#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CCDC66	285331	hgsc.bcm.edu	37	3	56650051	56650052	+	In_Frame_Ins	INS	-	-	CTT	rs67797937|rs77152637|rs74463118	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:56650051_56650052insCTT	ENST00000394672.3	+	13	1883_1884	c.1813_1814insCTT	c.(1813-1815)act>aCTTct	p.606_607insS	CCDC66_ENST00000326595.7_In_Frame_Ins_p.572_573insS|CCDC66_ENST00000436465.2_In_Frame_Ins_p.606_607insS	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	606					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		GAATTCTACGACTTCTAAGAAG	0.287																																					p.T605delinsTS		Pindel	.											.	CCDC66	145	.	0			c.1813_1814insCTT						PASS	.		,	3586,680		1520,546,67					,	1.9	0.0		dbSNP_130	92	3788,4448		872,2044,1202	no	coding,coding	CCDC66	NM_001141947.1,NM_001012506.4	,	2392,2590,1269	A1A1,A1R,RR		45.9932,15.94,41.0174	,	,		7374,5128				SO:0001652	inframe_insertion	285331	exon13			.	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.1814_1816dupCTT	3.37:g.56650052_56650054dupCTT	ENSP00000378167:p.Ser606_Ser606dup	Somatic	114	.	.		WXS	Illumina HiSeq	Phase_I	136	45	0.331	NM_001141947	B3KWL8|Q4VC34|Q8N949	In_Frame_Ins	INS	ENST00000394672.3	37	CCDS46852.1																																																																																			-|0.298;CTT|0.702	0.702	strong		0.287	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
PCDHGA12	26025	hgsc.bcm.edu	37	5	140812776	140812776	+	Intron	DEL	T	T	-			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr5:140812776delT	ENST00000252085.3	+	1	2566				PCDHGA11_ENST00000518882.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCttctttcttttttttttt	0.413																																					p.L817fs		Pindel	.											.	PCDHGA12	271	.	0			c.2449delC						PASS	.		,,,,,,,,,,,,,,,,,,,,	139,219,3894		0,0,139,2,215,1770	27.0	30.0	29.0		,,,,,,,,,,,,,,,,,,,,	-0.3	0.0	5		30	252,363,7627		2,1,247,1,360,3510	no	codingComplex,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron	PCDHGB4,PCDHGA8,PCDHGA12,PCDHGB7,PCDHGB6,PCDHGB5,PCDHGB3,PCDHGB2,PCDHGB1,PCDHGA11,PCDHGA10,PCDHGA9,PCDHGA7,PCDHGA6,PCDHGA5,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_032094.1,NM_032092.1,NM_032088.1,NM_018927.3,NM_018926.2,NM_018925.2,NM_018924.2,NM_018923.2,NM_018922.2,NM_018921.2,NM_018920.2,NM_018919.2,NM_018918.2,NM_018917.2,NM_018916.3,NM_018915.2,NM_018914.2,NM_018913.2,NM_018912.2,NM_003736.2,NM_003735.2	,,,,,,,,,,,,,,,,,,,,	2,1,386,3,575,5280	A1A1,A1A2,A1R,A2A2,A2R,RR		7.4618,8.4196,7.7877	,,,,,,,,,,,,,,,,,,,,	,,,,,,,,,,,,,,,,,,,,	140812776	391,582,11521	2201	4298	6499	SO:0001627	intron_variant	26025	exon1			.	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.2424+26T>-	5.37:g.140812776delT		Somatic	88	.	.		WXS	Illumina HiSeq	Phase_I	72	13	0.181	NM_032094	O15100|Q6UW70|Q9Y5D7	Frame_Shift_Del	DEL	ENST00000252085.3	37	CCDS4260.1																																																																																			.	.	none		0.413	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
ROBO2	6092	hgsc.bcm.edu	37	3	77147265	77147265	+	Silent	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:77147265G>A	ENST00000461745.1	+	2	1062	c.162G>A	c.(160-162)gcG>gcA	p.A54A	ROBO2_ENST00000332191.8_Silent_p.A54A|ROBO2_ENST00000487694.3_Silent_p.A70A	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	54	Ig-like C2-type 1.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		ACTGCAAGGCGGAGGGCCGGC	0.617																																					p.A54A		Atlas-SNP	.											.	ROBO2	527	.	0			c.G162A						PASS	.						53.0	59.0	57.0					3																	77147265		1980	4165	6145	SO:0001819	synonymous_variant	6092	exon2			CAAGGCGGAGGGC	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.162G>A	3.37:g.77147265G>A		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	139	8	0.057554	NM_002942	O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	37	CCDS43109.1																																																																																			.	.	none		0.617	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
EP400	57634	hgsc.bcm.edu	37	12	132547090	132547090	+	Silent	SNP	A	A	G	rs7974276	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:132547090A>G	ENST00000333577.4	+	48	8395	c.8286A>G	c.(8284-8286)caA>caG	p.Q2762Q	EP400_ENST00000389562.2_Silent_p.Q2725Q|EP400_ENST00000389561.2_Silent_p.Q2726Q|EP400_ENST00000332482.4_Silent_p.Q2689Q|EP400_ENST00000330386.6_Silent_p.Q2645Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2762	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcaacaacagcagc	0.557													G|||	1450	0.289537	0.6316	0.1671	5008	,	,		15386	0.1865		0.1322	False		,,,				2504	0.182				p.Q2726Q		Atlas-SNP	.											EP400,colon,carcinoma,0,3	EP400	370	3	0			c.A8178G						scavenged	.						26.0	30.0	29.0					12																	132547090		2181	4250	6431	SO:0001819	synonymous_variant	57634	exon47			GCAGCAACAACAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8286A>G	12.37:g.132547090A>G		Somatic	78	1	0.0128205		WXS	Illumina HiSeq	Phase_I	46	2	0.0434783	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				A|0.794;G|0.206	0.206	strong		0.557	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
KCNN3	3782	hgsc.bcm.edu	37	1	154842243	154842243	+	Silent	SNP	A	A	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:154842243A>C	ENST00000271915.4	-	1	513	c.198T>G	c.(196-198)ctT>ctG	p.L66L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgaagctgcggag	0.701																																					p.L66L		Atlas-SNP	.											KCNN3,NS,carcinoma,0,3	KCNN3	141	3	0			c.T198G						scavenged	.						6.0	4.0	5.0					1																	154842243		1926	3811	5737	SO:0001819	synonymous_variant	3782	exon1			CTGCTGAAGCTGC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.198T>G	1.37:g.154842243A>C		Somatic	51	3	0.0588235		WXS	Illumina HiSeq	Phase_I	50	17	0.34	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			.	.	none		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
CBWD3	445571	hgsc.bcm.edu	37	9	70871836	70871836	+	Splice_Site	SNP	C	C	G	rs376362566		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr9:70871836C>G	ENST00000360171.6	+	5	981		c.e5-1		CBWD3_ENST00000377342.5_Intron	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3								ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		TATATTTTCACGTGCAGTGGC	0.289																																					.		Atlas-SNP	.											CBWD3,rectum,carcinoma,-1,1	CBWD3	10	1	0			c.431-1C>G						scavenged	.						25.0	31.0	29.0					9																	70871836		2190	4250	6440	SO:0001630	splice_region_variant	445571	exon5			TTTTCACGTGCAG	BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.431-1C>G	9.37:g.70871836C>G		Somatic	1248	12	0.00961538		WXS	Illumina HiSeq	Phase_I	1232	14	0.0113636	NM_201453	B4DNG9|Q6VB91	Splice_Site	SNP	ENST00000360171.6	37	CCDS35038.1	.	.	.	.	.	.	.	.	.	.	c	14.78	2.637800	0.47049	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344	.	.	.	3.38	3.38	0.38709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.714	0.51641	0.0:0.1812:0.8188:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBWD3	70061656	1.000000	0.71417	0.991000	0.47740	0.802000	0.45316	7.061000	0.76699	0.543000	0.28864	-0.676000	0.03789	.	C|0.500;G|0.500	0.500	weak		0.289	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1	NM_201453	Intron
ADAM21	8747	hgsc.bcm.edu	37	14	70924613	70924613	+	Nonsense_Mutation	SNP	C	C	T	rs138262361	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr14:70924613C>T	ENST00000603540.1	+	2	655	c.397C>T	c.(397-399)Cga>Tga	p.R133*	ADAM21_ENST00000267499.3_Nonsense_Mutation_p.R133*|RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	133					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGGGGGCTTTCGAGGAGTATT	0.448																																					p.R133X		Atlas-SNP	.											ADAM21_ENST00000267499,NS,carcinoma,0,6	ADAM21	181	6	0			c.C397T						scavenged	.						74.0	86.0	82.0					14																	70924613		2202	4300	6502	SO:0001587	stop_gained	8747	exon2			GGCTTTCGAGGAG	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.397C>T	14.37:g.70924613C>T	ENSP00000474385:p.Arg133*	Somatic	96	2	0.0208333		WXS	Illumina HiSeq	Phase_I	82	7	0.0853659	NM_003813	O43507|Q2VPC6|Q32MR0	Nonsense_Mutation	SNP	ENST00000603540.1	37	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	C	9.227	1.034843	0.19590	.	.	ENSG00000139985	ENST00000267499	.	.	.	3.76	3.76	0.43208	.	0.682149	0.11938	U	0.515009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	12.162	0.54109	0.1717:0.8283:0.0:0.0	.	.	.	.	X	133	.	ENSP00000267499:R133X	R	+	1	2	ADAM21	69994366	0.003000	0.15002	0.322000	0.25334	0.071000	0.16799	1.122000	0.31295	2.090000	0.63153	0.557000	0.71058	CGA	C|0.993;T|0.007	0.007	strong		0.448	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
MUC21	394263	hgsc.bcm.edu	37	6	30955019	30955019	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr6:30955019G>A	ENST00000376296.3	+	2	1308	c.1067G>A	c.(1066-1068)gGg>gAg	p.G356E	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	356	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						ACCTCCAGTGGGGCCAGCACA	0.637																																					p.G356E		Atlas-SNP	.											MUC21,NS,carcinoma,0,3	MUC21	98	3	0			c.G1067A						scavenged	.						136.0	135.0	136.0					6																	30955019		2203	4300	6503	SO:0001583	missense	394263	exon2			CCAGTGGGGCCAG	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1067G>A	6.37:g.30955019G>A	ENSP00000365473:p.Gly356Glu	Somatic	95	2	0.0210526		WXS	Illumina HiSeq	Phase_I	106	14	0.132075	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	g	7.208	0.594777	0.13875	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.03035	4.07	3.8	-1.27	0.09347	.	.	.	.	.	T	0.00724	0.0024	L	0.29908	0.895	0.09310	N	1	P	0.41393	0.748	B	0.36959	0.237	T	0.44159	-0.9346	9	0.15952	T	0.53	0.3604	4.2322	0.10608	0.4907:0.0:0.345:0.1644	.	356	Q5SSG8	MUC21_HUMAN	E	206;356	ENSP00000365473:G356E	ENSP00000365473:G356E	G	+	2	0	MUC21	31062998	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-0.756000	0.04777	-0.290000	0.09025	0.586000	0.80456	GGG	.	.	none		0.637	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
ZNF837	116412	hgsc.bcm.edu	37	19	58879701	58879701	+	Silent	SNP	C	C	G	rs61746129	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:58879701C>G	ENST00000427624.2	-	3	1321	c.999G>C	c.(997-999)gcG>gcC	p.A333A	CTD-2619J13.3_ENST00000599889.1_RNA|ZNF837_ENST00000597582.1_Silent_p.A333A			Q96EG3	ZN837_HUMAN	zinc finger protein 837	333					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						AGGCGCGCCGCGCCAGGACGG	0.761													G|||	762	0.152157	0.1263	0.1816	5008	,	,		10510	0.3393		0.0626	False		,,,				2504	0.0654				p.A333A		Atlas-SNP	.											.	ZNF837	16	.	0			c.G999C						PASS	.						2.0	3.0	3.0					19																	58879701		549	1272	1821	SO:0001819	synonymous_variant	116412	exon3			GCGCCGCGCCAGG	BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.999G>C	19.37:g.58879701C>G		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_138466		Silent	SNP	ENST00000427624.2	37	CCDS46216.1																																																																																			C|0.818;G|0.182	0.182	strong		0.761	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466962.1	NM_138466	
ANKRD17	26057	hgsc.bcm.edu	37	4	74005553	74005553	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr4:74005553G>T	ENST00000358602.4	-	15	2896	c.2780C>A	c.(2779-2781)gCa>gAa	p.A927E	ANKRD17_ENST00000330838.6_Intron|ANKRD17_ENST00000514252.1_5'UTR|ANKRD17_ENST00000509867.2_Missense_Mutation_p.A814E	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	927	Gln-rich.				blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTGTAACCGTGCATAGTCTCC	0.493																																					p.A927E		Atlas-SNP	.											ANKRD17,NS,carcinoma,0,1	ANKRD17	214	1	0			c.C2780A						scavenged	.						121.0	114.0	116.0					4																	74005553		2203	4300	6503	SO:0001583	missense	26057	exon15			AACCGTGCATAGT	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.2780C>A	4.37:g.74005553G>T	ENSP00000351416:p.Ala927Glu	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	77	3	0.038961	NM_032217	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.823696	0.71143	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000509867;ENST00000411811	T;T	0.66099	-0.18;-0.19	5.65	5.65	0.86999	Ankyrin repeat-containing domain (1);	0.087223	0.48767	D	0.000165	T	0.57272	0.2042	L	0.40543	1.245	0.80722	D	1	P;P;P;B	0.39665	0.682;0.634;0.501;0.309	B;B;B;B	0.36845	0.114;0.234;0.118;0.055	T	0.60444	-0.7262	10	0.54805	T	0.06	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	448;927;927;814	B4DR08;O75179-2;O75179;E7EUV3	.;.;ANR17_HUMAN;.	E	927;927;814;927	ENSP00000351416:A927E;ENSP00000427151:A814E	ENSP00000351416:A927E	A	-	2	0	ANKRD17	74224417	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.713000	0.91408	2.824000	0.97209	0.655000	0.94253	GCA	.	.	none		0.493	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573991	140573991	+	Silent	SNP	G	G	C	rs372116572		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr5:140573991G>C	ENST00000239446.4	+	1	2050	c.1866G>C	c.(1864-1866)ggG>ggC	p.G622G		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	622	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G622G(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCACAATGGGGAGGTGCGCA	0.692																																					p.G622G		Atlas-SNP	.											PCDHB10,colon,carcinoma,0,1	PCDHB10	177	1	1	Substitution - coding silent(1)	large_intestine(1)	c.G1866C						scavenged	.						15.0	15.0	15.0					5																	140573991		1844	3568	5412	SO:0001819	synonymous_variant	56126	exon1			CAATGGGGAGGTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1866G>C	5.37:g.140573991G>C		Somatic	35	1	0.0285714		WXS	Illumina HiSeq	Phase_I	31	8	0.258065	NM_018930	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.	.	weak		0.692	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PEX5L	51555	hgsc.bcm.edu	37	3	179525541	179525541	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:179525541G>A	ENST00000467460.1	-	14	1927	c.1597C>T	c.(1597-1599)Cga>Tga	p.R533*	PEX5L_ENST00000263962.8_Nonsense_Mutation_p.R531*|PEX5L_ENST00000468741.1_Nonsense_Mutation_p.R341*|PEX5L_ENST00000472994.1_Nonsense_Mutation_p.R474*|PEX5L_ENST00000392649.3_Nonsense_Mutation_p.R425*|PEX5L_ENST00000476138.1_Nonsense_Mutation_p.R490*|PEX5L_ENST00000485199.1_Nonsense_Mutation_p.R498*|PEX5L_ENST00000464614.1_Nonsense_Mutation_p.R425*|PEX5L_ENST00000465751.1_Nonsense_Mutation_p.R509*|PEX5L_ENST00000467440.2_5'UTR	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	533					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TCCAGTGCTCGCGTATAGGCC	0.547																																					p.R533X		Atlas-SNP	.											.	PEX5L	104	.	0			c.C1597T						PASS	.						156.0	158.0	157.0					3																	179525541		2203	4300	6503	SO:0001587	stop_gained	51555	exon14			GTGCTCGCGTATA	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.1597C>T	3.37:g.179525541G>A	ENSP00000419975:p.Arg533*	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	80	5	0.0625	NM_016559	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Nonsense_Mutation	SNP	ENST00000467460.1	37	CCDS3236.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310115	0.60414	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	.	.	.	6.07	0.263	0.15602	.	0.062097	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.1829	18.2127	0.89876	0.0:0.0:0.3064:0.6936	.	.	.	.	X	533;531;498;531;425;341;490;421;474;425;509	.	ENSP00000263962:R531X	R	-	1	2	PEX5L	181008235	0.806000	0.28996	0.047000	0.18901	0.321000	0.28281	1.324000	0.33712	0.023000	0.15187	-0.291000	0.09656	CGA	.	.	none		0.547	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559	
ZC3H12A	80149	hgsc.bcm.edu	37	1	37948367	37948367	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:37948367C>T	ENST00000373087.6	+	6	1071	c.955C>T	c.(955-957)Cga>Tga	p.R319*		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GATCAAGTGCCGATTCTTCCA	0.592																																					p.R319X		Atlas-SNP	.											.	ZC3H12A	58	.	0			c.C955T						PASS	.						53.0	58.0	56.0					1																	37948367		2203	4300	6503	SO:0001587	stop_gained	80149	exon6			AAGTGCCGATTCT		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.955C>T	1.37:g.37948367C>T	ENSP00000362179:p.Arg319*	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	36	7	0.194444	NM_025079		Nonsense_Mutation	SNP	ENST00000373087.6	37	CCDS417.1	.	.	.	.	.	.	.	.	.	.	C	37	6.207425	0.97376	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	.	.	.	5.35	4.42	0.53409	.	0.056788	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-13.4531	12.5056	0.55979	0.4622:0.5378:0.0:0.0	.	.	.	.	X	319	.	ENSP00000362174:R319X	R	+	1	2	ZC3H12A	37720954	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.551000	0.67274	1.202000	0.43218	0.563000	0.77884	CGA	.	.	none		0.592	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
MUC21	394263	hgsc.bcm.edu	37	6	30954354	30954354	+	Silent	SNP	A	A	T	rs9262322		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr6:30954354A>T	ENST00000376296.3	+	2	643	c.402A>T	c.(400-402)acA>acT	p.T134T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	134	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GGGCCAGCACAGCCACCAACT	0.607																																					p.T134T		Atlas-SNP	.											MUC21,NS,carcinoma,+1,1	MUC21	98	1	0			c.A402T						scavenged	.						166.0	155.0	159.0					6																	30954354		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			CAGCACAGCCACC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.402A>T	6.37:g.30954354A>T		Somatic	134	5	0.0373134		WXS	Illumina HiSeq	Phase_I	136	10	0.0735294	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																			.	.	none		0.607	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
TEX15	56154	hgsc.bcm.edu	37	8	30706107	30706107	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:30706107C>A	ENST00000256246.2	-	1	501	c.427G>T	c.(427-429)Gtt>Ttt	p.V143F	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	143					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GCCATGGTAACTTTATTGGGA	0.423																																					p.V143F		Atlas-SNP	.											TEX15,colon,carcinoma,+1,1	TEX15	350	1	0			c.G427T						PASS	.						116.0	111.0	113.0					8																	30706107		2203	4300	6503	SO:0001583	missense	56154	exon1			TGGTAACTTTATT	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.427G>T	8.37:g.30706107C>A	ENSP00000256246:p.Val143Phe	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	111	7	0.0630631	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025481	0.35701	.	.	ENSG00000133863	ENST00000256246	T	0.13196	2.61	5.51	-1.39	0.08997	.	1.516910	0.03687	N	0.246505	T	0.10937	0.0267	N	0.08118	0	0.09310	N	1	P	0.44380	0.834	P	0.45506	0.483	T	0.41088	-0.9528	10	0.87932	D	0	.	10.4415	0.44469	0.0:0.5403:0.0:0.4597	.	143	Q9BXT5	TEX15_HUMAN	F	143	ENSP00000256246:V143F	ENSP00000256246:V143F	V	-	1	0	TEX15	30825649	0.034000	0.19679	0.002000	0.10522	0.030000	0.12068	0.067000	0.14510	-0.081000	0.12662	-0.302000	0.09304	GTT	.	.	none		0.423	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
FLG2	388698	hgsc.bcm.edu	37	1	152328051	152328051	+	Silent	SNP	T	T	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:152328051T>C	ENST00000388718.5	-	3	2283	c.2211A>G	c.(2209-2211)tcA>tcG	p.S737S	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	737	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCTGAGCCTGATCCATGTT	0.502																																					p.S737S		Atlas-SNP	.											FLG2,NS,carcinoma,-1,1	FLG2	431	1	0			c.A2211G						scavenged	.						313.0	309.0	310.0					1																	152328051		2203	4300	6503	SO:0001819	synonymous_variant	388698	exon3			TGAGCCTGATCCA	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2211A>G	1.37:g.152328051T>C		Somatic	131	4	0.0305344		WXS	Illumina HiSeq	Phase_I	104	8	0.0769231	NM_001014342	Q9H4U1	Silent	SNP	ENST00000388718.5	37	CCDS30861.1																																																																																			.	.	none		0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
KCNN3	3782	hgsc.bcm.edu	37	1	154842244	154842244	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:154842244A>T	ENST00000271915.4	-	1	512	c.197T>A	c.(196-198)cTt>cAt	p.L66H	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ctgctgctgaagctgcggagg	0.701																																					p.L66H		Atlas-SNP	.											KCNN3,NS,carcinoma,+1,3	KCNN3	141	3	0			c.T197A						scavenged	.																																			SO:0001583	missense	3782	exon1			TGCTGAAGCTGCG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.197T>A	1.37:g.154842244A>T	ENSP00000271915:p.Leu66His	Somatic	51	4	0.0784314		WXS	Illumina HiSeq	Phase_I	50	15	0.3	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	37	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	a	9.986	1.229557	0.22542	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.58060	0.36	4.47	-1.06	0.10002	.	2.530250	0.01603	N	0.022141	T	0.17152	0.0412	N	0.08118	0	0.35103	D	0.765442	.	.	.	.	.	.	T	0.03807	-1.1002	8	0.72032	D	0.01	-1.1381	4.5154	0.11932	0.5982:0.0:0.2622:0.1396	.	.	.	.	H	66;161	ENSP00000271915:L66H	ENSP00000271915:L66H	L	-	2	0	KCNN3	153108868	0.001000	0.12720	0.839000	0.33178	0.980000	0.70556	0.019000	0.13444	0.013000	0.14918	0.460000	0.39030	CTT	.	.	none		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
DPP6	1804	hgsc.bcm.edu	37	7	154561188	154561188	+	Silent	SNP	C	C	T	rs56091483	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr7:154561188C>T	ENST00000377770.3	+	9	1086	c.945C>T	c.(943-945)taC>taT	p.Y315Y	DPP6_ENST00000404039.1_Silent_p.Y251Y|DPP6_ENST00000427557.1_Silent_p.Y208Y|DPP6_ENST00000332007.3_Silent_p.Y253Y			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	315					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GACTCGCCTACGCCGCCATCA	0.522													C|||	485	0.096845	0.1104	0.0533	5008	,	,		18877	0.12		0.0964	False		,,,				2504	0.0859				p.Y315Y	NSCLC(125;1384 1783 2490 7422 34254)	Atlas-SNP	.											.	DPP6	383	.	0			c.C945T						PASS	.	C	,,	422,3630		26,370,1630	75.0	79.0	78.0		399,318,318	-4.7	0.9	7	dbSNP_129	78	671,7673		27,617,3528	no	coding-synonymous,coding-synonymous,coding-synonymous	DPP6	NM_001039350.1,NM_001936.3,NM_130797.2	,,	53,987,5158	TT,TC,CC		8.0417,10.4146,8.8174	,,	133/684,106/657,106/657	154561188	1093,11303	2026	4172	6198	SO:0001819	synonymous_variant	1804	exon9			CGCCTACGCCGCC	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.945C>T	7.37:g.154561188C>T		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	67	18	0.268657	NM_130797		Silent	SNP	ENST00000377770.3	37																																																																																				C|0.910;T|0.090	0.090	strong		0.522	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
