#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NEFH	4744	hgsc.bcm.edu	37	22	29885567	29885568	+	In_Frame_Ins	INS	-	-	AAGTCCCCTGAGAAGGCC	rs147489453|rs559153194|rs75808076|rs59279731		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr22:29885567_29885568insAAGTCCCCTGAGAAGGCC	ENST00000310624.6	+	4	1971_1972	c.1938_1939insAAGTCCCCTGAGAAGGCC	c.(1939-1941)aag>AAGTCCCCTGAGAAGGCCaag	p.647_647K>KSPEKAK		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	653	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAGGAAGCAAAGTCCCCTGA	0.569																																					p.A646delinsAKSPEKA		Atlas-Indel	.											NEFH,rectum,carcinoma,0,1	NEFH	178	1	0			c.1938_1939insAAGTCCCCTGAGAAGGCC						PASS	.			2816,1448		937,942,253						-5.3	0.0		dbSNP_134	77	5046,3206		1537,1972,617	no	coding	NEFH	NM_021076.3		2474,2914,870	A1A1,A1R,RR		38.8512,33.9587,37.1844				7862,4654				SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1939_1956dupAAGTCCCCTGAGAAGGCC	22.37:g.29885567_29885568insAAGTCCCCTGAGAAGGCC	Exception_encountered	Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	18	10	0.555556	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	strong		0.569	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
IFT46	56912	hgsc.bcm.edu	37	11	118427683	118427685	+	In_Frame_Del	DEL	ATC	ATC	-			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	ATC	ATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:118427683_118427685delATC	ENST00000264021.3	-	4	539_541	c.121_123delGAT	c.(121-123)gatdel	p.D41del	IFT46_ENST00000264020.2_In_Frame_Del_p.D92del|IFT46_ENST00000530872.1_In_Frame_Del_p.D92del	NM_001168618.1	NP_001162089.1	Q9NQC8	IFT46_HUMAN	intraflagellar transport 46	41	Asp/Glu-rich (highly acidic).				cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)|protein stabilization (GO:0050821)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)	protein C-terminus binding (GO:0008022)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9						TTTCAGATGAatcatcatcatca	0.478																																					p.92_93del		Atlas-Indel	.											.	IFT46	19	.	0			c.275_277del						PASS	.																																			SO:0001651	inframe_deletion	56912	exon5			.	AL136934	CCDS8399.1, CCDS53718.1	11q23.3	2014-07-18	2014-07-03	2010-04-22	ENSG00000118096	ENSG00000118096		"""Intraflagellar transport homologs"""	26146	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 32"""		"""chromosome 11 open reading frame 60"", ""intraflagellar transport 46 homolog (Chlamydomonas)"""	C11orf60		10873569, 19253336	Standard	NM_020153		Approved	C11orf2, FLJ21827, CFAP32	uc001pto.2	Q9NQC8	OTTHUMG00000166408	ENST00000264021.3:c.121_123delGAT	11.37:g.118427692_118427694delATC	ENSP00000264021:p.Asp41del	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	135	10	0.0740741	NM_020153	A8K0F6|Q9H6V5	In_Frame_Del	DEL	ENST00000264021.3	37	CCDS53718.1																																																																																			.	.	none		0.478	IFT46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389627.1	NM_020153	
KLHL17	339451	hgsc.bcm.edu	37	1	900388	900388	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:900388delG	ENST00000338591.3	+	12	1853	c.1746delG	c.(1744-1746)gtgfs	p.V582fs	PLEKHN1_ENST00000379407.3_5'Flank|PLEKHN1_ENST00000379409.2_5'Flank|PLEKHN1_ENST00000379410.3_5'Flank	NM_198317.2	NP_938073.1	Q6TDP4	KLH17_HUMAN	kelch-like family member 17	582	Interaction with F-actin. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|dendrite cytoplasm (GO:0032839)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein complex scaffold (GO:0032947)			central_nervous_system(1)|kidney(2)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGTACGCCGTGGGGGGTAACG	0.657																																					p.V582fs		Pindel,Atlas-Indel	.											.	KLHL17	31	.	0			c.1745delT						PASS	.						96.0	71.0	80.0					1																	900388		2203	4298	6501	SO:0001589	frameshift_variant	339451	exon12			.	AY423763	CCDS30550.1	1p36	2013-01-30	2013-01-30		ENSG00000187961	ENSG00000187961		"""Kelch-like"", ""BTB/POZ domain containing"""	24023	protein-coding gene	gene with protein product	"""actinfilin"""		"""kelch-like 17 (Drosophila)"""			12063253	Standard	NM_198317		Approved		uc001aca.2	Q6TDP4	OTTHUMG00000040721	ENST00000338591.3:c.1746delG	1.37:g.900388delG	ENSP00000343930:p.Val582fs	Somatic	39	.	.		WXS	Illumina HiSeq	Phase_I	38	13	0.342	NM_198317	Q5SV94	Frame_Shift_Del	DEL	ENST00000338591.3	37	CCDS30550.1																																																																																			.	.	none		0.657	KLHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097875.3	NM_198317	
CSK	1445	hgsc.bcm.edu	37	15	75094222	75094223	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr15:75094222_75094223delGA	ENST00000220003.9	+	11	1803_1804	c.1074_1075delGA	c.(1072-1077)ctgagafs	p.R359fs	CSK_ENST00000439220.2_Frame_Shift_Del_p.R359fs|CSK_ENST00000567571.1_Frame_Shift_Del_p.R359fs|CSK_ENST00000309470.9_Frame_Shift_Del_p.R359fs	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	359	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|lung(2)	3						CTGAGGCCCTGAGAGAGAAGGT	0.644																																					p.358_358del		Pindel,Atlas-Indel	.											.	CSK	43	.	0			c.1073_1074del						PASS	.																																			SO:0001589	frameshift_variant	1445	exon12			.		CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.1074_1075delGA	15.37:g.75094228_75094229delGA	ENSP00000220003:p.Arg359fs	Somatic	65	.	.		WXS	Illumina HiSeq	Phase_I	61	17	0.279	NM_001127190	Q2M3N2|Q6FGZ6	Frame_Shift_Del	DEL	ENST00000220003.9	37	CCDS10269.1																																																																																			.	.	none		0.644	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2	NM_004383	
KRT2	3849	hgsc.bcm.edu	37	12	53045601	53045603	+	In_Frame_Del	DEL	CTG	CTG	-	rs369691469		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:53045601_53045603delCTG	ENST00000309680.3	-	1	345_347	c.324_326delCAG	c.(322-327)ttcagt>ttt	p.S109del		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	109	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		accaccaccactgaagccgctgc	0.635																																					p.109_109del		Atlas-Indel	.											.	KRT2	94	.	0			c.325_327del						PASS	.			45,4193		0,45,2074						-3.5	0.4		dbSNP_126	33	375,7857		0,375,3741	no	coding	KRT2	NM_000423.2		0,420,5815	A1A1,A1R,RR		4.5554,1.0618,3.3681				420,12050				SO:0001651	inframe_deletion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.324_326delCAG	12.37:g.53045601_53045603delCTG	ENSP00000310861:p.Ser109del	Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	89	11	0.123596	NM_000423	Q4VAQ2	In_Frame_Del	DEL	ENST00000309680.3	37	CCDS8835.1																																																																																			.	.	weak		0.635	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
IL4R	3566	hgsc.bcm.edu	37	16	27373787	27373789	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:27373787_27373789delGAG	ENST00000395762.2	+	11	1373_1375	c.1114_1116delGAG	c.(1114-1116)gagdel	p.E376del	IL4R_ENST00000170630.2_In_Frame_Del_p.E376del|IL4R_ENST00000543915.2_In_Frame_Del_p.E376del|IL4R_ENST00000565915.1_3'UTR|IL4R_ENST00000380922.3_In_Frame_Del_p.E361del	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	376	Poly-Glu.				defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						GGTGGAGTGTGAGGAGGAGGAGG	0.591																																					p.371_372del		Atlas-Indel	.											.	IL4R	70	.	0			c.1113_1115del						PASS	.																																			SO:0001651	inframe_deletion	3566	exon11			.	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.1114_1116delGAG	16.37:g.27373796_27373798delGAG	ENSP00000379111:p.Glu376del	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	117	10	0.0854701	NM_000418	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	In_Frame_Del	DEL	ENST00000395762.2	37	CCDS10629.1																																																																																			.	.	none		0.591	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4		
TPP2	7174	hgsc.bcm.edu	37	13	103316014	103316017	+	Frame_Shift_Del	DEL	ATTT	ATTT	-	rs370265663		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	ATTT	ATTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr13:103316014_103316017delATTT	ENST00000376065.4	+	25	3157_3160	c.3121_3124delATTT	c.(3121-3126)atttatfs	p.IY1041fs	TPP2_ENST00000376052.3_Frame_Shift_Del_p.IY1054fs|TPP2_ENST00000466153.1_3'UTR	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	1041					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTCTAGTGACATTTATAACGAATT	0.304																																					p.1040_1041del		Pindel,Atlas-Indel	.											.	TPP2	124	.	0			c.3120_3123del						PASS	.																																			SO:0001589	frameshift_variant	7174	exon25			.	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.3121_3124delATTT	13.37:g.103316014_103316017delATTT	ENSP00000365233:p.Ile1041fs	Somatic	81	.	.		WXS	Illumina HiSeq	Phase_I	63	37	0.587	NM_003291	Q5VZU8	Frame_Shift_Del	DEL	ENST00000376065.4	37	CCDS9502.1																																																																																			.	.	none		0.304	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
TBP	6908	hgsc.bcm.edu	37	6	170871013	170871014	+	In_Frame_Ins	INS	-	-	CAG	rs201732168|rs113202486|rs574714675|rs71010672	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:170871013_170871014insCAG	ENST00000392092.2	+	3	468_469	c.189_190insCAG	c.(190-192)cag>CAGcag	p.64_64Q>QQ	TBP_ENST00000230354.6_In_Frame_Ins_p.64_64Q>QQ|TBP_ENST00000540980.1_In_Frame_Ins_p.44_44Q>QQ	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q63_Q64insQ(1)|p.Q63Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagca	0.55																																					p.Q63delinsQQ		Atlas-Indel	.											TBP,NS,carcinoma,0,5	TBP	58	5	2	Insertion - In frame(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	c.189_190insCAG						PASS	.																																			SO:0001652	inframe_insertion	6908	exon3			.	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.211_213dupCAG	6.37:g.170871020_170871022dupCAG	ENSP00000375942:p.Gln95dup	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	39	23	0.589744	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Ins	INS	ENST00000392092.2	37	CCDS5315.1																																																																																			-|0.138;CAG|0.862	0.862	strong		0.550	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
CHD9	80205	hgsc.bcm.edu	37	16	53256588	53256591	+	Frame_Shift_Del	DEL	AAAG	AAAG	-	rs538376255	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	AAAG	AAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:53256588_53256591delAAAG	ENST00000398510.3	+	3	1904_1907	c.1817_1820delAAAG	c.(1816-1821)aaaagafs	p.KR606fs	CHD9_ENST00000566029.1_Frame_Shift_Del_p.KR606fs|CHD9_ENST00000447540.1_Frame_Shift_Del_p.KR606fs|CHD9_ENST00000564845.1_Frame_Shift_Del_p.KR606fs			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	606	Lys-rich.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AAGAAACAAAAAAGAAAGAATGAG	0.284																																					p.606_607del		Atlas-Indel	.											.	CHD9	203	.	0			c.1816_1819del						PASS	.																																			SO:0001589	frameshift_variant	80205	exon4			.	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.1817_1820delAAAG	16.37:g.53256592_53256595delAAAG	ENSP00000381522:p.Lys606fs	Somatic	366	0	0		WXS	Illumina HiSeq	Phase_I	587	166	0.282794	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Frame_Shift_Del	DEL	ENST00000398510.3	37																																																																																				.	.	none		0.284	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
TRIM13	10206	hgsc.bcm.edu	37	13	50588496	50588497	+	3'UTR	INS	-	-	AC	rs199807501|rs35381218|rs377384125		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr13:50588496_50588497insAC	ENST00000378182.3	+	0	3158_3159				KCNRG_ENST00000312942.1_5'Flank|KCNRG_ENST00000360473.4_5'Flank|TRIM13_ENST00000478111.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		tatatatatatacacacacaca	0.292																																					.		Atlas-Indel	.											.	TRIM13	30	.	0			.						PASS	.																																			SO:0001624	3_prime_UTR_variant	10206	.			.	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*1197->AC	13.37:g.50588505_50588506dupAC		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	53	32	0.603774	.	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	INS	ENST00000378182.3	37	CCDS9423.1																																																																																			.	.	alt		0.292	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
BTG2	7832	hgsc.bcm.edu	37	1	203274815	203274823	+	In_Frame_Del	DEL	GGGCTGCGT	GGGCTGCGT	-	rs55906353		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	GGGCTGCGT	GGGCTGCGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:203274815_203274823delGGGCTGCGT	ENST00000290551.4	+	1	152_160	c.81_89delGGGCTGCGT	c.(79-90)cggggctgcgtg>cgg	p.GCV28del	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	28					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R27R(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			TGAGGACCCGGGGCTGCGTGAGCGAGCAG	0.718																																					p.27_30del		Pindel,Atlas-Indel	.											BTG2,rectum,carcinoma,-1,3	BTG2	16	3	1	Substitution - coding silent(1)	skin(1)	c.80_88del						PASS	.																																			SO:0001651	inframe_deletion	7832	exon1			.		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.81_89delGGGCTGCGT	1.37:g.203274815_203274823delGGGCTGCGT	ENSP00000290551:p.Gly28_Val30del	Somatic	63	.	.		WXS	Illumina HiSeq	Phase_I	114	25	0.219	NM_006763	A0A024R986|Q3KR25|Q5VUT0	In_Frame_Del	DEL	ENST00000290551.4	37	CCDS1437.1																																																																																			.	.	none		0.718	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
DENND3	22898	hgsc.bcm.edu	37	8	142202753	142202754	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr8:142202753_142202754insAA	ENST00000262585.2	+	22	3665_3666	c.3387_3388insAA	c.(3388-3390)aagfs	p.K1130fs	DENND3_ENST00000424248.1_Frame_Shift_Ins_p.K1078fs|DENND3_ENST00000523308.1_Frame_Shift_Ins_p.K180fs|DENND3_ENST00000519811.1_Frame_Shift_Ins_p.K1210fs	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	1130					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			TGATCCGGGTGAAGAAGCAGGT	0.673																																					p.V1129fs		Pindel,Atlas-Indel	.											.	DENND3	127	.	0			c.3387_3388insAA						PASS	.																																			SO:0001589	frameshift_variant	22898	exon22			.	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.3388_3389dupAA	8.37:g.142202754_142202755dupAA	ENSP00000262585:p.Lys1130fs	Somatic	64	.	.		WXS	Illumina HiSeq	Phase_I	74	17	0.230	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Frame_Shift_Ins	INS	ENST00000262585.2	37	CCDS34947.1																																																																																			.	.	none		0.673	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
