0.0	P;P;P	0.36144	0.539;0.539;0.539	B;B;B	0.31016	0.123;0.123;0.123	T	0.45056	-0.9287	9	0.33141	T	0.24	.	6.2127	0.20638	0.0:0.2856:0.0:0.7143	rs1805015;rs17513769;rs60163518;rs1805015	488;503;503	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	P	503;503;488;503	ENSP00000379111:S503P;ENSP00000441667:S503P;ENSP00000370309:S488P;ENSP00000170630:S503P	ENSP00000170630:S503P	S	+	1	0	IL4R	27281681	0.000000	0.05858	0.001000	0.08648	0.081000	0.17604	0.118000	0.15605	0.762000	0.33152	0.459000	0.35465	TCC	T|0.773;C|0.227	0.227	strong		0.622	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4		
NEB	4703	hgsc.bcm.edu	37	2	152422087	152422087	+	Silent	SNP	A	A	G	rs2288211	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:152422087A>G	ENST00000172853.10	-	88	13338	c.13191T>C	c.(13189-13191)taT>taC	p.Y4397Y	NEB_ENST00000604864.1_Silent_p.Y6098Y|NEB_ENST00000409198.1_Silent_p.Y4397Y|NEB_ENST00000603639.1_Silent_p.Y6098Y|NEB_ENST00000397345.3_Silent_p.Y6098Y|NEB_ENST00000427231.2_Silent_p.Y6098Y			P20929	NEBU_HUMAN	nebulin	4397					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.Y4397Y(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TAAAGTTAGGATAGTTTTCAA	0.388													A|||	1121	0.223842	0.0363	0.3761	5008	,	,		19432	0.3036		0.328	False		,,,				2504	0.18				p.Y6098Y		Atlas-SNP	.											NEB,NS,carcinoma,0,1	NEB	1697	1	1	Substitution - coding silent(1)	stomach(1)	c.T18294C						scavenged	.	A	,,	314,3372		8,298,1537	70.0	63.0	65.0		18294,18294,13191	1.2	1.0	2	dbSNP_100	65	2380,5802		349,1682,2060	no	coding-synonymous,coding-synonymous,coding-synonymous	NEB	NM_001164507.1,NM_001164508.1,NM_004543.4	,,	357,1980,3597	GG,GA,AA		29.0882,8.5187,22.6997	,,	6098/8526,6098/8526,4397/6670	152422087	2694,9174	1843	4091	5934	SO:0001819	synonymous_variant	4703	exon116			GTTAGGATAGTTT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.13191T>C	2.37:g.152422087A>G		Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	158	5	0.0316456	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				A|0.732;G|0.268	0.268	strong		0.388	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
DPM1	8813	hgsc.bcm.edu	37	20	49575719	49575719	+	5'Flank	SNP	T	T	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:49575719T>A	ENST00000371588.5	-	0	0				DPM1_ENST00000371583.5_5'Flank|MOCS3_ENST00000244051.1_Missense_Mutation_p.Y114N|DPM1_ENST00000371582.4_5'Flank|DPM1_ENST00000466152.1_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						CCTTGTGGACTATGACGTGGT	0.692																																					p.Y114N		Atlas-SNP	.											.	MOCS3	44	.	0			c.T340A						PASS	.						46.0	56.0	53.0					20																	49575719		2192	4285	6477	SO:0001631	upstream_gene_variant	27304	exon1			GTGGACTATGACG	AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49575719T>A	Exception_encountered	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	51	17	0.333333	NM_014484	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	37	CCDS13434.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.975590	0.74360	.	.	ENSG00000124217	ENST00000244051	T	0.28069	1.63	6.08	2.51	0.30379	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.272984	0.37955	N	0.001868	T	0.27731	0.0682	L	0.37561	1.115	0.50039	D	0.99984	P	0.42409	0.779	P	0.49683	0.619	T	0.04360	-1.0957	9	.	.	.	-10.1451	4.0058	0.09600	0.0:0.4057:0.2107:0.3836	.	114	O95396	MOCS3_HUMAN	N	114	ENSP00000244051:Y114N	.	Y	+	1	0	MOCS3	49009126	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.110000	0.41873	0.550000	0.28991	0.533000	0.62120	TAT	.	.	none		0.692	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859	
FAM214A	56204	hgsc.bcm.edu	37	15	52901977	52901977	+	Silent	SNP	G	G	A	rs2414166	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:52901977G>A	ENST00000261844.7	-	6	1286	c.1134C>T	c.(1132-1134)gcC>gcT	p.A378A	FAM214A_ENST00000546305.2_Silent_p.A385A	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	378								p.A378A(1)									TCAAATGTTGGGCAATTCTTG	0.418													G|||	2089	0.417133	0.202	0.6095	5008	,	,		19527	0.1081		0.7445	False		,,,				2504	0.5532				p.A378A		Atlas-SNP	.											KIAA1370,NS,carcinoma,0,1	.	.	1	1	Substitution - coding silent(1)	stomach(1)	c.C1134T						scavenged	.	G		1126,2538		154,818,860	85.0	78.0	80.0		1134	-1.7	1.0	15	dbSNP_100	80	5986,2198		2198,1590,304	no	coding-synonymous	KIAA1370	NM_019600.2		2352,2408,1164	AA,AG,GG		26.8573,30.7314,39.973		378/1077	52901977	7112,4736	1832	4092	5924	SO:0001819	synonymous_variant	56204	exon6			ATGTTGGGCAATT	AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.1134C>T	15.37:g.52901977G>A		Somatic	51	1	0.0196078		WXS	Illumina HiSeq	Phase_I	54	5	0.0925926	NM_019600	A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Silent	SNP	ENST00000261844.7	37	CCDS45263.1																																																																																			G|0.561;A|0.439	0.439	strong		0.418	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419914.1	NM_019600	
ALG10B	144245	hgsc.bcm.edu	37	12	38715000	38715000	+	Silent	SNP	A	A	G	rs35518352	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:38715000A>G	ENST00000308742.4	+	3	1723	c.1407A>G	c.(1405-1407)caA>caG	p.Q469Q	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	469					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				AGGACATTCAAAGGTTTATGT	0.318													A|||	1259	0.251398	0.1377	0.2867	5008	,	,		16352	0.1429		0.4513	False		,,,				2504	0.2863				p.Q469Q		Atlas-SNP	.											ALG10B,colon,carcinoma,0,1	ALG10B	58	1	0			c.A1407G						scavenged	.	A		716,3688	278.7+/-274.4	65,586,1551	118.0	120.0	119.0		1407	-0.6	1.0	12	dbSNP_126	119	3877,4717	533.8+/-382.5	859,2159,1279	no	coding-synonymous	ALG10B	NM_001013620.3		924,2745,2830	GG,GA,AA		45.1129,16.2579,35.3362		469/474	38715000	4593,8405	2202	4297	6499	SO:0001819	synonymous_variant	144245	exon3			CATTCAAAGGTTT	AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.1407A>G	12.37:g.38715000A>G		Somatic	359	1	0.00278552		WXS	Illumina HiSeq	Phase_I	386	4	0.0103627	NM_001013620	B2RPF4	Silent	SNP	ENST00000308742.4	37	CCDS31772.1																																																																																			A|0.664;G|0.336	0.336	strong		0.318	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620	
CYP4A11	1579	hgsc.bcm.edu	37	1	47395874	47395874	+	Missense_Mutation	SNP	A	A	C	rs148507594	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:47395874A>C	ENST00000310638.4	-	12	1504	c.1473T>G	c.(1471-1473)atT>atG	p.I491M	CYP4A11_ENST00000462347.1_Missense_Mutation_p.I393M|CYP4A11_ENST00000371904.4_Missense_Mutation_p.I492M	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	491					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)	p.I491M(1)		endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	CAAGTCGTGCAATGGGGATGG	0.562													N|||	7	0.00139776	0.0015	0.0	5008	,	,		21860	0.0		0.001	False		,,,				2504	0.0041				p.I491M		Atlas-SNP	.											CYP4A11,NS,carcinoma,0,1	CYP4A11	77	1	1	Substitution - Missense(1)	endometrium(1)	c.T1473G						scavenged	.						124.0	109.0	114.0					1																	47395874		2203	4300	6503	SO:0001583	missense	1579	exon12			TCGTGCAATGGGG	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.1473T>G	1.37:g.47395874A>C	ENSP00000311095:p.Ile491Met	Somatic	158	5	0.0316456		WXS	Illumina HiSeq	Phase_I	134	5	0.0373134	NM_000778	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	37	CCDS543.1	.	.	.	.	.	.	.	.	.	.	A	5.139	0.211298	0.09757	.	.	ENSG00000187048	ENST00000310638;ENST00000371904	T;T	0.70164	-0.46;-0.46	4.41	-8.82	0.00810	.	1.064920	0.07281	N	0.870735	T	0.37237	0.0996	N	0.17564	0.495	0.09310	N	1	B	0.09022	0.002	B	0.23018	0.043	T	0.24799	-1.0150	10	0.13108	T	0.6	.	2.0606	0.03591	0.2182:0.3451:0.2706:0.166	.	491	Q02928	CP4AB_HUMAN	M	491;492	ENSP00000311095:I491M;ENSP00000360971:I492M	ENSP00000311095:I491M	I	-	3	3	CYP4A11	47168461	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-2.724000	0.00809	-2.209000	0.00739	-1.524000	0.00929	ATT	.	.	weak		0.562	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778	