MUC4	4585	hgsc.bcm.edu	37	3	195513411	195513411	+	Silent	SNP	A	A	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:195513411A>T	ENST00000463781.3	-	2	5499	c.5040T>A	c.(5038-5040)ccT>ccA	p.P1680P	MUC4_ENST00000475231.1_Silent_p.P1680P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACAGGAAGAGGGGTGGCGT	0.612																																					p.P1680P		Atlas-SNP	.											MUC4_ENST00000463781,trunk,malignant_melanoma,-2,4	MUC4	1505	4	0			c.T5040A						scavenged	.						38.0	36.0	37.0					3																	195513411		690	1583	2273	SO:0001819	synonymous_variant	4585	exon2			AGGAAGAGGGGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5040T>A	3.37:g.195513411A>T		Somatic	403	5	0.0124069		WXS	Illumina HiSeq	Phase_I	491	9	0.0183299	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	none		0.612	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
EPSTI1	94240	hgsc.bcm.edu	37	13	43474489	43474489	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:43474489G>T	ENST00000398762.3	-	10	804	c.805C>A	c.(805-807)Caa>Aaa	p.Q269K	EPSTI1_ENST00000313624.7_Missense_Mutation_p.Q258K|EPSTI1_ENST00000313640.7_Missense_Mutation_p.Q269K			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	269										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		TCTTGCTCTTGCTGCTGCCGT	0.353																																					p.Q269K		Atlas-SNP	.											.	EPSTI1	47	.	0			c.C805A						PASS	.						210.0	180.0	191.0					13																	43474489		2202	4300	6502	SO:0001583	missense	94240	exon10			GCTCTTGCTGCTG	AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.805C>A	13.37:g.43474489G>T	ENSP00000381746:p.Gln269Lys	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	65	4	0.0615385	NM_001002264	Q8IVC7|Q8NDQ7	Missense_Mutation	SNP	ENST00000398762.3	37	CCDS9387.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189527	0.38707	.	.	ENSG00000133106	ENST00000313640;ENST00000313624;ENST00000398762	T	0.21191	2.02	5.15	3.42	0.39159	.	0.315322	0.27535	N	0.018925	T	0.27629	0.0679	M	0.67953	2.075	0.27333	N	0.956715	P;P	0.51537	0.946;0.946	P;P	0.48840	0.592;0.592	T	0.10064	-1.0646	10	0.49607	T	0.09	-9.5038	7.5873	0.27999	0.085:0.3183:0.5966:0.0	.	258;269	Q96J88-2;Q96J88-3	.;.	K	269;258;269	ENSP00000318982:Q269K	ENSP00000318643:Q258K	Q	-	1	0	EPSTI1	42372489	0.720000	0.27996	0.948000	0.38648	0.158000	0.22134	0.469000	0.22067	0.869000	0.35703	0.650000	0.86243	CAA	.	.	none		0.353	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	
BTG2	7832	hgsc.bcm.edu	37	1	203276562	203276562	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:203276562G>A	ENST00000290551.4	+	2	544	c.473G>A	c.(472-474)aGc>aAc	p.S158N	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	158					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			GCAGTCTCCAGCTAGGCCCTT	0.627																																					p.S158N		Atlas-SNP	.											.	BTG2	16	.	0			c.G473A						PASS	.						23.0	24.0	24.0					1																	203276562		2196	4278	6474	SO:0001583	missense	7832	exon2			TCTCCAGCTAGGC		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.473G>A	1.37:g.203276562G>A	ENSP00000290551:p.Ser158Asn	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	50	10	0.2	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902148	0.52227	.	.	ENSG00000159388	ENST00000290551	T	0.26373	1.74	4.76	3.85	0.44370	.	0.000000	0.85682	D	0.000000	T	0.46483	0.1395	M	0.73217	2.22	0.43338	D	0.995382	D	0.76494	0.999	D	0.66084	0.941	T	0.49021	-0.8982	10	0.87932	D	0	-21.5168	11.8943	0.52648	0.087:0.0:0.913:0.0	.	158	P78543	BTG2_HUMAN	N	158	ENSP00000290551:S158N	ENSP00000290551:S158N	S	+	2	0	BTG2	201543185	1.000000	0.71417	1.000000	0.80357	0.097000	0.18754	9.420000	0.97426	1.140000	0.42260	0.313000	0.20887	AGC	.	.	none		0.627	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
LAX1	54900	hgsc.bcm.edu	37	1	203743519	203743519	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:203743519A>T	ENST00000442561.2	+	5	1297	c.907A>T	c.(907-909)Agt>Tgt	p.S303C	LAX1_ENST00000367215.1_3'UTR|LAX1_ENST00000367217.5_Missense_Mutation_p.S287C	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	303					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AGCAGATCCCAGTGGAAGCCA	0.517																																					p.S303C		Atlas-SNP	.											LAX1,NS,carcinoma,0,2	LAX1	48	2	0			c.A907T						scavenged	.						77.0	74.0	75.0					1																	203743519		2203	4300	6503	SO:0001583	missense	54900	exon5			GATCCCAGTGGAA	AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.907A>T	1.37:g.203743519A>T	ENSP00000406970:p.Ser303Cys	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	158	2	0.0126582	NM_017773	B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	ENST00000442561.2	37	CCDS1441.2	.	.	.	.	.	.	.	.	.	.	A	18.81	3.703553	0.68501	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	4.79	2.34	0.29019	.	0.866628	0.10281	N	0.693580	T	0.33760	0.0874	L	0.36672	1.1	0.09310	N	1	D;D	0.57257	0.979;0.979	P;P	0.50192	0.634;0.634	T	0.17319	-1.0373	9	0.72032	D	0.01	-1.1395	3.9964	0.09559	0.6696:0.2116:0.1188:0.0	.	287;303	B7Z744;Q8IWV1	.;LAX1_HUMAN	C	303;287	.	ENSP00000356186:S287C	S	+	1	0	LAX1	202010142	0.000000	0.05858	0.001000	0.08648	0.666000	0.39218	0.246000	0.18160	0.369000	0.24510	0.533000	0.62120	AGT	.	.	none		0.517	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087468.3	NM_017773	
CHSY3	337876	hgsc.bcm.edu	37	5	129240972	129240972	+	Silent	SNP	G	G	C	rs33917	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr5:129240972G>C	ENST00000305031.4	+	1	808	c.450G>C	c.(448-450)ccG>ccC	p.P150P	CTC-575N7.1_ENST00000515569.1_RNA|CTC-575N7.1_ENST00000503616.1_RNA	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	150					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		ACGGCCGGCCGGGGAGTAGCC	0.766													G|||	2286	0.45647	0.2254	0.513	5008	,	,		7622	0.5833		0.5368	False		,,,				2504	0.5153				p.P150P		Atlas-SNP	.											.	CHSY3	92	.	0			c.G450C						PASS	.						1.0	2.0	2.0					5																	129240972		822	2140	2962	SO:0001819	synonymous_variant	337876	exon1			CCGGCCGGGGAGT	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.450G>C	5.37:g.129240972G>C		Somatic	1	0	0		WXS	Illumina HiSeq	Phase_I	9	4	0.444444	NM_175856	B2RP97|Q76L22|Q86Y52	Silent	SNP	ENST00000305031.4	37	CCDS34223.1																																																																																			G|0.522;C|0.478	0.478	strong		0.766	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
ASPH	444	hgsc.bcm.edu	37	8	62430094	62430094	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:62430094C>T	ENST00000379454.4	-	24	2306	c.2119G>A	c.(2119-2121)Gag>Aag	p.E707K	ASPH_ENST00000541428.1_Missense_Mutation_p.E678K	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	707					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TACTTGGTCTCGTTGGCACAT	0.507																																					p.E707K		Atlas-SNP	.											.	ASPH	87	.	0			c.G2119A						PASS	.						171.0	121.0	138.0					8																	62430094		2203	4300	6503	SO:0001583	missense	444	exon24			TGGTCTCGTTGGC	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.2119G>A	8.37:g.62430094C>T	ENSP00000368767:p.Glu707Lys	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	77	13	0.168831	NM_004318	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	ENST00000379454.4	37	CCDS34898.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.768991	0.49680	.	.	ENSG00000198363	ENST00000541428;ENST00000379454	T;T	0.43688	0.94;0.94	5.96	4.19	0.49359	.	0.116455	0.64402	D	0.000016	T	0.43144	0.1234	M	0.80422	2.495	0.80722	D	1	B;P	0.50943	0.235;0.94	B;B	0.37346	0.092;0.247	T	0.50734	-0.8793	10	0.49607	T	0.09	-19.997	12.9723	0.58520	0.0:0.8691:0.0:0.1309	.	678;707	F5H667;Q12797	.;ASPH_HUMAN	K	678;707	ENSP00000437864:E678K;ENSP00000368767:E707K	ENSP00000368767:E707K	E	-	1	0	ASPH	62592648	0.996000	0.38824	0.678000	0.29963	0.418000	0.31294	3.084000	0.50143	0.872000	0.35775	0.650000	0.86243	GAG	.	.	none		0.507	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378510.3	NM_004318	
AAGAB	79719	hgsc.bcm.edu	37	15	67524188	67524188	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr15:67524188T>C	ENST00000261880.5	-	5	603	c.499A>G	c.(499-501)Aat>Gat	p.N167D	AAGAB_ENST00000542650.1_Missense_Mutation_p.N58D|AAGAB_ENST00000561452.1_Missense_Mutation_p.N58D	NM_001271885.1|NM_001271886.1|NM_024666.3	NP_001258814.1|NP_001258815.1|NP_078942.3	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin binding protein	167					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9						ACATTGGCATTCAGGGCTTGG	0.368																																					p.N167D		Atlas-SNP	.											.	AAGAB	24	.	0			c.A499G						PASS	.						258.0	249.0	252.0					15																	67524188		1926	4146	6072	SO:0001583	missense	79719	exon5			TGGCATTCAGGGC	AL136715	CCDS42050.1, CCDS61679.1	15q22.33-q23	2014-02-12	2009-07-20		ENSG00000103591	ENSG00000103591			25662	protein-coding gene	gene with protein product		614888				11230166, 10477754	Standard	NM_024666		Approved	FLJ11506, p34	uc002aqk.5	Q6PD74	OTTHUMG00000172246	ENST00000261880.5:c.499A>G	15.37:g.67524188T>C	ENSP00000261880:p.Asn167Asp	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	69	5	0.0724638	NM_024666	B4DG44|Q6FI86|Q7Z5X9|Q9H0P1|Q9HAK0	Missense_Mutation	SNP	ENST00000261880.5	37	CCDS42050.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.830795	0.91036	.	.	ENSG00000103591	ENST00000261880;ENST00000542650	T;T	0.46451	0.89;0.87	5.21	5.21	0.72293	.	0.094714	0.85682	D	0.000000	T	0.55609	0.1931	M	0.68952	2.095	0.80722	D	1	D	0.52996	0.957	P	0.55667	0.781	T	0.53760	-0.8393	10	0.32370	T	0.25	-28.4102	15.2497	0.73536	0.0:0.0:0.0:1.0	.	167	Q6PD74	AAGAB_HUMAN	D	167;58	ENSP00000261880:N167D;ENSP00000440735:N58D	ENSP00000261880:N167D	N	-	1	0	AAGAB	65311242	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.428000	0.80296	2.180000	0.69256	0.528000	0.53228	AAT	.	.	none		0.368	AAGAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417472.1	NM_024666	
TRIP11	9321	hgsc.bcm.edu	37	14	92472110	92472110	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr14:92472110T>C	ENST00000267622.4	-	11	2583	c.2210A>G	c.(2209-2211)aAc>aGc	p.N737S		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	737					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CTCATACTTGTTTGCTTCTTC	0.368			T	PDGFRB	AML																																p.N737S	Ovarian(84;609 1888 9852 42686)	Atlas-SNP	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	TRIP11,NS,carcinoma,0,1	TRIP11	184	1	0			c.A2210G						scavenged	.						194.0	196.0	195.0					14																	92472110		2203	4300	6503	SO:0001583	missense	9321	exon11			TACTTGTTTGCTT	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.2210A>G	14.37:g.92472110T>C	ENSP00000267622:p.Asn737Ser	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	97	2	0.0206186	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	.	.	.	.	.	.	.	.	.	.	T	0.105	-1.146008	0.01714	.	.	ENSG00000100815	ENST00000267622;ENST00000542257	T	0.03860	3.78	5.77	-6.41	0.01938	.	1.047670	0.07339	N	0.880403	T	0.04679	0.0127	L	0.44542	1.39	0.09310	N	1	B;B	0.16166	0.002;0.016	B;B	0.11329	0.002;0.006	T	0.45848	-0.9233	10	0.09843	T	0.71	.	15.1293	0.72511	0.0:0.5496:0.0:0.4504	.	473;737	F5H1Z0;Q15643	.;TRIPB_HUMAN	S	737;473	ENSP00000267622:N737S	ENSP00000267622:N737S	N	-	2	0	TRIP11	91541863	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	0.000000	0.12993	-1.646000	0.01513	-0.361000	0.07541	AAC	.	.	none		0.368	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
FRG2B	441581	hgsc.bcm.edu	37	10	135440123	135440123	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr10:135440123C>T	ENST00000425520.1	-	1	176	c.124G>A	c.(124-126)Gaa>Aaa	p.E42K	FRG2B_ENST00000443774.1_Missense_Mutation_p.E42K	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	42						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTGCCTTTTTCTTTGAATGGT	0.512																																					p.E42K		Atlas-SNP	.											FRG2B,NS,carcinoma,0,1	FRG2B	47	1	0			c.G124A						scavenged	.						6.0	7.0	6.0					10																	135440123		1818	3856	5674	SO:0001583	missense	441581	exon1			CTTTTTCTTTGAA	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.124G>A	10.37:g.135440123C>T	ENSP00000401310:p.Glu42Lys	Somatic	246	3	0.0121951		WXS	Illumina HiSeq	Phase_I	212	10	0.0471698	NM_001080998	Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	4.857	0.159324	0.09236	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.37235	1.21;1.21	0.109	0.109	0.14578	.	.	.	.	.	T	0.19366	0.0465	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.15870	0.014	T	0.20739	-1.0266	8	0.51188	T	0.08	-0.0822	.	.	.	.	42	Q96QU4	FRG2B_HUMAN	K	42	ENSP00000408343:E42K;ENSP00000401310:E42K	ENSP00000401310:E42K	E	-	1	0	FRG2B	135290113	0.953000	0.32496	0.013000	0.15412	0.013000	0.08279	-0.459000	0.06728	0.181000	0.19994	0.184000	0.17185	GAA	.	.	none		0.512	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
POTED	317754	hgsc.bcm.edu	37	21	15011839	15011839	+	Silent	SNP	T	T	C	rs182477426	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr21:15011839T>C	ENST00000299443.5	+	10	1465	c.1413T>C	c.(1411-1413)gaT>gaC	p.D471D		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	471						plasma membrane (GO:0005886)		p.D471D(1)		central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						CTTCTAGTGATGAACAAAATG	0.363													N|||	1402	0.279952	0.2632	0.1455	5008	,	,		3613	0.5258		0.2266	False		,,,				2504	0.1994				p.D471D		Atlas-SNP	.											POTED,NS,carcinoma,0,1	POTED	57	1	1	Substitution - coding silent(1)	stomach(1)	c.T1413C						scavenged	.						17.0	22.0	21.0					21																	15011839		824	3044	3868	SO:0001819	synonymous_variant	317754	exon10			TAGTGATGAACAA	AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.1413T>C	21.37:g.15011839T>C		Somatic	230	2	0.00869565		WXS	Illumina HiSeq	Phase_I	154	5	0.0324675	NM_174981	C9JCF7	Silent	SNP	ENST00000299443.5	37	CCDS13562.1																																																																																			T|0.500;C|0.500	0.500	weak		0.363	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1	NM_174981	
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	NME3_ENST00000563498.1_5'Flank|MRPS34_ENST00000177742.3_5'Flank|EME2_ENST00000307394.7_Silent_p.V72V|MRPS34_ENST00000397375.2_5'Flank|NME3_ENST00000219302.3_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		Atlas-SNP	.											.	EME2	40	.	0			c.C216G						PASS	.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		Somatic	2	0	0		WXS	Illumina HiSeq	Phase_I	8	4	0.5	NM_001257370	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385	0.385	strong		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
TTK	7272	hgsc.bcm.edu	37	6	80751906	80751906	+	Missense_Mutation	SNP	G	G	A	rs539988632		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr6:80751906G>A	ENST00000369798.2	+	22	2672	c.2561G>A	c.(2560-2562)aGg>aAg	p.R854K	TTK_ENST00000230510.3_Missense_Mutation_p.R853K|TTK_ENST00000509894.1_Missense_Mutation_p.R853K	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	854					chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.R838K(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		GAAAAAAAAAGGGGAAAAAAA	0.308													G|||	1	0.000199681	0.0	0.0	5008	,	,		15015	0.0		0.001	False		,,,				2504	0.0				p.R854K		Atlas-SNP	.											TTK_ENST00000369798,NS,carcinoma,+1,7	TTK	199	7	1	Substitution - Missense(1)	ovary(1)	c.G2561A						scavenged	.						48.0	51.0	50.0					6																	80751906		2203	4286	6489	SO:0001583	missense	7272	exon22			AAAAAAGGGGAAA		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2561G>A	6.37:g.80751906G>A	ENSP00000358813:p.Arg854Lys	Somatic	333	1	0.003003		WXS	Illumina HiSeq	Phase_I	268	5	0.0186567	NM_003318	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	37	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.513029	0.00975	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.65732	-0.17;-0.17;-0.17	5.6	4.71	0.59529	.	0.346876	0.32134	N	0.006539	T	0.26484	0.0647	L	0.36672	1.1	0.09310	N	1	B;B	0.21520	0.057;0.057	B;B	0.17722	0.019;0.019	T	0.22103	-1.0226	10	0.05721	T	0.95	.	14.7704	0.69671	0.0:0.0:0.8545:0.1455	.	854;853	P33981;A8K8U5	TTK_HUMAN;.	K	853;853;854	ENSP00000422936:R853K;ENSP00000230510:R853K;ENSP00000358813:R854K	ENSP00000230510:R853K	R	+	2	0	TTK	80808625	0.994000	0.37717	0.003000	0.11579	0.004000	0.04260	2.330000	0.43885	1.339000	0.45563	0.561000	0.74099	AGG	.	.	none		0.308	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2		
TMEM108	66000	hgsc.bcm.edu	37	3	133099739	133099739	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:133099739G>A	ENST00000321871.6	+	4	1394	c.1184G>A	c.(1183-1185)aGc>aAc	p.S395N	TMEM108_ENST00000393130.3_Missense_Mutation_p.S395N|TMEM108_ENST00000515826.1_Missense_Mutation_p.S395N|TMEM108_ENST00000508711.1_Intron	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	395						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GTCTCAGAAAGCACTATTTCT	0.592																																					p.S395N		Atlas-SNP	.											.	TMEM108	67	.	0			c.G1184A						PASS	.						51.0	51.0	51.0					3																	133099739		2203	4300	6503	SO:0001583	missense	66000	exon4			CAGAAAGCACTAT	AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.1184G>A	3.37:g.133099739G>A	ENSP00000324651:p.Ser395Asn	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	58	11	0.189655	NM_023943	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	ENST00000321871.6	37	CCDS33858.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.419812	0.42918	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000515826	T;T;T	0.51325	0.77;0.77;0.71	3.66	2.78	0.32641	.	0.563192	0.16981	N	0.191688	T	0.58935	0.2157	L	0.57536	1.79	0.25499	N	0.987578	D;B	0.67145	0.996;0.023	D;B	0.78314	0.991;0.01	T	0.43653	-0.9378	10	0.45353	T	0.12	-9.2727	6.9696	0.24642	0.2917:0.0:0.7083:0.0	.	395;395	E9PB58;Q6UXF1	.;TM108_HUMAN	N	395	ENSP00000324651:S395N;ENSP00000376838:S395N;ENSP00000423338:S395N	ENSP00000324651:S395N	S	+	2	0	TMEM108	134582429	0.989000	0.36119	0.992000	0.48379	0.937000	0.57800	0.931000	0.28871	0.881000	0.35993	0.561000	0.74099	AGC	.	.	none		0.592	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
NEDD4	4734	hgsc.bcm.edu	37	15	56208006	56208006	+	Missense_Mutation	SNP	G	G	A	rs370853036|rs370701101		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr15:56208006G>A	ENST00000508342.1	-	1	1323	c.1024C>T	c.(1024-1026)Cgg>Tgg	p.R342W	NEDD4_ENST00000435532.3_Intron|NEDD4_ENST00000506154.1_Missense_Mutation_p.R342W|NEDD4_ENST00000338963.2_Missense_Mutation_p.R342W	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	342					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		TGAAGCGGCCGTATGTCTCTT	0.418																																					p.R342W		Atlas-SNP	.											.	NEDD4	167	.	0			c.C1024T						PASS	.	G	,TRP/ARG	0,4376		0,0,2188	65.0	68.0	67.0		,1024	-0.7	0.8	15		67	1,8575		0,1,4287	no	intron,missense	NEDD4	NM_006154.2,NM_198400.2	,101	0,1,6475	AA,AG,GG		0.0117,0.0,0.0077	,probably-damaging	,342/1248	56208006	1,12951	2188	4288	6476	SO:0001583	missense	4734	exon1			GCGGCCGTATGTC	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.1024C>T	15.37:g.56208006G>A	ENSP00000424827:p.Arg342Trp	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	64	13	0.203125	NM_198400	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	ENST00000508342.1	37		.	.	.	.	.	.	.	.	.	.	G	12.03	1.816573	0.32145	0.0	1.17E-4	ENSG00000069869	ENST00000508342;ENST00000338963;ENST00000506154	T;T;T	0.45668	0.89;0.89;0.89	5.46	-0.682	0.11339	.	215.666000	0.00166	N	0.000000	T	0.48874	0.1524	M	0.63843	1.955	0.09310	N	0.999998	B;B;B	0.18968	0.032;0.019;0.032	B;B;B	0.16722	0.016;0.012;0.016	T	0.57717	-0.7763	10	0.87932	D	0	.	17.0411	0.86489	0.0:0.0:0.5238:0.4762	.	342;342;342	P46934-2;P46934;P46934-3	.;NEDD4_HUMAN;.	W	342	ENSP00000424827:R342W;ENSP00000345530:R342W;ENSP00000422705:R342W	ENSP00000345530:R342W	R	-	1	2	NEDD4	53995298	0.277000	0.24220	0.787000	0.31911	0.260000	0.26232	1.086000	0.30853	-0.015000	0.14150	-0.488000	0.04728	CGG	.	.	weak		0.418	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400	
COL1A2	1278	hgsc.bcm.edu	37	7	94041934	94041934	+	Silent	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr7:94041934C>T	ENST00000297268.6	+	25	1914	c.1443C>T	c.(1441-1443)ggC>ggT	p.G481G		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	481					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GCCCAATTGGCCCAGCTGGAG	0.512										HNSCC(75;0.22)																											p.G481G		Atlas-SNP	.											.	COL1A2	240	.	0			c.C1443T						PASS	.						51.0	50.0	50.0					7																	94041934		2203	4300	6503	SO:0001819	synonymous_variant	1278	exon25			AATTGGCCCAGCT	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.1443C>T	7.37:g.94041934C>T		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	47	8	0.170213	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	ENST00000297268.6	37	CCDS34682.1																																																																																			.	.	none		0.512	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
TRIM51	84767	hgsc.bcm.edu	37	11	55655597	55655597	+	Silent	SNP	A	A	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr11:55655597A>G	ENST00000449290.2	+	4	689	c.597A>G	c.(595-597)gaA>gaG	p.E199E	TRIM51_ENST00000244891.3_Silent_p.E56E	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	199						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										ATCACTTGGAAAGGCTGCGAA	0.433																																					p.E199E		Atlas-SNP	.											SPRYD5_ENST00000327733,NS,carcinoma,+2,2	.	.	2	0			c.A597G						scavenged	.						61.0	58.0	59.0					11																	55655597		2201	4296	6497	SO:0001819	synonymous_variant	84767	exon4			CTTGGAAAGGCTG	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.597A>G	11.37:g.55655597A>G		Somatic	522	30	0.0574713		WXS	Illumina HiSeq	Phase_I	410	17	0.0414634	NM_032681	A6NMG2	Silent	SNP	ENST00000449290.2	37																																																																																				.	.	none		0.433	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
OR4K1	79544	hgsc.bcm.edu	37	14	20403925	20403925	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr14:20403925G>T	ENST00000285600.4	+	1	159	c.100G>T	c.(100-102)Gtc>Ttc	p.V34F		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		CTTCTCTATAGTCTATGTGAC	0.378																																					p.V34F		Atlas-SNP	.											OR4K1,right_upper_lobe,carcinoma,0,2	OR4K1	108	2	0			c.G100T						scavenged	.						349.0	375.0	366.0					14																	20403925		2203	4300	6503	SO:0001583	missense	79544	exon1			TCTATAGTCTATG		CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.100G>T	14.37:g.20403925G>T	ENSP00000285600:p.Val34Phe	Somatic	186	1	0.00537634		WXS	Illumina HiSeq	Phase_I	182	3	0.0164835	NM_001004063	B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	ENST00000285600.4	37	CCDS32025.1	.	.	.	.	.	.	.	.	.	.	.	0.011	-1.716358	0.00706	.	.	ENSG00000155249	ENST00000285600	T	0.00063	8.78	4.77	0.625	0.17665	.	0.302462	0.24033	N	0.042178	T	0.00039	0.0001	N	0.01809	-0.71	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.37361	-0.9709	10	0.02654	T	1	.	4.2281	0.10590	0.3994:0.1673:0.4333:0.0	.	34	Q8NGD4	OR4K1_HUMAN	F	34	ENSP00000285600:V34F	ENSP00000285600:V34F	V	+	1	0	OR4K1	19473765	0.000000	0.05858	0.004000	0.12327	0.771000	0.43674	-0.319000	0.08039	-0.055000	0.13244	0.561000	0.74099	GTC	.	.	none		0.378	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1		