CSNK1E	1454	hgsc.bcm.edu	37	22	38690161	38690163	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr22:38690161_38690163delGAG	ENST00000396832.1	-	9	1430_1432	c.1170_1172delCTC	c.(1168-1173)tcctca>tca	p.390_391SS>S	CSNK1E_ENST00000403904.1_In_Frame_Del_p.390_391SS>S|CSNK1E_ENST00000359867.3_In_Frame_Del_p.390_391SS>S|CSNK1E_ENST00000400206.2_In_Frame_Del_p.390_391SS>S|CSNK1E_ENST00000498529.1_5'Flank	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	390					cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					AGTGAGGTCTGAGGAGGAGACGT	0.645																																					p.391_391del	Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	Pindel,Atlas-Indel	.											.	CSNK1E	143	.	0			c.1171_1173del						PASS	.																																			SO:0001651	inframe_deletion	1454	exon9			.		CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.1170_1172delCTC	22.37:g.38690167_38690169delGAG	ENSP00000380044:p.Ser391del	Somatic	31	.	.		WXS	Illumina HiSeq	Phase_I	42	13	0.310	NM_001894		In_Frame_Del	DEL	ENST00000396832.1	37	CCDS13970.1																																																																																			.	.	none		0.645	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	NM_001894	
ATRX	546	hgsc.bcm.edu	37	X	76845412	76845413	+	Splice_Site	INS	-	-	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chrX:76845412_76845413insA	ENST00000373344.5	-	27	6325		c.e27-2		ATRX_ENST00000480283.1_Splice_Site|ATRX_ENST00000395603.3_Splice_Site	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AAAACAAGGCTAAAAAAACAGA	0.332			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														.		Atlas-Indel	.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833	.	1	Unknown(1)	bone(1)	c.6111-2->T						PASS	.																																			SO:0001630	splice_region_variant	546	exon28			.	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6111-2->T	X.37:g.76845419_76845419dupA		Somatic	274	0	0		WXS	Illumina HiSeq	Phase_I	386	66	0.170984	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Splice_Site	INS	ENST00000373344.5	37	CCDS14434.1																																																																																			.	.	none		0.332	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	Intron
CTRC	11330	hgsc.bcm.edu	37	1	15769988	15769990	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:15769988_15769990delAGA	ENST00000375949.4	+	5	457_459	c.431_433delAGA	c.(430-435)gagaag>gag	p.K145del	CTRC_ENST00000483406.1_3'UTR|CTRC_ENST00000375943.2_3'UTR	NM_007272.2	NP_009203.2	Q99895	CTRC_HUMAN	chymotrypsin C (caldecrin)	145	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	13		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGCCTGCCAGAGAAGGACTCCCT	0.576																																					p.144_144del		Pindel,Atlas-Indel	.											.	CTRC	28	.	0			c.430_432del						PASS	.																																			SO:0001651	inframe_deletion	11330	exon5			.	BC015118	CCDS156.1	1p36.21	2009-02-18			ENSG00000162438	ENSG00000162438	3.4.21.2		2523	protein-coding gene	gene with protein product	"""elastase 4"""	601405				8635596	Standard	NM_007272		Approved	CLCR, ELA4	uc001awi.1	Q99895	OTTHUMG00000002255	ENST00000375949.4:c.431_433delAGA	1.37:g.15769988_15769990delAGA	ENSP00000365116:p.Lys145del	Somatic	56	.	.		WXS	Illumina HiSeq	Phase_I	56	19	0.339	NM_007272	A8K082|O00765|Q9NUH5	In_Frame_Del	DEL	ENST00000375949.4	37	CCDS156.1																																																																																			.	.	none		0.576	CTRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006435.1	NM_007272	
TAS2R14	50840	hgsc.bcm.edu	37	12	11091177	11091191	+	In_Frame_Del	DEL	CTTGCGATGTTTCCA	CTTGCGATGTTTCCA	-	rs137967465|rs145427921	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	CTTGCGATGTTTCCA	CTTGCGATGTTTCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:11091177_11091191delCTTGCGATGTTTCCA	ENST00000537503.1	-	1	671_685	c.616_630delTGGAAACATCGCAAG	c.(616-630)tggaaacatcgcaagdel	p.WKHRK206del	TAS2R14_ENST00000381852.4_Splice_Site|PRR4_ENST00000536668.1_Intron	NM_023922.1	NP_076411.1	Q9NYV8	T2R14_HUMAN	taste receptor, type 2, member 14	206					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						GCTGCATCTTCTTGCGATGTTTCCACATGGAGAAG	0.423																																					p.206_211del		Pindel	.											.	TAS2R14	26	.	0			c.617_631del						PASS	.																																			SO:0001651	inframe_deletion	50840	exon1			.	AF227138	CCDS8637.1	12p13	2012-08-22			ENSG00000212127	ENSG00000212127		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14920	protein-coding gene	gene with protein product		604790				10761934, 10766242	Standard	NM_023922		Approved	T2R14, TRB1	uc010shi.2	Q9NYV8	OTTHUMG00000162720	ENST00000537503.1:c.616_630delTGGAAACATCGCAAG	12.37:g.11091177_11091191delCTTGCGATGTTTCCA	ENSP00000441949:p.Trp206_Lys210del	Somatic	89	.	.		WXS	Illumina HiSeq	Phase_I	139	45	0.324	NM_023922	Q645X3	In_Frame_Del	DEL	ENST00000537503.1	37	CCDS8637.1																																																																																			.	.	none		0.423	TAS2R14-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370194.4	NM_023922	
OR6C76	390326	hgsc.bcm.edu	37	12	55820959	55820959	+	Frame_Shift_Del	DEL	A	A	-	rs397719965|rs57387180		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:55820959delA	ENST00000328314.3	+	1	922	c.922delA	c.(922-924)aaafs	p.K311fs		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GATTTCCCACAAAAAAAAAAA	0.338																																					p.H307fs		Pindel	.											OR6C76,NS,malignant_melanoma,0,1	OR6C76	98	1	0			c.921delC						PASS	.						19.0	20.0	19.0					12																	55820959		2110	4120	6230	SO:0001589	frameshift_variant	390326	exon1			.		CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.922delA	12.37:g.55820959delA	ENSP00000328402:p.Lys311fs	Somatic	44	.	.		WXS	Illumina HiSeq	Phase_I	76	19	0.250	NM_001005183		Frame_Shift_Del	DEL	ENST00000328314.3	37	CCDS31823.1																																																																																			-|1.000	.	weak		0.338	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406675.1	NM_001005183	
KRT3	3850	hgsc.bcm.edu	37	12	53189414	53189431	+	In_Frame_Del	DEL	CCAAAGCCACCAGCCCCT	CCAAAGCCACCAGCCCCT	-	rs148531142|rs184322044|rs142692092		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	CCAAAGCCACCAGCCCCT	CCAAAGCCACCAGCCCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:53189414_53189431delCCAAAGCCACCAGCCCCT	ENST00000417996.2	-	1	470_487	c.396_413delAGGGGCTGGTGGCTTTGG	c.(394-414)ggaggggctggtggctttggt>ggt	p.132_138GGAGGFG>G	KRT3_ENST00000309505.3_In_Frame_Del_p.132_138GGAGGFG>G	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	132	Gly-rich.|Head.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						accaggaccaccaaagccaccagcccctccaaagccac	0.633																																					p.133_138del		Pindel	.											.	KRT3	65	.	0			c.397_414del						PASS	.			595,3499		80,435,1532						-0.9	0.2			185	257,7693		40,177,3758	no	coding	KRT3	NM_057088.2		120,612,5290	A1A1,A1R,RR		3.2327,14.5335,7.0741				852,11192				SO:0001651	inframe_deletion	3850	exon1			.		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.396_413delAGGGGCTGGTGGCTTTGG	12.37:g.53189414_53189431delCCAAAGCCACCAGCCCCT	ENSP00000413479:p.Gly132_Phe137del	Somatic	38	.	.		WXS	Illumina HiSeq	Phase_I	62	10	0.161	NM_057088	A6NIS2|Q701L8	In_Frame_Del	DEL	ENST00000417996.2	37	CCDS44895.1																																																																																			.	.	none		0.633	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
CD14	929	hgsc.bcm.edu	37	5	140011945	140011945	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:140011945G>A	ENST00000302014.6	-	2	1253	c.624C>T	c.(622-624)ggC>ggT	p.G208G	CD14_ENST00000401743.2_Silent_p.G208G	NM_000591.3	NP_000582.1	P08571	CD14_HUMAN	CD14 molecule	208					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|phagocytosis (GO:0006909)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endocytosis (GO:0045807)|positive regulation of tumor necrosis factor production (GO:0032760)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to magnesium ion (GO:0032026)|response to tumor necrosis factor (GO:0034612)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|opsonin receptor activity (GO:0001847)|peptidoglycan receptor activity (GO:0016019)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCCGCGTTCGCCCAGTCCAG	0.617																																					p.G208G		Atlas-SNP	.											.	CD14	20	.	0			c.C624T						PASS	.						56.0	61.0	59.0					5																	140011945		2203	4300	6503	SO:0001819	synonymous_variant	929	exon3			GCGTTCGCCCAGT		CCDS4232.1	5q31.3	2012-09-20	2006-03-28		ENSG00000170458	ENSG00000170458		"""CD molecules"""	1628	protein-coding gene	gene with protein product		158120	"""CD14 antigen"""			2472171, 2462937	Standard	NM_000591		Approved		uc003lgi.2	P08571	OTTHUMG00000129507	ENST00000302014.6:c.624C>T	5.37:g.140011945G>A		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	57	29	0.508772	NM_001174105	Q53XT5|Q96FR6|Q96L99|Q9UNS3	Silent	SNP	ENST00000302014.6	37	CCDS4232.1																																																																																			.	.	none		0.617	CD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251681.2	NM_000591	
ARHGEF2	9181	hgsc.bcm.edu	37	1	155917765	155917765	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:155917765G>A	ENST00000361247.4	-	22	3028	c.2929C>T	c.(2929-2931)Cgc>Tgc	p.R977C	ARHGEF2_ENST00000368316.1_Missense_Mutation_p.R949C|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.R1022C|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.R949C|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.R978C|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.R976C|ARHGEF2_ENST00000477754.2_Intron	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	977					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCCCCGTCGCGGCTCTCCGTC	0.612																																					p.R977C	Melanoma(178;35 2768 6610 28839)	Atlas-SNP	.											.	ARHGEF2	81	.	0			c.C2929T						PASS	.						12.0	10.0	11.0					1																	155917765		1898	3573	5471	SO:0001583	missense	9181	exon22			CGTCGCGGCTCTC	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.2929C>T	1.37:g.155917765G>A	ENSP00000354837:p.Arg977Cys	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	102	43	0.421569	NM_001162383	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	37	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916847	0.73098	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.70516	-0.49;-0.37;-0.38;-0.49;-0.49	5.22	5.22	0.72569	.	0.000000	0.45867	D	0.000323	T	0.65015	0.2651	N	0.19112	0.55	0.44771	D	0.997772	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;P;D;D	0.69654	0.948;0.893;0.95;0.965	T	0.71457	-0.4587	10	0.87932	D	0	-18.6811	11.2356	0.48938	0.0:0.0:0.8176:0.1824	.	1021;977;976;978	D3DVA5;Q92974;Q92974-2;Q5VY93	.;ARHG2_HUMAN;.;.	C	949;977;978;949;976	ENSP00000315325:R949C;ENSP00000354837:R977C;ENSP00000357298:R978C;ENSP00000357299:R949C;ENSP00000314787:R976C	ENSP00000314787:R976C	R	-	1	0	ARHGEF2	154184389	1.000000	0.71417	0.986000	0.45419	0.987000	0.75469	2.542000	0.45744	2.713000	0.92767	0.655000	0.94253	CGC	.	.	none		0.612	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
MAP7D3	79649	hgsc.bcm.edu	37	X	135301796	135301796	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chrX:135301796T>C	ENST00000316077.9	-	17	2741	c.2521A>G	c.(2521-2523)Aaa>Gaa	p.K841E	MAP7D3_ENST00000370663.5_Missense_Mutation_p.K823E|MAP7D3_ENST00000370661.1_Missense_Mutation_p.K806E|MAP7D3_ENST00000495432.1_5'Flank	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	841					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TTTCTGGTTTTCGTTGTGTGA	0.433																																					p.K841E		Atlas-SNP	.											.	MAP7D3	102	.	0			c.A2521G						PASS	.						241.0	220.0	227.0					X																	135301796		1964	4134	6098	SO:0001583	missense	79649	exon17			TGGTTTTCGTTGT	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.2521A>G	X.37:g.135301796T>C	ENSP00000318086:p.Lys841Glu	Somatic	460	0	0		WXS	Illumina HiSeq	Phase_I	636	191	0.300314	NM_024597	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	T	16.25	3.071604	0.55646	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.23147	1.92;3.75;3.75;1.95	4.0	4.0	0.46444	.	.	.	.	.	T	0.33294	0.0858	L	0.27053	0.805	0.09310	N	1	D;D;D;D	0.64830	0.989;0.994;0.989;0.994	P;D;P;D	0.65773	0.868;0.938;0.868;0.938	T	0.07065	-1.0792	9	0.72032	D	0.01	-19.2007	8.4163	0.32672	0.0:0.0:0.0:1.0	.	823;800;841;806	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	E	806;841;823;800	ENSP00000359695:K806E;ENSP00000318086:K841E;ENSP00000359697:K823E;ENSP00000359694:K800E	ENSP00000318086:K841E	K	-	1	0	MAP7D3	135129462	0.045000	0.20229	0.003000	0.11579	0.012000	0.07955	1.746000	0.38288	1.805000	0.52779	0.430000	0.28490	AAA	.	.	none		0.433	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
PGBD1	84547	hgsc.bcm.edu	37	6	28253469	28253469	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:28253469C>T	ENST00000405948.2	+	3	958	c.538C>T	c.(538-540)Ccc>Tcc	p.P180S	PGBD1_ENST00000259883.3_Missense_Mutation_p.P180S	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	180						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						TCAAGGGAACCCCCAAGAAGT	0.537																																					p.P180S		Atlas-SNP	.											.	PGBD1	106	.	0			c.C538T						PASS	.						83.0	79.0	80.0					6																	28253469		2203	4300	6503	SO:0001583	missense	84547	exon3			GGGAACCCCCAAG	D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.538C>T	6.37:g.28253469C>T	ENSP00000385213:p.Pro180Ser	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	57	48	0.842105	NM_001184743	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.229706	0.00280	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.01446	4.88;4.88	2.37	-1.27	0.09347	.	.	.	.	.	T	0.00384	0.0012	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.41197	-0.9522	9	0.16896	T	0.51	.	3.7067	0.08404	0.0:0.4512:0.2324:0.3164	.	180	Q96JS3	PGBD1_HUMAN	S	180	ENSP00000385213:P180S;ENSP00000259883:P180S	ENSP00000259883:P180S	P	+	1	0	PGBD1	28361448	0.000000	0.05858	0.000000	0.03702	0.109000	0.19521	-0.800000	0.04555	-0.341000	0.08376	0.557000	0.71058	CCC	.	.	none		0.537	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2		
FTMT	94033	hgsc.bcm.edu	37	5	121188183	121188183	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:121188183G>A	ENST00000321339.1	+	1	534	c.525G>A	c.(523-525)ctG>ctA	p.L175L		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	175	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		AGTCGTTGCTGGAATTGCACG	0.502																																					p.L175L		Atlas-SNP	.											.	FTMT	71	.	0			c.G525A						PASS	.						133.0	123.0	126.0					5																	121188183		2203	4300	6503	SO:0001819	synonymous_variant	94033	exon1			GTTGCTGGAATTG	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.525G>A	5.37:g.121188183G>A		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	67	39	0.58209	NM_177478		Silent	SNP	ENST00000321339.1	37	CCDS4128.1																																																																																			.	.	none		0.502	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