DIEXF	27042	hgsc.bcm.edu	37	1	210004199	210004199	+	Missense_Mutation	SNP	C	C	G	rs585627	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:210004199C>G	ENST00000491415.2	+	3	256	c.199C>G	c.(199-201)Caa>Gaa	p.Q67E		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	67			Q -> E (in dbSNP:rs585627). {ECO:0000269|PubMed:17974005}.		multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						GAGTGAACCACAACAAGTTTC	0.373													G|||	2955	0.590056	0.6074	0.5418	5008	,	,		20577	0.3859		0.7286	False		,,,				2504	0.6687				p.Q67E		Atlas-SNP	.											DIEXF,colon,carcinoma,0,1	DIEXF	97	1	0			c.C199G						scavenged	.	G	GLU/GLN	2593,1813	530.6+/-373.0	759,1075,369	75.0	72.0	73.0		199	5.0	1.0	1	dbSNP_83	73	6552,2048	357.1+/-330.6	2510,1532,258	yes	missense	DIEXF	NM_014388.6	29	3269,2607,627	GG,GC,CC		23.814,41.1484,29.6863	benign	67/757	210004199	9145,3861	2203	4300	6503	SO:0001583	missense	27042	exon3			GAACCACAACAAG	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.199C>G	1.37:g.210004199C>G	ENSP00000419005:p.Gln67Glu	Somatic	295	0	0		WXS	Illumina HiSeq	Phase_I	206	5	0.0242718	NM_014388	O75992|Q4VY00|Q63HL9	Missense_Mutation	SNP	ENST00000491415.2	37	CCDS1493.1	1310	0.5998168498168498	308	0.6260162601626016	220	0.6077348066298343	236	0.4125874125874126	546	0.7203166226912929	G	2.855	-0.237372	0.05944	0.588516	0.76186	ENSG00000117597	ENST00000491415	T	0.37915	1.17	5.02	5.02	0.67125	.	0.047763	0.85682	N	0.000000	T	0.00012	0.0000	N	0.00128	-2.045	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.43940	-0.9360	9	0.02654	T	1	-16.9158	15.9314	0.79663	0.0:0.1355:0.8645:0.0	rs585627;rs3765243;rs52803074;rs585627	67	Q68CQ4	DIEXF_HUMAN	E	67	ENSP00000419005:Q67E	ENSP00000419005:Q67E	Q	+	1	0	DIEXF	208070822	1.000000	0.71417	1.000000	0.80357	0.465000	0.32709	5.518000	0.67068	1.248000	0.43934	-0.120000	0.15030	CAA	C|0.331;G|0.669	0.669	strong		0.373	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388	
NUFIP2	57532	hgsc.bcm.edu	37	17	27613677	27613677	+	Silent	SNP	G	G	A	rs12452857	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:27613677G>A	ENST00000225388.4	-	2	1393	c.1335C>T	c.(1333-1335)ccC>ccT	p.P445P	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	445						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			CAGAAGAGATGGGTGTTAGAG	0.433													G|||	772	0.154153	0.0371	0.2839	5008	,	,		20061	0.0119		0.2773	False		,,,				2504	0.2403				p.P445P		Atlas-SNP	.											.	NUFIP2	60	.	0			c.C1335T						PASS	.	G		333,4073	174.4+/-204.0	7,319,1877	81.0	81.0	81.0		1335	4.1	1.0	17	dbSNP_120	81	2433,6167	401.1+/-347.0	365,1703,2232	no	coding-synonymous	NUFIP2	NM_020772.2		372,2022,4109	AA,AG,GG		28.2907,7.5579,21.2671		445/696	27613677	2766,10240	2203	4300	6503	SO:0001819	synonymous_variant	57532	exon2			AGAGATGGGTGTT	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.1335C>T	17.37:g.27613677G>A		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	108	7	0.0648148	NM_020772	A1L3A6|Q9P2M5	Silent	SNP	ENST00000225388.4	37	CCDS32600.1																																																																																			G|0.815;A|0.185	0.185	strong		0.433	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2	NM_020772	
UHRF1BP1L	23074	hgsc.bcm.edu	37	12	100452832	100452832	+	Silent	SNP	C	C	T	rs11832216	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:100452832C>T	ENST00000279907.7	-	14	2435	c.2223G>A	c.(2221-2223)ccG>ccA	p.P741P	UHRF1BP1L_ENST00000545232.2_Silent_p.P391P	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	741										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						TACAAGTCTGCGGCTCTTTTT	0.403													C|||	268	0.0535144	0.0703	0.0591	5008	,	,		18430	0.004		0.0686	False		,,,				2504	0.0624				p.P741P		Atlas-SNP	.											UHRF1BP1L,caecum,carcinoma,-1,1	UHRF1BP1L	144	1	0			c.G2223A						scavenged	.	C		336,4066	162.9+/-194.8	14,308,1879	93.0	100.0	98.0		2223	-9.4	0.0	12	dbSNP_120	98	568,8024	151.3+/-206.1	23,522,3751	no	coding-synonymous	UHRF1BP1L	NM_015054.1		37,830,5630	TT,TC,CC		6.6108,7.6329,6.9571		741/1465	100452832	904,12090	2201	4296	6497	SO:0001819	synonymous_variant	23074	exon14			AGTCTGCGGCTCT		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.2223G>A	12.37:g.100452832C>T		Somatic	148	2	0.0135135		WXS	Illumina HiSeq	Phase_I	154	6	0.038961	NM_015054	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Silent	SNP	ENST00000279907.7	37	CCDS31882.1																																																																																			C|0.936;T|0.064	0.064	strong		0.403	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947	
S100A7A	338324	hgsc.bcm.edu	37	1	153391729	153391729	+	Missense_Mutation	SNP	G	G	A	rs3006414	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:153391729G>A	ENST00000368729.4	+	3	307	c.250G>A	c.(250-252)Gca>Aca	p.A84T	S100A7A_ENST00000329256.2_Missense_Mutation_p.A84T|S100A7A_ENST00000368728.2_Missense_Mutation_p.A84T	NM_176823.3	NP_789793.1	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7A	84	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.		A -> T (in dbSNP:rs3006414).			cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein self-association (GO:0043621)	p.A84T(1)		cervix(1)|endometrium(3)|kidney(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	12	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGACATAGCCGCAGACTACCA	0.527													a|||	1047	0.209065	0.4766	0.1686	5008	,	,		16030	0.1379		0.0835	False		,,,				2504	0.0787				p.A84T		Atlas-SNP	.											S100A7A,rectum,carcinoma,0,2	S100A7A	24	2	1	Substitution - Missense(1)	stomach(1)	c.G250A						scavenged	.	A	THR/ALA	1893,2513		408,1077,718	81.0	76.0	78.0		250	-2.9	0.0	1	dbSNP_101	78	765,7835		32,701,3567	no	missense	S100A7A	NM_176823.3	58	440,1778,4285	AA,AG,GG		8.8953,42.9641,20.4367	benign	84/102	153391729	2658,10348	2203	4300	6503	SO:0001583	missense	338324	exon3			ATAGCCGCAGACT	AY189118	CCDS30872.1	1q22	2013-01-10	2006-09-11	2006-09-11	ENSG00000184330	ENSG00000184330		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	21657	protein-coding gene	gene with protein product			"""S100 calcium binding protein A15"", ""S100 calcium binding protein A7-like 1"""	S100A15, S100A7L1		11230159	Standard	NM_176823		Approved	S100A7f	uc001fbt.1	Q86SG5	OTTHUMG00000013122	ENST00000368729.4:c.250G>A	1.37:g.153391729G>A	ENSP00000357718:p.Ala84Thr	Somatic	277	0	0		WXS	Illumina HiSeq	Phase_I	289	5	0.017301	NM_176823	D3DV38|Q5SY69	Missense_Mutation	SNP	ENST00000368729.4	37	CCDS30872.1	436	0.19963369963369965	229	0.4654471544715447	55	0.15193370165745856	85	0.1486013986013986	67	0.08839050131926121	.	0.009	-1.820264	0.00595	0.429641	0.088953	ENSG00000184330	ENST00000368729;ENST00000368728;ENST00000329256	T;T;T	0.06142	3.34;3.34;3.34	1.7	-2.9	0.05648	EF-hand-like domain (1);	.	.	.	.	T	0.00328	0.0010	N	0.00289	-1.7	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	8	0.09843	T	0.71	.	3.6925	0.08351	0.2976:0.0:0.4869:0.2155	rs3006414;rs57686181;rs3006414	84	Q86SG5	S1A7A_HUMAN	T	84	ENSP00000357718:A84T;ENSP00000357717:A84T;ENSP00000329008:A84T	ENSP00000329008:A84T	A	+	1	0	S100A7A	151658353	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.964000	0.01512	-1.503000	0.01812	-2.435000	0.00213	GCA	.	.	weak		0.527	S100A7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036786.2	NM_176823	