CSMD1	64478	hgsc.bcm.edu	37	8	2944669	2944669	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:2944669C>T	ENST00000520002.1	-	50	7982	c.7427G>A	c.(7426-7428)cGa>cAa	p.R2476Q	CSMD1_ENST00000537824.1_Missense_Mutation_p.R2475Q|CSMD1_ENST00000602723.1_Missense_Mutation_p.R2476Q|CSMD1_ENST00000400186.3_Missense_Mutation_p.R2476Q|CSMD1_ENST00000542608.1_Missense_Mutation_p.R2475Q|CSMD1_ENST00000602557.1_Missense_Mutation_p.R2476Q			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2476	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.R2204P(1)|p.R2204Q(1)|p.R2475P(1)|p.R2475Q(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAGTGGGTTTCGTCTACAGGT	0.507																																					p.R2475Q		Atlas-SNP	.											CSMD1_ENST00000537824,NS,carcinoma,0,4	CSMD1	1469	4	4	Substitution - Missense(4)	lung(2)|skin(2)	c.G7424A						PASS	.						106.0	106.0	106.0					8																	2944669		2042	4187	6229	SO:0001583	missense	64478	exon49			GGGTTTCGTCTAC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7427G>A	8.37:g.2944669C>T	ENSP00000430733:p.Arg2476Gln	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	52	9	0.173077	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	C	7.075	0.569036	0.13560	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.81	4.93	0.64822	Complement control module (2);Sushi/SCR/CCP (3);	0.172123	0.40064	N	0.001184	T	0.19005	0.0456	L	0.27053	0.805	0.42680	D	0.993547	B;B;B	0.23442	0.015;0.066;0.085	B;B;B	0.21917	0.008;0.037;0.022	T	0.04053	-1.0981	10	0.27785	T	0.31	.	14.2967	0.66318	0.0:0.9289:0.0:0.0711	.	2476;2476;2475	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	Q	2476;2476;2337;2475;2475	ENSP00000383047:R2476Q;ENSP00000430733:R2476Q;ENSP00000441462:R2475Q;ENSP00000446243:R2475Q	ENSP00000320445:R2337Q	R	-	2	0	CSMD1	2932076	0.648000	0.27313	0.059000	0.19551	0.012000	0.07955	1.487000	0.35540	2.749000	0.94314	0.561000	0.74099	CGA	.	.	none		0.507	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CCDC144NL	339184	hgsc.bcm.edu	37	17	20768763	20768763	+	Missense_Mutation	SNP	T	T	C	rs201148033		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr17:20768763T>C	ENST00000327925.5	-	4	750	c.631A>G	c.(631-633)Aag>Gag	p.K211E	RP11-344E13.3_ENST00000577537.1_RNA|CCDC144NL_ENST00000539484.1_5'UTR	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	211										large_intestine(3)|lung(3)|skin(1)	7						TTCTTCCCCTTTCTTTTTCCT	0.368																																					p.K211E		Atlas-SNP	.											CCDC144NL,colon,carcinoma,0,1	CCDC144NL	34	1	0			c.A631G						scavenged	.						103.0	95.0	98.0					17																	20768763		2203	4300	6503	SO:0001583	missense	339184	exon4			TCCCCTTTCTTTT		CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.631A>G	17.37:g.20768763T>C	ENSP00000328054:p.Lys211Glu	Somatic	45	5	0.111111		WXS	Illumina HiSeq	Phase_I	55	8	0.145455	NM_001004306		Missense_Mutation	SNP	ENST00000327925.5	37	CCDS32591.1	.	.	.	.	.	.	.	.	.	.	t	0.914	-0.718026	0.03182	.	.	ENSG00000205212	ENST00000327925	T	0.17854	2.25	.	.	.	.	.	.	.	.	T	0.07098	0.0180	N	0.08118	0	0.09310	N	1	B	0.29162	0.235	B	0.16289	0.015	T	0.29458	-1.0011	7	0.72032	D	0.01	.	.	.	.	.	211	Q6NUI1	C144L_HUMAN	E	211	ENSP00000328054:K211E	ENSP00000328054:K211E	K	-	1	0	CCDC144NL	20709355	0.087000	0.21565	0.028000	0.17463	0.028000	0.11728	0.077000	0.14738	0.077000	0.16863	0.076000	0.15429	AAG	.	.	weak		0.368	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255361.2	NM_001004306	
MUC4	4585	hgsc.bcm.edu	37	3	195513476	195513476	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:195513476T>A	ENST00000463781.3	-	2	5434	c.4975A>T	c.(4975-4977)Aca>Tca	p.T1659S	MUC4_ENST00000475231.1_Missense_Mutation_p.T1659S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCGTGACCTGTGGATGCTGAG	0.587																																					p.T1659S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,+2,5	MUC4	1505	5	0			c.A4975T						scavenged	.						25.0	30.0	29.0					3																	195513476		689	1579	2268	SO:0001583	missense	4585	exon2			GACCTGTGGATGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4975A>T	3.37:g.195513476T>A	ENSP00000417498:p.Thr1659Ser	Somatic	412	9	0.0218447		WXS	Illumina HiSeq	Phase_I	500	16	0.032	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.942	0.175024	0.09391	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.39056	1.28;1.1	0.595	0.595	0.17490	.	.	.	.	.	T	0.32285	0.0824	N	0.19112	0.55	0.09310	N	1	P	0.46578	0.88	P	0.50270	0.636	T	0.14448	-1.0472	8	.	.	.	.	5.5469	0.17069	0.0:1.0E-4:0.0:0.9999	.	1659	E7ESK3	.	S	1659	ENSP00000417498:T1659S;ENSP00000420243:T1659S	.	T	-	1	0	MUC4	196997871	0.088000	0.21588	0.016000	0.15963	0.021000	0.10359	1.695000	0.37763	0.523000	0.28482	0.076000	0.15429	ACA	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TCHH	7062	hgsc.bcm.edu	37	1	152084216	152084216	+	Missense_Mutation	SNP	C	C	G	rs201131683	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:152084216C>G	ENST00000368804.1	-	2	1476	c.1477G>C	c.(1477-1479)Gag>Cag	p.E493Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	493	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTCCTCCTCCTCGAGCTTC	0.672																																					p.E493Q		Atlas-SNP	.											TCHH,NS,lymphoid_neoplasm,0,1	TCHH	275	1	0			c.G1477C						scavenged	.		GLN/GLU	0,4218		0,0,2109	64.0	71.0	69.0		1477	-1.7	0.0	1		69	17,8419		0,17,4201	no	missense	TCHH	NM_007113.2	29	0,17,6310	GG,GC,CC		0.2015,0.0,0.1343	benign	493/1944	152084216	17,12637	2109	4218	6327	SO:0001583	missense	7062	exon3			CCTCCTCCTCGAG	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1477G>C	1.37:g.152084216C>G	ENSP00000357794:p.Glu493Gln	Somatic	33	2	0.0606061		WXS	Illumina HiSeq	Phase_I	19	2	0.105263	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	c	7.158	0.585028	0.13749	0.0	0.002015	ENSG00000159450	ENST00000368804	T	0.04551	3.6	3.42	-1.67	0.08238	.	.	.	.	.	T	0.00695	0.0023	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.43147	-0.9409	9	0.12103	T	0.63	.	11.5902	0.50941	0.1022:0.7375:0.1603:0.0	.	493	Q07283	TRHY_HUMAN	Q	493	ENSP00000357794:E493Q	ENSP00000357794:E493Q	E	-	1	0	TCHH	150350840	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.797000	0.04570	-0.858000	0.04110	-0.574000	0.04147	GAG	C|0.986;G|0.013	0.013	strong		0.672	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
OR2T35	403244	hgsc.bcm.edu	37	1	248801912	248801912	+	Silent	SNP	C	C	G	rs1770044	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:248801912C>G	ENST00000317450.3	-	1	647	c.648G>C	c.(646-648)gtG>gtC	p.V216V		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V216V(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCGTGTAGGACACAGAGATGA	0.542																																					p.V216V		Atlas-SNP	.											OR2T35,NS,carcinoma,0,2	OR2T35	19	2	1	Substitution - coding silent(1)	endometrium(1)	c.G648C						scavenged	.						132.0	107.0	115.0					1																	248801912		2057	4250	6307	SO:0001819	synonymous_variant	403244	exon1			GTAGGACACAGAG	BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.648G>C	1.37:g.248801912C>G		Somatic	113	1	0.00884956		WXS	Illumina HiSeq	Phase_I	89	2	0.0224719	NM_001001827	Q6IEY7	Silent	SNP	ENST00000317450.3	37	CCDS31123.1																																																																																			C|0.500;G|0.500	0.500	strong		0.542	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097130.1	NM_001001827	
COL22A1	169044	hgsc.bcm.edu	37	8	139606427	139606427	+	Missense_Mutation	SNP	A	A	G	rs72727814	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:139606427A>G	ENST00000303045.6	-	63	4894	c.4448T>C	c.(4447-4449)cTc>cCc	p.L1483P	COL22A1_ENST00000435777.1_Missense_Mutation_p.L1463P|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1483	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTGGGCCAGGAGGTAGGCGAG	0.577										HNSCC(7;0.00092)																											p.L1483P		Atlas-SNP	.											.	COL22A1	390	.	0			c.T4448C						PASS	.						35.0	39.0	37.0					8																	139606427		2203	4300	6503	SO:0001583	missense	169044	exon63			GCCAGGAGGTAGG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4448T>C	8.37:g.139606427A>G	ENSP00000303153:p.Leu1483Pro	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	117	11	0.0940171	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.924459	0.52653	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.90504	-2.68;-2.57	5.92	5.92	0.95590	.	0.155601	0.29783	N	0.011218	D	0.93943	0.8061	M	0.63428	1.95	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.77004	0.989;0.972	D	0.92409	0.5936	10	0.26408	T	0.33	.	15.5808	0.76439	1.0:0.0:0.0:0.0	.	1463;1483	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	P	1483;1463;1176	ENSP00000303153:L1483P;ENSP00000387655:L1463P	ENSP00000303153:L1483P	L	-	2	0	COL22A1	139675609	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	7.098000	0.76974	2.275000	0.75901	0.529000	0.55759	CTC	A|0.995;T|0.005	.	alt		0.577	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
MUC4	4585	hgsc.bcm.edu	37	3	195515038	195515038	+	Missense_Mutation	SNP	G	G	A	rs201206859		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:195515038G>A	ENST00000463781.3	-	2	3872	c.3413C>T	c.(3412-3414)cCt>cTt	p.P1138L	MUC4_ENST00000475231.1_Missense_Mutation_p.P1138L|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	605					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P1138L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGAGGT	0.567																																					p.P1138L		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - Missense(1)	endometrium(1)	c.C3413T						scavenged	.																																			SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3413C>T	3.37:g.195515038G>A	ENSP00000417498:p.Pro1138Leu	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	80	6	0.075	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.066	0.197826	0.09652	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33865	1.39;1.39	0.814	0.814	0.18756	.	.	.	.	.	T	0.38108	0.1028	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	D	0.74674	0.984	T	0.21280	-1.0250	8	.	.	.	.	7.6132	0.28142	0.0:0.0:1.0:0.0	.	1138	E7ESK3	.	L	1138	ENSP00000417498:P1138L;ENSP00000420243:P1138L	.	P	-	2	0	MUC4	196999433	0.002000	0.14202	0.001000	0.08648	0.065000	0.16274	1.050000	0.30404	0.776000	0.33473	0.064000	0.15345	CCT	.	.	weak		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
IER5	51278	hgsc.bcm.edu	37	1	181058618	181058618	+	Missense_Mutation	SNP	C	C	G	rs1416829	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:181058618C>G	ENST00000367577.4	+	1	981	c.580C>G	c.(580-582)Cgc>Ggc	p.R194G	RP11-309G3.3_ENST00000606938.1_lincRNA	NM_016545.4	NP_057629.2	Q5VY09	IER5_HUMAN	immediate early response 5	194			R -> G (in dbSNP:rs1416829). {ECO:0000269|PubMed:15498874}.							lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	4						CGCGACCCCCCGCGCTGCCTG	0.811													C|||	2222	0.44369	0.2489	0.4452	5008	,	,		5637	0.6012		0.3777	False		,,,				2504	0.6115				p.R194G		Atlas-SNP	.											IER5,cerebellum,glioma,0,1	IER5	15	1	0			c.C580G						scavenged	.						1.0	1.0	1.0					1																	181058618		352	834	1186	SO:0001583	missense	51278	exon1			ACCCCCCGCGCTG	BC000128	CCDS1343.1	1q25.3	2008-02-05			ENSG00000162783	ENSG00000162783			5393	protein-coding gene	gene with protein product		607177				10049588, 11102586	Standard	NM_016545		Approved		uc001got.4	Q5VY09	OTTHUMG00000035178	ENST00000367577.4:c.580C>G	1.37:g.181058618C>G	ENSP00000356549:p.Arg194Gly	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_016545	B2RBV3|Q8WY68|Q9NY49|Q9NZP9	Missense_Mutation	SNP	ENST00000367577.4	37	CCDS1343.1	948	0.4340659340659341	135	0.27439024390243905	158	0.43646408839779005	360	0.6293706293706294	295	0.3891820580474934	C	4.540	0.100211	0.08731	.	.	ENSG00000162783	ENST00000367577	T	0.11821	2.74	3.33	-0.106	0.13596	.	1.560750	0.05354	N	0.532505	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.18610	0.029	B	0.15484	0.013	T	0.38972	-0.9636	9	0.34782	T	0.22	.	8.3021	0.32021	0.0:0.4746:0.4312:0.0942	rs1416829;rs3747953	194	Q5VY09	IER5_HUMAN	G	194	ENSP00000356549:R194G	ENSP00000356549:R194G	R	+	1	0	IER5	179325241	0.001000	0.12720	0.001000	0.08648	0.005000	0.04900	-0.019000	0.12546	0.004000	0.14682	-1.520000	0.00934	CGC	C|0.566;G|0.434	0.434	strong		0.811	IER5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085142.1	NM_016545	
MUC4	4585	hgsc.bcm.edu	37	3	195505859	195505859	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:195505859T>C	ENST00000463781.3	-	2	13051	c.12592A>G	c.(12592-12594)Act>Gct	p.T4198A	MUC4_ENST00000475231.1_Missense_Mutation_p.T4198A|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T4198A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGTCGGTGACA	0.602																																					p.T4198A		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	3	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	c.A12592G						scavenged	.						19.0	15.0	16.0					3																	195505859		689	1576	2265	SO:0001583	missense	4585	exon2			AGGAAGTGTCGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12592A>G	3.37:g.195505859T>C	ENSP00000417498:p.Thr4198Ala	Somatic	88	17	0.193182		WXS	Illumina HiSeq	Phase_I	104	33	0.317308	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	1.310	-0.602470	0.03744	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35789	1.42;1.29	.	.	.	.	.	.	.	.	T	0.15739	0.0379	N	0.14661	0.345	0.18873	N	0.999989	B	0.14438	0.01	B	0.15870	0.014	T	0.21827	-1.0234	7	.	.	.	.	4.4479	0.11606	0.0:0.2715:0.0:0.7285	.	4070	E7ESK3	.	A	4198	ENSP00000417498:T4198A;ENSP00000420243:T4198A	.	T	-	1	0	MUC4	196990638	0.000000	0.05858	0.008000	0.14137	0.030000	0.12068	-0.602000	0.05680	-1.729000	0.01364	-1.976000	0.00459	ACT	.	.	weak		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
GLTSCR2	29997	hgsc.bcm.edu	37	19	48258717	48258717	+	Missense_Mutation	SNP	A	A	G	rs1804994	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:48258717A>G	ENST00000246802.5	+	9	1204	c.1166A>G	c.(1165-1167)cAg>cGg	p.Q389R	SNORD23_ENST00000408876.1_RNA|CTD-2571L23.6_ENST00000602048.1_RNA|GLTSCR2_ENST00000598681.1_3'UTR	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	389			Q -> R (in dbSNP:rs1804994). {ECO:0000269|PubMed:10708517, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005, ECO:0000269|Ref.4}.			intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		gcgcggcggcagaggcggcgg	0.761													G|||	3570	0.712859	0.857	0.6888	5008	,	,		6528	0.5546		0.6799	False		,,,				2504	0.7321				p.Q389R	Colon(58;613 1041 9473 10089 15241)	Atlas-SNP	.											GLTSCR2,brain,glioma,0,4	GLTSCR2	45	4	0			c.A1166G						scavenged	.						1.0	2.0	1.0					19																	48258717		823	2228	3051	SO:0001583	missense	29997	exon9			GGCGGCAGAGGCG	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.1166A>G	19.37:g.48258717A>G	ENSP00000246802:p.Gln389Arg	Somatic	5	1	0.2		WXS	Illumina HiSeq	Phase_I	16	10	0.625	NM_015710	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	1513	0.6927655677655677	424	0.8617886178861789	252	0.6961325966850829	316	0.5524475524475524	521	0.6873350923482849	G	0.092	-1.166361	0.01660	.	.	ENSG00000105373	ENST00000246802;ENST00000325566	T	0.39229	1.09	3.93	2.86	0.33363	.	0.430291	0.24226	N	0.040398	T	0.00012	0.0000	N	0.00289	-1.7	0.54753	P	1.2000000000012001E-5	B	0.02656	0.0	B	0.06405	0.002	T	0.35450	-0.9788	9	0.05620	T	0.96	-11.9316	6.8245	0.23874	0.2235:0.0:0.7765:0.0	rs1804994;rs3211363;rs16949619;rs17343460;rs17856180;rs17856325;rs57240470	389	Q9NZM5	GSCR2_HUMAN	R	389;383	ENSP00000246802:Q389R	ENSP00000246802:Q389R	Q	+	2	0	GLTSCR2	52950529	0.025000	0.19082	0.815000	0.32552	0.328000	0.28507	0.153000	0.16323	0.415000	0.25817	-0.231000	0.12243	CAG	A|0.308;G|0.692	0.692	strong		0.761	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
GOLGA3	2802	hgsc.bcm.edu	37	12	133389993	133389993	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:133389993G>T	ENST00000450791.2	-	3	602	c.419C>A	c.(418-420)tCt>tAt	p.S140Y	GOLGA3_ENST00000456883.2_Missense_Mutation_p.S140Y|GOLGA3_ENST00000204726.3_Missense_Mutation_p.S140Y|GOLGA3_ENST00000537452.1_Missense_Mutation_p.S140Y|GOLGA3_ENST00000545875.1_Missense_Mutation_p.S140Y			Q08378	GOGA3_HUMAN	golgin A3	140	Interaction with GOPC.	Cleavage; by caspase-3.			intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GGGCAGGGGAGAATCTGTAGA	0.512																																					p.S140Y		Atlas-SNP	.											.	GOLGA3	234	.	0			c.C419A						PASS	.						51.0	46.0	48.0					12																	133389993		2203	4300	6503	SO:0001583	missense	2802	exon4			AGGGGAGAATCTG	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.419C>A	12.37:g.133389993G>T	ENSP00000410378:p.Ser140Tyr	Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	43	7	0.162791	NM_001172557	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118729	0.37436	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.35236	1.75;1.75;1.75;1.32;1.32	5.21	5.21	0.72293	.	0.414396	0.28665	N	0.014554	T	0.36026	0.0952	L	0.43152	1.355	0.80722	D	1	P;B;P	0.45078	0.85;0.432;0.492	B;B;B	0.40534	0.246;0.246;0.332	T	0.32587	-0.9901	10	0.72032	D	0.01	.	18.3644	0.90385	0.0:0.0:1.0:0.0	.	140;140;140	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	Y	140	ENSP00000204726:S140Y;ENSP00000410378:S140Y;ENSP00000409303:S140Y;ENSP00000442143:S140Y;ENSP00000442603:S140Y	ENSP00000204726:S140Y	S	-	2	0	GOLGA3	131900066	1.000000	0.71417	0.069000	0.20011	0.265000	0.26407	8.069000	0.89491	2.414000	0.81942	0.462000	0.41574	TCT	.	.	none		0.512	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895	
IFT122	55764	hgsc.bcm.edu	37	3	129207102	129207102	+	Silent	SNP	C	C	T	rs146874343	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:129207102C>T	ENST00000348417.2	+	16	1931	c.1854C>T	c.(1852-1854)tcC>tcT	p.S618S	IFT122_ENST00000349441.2_Silent_p.S507S|IFT122_ENST00000440957.2_Silent_p.S409S|IFT122_ENST00000504021.1_Silent_p.S512S|IFT122_ENST00000347300.2_Silent_p.S559S|IFT122_ENST00000296266.3_Silent_p.S669S|IFT122_ENST00000431818.2_Silent_p.S468S|IFT122_ENST00000507564.1_Silent_p.S610S	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	618					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						TCCTGCAGTCCGCTCCCATGT	0.493													C|||	46	0.0091853	0.031	0.0029	5008	,	,		20875	0.002		0.001	False		,,,				2504	0.0				p.S669S		Atlas-SNP	.											IFT122,NS,carcinoma,+1,1	IFT122	117	1	0			c.C2007T						scavenged	.	C	,,,	133,4273	95.3+/-134.0	4,125,2074	91.0	86.0	88.0		1677,2007,1854,1521	-2.7	1.0	3	dbSNP_134	88	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	IFT122	NM_018262.2,NM_052985.2,NM_052989.1,NM_052990.1	,,,	4,129,6370	TT,TC,CC		0.0465,3.0186,1.0534	,,,	559/1183,669/1293,618/1242,507/1132	129207102	137,12869	2203	4300	6503	SO:0001819	synonymous_variant	55764	exon17			GCAGTCCGCTCCC	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.1854C>T	3.37:g.129207102C>T		Somatic	282	3	0.0106383		WXS	Illumina HiSeq	Phase_I	316	12	0.0379747	NM_052985	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Silent	SNP	ENST00000348417.2	37	CCDS3061.1																																																																																			C|0.987;T|0.013	0.013	strong		0.493	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262	
PLEKHD1	400224	hgsc.bcm.edu	37	14	69951714	69951714	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr14:69951714C>G	ENST00000322564.7	+	1	244	c.32C>G	c.(31-33)cCc>cGc	p.P11R		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	11										breast(1)|endometrium(1)|kidney(2)	4						TCGGTGTCGCCCTCGCCGTCC	0.682																																					p.P11R		Atlas-SNP	.											.	PLEKHD1	24	.	0			c.C32G						PASS	.						46.0	48.0	47.0					14																	69951714		692	1591	2283	SO:0001583	missense	400224	exon1			TGTCGCCCTCGCC	AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.32C>G	14.37:g.69951714C>G	ENSP00000317175:p.Pro11Arg	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	74	13	0.175676	NM_001161498	B9EJC2	Missense_Mutation	SNP	ENST00000322564.7	37	CCDS53903.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158205	0.78114	.	.	ENSG00000175985	ENST00000322564	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	T	0.75917	0.3915	L	0.54323	1.7	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	T	0.74677	-0.3585	7	.	.	.	.	18.5699	0.91132	0.0:1.0:0.0:0.0	.	11	B9EJC2	.	R	11	.	.	P	+	2	0	PLEKHD1	69021467	1.000000	0.71417	1.000000	0.80357	0.512000	0.34134	7.186000	0.77722	2.387000	0.81309	0.511000	0.50034	CCC	.	.	none		0.682	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412451.2	NM_001161498	
GDA	9615	hgsc.bcm.edu	37	9	74838127	74838127	+	Missense_Mutation	SNP	G	G	A	rs142139311	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr9:74838127G>A	ENST00000358399.3	+	7	791	c.698G>A	c.(697-699)cGt>cAt	p.R233H	GDA_ENST00000238018.4_Missense_Mutation_p.R233H|GDA_ENST00000376986.1_Intron|GDA_ENST00000545168.1_Missense_Mutation_p.R159H|GDA_ENST00000376989.3_Intron|GDA_ENST00000477618.1_3'UTR	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	233					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		GCTAAAACCCGTGATTTGCAC	0.433													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18219	0.001		0.0	False		,,,				2504	0.0				p.R233H		Atlas-SNP	.											.	GDA	113	.	0			c.G698A						PASS	.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	174.0	154.0	161.0		698,476,476,698	-1.5	0.9	9	dbSNP_134	161	0,8600		0,0,4300	no	missense,missense,missense,missense	GDA	NM_001242505.1,NM_001242506.1,NM_001242507.1,NM_004293.3	29,29,29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign	233/472,159/381,159/381,233/455	74838127	1,13005	2203	4300	6503	SO:0001583	missense	9615	exon7			AAACCCGTGATTT	AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.698G>A	9.37:g.74838127G>A	ENSP00000351170:p.Arg233His	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	96	5	0.0520833	NM_004293	B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Missense_Mutation	SNP	ENST00000358399.3	37	CCDS6641.1	.	.	.	.	.	.	.	.	.	.	G	1.462	-0.562132	0.03939	2.27E-4	0.0	ENSG00000119125	ENST00000545168;ENST00000238018;ENST00000358399;ENST00000414671	D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65	5.58	-1.51	0.08664	Amidohydrolase 1 (1);	0.560216	0.21401	N	0.075150	T	0.66376	0.2783	N	0.00496	-1.435	0.27209	N	0.959976	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.61402	-0.7070	10	0.15066	T	0.55	-0.897	10.6755	0.45783	0.739:0.0:0.261:0.0	.	233;233	Q9Y2T3-3;Q9Y2T3	.;GUAD_HUMAN	H	159;233;233;99	ENSP00000437972:R159H;ENSP00000238018:R233H;ENSP00000351170:R233H;ENSP00000403897:R99H	ENSP00000238018:R233H	R	+	2	0	GDA	74027947	0.001000	0.12720	0.885000	0.34714	0.643000	0.38383	0.307000	0.19296	-0.524000	0.06400	-0.783000	0.03347	CGT	G|1.000;A|0.000	0.000	weak		0.433	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052633.1		
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V|FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000460181.1_3'UTR	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		Atlas-SNP	.											.	FPGS	30	.	0			c.A64G						PASS	.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	13	13	1	NM_004957	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.234;G|0.766	0.766	strong		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