FRG2B	441581	hgsc.bcm.edu	37	10	135438933	135438933	+	Silent	SNP	C	C	T	rs200793608		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr10:135438933C>T	ENST00000425520.1	-	4	559	c.507G>A	c.(505-507)ccG>ccA	p.P169P	FRG2B_ENST00000443774.1_Silent_p.P170P	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	169						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTCGAATTGACGGTGTTTGGA	0.552																																					p.P169P		Atlas-SNP	.											FRG2B,colon,carcinoma,-1,1	FRG2B	47	1	0			c.G507A						scavenged	.						126.0	151.0	143.0					10																	135438933		2193	4291	6484	SO:0001819	synonymous_variant	441581	exon4			AATTGACGGTGTT	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.507G>A	10.37:g.135438933C>T		Somatic	347	4	0.0115274		WXS	Illumina HiSeq	Phase_I	288	11	0.0381944	NM_001080998	Q5VSQ1	Silent	SNP	ENST00000425520.1	37	CCDS44502.1																																																																																			C|0.996;T|0.004	0.004	weak		0.552	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
CFAP57	149465	hgsc.bcm.edu	37	1	43688658	43688658	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:43688658T>C	ENST00000372492.4	+	16	3020	c.2696T>C	c.(2695-2697)aTg>aCg	p.M899T		NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		899										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ACAGGCATCATGAGGAAGAAG	0.527																																					p.M899T		Atlas-SNP	.											.	WDR65	76	.	0			c.T2696C						PASS	.																																			SO:0001583	missense	149465	exon16			GCATCATGAGGAA																												ENST00000372492.4:c.2696T>C	1.37:g.43688658T>C	ENSP00000361570:p.Met899Thr	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	65	24	0.369231	NM_001195831	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	ENST00000372492.4	37		.	.	.	.	.	.	.	.	.	.	T	13.14	2.147374	0.37923	.	.	ENSG00000243710	ENST00000372492	T	0.76448	-1.02	4.49	4.49	0.54785	.	.	.	.	.	T	0.81375	0.4809	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.80881	-0.1184	6	0.41790	T	0.15	.	12.0326	0.53406	0.0:0.0:0.0:1.0	.	.	.	.	T	899	ENSP00000361570:M899T	ENSP00000361570:M899T	M	+	2	0	WDR65	43461245	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.028000	0.64115	1.670000	0.50864	0.377000	0.23210	ATG	.	.	none		0.527	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
ZBTB20	26137	hgsc.bcm.edu	37	3	114070301	114070301	+	Silent	SNP	G	G	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:114070301G>C	ENST00000474710.1	-	4	802	c.624C>G	c.(622-624)ggC>ggG	p.G208G	ZBTB20_ENST00000464560.1_Silent_p.G135G|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20_ENST00000462705.1_Silent_p.G135G|ZBTB20_ENST00000481632.1_Silent_p.G135G|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000357258.3_Silent_p.G135G|ZBTB20_ENST00000393785.2_Silent_p.G135G|ZBTB20_ENST00000471418.1_Silent_p.G135G	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	208						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GCGTGTCCTGGCCCGAGTCCT	0.657																																					p.G208G	NSCLC(69;748 1344 9802 11203 30933)	Atlas-SNP	.											.	ZBTB20	157	.	0			c.C624G						PASS	.						68.0	61.0	63.0					3																	114070301		2203	4300	6503	SO:0001819	synonymous_variant	26137	exon4			GTCCTGGCCCGAG	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.624C>G	3.37:g.114070301G>C		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	33	12	0.363636	NM_001164342	Q63HP6|Q8N6R5|Q9Y410	Silent	SNP	ENST00000474710.1	37	CCDS54626.1																																																																																			.	.	none		0.657	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642	
GAS8	2622	hgsc.bcm.edu	37	16	90095558	90095558	+	Intron	SNP	C	C	T	rs76646627		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:90095558C>T	ENST00000268699.4	+	2	212				C16orf3_ENST00000408886.2_Missense_Mutation_p.G65S|GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)		p.G65S(1)		endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		acggggcagcctacggggcag	0.672																																					p.G65S		Atlas-SNP	.											C16orf3,NS,carcinoma,0,2	C16orf3	14	2	1	Substitution - Missense(1)	lung(1)	c.G193A						scavenged	.						25.0	20.0	21.0					16																	90095558		2191	4298	6489	SO:0001627	intron_variant	750	exon1			GGCAGCCTACGGG	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1428C>T	16.37:g.90095558C>T		Somatic	162	9	0.0555556		WXS	Illumina HiSeq	Phase_I	193	15	0.0777202	NM_001214	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	C	9.046	0.990885	0.18966	.	.	ENSG00000221819	ENST00000408886	T	0.57595	0.39	1.2	-1.14	0.09741	.	.	.	.	.	T	0.23492	0.0568	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.14578	0.011	T	0.14755	-1.0461	8	.	.	.	.	2.4936	0.04616	0.0:0.4385:0.3231:0.2384	.	73	O95177	CP003_HUMAN	S	65	ENSP00000386218:G65S	.	G	-	1	0	C16orf3	88623059	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.145000	0.10265	-0.326000	0.08564	0.407000	0.27541	GGC	C|0.500;T|0.500	0.500	weak		0.672	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
RNF123	63891	hgsc.bcm.edu	37	3	49751413	49751413	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:49751413C>T	ENST00000327697.6	+	30	3052	c.2908C>T	c.(2908-2910)Ctg>Ttg	p.L970L	RNF123_ENST00000433785.1_Silent_p.L82L	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	970					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CAACTGGATCCTGGTGCGGCT	0.662																																					p.L970L		Atlas-SNP	.											.	RNF123	100	.	0			c.C2908T						PASS	.						57.0	62.0	60.0					3																	49751413		2203	4300	6503	SO:0001819	synonymous_variant	63891	exon30			TGGATCCTGGTGC	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.2908C>T	3.37:g.49751413C>T		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	28	13	0.464286	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Silent	SNP	ENST00000327697.6	37	CCDS33758.1																																																																																			.	.	none		0.662	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
TMEM259	91304	hgsc.bcm.edu	37	19	1014261	1014261	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:1014261C>T	ENST00000356663.3	-	2	558	c.437G>A	c.(436-438)aGc>aAc	p.S146N	TMEM259_ENST00000333175.5_Missense_Mutation_p.S146N	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259	146						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											GTCCAGGTTGCTGCCTGGTTC	0.637																																					p.S146N		Atlas-SNP	.											C19orf6,NS,carcinoma,+1,1	.	.	1	0			c.G437A						scavenged	.						66.0	61.0	63.0					19																	1014261		2202	4300	6502	SO:0001583	missense	91304	exon2			AGGTTGCTGCCTG	BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3		ENST00000356663.3:c.437G>A	19.37:g.1014261C>T	ENSP00000349087:p.Ser146Asn	Somatic	142	1	0.00704225		WXS	Illumina HiSeq	Phase_I	79	10	0.126582	NM_033420	O60392|Q8NF79|Q96H30	Missense_Mutation	SNP	ENST00000356663.3	37	CCDS32862.1	.	.	.	.	.	.	.	.	.	.	C	6.114	0.389285	0.11581	.	.	ENSG00000182087	ENST00000356663;ENST00000333175	.	.	.	4.06	1.86	0.25419	.	0.774128	0.11482	N	0.559656	T	0.28732	0.0712	L	0.38175	1.15	0.09310	N	1	B;B	0.25105	0.118;0.002	B;B	0.26517	0.07;0.001	T	0.19943	-1.0290	9	0.29301	T	0.29	-5.843	4.2325	0.10610	0.0:0.5855:0.1928:0.2218	.	146;146	Q4ZIN3-2;Q4ZIN3	.;MBRL_HUMAN	N	146	.	ENSP00000331423:S146N	S	-	2	0	C19orf6	965261	0.002000	0.14202	0.006000	0.13384	0.060000	0.15804	0.209000	0.17435	0.930000	0.37217	0.462000	0.41574	AGC	.	.	none		0.637	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458236.1	NM_033420	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36628191	36628191	+	Missense_Mutation	SNP	G	G	A	rs199655106	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:36628191G>A	ENST00000431231.2	+	11	2130	c.2062G>A	c.(2062-2064)Gat>Aat	p.D688N	ARHGAP23_ENST00000437668.3_Missense_Mutation_p.D688N|ARHGAP23_ENST00000443378.1_Missense_Mutation_p.D594N	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	688	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GACCTTCAGCGATATCAGGAG	0.522													G|||	55	0.0109824	0.0159	0.0072	5008	,	,		22272	0.0069		0.006	False		,,,				2504	0.0164				p.D688N		Atlas-SNP	.											ARHGAP23,NS,carcinoma,0,1	ARHGAP23	48	1	0			c.G2062A						scavenged	.						74.0	62.0	65.0					17																	36628191		692	1591	2283	SO:0001583	missense	57636	exon11			TTCAGCGATATCA	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.2062G>A	17.37:g.36628191G>A	ENSP00000393539:p.Asp688Asn	Somatic	48	1	0.0208333		WXS	Illumina HiSeq	Phase_I	89	10	0.11236	NM_001199417		Missense_Mutation	SNP	ENST00000431231.2	37	CCDS56027.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620931	0.66787	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000443378	T;T;T	0.18338	2.22;2.59;2.56	4.55	4.55	0.56014	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.195267	0.40908	D	0.000982	T	0.43986	0.1272	M	0.78223	2.4	0.41923	D	0.990523	P;D	0.89917	0.898;1.0	B;D	0.87578	0.355;0.998	T	0.47315	-0.9127	10	0.62326	D	0.03	.	16.2347	0.82365	0.0:0.0:1.0:0.0	.	688;688	Q9P227;Q9P227-2	RHG23_HUMAN;.	N	688;688;594	ENSP00000394153:D688N;ENSP00000393539:D688N;ENSP00000407333:D594N	ENSP00000393539:D688N	D	+	1	0	ARHGAP23	33881717	1.000000	0.71417	0.994000	0.49952	0.760000	0.43138	5.784000	0.68990	2.366000	0.80165	0.561000	0.74099	GAT	G|0.986;A|0.014	0.014	strong		0.522	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
PLXNB2	23654	hgsc.bcm.edu	37	22	50727961	50727961	+	Silent	SNP	G	G	A	rs541323204	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr22:50727961G>A	ENST00000449103.1	-	3	1193	c.1053C>T	c.(1051-1053)tgC>tgT	p.C351C	PLXNB2_ENST00000359337.4_Silent_p.C351C			O15031	PLXB2_HUMAN	plexin B2	351	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGTGGCCGCCGCACTGGATAT	0.662													G|||	4	0.000798722	0.0	0.0	5008	,	,		15347	0.004		0.0	False		,,,				2504	0.0				p.C351C		Atlas-SNP	.											.	PLXNB2	172	.	0			c.C1053T						PASS	.						24.0	29.0	28.0					22																	50727961		1987	4152	6139	SO:0001819	synonymous_variant	23654	exon3			GCCGCCGCACTGG		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.1053C>T	22.37:g.50727961G>A		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	21	13	0.619048	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	ENST00000449103.1	37	CCDS43035.1																																																																																			.	.	none		0.662	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
CSPG4	1464	hgsc.bcm.edu	37	15	75980082	75980082	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr15:75980082G>A	ENST00000308508.5	-	3	3416	c.3324C>T	c.(3322-3324)tcC>tcT	p.S1108S		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1108	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GTTGCCCGTCGGACACCTGCA	0.662																																					p.S1108S		Atlas-SNP	.											.	CSPG4	175	.	0			c.C3324T						PASS	.						54.0	53.0	54.0					15																	75980082		2196	4290	6486	SO:0001819	synonymous_variant	1464	exon3			CCCGTCGGACACC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.3324C>T	15.37:g.75980082G>A		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	48	21	0.4375	NM_001897	D3DW77|Q92675	Silent	SNP	ENST00000308508.5	37	CCDS10284.1																																																																																			.	.	none		0.662	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
SPTBN4	57731	hgsc.bcm.edu	37	19	41073666	41073666	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:41073666C>T	ENST00000352632.3	+	31	6520	c.6434C>T	c.(6433-6435)gCg>gTg	p.A2145V	SPTBN4_ENST00000392025.1_Missense_Mutation_p.A888V|SPTBN4_ENST00000598249.1_Missense_Mutation_p.A2145V			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2145					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCCAAGGCGGCGCCCCTGCTG	0.677																																					p.A2145V		Atlas-SNP	.											.	SPTBN4	213	.	0			c.C6434T						PASS	.						5.0	5.0	5.0					19																	41073666		2073	4105	6178	SO:0001583	missense	57731	exon31			AGGCGGCGCCCCT	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.6434C>T	19.37:g.41073666C>T	ENSP00000263373:p.Ala2145Val	Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	35	13	0.371429	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.481397	0.84747	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.77750	-1.12;0.11	4.91	4.91	0.64330	.	0.161948	0.28671	U	0.014532	T	0.66287	0.2774	N	0.08118	0	0.80722	D	1	D;D	0.61080	0.989;0.989	P;P	0.47626	0.552;0.552	T	0.69573	-0.5109	10	0.32370	T	0.25	.	16.874	0.86046	0.0:1.0:0.0:0.0	.	888;2145	C9JY79;Q9H254	.;SPTN4_HUMAN	V	2145;2145;888	ENSP00000263373:A2145V;ENSP00000375879:A888V	ENSP00000263373:A2145V	A	+	2	0	SPTBN4	45765506	0.281000	0.24258	0.995000	0.50966	0.952000	0.60782	2.449000	0.44935	2.252000	0.74401	0.561000	0.74099	GCG	.	.	none		0.677	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
PSEN1	5663	hgsc.bcm.edu	37	14	73640277	73640277	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr14:73640277C>T	ENST00000324501.5	+	5	614	c.342C>T	c.(340-342)atC>atT	p.I114I	PSEN1_ENST00000261970.3_Silent_p.I114I|PSEN1_ENST00000406768.1_Silent_p.I22I|PSEN1_ENST00000394164.1_Silent_p.I110I|PSEN1_ENST00000344094.3_Silent_p.I114I|PSEN1_ENST00000357710.4_Silent_p.I110I|PSEN1_ENST00000394157.3_Silent_p.I114I|PSEN1_ENST00000557511.1_Silent_p.I114I	NM_000021.3|NM_007318.2	NP_000012.1|NP_015557.2	P49768	PSN1_HUMAN	presenilin 1	114					activation of MAPKK activity (GO:0000186)|amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|autophagic vacuole assembly (GO:0000045)|beta-amyloid formation (GO:0034205)|beta-amyloid metabolic process (GO:0050435)|blood vessel development (GO:0001568)|brain morphogenesis (GO:0048854)|Cajal-Retzius cell differentiation (GO:0021870)|calcium ion transmembrane transport (GO:0070588)|canonical Wnt signaling pathway (GO:0060070)|cell fate specification (GO:0001708)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex cell migration (GO:0021795)|choline transport (GO:0015871)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|L-glutamate transport (GO:0015813)|membrane protein ectodomain proteolysis (GO:0006509)|memory (GO:0007613)|mitochondrial transport (GO:0006839)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of axonogenesis (GO:0050771)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of receptor recycling (GO:0001921)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of phosphorylation (GO:0042325)|regulation of protein binding (GO:0043393)|regulation of resting membrane potential (GO:0060075)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)|skeletal system morphogenesis (GO:0048705)|skin morphogenesis (GO:0043589)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|somitogenesis (GO:0001756)|synaptic vesicle targeting (GO:0016080)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary rootlet (GO:0035253)|cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|calcium channel activity (GO:0005262)|endopeptidase activity (GO:0004175)|PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		ATTGTAGAATCTATACCCCAT	0.413																																					p.I114I		Atlas-SNP	.											.	PSEN1	38	.	0			c.C342T						PASS	.						137.0	133.0	134.0					14																	73640277		2203	4300	6503	SO:0001819	synonymous_variant	5663	exon5			TAGAATCTATACC	AJ008005	CCDS9812.1, CCDS9813.1	14q24.3	2014-09-17	2008-07-28		ENSG00000080815	ENSG00000080815			9508	protein-coding gene	gene with protein product		104311	"""Alzheimer disease 3"""	AD3		1411576	Standard	NM_007318		Approved	FAD, S182, PS1	uc001xnr.3	P49768	OTTHUMG00000141279	ENST00000324501.5:c.342C>T	14.37:g.73640277C>T		Somatic	181	0	0		WXS	Illumina HiSeq	Phase_I	198	73	0.368687	NM_000021	B2R6D3|O95465|Q14762|Q15719|Q15720|Q96P33|Q9UIF0	Silent	SNP	ENST00000324501.5	37	CCDS9812.1																																																																																			.	.	none		0.413	PSEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280500.2		