OR2L3	391192	hgsc.bcm.edu	37	1	248224294	248224294	+	Missense_Mutation	SNP	C	C	T	rs6658256	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:248224294C>T	ENST00000359959.3	+	1	311	c.311C>T	c.(310-312)tCg>tTg	p.S104L	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	104			S -> L (in dbSNP:rs6658256).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TTCTTCTTCTCGGCATTAGGA	0.433													t|||	1555	0.310503	0.7398	0.1326	5008	,	,		23310	0.254		0.1481	False		,,,				2504	0.0818				p.S104L		Atlas-SNP	.											.	OR2L3	97	.	0			c.C311T						PASS	.	T	LEU/SER,	2644,1762		888,868,447	195.0	238.0	224.0		311,	-2.4	0.0	1	dbSNP_116	224	970,7630		91,788,3421	no	missense,intron	OR2L13,OR2L3	NM_001004687.1,NM_175911.2	145,	979,1656,3868	TT,TC,CC		11.2791,39.9909,27.7872	benign,	104/313,	248224294	3614,9392	2203	4300	6503	SO:0001583	missense	391192	exon1			TCTTCTCGGCATT	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.311C>T	1.37:g.248224294C>T	ENSP00000353044:p.Ser104Leu	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	83	4	0.0481928	NM_001004687	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	CCDS31104.1	574	0.26282051282051283	291	0.5914634146341463	42	0.11602209944751381	152	0.26573426573426573	89	0.11741424802110818	.	0.006	-2.115650	0.00349	0.600091	0.112791	ENSG00000198128	ENST00000359959	T	0.01335	5.0	1.91	-2.42	0.06542	GPCR, rhodopsin-like superfamily (1);	0.000000	0.26642	N	0.023253	T	0.00012	0.0000	N	0.00278	-1.715	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.11470	-1.0586	9	0.02654	T	1	.	5.0096	0.14306	0.0:0.235:0.1594:0.6056	rs6658256;rs6658256	104	Q8NG85	OR2L3_HUMAN	L	104	ENSP00000353044:S104L	ENSP00000353044:S104L	S	+	2	0	OR2L3	246290917	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.918000	0.04021	-0.429000	0.07329	-1.562000	0.00884	TCG	C|0.712;T|0.288	0.288	strong		0.433	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
NPY4R	5540	hgsc.bcm.edu	37	10	47087299	47087299	+	Silent	SNP	G	G	C	rs140965359	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:47087299G>C	ENST00000395716.1	+	2	601	c.516G>C	c.(514-516)ctG>ctC	p.L172L	NPY4R_ENST00000374312.1_Silent_p.L172L			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	172					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										TCCTCTCCCTGCCCTTCCTGG	0.572													G|||	7	0.00139776	0.0	0.0029	5008	,	,		45561	0.0		0.004	False		,,,				2504	0.001				p.L172L		Atlas-SNP	.											.	PPYR1	54	.	0			c.G516C						PASS	.	G		1,4405		0,1,2202	197.0	156.0	170.0		516	4.0	1.0	10	dbSNP_134	170	12,8588	7.1+/-27.0	0,12,4288	no	coding-synonymous	PPYR1	NM_005972.4		0,13,6490	CC,CG,GG		0.1395,0.0227,0.1		172/376	47087299	13,12993	2203	4300	6503	SO:0001819	synonymous_variant	5540	exon3			CTCCCTGCCCTTC		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.516G>C	10.37:g.47087299G>C		Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	81	7	0.0864198	NM_005972	Q13456|Q5ISU3|Q5T2X9|Q6FH06	Silent	SNP	ENST00000395716.1	37	CCDS31193.1																																																																																			G|0.998;C|0.002	0.002	strong		0.572	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047837.1		
CAMKV	79012	hgsc.bcm.edu	37	3	49898273	49898273	+	Silent	SNP	A	A	G	rs2681781	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:49898273A>G	ENST00000477224.1	-	8	1129	c.651T>C	c.(649-651)aaT>aaC	p.N217N	RN7SL217P_ENST00000584520.1_RNA|CAMKV_ENST00000467248.1_Silent_p.N142N|CAMKV_ENST00000466940.1_Silent_p.N174N|CAMKV_ENST00000296471.7_Silent_p.N189N|CAMKV_ENST00000498324.1_5'Flank|CAMKV_ENST00000463537.1_Silent_p.N217N|CAMKV_ENST00000488336.1_Silent_p.N217N			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	217	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		AGAAAGGTGGATTGCCTGAAA	0.507													G|||	2019	0.403155	0.6914	0.3703	5008	,	,		16605	0.1448		0.4911	False		,,,				2504	0.2127				p.N217N		Atlas-SNP	.											.	CAMKV	84	.	0			c.T651C						PASS	.	G		2797,1609	497.6+/-363.9	894,1009,300	154.0	157.0	156.0		651	0.7	1.0	3	dbSNP_100	156	4271,4329	579.4+/-390.9	1060,2151,1089	no	coding-synonymous	CAMKV	NM_024046.3		1954,3160,1389	GG,GA,AA		49.6628,36.5184,45.6559		217/502	49898273	7068,5938	2203	4300	6503	SO:0001819	synonymous_variant	79012	exon8			AGGTGGATTGCCT	BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.651T>C	3.37:g.49898273A>G		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	68	4	0.0588235	NM_024046	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Silent	SNP	ENST00000477224.1	37	CCDS33762.1																																																																																			A|0.515;G|0.485	0.485	strong		0.507	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350584.4	NM_024046	
GUCA1C	9626	hgsc.bcm.edu	37	3	108639384	108639384	+	Missense_Mutation	SNP	T	T	C	rs6804162	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:108639384T>C	ENST00000261047.3	-	2	385	c.253A>G	c.(253-255)Atg>Gtg	p.M85V	GUCA1C_ENST00000393963.3_Missense_Mutation_p.M85V|GUCA1C_ENST00000471108.1_Missense_Mutation_p.M85V	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	85	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.		M -> V (in dbSNP:rs6804162).		phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						TTTTCTTGCATGATTAGATTT	0.289													C|||	1688	0.337061	0.438	0.2522	5008	,	,		18067	0.25		0.3807	False		,,,				2504	0.3057				p.M85V	NSCLC(157;1360 1999 30631 40189 44208)	Atlas-SNP	.											.	GUCA1C	39	.	0			c.A253G						PASS	.	C	VAL/MET	1844,2562	630.5+/-395.5	393,1058,752	77.0	74.0	75.0		253	3.1	0.0	3	dbSNP_116	75	3062,5534	657.8+/-401.5	548,1966,1784	yes	missense	GUCA1C	NM_005459.3	21	941,3024,2536	CC,CT,TT		35.6212,41.852,37.7327	benign	85/210	108639384	4906,8096	2203	4298	6501	SO:0001583	missense	9626	exon2			CTTGCATGATTAG	AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.253A>G	3.37:g.108639384T>C	ENSP00000261047:p.Met85Val	Somatic	297	0	0		WXS	Illumina HiSeq	Phase_I	307	13	0.0423453	NM_005459	O95844|Q9UNM0	Missense_Mutation	SNP	ENST00000261047.3	37	CCDS2954.1	741	0.3392857142857143	205	0.4166666666666667	93	0.2569060773480663	143	0.25	300	0.39577836411609496	C	6.052	0.377909	0.11466	0.41852	0.356212	ENSG00000138472	ENST00000393963;ENST00000261047;ENST00000471108	T;T;T	0.40476	1.03;1.03;1.03	5.17	3.1	0.35709	EF-hand-like domain (1);	0.215490	0.39909	N	0.001229	T	0.00012	0.0000	N	0.11255	0.115	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44757	-0.9307	9	0.06236	T	0.91	.	