PCYOX1L	78991	hgsc.bcm.edu	37	5	148742308	148742308	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr5:148742308G>T	ENST00000274569.4	+	2	259	c.197G>T	c.(196-198)cGc>cTc	p.R66L	PCYOX1L_ENST00000514349.1_5'UTR	NM_024028.3	NP_076933.3	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like	66					prenylcysteine catabolic process (GO:0030328)	extracellular region (GO:0005576)|membrane (GO:0016020)	prenylcysteine oxidase activity (GO:0001735)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGGTGGCCGCTTGGCCACC	0.612																																					p.R66L	Ovarian(62;1136 1477 27277 27495)	Atlas-SNP	.											.	PCYOX1L	32	.	0			c.G197T						PASS	.						102.0	107.0	105.0					5																	148742308		2203	4300	6503	SO:0001583	missense	78991	exon2			GTGGCCGCTTGGC		CCDS4296.1	5q33.1	2008-02-05			ENSG00000145882	ENSG00000145882			28477	protein-coding gene	gene with protein product						12477932	Standard	NM_024028		Approved	MGC3265	uc003lqk.2	Q8NBM8	OTTHUMG00000130052	ENST00000274569.4:c.197G>T	5.37:g.148742308G>T	ENSP00000274569:p.Arg66Leu	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	44	14	0.318182	NM_024028	Q7Z4S2|Q8NCY5|Q8NF69|Q9BTE8|Q9BWS3	Missense_Mutation	SNP	ENST00000274569.4	37	CCDS4296.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532690	0.85812	.	.	ENSG00000145882	ENST00000274569	T	0.14391	2.51	5.23	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.36690	0.0976	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.26121	-1.0112	10	0.87932	D	0	-20.8276	16.1457	0.81563	0.0:0.1339:0.8661:0.0	.	66	Q8NBM8	PCYXL_HUMAN	L	66	ENSP00000274569:R66L	ENSP00000274569:R66L	R	+	2	0	PCYOX1L	148722501	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	7.840000	0.86819	1.321000	0.45227	0.561000	0.74099	CGC	.	.	none		0.612	PCYOX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252331.2	NM_024028	
EVC2	132884	hgsc.bcm.edu	37	4	5630349	5630349	+	Missense_Mutation	SNP	C	C	T	rs145693546	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr4:5630349C>T	ENST00000344408.5	-	12	1876	c.1823G>A	c.(1822-1824)cGt>cAt	p.R608H	EVC2_ENST00000310917.2_Missense_Mutation_p.R528H|EVC2_ENST00000344938.1_Missense_Mutation_p.R608H	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	608					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R608H(2)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						GCCCTGCACACGGGTCTCTGA	0.507													C|||	2	0.000399361	0.0	0.0014	5008	,	,		15112	0.0		0.001	False		,,,				2504	0.0				p.R608H		Atlas-SNP	.											EVC2,NS,carcinoma,0,2	EVC2	202	2	2	Substitution - Missense(2)	lung(1)|pancreas(1)	c.G1823A						PASS	.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	117.0	107.0	110.0		1583,1823	4.0	0.9	4	dbSNP_134	110	18,8582	13.3+/-46.6	0,18,4282	yes	missense,missense	EVC2	NM_001166136.1,NM_147127.4	29,29	0,18,6485	TT,TC,CC		0.2093,0.0,0.1384	benign,benign	528/1229,608/1309	5630349	18,12988	2203	4300	6503	SO:0001583	missense	132884	exon12			TGCACACGGGTCT	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1823G>A	4.37:g.5630349C>T	ENSP00000342144:p.Arg608His	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	51	10	0.196078	NM_147127	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.35	2.806076	0.50421	0.0	0.002093	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.77229	-1.08;-1.08;-1.08	4.89	4.03	0.46877	.	0.241588	0.35555	N	0.003133	T	0.69663	0.3136	M	0.65975	2.015	0.34074	D	0.65882	P	0.38565	0.637	B	0.32211	0.142	T	0.77616	-0.2521	10	0.39692	T	0.17	-15.3919	8.6899	0.34260	0.0:0.8367:0.0:0.1633	.	608	Q86UK5	LBN_HUMAN	H	608;528;608	ENSP00000339954:R608H;ENSP00000311683:R528H;ENSP00000342144:R608H	ENSP00000311683:R528H	R	-	2	0	EVC2	5681250	0.208000	0.23494	0.945000	0.38365	0.980000	0.70556	0.324000	0.19610	2.426000	0.82243	0.484000	0.47621	CGT	C|0.998;T|0.002	0.002	strong		0.507	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
DRD5	1816	hgsc.bcm.edu	37	4	9784882	9784882	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr4:9784882A>G	ENST00000304374.2	+	1	1625	c.1229A>G	c.(1228-1230)tAc>tGc	p.Y410C		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	410					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.Y410C(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GCAGCTGCCTACATCCACATG	0.567																																					p.Y410C		Atlas-SNP	.											DRD5,NS,carcinoma,0,1	DRD5	119	1	1	Substitution - Missense(1)	endometrium(1)	c.A1229G						scavenged	.						95.0	78.0	84.0					4																	9784882		2203	4300	6503	SO:0001583	missense	1816	exon1			CTGCCTACATCCA	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1229A>G	4.37:g.9784882A>G	ENSP00000306129:p.Tyr410Cys	Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	88	4	0.0454545	NM_000798	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	a	4.012	-0.000485	0.07819	.	.	ENSG00000169676	ENST00000304374	T	0.65732	-0.17	4.84	-0.829	0.10796	.	0.427940	0.23452	N	0.048029	T	0.52484	0.1737	M	0.63843	1.955	0.40005	D	0.975218	B	0.13145	0.007	B	0.12156	0.007	T	0.39354	-0.9618	10	0.42905	T	0.14	.	7.8717	0.29569	0.5289:0.3988:0.0724:0.0	.	410	P21918	DRD5_HUMAN	C	410	ENSP00000306129:Y410C	ENSP00000306129:Y410C	Y	+	2	0	DRD5	9393980	1.000000	0.71417	0.005000	0.12908	0.158000	0.22134	3.963000	0.56773	-0.248000	0.09583	0.377000	0.23210	TAC	.	.	none		0.567	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
MUC4	4585	hgsc.bcm.edu	37	3	195508478	195508478	+	Missense_Mutation	SNP	G	G	C	rs76305071	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:195508478G>C	ENST00000463781.3	-	2	10432	c.9973C>G	c.(9973-9975)Cac>Gac	p.H3325D	MUC4_ENST00000475231.1_Missense_Mutation_p.H3325D|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3305_S3336delVSTGHATPLLVTDASSASTGHATPLHVTSPSS(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGCGTGACCTGTGGAT	0.582													.|||	36	0.0071885	0.025	0.0043	5008	,	,		11084	0.0		0.0	False		,,,				2504	0.0				p.H3325D		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,+2,3	MUC4	1505	3	1	Deletion - In frame(1)	stomach(1)	c.C9973G						scavenged	.						16.0	16.0	16.0					3																	195508478		681	1566	2247	SO:0001583	missense	4585	exon2			TGGCGTGACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9973C>G	3.37:g.195508478G>C	ENSP00000417498:p.His3325Asp	Somatic	56	4	0.0714286		WXS	Illumina HiSeq	Phase_I	68	6	0.0882353	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	2.541	-0.306191	0.05458	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.26957	1.7;1.7	1.03	-0.504	0.11997	.	.	.	.	.	T	0.11110	0.0271	N	0.14661	0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33854	-0.9852	7	.	.	.	.	2.6532	0.05004	0.0:0.4387:0.3046:0.2566	.	3197	E7ESK3	.	D	3325	ENSP00000417498:H3325D;ENSP00000420243:H3325D	.	H	-	1	0	MUC4	196993257	0.129000	0.22400	0.000000	0.03702	0.009000	0.06853	0.657000	0.24963	-2.022000	0.00938	-1.954000	0.00483	CAC	G|0.990;C|0.010	0.010	strong		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ZNF285	26974	hgsc.bcm.edu	37	19	44892266	44892266	+	Splice_Site	SNP	T	T	C	rs200167944		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:44892266T>C	ENST00000330997.4	-	4	207		c.e4-2		CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Splice_Site|ZNF285_ENST00000544719.2_Splice_Site	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						TCCCGTCTCCTAGGAGAAGAA	0.413																																					.		Atlas-SNP	.											ZNF285,colon,carcinoma,0,1	ZNF285	86	1	0			c.143-2A>G						scavenged	.						50.0	54.0	53.0					19																	44892266		2173	4283	6456	SO:0001630	splice_region_variant	26974	exon5			GTCTCCTAGGAGA	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.143-2A>G	19.37:g.44892266T>C		Somatic	108	2	0.0185185		WXS	Illumina HiSeq	Phase_I	84	4	0.047619	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Splice_Site	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	T	9.943	1.218077	0.22373	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	.	.	.	3.86	3.86	0.44501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3975	0.38412	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF285	49584106	0.507000	0.26146	0.215000	0.23724	0.122000	0.20287	3.134000	0.50538	1.528000	0.49103	0.373000	0.22412	.	.	.	weak		0.413	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	Intron
AGGF1	55109	hgsc.bcm.edu	37	5	76332530	76332530	+	Silent	SNP	T	T	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr5:76332530T>G	ENST00000312916.7	+	4	1048	c.666T>G	c.(664-666)ggT>ggG	p.G222G		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	222					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		ACAGCACTGGTTTCTATTATG	0.423																																					p.G222G		Atlas-SNP	.											AGGF1,NS,carcinoma,+2,1	AGGF1	71	1	0			c.T666G						scavenged	.						48.0	49.0	49.0					5																	76332530		2203	4300	6503	SO:0001819	synonymous_variant	55109	exon4			CACTGGTTTCTAT	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.666T>G	5.37:g.76332530T>G		Somatic	150	2	0.0133333		WXS	Illumina HiSeq	Phase_I	110	3	0.0272727	NM_018046	O00581|Q53YS3|Q9BU84|Q9NW66	Silent	SNP	ENST00000312916.7	37	CCDS4035.1																																																																																			.	.	none		0.423	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	NM_018046	
TUBA3C	7278	hgsc.bcm.edu	37	13	19751301	19751301	+	Silent	SNP	C	C	T	rs140548354		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:19751301C>T	ENST00000400113.3	-	4	926	c.822G>A	c.(820-822)ccG>ccA	p.P274P		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	274					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CTGAGATGACCGGGGCGTAGG	0.607																																					p.P274P		Atlas-SNP	.											TUBA3C,bladder,carcinoma,-2,1	TUBA3C	166	1	0			c.G822A						scavenged	.						123.0	114.0	117.0					13																	19751301		2203	4300	6503	SO:0001819	synonymous_variant	7278	exon4			GATGACCGGGGCG	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.822G>A	13.37:g.19751301C>T		Somatic	127	5	0.0393701		WXS	Illumina HiSeq	Phase_I	112	6	0.0535714	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																			C|0.999;T|0.001	0.001	weak		0.607	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
CSMD3	114788	hgsc.bcm.edu	37	8	113657379	113657379	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:113657379G>A	ENST00000297405.5	-	20	3513	c.3269C>T	c.(3268-3270)tCt>tTt	p.S1090F	CSMD3_ENST00000455883.2_Missense_Mutation_p.S986F|MIR2053_ENST00000459295.1_RNA|CSMD3_ENST00000343508.3_Missense_Mutation_p.S1050F|CSMD3_ENST00000352409.3_Missense_Mutation_p.S1090F	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1090	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1090Y(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACAATTCAGAGAATTTGGATA	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S1090F		Atlas-SNP	.											CSMD3_ENST00000343508,NS,carcinoma,0,5	CSMD3	2325	5	1	Substitution - Missense(1)	large_intestine(1)	c.C3269T						PASS	.						92.0	92.0	92.0					8																	113657379		2203	4300	6503	SO:0001583	missense	114788	exon20			TTCAGAGAATTTG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3269C>T	8.37:g.113657379G>A	ENSP00000297405:p.Ser1090Phe	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	66	14	0.212121	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979091	0.74360	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.68	5.68	0.88126	CUB (5);	0.073489	0.56097	D	0.000033	T	0.54565	0.1866	M	0.62016	1.91	0.43069	D	0.994709	B;B;D	0.67145	0.016;0.02;0.996	B;B;D	0.66602	0.026;0.044;0.945	T	0.53301	-0.8458	10	0.66056	D	0.02	.	20.1553	0.98111	0.0:0.0:1.0:0.0	.	986;1090;1050	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	F	1050;1090;430;986;1090	ENSP00000345799:S1050F;ENSP00000297405:S1090F;ENSP00000341558:S430F;ENSP00000412263:S986F;ENSP00000343124:S1090F	ENSP00000297405:S1090F	S	-	2	0	CSMD3	113726555	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.677000	0.74503	2.838000	0.97847	0.591000	0.81541	TCT	.	.	none		0.363	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
MUC4	4585	hgsc.bcm.edu	37	3	195507874	195507874	+	Missense_Mutation	SNP	G	G	T	rs199875073		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:195507874G>T	ENST00000463781.3	-	2	11036	c.10577C>A	c.(10576-10578)aCt>aAt	p.T3526N	MUC4_ENST00000475231.1_Missense_Mutation_p.T3526N|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTCGGTGAC	0.602																																					p.T3526N		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.C10577A						scavenged	.						44.0	36.0	38.0					3																	195507874		680	1586	2266	SO:0001583	missense	4585	exon2			GAGGAAGTGTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10577C>A	3.37:g.195507874G>T	ENSP00000417498:p.Thr3526Asn	Somatic	247	7	0.0283401		WXS	Illumina HiSeq	Phase_I	303	10	0.0330033	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.955	0.177484	0.09443	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30714	1.52;1.62	0.743	0.743	0.18347	.	.	.	.	.	T	0.11793	0.0287	N	0.08118	0	0.09310	N	1	B	0.22909	0.077	B	0.09377	0.004	T	0.29181	-1.0020	8	.	.	.	.	3.2552	0.06828	0.3579:0.0:0.6421:0.0	.	3398	E7ESK3	.	N	3526	ENSP00000417498:T3526N;ENSP00000420243:T3526N	.	T	-	2	0	MUC4	196992653	0.003000	0.15002	0.011000	0.14972	0.011000	0.07611	1.098000	0.31000	0.088000	0.17205	0.089000	0.15464	ACT	.	.	weak		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
RNF128	79589	hgsc.bcm.edu	37	X	105970554	105970554	+	Missense_Mutation	SNP	G	G	C	rs148223909		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chrX:105970554G>C	ENST00000255499.2	+	1	661	c.411G>C	c.(409-411)gaG>gaC	p.E137D	RNF128_ENST00000324342.3_Intron	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	137	PA.				negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						TGGCTTATGAGAGAGGGGCGT	0.602																																					p.E137D		Atlas-SNP	.											.	RNF128	74	.	0			c.G411C						PASS	.	G	,ASP/GLU	0,3835		0,0,1632,571	53.0	49.0	50.0		,411	2.4	1.0	X	dbSNP_134	50	1,6727		0,1,2427,1872	no	intron,missense	RNF128	NM_024539.3,NM_194463.1	,45	0,1,4059,2443	CC,CG,GG,G		0.0149,0.0,0.0095	,benign	,137/429	105970554	1,10562	2203	4300	6503	SO:0001583	missense	79589	exon1			TTATGAGAGAGGG	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.411G>C	X.37:g.105970554G>C	ENSP00000255499:p.Glu137Asp	Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	176	50	0.284091	NM_194463	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Missense_Mutation	SNP	ENST00000255499.2	37	CCDS14521.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636379	0.29068	0.0	1.49E-4	ENSG00000133135	ENST00000255499	T	0.07444	3.19	4.29	2.37	0.29283	Protease-associated domain, PA (1);	0.762462	0.12450	N	0.467829	T	0.04770	0.0129	N	0.16368	0.405	0.32627	N	0.522588	B	0.02656	0.0	B	0.08055	0.003	T	0.28522	-1.0041	10	0.22706	T	0.39	.	5.6553	0.17639	0.123:0.1989:0.6781:0.0	.	137	Q8TEB7	RN128_HUMAN	D	137	ENSP00000255499:E137D	ENSP00000255499:E137D	E	+	3	2	RNF128	105857210	1.000000	0.71417	0.999000	0.59377	0.855000	0.48748	0.891000	0.28309	0.771000	0.33359	0.600000	0.82982	GAG	G|1.000;C|0.000	0.000	weak		0.602	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539	
BTG1	694	hgsc.bcm.edu	37	12	92539200	92539200	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:92539200G>A	ENST00000256015.3	-	1	473	c.112C>T	c.(112-114)Cag>Tag	p.Q38*	C12orf79_ENST00000549802.1_5'Flank|C12orf79_ENST00000546975.1_5'Flank|RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000551563.2_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	38					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)	p.Q38E(1)		haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CTGAAGGTCTGCAGCTGTCGC	0.682			T	MYC	BCLL																																p.Q38X		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	BTG1,NS,lymphoid_neoplasm,0,1	BTG1	30	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C112T						scavenged	.						37.0	40.0	39.0					12																	92539200		2203	4300	6503	SO:0001587	stop_gained	694	exon1			AGGTCTGCAGCTG		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.112C>T	12.37:g.92539200G>A	ENSP00000256015:p.Gln38*	Somatic	123	1	0.00813008		WXS	Illumina HiSeq	Phase_I	85	12	0.141176	NM_001731	P31607	Nonsense_Mutation	SNP	ENST00000256015.3	37	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	G	39	7.775086	0.98483	.	.	ENSG00000133639	ENST00000256015	.	.	.	3.92	1.83	0.25207	.	0.185973	0.48286	D	0.000200	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-3.618	9.7333	0.40374	0.0:0.1525:0.6897:0.1579	.	.	.	.	X	38	.	ENSP00000256015:Q38X	Q	-	1	0	BTG1	91063331	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.272000	0.89885	0.765000	0.33221	0.455000	0.32223	CAG	.	.	none		0.682	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
POM121	9883	hgsc.bcm.edu	37	7	72413896	72413896	+	Missense_Mutation	SNP	A	A	G	rs201049716		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr7:72413896A>G	ENST00000434423.2	+	11	3364	c.3364A>G	c.(3364-3366)Acc>Gcc	p.T1122A	POM121_ENST00000358357.3_Missense_Mutation_p.T857A|POM121_ENST00000446813.1_Missense_Mutation_p.T857A|POM121_ENST00000257622.4_Missense_Mutation_p.T857A|POM121_ENST00000395270.1_Missense_Mutation_p.T857A			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1122	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.T857A(8)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				AGGCTCCAGCACCACCACCGG	0.637																																					p.T857A		Atlas-SNP	.											POM121_ENST00000395270,NS,carcinoma,0,8	POM121	131	8	8	Substitution - Missense(8)	lung(4)|kidney(4)	c.A2569G						scavenged	.						32.0	30.0	30.0					7																	72413896		2201	4299	6500	SO:0001583	missense	9883	exon11			TCCAGCACCACCA	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.3364A>G	7.37:g.72413896A>G	ENSP00000405562:p.Thr1122Ala	Somatic	346	5	0.0144509		WXS	Illumina HiSeq	Phase_I	354	8	0.0225989	NM_172020	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000434423.2	37		56	0.02564102564102564	11	0.022357723577235773	14	0.03867403314917127	19	0.033216783216783216	12	0.0158311345646438	G	2.480	-0.319876	0.05386	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.05649	3.46;3.41;3.46;3.41;3.71	2.86	-2.18	0.07037	.	0.720175	0.11383	N	0.569582	T	0.00724	0.0024	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.42275	-0.9461	10	0.36615	T	0.2	.	4.8571	0.13564	0.1842:0.0:0.3666:0.4491	.	857;1122	A8MXF9;Q96HA1	.;P121A_HUMAN	A	857;857;857;857;1122	ENSP00000393020:T857A;ENSP00000257622:T857A;ENSP00000378687:T857A;ENSP00000351124:T857A;ENSP00000405562:T1122A	ENSP00000257622:T857A	T	+	1	0	POM121	72051832	0.360000	0.24964	0.406000	0.26421	0.004000	0.04260	0.000000	0.12993	-0.499000	0.06623	-2.511000	0.00188	ACC	A|0.500;G|0.500	0.500	weak		0.637	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
GDF3	9573	hgsc.bcm.edu	37	12	7848214	7848214	+	Silent	SNP	C	C	T	rs376751766		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:7848214C>T	ENST00000329913.3	-	1	158	c.111G>A	c.(109-111)aaG>aaA	p.K37K		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	37					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						GTGAAGGCGCCTTATCTAAGC	0.478																																					p.K37K		Atlas-SNP	.											.	GDF3	68	.	0			c.G111A						PASS	.	C		0,4406		0,0,2203	47.0	48.0	48.0		111	-1.4	0.0	12		48	1,8599		0,1,4299	no	coding-synonymous	GDF3	NM_020634.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		37/365	7848214	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9573	exon1			AGGCGCCTTATCT	AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.111G>A	12.37:g.7848214C>T		Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	82	13	0.158537	NM_020634	Q8NEJ4	Silent	SNP	ENST00000329913.3	37	CCDS8581.1																																																																																			.	.	weak		0.478	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399717.1		
STK11	6794	hgsc.bcm.edu	37	19	1220490	1220490	+	Silent	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:1220490C>T	ENST00000326873.7	+	4	1756	c.583C>T	c.(583-585)Ctg>Ttg	p.L195L		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	195	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.Y156fs*87(4)|p.?(3)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		AATCTCCGACCTGGGCGTGGC	0.687		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																											p.L195L		Atlas-SNP	.	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	STK11,NS,carcinoma,0,1	STK11	410	1	27	Whole gene deletion(20)|Deletion - Frameshift(4)|Unknown(3)	cervix(14)|lung(9)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	c.C583T						PASS	.						35.0	40.0	38.0					19																	1220490		2011	4156	6167	SO:0001819	synonymous_variant	6794	exon4	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	TCCGACCTGGGCG	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.583C>T	19.37:g.1220490C>T		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	68	10	0.147059	NM_000455	B2RBX7|E7EW76	Silent	SNP	ENST00000326873.7	37	CCDS45896.1																																																																																			.	.	none		0.687	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	
AKAP11	11215	hgsc.bcm.edu	37	13	42877901	42877901	+	Silent	SNP	C	C	T	rs201525107	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:42877901C>T	ENST00000025301.2	+	8	5194	c.5019C>T	c.(5017-5019)gcC>gcT	p.A1673A		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1673					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		GCCTGGCAGCCGACAGTGGGA	0.507													C|||	3	0.000599042	0.0	0.0	5008	,	,		18914	0.003		0.0	False		,,,				2504	0.0				p.A1673A		Atlas-SNP	.											.	AKAP11	146	.	0			c.C5019T						PASS	.						37.0	35.0	36.0					13																	42877901		2203	4300	6503	SO:0001819	synonymous_variant	11215	exon8			GGCAGCCGACAGT	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5019C>T	13.37:g.42877901C>T		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	96	24	0.25	NM_016248	O75124|Q9NUK7	Silent	SNP	ENST00000025301.2	37	CCDS9383.1																																																																																			C|1.000;T|0.000	0.000	strong		0.507	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
SMARCAD1	56916	hgsc.bcm.edu	37	4	95199798	95199798	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr4:95199798G>T	ENST00000354268.4	+	18	2283	c.2210G>T	c.(2209-2211)cGa>cTa	p.R737L	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.R737L|SMARCAD1_ENST00000509418.1_Missense_Mutation_p.R307L			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	737					ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.R737Q(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		AAGAAAGATCGAATTGAGTTG	0.338																																					p.R737L		Atlas-SNP	.											SMARCAD1,NS,malignant_melanoma,+1,3	SMARCAD1	97	3	1	Substitution - Missense(1)	large_intestine(1)	c.G2210T						scavenged	.						90.0	97.0	95.0					4																	95199798		2198	4300	6498	SO:0001583	missense	56916	exon18			AAGATCGAATTGA	AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.2210G>T	4.37:g.95199798G>T	ENSP00000346217:p.Arg737Leu	Somatic	323	1	0.00309598		WXS	Illumina HiSeq	Phase_I	288	3	0.0104167	NM_001128429	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	37	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	G	0.198	-1.047315	0.01981	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.55	-9.99	0.00435	SNF2-related (1);	1.372300	0.05135	N	0.493304	D	0.83022	0.5164	N	0.12746	0.255	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.69789	-0.5050	10	0.12430	T	0.62	1.7678	14.3145	0.66440	0.2865:0.0:0.6031:0.1104	.	737;737	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	L	737;737;737;307	ENSP00000351947:R737L;ENSP00000415576:R737L;ENSP00000346217:R737L;ENSP00000423286:R307L	ENSP00000346217:R737L	R	+	2	0	SMARCAD1	95418821	0.000000	0.05858	0.005000	0.12908	0.129000	0.20672	0.145000	0.16157	-1.752000	0.01325	-1.223000	0.01593	CGA	.	.	none		0.338	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159	