GP2	2813	hgsc.bcm.edu	37	16	20322559	20322559	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:20322559C>G	ENST00000381362.4	-	12	1676	c.1600G>C	c.(1600-1602)Gct>Cct	p.A534P	GP2_ENST00000381360.5_Missense_Mutation_p.A387P|GP2_ENST00000341642.5_Missense_Mutation_p.A384P|GP2_ENST00000302555.5_Missense_Mutation_p.A531P	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	534					antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						AACAGCCAAGCCAGGAGGACA	0.522																																					p.A534P		Atlas-SNP	.											GP2,colon,carcinoma,+1,1	GP2	122	1	0			c.G1600C						PASS	.						130.0	125.0	127.0					16																	20322559		2203	4300	6503	SO:0001583	missense	2813	exon12			GCCAAGCCAGGAG	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.1600G>C	16.37:g.20322559C>G	ENSP00000370767:p.Ala534Pro	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	126	69	0.547619	NM_001007240	A6NFM9|A6NJA8|Q13338|Q9UIF1	Missense_Mutation	SNP	ENST00000381362.4	37	CCDS42128.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071751	0.55646	.	.	ENSG00000169347	ENST00000302555;ENST00000381362;ENST00000381360;ENST00000341642;ENST00000537520	D;D;D;D	0.91577	-2.87;-2.87;-1.65;-1.65	5.1	4.13	0.48395	.	.	.	.	.	D	0.92731	0.7689	L	0.59436	1.845	0.38652	D	0.951875	D;D;D;D	0.76494	0.996;0.999;0.999;0.998	D;D;D;P	0.66196	0.931;0.942;0.931;0.852	D	0.93047	0.6462	9	0.72032	D	0.01	-3.3065	10.0547	0.42237	0.0:0.9013:0.0:0.0987	.	384;512;531;534	P55259-4;B7Z1G2;P55259-3;P55259	.;.;.;GP2_HUMAN	P	531;534;387;384;512	ENSP00000304044:A531P;ENSP00000370767:A534P;ENSP00000370765:A387P;ENSP00000343861:A384P	ENSP00000304044:A531P	A	-	1	0	GP2	20230060	0.404000	0.25328	1.000000	0.80357	0.423000	0.31445	0.381000	0.20619	2.506000	0.84524	0.650000	0.86243	GCT	.	.	none		0.522	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295	
ZNF688	146542	hgsc.bcm.edu	37	16	30583567	30583567	+	5'UTR	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:30583567C>A	ENST00000223459.6	-	0	488				ZNF688_ENST00000395219.1_Silent_p.L10L|ZNF688_ENST00000567855.1_5'Flank|AC002310.7_ENST00000492040.1_RNA|ZNF688_ENST00000563707.1_5'Flank|AC002310.7_ENST00000486926.1_RNA	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CCTCTGTTGACAGACTGGAGC	0.637																																					p.L10L		Atlas-SNP	.											.	ZNF688	37	.	0			c.G30T						PASS	.						34.0	39.0	37.0					16																	30583567		1926	4119	6045	SO:0001623	5_prime_UTR_variant	146542	exon1			TGTTGACAGACTG	AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.-617G>T	16.37:g.30583567C>A		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	45	29	0.644444	NM_001024683	A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Silent	SNP	ENST00000223459.6	37	CCDS10684.1																																																																																			.	.	none		0.637	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255544.2	NM_145271	
PDE4DIP	9659	hgsc.bcm.edu	37	1	145075777	145075777	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:145075777G>A	ENST00000530740.1	-	1	124	c.86C>T	c.(85-87)aCg>aTg	p.T29M	PDE4DIP_ENST00000369345.4_Missense_Mutation_p.T29M|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.T29M|PDE4DIP_ENST00000369348.3_Missense_Mutation_p.T29M			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	0					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCGGTAAGGCGTGTAGTGAGC	0.711			T	PDGFRB	MPD																																p.T29M		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	PDE4DIP_ENST00000369348,NS,carcinoma,-1,2	PDE4DIP	817	2	0			c.C86T						PASS	.						46.0	59.0	54.0					1																	145075777		2203	4298	6501	SO:0001583	missense	9659	exon1			TAAGGCGTGTAGT	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000530740.1:c.86C>T	1.37:g.145075777G>A	ENSP00000435654:p.Thr29Met	Somatic	219	0	0		WXS	Illumina HiSeq	Phase_I	180	27	0.15	NM_022359	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000530740.1	37		.	.	.	.	.	.	.	.	.	.	G	11.01	1.513553	0.27123	.	.	ENSG00000178104	ENST00000530740;ENST00000369359;ENST00000369348;ENST00000369345	T;T;T	0.08984	4.82;4.82;3.03	3.25	3.25	0.37280	.	.	.	.	.	T	0.01156	0.0038	N	0.08118	0	0.09310	N	0.999998	B;P	0.49358	0.079;0.923	B;B	0.25884	0.005;0.064	T	0.44711	-0.9310	9	0.72032	D	0.01	.	10.1438	0.42751	0.0:0.0:1.0:0.0	.	29;29	Q5TB27;E9PJ64	.;.	M	29	ENSP00000435654:T29M;ENSP00000358366:T29M;ENSP00000358354:T29M	ENSP00000358351:T29M	T	-	2	0	PDE4DIP	143787134	0.007000	0.16637	0.524000	0.27887	0.036000	0.12997	1.660000	0.37397	1.798000	0.52647	0.511000	0.50034	ACG	.	.	none		0.711	PDE4DIP-036	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000384663.2	NM_022359	
COBL	23242	hgsc.bcm.edu	37	7	51203882	51203882	+	Silent	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr7:51203882T>C	ENST00000265136.7	-	6	1095	c.930A>G	c.(928-930)ccA>ccG	p.P310P	COBL_ENST00000395540.2_Silent_p.P310P|COBL_ENST00000441453.1_Silent_p.P310P|COBL_ENST00000395542.2_Silent_p.P335P	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	310	Pro-rich.				actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					CTTGCACAGGTGGCCCTGAAC	0.567																																					p.P310P	NSCLC(189;2119 2138 12223 30818 34679)	Atlas-SNP	.											.	COBL	167	.	0			c.A930G						PASS	.						81.0	62.0	69.0					7																	51203882		2203	4300	6503	SO:0001819	synonymous_variant	23242	exon6			CACAGGTGGCCCT	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.930A>G	7.37:g.51203882T>C		Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	136	42	0.308824	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	ENST00000265136.7	37	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	T	9.074	0.997562	0.19043	.	.	ENSG00000106078	ENST00000452534	.	.	.	5.55	0.604	0.17547	.	.	.	.	.	T	0.25044	0.0608	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.26018	-1.0115	4	.	.	.	.	5.2781	0.15661	0.1214:0.2779:0.0:0.6007	.	.	.	.	A	229	.	.	T	-	1	0	COBL	51171376	0.000000	0.05858	0.000000	0.03702	0.354000	0.29330	-1.119000	0.03276	-0.112000	0.11979	0.460000	0.39030	ACC	.	.	none		0.567	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
FMN1	342184	hgsc.bcm.edu	37	15	33359827	33359827	+	Intron	SNP	C	C	A	rs570854143		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr15:33359827C>A	ENST00000559047.1	-	3	2043				FMN1_ENST00000561249.1_Intron|FMN1_ENST00000334528.9_Missense_Mutation_p.V87F|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000558197.1_Missense_Mutation_p.V87F			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		TCAGGTGAAACCCGAGACCCT	0.483																																					p.V87F		Atlas-SNP	.											.	FMN1	174	.	0			c.G259T						PASS	.						73.0	72.0	72.0					15																	33359827		1927	4150	6077	SO:0001627	intron_variant	342184	exon1			GTGAAACCCGAGA	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-2552G>T	15.37:g.33359827C>A		Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	161	67	0.416149	NM_001103184	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	37		.	.	.	.	.	.	.	.	.	.	C	1.806	-0.475955	0.04414	.	.	ENSG00000248905	ENST00000334528	T	0.39787	1.06	4.92	1.71	0.24356	.	.	.	.	.	T	0.28532	0.0706	.	.	.	.	.	.	B;B	0.06786	0.001;0.0	B;B	0.12156	0.007;0.003	T	0.28554	-1.0040	7	0.66056	D	0.02	.	4.1619	0.10287	0.1924:0.6092:0.0:0.1984	.	87;87	Q68DA7-3;Q68DA7-5	.;.	F	87	ENSP00000333950:V87F	ENSP00000333950:V87F	V	-	1	0	FMN1	31147119	0.000000	0.05858	0.009000	0.14445	0.019000	0.09904	-0.153000	0.10144	0.651000	0.30788	-0.137000	0.14449	GTT	.	.	none		0.483	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
TRAF7	84231	hgsc.bcm.edu	37	16	2226351	2226351	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:2226351G>A	ENST00000326181.6	+	20	2096	c.1964G>A	c.(1963-1965)cGa>cAa	p.R655Q		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	655					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						TCCCGGGGCCGACTCTTCTCA	0.642																																					p.R655Q		Atlas-SNP	.											.	TRAF7	158	.	0			c.G1964A						PASS	.						22.0	21.0	21.0					16																	2226351		2186	4297	6483	SO:0001583	missense	84231	exon20			GGGGCCGACTCTT	AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.1964G>A	16.37:g.2226351G>A	ENSP00000318944:p.Arg655Gln	Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	44	21	0.477273	NM_032271	Q9H073	Missense_Mutation	SNP	ENST00000326181.6	37	CCDS10461.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670240	0.67814	.	.	ENSG00000131653	ENST00000326181	T	0.60299	0.2	5.45	4.43	0.53597	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.57858	0.2082	L	0.31476	0.935	0.80722	D	1	D	0.69078	0.997	P	0.55011	0.766	T	0.58103	-0.7695	10	0.42905	T	0.14	-32.9563	14.7786	0.69749	0.0:0.1449:0.8551:0.0	.	655	Q6Q0C0	TRAF7_HUMAN	Q	655	ENSP00000318944:R655Q	ENSP00000318944:R655Q	R	+	2	0	TRAF7	2166352	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.039000	0.76544	2.564000	0.86499	0.514000	0.50259	CGA	.	.	none		0.642	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250762.1	NM_032271	
RC3H1	149041	hgsc.bcm.edu	37	1	173916598	173916598	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:173916598G>A	ENST00000367696.2	-	15	2997	c.2646C>T	c.(2644-2646)atC>atT	p.I882I	RC3H1_ENST00000258349.4_Silent_p.I882I|RC3H1_ENST00000367694.2_Silent_p.I882I			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	882					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						AAGTTCGTGAGATGGCACCAA	0.473																																					p.I882I		Atlas-SNP	.											.	RC3H1	110	.	0			c.C2646T						PASS	.						142.0	141.0	142.0					1																	173916598		2203	4300	6503	SO:0001819	synonymous_variant	149041	exon14			TCGTGAGATGGCA	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.2646C>T	1.37:g.173916598G>A		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	174	60	0.344828	NM_172071	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Silent	SNP	ENST00000367696.2	37	CCDS30940.1																																																																																			.	.	none		0.473	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071	
NHSL2	340527	hgsc.bcm.edu	37	X	71358413	71358413	+	5'UTR	SNP	A	A	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chrX:71358413A>G	ENST00000373677.1	+	0	1179				NHSL2_ENST00000540800.1_Missense_Mutation_p.S339G|NHSL2_ENST00000535692.1_5'UTR|NHSL2_ENST00000510661.1_Missense_Mutation_p.S108G			Q5HYW2	NHSL2_HUMAN	NHS-like 2											NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					TCGGTTCCCAAGTCTCACCTC	0.582																																					p.S339G		Atlas-SNP	.											.	NHSL2	148	.	0			c.A1015G						PASS	.						107.0	91.0	96.0					X																	71358413		692	1591	2283	SO:0001623	5_prime_UTR_variant	340527	exon6			TTCCCAAGTCTCA			Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.-84A>G	X.37:g.71358413A>G		Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	181	108	0.596685	NM_001013627	B2RN94	Missense_Mutation	SNP	ENST00000373677.1	37		.	.	.	.	.	.	.	.	.	.	A	10.15	1.271688	0.23221	.	.	ENSG00000204131	ENST00000540800;ENST00000510661	T;T	0.47177	1.45;0.85	5.79	4.63	0.57726	.	.	.	.	.	T	0.33527	0.0866	L	0.29908	0.895	0.58432	D	0.999999	B;B	0.15473	0.013;0.013	B;B	0.19391	0.025;0.025	T	0.07790	-1.0754	8	.	.	.	.	9.1966	0.37231	0.9136:0.0:0.0864:0.0	.	339;108	F5H593;D6RBM4	.;.	G	339;108	ENSP00000444617:S339G;ENSP00000424079:S108G	.	S	+	1	0	NHSL2	71275138	0.343000	0.24818	0.981000	0.43875	0.226000	0.24999	1.445000	0.35079	0.806000	0.34183	-0.334000	0.08254	AGT	.	.	none		0.582	NHSL2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057170.1	NM_001013627	
CREBBP	1387	hgsc.bcm.edu	37	16	3828721	3828721	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:3828721A>G	ENST00000262367.5	-	9	2730	c.1921T>C	c.(1921-1923)Tac>Cac	p.Y641H	CREBBP_ENST00000382070.3_Missense_Mutation_p.Y603H	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	641	KIX. {ECO:0000255|PROSITE- ProRule:PRU00311}.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GCAGACTCGTACATGTCCCCT	0.512			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.Y641H		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	0			c.T1921C						PASS	.						214.0	185.0	195.0					16																	3828721		2197	4300	6497	SO:0001583	missense	1387	exon9			ACTCGTACATGTC	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.1921T>C	16.37:g.3828721A>G	ENSP00000262367:p.Tyr641His	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	120	49	0.408333	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	A	19.70	3.875661	0.72180	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.91843	-2.92;-2.87	5.01	5.01	0.66863	Coactivator CBP, KIX (4);	0.000000	0.64402	D	0.000003	D	0.96216	0.8766	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96923	0.9675	10	0.87932	D	0	-11.1709	15.0035	0.71492	1.0:0.0:0.0:0.0	.	671;641	Q4LE28;Q92793	.;CBP_HUMAN	H	641;671;603	ENSP00000262367:Y641H;ENSP00000371502:Y603H	ENSP00000262367:Y641H	Y	-	1	0	CREBBP	3768722	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.206000	0.95056	1.999000	0.58509	0.460000	0.39030	TAC	.	.	none		0.512	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
CCSER1	401145	hgsc.bcm.edu	37	4	92519732	92519732	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr4:92519732C>T	ENST00000509176.1	+	11	2515	c.2227C>T	c.(2227-2229)Cga>Tga	p.R743*	CCSER1_ENST00000333691.8_Nonsense_Mutation_p.R743*	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	743																	GGCTACATATCGAAATCGAAT	0.388																																					p.R743X		Atlas-SNP	.											.	.	.	.	0			c.C2227T						PASS	.						39.0	34.0	36.0					4																	92519732		692	1591	2283	SO:0001587	stop_gained	401145	exon11			ACATATCGAAATC		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.2227C>T	4.37:g.92519732C>T	ENSP00000425040:p.Arg743*	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	67	29	0.432836	NM_001145065	Q4W5M0|Q86V57	Nonsense_Mutation	SNP	ENST00000509176.1	37	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	C	39	7.852994	0.98525	.	.	ENSG00000184305	ENST00000509176;ENST00000333691	.	.	.	5.77	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-3.0095	14.0425	0.64684	0.0:0.9266:0.0:0.0734	.	.	.	.	X	743	.	ENSP00000329482:R743X	R	+	1	2	FAM190A	92738755	1.000000	0.71417	0.995000	0.50966	0.900000	0.52787	3.685000	0.54678	2.890000	0.99128	0.650000	0.86243	CGA	.	.	none		0.388	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