2.791	0.05388	0.2015:0.4347:0.0:0.3638	rs6804162;rs52828740;rs56507439;rs56791641;rs6804162	85;85	C9JNI2;O95843	.;GUC1C_HUMAN	V	85	ENSP00000377535:M85V;ENSP00000261047:M85V;ENSP00000417761:M85V	ENSP00000261047:M85V	M	-	1	0	GUCA1C	110122074	0.009000	0.17119	0.005000	0.12908	0.729000	0.41735	-0.034000	0.12225	0.598000	0.29829	-0.186000	0.12905	ATG	T|0.647;C|0.353	0.353	strong		0.289	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353819.1	NM_005459	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376116	113376116	+	Silent	SNP	C	C	T	rs112313093|rs59601191		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:113376116C>T	ENST00000478658.1	-	5	4430	c.4413G>A	c.(4411-4413)caG>caA	p.Q1471Q	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.Q1471Q			Q68DE3	K2018_HUMAN	KIAA2018	1471	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gctgttgctgctgctgctgct	0.498																																					p.Q1471Q		Atlas-SNP	.											.	KIAA2018	180	.	0			c.G4413A						PASS	.						63.0	72.0	69.0					3																	113376116		2187	4278	6465	SO:0001819	synonymous_variant	205717	exon7			TTGCTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4413G>A	3.37:g.113376116C>T		Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	28	10	0.357143	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																			.	.	none		0.498	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
OR52E6	390078	hgsc.bcm.edu	37	11	5863013	5863013	+	Missense_Mutation	SNP	T	T	C	rs4362173	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:5863013T>C	ENST00000329322.5	-	1	114	c.115A>G	c.(115-117)Att>Gtt	p.I39V	TRIM5_ENST00000380027.1_Intron|OR52E6_ENST00000379946.2_Missense_Mutation_p.I43V	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	39			I -> V (in dbSNP:rs4362173).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGAGTGCAATAAGATACACA	0.468													C|||	1924	0.384185	0.379	0.3184	5008	,	,		20747	0.4593		0.3728	False		,,,				2504	0.3722				p.I39V		Atlas-SNP	.											.	OR52E6	70	.	0			c.A115G						PASS	.	C	VAL/ILE	1625,2775	632.2+/-395.8	300,1025,875	119.0	119.0	119.0		115	-3.2	0.0	11	dbSNP_111	119	3011,5581	659.9+/-401.7	534,1943,1819	yes	missense	OR52E6	NM_001005167.1	29	834,2968,2694	CC,CT,TT		35.0442,36.9318,35.6835	benign	39/314	5863013	4636,8356	2200	4296	6496	SO:0001583	missense	390078	exon1			GTGCAATAAGATA	AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.115A>G	11.37:g.5863013T>C	ENSP00000328878:p.Ile39Val	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	135	6	0.0444444	NM_001005167	Q6IFF8	Missense_Mutation	SNP	ENST00000329322.5	37	CCDS53597.1	879	0.4024725274725275	201	0.40853658536585363	120	0.3314917127071823	264	0.46153846153846156	294	0.38786279683377306	C	0	-2.611809	0.00120	0.369318	0.350442	ENSG00000205409	ENST00000329322;ENST00000379946	T;T	0.00253	8.43;8.43	3.64	-3.21	0.05140	.	0.674836	0.13488	N	0.384173	T	0.00012	0.0000	N	0.12569	0.235	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.23048	-1.0199	9	0.02654	T	1	.	7.5924	0.28029	0.1155:0.2699:0.0:0.6146	rs4362173;rs52822593;rs4362173	39	Q96RD3	O52E6_HUMAN	V	39;43	ENSP00000328878:I39V;ENSP00000369279:I43V	ENSP00000328878:I39V	I	-	1	0	OR52E6	5819589	0.000000	0.05858	0.002000	0.10522	0.119000	0.20118	-5.184000	0.00143	-0.999000	0.03442	-0.229000	0.12294	ATT	T|0.606;C|0.394	0.394	strong		0.468	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401144.1	NM_001005167	
POTEE	445582	hgsc.bcm.edu	37	2	132021860	132021860	+	Silent	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:132021860T>C	ENST00000356920.5	+	15	2926	c.2832T>C	c.(2830-2832)gaT>gaC	p.D944D	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	944	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											AGCTGCCCGATGGCCAGGTCA	0.597																																					p.D944D		Atlas-SNP	.											ENSG00000188219,NS,carcinoma,+1,1	.	.	1	0			c.T2832C						scavenged	.						50.0	59.0	56.0					2																	132021860		2063	4067	6130	SO:0001819	synonymous_variant	445582	exon15			GCCCGATGGCCAG	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2832T>C	2.37:g.132021860T>C		Somatic	121	10	0.0826446		WXS	Illumina HiSeq	Phase_I	121	7	0.0578512	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	ENST00000356920.5	37	CCDS46414.1																																																																																			.	.	none		0.597	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
UGT2B28	54490	hgsc.bcm.edu	37	4	70146804	70146804	+	Missense_Mutation	SNP	G	G	C	rs148987832	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:70146804G>C	ENST00000335568.5	+	1	588	c.586G>C	c.(586-588)Gtt>Ctt	p.V196L	UGT2B28_ENST00000511240.1_Missense_Mutation_p.V196L	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	196					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.V196L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						CTACATACCTGTTGTTATGTC	0.383													-|||	540	0.107827	0.0794	0.1066	5008	,	,		15023	0.001		0.1998	False		,,,				2504	0.1626				p.V196L		Atlas-SNP	.											UGT2B28,NS,carcinoma,0,1	UGT2B28	101	1	1	Substitution - Missense(1)	pancreas(1)	c.G586C						scavenged	.	A	LEU/VAL,LEU/VAL	456,3602		118,220,1691	82.0	85.0	84.0		586,586	-3.0	0.0	4	dbSNP_134	84	1636,6830		327,982,2924	no	missense,missense	UGT2B28	NM_001207004.1,NM_053039.1	32,32	445,1202,4615	CC,CG,GG		19.3244,11.2371,16.7039	benign,benign	196/336,196/530	70146804	2092,10432	2029	4233	6262	SO:0001583	missense	54490	exon1			ATACCTGTTGTTA	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.586G>C	4.37:g.70146804G>C	ENSP00000334276:p.Val196Leu	Somatic	277	0	0		WXS	Illumina HiSeq	Phase_I	213	6	0.028169	NM_053039	B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	ENST00000335568.5	37	CCDS3528.1	232	0.10622710622710622	34	0.06910569105691057	47	0.1298342541436464	6	0.01048951048951049	145	0.19129287598944592	-	5.967	0.362313	0.11296	0.112371	0.193244	ENSG00000135226	ENST00000335568;ENST00000511240	T;T	0.60171	0.21;0.21	2.18	-2.99	0.05497	.	10.250200	0.01475	U	0.016449	T	0.00109	0.0003	L	0.58101	1.795	0.80722	P	0.0	B;B	0.23185	0.081;0.005	B;B	0.33750	0.169;0.031	T	0.07385	-1.0775	9	0.10111	T	0.7	.	7.3598	0.26739	0.4534:0.0:0.5466:0.0	.	196;196	Q9BY64-2;Q9BY64	.;UDB28_HUMAN	L	196	ENSP00000334276:V196L;ENSP00000427399:V196L	ENSP00000334276:V196L	V	+	1	0	UGT2B28	70181393	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.213000	0.17521	-1.067000	0.03160	-1.139000	0.01908	GTT	.	.	weak		0.383	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	