CD79B	974	hgsc.bcm.edu	37	17	62006798	62006798	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr17:62006798T>A	ENST00000006750.3	-	5	679	c.587A>T	c.(586-588)tAc>tTc	p.Y196F	CD79B_ENST00000349817.2_Missense_Mutation_p.Y92F|CD79B_ENST00000392795.3_Missense_Mutation_p.Y197F	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	196	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.				B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.Y196C(1)|p.Y196F(1)|p.Y196S(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						CCTTACCTCGTAGGTGTGATC	0.632			"""Mis, O"""		DLBCL																																p.Y197F		Atlas-SNP	.		Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	CD79B,NS,lymphoid_neoplasm,-1,13	CD79B	38	13	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.A590T						PASS	.						93.0	74.0	81.0					17																	62006798		2203	4300	6503	SO:0001583	missense	974	exon5			ACCTCGTAGGTGT	L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.587A>T	17.37:g.62006798T>A	ENSP00000006750:p.Tyr196Phe	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	50	21	0.42	NM_001039933	Q53FS2|Q9BU06	Missense_Mutation	SNP	ENST00000006750.3	37	CCDS11655.1	.	.	.	.	.	.	.	.	.	.	T	15.77	2.930227	0.52866	.	.	ENSG00000007312	ENST00000349817;ENST00000392795;ENST00000006750	D;D;D	0.96587	-4.06;-4.06;-4.06	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000002	D	0.95601	0.8570	N	0.24115	0.695	0.43426	D	0.995588	D;D	0.76494	0.996;0.999	D;D	0.85130	0.986;0.997	D	0.95387	0.8478	10	0.87932	D	0	-12.4743	9.5968	0.39578	0.0:0.0:0.0:1.0	.	92;196	P40259-2;P40259	.;CD79B_HUMAN	F	92;197;196	ENSP00000245862:Y92F;ENSP00000376544:Y197F;ENSP00000006750:Y196F	ENSP00000006750:Y196F	Y	-	2	0	CD79B	59360530	0.997000	0.39634	0.977000	0.42913	0.245000	0.25701	3.902000	0.56310	1.782000	0.52362	0.358000	0.22013	TAC	.	.	none		0.632	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417711.1		
KCNQ2	3785	hgsc.bcm.edu	37	20	62038381	62038381	+	Silent	SNP	C	C	T	rs139587368	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr20:62038381C>T	ENST00000359125.2	-	17	2409	c.2235G>A	c.(2233-2235)ccG>ccA	p.P745P	KCNQ2_ENST00000360480.3_Silent_p.P717P|KCNQ2_ENST00000354587.3_Silent_p.P753P|KCNQ2_ENST00000370224.1_Silent_p.P753P|KCNQ2_ENST00000357249.2_Silent_p.P727P|KCNQ2_ENST00000359689.1_Silent_p.P745P|KCNQ2_ENST00000344462.4_Silent_p.P714P	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	745					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CGTGGGCAGGCGGCGGCGGGA	0.771													C|||	115	0.0229633	0.0008	0.0014	5008	,	,		11038	0.1111		0.0	False		,,,				2504	0.001				p.P745P		Atlas-SNP	.											.	KCNQ2	201	.	0			c.G2235A						PASS	.	C	,,,	4,3478		0,4,1737	3.0	4.0	4.0		2151,2181,2235,2142	-10.3	0.1	20	dbSNP_134	4	3,7003		0,3,3500	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KCNQ2	NM_004518.4,NM_172106.1,NM_172107.2,NM_172108.3	,,,	0,7,5237	TT,TC,CC		0.0428,0.1149,0.0667	,,,	717/845,727/855,745/873,714/842	62038381	7,10481	1741	3503	5244	SO:0001819	synonymous_variant	3785	exon17			GGCAGGCGGCGGC	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.2235G>A	20.37:g.62038381C>T		Somatic	1	0	0		WXS	Illumina HiSeq	Phase_I	15	10	0.666667	NM_172107	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Silent	SNP	ENST00000359125.2	37	CCDS13520.1																																																																																			C|0.975;T|0.025	0.025	strong		0.771	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
DHRS4	10901	hgsc.bcm.edu	37	14	24424420	24424420	+	Splice_Site	SNP	C	C	T	rs537144117	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr14:24424420C>T	ENST00000313250.5	+	2	508	c.305C>T	c.(304-306)aCg>aTg	p.T102M	DHRS4_ENST00000421831.1_Splice_Site_p.T84M|DHRS4_ENST00000382761.3_Splice_Site_p.T84M|DHRS4_ENST00000397074.3_Splice_Site_p.T102M|DHRS4_ENST00000559632.1_Splice_Site_p.T102M|DHRS4_ENST00000397073.2_Splice_Site_p.T84M|DHRS4-AS1_ENST00000556379.1_RNA|DHRS4_ENST00000558581.1_Splice_Site_p.T102M|DHRS4_ENST00000558263.1_Splice_Site_p.T102M|DHRS4_ENST00000308178.8_Splice_Site_p.T84M|DHRS4_ENST00000397075.3_Splice_Site_p.T102M|DHRS4_ENST00000543741.2_Splice_Site_p.T102M	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4	102				T -> M (in Ref. 1; AAD02292). {ECO:0000305}.	alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)	p.T102M(4)		central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	CTGGTGGCCACGGTGAGCTGC	0.652													.|||	14	0.00279553	0.0008	0.0	5008	,	,		13962	0.003		0.004	False		,,,				2504	0.0061				p.T102M		Atlas-SNP	.											DHRS4,NS,carcinoma,0,5	DHRS4	22	5	4	Substitution - Missense(4)	central_nervous_system(2)|lung(1)|kidney(1)	c.C305T						scavenged	.																																			SO:0001630	splice_region_variant	10901	exon2			TGGCCACGGTGAG	AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.306+1C>T	14.37:g.24424420C>T		Somatic	124	8	0.0645161		WXS	Illumina HiSeq	Phase_I	116	6	0.0517241	NM_021004	B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	Missense_Mutation	SNP	ENST00000313250.5	37	CCDS9605.1	.	.	.	.	.	.	.	.	.	.	.	8.197	0.797295	0.16327	.	.	ENSG00000157326	ENST00000313250;ENST00000421831;ENST00000397073;ENST00000308178;ENST00000382761;ENST00000397075;ENST00000397074;ENST00000543741	T;T;D;D;D;D;D;D	0.88201	0.93;0.93;-2.35;-2.35;-2.35;-2.35;-2.35;-2.35	3.78	0.837	0.18896	NAD(P)-binding domain (1);	0.264094	0.42294	N	0.000732	D	0.83839	0.5341	M	0.77712	2.385	0.36055	D	0.841007	P;B;B;B;B;B	0.45011	0.848;0.001;0.002;0.065;0.05;0.035	B;B;B;B;B;B	0.34180	0.177;0.002;0.001;0.016;0.064;0.044	T	0.80294	-0.1443	10	0.37606	T	0.19	.	7.6245	0.28204	0.0:0.6987:0.0:0.3013	.	102;102;102;102;102;102	Q9BTZ2-5;F5GWZ1;Q9BTZ2-2;Q9BTZ2-7;Q9BTZ2-4;Q9BTZ2	.;.;.;.;.;DHRS4_HUMAN	M	102;84;84;84;84;102;102;102	ENSP00000326219:T102M;ENSP00000404147:T84M;ENSP00000380263:T84M;ENSP00000311993:T84M;ENSP00000372209:T84M;ENSP00000380265:T102M;ENSP00000380264:T102M;ENSP00000440508:T102M	ENSP00000311993:T84M	T	+	2	0	DHRS4	23494260	0.410000	0.25376	0.968000	0.41197	0.539000	0.34962	-0.130000	0.10498	-0.015000	0.14150	0.479000	0.44913	ACG	.	.	none		0.652	DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071857.3		Missense_Mutation
PCDHB7	56129	hgsc.bcm.edu	37	5	140554142	140554142	+	Missense_Mutation	SNP	T	T	G	rs13174866		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr5:140554142T>G	ENST00000231137.3	+	1	1900	c.1726T>G	c.(1726-1728)Ttg>Gtg	p.L576V		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	576	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.		L -> V (in dbSNP:rs13174866).		homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L576V(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACCGAGCCGTTGCCCCGGGC	0.706																																					p.L576V		Atlas-SNP	.											PCDHB7,NS,carcinoma,0,1	PCDHB7	231	1	1	Substitution - Missense(1)	prostate(1)	c.T1726G						scavenged	.						31.0	41.0	37.0					5																	140554142		2147	4229	6376	SO:0001583	missense	56129	exon1			GAGCCGTTGCCCC	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1726T>G	5.37:g.140554142T>G	ENSP00000231137:p.Leu576Val	Somatic	41	1	0.0243902		WXS	Illumina HiSeq	Phase_I	55	6	0.109091	NM_018940	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.992149	0.00439	.	.	ENSG00000113212	ENST00000231137	T	0.62498	0.02	4.3	-0.0538	0.13816	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.28632	0.0709	N	0.01789	-0.72	0.26682	N	0.971522	B	0.06786	0.001	B	0.12156	0.007	T	0.27400	-1.0075	9	0.02654	T	1	.	10.3392	0.43868	0.0:0.4572:0.3179:0.2249	rs13174866;rs17844470	576	Q9Y5E2	PCDB7_HUMAN	V	576	ENSP00000231137:L576V	ENSP00000231137:L576V	L	+	1	2	PCDHB7	140534326	0.880000	0.30214	0.995000	0.50966	0.341000	0.28922	0.694000	0.25512	-0.325000	0.08577	-1.785000	0.00643	TTG	T|1.000;|0.000	.	weak		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
HAGHL	84264	hgsc.bcm.edu	37	16	778158	778158	+	Silent	SNP	C	C	G	rs1406815	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr16:778158C>G	ENST00000341413.4	+	4	494	c.213C>G	c.(211-213)ccC>ccG	p.P71P	HAGHL_ENST00000564537.1_Silent_p.P71P|HAGHL_ENST00000389703.3_Silent_p.P71P|HAGHL_ENST00000564545.1_Missense_Mutation_p.R50G|HAGHL_ENST00000561546.1_Silent_p.P71P|CCDC78_ENST00000293889.6_5'Flank|HAGHL_ENST00000549114.1_Silent_p.P71P|NARFL_ENST00000562862.1_5'Flank			Q6PII5	HAGHL_HUMAN	hydroxyacylglutathione hydrolase-like	71							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			lung(3)	3		Hepatocellular(780;0.00335)				GGCTTCGTCCCGGGCTGGCGG	0.781													c|||	2240	0.447284	0.3434	0.4784	5008	,	,		5375	0.7579		0.2396	False		,,,				2504	0.4591				p.P71P	Pancreas(46;538 1326 12403 32360)	Atlas-SNP	.											.	HAGHL	18	.	0			c.C213G						PASS	.						1.0	1.0	1.0					16																	778158		455	1002	1457	SO:0001819	synonymous_variant	84264	exon3			TCGTCCCGGGCTG	AK054841	CCDS32354.1	16p13.3	2008-02-05	2003-11-04						14177	protein-coding gene	gene with protein product			"""hydroxyacyl glutathione hydrolase-like"""			12477932	Standard	XM_005255629		Approved	MGC2605	uc002cjo.1	Q6PII5		ENST00000341413.4:c.213C>G	16.37:g.778158C>G		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_032304	A6NCC4|D3DU64|Q59FX8|Q96BZ3|Q96NR5|Q96S11|Q9BT45	Silent	SNP	ENST00000341413.4	37																																																																																				C|0.556;G|0.444	0.444	strong		0.781	HAGHL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409607.1	NM_032304	
CUX1	1523	hgsc.bcm.edu	37	7	101892121	101892121	+	Silent	SNP	G	G	A	rs410825	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr7:101892121G>A	ENST00000292535.7	+	24	4355	c.4317G>A	c.(4315-4317)ccG>ccA	p.P1439P	CUX1_ENST00000547394.2_Intron|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Silent_p.P1281P|CUX1_ENST00000546411.2_Silent_p.P1337P|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Silent_p.P1450P|CUX1_ENST00000549414.2_Silent_p.P1417P|CUX1_ENST00000550008.2_Silent_p.P1383P	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1439					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GCTCCGCGCCGCCGCCCAGCA	0.831													G|||	2727	0.544529	0.3147	0.5	5008	,	,		1201	0.9097		0.4901	False		,,,				2504	0.5665				p.P1450P		Atlas-SNP	.											.	CUX1	253	.	0			c.G4350A						PASS	.						1.0	1.0	1.0					7																	101892121		593	1623	2216	SO:0001819	synonymous_variant	1523	exon24			CGCGCCGCCGCCC	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.4317G>A	7.37:g.101892121G>A		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	5	5	1	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	ENST00000292535.7	37	CCDS5721.1																																																																																			G|0.460;A|0.540	0.540	strong		0.831	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
GALNT11	63917	hgsc.bcm.edu	37	7	151818642	151818642	+	Silent	SNP	G	G	T	rs201978640		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr7:151818642G>T	ENST00000434507.1	+	14	2144	c.1707G>T	c.(1705-1707)cgG>cgT	p.R569R	GALNT11_ENST00000452146.2_Silent_p.R488R|GALNT11_ENST00000320311.2_Silent_p.R569R|GALNT11_ENST00000430044.2_Silent_p.R569R|RP5-981O7.2_ENST00000424630.1_RNA			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	569	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		AAAACAATCGGCTATACCAGG	0.483																																					p.R569R		Atlas-SNP	.											GALNT11,colon,carcinoma,+1,1	GALNT11	59	1	0			c.G1707T						scavenged	.						89.0	82.0	84.0					7																	151818642		2203	4300	6503	SO:0001819	synonymous_variant	63917	exon12			CAATCGGCTATAC	AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.1707G>T	7.37:g.151818642G>T		Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	189	3	0.015873	NM_022087	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Silent	SNP	ENST00000434507.1	37	CCDS5930.1																																																																																			G|0.999;A|0.001	.	alt		0.483	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348184.1	NM_022087	
HSD17B7	51478	hgsc.bcm.edu	37	1	162769603	162769603	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:162769603G>A	ENST00000254521.3	+	5	573	c.518G>A	c.(517-519)aGt>aAt	p.S173N	HSD17B7_ENST00000485405.1_3'UTR|HSD17B7_ENST00000367917.3_Missense_Mutation_p.S173N	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	173					cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)	p.S173N(4)		endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					TCATCTCGCAGTGCAAGGAAA	0.458																																					p.S173N		Atlas-SNP	.											HSD17B7,NS,carcinoma,0,5	HSD17B7	25	5	4	Substitution - Missense(4)	kidney(2)|endometrium(2)	c.G518A						scavenged	.						76.0	70.0	72.0					1																	162769603		2203	4300	6503	SO:0001583	missense	51478	exon5			CTCGCAGTGCAAG	AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.518G>A	1.37:g.162769603G>A	ENSP00000254521:p.Ser173Asn	Somatic	444	3	0.00675676		WXS	Illumina HiSeq	Phase_I	371	6	0.0161725	NM_016371	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	Missense_Mutation	SNP	ENST00000254521.3	37	CCDS1242.1	.	.	.	.	.	.	.	.	.	.	A	0.896	-0.723912	0.03158	.	.	ENSG00000132196	ENST00000367917;ENST00000254521;ENST00000413934	T;T;T	0.76578	2.88;-1.03;2.88	4.44	3.31	0.37934	NAD(P)-binding domain (1);	0.000000	0.85682	N	0.000000	T	0.27205	0.0667	N	0.04705	-0.18	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.06917	-1.0800	9	0.05833	T	0.94	-30.7352	7.9369	0.29935	0.8252:0.0:0.1748:0.0	.	173	P56937	DHB7_HUMAN	N	173;173;26	ENSP00000356894:S173N;ENSP00000254521:S173N;ENSP00000412146:S26N	ENSP00000254521:S173N	S	+	2	0	HSD17B7	161036227	1.000000	0.71417	0.991000	0.47740	0.478000	0.33099	4.183000	0.58317	0.241000	0.21283	-1.007000	0.02485	AGT	.	.	none		0.458	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083207.1	NM_016371	
TPPP	11076	hgsc.bcm.edu	37	5	678087	678087	+	Missense_Mutation	SNP	C	C	T	rs570878136	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr5:678087C>T	ENST00000360578.5	-	2	210	c.89G>A	c.(88-90)aGg>aAg	p.R30K	CTD-2589H19.6_ENST00000607068.1_RNA	NM_007030.2	NP_008961.1	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	30	Mediates interaction with LIMK1.				microtubule bundle formation (GO:0001578)|microtubule polymerization (GO:0046785)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein polymerization (GO:0032273)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.R30K(1)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		CAGCGACAGCCTCTTGGCTGC	0.677													C|||	15	0.00299521	0.0061	0.0	5008	,	,		16462	0.0069		0.0	False		,,,				2504	0.0				p.R30K		Atlas-SNP	.											TPPP,NS,carcinoma,0,1	TPPP	24	1	1	Substitution - Missense(1)	prostate(1)	c.G89A						scavenged	.						14.0	17.0	16.0					5																	678087		2199	4295	6494	SO:0001583	missense	11076	exon2			GACAGCCTCTTGG	AB017016	CCDS3856.1	5p15.33	2008-02-05			ENSG00000171368	ENSG00000171368			24164	protein-coding gene	gene with protein product	"""brain specific protein p25 alpha"""	608773				10083737, 12093283, 15590652, 17105200	Standard	NM_007030		Approved	p25alpha, TPPP1, p25, TPPP/p25	uc003jbh.4	O94811	OTTHUMG00000131011	ENST00000360578.5:c.89G>A	5.37:g.678087C>T	ENSP00000353785:p.Arg30Lys	Somatic	281	7	0.024911		WXS	Illumina HiSeq	Phase_I	186	5	0.0268817	NM_007030		Missense_Mutation	SNP	ENST00000360578.5	37	CCDS3856.1	.	.	.	.	.	.	.	.	.	.	c	14.67	2.605282	0.46423	.	.	ENSG00000171368	ENST00000360578	T	0.45276	0.9	5.23	5.23	0.72850	.	0.149935	0.44902	D	0.000407	T	0.29588	0.0738	L	0.29908	0.895	0.44635	D	0.997618	B	0.15141	0.012	B	0.13407	0.009	T	0.11867	-1.0570	10	0.05436	T	0.98	-54.1656	16.5545	0.84482	0.0:1.0:0.0:0.0	.	30	O94811	TPPP_HUMAN	K	30	ENSP00000353785:R30K	ENSP00000353785:R30K	R	-	2	0	TPPP	731087	1.000000	0.71417	0.998000	0.56505	0.405000	0.30901	4.081000	0.57627	2.437000	0.82529	0.491000	0.48974	AGG	.	.	none		0.677	TPPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253645.3	NM_007030	
SALL1	6299	hgsc.bcm.edu	37	16	51175655	51175655	+	Missense_Mutation	SNP	C	C	T	rs113614842|rs199760974	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr16:51175655C>T	ENST00000251020.4	-	2	511	c.478G>A	c.(478-480)Ggc>Agc	p.G160S	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.G63S	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	160	Poly-Gly.				adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ccgccgccgccgctgctgctg	0.632													c|||	53	0.0105831	0.0234	0.0014	5008	,	,		12568	0.0		0.0	False		,,,				2504	0.0215				p.G160S	GBM(103;1352 1446 1855 4775 8890)	Atlas-SNP	.											.	SALL1	301	.	0			c.G478A						PASS	.						24.0	26.0	25.0					16																	51175655		2196	4299	6495	SO:0001583	missense	6299	exon2			CGCCGCCGCTGCT	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.478G>A	16.37:g.51175655C>T	ENSP00000251020:p.Gly160Ser	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	43	8	0.186047	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.627404	0.00007	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.06849	3.36;3.25	0.817	-1.63	0.08345	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.44003	-0.9356	9	0.02654	T	1	.	4.4659	0.11689	0.0:0.5444:0.0:0.4556	.	160	Q9NSC2	SALL1_HUMAN	S	160;63;124	ENSP00000251020:G160S;ENSP00000407914:G63S	ENSP00000251020:G160S	G	-	1	0	SALL1	49733156	1.000000	0.71417	0.002000	0.10522	0.010000	0.07245	1.889000	0.39718	-0.863000	0.04084	-1.054000	0.02325	GGC	.	.	weak		0.632	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
CCDC81	60494	hgsc.bcm.edu	37	11	86131001	86131001	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr11:86131001C>T	ENST00000445632.2	+	14	1995	c.1723C>T	c.(1723-1725)Cga>Tga	p.R575*	CCDC81_ENST00000278487.3_Nonsense_Mutation_p.R310*|CCDC81_ENST00000528728.1_Nonsense_Mutation_p.R310*|CCDC81_ENST00000354755.1_Nonsense_Mutation_p.R485*	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	575										kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				TGAGCTGGAGCGAGTAAATAG	0.507																																					p.R575X		Atlas-SNP	.											.	CCDC81	89	.	0			c.C1723T						PASS	.						87.0	75.0	79.0					11																	86131001		2202	4299	6501	SO:0001587	stop_gained	60494	exon14			CTGGAGCGAGTAA	AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.1723C>T	11.37:g.86131001C>T	ENSP00000415528:p.Arg575*	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	74	16	0.216216	NM_001156474	A0AVL7|Q53FW3|Q9H5E5	Nonsense_Mutation	SNP	ENST00000445632.2	37	CCDS53691.1	.	.	.	.	.	.	.	.	.	.	C	44	10.710250	0.99454	.	.	ENSG00000149201	ENST00000354755;ENST00000278487;ENST00000445632;ENST00000528728	.	.	.	5.16	1.89	0.25635	.	0.306262	0.25236	N	0.032136	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.9965	10.4293	0.44398	0.5496:0.4504:0.0:0.0	.	.	.	.	X	485;310;575;310	.	.	R	+	1	2	CCDC81	85808649	0.100000	0.21855	0.007000	0.13788	0.208000	0.24298	0.133000	0.15912	0.683000	0.31428	0.555000	0.69702	CGA	.	.	none		0.507	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393756.1	NM_021827	
NBPF14	25832	hgsc.bcm.edu	37	1	148004784	148004784	+	Missense_Mutation	SNP	T	T	C	rs144889269	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:148004784T>C	ENST00000369219.1	-	22	2546	c.2530A>G	c.(2530-2532)Agc>Ggc	p.S844G				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	844	NBPF 10. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					ATCAGCATGCTGTTGAGCCTG	0.448													-|||	904	0.180511	0.4304	0.1398	5008	,	,		14996	0.1002		0.0527	False		,,,				2504	0.0859				p.S844G		Atlas-SNP	.											NBPF14,NS,adenoma,+1,2	NBPF14	107	2	0			c.A2530G						scavenged	.						73.0	122.0	108.0					1																	148004784		1676	4096	5772	SO:0001583	missense	25832	exon22			GCATGCTGTTGAG	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.2530A>G	1.37:g.148004784T>C	ENSP00000358221:p.Ser844Gly	Somatic	363	10	0.0275482		WXS	Illumina HiSeq	Phase_I	270	17	0.062963	NM_015383	Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	ENST00000369219.1	37		172	0.07875457875457875	90	0.18292682926829268	21	0.058011049723756904	39	0.06818181818181818	22	0.029023746701846966	N	0.149	-1.093496	0.01858	.	.	ENSG00000122497	ENST00000369219;ENST00000369368	T	0.06294	3.32	0.445	-0.891	0.10573	DUF1220 (2);	.	.	.	.	T	0.00468	0.0015	N	0.01352	-0.895	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.11329	0.0;0.006;0.006	T	0.42464	-0.9450	8	0.21014	T	0.42	.	.	.	.	.	192;825;844	F8WEX8;B4DH59;Q5TI25	.;.;NBPFE_HUMAN	G	844;192	ENSP00000358221:S844G	ENSP00000358221:S844G	S	-	1	0	NBPF14	146471408	0.011000	0.17503	0.001000	0.08648	0.006000	0.05464	-2.754000	0.00790	-1.348000	0.02205	-1.814000	0.00607	AGC	T|0.944;C|0.056	0.056	strong		0.448	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
SLC16A1	6566	hgsc.bcm.edu	37	1	113460019	113460019	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:113460019C>T	ENST00000538576.1	-	4	1840	c.1009G>A	c.(1009-1011)Gtt>Att	p.V337I	SLC16A1_ENST00000369626.3_Missense_Mutation_p.V337I|SLC16A1_ENST00000433570.4_Missense_Mutation_p.V337I	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	337					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	TTTGCAACAACGGAAGCCGCA	0.458																																					p.V337I		Atlas-SNP	.											.	SLC16A1	61	.	0			c.G1009A						PASS	.						64.0	52.0	56.0					1																	113460019		2203	4300	6503	SO:0001583	missense	6566	exon4			CAACAACGGAAGC	BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.1009G>A	1.37:g.113460019C>T	ENSP00000441065:p.Val337Ile	Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	113	30	0.265487	NM_001166496	Q49A45|Q5T8R6|Q9NSJ9	Missense_Mutation	SNP	ENST00000538576.1	37	CCDS858.1	.	.	.	.	.	.	.	.	.	.	C	0.510	-0.867034	0.02590	.	.	ENSG00000155380	ENST00000369626;ENST00000538576;ENST00000458229;ENST00000433570	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.56	-8.41	0.00961	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.434923	0.25001	N	0.033909	T	0.10380	0.0254	N	0.05199	-0.095	0.09310	N	1	B;B	0.21147	0.052;0.006	B;B	0.24006	0.05;0.03	T	0.15925	-1.0420	10	0.10902	T	0.67	.	20.5631	0.99335	0.0:0.7483:0.0:0.2517	.	337;337	Q49A45;P53985	.;MOT1_HUMAN	I	337	ENSP00000358640:V337I;ENSP00000441065:V337I;ENSP00000416167:V337I;ENSP00000445061:V337I	ENSP00000358640:V337I	V	-	1	0	SLC16A1	113261542	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-0.393000	0.07305	-1.666000	0.01475	-1.166000	0.01754	GTT	.	.	none		0.458	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033539.1	NM_003051	