NFYC	4802	hgsc.bcm.edu	37	1	41213216	41213216	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:41213216G>A	ENST00000308733.5	+	2	122	c.116G>A	c.(115-117)cGa>cAa	p.R39Q	NFYC_ENST00000372653.1_Missense_Mutation_p.R39Q|NFYC_ENST00000456393.2_Missense_Mutation_p.R39Q|NFYC_ENST00000372651.1_Missense_Mutation_p.R39Q|NFYC_ENST00000372654.1_Missense_Mutation_p.R39Q|NFYC_ENST00000447388.3_Missense_Mutation_p.R39Q|NFYC_ENST00000372652.1_Missense_Mutation_p.R39Q|NFYC_ENST00000440226.3_Missense_Mutation_p.R39Q|NFYC_ENST00000427410.2_Missense_Mutation_p.R39Q|NFYC_ENST00000425457.2_Missense_Mutation_p.R39Q			Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma	39					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)|skin(2)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			AAAGACTTCCGAGTGCAGGAA	0.403																																					p.R39Q		Atlas-SNP	.											.	NFYC	39	.	0			c.G116A						PASS	.						110.0	96.0	101.0					1																	41213216		2203	4300	6503	SO:0001583	missense	4802	exon3			ACTTCCGAGTGCA	U78774	CCDS455.1, CCDS44120.1, CCDS44121.1, CCDS44122.1, CCDS44123.1	1p32	2008-11-11			ENSG00000066136	ENSG00000066136			7806	protein-coding gene	gene with protein product		605344				8921405, 9249075	Standard	NM_014223		Approved	CBF-C, NF-YC	uc009vwd.3	Q13952	OTTHUMG00000007729	ENST00000308733.5:c.116G>A	1.37:g.41213216G>A	ENSP00000312617:p.Arg39Gln	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	96	42	0.4375	NM_001142587	B4DUS6|B4DW63|D3DPV9|F8VWM3|Q59GY4|Q5T6K8|Q5T6K9|Q5T6L1|Q5TZR6|Q92869|Q9HBX1|Q9NXB5|Q9UM67|Q9UML0|Q9UMT7	Missense_Mutation	SNP	ENST00000308733.5	37		.	.	.	.	.	.	.	.	.	.	G	36	5.955404	0.97145	.	.	ENSG00000066136	ENST00000427410;ENST00000447388;ENST00000425457;ENST00000453631;ENST00000456393;ENST00000372654;ENST00000534399;ENST00000372653;ENST00000372669;ENST00000372652;ENST00000372651;ENST00000531464;ENST00000440226;ENST00000525290;ENST00000416859;ENST00000308733	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.50548	0.74;1.45;1.44;0.88;1.45;1.45;1.44;2.44;1.46;1.45;1.45;0.89;0.86;1.43	6.17	6.17	0.99709	Histone-fold (1);	0.000000	0.85682	D	0.000000	T	0.63628	0.2527	L	0.44542	1.39	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.997;0.999;0.994;0.999;0.997;0.997;0.986	D;D;P;D;D;D;P	0.77557	0.947;0.978;0.885;0.99;0.947;0.947;0.658	T	0.62320	-0.6879	10	0.72032	D	0.01	.	18.3732	0.90420	0.0:0.0:1.0:0.0	.	39;39;39;39;39;39;39	B4DW63;Q13952;Q5T6K9;Q13952-3;F8VWM3;Q13952-2;B4DUS6	.;NFYC_HUMAN;.;.;.;.;.	Q	39	ENSP00000408315:R39Q;ENSP00000404427:R39Q;ENSP00000396620:R39Q;ENSP00000397647:R39Q;ENSP00000408867:R39Q;ENSP00000361738:R39Q;ENSP00000361737:R39Q;ENSP00000361754:R39Q;ENSP00000361736:R39Q;ENSP00000361734:R39Q;ENSP00000414299:R39Q;ENSP00000436710:R39Q;ENSP00000409219:R39Q;ENSP00000312617:R39Q	ENSP00000312617:R39Q	R	+	2	0	NFYC	40985803	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.356000	0.97091	2.941000	0.99782	0.655000	0.94253	CGA	.	.	none		0.403	NFYC-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000020802.1	NM_014223	
UACA	55075	hgsc.bcm.edu	37	15	71055671	71055671	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr15:71055671C>T	ENST00000322954.6	-	1	261	c.76G>A	c.(76-78)Gcg>Acg	p.A26T	UACA_ENST00000539319.1_Missense_Mutation_p.A26T	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	26	Poly-Ala.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						GGACTCACCGCGCTGGCGGCG	0.731																																					p.A26T		Atlas-SNP	.											.	UACA	235	.	0			c.G76A						PASS	.						2.0	4.0	3.0					15																	71055671		1383	2742	4125	SO:0001583	missense	55075	exon1			TCACCGCGCTGGC	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.76G>A	15.37:g.71055671C>T	ENSP00000314556:p.Ala26Thr	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	111	52	0.468468	NM_018003	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.497322	0.26861	.	.	ENSG00000137831	ENST00000322954;ENST00000539319	T;T	0.34472	1.36;1.77	4.82	1.71	0.24356	.	1.180030	0.06665	N	0.765191	T	0.12689	0.0308	N	0.02539	-0.55	0.23665	N	0.997162	B;B	0.24132	0.098;0.027	B;B	0.16289	0.015;0.003	T	0.28106	-1.0054	10	0.12103	T	0.63	-0.4557	3.4056	0.07340	0.1748:0.5599:0.1692:0.0961	.	26;26	F5H2B9;Q9BZF9	.;UACA_HUMAN	T	26	ENSP00000314556:A26T;ENSP00000438667:A26T	ENSP00000314556:A26T	A	-	1	0	UACA	68842725	0.910000	0.30920	1.000000	0.80357	0.946000	0.59487	-0.164000	0.09983	0.436000	0.26393	0.484000	0.47621	GCG	.	.	none		0.731	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
XRN1	54464	hgsc.bcm.edu	37	3	142090122	142090122	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:142090122C>T	ENST00000264951.4	-	26	3144	c.3027G>A	c.(3025-3027)gtG>gtA	p.V1009V	XRN1_ENST00000392981.2_Silent_p.V1009V	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1009					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						CTTCATAGAACACATCCTCTT	0.313																																					p.V1009V		Atlas-SNP	.											.	XRN1	138	.	0			c.G3027A						PASS	.						93.0	92.0	92.0					3																	142090122		2202	4300	6502	SO:0001819	synonymous_variant	54464	exon26			ATAGAACACATCC	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.3027G>A	3.37:g.142090122C>T		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	105	50	0.47619	NM_001042604	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Silent	SNP	ENST00000264951.4	37	CCDS3123.1																																																																																			.	.	none		0.313	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
IL4I1	259307	hgsc.bcm.edu	37	19	50397663	50397663	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:50397663C>G	ENST00000391826.2	-	5	571	c.429G>C	c.(427-429)aaG>aaC	p.K143N	IL4I1_ENST00000341114.3_Missense_Mutation_p.K165N|IL4I1_ENST00000595948.1_Missense_Mutation_p.K165N	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	143						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	TCCACGTGTTCTTGTCGTACT	0.617																																					p.K165N		Atlas-SNP	.											.	IL4I1	50	.	0			c.G495C						PASS	.						116.0	113.0	114.0					19																	50397663		2203	4300	6503	SO:0001583	missense	259307	exon7			CGTGTTCTTGTCG	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.429G>C	19.37:g.50397663C>G	ENSP00000375702:p.Lys143Asn	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	101	41	0.405941	NM_172374	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Missense_Mutation	SNP	ENST00000391826.2	37	CCDS12787.1	.	.	.	.	.	.	.	.	.	.	C	2.739	-0.262761	0.05754	.	.	ENSG00000104951	ENST00000341114;ENST00000391826	D;D	0.92299	-3.01;-3.01	5.24	2.95	0.34219	Amine oxidase (1);	0.996710	0.08139	N	0.991977	T	0.79656	0.4483	N	0.02247	-0.625	0.19775	N	0.999956	P;P;B	0.38677	0.589;0.642;0.006	B;B;B	0.33121	0.098;0.158;0.01	T	0.67484	-0.5659	10	0.22109	T	0.4	-29.9311	13.0756	0.59085	0.0:0.6914:0.3086:0.0	.	165;165;143	Q96RQ9-2;Q1WMJ3;Q96RQ9	.;.;OXLA_HUMAN	N	165;143	ENSP00000342557:K165N;ENSP00000375702:K143N	ENSP00000342557:K165N	K	-	3	2	IL4I1	55089475	0.998000	0.40836	0.995000	0.50966	0.056000	0.15407	1.642000	0.37207	1.206000	0.43276	0.491000	0.48974	AAG	.	.	none		0.617	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1		
SERPINB9	5272	hgsc.bcm.edu	37	6	2890535	2890535	+	Silent	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:2890535T>C	ENST00000380698.4	-	7	1082	c.993A>G	c.(991-993)gcA>gcG	p.A331A		NM_004155.5	NP_004146.1	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 9	331					cellular response to estrogen stimulus (GO:0071391)|immune response (GO:0006955)|mast cell mediated immunity (GO:0002448)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|pancreas(1)|prostate(1)	15	Ovarian(93;0.0412)	all_hematologic(90;0.108)				AGCTCGACGCTGCCGCTGCCT	0.542																																					p.A331A		Atlas-SNP	.											.	SERPINB9	37	.	0			c.A993G						PASS	.						104.0	91.0	95.0					6																	2890535		2203	4300	6503	SO:0001819	synonymous_variant	5272	exon7			CGACGCTGCCGCT	L40378	CCDS4478.1	6p25.2	2014-02-18	2005-08-18		ENSG00000170542	ENSG00000170542		"""Serine (or cysteine) peptidase inhibitors"""	8955	protein-coding gene	gene with protein product		601799	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9"""	PI9		8530382, 9858835, 24172014	Standard	NM_004155		Approved	CAP3	uc003mug.4	P50453	OTTHUMG00000014131	ENST00000380698.4:c.993A>G	6.37:g.2890535T>C		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	92	72	0.782609	NM_004155	B2RBW3|Q5TD03	Silent	SNP	ENST00000380698.4	37	CCDS4478.1																																																																																			.	.	none		0.542	SERPINB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039656.1		
DCAF6	55827	hgsc.bcm.edu	37	1	168014147	168014147	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:168014147A>G	ENST00000312263.6	+	14	1913	c.1709A>G	c.(1708-1710)gAt>gGt	p.D570G	DCAF6_ENST00000367840.3_Missense_Mutation_p.D647G|DCAF6_ENST00000367843.3_Missense_Mutation_p.D590G|DCAF6_ENST00000432587.2_Missense_Mutation_p.D616G	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	570					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						GCACAATCAGATAAGTTCACA	0.388																																					p.D647G		Atlas-SNP	.											.	DCAF6	99	.	0			c.A1940G						PASS	.						111.0	123.0	119.0					1																	168014147		2203	4300	6503	SO:0001583	missense	55827	exon16			AATCAGATAAGTT	AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.1709A>G	1.37:g.168014147A>G	ENSP00000311949:p.Asp570Gly	Somatic	271	1	0.00369004		WXS	Illumina HiSeq	Phase_I	445	269	0.604494	NM_001198956	A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Missense_Mutation	SNP	ENST00000312263.6	37	CCDS30933.1	.	.	.	.	.	.	.	.	.	.	A	13.26	2.185240	0.38609	.	.	ENSG00000143164	ENST00000367843;ENST00000432587;ENST00000312263;ENST00000367840	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.29	4.16	0.48862	WD40 repeat-like-containing domain (1);	0.534254	0.18907	N	0.127876	T	0.13841	0.0335	N	0.24115	0.695	0.29487	N	0.85592	P;P;B;P	0.52170	0.951;0.814;0.002;0.702	P;B;B;B	0.48552	0.581;0.402;0.004;0.294	T	0.04203	-1.0969	9	0.51188	T	0.08	.	9.6019	0.39609	0.9203:0.0:0.0797:0.0	.	616;647;570;590	B4DNB8;Q58WW2-3;Q58WW2;Q58WW2-2	.;.;DCAF6_HUMAN;.	G	590;616;570;647	ENSP00000356817:D590G;ENSP00000396238:D616G;ENSP00000311949:D570G;ENSP00000356814:D647G	ENSP00000311949:D570G	D	+	2	0	DCAF6	166280771	1.000000	0.71417	0.670000	0.29842	0.817000	0.46193	2.828000	0.48120	0.848000	0.35191	0.460000	0.39030	GAT	.	.	none		0.388	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083661.2	NM_018442	
MUC4	4585	hgsc.bcm.edu	37	3	195509498	195509498	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:195509498C>T	ENST00000463781.3	-	2	9412	c.8953G>A	c.(8953-8955)Gca>Aca	p.A2985T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2985T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A2985T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CCTGTGGATGCTGAGGAAGTG	0.572																																					p.A2985T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	3	2	Substitution - Missense(2)	endometrium(2)	c.G8953A						scavenged	.						18.0	10.0	12.0					3																	195509498		655	1551	2206	SO:0001583	missense	4585	exon2			TGGATGCTGAGGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8953G>A	3.37:g.195509498C>T	ENSP00000417498:p.Ala2985Thr	Somatic	58	9	0.155172		WXS	Illumina HiSeq	Phase_I	61	10	0.163934	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	4.352	0.064824	0.08388	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.58;1.53	.	.	.	.	.	.	.	.	T	0.13500	0.0327	N	0.14661	0.345	0.09310	N	0.999999	B	0.22480	0.07	B	0.14023	0.01	T	0.25745	-1.0123	7	.	.	.	.	2.3265	0.04224	0.0:0.3925:0.3321:0.2754	.	2857	E7ESK3	.	T	2985	ENSP00000417498:A2985T;ENSP00000420243:A2985T	.	A	-	1	0	MUC4	196994277	.	.	0.014000	0.15608	0.000000	0.00434	.	.	0.482000	0.27582	0.000000	0.15137	GCA	.	.	none		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
COL21A1	81578	hgsc.bcm.edu	37	6	55988901	55988901	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:55988901T>A	ENST00000244728.5	-	16	2114	c.1717A>T	c.(1717-1719)Aga>Tga	p.R573*	COL21A1_ENST00000535941.1_Nonsense_Mutation_p.R573*|COL21A1_ENST00000370819.1_Nonsense_Mutation_p.R570*	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	573	Collagen-like 3.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TTTCCATGTCTTCCTGGTTCT	0.264																																					p.R573X		Atlas-SNP	.											.	COL21A1	201	.	0			c.A1717T						PASS	.						32.0	27.0	29.0					6																	55988901		1666	3836	5502	SO:0001587	stop_gained	81578	exon16			CATGTCTTCCTGG	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1717A>T	6.37:g.55988901T>A	ENSP00000244728:p.Arg573*	Somatic	311	0	0		WXS	Illumina HiSeq	Phase_I	247	202	0.817814	NM_030820	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Nonsense_Mutation	SNP	ENST00000244728.5	37	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	T	41	8.904774	0.98998	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811	.	.	.	4.36	4.36	0.52297	.	0.227351	0.30584	N	0.009318	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	10.2225	0.43205	0.0:0.0:0.0:1.0	.	.	.	.	X	573;570;573;570	.	ENSP00000244728:R573X	R	-	1	2	COL21A1	56096860	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.795000	0.38784	1.711000	0.51337	0.402000	0.26972	AGA	.	.	none		0.264	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
FBXW11	23291	hgsc.bcm.edu	37	5	171305089	171305089	+	Silent	SNP	T	T	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:171305089T>A	ENST00000265094.5	-	7	971	c.834A>T	c.(832-834)ggA>ggT	p.G278G	FBXW11_ENST00000296933.6_Silent_p.G265G|FBXW11_ENST00000393802.2_Silent_p.G244G|FBXW11_ENST00000425623.2_Silent_p.G246G|FBXW11_ENST00000522891.1_5'UTR	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11	278					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGCCTGTGTGTCCTGTTAACA	0.398																																					p.G278G		Atlas-SNP	.											.	FBXW11	72	.	0			c.A834T						PASS	.						109.0	95.0	100.0					5																	171305089		2203	4300	6503	SO:0001819	synonymous_variant	23291	exon7			TGTGTGTCCTGTT	AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.834A>T	5.37:g.171305089T>A		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	171	36	0.210526	NM_012300	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Silent	SNP	ENST00000265094.5	37	CCDS34289.1																																																																																			.	.	none		0.398	FBXW11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372382.1	NM_012300	