RGPD3	653489	hgsc.bcm.edu	37	2	107049714	107049714	+	Missense_Mutation	SNP	C	C	G	rs62152468		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:107049714C>G	ENST00000409886.3	-	16	2320	c.2233G>C	c.(2233-2235)Gag>Cag	p.E745Q	RGPD3_ENST00000304514.7_Missense_Mutation_p.E745Q	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	745					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTAAGCATCTCTTTTACAGAC	0.343																																					p.E745Q		Atlas-SNP	.											RGPD3_ENST00000304514,right_upper_lobe,carcinoma,0,2	RGPD3	316	2	0			c.G2233C						scavenged	.						15.0	28.0	24.0					2																	107049714		673	1545	2218	SO:0001583	missense	653489	exon16			GCATCTCTTTTAC		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2233G>C	2.37:g.107049714C>G	ENSP00000386588:p.Glu745Gln	Somatic	892	0	0		WXS	Illumina HiSeq	Phase_I	1066	13	0.0121951	NM_001144013	B8ZZM4	Missense_Mutation	SNP	ENST00000409886.3	37	CCDS46379.1	.	.	.	.	.	.	.	.	.	.	.	4.999	0.185488	0.09495	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.24908	1.83;1.83	2.34	2.34	0.29019	.	.	.	.	.	T	0.21841	0.0526	M	0.62723	1.935	0.26104	N	0.980775	P	0.35700	0.516	B	0.20955	0.032	T	0.10405	-1.0631	9	0.42905	T	0.14	-11.6791	10.3857	0.44138	0.0:1.0:0.0:0.0	.	745	A6NKT7	RGPD3_HUMAN	Q	745;503;745	ENSP00000386588:E745Q;ENSP00000303659:E745Q	ENSP00000303659:E745Q	E	-	1	0	RGPD3	106416146	1.000000	0.71417	0.998000	0.56505	0.191000	0.23601	5.692000	0.68256	1.308000	0.44962	0.173000	0.16961	GAG	C|0.250;G|0.750	0.750	weak		0.343	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
CXCR2	3579	hgsc.bcm.edu	37	2	219000310	219000310	+	Silent	SNP	C	C	T	rs2230054	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:219000310C>T	ENST00000318507.2	+	3	1213	c.786C>T	c.(784-786)ctC>ctT	p.L262L		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	262					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)	p.L262L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						TCTTCCTGCTCTGCTGGCTGC	0.607													T|||	2566	0.51238	0.7315	0.5072	5008	,	,		20598	0.3175		0.4602	False		,,,				2504	0.4744				p.L262L		Atlas-SNP	.											CXCR2,NS,carcinoma,0,1	CXCR2	54	1	1	Substitution - coding silent(1)	stomach(1)	c.C786T						scavenged	.	T	,	2852,1554	488.1+/-361.1	924,1004,275	128.0	124.0	125.0		786,786	4.5	1.0	2	dbSNP_98	125	4308,4292	576.8+/-390.4	1043,2222,1035	no	coding-synonymous,coding-synonymous	CXCR2	NM_001168298.1,NM_001557.3	,	1967,3226,1310	TT,TC,CC		49.907,35.2701,44.9485	,	262/361,262/361	219000310	7160,5846	2203	4300	6503	SO:0001819	synonymous_variant	3579	exon4			CCTGCTCTGCTGG	U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.786C>T	2.37:g.219000310C>T		Somatic	85	1	0.0117647		WXS	Illumina HiSeq	Phase_I	66	7	0.106061	NM_001168298	Q8IUZ1|Q9P2T6|Q9P2T7	Silent	SNP	ENST00000318507.2	37	CCDS2408.1																																																																																			C|0.465;T|0.535	0.535	strong		0.607	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256772.2	NM_001557	
SIM2	6493	hgsc.bcm.edu	37	21	38117308	38117308	+	Missense_Mutation	SNP	C	C	A	rs2073601	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr21:38117308C>A	ENST00000290399.6	+	10	2060	c.1447C>A	c.(1447-1449)Ctg>Atg	p.L483M	SIM2_ENST00000430056.3_Missense_Mutation_p.L483M	NM_005069.3	NP_005060.1	Q14190	SIM2_HUMAN	single-minded family bHLH transcription factor 2	483	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.		L -> M (in dbSNP:rs2073601). {ECO:0000269|PubMed:9503011}.		cell differentiation (GO:0030154)|embryonic pattern specification (GO:0009880)|lung development (GO:0030324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(2)	16						CCTGAGCACACTGCCAGCCAG	0.582													C|||	861	0.171925	0.0514	0.1729	5008	,	,		20231	0.0427		0.326	False		,,,				2504	0.3088				p.L483M		Atlas-SNP	.											.	SIM2	55	.	0			c.C1447A						PASS	.	C	MET/LEU,MET/LEU	419,3987	206.2+/-227.9	21,377,1805	80.0	69.0	73.0		1447,1447	3.5	1.0	21	dbSNP_96	73	3062,5538	471.1+/-368.0	540,1982,1778	yes	missense,missense	SIM2	NM_005069.3,NM_009586.2	15,15	561,2359,3583	AA,AC,CC		35.6047,9.5098,26.7646	possibly-damaging,possibly-damaging	483/668,483/571	38117308	3481,9525	2203	4300	6503	SO:0001583	missense	6493	exon10			AGCACACTGCCAG		CCDS13646.1	21q22.2	2013-10-17	2013-10-17		ENSG00000159263	ENSG00000159263		"""Basic helix-loop-helix proteins"""	10883	protein-coding gene	gene with protein product	"""transcription factor SIM2"""	600892	"""single-minded (Drosophila) homolog 2"", ""single-minded homolog 2 (Drosophila)"""	SIM		7485157	Standard	NM_009586		Approved	MGC119447, bHLHe15	uc002yvr.2	Q14190	OTTHUMG00000086637	ENST00000290399.6:c.1447C>A	21.37:g.38117308C>A	ENSP00000290399:p.Leu483Met	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	81	7	0.0864198	NM_005069	O60766|Q15470|Q15471|Q15472|Q15473|Q16532|Q2TBD8	Missense_Mutation	SNP	ENST00000290399.6	37	CCDS13646.1	378|378	0.17307692307692307|0.17307692307692307	33|33	0.06707317073170732|0.06707317073170732	71|71	0.19613259668508287|0.19613259668508287	25|25	0.043706293706293704|0.043706293706293704	249|249	0.32849604221635886|0.32849604221635886	C|C	17.56|17.56	3.420969|3.420969	0.62622|0.62622	0.095098|0.095098	0.356047|0.356047	ENSG00000159263|ENSG00000159263	ENST00000290399;ENST00000430056|ENST00000431229;ENST00000481730	T;T|T	0.37235|0.54866	1.21;1.21|0.55	4.46|4.46	3.55|3.55	0.40652|0.40652	Single-minded, C-terminal (2);|.	6.537880|.	0.00166|.	N|.	0.000004|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.59436|0.59436	1.845|1.845	0.34763|0.34763	P|P	0.267038|0.267038	D;D|.	0.71674|.	0.966;0.998|.	P;D|.	0.74348|.	0.908;0.983|.	T|T	0.30880|0.30880	-0.9963|-0.9963	9|6	0.34782|0.87932	T|D	0.22|0	.|.	11.0463|11.0463	0.47861|0.47861	0.0:0.8471:0.0:0.1529|0.0:0.8471:0.0:0.1529	rs2073601;rs52828939;rs58314380;rs2073601|rs2073601;rs52828939;rs58314380;rs2073601	483;483|.	Q14190;Q14190-2|.	SIM2_HUMAN;.|.	M|N	483|420;79	ENSP00000290399:L483M;ENSP00000404176:L483M|ENSP00000392003:T420N	ENSP00000290399:L483M|ENSP00000392003:T420N	L|T	+|+	1|2	2|0	SIM2|SIM2	37039178|37039178	0.123000|0.123000	0.22298|0.22298	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.413000|0.413000	0.21148|0.21148	2.194000|2.194000	0.70268|0.70268	0.558000|0.558000	0.71614|0.71614	CTG|ACT	C|0.777;A|0.223	0.223	strong		0.582	SIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194692.1	NM_009586	
STRN	6801	hgsc.bcm.edu	37	2	37152329	37152329	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:37152329C>T	ENST00000263918.4	-	2	265	c.257G>A	c.(256-258)gGa>gAa	p.G86E	STRN_ENST00000379213.2_Missense_Mutation_p.G74E	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	86					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)	p.G86E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				CTTCCTTTCTCCCTGCAGGAA	0.373																																					p.G86E		Atlas-SNP	.											STRN,NS,carcinoma,0,1	STRN	71	1	1	Substitution - Missense(1)	prostate(1)	c.G257A						scavenged	.						51.0	54.0	53.0					2																	37152329		2203	4300	6503	SO:0001583	missense	6801	exon2			CTTTCTCCCTGCA	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.257G>A	2.37:g.37152329C>T	ENSP00000263918:p.Gly86Glu	Somatic	221	6	0.0271493		WXS	Illumina HiSeq	Phase_I	258	9	0.0348837	NM_003162	Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	ENST00000263918.4	37	CCDS1784.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755771	0.89843	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	D;T	0.81821	-1.54;-1.43	5.16	5.16	0.70880	Striatin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91888	0.7432	M	0.91872	3.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93679	0.6997	10	0.87932	D	0	-13.4425	17.4167	0.87503	0.0:1.0:0.0:0.0	.	74;86	O43815-2;O43815	.;STRN_HUMAN	E	86;61;74	ENSP00000263918:G86E;ENSP00000368513:G74E	ENSP00000263918:G86E	G	-	2	0	STRN	37005833	1.000000	0.71417	0.999000	0.59377	0.894000	0.52154	7.468000	0.80943	2.376000	0.81061	0.650000	0.86243	GGA	.	.	none		0.373	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218568.1		