FMN2	56776	hgsc.bcm.edu	37	1	240371097	240371097	+	Silent	SNP	G	G	A	rs71646827	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:240371097G>A	ENST00000319653.9	+	5	3215	c.2985G>A	c.(2983-2985)gcG>gcA	p.A995A		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	995	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTCCCGGAGCGGGCATACCCC	0.706																																					p.A995A		Atlas-SNP	.											FMN2,NS,carcinoma,0,1	FMN2	451	1	0			c.G2985A						scavenged	.						6.0	9.0	8.0					1																	240371097		2109	4153	6262	SO:0001819	synonymous_variant	56776	exon5			CGGAGCGGGCATA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2985G>A	1.37:g.240371097G>A		Somatic	95	4	0.0421053		WXS	Illumina HiSeq	Phase_I	66	9	0.136364	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			G|0.939;A|0.061	0.061	strong		0.706	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
NR0B1	190	hgsc.bcm.edu	37	X	30327153	30327153	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chrX:30327153C>T	ENST00000378970.4	-	1	562	c.328G>A	c.(328-330)Ggc>Agc	p.G110S	NR0B1_ENST00000453287.1_Missense_Mutation_p.G110S|NR0B1_ENST00000378963.1_5'Flank	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	110	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	GGATCAGAGCCGCACGAACAG	0.692											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G110S		Atlas-SNP	.											.	NR0B1	61	.	0			c.G328A						PASS	.						22.0	25.0	24.0					X																	30327153		2197	4287	6484	SO:0001583	missense	190	exon1			CAGAGCCGCACGA	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.328G>A	X.37:g.30327153C>T	ENSP00000368253:p.Gly110Ser	Somatic	134	0	0	816	WXS	Illumina HiSeq	Phase_I	141	10	0.070922	NM_000475	Q96F69	Missense_Mutation	SNP	ENST00000378970.4	37	CCDS14223.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612239	0.28712	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.97404	-3.49;-4.37	4.42	3.54	0.40534	.	0.173259	0.28109	N	0.016578	D	0.94660	0.8278	L	0.55743	1.74	0.31729	N	0.637317	P	0.46621	0.881	B	0.41860	0.368	D	0.93333	0.6703	10	0.46703	T	0.11	-9.6228	9.3873	0.38352	0.0:0.8933:0.0:0.1067	.	110	P51843	NR0B1_HUMAN	S	110	ENSP00000368253:G110S;ENSP00000396403:G110S	ENSP00000368253:G110S	G	-	1	0	NR0B1	30237074	0.999000	0.42202	0.832000	0.32986	0.238000	0.25445	1.241000	0.32743	0.957000	0.37930	0.513000	0.50165	GGC	.	.	none		0.692	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	NM_000475	
HTT	3064	hgsc.bcm.edu	37	4	3184180	3184180	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr4:3184180A>G	ENST00000355072.5	+	37	4994	c.4849A>G	c.(4849-4851)Atg>Gtg	p.M1617V		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1617					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CATCCTCCCAATGTTAGCCAA	0.502																																					p.M1617V		Atlas-SNP	.											.	HTT	221	.	0			c.A4849G						PASS	.						135.0	137.0	137.0					4																	3184180		2052	4201	6253	SO:0001583	missense	3064	exon37			CTCCCAATGTTAG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.4849A>G	4.37:g.3184180A>G	ENSP00000347184:p.Met1617Val	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	51	16	0.313726	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	A	13.10	2.136143	0.37728	.	.	ENSG00000197386	ENST00000355072	T	0.05139	3.49	4.98	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.06554	0.0168	L	0.60455	1.87	0.48185	D	0.9996	P	0.35328	0.495	B	0.23852	0.049	T	0.27773	-1.0064	10	0.42905	T	0.14	.	9.3075	0.37885	0.9186:0.0:0.0814:0.0	.	1617	P42858	HD_HUMAN	V	1617	ENSP00000347184:M1617V	ENSP00000347184:M1617V	M	+	1	0	HTT	3153978	1.000000	0.71417	0.796000	0.32109	0.774000	0.43823	6.119000	0.71590	0.931000	0.37242	-0.379000	0.06801	ATG	.	.	none		0.502	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
PLXNB3	5365	hgsc.bcm.edu	37	X	153039489	153039489	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chrX:153039489C>T	ENST00000361971.5	+	20	3569	c.3455C>T	c.(3454-3456)cCc>cTc	p.P1152L	PLXNB3_ENST00000538282.1_Missense_Mutation_p.P762L|PLXNB3_ENST00000538776.1_Missense_Mutation_p.P805L|PLXNB3_ENST00000538966.1_Missense_Mutation_p.P1175L|SRPK3_ENST00000489426.1_5'Flank	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1152					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CGCCTGGCACCCCTCAGCCGC	0.692																																					p.P1175L		Atlas-SNP	.											.	PLXNB3	208	.	0			c.C3524T						PASS	.						16.0	17.0	17.0					X																	153039489		2174	4240	6414	SO:0001583	missense	5365	exon21			TGGCACCCCTCAG	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.3455C>T	X.37:g.153039489C>T	ENSP00000355378:p.Pro1152Leu	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	50	10	0.2	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539525	0.45176	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.69435	5.19;5.16;4.57;-0.4	5.14	5.14	0.70334	.	0.117279	0.56097	D	0.000021	T	0.67581	0.2908	M	0.71036	2.16	0.36580	D	0.873501	B;P;P	0.45768	0.409;0.866;0.668	B;P;B	0.44811	0.168;0.461;0.318	T	0.75755	-0.3206	10	0.46703	T	0.11	.	10.9628	0.47395	0.0:0.8153:0.1847:0.0	.	805;1175;1152	B7Z3H9;F5H773;Q9ULL4	.;.;PLXB3_HUMAN	L	1175;1152;805;762	ENSP00000442736:P1175L;ENSP00000355378:P1152L;ENSP00000445569:P805L;ENSP00000441919:P762L	ENSP00000355378:P1152L	P	+	2	0	PLXNB3	152692683	0.722000	0.28017	0.054000	0.19295	0.555000	0.35460	1.617000	0.36943	2.125000	0.65367	0.529000	0.55759	CCC	.	.	none		0.692	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
NOTUM	147111	hgsc.bcm.edu	37	17	79912130	79912130	+	Splice_Site	SNP	A	A	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr17:79912130A>G	ENST00000409678.3	-	10	1568		c.e10+1			NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)							extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			AGGGACACTGACCTCCGGATG	0.607																																					.		Atlas-SNP	.											.	NOTUM	50	.	0			c.1184+2T>C						PASS	.						80.0	70.0	73.0					17																	79912130		2203	4300	6503	SO:0001630	splice_region_variant	147111	exon11			ACACTGACCTCCG	BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269			27106	protein-coding gene	gene with protein product		609847					Standard	NM_178493		Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.1184+1T>C	17.37:g.79912130A>G		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	84	5	0.0595238	NM_178493	Q8N410|Q8NI82	Splice_Site	SNP	ENST00000409678.3	37	CCDS32771.2	.	.	.	.	.	.	.	.	.	.	A	22.5	4.302227	0.81136	.	.	ENSG00000185269	ENST00000409678	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3587	0.66754	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTUM	77505420	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.222000	0.89777	1.985000	0.57927	0.533000	0.62120	.	.	.	none		0.607	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335123.2	NM_178493	Intron
FAM153B	202134	hgsc.bcm.edu	37	5	175528584	175528584	+	Splice_Site	SNP	C	C	T	rs200684937		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr5:175528584C>T	ENST00000253490.4	+	12	721	c.664C>T	c.(664-666)Ctt>Ttt	p.L222F	FAM153B_ENST00000510151.1_Splice_Site_p.L145F|FAM153B_ENST00000512862.1_Intron|FAM153B_ENST00000515817.1_Splice_Site_p.L145F			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	222								p.L222F(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		ACTGGCCGAACGTACGTATTC	0.463																																					p.L145F		Atlas-SNP	.											FAM153B,NS,carcinoma,0,1	FAM153B	28	1	1	Substitution - Missense(1)	prostate(1)	c.C433T						scavenged	.																																			SO:0001630	splice_region_variant	202134	exon11			GCCGAACGTACGT	AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.664+1C>T	5.37:g.175528584C>T		Somatic	552	8	0.0144928		WXS	Illumina HiSeq	Phase_I	453	18	0.0397351	NM_001265615	A8MTI1	Missense_Mutation	SNP	ENST00000253490.4	37		.	.	.	.	.	.	.	.	.	.	C	6.188	0.402789	0.11696	.	.	ENSG00000182230	ENST00000515817;ENST00000253490	.	.	.	0.752	-0.292	0.12839	.	.	.	.	.	T	0.10423	0.0255	N	0.08118	0	0.09310	N	1	D	0.60575	0.988	B	0.40982	0.345	T	0.17410	-1.0370	8	0.38643	T	0.18	.	4.5589	0.12151	0.0:0.421:0.579:0.0	.	222	P0C7A2	F153B_HUMAN	F	145;222	.	ENSP00000253490:L222F	L	+	1	0	FAM153B	175461190	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	-4.439000	0.00234	-0.089000	0.12484	-1.402000	0.01139	CTT	C|0.500;T|0.500	0.500	strong		0.463	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001079529	Missense_Mutation
MUC6	4588	hgsc.bcm.edu	37	11	1016693	1016693	+	Silent	SNP	G	G	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr11:1016693G>C	ENST00000421673.2	-	31	6158	c.6108C>G	c.(6106-6108)gcC>gcG	p.A2036A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2036	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGTGGATGGAGGCAGAAGTGG	0.567																																					p.A2036A		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,-1,2	MUC6	408	2	0			c.C6108G						scavenged	.						543.0	499.0	514.0					11																	1016693		2202	4293	6495	SO:0001819	synonymous_variant	4588	exon31			GATGGAGGCAGAA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6108C>G	11.37:g.1016693G>C		Somatic	461	4	0.00867679		WXS	Illumina HiSeq	Phase_I	337	11	0.0326409	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			.	.	none		0.567	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
ISCU	23479	hgsc.bcm.edu	37	12	108956417	108956417	+	Missense_Mutation	SNP	T	T	G	rs67681514|rs10778647	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:108956417T>G	ENST00000311893.9	+	1	41	c.19T>G	c.(19-21)Ttc>Gtc	p.F7V	ISCU_ENST00000392807.4_5'UTR|SART3_ENST00000431469.2_5'Flank|SART3_ENST00000228284.3_5'Flank|SART3_ENST00000552221.1_5'Flank|ISCU_ENST00000535729.1_Missense_Mutation_p.F7V|ISCU_ENST00000547005.1_Missense_Mutation_p.F7V|SART3_ENST00000546611.1_5'Flank|ISCU_ENST00000539593.1_Missense_Mutation_p.F7V|ISCU_ENST00000431221.2_Missense_Mutation_p.F7V|ISCU_ENST00000338291.4_5'UTR	NM_213595.2	NP_998760.1	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme	7				F -> G (in Ref. 1; AAG37428 and 3; AAH11906). {ECO:0000305}.	iron-sulfur cluster assembly (GO:0016226)|nitrogen fixation (GO:0009399)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|iron-sulfur cluster binding (GO:0051536)|protein complex scaffold (GO:0032947)			kidney(2)|large_intestine(2)|lung(4)|prostate(2)|urinary_tract(1)	11						GGCTGGGGCTTTCCGTCTGAG	0.746													G|||	4477	0.89397	0.8396	0.8775	5008	,	,		9082	0.9544		0.8678	False		,,,				2504	0.9438				p.F7V		Atlas-SNP	.											.	ISCU	19	.	0			c.T19G						PASS	.						2.0	3.0	3.0					12																	108956417		1074	2745	3819	SO:0001583	missense	23479	exon1			GGGGCTTTCCGTC	U47101	CCDS9118.1, CCDS44966.1, CCDS73518.1	12q24.1	2013-08-05	2013-08-05	2006-10-24	ENSG00000136003	ENSG00000136003			29882	protein-coding gene	gene with protein product		611911	"""NifU-like N-terminal domain containing"", ""IscU iron-sulfur cluster scaffold homolog (E. coli)"", ""iron-sulfur cluster scaffold homolog (E. coli)"""	NIFUN		8875867, 11060020	Standard	XM_005268760		Approved	ISU2, hnifU, IscU	uc010sxc.2	Q9H1K1	OTTHUMG00000168420	ENST00000311893.9:c.19T>G	12.37:g.108956417T>G	ENSP00000310623:p.Phe7Val	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_213595	Q6P713|Q99617|Q9H1K2	Missense_Mutation	SNP	ENST00000311893.9	37	CCDS44966.1	1931	0.8841575091575091	428	0.8699186991869918	313	0.8646408839779005	539	0.9423076923076923	651	0.8588390501319261	G	10.60	1.395545	0.25205	.	.	ENSG00000136003	ENST00000535729;ENST00000431221;ENST00000547005;ENST00000311893;ENST00000539593	T;T;T;T;T	0.62364	0.03;0.05;0.03;0.07;0.06	4.95	4.95	0.65309	.	0.282027	0.39341	N	0.001397	T	0.00012	0.0000	N	0.08118	0	0.09310	P	0.9999999999944561	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.33240	-0.9876	9	0.17369	T	0.5	.	11.0295	0.47763	0.0:0.0:0.8142:0.1858	rs10778647;rs59554812	7;7;7;7	B3KQ30;Q9H1K1;B4DNC9;F5H5N2	.;ISCU_HUMAN;.;.	V	7	ENSP00000445598:F7V;ENSP00000411108:F7V;ENSP00000446606:F7V;ENSP00000310623:F7V;ENSP00000443272:F7V	ENSP00000310623:F7V	F	+	1	0	ISCU	107480547	0.093000	0.21703	0.631000	0.29282	0.038000	0.13279	2.348000	0.44045	1.467000	0.48044	-0.121000	0.15023	TTC	GG|0.500;TT|0.500	.	alt		0.746	ISCU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399693.1	NM_014301	
USP4	7375	hgsc.bcm.edu	37	3	49362425	49362425	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:49362425G>C	ENST00000265560.4	-	5	581	c.535C>G	c.(535-537)Cgt>Ggt	p.R179G	USP4_ENST00000351842.4_Missense_Mutation_p.R179G|USP4_ENST00000416417.1_Missense_Mutation_p.R179G|USP4_ENST00000415188.1_Missense_Mutation_p.R179G	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	179	Necessary for interaction with SART3. {ECO:0000269|PubMed:20595234}.|Ubiquitin-like 1.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		CGTGTTTCACGCTCCGCAGGG	0.502																																					p.R179G		Atlas-SNP	.											USP4,mouth,carcinoma,+1,1	USP4	72	1	0			c.C535G						PASS	.						182.0	180.0	181.0					3																	49362425		2203	4300	6503	SO:0001583	missense	7375	exon5			TTTCACGCTCCGC	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.535C>G	3.37:g.49362425G>C	ENSP00000265560:p.Arg179Gly	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	102	10	0.0980392	NM_199443	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	ENST00000265560.4	37	CCDS2793.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997823	0.54147	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.32023	1.98;2.1;1.47	5.51	2.33	0.28932	.	0.100082	0.64402	N	0.000006	T	0.26268	0.0641	L	0.41824	1.3	0.32078	N	0.593569	P;B	0.39624	0.681;0.372	B;B	0.38755	0.281;0.095	T	0.38457	-0.9660	10	0.72032	D	0.01	-9.6545	12.7177	0.57123	0.0:0.0:0.3137:0.6863	.	179;179	Q13107-2;Q13107	.;UBP4_HUMAN	G	179	ENSP00000341028:R179G;ENSP00000265560:R179G;ENSP00000400623:R179G	ENSP00000265560:R179G	R	-	1	0	USP4	49337429	1.000000	0.71417	0.005000	0.12908	0.963000	0.63663	4.711000	0.61881	0.644000	0.30656	0.491000	0.48974	CGT	.	.	none		0.502	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443	
RETSAT	54884	hgsc.bcm.edu	37	2	85571180	85571180	+	Missense_Mutation	SNP	G	G	A	rs149307146		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr2:85571180G>A	ENST00000295802.4	-	9	1587	c.1475C>T	c.(1474-1476)tCc>tTc	p.S492F	RETSAT_ENST00000457495.2_Missense_Mutation_p.S431F|RETSAT_ENST00000475624.2_Intron|RETSAT_ENST00000263854.6_Intron	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	492					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)	p.S492F(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	TTCCACAAAGGAGTTTTTGAA	0.537																																					p.S492F		Atlas-SNP	.											RETSAT,NS,carcinoma,0,1	RETSAT	56	1	1	Substitution - Missense(1)	endometrium(1)	c.C1475T						scavenged	.	G	PHE/SER	0,4406		0,0,2203	98.0	106.0	104.0		1475	5.1	0.4	2	dbSNP_134	104	4,8596	3.0+/-9.4	0,4,4296	yes	missense	RETSAT	NM_017750.3	155	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	492/611	85571180	4,13002	2203	4300	6503	SO:0001583	missense	54884	exon9			ACAAAGGAGTTTT	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1475C>T	2.37:g.85571180G>A	ENSP00000295802:p.Ser492Phe	Somatic	131	2	0.0152672		WXS	Illumina HiSeq	Phase_I	82	4	0.0487805	NM_017750	A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	37	CCDS1972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.76|15.76	2.928287|2.928287	0.52759|0.52759	0.0|0.0	4.65E-4|4.65E-4	ENSG00000042445|ENSG00000042445	ENST00000449375|ENST00000295802;ENST00000457495	.|T;T	.|0.23552	.|1.9;1.9	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.852245	.|0.10867	.|N	.|0.625371	T|T	0.36303|0.36303	0.0962|0.0962	M|M	0.65975|0.65975	2.015|2.015	0.35609|0.35609	D|D	0.808519|0.808519	.|P;P;P	.|0.48089	.|0.905;0.905;0.748	.|P;P;B	.|0.46585	.|0.521;0.521;0.243	T|T	0.45760|0.45760	-0.9239|-0.9239	5|10	.|0.56958	.|D	.|0.05	-8.7214|-8.7214	12.225|12.225	0.54455|0.54455	0.0:0.1718:0.8282:0.0|0.0:0.1718:0.8282:0.0	.|.	.|431;431;492	.|G5E9N3;B4DKE1;Q6NUM9	.|.;.;RETST_HUMAN	S|F	281|492;431	.|ENSP00000295802:S492F;ENSP00000405040:S431F	.|ENSP00000295802:S492F	P|S	-|-	1|2	0|0	RETSAT|RETSAT	85424691|85424691	0.967000|0.967000	0.33354|0.33354	0.392000|0.392000	0.26245|0.26245	0.722000|0.722000	0.41435|0.41435	3.004000|3.004000	0.49513|0.49513	2.561000|2.561000	0.86390|0.86390	0.561000|0.561000	0.74099|0.74099	CCT|TCC	G|1.000;A|0.000	0.000	weak		0.537	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750	
AIM1L	55057	hgsc.bcm.edu	37	1	26655287	26655287	+	Silent	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:26655287C>T	ENST00000308182.5	-	15	1686	c.1257G>A	c.(1255-1257)gtG>gtA	p.V419V	AIM1L_ENST00000527815.1_Silent_p.V590V			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	419	Beta/gamma crystallin 'Greek key' 9. {ECO:0000255|PROSITE-ProRule:PRU00028}.						carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		GCAGGCTCCGCACCTCCCTGC	0.602																																					p.V1464V		Atlas-SNP	.											.	AIM1L	98	.	0			c.G4392A						PASS	.						144.0	122.0	129.0					1																	26655287		2203	4300	6503	SO:0001819	synonymous_variant	55057	exon16			GCTCCGCACCTCC			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.1257G>A	1.37:g.26655287C>T		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	47	12	0.255319	NM_001039775	B2RNG3|Q5T137|Q5T150	Silent	SNP	ENST00000308182.5	37																																																																																				.	.	none		0.602	AIM1L-201	KNOWN	basic	protein_coding	protein_coding		NM_001039775.2	
RNF10	9921	hgsc.bcm.edu	37	12	121014414	121014414	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:121014414G>C	ENST00000325954.4	+	17	2842	c.2381G>C	c.(2380-2382)aGa>aCa	p.R794T	RNF10_ENST00000413266.2_Missense_Mutation_p.R799T|RNF10_ENST00000542701.1_3'UTR|POP5_ENST00000542776.1_5'Flank	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	794					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ggaaagaaaagaaaaaaacag	0.443																																					p.R794T		Atlas-SNP	.											.	RNF10	75	.	0			c.G2381C						PASS	.						84.0	80.0	81.0					12																	121014414		2203	4300	6503	SO:0001583	missense	9921	exon17			AGAAAAGAAAAAA	AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.2381G>C	12.37:g.121014414G>C	ENSP00000322242:p.Arg794Thr	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	77	14	0.181818	NM_014868	Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	37	CCDS9201.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.368859	0.61624	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266;ENST00000538254	D;D	0.89415	-2.51;-2.51	6.09	6.09	0.99107	.	0.204155	0.51477	D	0.000100	D	0.82554	0.5062	L	0.36672	1.1	0.50813	D	0.999892	B;P	0.48764	0.277;0.915	B;B	0.36922	0.068;0.236	D	0.84750	0.0756	10	0.72032	D	0.01	.	12.9234	0.58245	0.0733:0.0:0.9267:0.0	.	799;794	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	T	794;794;799;129	ENSP00000322242:R794T;ENSP00000415682:R799T	ENSP00000322242:R794T	R	+	2	0	RNF10	119498797	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.030000	0.64128	2.899000	0.99337	0.655000	0.94253	AGA	.	.	none		0.443	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4		
FBP2	8789	hgsc.bcm.edu	37	9	97321395	97321395	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr9:97321395C>T	ENST00000375337.3	-	7	911	c.845G>A	c.(844-846)tGc>tAc	p.C282Y	PCAT7_ENST00000452148.2_RNA	NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	282					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				CACGGGATTGCATTCATACAG	0.597																																					p.C282Y		Atlas-SNP	.											.	FBP2	26	.	0			c.G845A						PASS	.						56.0	53.0	54.0					9																	97321395		2203	4300	6503	SO:0001583	missense	8789	exon7			GGATTGCATTCAT	Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.845G>A	9.37:g.97321395C>T	ENSP00000364486:p.Cys282Tyr	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	62	6	0.0967742	NM_003837	Q17R39|Q6FI53	Missense_Mutation	SNP	ENST00000375337.3	37	CCDS6711.1	.	.	.	.	.	.	.	.	.	.	.	25.5	4.645909	0.87958	.	.	ENSG00000130957	ENST00000375337	T	0.73152	-0.72	5.43	5.43	0.79202	.	0.045824	0.85682	D	0.000000	D	0.88786	0.6531	H	0.94734	3.575	0.80722	D	1	D	0.64830	0.994	D	0.69479	0.964	D	0.91262	0.5037	10	0.87932	D	0	0.263	19.4276	0.94749	0.0:1.0:0.0:0.0	.	282	O00757	F16P2_HUMAN	Y	282	ENSP00000364486:C282Y	ENSP00000364486:C282Y	C	-	2	0	FBP2	96361216	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.327000	0.79147	2.813000	0.96785	0.655000	0.94253	TGC	.	.	none		0.597	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053189.1	NM_003837	
MUC4	4585	hgsc.bcm.edu	37	3	195510341	195510341	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:195510341A>G	ENST00000463781.3	-	2	8569	c.8110T>C	c.(8110-8112)Tct>Cct	p.S2704P	MUC4_ENST00000475231.1_Missense_Mutation_p.S2704P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGAGGTGGTGTCA	0.567																																					p.S2704P		Atlas-SNP	.											MUC4_ENST00000463781,NS,lymphoid_neoplasm,0,1	MUC4	1505	1	0			c.T8110C						scavenged	.						2.0	2.0	2.0					3																	195510341		468	1070	1538	SO:0001583	missense	4585	exon2			GAAGAGAGGTGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8110T>C	3.37:g.195510341A>G	ENSP00000417498:p.Ser2704Pro	Somatic	63	13	0.206349		WXS	Illumina HiSeq	Phase_I	71	22	0.309859	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	0.679	-0.798856	0.02841	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.45276	0.9;1.13	1.02	-2.03	0.07365	.	.	.	.	.	T	0.16385	0.0394	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.17837	-1.0356	5	.	.	.	.	3.2634	0.06856	0.5581:0.2306:0.2113:0.0	.	.	.	.	P	2704	ENSP00000417498:S2704P;ENSP00000420243:S2704P	.	S	-	1	0	MUC4	196993440	0.003000	0.15002	0.003000	0.11579	0.038000	0.13279	-4.738000	0.00192	-1.773000	0.01290	-1.973000	0.00462	TCT	.	.	none		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DCT	1638	hgsc.bcm.edu	37	13	95092324	95092324	+	Missense_Mutation	SNP	A	A	G	rs138244474		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:95092324A>G	ENST00000377028.5	-	8	1801	c.1388T>C	c.(1387-1389)gTt>gCt	p.V463A	DCT_ENST00000446125.1_Missense_Mutation_p.V496A	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	463					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		AGTTTCTTCAACTGAAACTAA	0.428																																					p.V496A		Atlas-SNP	.											DCT_ENST00000446125,colon,carcinoma,0,2	DCT	186	2	0			c.T1487C						scavenged	.	A	ALA/VAL,ALA/VAL	0,4406		0,0,2203	56.0	56.0	56.0		1487,1388	-0.7	0.8	13	dbSNP_134	56	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DCT	NM_001129889.1,NM_001922.3	64,64	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign,benign	496/553,463/520	95092324	1,13005	2203	4300	6503	SO:0001583	missense	1638	exon10			TCTTCAACTGAAA	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.1388T>C	13.37:g.95092324A>G	ENSP00000366227:p.Val463Ala	Somatic	121	1	0.00826446		WXS	Illumina HiSeq	Phase_I	92	12	0.130435	NM_001129889	Q09GT4	Missense_Mutation	SNP	ENST00000377028.5	37	CCDS9470.1	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.082364	0.00371	0.0	1.16E-4	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.99023	-5.32;-5.34	4.7	-0.737	0.11129	.	0.914482	0.09445	N	0.801161	D	0.95262	0.8463	L	0.29908	0.895	0.19300	N	0.999973	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	D	0.89694	0.3900	10	0.09590	T	0.72	-2.0498	4.6745	0.12705	0.6146:0.0:0.2503:0.1351	.	496;463	Q09GT4;P40126	.;TYRP2_HUMAN	A	463;496	ENSP00000366227:V463A;ENSP00000392762:V496A	ENSP00000366227:V463A	V	-	2	0	DCT	93890325	0.000000	0.05858	0.758000	0.31321	0.085000	0.17905	-0.583000	0.05807	-0.035000	0.13691	0.460000	0.39030	GTT	A|1.000;G|0.000	0.000	weak		0.428	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3		