CHRM3	1131	hgsc.bcm.edu	37	1	240071868	240071868	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:240071868G>C	ENST00000255380.4	+	5	1896	c.1117G>C	c.(1117-1119)Ggt>Cgt	p.G373R		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	373					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CAAGCTTCCGGGTCACAGCAC	0.592																																					p.G373R		Atlas-SNP	.											.	CHRM3	118	.	0			c.G1117C						PASS	.						33.0	26.0	28.0					1																	240071868		2203	4300	6503	SO:0001583	missense	1131	exon5			CTTCCGGGTCACA	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1117G>C	1.37:g.240071868G>C	ENSP00000255380:p.Gly373Arg	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	90	18	0.2	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	37	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285109	0.80803	.	.	ENSG00000133019	ENST00000255380	T	0.60672	0.17	5.97	5.97	0.96955	GPCR, rhodopsin-like superfamily (1);	0.174679	0.49305	D	0.000152	T	0.72716	0.3495	L	0.58101	1.795	0.80722	D	1	D	0.55605	0.972	P	0.61275	0.886	T	0.70594	-0.4829	10	0.51188	T	0.08	-13.9681	20.4238	0.99064	0.0:0.0:1.0:0.0	.	373	P20309	ACM3_HUMAN	R	373	ENSP00000255380:G373R	ENSP00000255380:G373R	G	+	1	0	CHRM3	238138491	1.000000	0.71417	0.479000	0.27329	0.884000	0.51177	9.869000	0.99810	2.828000	0.97474	0.655000	0.94253	GGT	.	.	none		0.592	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
DZANK1	55184	hgsc.bcm.edu	37	20	18446022	18446022	+	Splice_Site	SNP	C	C	A	rs371169404|rs74875927	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr20:18446022C>A	ENST00000262547.5	-	2	190		c.e2-1		DZANK1_ENST00000357236.4_Splice_Site|POLR3F_ENST00000377603.4_5'Flank|DZANK1_ENST00000329494.5_Splice_Site|DZANK1_ENST00000358866.6_5'UTR	NM_001099407.1	NP_001092877.1	Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1								zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						ctctctctctctctATATATA	0.368													C|||	559	0.111621	0.1868	0.1009	5008	,	,		12978	0.0377		0.1322	False		,,,				2504	0.0726				.		Atlas-SNP	.											.	DZANK1	65	.	0			.						PASS	.						31.0	27.0	28.0					20																	18446022		1812	4073	5885	SO:0001630	splice_region_variant	55184	.			CTCTCTCTCTATA	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000262547.5:c.19-1G>T	20.37:g.18446022C>A		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	39	15	0.384615	.	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Splice_Site	SNP	ENST00000262547.5	37	CCDS46582.1																																																																																			C|0.907;A|0.093	0.093	strong		0.368	DZANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001099407	Intron
PLCE1	51196	hgsc.bcm.edu	37	10	96084266	96084266	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr10:96084266C>T	ENST00000371380.3	+	30	6897	c.6662C>T	c.(6661-6663)gCc>gTc	p.A2221V	PLCE1_ENST00000371385.3_Missense_Mutation_p.A1913V|PLCE1_ENST00000260766.3_Missense_Mutation_p.A2221V|NOC3L_ENST00000543788.1_Intron|PLCE1_ENST00000371375.1_Missense_Mutation_p.A1913V			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	2221	Ras-associating 2. {ECO:0000255|PROSITE- ProRule:PRU00166}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				GTGTTTCAAGCCCAAAGCAAG	0.438																																					p.A2221V		Atlas-SNP	.											.	PLCE1	543	.	0			c.C6662T						PASS	.						158.0	156.0	157.0					10																	96084266		1886	4112	5998	SO:0001583	missense	51196	exon31			TTCAAGCCCAAAG		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.6662C>T	10.37:g.96084266C>T	ENSP00000360431:p.Ala2221Val	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	83	30	0.361446	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585086	0.86748	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	5.59	4.69	0.59074	Ras-association (3);	0.062832	0.64402	N	0.000006	T	0.42108	0.1188	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	T	0.40232	-0.9574	10	0.72032	D	0.01	.	13.8887	0.63724	0.0:0.9261:0.0:0.0739	.	2205;1913;2221	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	V	2221;2221;1913;1913	ENSP00000260766:A2221V;ENSP00000360431:A2221V;ENSP00000360438:A1913V;ENSP00000360426:A1913V	ENSP00000260766:A2221V	A	+	2	0	PLCE1	96074256	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	3.805000	0.55575	1.362000	0.46000	0.655000	0.94253	GCC	.	.	none		0.438	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
KRAS	3845	hgsc.bcm.edu	37	12	25398255	25398255	+	Missense_Mutation	SNP	G	G	T	rs121913236		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:25398255G>T	ENST00000256078.4	-	2	127	c.64C>A	c.(64-66)Cag>Aag	p.Q22K	KRAS_ENST00000556131.1_Missense_Mutation_p.Q22K|KRAS_ENST00000311936.3_Missense_Mutation_p.Q22K|KRAS_ENST00000557334.1_Missense_Mutation_p.Q22K	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	22			Q -> E (in CFC2; exhibits an increase in intrinsic and guanine nucleotide exchange factor catalyzed nucleotide exchange in combination with an impaired GTPase- activating protein-stimulated GTP hydrolysis but functional in interaction with effectors). {ECO:0000269|PubMed:17056636}.|Q -> R (in NS3; impairs GTPase-activating protein stimulated GTP hydrolysis with unaffected intrinsic functions and a virtually functional effector interaction).		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q22K(8)|p.Q22*(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TGAATTAGCTGTATCGTCAAG	0.363		119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.Q22K	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Atlas-SNP	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,colon,carcinoma,0,18	KRAS	30930	18	9	Substitution - Missense(8)|Substitution - Nonsense(1)	large_intestine(7)|haematopoietic_and_lymphoid_tissue(1)|small_intestine(1)	c.C64A	GRCh37	CM070964	KRAS	M	rs121913236	PASS	.						88.0	76.0	80.0					12																	25398255		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	TTAGCTGTATCGT	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.64C>A	12.37:g.25398255G>T	ENSP00000256078:p.Gln22Lys	Somatic	209	1	0.00478469		WXS	Illumina HiSeq	Phase_I	279	167	0.598566	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	G	32	5.113031	0.94339	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79749	-1.3;-0.43;-0.43;-0.43	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90013	0.6882	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.976	D	0.90739	0.4648	10	0.87932	D	0	.	18.3719	0.90409	0.0:0.0:1.0:0.0	.	22;22	P01116-2;P01116	.;RASK_HUMAN	K	22	ENSP00000308495:Q22K;ENSP00000452512:Q22K;ENSP00000256078:Q22K;ENSP00000451856:Q22K	ENSP00000256078:Q22K	Q	-	1	0	KRAS	25289522	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.770000	0.98971	2.668000	0.90789	0.563000	0.77884	CAG	.	.	weak		0.363	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
RHPN2	85415	hgsc.bcm.edu	37	19	33493200	33493200	+	Missense_Mutation	SNP	G	G	A	rs200623446	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:33493200G>A	ENST00000254260.3	-	9	1093	c.1058C>T	c.(1057-1059)gCg>gTg	p.A353V	RHPN2_ENST00000400226.4_Missense_Mutation_p.A202V	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	353	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GGCCAGGGCCGCGTAGTGGTG	0.637																																					p.A353V		Atlas-SNP	.											RHPN2,caecum,carcinoma,-1,17	RHPN2	107	17	0			c.C1058T						scavenged	.						50.0	48.0	49.0					19																	33493200		2203	4300	6503	SO:0001583	missense	85415	exon9			AGGGCCGCGTAGT	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1058C>T	19.37:g.33493200G>A	ENSP00000254260:p.Ala353Val	Somatic	84	1	0.0119048		WXS	Illumina HiSeq	Phase_I	67	25	0.373134	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.276172	0.23307	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.18810	2.19;2.19	4.61	-4.16	0.03869	BRO1 domain (3);	1.055030	0.07227	N	0.861852	T	0.14830	0.0358	L	0.39898	1.24	0.09310	N	1	B	0.18013	0.025	B	0.15484	0.013	T	0.36114	-0.9761	10	0.30078	T	0.28	0.2931	7.8623	0.29517	0.0:0.2524:0.4684:0.2792	.	353	Q8IUC4	RHPN2_HUMAN	V	353;83;202	ENSP00000254260:A353V;ENSP00000402244:A202V	ENSP00000254260:A353V	A	-	2	0	RHPN2	38185040	0.000000	0.05858	0.001000	0.08648	0.375000	0.29983	0.178000	0.16820	-0.540000	0.06265	0.455000	0.32223	GCG	G|0.935;A|0.065	0.065	strong		0.637	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
HSF2BP	11077	hgsc.bcm.edu	37	21	45064273	45064273	+	Splice_Site	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr21:45064273T>C	ENST00000291560.2	-	4	519	c.188A>G	c.(187-189)aAc>aGc	p.N63S	HSF2BP_ENST00000542962.1_5'UTR	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	63					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)				kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		CCTTTCCAGGTCTAGGAGAAA	0.408																																					p.N63S		Atlas-SNP	.											.	HSF2BP	28	.	0			c.A188G						PASS	.						106.0	103.0	104.0					21																	45064273		2203	4300	6503	SO:0001630	splice_region_variant	11077	exon4			TCCAGGTCTAGGA	AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.188-1A>G	21.37:g.45064273T>C		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	101	38	0.376238	NM_007031	B4DX36	Missense_Mutation	SNP	ENST00000291560.2	37	CCDS13697.1	.	.	.	.	.	.	.	.	.	.	T	3.845	-0.033093	0.07543	.	.	ENSG00000160207	ENST00000291560;ENST00000443485	.	.	.	5.2	4.07	0.47477	.	0.456651	0.24534	N	0.037681	T	0.23054	0.0557	N	0.04880	-0.145	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14035	-1.0487	9	0.13108	T	0.6	.	2.7045	0.05158	0.0:0.1771:0.2775:0.5454	.	63	O75031	HSF2B_HUMAN	S	63	.	ENSP00000291560:N63S	N	-	2	0	HSF2BP	43888701	0.994000	0.37717	1.000000	0.80357	0.954000	0.61252	0.367000	0.20382	1.966000	0.57179	0.460000	0.39030	AAC	.	.	none		0.408	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195620.1	NM_007031	Missense_Mutation
C9orf47	286223	hgsc.bcm.edu	37	9	91606581	91606581	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr9:91606581C>T	ENST00000334490.5	+	2	511	c.443C>T	c.(442-444)cCg>cTg	p.P148L	C9orf47_ENST00000375850.3_Missense_Mutation_p.P129L|S1PR3_ENST00000358157.2_5'UTR|C9orf47_ENST00000375851.2_Missense_Mutation_p.P129L			Q6ZRZ4	CI047_HUMAN	chromosome 9 open reading frame 47	148						extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|liver(1)|lung(1)	4						GCTAGGATGCCGGTGGCCCCA	0.766																																					p.P148L		Atlas-SNP	.											.	C9orf47	9	.	0			c.C443T						PASS	.						2.0	2.0	2.0					9																	91606581		1230	2747	3977	SO:0001583	missense	286223	exon2			GGATGCCGGTGGC	AK094842	CCDS35062.1, CCDS47989.1	9q22.1	2008-02-05	2004-11-04		ENSG00000186354	ENSG00000186354			23669	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 108"""	C9orf108			Standard	NM_001001938		Approved	FLJ37523, bA791O21.3	uc004aqc.2	Q6ZRZ4	OTTHUMG00000020172	ENST00000334490.5:c.443C>T	9.37:g.91606581C>T	ENSP00000335616:p.Pro148Leu	Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	39	12	0.307692	NM_001001938	B7ZMC7|Q5SQD7|Q7Z568|Q8N1V4	Missense_Mutation	SNP	ENST00000334490.5	37	CCDS35062.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004462	0.35320	.	.	ENSG00000186354	ENST00000375851;ENST00000375850;ENST00000334490	.	.	.	2.64	-0.648	0.11464	.	.	.	.	.	T	0.10165	0.0249	N	0.08118	0	0.26189	N	0.979614	D;D	0.56287	0.975;0.975	B;B	0.40477	0.33;0.33	T	0.16482	-1.0401	8	0.87932	D	0	.	2.1044	0.03688	0.2681:0.3827:0.0:0.3492	.	148;129	Q6ZRZ4;Q6ZRZ4-2	CI047_HUMAN;.	L	129;129;148	.	ENSP00000335616:P148L	P	+	2	0	C9orf47	90796401	0.000000	0.05858	0.057000	0.19452	0.022000	0.10575	-1.050000	0.03510	-0.143000	0.11334	0.555000	0.69702	CCG	.	.	none		0.766	C9orf47-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355972.1	NM_182599	
KCNT1	57582	hgsc.bcm.edu	37	9	138664597	138664597	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr9:138664597G>A	ENST00000263604.3	+	19	1988	c.1988G>A	c.(1987-1989)cGg>cAg	p.R663Q	KCNT1_ENST00000486577.2_Missense_Mutation_p.R641Q|KCNT1_ENST00000490355.2_Missense_Mutation_p.R661Q|KCNT1_ENST00000488444.2_Missense_Mutation_p.R663Q|KCNT1_ENST00000491806.2_Missense_Mutation_p.R649Q|KCNT1_ENST00000487664.1_Missense_Mutation_p.R637Q|KCNT1_ENST00000298480.5_Missense_Mutation_p.R682Q|KCNT1_ENST00000371757.2_Missense_Mutation_p.R682Q			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	663					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		ACAGAGCACCGGCCTACGCAG	0.716																																					p.R682Q		Atlas-SNP	.											.	KCNT1	139	.	0			c.G2045A						PASS	.						4.0	6.0	5.0					9																	138664597		2007	4003	6010	SO:0001583	missense	57582	exon19			AGCACCGGCCTAC	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.1988G>A	9.37:g.138664597G>A	ENSP00000263604:p.Arg663Gln	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	59	33	0.559322	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37		.	.	.	.	.	.	.	.	.	.	G	10.46	1.355993	0.24598	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.23552	1.92;1.91;1.91;1.9	4.02	2.14	0.27477	.	0.225763	0.38492	N	0.001664	T	0.23886	0.0578	M	0.77820	2.39	0.37757	D	0.926174	P;P;P;B	0.39920	0.47;0.569;0.695;0.342	B;B;B;B	0.28916	0.044;0.044;0.096;0.044	T	0.13495	-1.0507	10	0.39692	T	0.17	-43.5149	10.0494	0.42205	0.1661:0.0:0.8339:0.0	.	649;682;637;663	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	Q	637;682;682;641;649;663;661;663	ENSP00000417851:R637Q;ENSP00000298480:R682Q;ENSP00000360822:R682Q;ENSP00000263604:R663Q	ENSP00000263604:R663Q	R	+	2	0	KCNT1	137804418	1.000000	0.71417	0.742000	0.31022	0.011000	0.07611	2.767000	0.47637	0.197000	0.20387	0.579000	0.79373	CGG	.	.	none		0.716	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
CHIT1	1118	hgsc.bcm.edu	37	1	203186947	203186947	+	Missense_Mutation	SNP	G	G	C	rs201682373	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:203186947G>C	ENST00000367229.1	-	10	1110	c.1076C>G	c.(1075-1077)gCa>gGa	p.A359G	CHIT1_ENST00000255427.3_Missense_Mutation_p.A340G|CHIT1_ENST00000484834.1_5'UTR|CHIT1_ENST00000535569.1_Missense_Mutation_p.A350G	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	359					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						TAAGTCCAGTGCCCAGACCAT	0.637																																					p.A359G		Atlas-SNP	.											CHIT1,NS,carcinoma,0,1	CHIT1	61	1	0			c.C1076G						PASS	.						60.0	52.0	55.0					1																	203186947		2203	4300	6503	SO:0001583	missense	1118	exon10			TCCAGTGCCCAGA	U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1076C>G	1.37:g.203186947G>C	ENSP00000356198:p.Ala359Gly	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	54	5	0.0925926	NM_003465	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Missense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	G	7.873	0.728517	0.15507	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	T;T;T	0.06068	3.35;3.35;3.35	4.57	0.302	0.15786	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.729039	0.11613	N	0.546569	T	0.10035	0.0246	M	0.85630	2.765	0.09310	N	1	B;B	0.27853	0.191;0.016	B;B	0.29176	0.099;0.04	T	0.34079	-0.9843	10	0.87932	D	0	-8.5687	2.2813	0.04115	0.1816:0.1509:0.5123:0.1553	.	350;359	G5EA51;Q13231	.;CHIT1_HUMAN	G	359;340;350	ENSP00000356198:A359G;ENSP00000255427:A340G;ENSP00000438078:A350G	ENSP00000255427:A340G	A	-	2	0	CHIT1	201453570	0.150000	0.22732	0.000000	0.03702	0.071000	0.16799	2.681000	0.46926	-0.144000	0.11314	0.563000	0.77884	GCA	G|0.988;C|0.012	0.012	strong		0.637	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465	