ULK4	54986	hgsc.bcm.edu	37	3	41952852	41952852	+	Missense_Mutation	SNP	T	T	C	rs35263917	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:41952852T>C	ENST00000301831.4	-	11	1504	c.1042A>G	c.(1042-1044)Agt>Ggt	p.S348G	ULK4_ENST00000420927.1_Missense_Mutation_p.S348G	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	348			S -> G (in dbSNP:rs35263917). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:17344846}.		cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TCAAGAGTACTCTTAGGCCGA	0.343													T|||	421	0.0840655	0.0635	0.0908	5008	,	,		20625	0.002		0.166	False		,,,				2504	0.1074				p.S348G		Atlas-SNP	.											ULK4_ENST00000301831,colon,carcinoma,+1,2	ULK4	150	2	0			c.A1042G						scavenged	.	T	GLY/SER	283,3385		9,265,1560	94.0	88.0	90.0		1042	5.2	0.9	3	dbSNP_126	90	1227,6941		90,1047,2947	yes	missense	ULK4	NM_017886.2	56	99,1312,4507	CC,CT,TT		15.022,7.7154,12.7577	possibly-damaging	348/1276	41952852	1510,10326	1834	4084	5918	SO:0001583	missense	54986	exon11			GAGTACTCTTAGG	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.1042A>G	3.37:g.41952852T>C	ENSP00000301831:p.Ser348Gly	Somatic	295	1	0.00338983		WXS	Illumina HiSeq	Phase_I	294	7	0.0238095	NM_017886	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	CCDS43071.1	198	0.09065934065934066	31	0.06300813008130081	32	0.08839779005524862	2	0.0034965034965034965	133	0.17546174142480211	T	21.5	4.164150	0.78339	0.077154	0.15022	ENSG00000168038	ENST00000301831;ENST00000420927	T;T	0.69040	0.42;-0.37	5.22	5.22	0.72569	.	0.707959	0.15193	N	0.275422	T	0.00300	0.0009	M	0.71581	2.175	0.09310	P	1.0	P	0.48911	0.917	B	0.43950	0.437	T	0.20907	-1.0261	9	0.62326	D	0.03	.	14.1258	0.65219	0.0:0.0:0.0:1.0	rs35263917;rs61740620	348	Q96C45	ULK4_HUMAN	G	348	ENSP00000301831:S348G;ENSP00000412187:S348G	ENSP00000301831:S348G	S	-	1	0	ULK4	41927856	1.000000	0.71417	0.918000	0.36340	0.766000	0.43426	5.411000	0.66386	1.979000	0.57680	0.529000	0.55759	AGT	T|0.887;C|0.113	0.113	strong		0.343	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989	
MUS81	80198	hgsc.bcm.edu	37	11	65629934	65629934	+	Missense_Mutation	SNP	G	G	C	rs545500|rs386754402	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:65629934G>C	ENST00000308110.4	+	6	888	c.539G>C	c.(538-540)cGa>cCa	p.R180P	CFL1_ENST00000534769.1_5'Flank|MUS81_ENST00000533035.1_Missense_Mutation_p.R105P	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	180	Interaction with BLM.		R -> P (in dbSNP:rs545500). {ECO:0000269|PubMed:11741546, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		GGGAGTGCTCGACCCTGGCCA	0.617								Homologous recombination					G|||	2144	0.428115	0.2012	0.4063	5008	,	,		16101	0.3323		0.668	False		,,,				2504	0.6022				p.R180P		Atlas-SNP	.											.	MUS81	68	.	0			c.G539C						PASS	.	G	PRO/ARG	1124,3278	389.6+/-327.4	153,818,1230	75.0	62.0	66.0		539	-2.0	0.0	11	dbSNP_83	66	5713,2879	663.9+/-402.1	1894,1925,477	yes	missense	MUS81	NM_025128.4	103	2047,2743,1707	CC,CG,GG		33.5079,25.5338,47.3834	benign	180/552	65629934	6837,6157	2201	4296	6497	SO:0001583	missense	80198	exon6			GTGCTCGACCCTG		CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.539G>C	11.37:g.65629934G>C	ENSP00000307853:p.Arg180Pro	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	141	6	0.0425532	NM_025128	Q9H7D9	Missense_Mutation	SNP	ENST00000308110.4	37	CCDS8115.1	974	0.445970695970696	117	0.23780487804878048	175	0.48342541436464087	174	0.3041958041958042	508	0.6701846965699209	G	15.14	2.746351	0.49257	0.255338	0.664921	ENSG00000172732	ENST00000533035;ENST00000308110;ENST00000437855;ENST00000525768	T;T;T	0.23147	2.47;2.7;1.92	5.29	-1.98	0.07480	.	0.645425	0.15248	N	0.272492	T	0.00012	0.0000	L	0.44542	1.39	0.80722	P	0.0	P	0.39551	0.678	B	0.29077	0.098	T	0.36768	-0.9734	9	0.32370	T	0.25	-0.0236	10.1301	0.42674	0.5065:0.0:0.4935:0.0	rs545500;rs17850598	180	Q96NY9	MUS81_HUMAN	P	105;180;180;105	ENSP00000432287:R105P;ENSP00000307853:R180P;ENSP00000431478:R105P	ENSP00000307853:R180P	R	+	2	0	MUS81	65386510	0.000000	0.05858	0.000000	0.03702	0.810000	0.45777	-0.071000	0.11505	-0.236000	0.09753	-0.291000	0.09656	CGA	G|0.499;C|0.501	0.501	strong		0.617	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390941.3	NM_025128	
DENND4A	10260	hgsc.bcm.edu	37	15	66034069	66034069	+	Silent	SNP	A	A	C	rs61751117	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:66034069A>C	ENST00000431932.2	-	5	823	c.615T>G	c.(613-615)acT>acG	p.T205T	DENND4A_ENST00000443035.3_Silent_p.T205T	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	205	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TGTAAGATACAGTGTTCGTCT	0.323													A|||	77	0.0153754	0.0008	0.0231	5008	,	,		15927	0.001		0.0348	False		,,,				2504	0.0245				p.T205T		Atlas-SNP	.											.	DENND4A	217	.	0			c.T615G						PASS	.	A	,	24,3610		0,24,1793	110.0	104.0	106.0		615,615	4.0	1.0	15	dbSNP_129	106	243,7905		6,231,3837	no	coding-synonymous,coding-synonymous	DENND4A	NM_001144823.1,NM_005848.3	,	6,255,5630	CC,CA,AA		2.9823,0.6604,2.2662	,	205/1907,205/1864	66034069	267,11515	1817	4074	5891	SO:0001819	synonymous_variant	10260	exon5			AGATACAGTGTTC	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.615T>G	15.37:g.66034069A>C		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	97	4	0.0412371	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	37	CCDS45285.1																																																																																			A|0.979;C|0.021	0.021	strong		0.323	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
MYO7B	4648	hgsc.bcm.edu	37	2	128367092	128367092	+	Silent	SNP	G	G	A	rs777432	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:128367092G>A	ENST00000409816.2	+	22	2858	c.2826G>A	c.(2824-2826)tcG>tcA	p.S942S	MYO7B_ENST00000389524.4_Silent_p.S942S|MYO7B_ENST00000428314.1_Silent_p.S942S			Q6PIF6	MYO7B_HUMAN	myosin VIIB	942						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		ATCTGGAATCGAAGACCCAGA	0.597													A|||	1608	0.321086	0.3661	0.2478	5008	,	,		19290	0.1319		0.3857	False		,,,				2504	0.4407				p.S942S		Atlas-SNP	.											MYO7B_ENST00000428314,colon,carcinoma,0,2	MYO7B	359	2	0			c.G2826A						scavenged	.	A		1392,2710		242,908,901	36.0	42.0	40.0		2826	-6.9	0.0	2	dbSNP_86	40	2971,5405		527,1917,1744	no	coding-synonymous	MYO7B	NM_001080527.1		769,2825,2645	AA,AG,GG		35.4704,33.9347,34.9655		942/2117	128367092	4363,8115	2051	4188	6239	SO:0001819	synonymous_variant	4648	exon23			GGAATCGAAGACC		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.2826G>A	2.37:g.128367092G>A		Somatic	80	3	0.0375		WXS	Illumina HiSeq	Phase_I	81	4	0.0493827	NM_001080527	Q14786|Q8TEE1	Silent	SNP	ENST00000409816.2	37	CCDS46405.1																																																																																			G|0.692;A|0.308	0.308	strong		0.597	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