ZNF503	84858	hgsc.bcm.edu	37	10	77158962	77158962	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr10:77158962C>T	ENST00000372524.4	-	2	1972	c.1486G>A	c.(1486-1488)Gcc>Acc	p.A496T	RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503_ENST00000535216.1_Missense_Mutation_p.A496T|ZNF503-AS2_ENST00000466942.2_RNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	496					G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					GGGTGGCCGGCCAGGGAGGGC	0.687																																					p.A496T		Atlas-SNP	.											.	ZNF503	25	.	0			c.G1486A						PASS	.						14.0	16.0	15.0					10																	77158962		2197	4291	6488	SO:0001583	missense	84858	exon2			GGCCGGCCAGGGA	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.1486G>A	10.37:g.77158962C>T	ENSP00000361602:p.Ala496Thr	Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	21	10	0.47619	NM_032772	Q8NAC5|Q96E25|Q96IJ0	Missense_Mutation	SNP	ENST00000372524.4	37	CCDS7350.1	.	.	.	.	.	.	.	.	.	.	C	9.686	1.150705	0.21371	.	.	ENSG00000165655	ENST00000372524;ENST00000535216;ENST00000372516	T;T	0.49720	0.77;0.77	4.04	4.04	0.47022	.	0.331694	0.32918	N	0.005493	T	0.31263	0.0791	N	0.24115	0.695	0.35873	D	0.828373	B	0.18863	0.031	B	0.13407	0.009	T	0.29822	-0.9999	10	0.19590	T	0.45	-16.1824	11.987	0.53153	0.0:0.8248:0.1752:0.0	.	496	Q96F45	ZN503_HUMAN	T	496;496;459	ENSP00000361602:A496T;ENSP00000438988:A496T	ENSP00000361594:A459T	A	-	1	0	ZNF503	76828968	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	0.688000	0.25422	2.084000	0.62774	0.551000	0.68910	GCC	.	.	none		0.687	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
DAZAP1	26528	hgsc.bcm.edu	37	19	1434903	1434903	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:1434903C>T	ENST00000233078.4	+	12	1377	c.1216C>T	c.(1216-1218)Cga>Tga	p.R406*	DAZAP1_ENST00000336761.6_3'UTR	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	406					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACCCCTACCGACGCTAGCC	0.672																																					p.R406X		Atlas-SNP	.											.	DAZAP1	52	.	0			c.C1216T						PASS	.						9.0	10.0	10.0					19																	1434903		2140	4189	6329	SO:0001587	stop_gained	26528	exon12			CCCTACCGACGCT		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.1216C>T	19.37:g.1434903C>T	ENSP00000233078:p.Arg406*	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	47	19	0.404255	NM_018959	Q96MJ3|Q9NRR9	Nonsense_Mutation	SNP	ENST00000233078.4	37	CCDS12065.1	.	.	.	.	.	.	.	.	.	.	C	38	6.709031	0.97780	.	.	ENSG00000071626	ENST00000233078	.	.	.	5.26	3.02	0.34903	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8945	0.58091	0.4422:0.5578:0.0:0.0	.	.	.	.	X	406	.	ENSP00000233078:R406X	R	+	1	2	DAZAP1	1385903	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.926000	0.40084	1.186000	0.42985	0.561000	0.74099	CGA	.	.	none		0.672	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
SPAG16	79582	hgsc.bcm.edu	37	2	214239770	214239770	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr2:214239770G>T	ENST00000331683.5	+	9	964	c.869G>T	c.(868-870)gGt>gTt	p.G290V	SPAG16_ENST00000374309.3_Missense_Mutation_p.G196V|SPAG16_ENST00000272898.7_Missense_Mutation_p.G290V|SPAG16_ENST00000447990.1_Missense_Mutation_p.G290V	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	290					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GCACCAGAAGGTCCTACTCAG	0.318																																					p.G290V		Atlas-SNP	.											SPAG16_ENST00000272898,NS,carcinoma,+1,2	SPAG16	134	2	0			c.G869T						scavenged	.						86.0	81.0	83.0					2																	214239770		2203	4300	6503	SO:0001583	missense	79582	exon9			CAGAAGGTCCTAC	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.869G>T	2.37:g.214239770G>T	ENSP00000332592:p.Gly290Val	Somatic	410	1	0.00243902		WXS	Illumina HiSeq	Phase_I	382	15	0.039267	NM_024532	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.119874	0.37436	.	.	ENSG00000144451	ENST00000331683;ENST00000272898;ENST00000447990;ENST00000374309	T;T	0.58358	0.4;0.34	5.0	5.0	0.66597	WD40/YVTN repeat-like-containing domain (1);	0.324591	0.29321	N	0.012483	T	0.66896	0.2836	L	0.61218	1.895	0.53005	D	0.99996	D;D;P;D	0.76494	0.999;0.996;0.777;0.996	P;D;B;P	0.64237	0.896;0.923;0.199;0.896	T	0.69435	-0.5146	10	0.72032	D	0.01	.	13.6791	0.62472	0.0:0.0:1.0:0.0	.	196;141;230;290	B4DYB5;Q8N0X2-2;Q4G1A2;Q8N0X2	.;.;.;SPG16_HUMAN	V	290;290;290;196	ENSP00000332592:G290V;ENSP00000363428:G196V	ENSP00000272898:G290V	G	+	2	0	SPAG16	213948015	1.000000	0.71417	1.000000	0.80357	0.352000	0.29268	2.109000	0.41863	2.580000	0.87095	0.561000	0.74099	GGT	.	.	none		0.318	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532	
WDR34	89891	hgsc.bcm.edu	37	9	131418828	131418828	+	Missense_Mutation	SNP	A	A	C	rs4837292		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr9:131418828A>C	ENST00000372715.2	-	1	238	c.178T>G	c.(178-180)Tgg>Ggg	p.W60G		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	60				W -> G (in Ref. 2; AAH11874/AAH01614). {ECO:0000305}.		axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						ACCGTCTCCCAGCGGATGCCC	0.806																																					p.W60G		Atlas-SNP	.											WDR34,cerebellum,glioma,0,1	WDR34	29	1	0			c.T178G						scavenged	.	C	GLY/TRP	1803,9		897,9,0	1.0	1.0	1.0		178	2.1	1.0	9	dbSNP_111	1	3858,0		1929,0,0	no	missense	WDR34	NM_052844.3	184	2826,9,0	CC,CA,AA		0.0,0.4967,0.1587	benign	60/537	131418828	5661,9	906	1929	2835	SO:0001583	missense	89891	exon1			TCTCCCAGCGGAT	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.178T>G	9.37:g.131418828A>C	ENSP00000361800:p.Trp60Gly	Somatic	1	1	1		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_052844	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	2170	0.9935897435897436	486	0.9878048780487805	362	1.0	571	0.9982517482517482	751	0.9907651715039578	C	7.343	0.621247	0.14193	0.995033	1.0	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T;T;T	0.74106	-0.81;-0.81;-0.81	4.02	2.12	0.27331	.	0.538297	0.18788	N	0.131154	T	0.00012	0.0000	N	0.00538	-1.39	0.58432	P	1.999999999946489E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34625	-0.9821	9	0.08381	T	0.77	-3.0135	7.4804	0.27402	0.1755:0.4462:0.3784:0.0	rs4837292;rs56752541	45;60	A2A3F8;Q96EX3	.;WDR34_HUMAN	G	60;51;45	ENSP00000361800:W60G;ENSP00000411370:W51G;ENSP00000415421:W45G	ENSP00000361800:W60G	W	-	1	0	WDR34	130458649	1.000000	0.71417	0.994000	0.49952	0.970000	0.65996	0.709000	0.25734	0.259000	0.21709	-0.126000	0.14955	TGG	A|0.006;C|0.994	0.994	strong		0.806	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
MUC4	4585	hgsc.bcm.edu	37	3	195510030	195510030	+	Silent	SNP	C	C	G	rs374297426	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:195510030C>G	ENST00000463781.3	-	2	8880	c.8421G>C	c.(8419-8421)tcG>tcC	p.S2807S	MUC4_ENST00000475231.1_Silent_p.S2807S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S2807S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGGACACTGACGAAGCGTCGG	0.582													.|||	29	0.00579073	0.0174	0.0014	5008	,	,		6131	0.002		0.001	False		,,,				2504	0.002				p.S2807S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - coding silent(1)	endometrium(1)	c.G8421C						scavenged	.						75.0	46.0	55.0					3																	195510030		683	1492	2175	SO:0001819	synonymous_variant	4585	exon2			CACTGACGAAGCG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8421G>C	3.37:g.195510030C>G		Somatic	96	5	0.0520833		WXS	Illumina HiSeq	Phase_I	173	16	0.0924855	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	weak		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
KRT6A	3853	hgsc.bcm.edu	37	12	52885485	52885485	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:52885485T>G	ENST00000330722.6	-	2	644	c.576A>C	c.(574-576)gaA>gaC	p.E192D		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	192	Coil 1A.|Rod.			E -> D (in Ref. 1; AAB60696). {ECO:0000305}.	cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCACTTTGTTTCCAGAACCT	0.532																																					p.E192D		Atlas-SNP	.											KRT6A,NS,haematopoietic_neoplasm,0,1	KRT6A	89	1	0			c.A576C						scavenged	.						66.0	67.0	67.0					12																	52885485		2203	4300	6503	SO:0001583	missense	3853	exon2			CTTTGTTTCCAGA	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.576A>C	12.37:g.52885485T>G	ENSP00000369317:p.Glu192Asp	Somatic	105	1	0.00952381		WXS	Illumina HiSeq	Phase_I	78	5	0.0641026	NM_005554	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	t	15.33	2.801841	0.50315	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	T	0.78595	-1.19	5.26	-1.41	0.08941	Filament (1);	0.298035	0.28414	N	0.015426	T	0.76772	0.4034	M	0.92555	3.32	0.31174	N	0.70282	B	0.24651	0.108	B	0.31016	0.123	T	0.68059	-0.5509	10	0.40728	T	0.16	.	2.0814	0.03635	0.1319:0.2762:0.2398:0.352	.	192	P02538	K2C6A_HUMAN	D	192;148	ENSP00000369317:E192D	ENSP00000369317:E192D	E	-	3	2	KRT6A	51171752	0.999000	0.42202	0.994000	0.49952	0.965000	0.64279	0.625000	0.24477	-0.197000	0.10350	-0.302000	0.09304	GAA	.	.	none		0.532	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
PSG8	440533	hgsc.bcm.edu	37	19	43268286	43268286	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:43268286T>C	ENST00000306511.4	-	2	309	c.212A>G	c.(211-213)cAa>cGa	p.Q71R	PSG8_ENST00000401467.2_Missense_Mutation_p.Q71R|PSG8_ENST00000406636.3_Intron|PSG8_ENST00000404209.4_Missense_Mutation_p.Q71R	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	71	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GTCCCTGATTTGCCCTTTGTA	0.413																																					p.Q71R		Atlas-SNP	.											.	PSG8	101	.	0			c.A212G						PASS	.						174.0	186.0	182.0					19																	43268286		2203	4292	6495	SO:0001583	missense	440533	exon2			CTGATTTGCCCTT	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.212A>G	19.37:g.43268286T>C	ENSP00000305005:p.Gln71Arg	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	155	18	0.116129	NM_001130167	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	37	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	t	5.359	0.251452	0.10130	.	.	ENSG00000124467	ENST00000404209;ENST00000401467;ENST00000407488;ENST00000306511	T;T;T	0.01484	4.84;4.84;4.84	1.35	0.162	0.14981	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03434	0.0099	M	0.80422	2.495	0.09310	N	1	B;B;P;B;B	0.39044	0.003;0.001;0.656;0.002;0.003	B;B;B;B;B	0.40982	0.008;0.01;0.345;0.005;0.008	T	0.29610	-1.0006	9	0.52906	T	0.07	.	4.2604	0.10739	0.0:0.0:0.3569:0.6431	.	71;71;71;71;71	B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;PSG8_HUMAN;.;.;.	R	71	ENSP00000385869:Q71R;ENSP00000386090:Q71R;ENSP00000305005:Q71R	ENSP00000305005:Q71R	Q	-	2	0	PSG8	47960126	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.899000	0.04101	-0.017000	0.14103	0.155000	0.16302	CAA	.	.	none		0.413	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000497517.2_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000349624.3_Intron|TPO_ENST00000382198.1_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		Atlas-SNP	.											TPO,cerebellum,glioma,0,1	TPO	224	1	0			c.G1193C						PASS	.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	7	4	0.571429	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699	0.699	strong		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TNF	7124	hgsc.bcm.edu	37	6	31543608	31543608	+	Silent	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr6:31543608C>T	ENST00000449264.2	+	1	265	c.90C>T	c.(88-90)tgC>tgT	p.C30C		NM_000594.3	NP_000585.2	P01375	TNFA_HUMAN	tumor necrosis factor	30					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nicotine (GO:0071316)|cellular response to organic cyclic compound (GO:0071407)|chronic inflammatory response to antigenic stimulus (GO:0002439)|defense response to Gram-positive bacterium (GO:0050830)|embryonic digestive tract development (GO:0048566)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glucose metabolic process (GO:0006006)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JNK cascade (GO:0007254)|leukocyte tethering or rolling (GO:0050901)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|necroptotic signaling pathway (GO:0097527)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of branching involved in lung morphogenesis (GO:0061048)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of glucose import (GO:0046325)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of L-glutamate transport (GO:0002037)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid storage (GO:0010888)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|organ morphogenesis (GO:0009887)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle development (GO:0051798)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of mononuclear cell migration (GO:0071677)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of podosome assembly (GO:0071803)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein transport (GO:0051222)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translational initiation by iron (GO:0045994)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|receptor biosynthetic process (GO:0032800)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of immunoglobulin secretion (GO:0051023)|regulation of insulin secretion (GO:0050796)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to salt stress (GO:0009651)|response to virus (GO:0009615)|sequestering of triglyceride (GO:0030730)|skeletal muscle contraction (GO:0003009)|transformed cell apoptotic process (GO:0006927)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	cytokine activity (GO:0005125)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|transcription regulatory region DNA binding (GO:0044212)|tumor necrosis factor receptor binding (GO:0005164)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(3)	8		Ovarian(999;0.00556)			Adalimumab(DB00051)|Amrinone(DB01427)|Certolizumab pegol(DB08904)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Epinephrine(DB00668)|Etanercept(DB00005)|Glucosamine(DB01296)|golimumab(DB06674)|Infliximab(DB00065)|Pomalidomide(DB08910)|Pranlukast(DB01411)|Pseudoephedrine(DB00852)|Thalidomide(DB01041)	CCAGGCGGTGCTTGTTCCTCA	0.632									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.C30C		Atlas-SNP	.											.	TNF	15	.	0			c.C90T						PASS	.						74.0	74.0	74.0					6																	31543608		2203	4300	6503	SO:0001819	synonymous_variant	7124	exon1	Familial Cancer Database	incl.: Familial Head and Neck Cancer	GCGGTGCTTGTTC	X02910	CCDS4702.1	6p21.3	2013-05-22	2010-05-04		ENSG00000232810	ENSG00000232810		"""Tumor necrosis factor (ligand) superfamily"""	11892	protein-coding gene	gene with protein product	"""TNF superfamily, member 2"""	191160	"""tumor necrosis factor (TNF superfamily, member 2)"""	TNFA		2413547, 6392892	Standard	NM_000594		Approved	TNFSF2, DIF, TNF-alpha	uc003nui.4	P01375	OTTHUMG00000031194	ENST00000449264.2:c.90C>T	6.37:g.31543608C>T		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	40	14	0.35	NM_000594	O43647|Q9P1Q2|Q9UIV3	Silent	SNP	ENST00000449264.2	37	CCDS4702.1																																																																																			.	.	none		0.632	TNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076390.2		
MUC4	4585	hgsc.bcm.edu	37	3	195505842	195505842	+	Silent	SNP	T	T	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:195505842T>G	ENST00000463781.3	-	2	13068	c.12609A>C	c.(12607-12609)acA>acC	p.T4203T	MUC4_ENST00000475231.1_Silent_p.T4203T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGGCGTGACCTGTGGATGCTG	0.597																																					p.T4203T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-2,1	MUC4	1505	1	0			c.A12609C						scavenged	.						16.0	14.0	15.0					3																	195505842		691	1577	2268	SO:0001819	synonymous_variant	4585	exon2			GTGACCTGTGGAT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12609A>C	3.37:g.195505842T>G		Somatic	95	16	0.168421		WXS	Illumina HiSeq	Phase_I	110	29	0.263636	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	none		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TRPC6	7225	hgsc.bcm.edu	37	11	101375357	101375357	+	Missense_Mutation	SNP	G	G	A	rs199884871		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr11:101375357G>A	ENST00000344327.3	-	2	767	c.343C>T	c.(343-345)Cgg>Tgg	p.R115W	TRPC6_ENST00000360497.4_Missense_Mutation_p.R115W|TRPC6_ENST00000348423.4_Missense_Mutation_p.R115W|TRPC6_ENST00000526713.1_5'Flank|TRPC6_ENST00000532133.1_Missense_Mutation_p.R115W	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	115					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		AACATCTTCCGCACCACTGGG	0.473																																					p.R115W	Colon(166;1315 1927 11094 12848 34731)	Atlas-SNP	.											TRPC6,NS,carcinoma,+1,1	TRPC6	132	1	0			c.C343T						PASS	.	G	TRP/ARG	0,4406		0,0,2203	156.0	142.0	147.0		343	4.0	1.0	11		147	1,8597	1.2+/-3.3	0,1,4298	no	missense	TRPC6	NM_004621.5	101	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign	115/932	101375357	1,13003	2203	4299	6502	SO:0001583	missense	7225	exon2			TCTTCCGCACCAC	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.343C>T	11.37:g.101375357G>A	ENSP00000340913:p.Arg115Trp	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	72	6	0.0833333	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607032	0.66558	0.0	1.16E-4	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.96	3.95	0.45737	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.82130	0.4970	M	0.83692	2.655	0.51233	D	0.999918	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.986;0.999;0.992	D	0.83852	0.0263	10	0.72032	D	0.01	-15.8714	13.7254	0.62754	0.0:0.0:0.6021:0.3979	.	115;115;115	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	W	115	ENSP00000340913:R115W;ENSP00000435574:R115W;ENSP00000343672:R115W;ENSP00000353687:R115W	ENSP00000340913:R115W	R	-	1	2	TRPC6	100880567	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.284000	0.43478	0.673000	0.31224	0.655000	0.94253	CGG	.	.	weak		0.473	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
KCNQ2	3785	hgsc.bcm.edu	37	20	62038378	62038378	+	Silent	SNP	A	A	T	rs1801471	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr20:62038378A>T	ENST00000359125.2	-	17	2412	c.2238T>A	c.(2236-2238)ccT>ccA	p.P746P	KCNQ2_ENST00000360480.3_Silent_p.P718P|KCNQ2_ENST00000354587.3_Silent_p.P754P|KCNQ2_ENST00000370224.1_Silent_p.P754P|KCNQ2_ENST00000357249.2_Silent_p.P728P|KCNQ2_ENST00000359689.1_Silent_p.P746P|KCNQ2_ENST00000344462.4_Silent_p.P715P	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	746					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GCTCGTGGGCAGGCGGCGGCG	0.771													A|||	547	0.109225	0.003	0.1037	5008	,	,		11056	0.1319		0.0895	False		,,,				2504	0.2536				p.P746P		Atlas-SNP	.											KCNQ2,NS,carcinoma,0,1	KCNQ2	201	1	0			c.T2238A						scavenged	.	A	,,,	53,3435		0,53,1691	3.0	4.0	4.0		2154,2184,2238,2145	-9.9	0.0	20	dbSNP_89	4	477,6555		12,453,3051	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KCNQ2	NM_004518.4,NM_172106.1,NM_172107.2,NM_172108.3	,,,	12,506,4742	TT,TA,AA		6.7833,1.5195,5.038	,,,	718/845,728/855,746/873,715/842	62038378	530,9990	1744	3516	5260	SO:0001819	synonymous_variant	3785	exon17			GTGGGCAGGCGGC	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.2238T>A	20.37:g.62038378A>T		Somatic	1	1	1		WXS	Illumina HiSeq	Phase_I	15	5	0.333333	NM_172107	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Silent	SNP	ENST00000359125.2	37	CCDS13520.1																																																																																			A|0.929;T|0.071	0.071	strong		0.771	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
PRR18	285800	hgsc.bcm.edu	37	6	166721424	166721424	+	Silent	SNP	C	C	T	rs13205770	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr6:166721424C>T	ENST00000322583.3	-	1	447	c.207G>A	c.(205-207)ccG>ccA	p.P69P		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	69	Pro-rich.									haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		GAGGGGCCGGCGGCTGCGTCC	0.826													C|||	2206	0.440495	0.2844	0.4251	5008	,	,		4957	0.6161		0.492	False		,,,				2504	0.4284				p.P69P		Atlas-SNP	.											.	PRR18	4	.	0			c.G207A						PASS	.						2.0	4.0	3.0					6																	166721424		540	1476	2016	SO:0001819	synonymous_variant	285800	exon1			GGCCGGCGGCTGC	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.207G>A	6.37:g.166721424C>T		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	5	5	1	NM_175922		Silent	SNP	ENST00000322583.3	37	CCDS5291.1																																																																																			C|0.517;T|0.483	0.483	strong		0.826	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
PABPC3	5042	hgsc.bcm.edu	37	13	25671795	25671795	+	Missense_Mutation	SNP	C	C	T	rs113416318	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:25671795C>T	ENST00000281589.3	+	1	1496	c.1459C>T	c.(1459-1461)Cgt>Tgt	p.R487C		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	487					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AGTGGGTCCACGTCctgcagc	0.522													c|||	175	0.0349441	0.0537	0.0403	5008	,	,		21647	0.0119		0.0159	False		,,,				2504	0.0491				p.R487C		Atlas-SNP	.											PABPC3,rectum,carcinoma,0,1	PABPC3	129	1	0			c.C1459T						scavenged	.																																			SO:0001583	missense	5042	exon1			GGTCCACGTCCTG	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1459C>T	13.37:g.25671795C>T	ENSP00000281589:p.Arg487Cys	Somatic	51	2	0.0392157		WXS	Illumina HiSeq	Phase_I	69	7	0.101449	NM_030979	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.862076	0.51482	.	.	ENSG00000151846	ENST00000281589	T	0.31247	1.5	0.875	0.875	0.19130	.	0.135300	0.32190	U	0.006459	T	0.29556	0.0737	L	0.59436	1.845	0.58432	D	0.999997	D	0.58970	0.984	P	0.45660	0.489	T	0.12630	-1.0540	10	0.72032	D	0.01	.	7.5489	0.27783	0.0:1.0:0.0:0.0	.	487	Q9H361	PABP3_HUMAN	C	487	ENSP00000281589:R487C	ENSP00000281589:R487C	R	+	1	0	PABPC3	24569795	1.000000	0.71417	0.944000	0.38274	0.640000	0.38277	4.773000	0.62331	0.759000	0.33084	0.313000	0.20887	CGT	C|0.988;T|0.012	0.012	strong		0.522	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