NXF1	10482	hgsc.bcm.edu	37	11	62564806	62564806	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:62564806G>A	ENST00000532297.1	-	13	1735	c.1106C>T	c.(1105-1107)aCg>aTg	p.T369M	NXF1_ENST00000531709.2_3'UTR|NXF1_ENST00000533048.1_5'Flank|NXF1_ENST00000294172.2_Missense_Mutation_p.T369M			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	369					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGGCGGTAACGTCGTGGGGGC	0.498																																					p.T369M		Atlas-SNP	.											.	NXF1	67	.	0			c.C1106T						PASS	.						116.0	101.0	106.0					11																	62564806		2201	4299	6500	SO:0001583	missense	10482	exon12			GGTAACGTCGTGG	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.1106C>T	11.37:g.62564806G>A	ENSP00000436679:p.Thr369Met	Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	112	54	0.482143	NM_006362	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	37	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	G	8.858	0.946327	0.18356	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875	T;T;T	0.63744	-0.06;-0.06;-0.06	5.42	-7.16	0.01516	.	0.924293	0.09295	N	0.821746	T	0.57917	0.2086	M	0.62016	1.91	0.09310	N	0.999999	B;B	0.18461	0.028;0.005	B;B	0.16289	0.015;0.001	T	0.37549	-0.9701	10	0.29301	T	0.29	0.0011	20.7843	0.99721	0.1545:0.0:0.8455:0.0	.	412;369	E9PIN3;Q9UBU9	.;NXF1_HUMAN	M	369;369;412	ENSP00000294172:T369M;ENSP00000436679:T369M;ENSP00000435742:T412M	ENSP00000294172:T369M	T	-	2	0	NXF1	62321382	0.008000	0.16893	0.001000	0.08648	0.512000	0.34134	0.602000	0.24134	-1.382000	0.02109	-0.300000	0.09419	ACG	.	.	none		0.498	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
LRRC73	221424	hgsc.bcm.edu	37	6	43477491	43477491	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:43477491C>G	ENST00000372441.1	-	1	933	c.33G>C	c.(31-33)gaG>gaC	p.E11D		NM_001012974.1	NP_001012992.1	Q5JTD7	LRC73_HUMAN	leucine rich repeat containing 73	11																	CGGACAGCGGCTCCCCCGAAA	0.751																																					p.E11D		Atlas-SNP	.											.	.	.	.	0			c.G33C						PASS	.						7.0	8.0	8.0					6																	43477491		1868	3757	5625	SO:0001583	missense	221424	exon1			CAGCGGCTCCCCC		CCDS34456.1	6p21.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000204052	ENSG00000204052			21375	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 154"""	C6orf154			Standard	NM_001012974		Approved	dJ337H4.2	uc003ovk.2	Q5JTD7	OTTHUMG00000014737	ENST00000372441.1:c.33G>C	6.37:g.43477491C>G	ENSP00000361518:p.Glu11Asp	Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	18	17	0.944444	NM_001012974		Missense_Mutation	SNP	ENST00000372441.1	37	CCDS34456.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.094211	0.56075	.	.	ENSG00000204052	ENST00000372441	T	0.52526	0.66	3.92	2.11	0.27256	.	0.220438	0.37304	U	0.002148	T	0.27900	0.0687	M	0.72118	2.19	0.80722	D	1	B	0.24768	0.111	B	0.28305	0.088	T	0.07520	-1.0768	10	0.30854	T	0.27	-2.5639	9.6261	0.39752	0.0:0.8277:0.0:0.1723	.	11	Q5JTD7	CF154_HUMAN	D	11	ENSP00000361518:E11D	ENSP00000361518:E11D	E	-	3	2	C6orf154	43585469	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	1.350000	0.34010	0.259000	0.21709	-0.379000	0.06801	GAG	.	.	none		0.751	LRRC73-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040635.1	NM_001012974	
GOLGB1	2804	hgsc.bcm.edu	37	3	121414039	121414039	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:121414039G>A	ENST00000340645.5	-	13	5441	c.5316C>T	c.(5314-5316)aaC>aaT	p.N1772N	GOLGB1_ENST00000393667.3_Silent_p.N1777N	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1772					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TGGCCTCTAGGTTAGCTTGTT	0.398																																					p.N1777N		Atlas-SNP	.											.	GOLGB1	319	.	0			c.C5331T						PASS	.						301.0	281.0	287.0					3																	121414039		2203	4300	6503	SO:0001819	synonymous_variant	2804	exon13			CTCTAGGTTAGCT	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.5316C>T	3.37:g.121414039G>A		Somatic	342	1	0.00292398		WXS	Illumina HiSeq	Phase_I	361	141	0.390582	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Silent	SNP	ENST00000340645.5	37	CCDS3004.1																																																																																			.	.	none		0.398	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
CBWD3	445571	hgsc.bcm.edu	37	9	70871836	70871836	+	Splice_Site	SNP	C	C	G	rs376362566		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr9:70871836C>G	ENST00000360171.6	+	5	981		c.e5-1		CBWD3_ENST00000377342.5_Intron	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3								ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		TATATTTTCACGTGCAGTGGC	0.289																																					.		Atlas-SNP	.											CBWD3,rectum,carcinoma,-1,1	CBWD3	10	1	0			c.431-1C>G						scavenged	.						25.0	31.0	29.0					9																	70871836		2190	4250	6440	SO:0001630	splice_region_variant	445571	exon5			TTTTCACGTGCAG	BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.431-1C>G	9.37:g.70871836C>G		Somatic	1146	11	0.0095986		WXS	Illumina HiSeq	Phase_I	1247	18	0.0144346	NM_201453	B4DNG9|Q6VB91	Splice_Site	SNP	ENST00000360171.6	37	CCDS35038.1	.	.	.	.	.	.	.	.	.	.	c	14.78	2.637800	0.47049	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344	.	.	.	3.38	3.38	0.38709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.714	0.51641	0.0:0.1812:0.8188:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBWD3	70061656	1.000000	0.71417	0.991000	0.47740	0.802000	0.45316	7.061000	0.76699	0.543000	0.28864	-0.676000	0.03789	.	C|0.500;G|0.500	0.500	weak		0.289	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1	NM_201453	Intron
MUC6	4588	hgsc.bcm.edu	37	11	1016749	1016749	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:1016749T>C	ENST00000421673.2	-	31	6102	c.6052A>G	c.(6052-6054)Act>Gct	p.T2018A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2018	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTACTTGGAGTCACCAAGGAG	0.542																																					p.T2018A		Atlas-SNP	.											.	MUC6	408	.	0			c.A6052G						PASS	.						795.0	734.0	755.0					11																	1016749		2203	4295	6498	SO:0001583	missense	4588	exon31			TTGGAGTCACCAA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6052A>G	11.37:g.1016749T>C	ENSP00000406861:p.Thr2018Ala	Somatic	454	0	0		WXS	Illumina HiSeq	Phase_I	425	20	0.0470588	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	T	11.21	1.571617	0.28003	.	.	ENSG00000184956	ENST00000421673	T	0.26660	1.72	2.8	1.55	0.23275	.	.	.	.	.	T	0.25382	0.0617	L	0.44542	1.39	0.09310	N	1	D	0.52996	0.957	P	0.51355	0.667	T	0.13282	-1.0515	9	0.14252	T	0.57	.	6.5144	0.22240	0.2164:0.0:0.0:0.7835	.	2018	Q6W4X9	MUC6_HUMAN	A	2018	ENSP00000406861:T2018A	ENSP00000406861:T2018A	T	-	1	0	MUC6	1006749	0.175000	0.23083	0.002000	0.10522	0.030000	0.12068	1.083000	0.30815	0.243000	0.21327	0.260000	0.18958	ACT	.	.	none		0.542	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MAGEB10	139422	hgsc.bcm.edu	37	X	27839462	27839462	+	Missense_Mutation	SNP	A	A	C	rs147336706	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chrX:27839462A>C	ENST00000356790.2	+	3	284	c.39A>C	c.(37-39)gaA>gaC	p.E13D		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	13										NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						GTGCCAGGGAAAAACGCCGTC	0.527																																					p.E13D		Atlas-SNP	.											.	MAGEB10	107	.	0			c.A39C						PASS	.						54.0	54.0	54.0					X																	27839462		2202	4300	6502	SO:0001583	missense	139422	exon3			CAGGGAAAAACGC		CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.39A>C	X.37:g.27839462A>C	ENSP00000368304:p.Glu13Asp	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	250	49	0.196	NM_182506	Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	ENST00000356790.2	37	CCDS35221.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.320930	0.41096	.	.	ENSG00000177689	ENST00000356790	T	0.08896	3.04	2.51	-1.62	0.08372	Melanoma associated antigen, MAGE, N-terminal (1);	1.247610	0.06246	U	0.691280	T	0.20007	0.0481	M	0.83223	2.63	0.09310	N	1	D	0.53462	0.96	P	0.53006	0.715	T	0.21449	-1.0245	10	0.54805	T	0.06	.	5.7982	0.18399	0.5237:0.0:0.4763:0.0	.	13	Q96LZ2	MAGBA_HUMAN	D	13	ENSP00000368304:E13D	ENSP00000368304:E13D	E	+	3	2	MAGEB10	27749383	0.044000	0.20184	0.001000	0.08648	0.012000	0.07955	-0.122000	0.10627	-0.468000	0.06922	0.339000	0.21740	GAA	A|0.993;G|0.007	.	alt		0.527	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106216.1	NM_182506	
COL5A1	1289	hgsc.bcm.edu	37	9	137726979	137726979	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr9:137726979C>T	ENST00000371817.3	+	65	5713	c.5299C>T	c.(5299-5301)Ctg>Ttg	p.L1767L		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1767	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCTCCGCTTCCTGGGCTCCAA	0.657																																					p.L1767L		Atlas-SNP	.											.	COL5A1	323	.	0			c.C5299T						PASS	.						90.0	72.0	78.0					9																	137726979		2203	4300	6503	SO:0001819	synonymous_variant	1289	exon65			CGCTTCCTGGGCT	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.5299C>T	9.37:g.137726979C>T		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	28	13	0.464286	NM_000093	Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406309	0.25378	.	.	ENSG00000130635	ENST00000371820	.	.	.	5.03	2.78	0.32641	.	.	.	.	.	T	0.61776	0.2374	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59789	-0.7388	4	.	.	.	.	11.6076	0.51041	0.0:0.8236:0.0:0.1764	.	.	.	.	L	186	.	.	P	+	2	0	COL5A1	136866800	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.500000	0.45381	1.090000	0.41315	0.561000	0.74099	CCT	.	.	none		0.657	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
COL16A1	1307	hgsc.bcm.edu	37	1	32124550	32124550	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:32124550G>A	ENST00000373672.3	-	63	4411	c.3895C>T	c.(3895-3897)Cca>Tca	p.P1299S	RP11-73M7.6_ENST00000591592.1_RNA|RP11-73M7.6_ENST00000585413.1_RNA|RP11-73M7.6_ENST00000609338.1_RNA|RP11-73M7.6_ENST00000608888.1_RNA|RP11-73M7.6_ENST00000593188.1_RNA|RP11-73M7.6_ENST00000589462.1_RNA|RP11-73M7.6_ENST00000609625.1_RNA|COL16A1_ENST00000271069.6_Missense_Mutation_p.P1299S|RP11-73M7.6_ENST00000610216.1_RNA|RP11-73M7.6_ENST00000610043.1_RNA|RP11-73M7.6_ENST00000609373.1_RNA|RP11-73M7.6_ENST00000588288.1_RNA|RP11-73M7.6_ENST00000609549.1_RNA|RP11-73M7.6_ENST00000609033.1_RNA|RP11-73M7.6_ENST00000587445.1_RNA|RP11-73M7.6_ENST00000607926.1_RNA|RP11-73M7.6_ENST00000608246.1_RNA|RP11-73M7.6_ENST00000585660.1_RNA|RP11-73M7.6_ENST00000445166.1_RNA|RP11-73M7.6_ENST00000608332.1_RNA|RP11-73M7.6_ENST00000591929.1_RNA	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1299	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GGCTGGCCTGGAGGCCCTGGT	0.572																																					p.P1299S	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.C3895T						PASS	.						29.0	36.0	34.0					1																	32124550		1968	4118	6086	SO:0001583	missense	1307	exon63			GGCCTGGAGGCCC	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3895C>T	1.37:g.32124550G>A	ENSP00000362776:p.Pro1299Ser	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	34	13	0.382353	NM_001856	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319289	0.41096	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000440437	D;D;D	0.93859	-3.3;-3.3;-2.81	4.43	4.43	0.53597	.	0.154041	0.44097	D	0.000481	D	0.94883	0.8346	M	0.74258	2.255	0.27094	N	0.96278	D;D	0.61697	0.99;0.969	P;P	0.56278	0.757;0.795	D	0.89856	0.4013	10	0.30854	T	0.27	.	14.3521	0.66711	0.0:0.0:1.0:0.0	.	1299;1297	Q07092;Q07092-2	COGA1_HUMAN;.	S	1299;1299;156	ENSP00000362776:P1299S;ENSP00000271069:P1299S;ENSP00000390281:P156S	ENSP00000271069:P1299S	P	-	1	0	COL16A1	31897137	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.229000	0.58625	2.179000	0.69175	0.563000	0.77884	CCA	.	.	none		0.572	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
TECTA	7007	hgsc.bcm.edu	37	11	120989139	120989139	+	Silent	SNP	C	C	T	rs367974065		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:120989139C>T	ENST00000392793.1	+	7	1186	c.915C>T	c.(913-915)tgC>tgT	p.C305C	TECTA_ENST00000264037.2_Silent_p.C305C			O75443	TECTA_HUMAN	tectorin alpha	305	VWFC.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		ACGAGGTGTGCGAACCCAAAG	0.532																																					p.C305C		Atlas-SNP	.											.	TECTA	329	.	0			c.C915T						PASS	.	C		0,4406		0,0,2203	102.0	98.0	99.0		915	0.6	1.0	11		99	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	TECTA	NM_005422.2		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		305/2156	120989139	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	7007	exon6			GGTGTGCGAACCC	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.915C>T	11.37:g.120989139C>T		Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	127	60	0.472441	NM_005422		Silent	SNP	ENST00000392793.1	37	CCDS8434.1																																																																																			.	.	weak		0.532	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
AKT2	208	hgsc.bcm.edu	37	19	40741861	40741861	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:40741861G>A	ENST00000392038.2	-	11	1409	c.1111C>T	c.(1111-1113)Cgc>Tgc	p.R371C	AKT2_ENST00000579047.1_Missense_Mutation_p.R309C|AKT2_ENST00000424901.1_Missense_Mutation_p.R371C|AKT2_ENST00000311278.6_Missense_Mutation_p.R328C	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	371	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			CTGAGCGTGCGCGGGAAGCGG	0.647			A		"""ovarian, pancreatic """																																p.R371C		Atlas-SNP	.		Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	AKT2,NS,carcinoma,+1,1	AKT2	53	1	0			c.C1111T						PASS	.						57.0	54.0	55.0					19																	40741861		2203	4300	6503	SO:0001583	missense	208	exon11			GCGTGCGCGGGAA	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.1111C>T	19.37:g.40741861G>A	ENSP00000375892:p.Arg371Cys	Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	21	6	0.285714	NM_001626	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	ENST00000392038.2	37	CCDS12552.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.151570	0.38021	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000311278;ENST00000391845	T;T;T	0.59083	0.29;0.29;0.29	5.77	4.73	0.59995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.094359	0.64402	D	0.000001	T	0.52108	0.1714	L	0.52206	1.635	0.80722	D	1	B;B;B	0.27791	0.022;0.02;0.189	B;B;B	0.25506	0.026;0.013;0.061	T	0.52815	-0.8525	10	0.51188	T	0.08	.	13.9471	0.64091	0.0744:0.0:0.9256:0.0	.	309;328;371	B4DG79;Q0VAN0;P31751	.;.;AKT2_HUMAN	C	371;272;371;328;191	ENSP00000375892:R371C;ENSP00000399532:R371C;ENSP00000309428:R328C	ENSP00000309428:R328C	R	-	1	0	AKT2	45433701	1.000000	0.71417	0.900000	0.35374	0.907000	0.53573	3.635000	0.54309	1.449000	0.47699	0.555000	0.69702	CGC	.	.	none		0.647	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626	
ADAM21	8747	hgsc.bcm.edu	37	14	70924294	70924294	+	Silent	SNP	C	C	T	rs112060847		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr14:70924294C>T	ENST00000603540.1	+	2	336	c.78C>T	c.(76-78)tcC>tcT	p.S26S	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Silent_p.S26S	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	26					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGTCTATTTCCGGCTACTGTC	0.542																																					p.S26S		Atlas-SNP	.											ADAM21_ENST00000267499,NS,malignant_melanoma,+1,4	ADAM21	181	4	0			c.C78T						scavenged	.						101.0	110.0	107.0					14																	70924294		2203	4300	6503	SO:0001819	synonymous_variant	8747	exon2			TATTTCCGGCTAC	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.78C>T	14.37:g.70924294C>T		Somatic	125	6	0.048		WXS	Illumina HiSeq	Phase_I	143	8	0.0559441	NM_003813	O43507|Q2VPC6|Q32MR0	Silent	SNP	ENST00000603540.1	37	CCDS9804.1																																																																																			C|0.779;T|0.221	0.221	strong		0.542	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