NEB	4703	hgsc.bcm.edu	37	2	152527608	152527608	+	Missense_Mutation	SNP	C	C	T	rs34577613	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:152527608C>T	ENST00000172853.10	-	38	4582	c.4435G>A	c.(4435-4437)Gtc>Atc	p.V1479I	NEB_ENST00000604864.1_Missense_Mutation_p.V1479I|NEB_ENST00000409198.1_Missense_Mutation_p.V1479I|NEB_ENST00000603639.1_Missense_Mutation_p.V1479I|NEB_ENST00000397345.3_Missense_Mutation_p.V1479I|NEB_ENST00000427231.2_Missense_Mutation_p.V1479I			P20929	NEBU_HUMAN	nebulin	1479			V -> I (in dbSNP:rs34577613).		muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.V1479I(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GTGAACTTGACGGTATCTGGG	0.483													T|||	1679	0.335264	0.4546	0.1095	5008	,	,		21763	0.5754		0.1223	False		,,,				2504	0.3057				p.V1479I		Atlas-SNP	.											NEB,NS,carcinoma,0,1	NEB	1697	1	1	Substitution - Missense(1)	stomach(1)	c.G4435A						scavenged	.	T	ILE/VAL,ILE/VAL,ILE/VAL	1503,2705		261,981,862	164.0	163.0	163.0		4435,4435,4435	4.2	1.0	2	dbSNP_126	163	920,7532		58,804,3364	yes	missense,missense,missense	NEB	NM_001164507.1,NM_001164508.1,NM_004543.4	29,29,29	319,1785,4226	TT,TC,CC		10.885,35.7177,19.139	benign,benign,benign	1479/8526,1479/8526,1479/6670	152527608	2423,10237	2104	4226	6330	SO:0001583	missense	4703	exon38			ACTTGACGGTATC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.4435G>A	2.37:g.152527608C>T	ENSP00000172853:p.Val1479Ile	Somatic	145	1	0.00689655		WXS	Illumina HiSeq	Phase_I	137	6	0.0437956	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		700	0.32051282051282054	243	0.49390243902439024	46	0.1270718232044199	322	0.5629370629370629	89	0.11741424802110818	T	5.418	0.262254	0.10239	0.357177	0.10885	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.05081	3.5;3.53;3.53;3.54	5.42	4.25	0.50352	.	0.288297	0.32671	N	0.005787	T	0.00012	0.0000	N	0.00707	-1.245	0.09310	P	0.9999999999754821	B	0.02656	0.0	B	0.04013	0.001	T	0.26883	-1.0090	9	0.10902	T	0.67	.	7.0714	0.25181	0.0:0.138:0.1258:0.7362	rs34577613;rs60727639	1479	P20929	NEBU_HUMAN	I	1479	ENSP00000386259:V1479I;ENSP00000380505:V1479I;ENSP00000416578:V1479I;ENSP00000172853:V1479I	ENSP00000172853:V1479I	V	-	1	0	NEB	152235854	0.007000	0.16637	1.000000	0.80357	0.802000	0.45316	0.019000	0.13444	0.997000	0.38969	-0.254000	0.11334	GTC	C|0.705;T|0.295	0.295	strong		0.483	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
PARM1	25849	hgsc.bcm.edu	37	4	75938236	75938236	+	Silent	SNP	A	A	G	rs1062293	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:75938236A>G	ENST00000307428.7	+	2	857	c.645A>G	c.(643-645)gtA>gtG	p.V215V	PARM1_ENST00000513238.1_Intron|RP11-44F21.2_ENST00000513770.1_RNA	NM_015393.3	NP_056208.2	Q6UWI2	PARM1_HUMAN	prostate androgen-regulated mucin-like protein 1	215					positive regulation of telomerase activity (GO:0051973)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)		p.V215V(1)		cervix(1)|endometrium(2)|lung(4)|ovary(1)	8						CTGAGCCAGTACCCCAGGAGA	0.572													G|||	2072	0.413738	0.4244	0.3473	5008	,	,		19214	0.2143		0.5338	False		,,,				2504	0.5286				p.V215V		Atlas-SNP	.											PARM1_ENST00000307428,NS,carcinoma,0,1	PARM1	52	1	1	Substitution - coding silent(1)	stomach(1)	c.A645G						scavenged	.	G		1816,2422		414,988,717	109.0	119.0	116.0		645	4.6	0.0	4	dbSNP_86	116	4211,4267		1041,2129,1069	no	coding-synonymous	PARM1	NM_015393.3		1455,3117,1786	GG,GA,AA		49.6697,42.8504,47.397		215/311	75938236	6027,6689	2119	4239	6358	SO:0001819	synonymous_variant	25849	exon2			GCCAGTACCCCAG	AK022311	CCDS47077.1	4q13.3-q21.3	2010-02-17	2009-09-28		ENSG00000169116	ENSG00000169116			24536	protein-coding gene	gene with protein product	"""Prostatic androgen-repressed message 1"", ""Castration-induced prostatic apoptosis-related protein 1"", ""WSC4, cell wall integrity and stress response component 4 homolog (S. cerevisiae)"""					10499539, 12772192, 18027867	Standard	NM_015393		Approved	DKFZP564O0823, Cipar1, WSC4	uc003hih.2	Q6UWI2	OTTHUMG00000160827	ENST00000307428.7:c.645A>G	4.37:g.75938236A>G		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	106	3	0.0283019	NM_015393	B3KMQ9|Q96DV8|Q9Y4S1	Silent	SNP	ENST00000307428.7	37	CCDS47077.1																																																																																			A|0.598;G|0.402	0.402	strong		0.572	PARM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362494.1	NM_015393	
CD79A	973	hgsc.bcm.edu	37	19	42384803	42384803	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:42384803G>T	ENST00000221972.3	+	4	750	c.565G>T	c.(565-567)Gaa>Taa	p.E189*	CD79A_ENST00000444740.2_Nonsense_Mutation_p.E151*|ARHGEF1_ENST00000347545.4_5'Flank|ARHGEF1_ENST00000599846.1_5'Flank|ARHGEF1_ENST00000354532.3_5'Flank	NM_001783.3|NM_021601.3	NP_001774.1|NP_067612.1	P11912	CD79A_HUMAN	CD79a molecule, immunoglobulin-associated alpha	189	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.			E -> G (in Ref. 10; BAD97091). {ECO:0000305}.	B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)	B cell receptor complex (GO:0019815)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11						AAACCTTTATGAAGTGAGTGA	0.597			"""O, S"""		DLBCL																																p.E189X		Atlas-SNP	.		Dom	yes		19	19q13.2	973	"""CD79a molecule, immunoglobulin-associated alpha"""		L	.	CD79A	25	.	0			c.G565T						PASS	.						17.0	17.0	17.0					19																	42384803		2059	4062	6121	SO:0001587	stop_gained	973	exon4			CTTTATGAAGTGA	M80462	CCDS12589.1, CCDS46088.1	19q13.2	2014-09-17	2006-03-28					"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1698	protein-coding gene	gene with protein product		112205	"""CD79A antigen (immunoglobulin-associated alpha)"""	IGA		1538135	Standard	NM_001783		Approved	MB-1	uc002orv.3	P11912		ENST00000221972.3:c.565G>T	19.37:g.42384803G>T	ENSP00000221972:p.Glu189*	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	51	20	0.392157	NM_001783	A0N775|Q53FB8	Nonsense_Mutation	SNP	ENST00000221972.3	37	CCDS12589.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.752565	0.49362	.	.	ENSG00000105369	ENST00000221972;ENST00000444740	.	.	.	3.89	3.89	0.44902	.	0.222714	0.28125	N	0.016501	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-31.5868	12.151	0.54050	0.0:0.0:1.0:0.0	.	.	.	.	X	189;151	.	ENSP00000221972:E189X	E	+	1	0	CD79A	47076643	1.000000	0.71417	0.983000	0.44433	0.048000	0.14542	4.749000	0.62155	2.135000	0.66039	0.449000	0.29647	GAA	.	.	none		0.597	CD79A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463058.1		
RNF144A	9781	hgsc.bcm.edu	37	2	7164578	7164578	+	Silent	SNP	A	A	G	rs376219	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:7164578A>G	ENST00000320892.6	+	7	1030	c.588A>G	c.(586-588)gaA>gaG	p.E196E	RNF144A_ENST00000467276.1_3'UTR	NM_014746.3	NP_055561.2	P50876	R144A_HUMAN	ring finger protein 144A	196					protein ubiquitination (GO:0016567)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)	25	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		AGCGAGACGAAGGCTGCGCGC	0.572													A|||	1324	0.264377	0.1097	0.3905	5008	,	,		19524	0.1696		0.3459	False		,,,				2504	0.3978				p.E196E		Atlas-SNP	.											.	RNF144A	38	.	0			c.A588G						PASS	.	A		675,3731	283.1+/-276.9	58,559,1586	109.0	92.0	98.0		588	0.5	1.0	2	dbSNP_80	98	3261,5339	487.7+/-372.2	628,2005,1667	no	coding-synonymous	RNF144A	NM_014746.3		686,2564,3253	GG,GA,AA		37.9186,15.32,30.263		196/293	7164578	3936,9070	2203	4300	6503	SO:0001819	synonymous_variant	9781	exon7			AGACGAAGGCTGC	D79983	CCDS1657.1	2p25.2	2008-02-05	2007-08-20	2007-08-20	ENSG00000151692	ENSG00000151692		"""RING-type (C3HC4) zinc fingers"""	20457	protein-coding gene	gene with protein product			"""ring finger protein 144"""	RNF144		8724849, 10431818	Standard	NM_014746		Approved	UBCE7IP4, KIAA0161	uc002qys.3	P50876	OTTHUMG00000090353	ENST00000320892.6:c.588A>G	2.37:g.7164578A>G		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	55	4	0.0727273	NM_014746	D6W4Y6|Q585H5	Silent	SNP	ENST00000320892.6	37	CCDS1657.1	536	0.2454212454212454	42	0.08536585365853659	132	0.36464088397790057	98	0.17132867132867133	264	0.3482849604221636	A	1.539	-0.542170	0.04053	0.1532	0.379186	ENSG00000151692	ENST00000432850	.	.	.	5.87	0.485	0.16830	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.39881	-0.9592	3	.	.	.	.	10.6812	0.45815	0.5408:0.0:0.4592:0.0	rs376219;rs17661911;rs376219	.	.	.	R	192	.	.	K	+	2	0	RNF144A	7082029	0.983000	0.35010	0.985000	0.45067	0.056000	0.15407	0.309000	0.19332	-0.138000	0.11434	-0.256000	0.11100	AAG	A|0.727;G|0.273	0.273	strong		0.572	RNF144A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206725.2	NM_014746	