MRPS7	51081	hgsc.bcm.edu	37	17	73261814	73261814	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr17:73261814G>A	ENST00000245539.6	+	5	766	c.539G>A	c.(538-540)cGc>cAc	p.R180H	MRPS7_ENST00000579002.1_Missense_Mutation_p.R209H	NM_015971.3	NP_057055.2	Q9Y2R9	RT07_HUMAN	mitochondrial ribosomal protein S7	180					translation (GO:0006412)	cytosolic small ribosomal subunit (GO:0022627)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)	6	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			CGGCGTCGCCGCTTCCTAGCC	0.597																																					p.R180H		Atlas-SNP	.											MRPS7,colon,carcinoma,0,1	MRPS7	19	1	0			c.G539A						scavenged	.						58.0	56.0	57.0					17																	73261814		2203	4300	6503	SO:0001583	missense	51081	exon5			GTCGCCGCTTCCT	AB051348	CCDS11718.1	17q25.1	2012-09-13				ENSG00000125445		"""Mitochondrial ribosomal proteins / small subunits"""	14499	protein-coding gene	gene with protein product		611974					Standard	NM_015971		Approved	MRP-S, RP-S7, RPMS7	uc002jnm.4	Q9Y2R9		ENST00000245539.6:c.539G>A	17.37:g.73261814G>A	ENSP00000245539:p.Arg180His	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	59	2	0.0338983	NM_015971	B2R9N5|Q53GD6	Missense_Mutation	SNP	ENST00000245539.6	37	CCDS11718.1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.412510	0.62511	.	.	ENSG00000125445	ENST00000245539	T	0.50813	0.73	6.07	5.1	0.69264	Ribosomal protein S7 domain (3);	0.000000	0.85682	D	0.000000	T	0.47303	0.1438	M	0.64404	1.975	0.80722	D	1	B	0.26120	0.142	B	0.24155	0.051	T	0.43261	-0.9402	10	0.46703	T	0.11	-14.9933	15.8057	0.78506	0.0659:0.0:0.9341:0.0	.	180	Q9Y2R9	RT07_HUMAN	H	180	ENSP00000245539:R180H	ENSP00000245539:R180H	R	+	2	0	MRPS7	70773409	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.013000	0.88655	2.885000	0.99019	0.655000	0.94253	CGC	.	.	none		0.597	MRPS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446666.1	NM_015971	
ANAPC1	64682	hgsc.bcm.edu	37	2	112608394	112608394	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr2:112608394T>C	ENST00000341068.3	-	14	2381	c.1609A>G	c.(1609-1611)Act>Gct	p.T537A		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	537					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.T537A(5)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						GGCTTTGGAGTACTAACGCCA	0.433																																					p.T537A		Atlas-SNP	.											ANAPC1,NS,carcinoma,0,9	ANAPC1	116	9	5	Substitution - Missense(5)	lung(3)|kidney(1)|endometrium(1)	c.A1609G						scavenged	.						109.0	106.0	107.0					2																	112608394		2203	4300	6503	SO:0001583	missense	64682	exon14			TTGGAGTACTAAC	AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.1609A>G	2.37:g.112608394T>C	ENSP00000339109:p.Thr537Ala	Somatic	560	5	0.00892857		WXS	Illumina HiSeq	Phase_I	422	5	0.0118483	NM_022662	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	ENST00000341068.3	37	CCDS2093.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.716|4.716	0.133071|0.133071	0.09032|0.09032	.|.	.|.	ENSG00000153107|ENSG00000153107	ENST00000341068|ENST00000427997	.|.	.|.	.|.	4.57|4.57	3.37|3.37	0.38596|0.38596	.|.	0.273018|.	0.23039|.	U|.	0.052629|.	T|T	0.55305|0.55305	0.1912|0.1912	L|L	0.45352|0.45352	1.415|1.415	0.37887|0.37887	D|D	0.930579|0.930579	B|.	0.14438|.	0.01|.	B|.	0.18263|.	0.021|.	T|T	0.53535|0.53535	-0.8425|-0.8425	9|5	0.08837|.	T|.	0.75|.	-8.0757|-8.0757	10.3103|10.3103	0.43704|0.43704	0.1479:0.0:0.0:0.8521|0.1479:0.0:0.0:0.8521	.|.	537|.	Q9H1A4|.	APC1_HUMAN|.	A|C	537|71	.|.	ENSP00000339109:T537A|.	T|Y	-|-	1|2	0|0	ANAPC1|ANAPC1	112324865|112324865	1.000000|1.000000	0.71417|0.71417	0.138000|0.138000	0.22173|0.22173	0.127000|0.127000	0.20565|0.20565	3.555000|3.555000	0.53727|0.53727	0.570000|0.570000	0.29347|0.29347	0.369000|0.369000	0.22263|0.22263	ACT|TAC	T|0.500;C|0.500	0.500	strong		0.433	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254045.2	NM_022662	
ARIH2	10425	hgsc.bcm.edu	37	3	49017001	49017001	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:49017001G>A	ENST00000356401.4	+	12	1387	c.1048G>A	c.(1048-1050)Gtg>Atg	p.V350M	ARIH2_ENST00000449376.1_Missense_Mutation_p.V350M|RP13-131K19.1_ENST00000429681.1_RNA|ARIH2_ENST00000490095.1_3'UTR|RP13-131K19.1_ENST00000415982.1_RNA	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	350					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		TCCTGACATCGTGAACCAGAG	0.498																																					p.V350M		Atlas-SNP	.											ARIH2,NS,carcinoma,0,1	ARIH2	32	1	0			c.G1048A						scavenged	.						142.0	120.0	128.0					3																	49017001		2203	4300	6503	SO:0001583	missense	10425	exon12			GACATCGTGAACC	AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.1048G>A	3.37:g.49017001G>A	ENSP00000348769:p.Val350Met	Somatic	74	1	0.0135135		WXS	Illumina HiSeq	Phase_I	84	14	0.166667	NM_006321	Q9HBZ6|Q9UEM9	Missense_Mutation	SNP	ENST00000356401.4	37	CCDS2780.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213019	0.79352	.	.	ENSG00000177479	ENST00000356401;ENST00000449376;ENST00000444790;ENST00000395481	D;D	0.82711	-1.64;-1.64	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.86108	0.5854	N	0.24115	0.695	0.80722	D	1	D;D;P	0.76494	0.999;0.998;0.792	P;D;B	0.70935	0.813;0.971;0.154	D	0.86779	0.1978	10	0.52906	T	0.07	.	19.9097	0.97022	0.0:0.0:1.0:0.0	.	357;350;350	B3KMG5;Q53ET9;O95376	.;.;ARI2_HUMAN	M	350;350;349;174	ENSP00000348769:V350M;ENSP00000403222:V350M	ENSP00000348769:V350M	V	+	1	0	ARIH2	48992005	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.418000	0.80167	2.710000	0.92621	0.472000	0.43445	GTG	.	.	none		0.498	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257525.1	NM_006321	
MUC4	4585	hgsc.bcm.edu	37	3	195505772	195505772	+	Missense_Mutation	SNP	C	C	G	rs556354486		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:195505772C>G	ENST00000463781.3	-	2	13138	c.12679G>C	c.(12679-12681)Gtc>Ctc	p.V4227L	MUC4_ENST00000475231.1_Missense_Mutation_p.V4227L|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	984					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V4227L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGCTGGTGACAGGAAGAGGG	0.582													.|||	1	0.000199681	0.0	0.0	5008	,	,		15508	0.0		0.001	False		,,,				2504	0.0				p.V4227L		Atlas-SNP	.											MUC4_ENST00000463781,bladder,carcinoma,0,4	MUC4	1505	4	1	Substitution - Missense(1)	lung(1)	c.G12679C						scavenged	.																																			SO:0001583	missense	4585	exon2			TGGTGACAGGAAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12679G>C	3.37:g.195505772C>G	ENSP00000417498:p.Val4227Leu	Somatic	81	2	0.0246914		WXS	Illumina HiSeq	Phase_I	109	6	0.0550459	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	5.247	0.230981	0.09969	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.6	1.57	0.566	0.17317	.	.	.	.	.	T	0.14227	0.0344	N	0.14661	0.345	0.19300	N	0.999978	B	0.27765	0.188	B	0.22601	0.04	T	0.27640	-1.0068	8	.	.	.	.	5.595	0.17321	0.0:0.6491:0.3509:0.0	.	4099	E7ESK3	.	L	4227	ENSP00000417498:V4227L;ENSP00000420243:V4227L	.	V	-	1	0	MUC4	196990551	0.000000	0.05858	0.020000	0.16555	0.011000	0.07611	-0.070000	0.11523	0.201000	0.20466	0.484000	0.47621	GTC	.	.	none		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ZNF814	730051	hgsc.bcm.edu	37	19	58385714	58385714	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:58385714T>G	ENST00000435989.2	-	3	1278	c.1044A>C	c.(1042-1044)gaA>gaC	p.E348D	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	348					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AATGTTTTTTTTCAGTGTGAA	0.368																																					p.E348D		Atlas-SNP	.											ZNF814,NS,carcinoma,0,2	ZNF814	93	2	0			c.A1044C						scavenged	.						192.0	147.0	160.0					19																	58385714		692	1591	2283	SO:0001583	missense	730051	exon3			TTTTTTTTCAGTG		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1044A>C	19.37:g.58385714T>G	ENSP00000410545:p.Glu348Asp	Somatic	232	2	0.00862069		WXS	Illumina HiSeq	Phase_I	203	4	0.0197044	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	13.49	2.252737	0.39797	.	.	ENSG00000204514	ENST00000435989	T	0.18502	2.21	2.01	0.932	0.19466	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09468	0.0233	N	0.13371	0.34	0.19775	N	0.999954	B	0.15473	0.013	B	0.13407	0.009	T	0.30650	-0.9971	9	0.66056	D	0.02	.	5.8021	0.18420	0.0:0.152:0.0:0.848	.	348	B7Z6K7	ZN814_HUMAN	D	348	ENSP00000410545:E348D	ENSP00000410545:E348D	E	-	3	2	ZNF814	63077526	0.000000	0.05858	0.013000	0.15412	0.381000	0.30169	-0.928000	0.03980	0.089000	0.17243	0.113000	0.15668	GAA	.	.	none		0.368	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
DRD5	1816	hgsc.bcm.edu	37	4	9784853	9784853	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr4:9784853C>G	ENST00000304374.2	+	1	1596	c.1200C>G	c.(1198-1200)atC>atG	p.I400M		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	400					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.I400M(2)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	ACCAAGACATCGTCTTCCACA	0.592																																					p.I400M		Atlas-SNP	.											DRD5,NS,carcinoma,0,2	DRD5	119	2	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	c.C1200G						scavenged	.						97.0	78.0	84.0					4																	9784853		2203	4300	6503	SO:0001583	missense	1816	exon1			AGACATCGTCTTC	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1200C>G	4.37:g.9784853C>G	ENSP00000306129:p.Ile400Met	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	85	4	0.0470588	NM_000798	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	c	2.136	-0.397995	0.04865	.	.	ENSG00000169676	ENST00000304374	T	0.65364	-0.15	4.73	-9.46	0.00597	.	0.191884	0.44688	D	0.000429	T	0.27098	0.0664	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.04650	-1.0936	10	0.33141	T	0.24	.	5.418	0.16384	0.1584:0.2933:0.4256:0.1227	.	400	P21918	DRD5_HUMAN	M	400	ENSP00000306129:I400M	ENSP00000306129:I400M	I	+	3	3	DRD5	9393951	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-2.589000	0.00900	-1.894000	0.01105	-1.614000	0.00798	ATC	.	.	none		0.592	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
NEBL	10529	hgsc.bcm.edu	37	10	21309077	21309077	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr10:21309077C>T	ENST00000417816.2	-	3	571	c.218G>A	c.(217-219)cGc>cAc	p.R73H	NEBL_ENST00000377159.4_Missense_Mutation_p.R39H	NM_001173484.1|NM_213569.2	NP_001166955.1|NP_998734.1	O76041	NEBL_HUMAN	nebulette	737					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CTGCTTCAGGCGAAGATTTTC	0.413																																					p.R73H		Atlas-SNP	.											NEBL_ENST00000417816,NS,malignant_melanoma,-1,2	NEBL	199	2	0			c.G218A						PASS	.						105.0	99.0	101.0					10																	21309077		2203	4300	6503	SO:0001583	missense	10529	exon3			TTCAGGCGAAGAT	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000417816.2:c.218G>A	10.37:g.21309077C>T	ENSP00000393896:p.Arg73His	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	113	8	0.0707965	NM_001173484	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	ENST00000417816.2	37	CCDS7133.1	.	.	.	.	.	.	.	.	.	.	c	27.3	4.819770	0.90873	.	.	ENSG00000078114	ENST00000417816;ENST00000377159	T;T	0.42131	0.98;0.98	5.24	5.24	0.73138	.	.	.	.	.	T	0.61223	0.2330	L	0.53729	1.69	0.41209	D	0.986421	D	0.89917	1.0	D	0.91635	0.999	T	0.60459	-0.7259	9	0.48119	T	0.1	.	17.9579	0.89075	0.0:1.0:0.0:0.0	.	73	Q70I54	.	H	73;39	ENSP00000393896:R73H;ENSP00000366364:R39H	ENSP00000366364:R39H	R	-	2	0	NEBL	21349083	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.105000	0.71505	2.595000	0.87683	0.651000	0.88453	CGC	.	.	none		0.413	NEBL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047112.1	NM_006393	
PLEKHD1	400224	hgsc.bcm.edu	37	14	69951715	69951715	+	Silent	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr14:69951715C>T	ENST00000322564.7	+	1	245	c.33C>T	c.(31-33)ccC>ccT	p.P11P		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	11										breast(1)|endometrium(1)|kidney(2)	4						CGGTGTCGCCCTCGCCGTCCC	0.687																																					p.P11P		Atlas-SNP	.											.	PLEKHD1	24	.	0			c.C33T						PASS	.						46.0	48.0	47.0					14																	69951715		692	1591	2283	SO:0001819	synonymous_variant	400224	exon1			GTCGCCCTCGCCG	AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.33C>T	14.37:g.69951715C>T		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	73	12	0.164384	NM_001161498	B9EJC2	Silent	SNP	ENST00000322564.7	37	CCDS53903.1																																																																																			.	.	none		0.687	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412451.2	NM_001161498	
TPTE2	93492	hgsc.bcm.edu	37	13	20056679	20056679	+	Missense_Mutation	SNP	T	T	G	rs200244531		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:20056679T>G	ENST00000400230.2	-	4	172	c.128A>C	c.(127-129)gAa>gCa	p.E43A	TPTE2_ENST00000457266.2_Missense_Mutation_p.E43A|TPTE2_ENST00000382975.4_Missense_Mutation_p.E43A|TPTE2_ENST00000400103.2_Missense_Mutation_p.E43A|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000382978.1_Missense_Mutation_p.E43A|TPTE2_ENST00000382977.4_Missense_Mutation_p.E43A|TPTE2_ENST00000390680.2_Intron			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	43					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E43A(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		GGAAAGTCGTTCTAACATACT	0.313																																					p.E43A		Atlas-SNP	.											TPTE2_ENST00000400230,NS,carcinoma,0,1	TPTE2	225	1	1	Substitution - Missense(1)	kidney(1)	c.A128C						scavenged	.						52.0	51.0	51.0					13																	20056679		2201	4299	6500	SO:0001583	missense	93492	exon5			AGTCGTTCTAACA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.128A>C	13.37:g.20056679T>G	ENSP00000383089:p.Glu43Ala	Somatic	605	4	0.00661157		WXS	Illumina HiSeq	Phase_I	615	10	0.0162602	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	2.387	-0.340821	0.05243	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94931	-3.56;-3.53;-3.47;-3.47;-3.56;-3.53	2.06	0.858	0.19030	.	0.878504	0.09602	U	0.780065	D	0.86159	0.5866	N	0.21448	0.665	0.09310	N	1	B;B	0.28850	0.225;0.0	B;B	0.19946	0.027;0.0	T	0.74598	-0.3612	9	.	.	.	-0.5937	3.8365	0.08896	0.0:0.192:0.0:0.808	.	43;43	A8MX64;Q6XPS3	.;TPTE2_HUMAN	A	43	ENSP00000372438:E43A;ENSP00000382974:E43A;ENSP00000383089:E43A;ENSP00000372437:E43A;ENSP00000372435:E43A;ENSP00000442218:E43A	.	E	-	2	0	TPTE2	18954679	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.422000	0.21296	0.241000	0.21283	0.383000	0.25322	GAA	.	.	weak		0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
RASA3	22821	hgsc.bcm.edu	37	13	114783725	114783725	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:114783725C>T	ENST00000334062.7	-	11	1067	c.946G>A	c.(946-948)Gtg>Atg	p.V316M	RASA3_ENST00000389544.4_Missense_Mutation_p.V284M|RASA3_ENST00000542651.1_3'UTR	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	316					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			GACGCTGACACGGGCTGCGGG	0.682																																					p.V316M		Atlas-SNP	.											.	RASA3	83	.	0			c.G946A						PASS	.						9.0	8.0	8.0					13																	114783725		2091	4147	6238	SO:0001583	missense	22821	exon11			CTGACACGGGCTG		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.946G>A	13.37:g.114783725C>T	ENSP00000335029:p.Val316Met	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	84	18	0.214286	NM_007368	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	37	CCDS32016.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529328	0.64860	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.17691	2.26;2.26	4.49	4.49	0.54785	Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.062063	0.64402	D	0.000006	T	0.36220	0.0959	M	0.62723	1.935	0.80722	D	1	D	0.69078	0.997	P	0.62649	0.905	T	0.09058	-1.0692	9	.	.	.	.	15.9295	0.79648	0.0:1.0:0.0:0.0	.	316	Q14644	RASA3_HUMAN	M	316;284	ENSP00000335029:V316M;ENSP00000374195:V284M	.	V	-	1	0	RASA3	113801827	1.000000	0.71417	0.760000	0.31359	0.031000	0.12232	4.899000	0.63245	2.004000	0.58718	0.491000	0.48974	GTG	.	.	none		0.682	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368	
ANKRD24	170961	hgsc.bcm.edu	37	19	4217956	4217956	+	Silent	SNP	A	A	G	rs6510794	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:4217956A>G	ENST00000600132.1	+	18	3075	c.2799A>G	c.(2797-2799)gcA>gcG	p.A933A	ANKRD24_ENST00000318934.4_Silent_p.A933A|ANKRD24_ENST00000262970.5_Silent_p.A1023A	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	933										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGGGCCGGGCAGCCAGTCTGG	0.766													G|||	2256	0.450479	0.5166	0.4164	5008	,	,		6898	0.4692		0.4751	False		,,,				2504	0.3405				p.A933A		Atlas-SNP	.											ANKRD24_ENST00000318934,NS,carcinoma,0,2	ANKRD24	180	2	0			c.A2799G						scavenged	.	G		1357,2019		337,683,668	3.0	6.0	5.0		2799	0.3	1.0	19	dbSNP_116	5	2607,4473		599,1409,1532	no	coding-synonymous	ANKRD24	NM_133475.1		936,2092,2200	GG,GA,AA		36.822,40.1955,37.9112		933/1147	4217956	3964,6492	1688	3540	5228	SO:0001819	synonymous_variant	170961	exon18			CCGGGCAGCCAGT	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.2799A>G	19.37:g.4217956A>G		Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	20	13	0.65	NM_133475	O75268|O95781	Silent	SNP	ENST00000600132.1	37	CCDS45925.1																																																																																			A|0.540;G|0.460	0.460	strong		0.766	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
FAM83H	286077	hgsc.bcm.edu	37	8	144810138	144810138	+	Missense_Mutation	SNP	G	G	A	rs1137806	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:144810138G>A	ENST00000388913.3	-	5	1618	c.1493C>T	c.(1492-1494)cCg>cTg	p.P498L		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	498					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCCGAGCTCCGGGAAGCGGGG	0.771													G|||	831	0.165935	0.0083	0.147	5008	,	,		6578	0.247		0.1451	False		,,,				2504	0.3303				p.P498L		Atlas-SNP	.											.	FAM83H	68	.	0			c.C1493T						PASS	.	G	LEU/PRO	64,3096		3,58,1519	4.0	7.0	6.0		1493	4.4	0.3	8	dbSNP_86	6	767,6345		32,703,2821	no	missense	FAM83H	NM_198488.3	98	35,761,4340	AA,AG,GG		10.7846,2.0253,8.09	benign	498/1180	144810138	831,9441	1580	3556	5136	SO:0001583	missense	286077	exon5			AGCTCCGGGAAGC	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.1493C>T	8.37:g.144810138G>A	ENSP00000373565:p.Pro498Leu	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	11	4	0.363636	NM_198488	A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	CCDS6410.2	321	0.14697802197802198	19	0.03861788617886179	46	0.1270718232044199	147	0.256993006993007	109	0.1437994722955145	N	15.31	2.796089	0.50208	0.020253	0.107846	ENSG00000180921	ENST00000388913	T	0.15256	2.44	4.45	4.45	0.53987	.	425.438000	0.00924	U	0.002638	T	0.00012	0.0000	L	0.32530	0.975	0.49299	P	2.2400000000000198E-4	D	0.76494	0.999	P	0.61275	0.886	T	0.14090	-1.0485	9	0.56958	D	0.05	.	12.8618	0.57918	0.0:0.0:0.8368:0.1632	rs1137806;rs3201609	498	Q6ZRV2	FA83H_HUMAN	L	498	ENSP00000373565:P498L	ENSP00000373565:P498L	P	-	2	0	FAM83H	144882126	1.000000	0.71417	0.283000	0.24790	0.537000	0.34900	4.979000	0.63806	2.010000	0.58986	0.455000	0.32223	CCG	G|0.853;A|0.147	0.147	strong		0.771	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
ZMYND10	51364	hgsc.bcm.edu	37	3	50378176	50378176	+	IGR	SNP	T	T	G	rs4688725	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:50378176T>G	ENST00000231749.3	-	0	2896				ZMYND10-AS1_ENST00000440013.1_RNA|ZMYND10_ENST00000490675.1_5'Flank|RASSF1_ENST00000359365.4_Missense_Mutation_p.K21Q|RASSF1_ENST00000395126.3_5'Flank|RASSF1_ENST00000488024.1_5'UTR|RASSF1_ENST00000357043.2_Missense_Mutation_p.K21Q	NM_015896.2	NP_056980.2	O75800	ZMY10_HUMAN	zinc finger, MYND-type containing 10						inner dynein arm assembly (GO:0036159)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)	centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|urinary_tract(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GTGCGGCCCTTCCCAGCGCGC	0.736										TSP Lung(30;0.18)			G|||	1175	0.234625	0.2436	0.2954	5008	,	,		13606	0.62		0.0119	False		,,,				2504	0.0112				p.K21Q		Atlas-SNP	.											.	RASSF1	46	.	0			c.A61C						PASS	.	G	,GLN/LYS,GLN/LYS	402,2740		7,388,1176	2.0	3.0	3.0		,61,61	4.5	0.0	3	dbSNP_111	3	24,6908		0,24,3442	no	utr-5,missense,missense	RASSF1	NM_001206957.1,NM_007182.4,NM_170714.1	,53,53	7,412,4618	GG,GT,TT		0.3462,12.7944,4.2287	,benign,benign	,21/341,21/345	50378176	426,9648	1571	3466	5037	SO:0001628	intergenic_variant	11186	exon1			GGCCCTTCCCAGC	U70824	CCDS2825.1	3p21.3	2014-02-03			ENSG00000004838	ENSG00000004838		"""Zinc fingers, MYND-type"""	19412	protein-coding gene	gene with protein product		607070				12629521, 23891469	Standard	NM_015896		Approved	BLU, CILD22	uc003dag.1	O75800	OTTHUMG00000156874		3.37:g.50378176T>G		Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	10	7	0.7	NM_007182	A6NK41|B3KU54|O14570|O75801|Q53FE6|Q8N4R6|Q8NDN6	Missense_Mutation	SNP	ENST00000231749.3	37	CCDS2825.1	588	0.2692307692307692	154	0.3130081300813008	87	0.24033149171270718	338	0.5909090909090909	9	0.011873350923482849	G	1.302	-0.604589	0.03717	0.127944	0.003462	ENSG00000068028	ENST00000357043;ENST00000359365	T;T	0.76448	-1.02;-1.01	5.35	4.48	0.54585	.	1.004080	0.08017	N	0.991328	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.12766	T	0.61	-7.5566	7.9536	0.30029	0.0764:0.0:0.6392:0.2844	rs4688725	21;21;21	B4DVA1;Q9NS23-2;Q9NS23	.;.;RASF1_HUMAN	Q	21	ENSP00000349547:K21Q;ENSP00000352323:K21Q	ENSP00000349547:K21Q	K	-	1	0	RASSF1	50353180	0.003000	0.15002	0.029000	0.17559	0.010000	0.07245	0.412000	0.21131	0.652000	0.30806	-0.121000	0.15023	AAG	T|0.731;G|0.269	0.269	strong		0.736	ZMYND10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346376.1	NM_015896	
SYTL5	94122	hgsc.bcm.edu	37	X	37965974	37965974	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chrX:37965974G>T	ENST00000357972.5	+	11	1830	c.1284G>T	c.(1282-1284)aaG>aaT	p.K428N	SYTL5_ENST00000456733.2_Missense_Mutation_p.K450N|TM4SF2_ENST00000465127.1_Intron|SYTL5_ENST00000297875.2_Missense_Mutation_p.K428N			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	428	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						TTTTTGTCAAGAATTGCAGAA	0.428																																					p.K450N		Atlas-SNP	.											.	SYTL5	72	.	0			c.G1350T						PASS	.						138.0	111.0	120.0					X																	37965974		2202	4300	6502	SO:0001583	missense	94122	exon11			TGTCAAGAATTGC		CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.1284G>T	X.37:g.37965974G>T	ENSP00000350657:p.Lys428Asn	Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	194	33	0.170103	NM_001163334	A2RRF2	Missense_Mutation	SNP	ENST00000357972.5	37	CCDS14244.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699815	0.68501	.	.	ENSG00000147041	ENST00000297875;ENST00000357972;ENST00000456733	T;T;T	0.70045	-0.45;-0.45;-0.45	5.71	5.71	0.89125	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.050650	0.85682	D	0.000000	T	0.80502	0.4635	M	0.81497	2.545	0.41478	D	0.988146	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.961	T	0.78453	-0.2198	10	0.21014	T	0.42	-19.1341	13.0607	0.59005	0.0784:0.0:0.9216:0.0	.	450;428	A2RRF2;Q8TDW5	.;SYTL5_HUMAN	N	428;428;450	ENSP00000297875:K428N;ENSP00000350657:K428N;ENSP00000395220:K450N	ENSP00000297875:K428N	K	+	3	2	SYTL5	37850918	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.373000	0.44266	2.394000	0.81467	0.594000	0.82650	AAG	.	.	none		0.428	SYTL5-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080883.1	NM_138780	