CEACAM6	4680	hgsc.bcm.edu	37	19	42260569	42260569	+	Silent	SNP	G	G	A	rs1805223	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:42260569G>A	ENST00000199764.6	+	2	344	c.126G>A	c.(124-126)ccG>ccA	p.P42P	CEA_ENST00000598976.1_Intron|AC011513.4_ENST00000601409.1_RNA	NM_002483.4	NP_002474.3	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	42	Ig-like V-type.				cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.P42P(1)		breast(1)|kidney(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		AATCCACGCCGTTCAATGTCG	0.527													g|||	1280	0.255591	0.1399	0.2911	5008	,	,		18831	0.2738		0.2873	False		,,,				2504	0.3354				p.P42P		Atlas-SNP	.											CEACAM6,NS,carcinoma,0,1	CEACAM6	52	1	1	Substitution - coding silent(1)	stomach(1)	c.G126A						scavenged	.	G		745,3661	305.5+/-289.0	63,619,1521	170.0	156.0	161.0		126	-5.1	0.0	19	dbSNP_92	161	2502,6098	410.2+/-350.1	384,1734,2182	no	coding-synonymous	CEACAM6	NM_002483.4		447,2353,3703	AA,AG,GG		29.093,16.9088,24.9654		42/345	42260569	3247,9759	2203	4300	6503	SO:0001819	synonymous_variant	4680	exon2			CACGCCGTTCAAT	M29541	CCDS12585.1	19q13.1-q13.2	2013-01-29			ENSG00000086548	ENSG00000086548		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1818	protein-coding gene	gene with protein product		163980		NCA			Standard	NM_002483		Approved	CD66c	uc002orm.2	P40199	OTTHUMG00000151064	ENST00000199764.6:c.126G>A	19.37:g.42260569G>A		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	146	4	0.0273973	NM_002483	Q13774|Q14920|Q53XP7	Silent	SNP	ENST00000199764.6	37	CCDS12585.1																																																																																			.	.	weak		0.527	CEACAM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321147.1		
TMPRSS11A	339967	hgsc.bcm.edu	37	4	68780427	68780427	+	Missense_Mutation	SNP	C	C	T	rs150048717		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:68780427C>T	ENST00000334830.7	-	9	1729	c.983G>A	c.(982-984)cGa>cAa	p.R328Q	TMPRSS11A_ENST00000508048.1_Missense_Mutation_p.R324Q|TMPRSS11A_ENST00000396188.2_Missense_Mutation_p.R325Q|UBA6-AS1_ENST00000500538.2_RNA			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	328	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.R328Q(1)		breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						TCTGGCTTCTCGGAGATCATT	0.388																																					p.R328Q	NSCLC(26;2 894 10941 14480 22546)	Atlas-SNP	.											TMPRSS11A,colon,carcinoma,0,1	TMPRSS11A	74	1	1	Substitution - Missense(1)	large_intestine(1)	c.G983A						scavenged	.	C	GLN/ARG,GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	138.0	130.0	132.0		974,983	3.2	0.6	4	dbSNP_134	132	25,8575	17.9+/-57.8	0,25,4275	yes	missense,missense	TMPRSS11A	NM_001114387.1,NM_182606.3	43,43	0,27,6476	TT,TC,CC		0.2907,0.0454,0.2076	possibly-damaging,possibly-damaging	325/419,328/422	68780427	27,12979	2203	4300	6503	SO:0001583	missense	339967	exon9			GCTTCTCGGAGAT	AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.983G>A	4.37:g.68780427C>T	ENSP00000334611:p.Arg328Gln	Somatic	172	1	0.00581395		WXS	Illumina HiSeq	Phase_I	143	8	0.0559441	NM_182606	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Missense_Mutation	SNP	ENST00000334830.7	37	CCDS3519.1	.	.	.	.	.	.	.	.	.	.	C	7.647	0.682081	0.14907	4.54E-4	0.002907	ENSG00000187054	ENST00000508048;ENST00000334830;ENST00000396188;ENST00000513536	D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01	5.78	3.15	0.36227	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.299635	0.24065	N	0.041869	T	0.67636	0.2914	N	0.01152	-0.98	0.31986	N	0.605203	P;P	0.51351	0.944;0.944	B;B	0.29077	0.098;0.098	T	0.73316	-0.4021	10	0.11794	T	0.64	.	7.8773	0.29601	0.0:0.6795:0.0:0.3205	.	325;328	B5MDI9;Q6ZMR5	.;TM11A_HUMAN	Q	324;328;325;292	ENSP00000426911:R324Q;ENSP00000334611:R328Q;ENSP00000379491:R325Q;ENSP00000427621:R292Q	ENSP00000334611:R328Q	R	-	2	0	TMPRSS11A	68463022	0.174000	0.23070	0.641000	0.29422	0.109000	0.19521	-0.117000	0.10708	0.380000	0.24823	0.591000	0.81541	CGA	C|0.998;T|0.002	0.002	strong		0.388	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251433.3	NM_182606	
TWF1	5756	hgsc.bcm.edu	37	12	44196125	44196125	+	Silent	SNP	T	T	C	rs112006889	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:44196125T>C	ENST00000395510.2	-	3	375	c.246A>G	c.(244-246)gaA>gaG	p.E82E	TWF1_ENST00000552521.1_5'UTR|TWF1_ENST00000548315.1_Silent_p.E82E|TWF1_ENST00000325127.4_Silent_p.E116E|TWF1_ENST00000547564.1_5'UTR	NM_001242397.1|NM_002822.4	NP_001229326.1|NP_002813.3	Q12792	TWF1_HUMAN	twinfilin actin-binding protein 1	82	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|negative regulation of actin filament polymerization (GO:0030837)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of actin phosphorylation (GO:0043538)|sequestering of actin monomers (GO:0042989)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|ruffle membrane (GO:0032587)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|stomach(1)	14	all_cancers(12;0.00125)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.0474)		TGAATATCCATTCATATCCCT	0.328													T|||	248	0.0495208	0.0393	0.072	5008	,	,		16572	0.0556		0.0119	False		,,,				2504	0.0798				p.E82E		Atlas-SNP	.											TWF1,NS,carcinoma,-2,1	TWF1	37	1	0			c.A246G						scavenged	.	T	,	136,4270	94.8+/-133.5	2,132,2069	51.0	55.0	54.0		246,246	-3.7	1.0	12	dbSNP_132	54	156,8440	73.2+/-135.9	2,152,4144	no	coding-synonymous,coding-synonymous	TWF1	NM_001242397.1,NM_002822.4	,	4,284,6213	CC,CT,TT		1.8148,3.0867,2.2458	,	82/358,82/351	44196125	292,12710	2203	4298	6501	SO:0001819	synonymous_variant	5756	exon3			TATCCATTCATAT	U02680	CCDS31780.1, CCDS31780.2, CCDS55818.1	12q12	2013-04-25	2013-04-25	2006-11-13					9620	protein-coding gene	gene with protein product		610932	"""protein tyrosine kinase 9"", ""PTK9 protein tyrosine kinase 9"", ""twinfilin, actin-binding protein, homolog 1 (Drosophila)"""	PTK9		7507208	Standard	NM_002822		Approved	A6	uc001rob.3	Q12792		ENST00000395510.2:c.246A>G	12.37:g.44196125T>C		Somatic	305	3	0.00983607		WXS	Illumina HiSeq	Phase_I	412	7	0.0169903	NM_002822	A8K5A8|B3KXS6|B4DLX9|Q59G07|Q5U0B1|Q6FHJ1|Q6FHL6|Q6NUK9|Q86XL6|Q8TCD3	Silent	SNP	ENST00000395510.2	37	CCDS31780.2																																																																																			T|0.973;C|0.027	0.027	strong		0.328	TWF1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403956.1	NM_002822	