DOCK6	57572	hgsc.bcm.edu	37	19	11363469	11363469	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:11363469G>A	ENST00000294618.7	-	3	309	c.298C>T	c.(298-300)Ccc>Tcc	p.P100S		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	100					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						TCATCCTTGGGGATCCCGGGC	0.642																																					p.P100S		Atlas-SNP	.											.	DOCK6	104	.	0			c.C298T						PASS	.						23.0	26.0	25.0					19																	11363469		1960	4143	6103	SO:0001583	missense	57572	exon3			CCTTGGGGATCCC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.298C>T	19.37:g.11363469G>A	ENSP00000294618:p.Pro100Ser	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	57	6	0.105263	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735441	0.69189	.	.	ENSG00000130158	ENST00000294618	T	0.79454	-1.27	4.59	4.59	0.56863	.	0.074083	0.56097	D	0.000034	D	0.88470	0.6445	M	0.85630	2.765	0.80722	D	1	D	0.67145	0.996	D	0.68039	0.955	D	0.90811	0.4701	10	0.87932	D	0	-22.0449	16.174	0.81840	0.0:0.0:1.0:0.0	.	100	Q96HP0	DOCK6_HUMAN	S	100	ENSP00000294618:P100S	ENSP00000294618:P100S	P	-	1	0	DOCK6	11224469	1.000000	0.71417	0.743000	0.31040	0.394000	0.30568	8.562000	0.90719	2.100000	0.63781	0.561000	0.74099	CCC	.	.	none		0.642	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
FLNA	2316	hgsc.bcm.edu	37	X	153578209	153578209	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chrX:153578209T>A	ENST00000369850.3	-	46	7596	c.7360A>T	c.(7360-7362)Acg>Tcg	p.T2454S	FLNA_ENST00000344736.4_Missense_Mutation_p.T2414S|FLNA_ENST00000369856.3_Missense_Mutation_p.T587S|FLNA_ENST00000498491.1_5'UTR|FLNA_ENST00000422373.1_Missense_Mutation_p.T2446S|FLNA_ENST00000360319.4_Missense_Mutation_p.T2446S	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	2454					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCATTGCTCGTGTTCACGACG	0.637											OREG0003592	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T2454S		Atlas-SNP	.											.	FLNA	373	.	0			c.A7360T						PASS	.						36.0	36.0	36.0					X																	153578209		2070	4180	6250	SO:0001583	missense	2316	exon46			TGCTCGTGTTCAC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.7360A>T	X.37:g.153578209T>A	ENSP00000358866:p.Thr2454Ser	Somatic	56	0	0	1756	WXS	Illumina HiSeq	Phase_I	72	15	0.208333	NM_001110556	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	T	16.01	3.002443	0.54254	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000369856;ENST00000344736	D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96	5.32	5.32	0.75619	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92440	0.7600	M	0.83483	2.645	0.45161	D	0.99817	D;D;D;D	0.89917	0.968;0.965;1.0;1.0	D;P;D;D	0.85130	0.96;0.607;0.997;0.997	D	0.93165	0.6561	10	0.59425	D	0.04	.	14.335	0.66584	0.0:0.0:0.0:1.0	.	587;2446;2454;2454	E9PHF0;P21333-2;P21333;E9KL45	.;.;FLNA_HUMAN;.	S	2446;2122;2446;2454;587;2414	ENSP00000353467:T2446S;ENSP00000416926:T2446S;ENSP00000358866:T2454S;ENSP00000358872:T587S;ENSP00000358863:T2414S	ENSP00000358863:T2414S	T	-	1	0	FLNA	153231403	1.000000	0.71417	0.987000	0.45799	0.272000	0.26649	7.996000	0.88334	1.764000	0.52075	0.350000	0.21858	ACG	.	.	none		0.637	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
SPRY3	10251	hgsc.bcm.edu	37	X	155004002	155004002	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chrX:155004002C>A	ENST00000302805.2	+	2	900	c.469C>A	c.(469-471)Ccc>Acc	p.P157T		NM_005840.1	NP_005831.1	O43610	SPY3_HUMAN	sprouty homolog 3 (Drosophila)	157	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				multicellular organismal development (GO:0007275)|regulation of signal transduction (GO:0009966)	cytoplasm (GO:0005737)|membrane (GO:0016020)						all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CAAGTGCGTCCCCTGCACAGC	0.592																																					p.P157T		Atlas-SNP	.											.	SPRY3	52	.	0			c.C469A						PASS	.						140.0	140.0	140.0					X																	155004002		2203	4296	6499	SO:0001583	missense	10251	exon2			TGCGTCCCCTGCA	AF041038	CCDS14769.4	Xq28 and Yq12	2008-02-05	2001-11-28		ENSG00000168939	ENSG00000168939		"""Pseudoautosomal regions / PAR2"""	11271	protein-coding gene	gene with protein product	"""antagonist of FGF signaling"""	300531	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005840		Approved	HSPRY3	uc004fnq.1	O43610	OTTHUMG00000022675	ENST00000302805.2:c.469C>A	X.37:g.155004002C>A	ENSP00000302978:p.Pro157Thr	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	157	53	0.33758	NM_005840	A8K0H8	Missense_Mutation	SNP	ENST00000302805.2	37	CCDS14769.4	.	.	.	.	.	.	.	.	.	.	C	8.853	0.945004	0.18356	.	.	ENSG00000168939	ENST00000302805	T	0.62232	0.04	2.71	2.71	0.32032	.	0.323378	0.29034	N	0.013349	T	0.44993	0.1320	.	.	.	0.09310	N	1	B	0.26975	0.165	B	0.16722	0.016	T	0.38693	-0.9649	9	0.51188	T	0.08	-30.9202	7.1284	0.25486	0.0:0.7231:0.2769:0.0	.	157	O43610	SPY3_HUMAN	T	157	ENSP00000302978:P157T	ENSP00000302978:P157T	P	+	1	0	SPRY3	154657196	0.997000	0.39634	0.995000	0.50966	0.748000	0.42578	3.822000	0.55708	1.366000	0.46076	0.279000	0.19357	CCC	.	.	none		0.592	SPRY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058823.2	NM_005840	
GPR158	57512	hgsc.bcm.edu	37	10	25887600	25887600	+	Silent	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr10:25887600C>A	ENST00000376351.3	+	11	3404	c.3045C>A	c.(3043-3045)acC>acA	p.T1015T	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1015					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						ATGACCTGACCCCTGGTCCTG	0.478																																					p.T1015T		Atlas-SNP	.											.	GPR158	255	.	0			c.C3045A						PASS	.						56.0	57.0	57.0					10																	25887600		2203	4300	6503	SO:0001819	synonymous_variant	57512	exon11			CCTGACCCCTGGT	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3045C>A	10.37:g.25887600C>A		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	77	27	0.350649	NM_020752	Q6QR81|Q9ULT3	Silent	SNP	ENST00000376351.3	37	CCDS31166.1																																																																																			.	.	none		0.478	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
MUC17	140453	hgsc.bcm.edu	37	7	100684573	100684573	+	Silent	SNP	G	G	A	rs144023476	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr7:100684573G>A	ENST00000306151.4	+	3	9940	c.9876G>A	c.(9874-9876)acG>acA	p.T3292T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3292	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCACCACAACGGTGGCCAGTT	0.512													G|||	172	0.034345	0.0688	0.0072	5008	,	,		27204	0.0298		0.0149	False		,,,				2504	0.0317				p.T3292T		Atlas-SNP	.											MUC17,NS,haematopoietic_neoplasm,0,1	MUC17	804	1	0			c.G9876A						scavenged	.	G		35,4371	28.1+/-56.4	2,31,2170	331.0	330.0	330.0		9876	-2.6	0.0	7	dbSNP_134	330	5,8595	2.2+/-6.3	0,5,4295	no	coding-synonymous	MUC17	NM_001040105.1		2,36,6465	AA,AG,GG		0.0581,0.7944,0.3076		3292/4494	100684573	40,12966	2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			CACAACGGTGGCC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9876G>A	7.37:g.100684573G>A		Somatic	60	1	0.0166667		WXS	Illumina HiSeq	Phase_I	50	3	0.06	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																			G|0.984;A|0.016	0.016	strong		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
FLG	2312	hgsc.bcm.edu	37	1	152276368	152276368	+	Missense_Mutation	SNP	C	C	G	rs201216189		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:152276368C>G	ENST00000368799.1	-	3	11029	c.10994G>C	c.(10993-10995)aGt>aCt	p.S3665T	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3665	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCACTGTCACTGGCCTGACT	0.587									Ichthyosis																												p.S3665T		Atlas-SNP	.											FLG,NS,carcinoma,0,1	FLG	900	1	0			c.G10994C						scavenged	.						34.0	36.0	36.0					1																	152276368		2201	4268	6469	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CTGTCACTGGCCT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10994G>C	1.37:g.152276368C>G	ENSP00000357789:p.Ser3665Thr	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	124	4	0.0322581	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.369374	0.24771	.	.	ENSG00000143631	ENST00000368799	T	0.08008	3.14	4.62	1.67	0.24075	.	.	.	.	.	T	0.04724	0.0128	M	0.69823	2.125	0.09310	N	1	B	0.31383	0.321	B	0.42112	0.376	T	0.45731	-0.9241	9	0.15499	T	0.54	.	6.3601	0.21422	0.0:0.5359:0.3655:0.0986	.	3665	P20930	FILA_HUMAN	T	3665	ENSP00000357789:S3665T	ENSP00000357789:S3665T	S	-	2	0	FLG	150542992	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	-0.297000	0.08276	0.647000	0.30713	0.552000	0.68991	AGT	.	.	weak		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CHIT1	1118	hgsc.bcm.edu	37	1	203186950	203186950	+	Nonsense_Mutation	SNP	C	C	T	rs201320385|rs3831317|rs150192398	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:203186950C>T	ENST00000367229.1	-	10	1107	c.1073G>A	c.(1072-1074)tGg>tAg	p.W358*	CHIT1_ENST00000255427.3_Nonsense_Mutation_p.W339*|CHIT1_ENST00000484834.1_5'UTR|CHIT1_ENST00000535569.1_Nonsense_Mutation_p.W349*	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	358					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						GTCCAGTGCCCAGACCATGGC	0.632																																					p.W358X		Atlas-SNP	.											CHIT1,colon,carcinoma,0,2	CHIT1	61	2	0			c.G1073A						PASS	.						60.0	52.0	54.0					1																	203186950		2203	4300	6503	SO:0001587	stop_gained	1118	exon10			AGTGCCCAGACCA	U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1073G>A	1.37:g.203186950C>T	ENSP00000356198:p.Trp358*	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	55	5	0.0909091	NM_003465	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Nonsense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918897	0.73098	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	.	.	.	4.57	4.57	0.56435	.	0.000000	0.42053	D	0.000776	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7042	15.2284	0.73369	0.0:1.0:0.0:0.0	.	.	.	.	X	358;339;349	.	ENSP00000255427:W339X	W	-	2	0	CHIT1	201453573	1.000000	0.71417	0.432000	0.26747	0.080000	0.17528	6.938000	0.75904	2.238000	0.73509	0.563000	0.77884	TGG	C|0.989;T|0.011	0.011	strong		0.632	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465	
ERCC5	2073	hgsc.bcm.edu	37	13	103528055	103528055	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr13:103528055G>T	ENST00000355739.4	+	15	4786	c.3363G>T	c.(3361-3363)gaG>gaT	p.E1121D	ERCC5_ENST00000375954.1_Missense_Mutation_p.E354D|ERCC5_ENST00000472247.1_3'UTR	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	1121					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CTGCGAAAGAGCCAAAAACCA	0.473			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.E1575D		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	.	.	.	0			c.G4725T						PASS	.						45.0	44.0	45.0					13																	103528055		2203	4300	6503	SO:0001583	missense	0	exon23	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GAAAGAGCCAAAA	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.3363G>T	13.37:g.103528055G>T	ENSP00000347978:p.Glu1121Asp	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	64	59	0.921875	NM_001204425	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	G	9.150	1.015967	0.19355	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	T;T	0.06933	3.57;3.24	4.68	0.389	0.16269	.	1.270480	0.05133	N	0.492840	T	0.07188	0.0182	L	0.41236	1.265	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.43589	-0.9382	10	0.15952	T	0.53	0.7098	4.9663	0.14093	0.074:0.1278:0.5347:0.2634	.	1121	P28715	ERCC5_HUMAN	D	1546;1121;953;354	ENSP00000347978:E1121D;ENSP00000365121:E354D	ENSP00000347978:E1121D	E	+	3	2	ERCC5	102326056	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.024000	0.12435	0.108000	0.17862	0.650000	0.86243	GAG	.	.	none		0.473	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
HSPG2	3339	hgsc.bcm.edu	37	1	22207014	22207014	+	Silent	SNP	G	G	A	rs377560753		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:22207014G>A	ENST00000374695.3	-	16	2116	c.2037C>T	c.(2035-2037)cgC>cgT	p.R679R		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	679	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCAGCTCCGCGCGCTGCACCG	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		19729	0.001		0.0	False		,,,				2504	0.0				p.R679R		Atlas-SNP	.											.	HSPG2	311	.	0			c.C2037T						PASS	.	G		0,4398		0,0,2199	35.0	32.0	33.0		2037	-5.2	0.2	1		33	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	HSPG2	NM_005529.5		0,1,6497	AA,AG,GG		0.0116,0.0,0.0077		679/4392	22207014	1,12995	2199	4299	6498	SO:0001819	synonymous_variant	3339	exon16			CTCCGCGCGCTGC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.2037C>T	1.37:g.22207014G>A		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	72	32	0.444444	NM_005529	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	CCDS30625.1																																																																																			.	.	none		0.632	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
FLNC	2318	hgsc.bcm.edu	37	7	128492881	128492881	+	Splice_Site	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr7:128492881G>A	ENST00000325888.8	+	37	6265		c.e37-1		FLNC_ENST00000346177.6_Splice_Site|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma						cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						ACTTTCCACAGGGATCTCCTT	0.647																																					.		Atlas-SNP	.											.	FLNC	339	.	0			c.6005-1G>A						PASS	.						58.0	65.0	63.0					7																	128492881		2033	4187	6220	SO:0001630	splice_region_variant	2318	exon37			TCCACAGGGATCT	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.6005-1G>A	7.37:g.128492881G>A		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	77	29	0.376623	NM_001458	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Splice_Site	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552313	0.86127	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9025	0.96993	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FLNC	128280117	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	9.806000	0.99153	2.722000	0.93159	0.655000	0.94253	.	.	.	none		0.647	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		Intron
ARHGAP5	394	hgsc.bcm.edu	37	14	32561296	32561296	+	Missense_Mutation	SNP	T	T	C	rs200111638		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr14:32561296T>C	ENST00000345122.3	+	2	1736	c.1421T>C	c.(1420-1422)gTa>gCa	p.V474A	ARHGAP5_ENST00000556611.1_Missense_Mutation_p.V474A|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.V474A|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.V474A	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	474	FF 3.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGCAAAGAGGTATATGGTAGG	0.368																																					p.V474A	NSCLC(9;77 350 3443 29227 41353)	Atlas-SNP	.											ARHGAP5,caecum,carcinoma,0,26	ARHGAP5	166	26	0			c.T1421C						scavenged	.						74.0	77.0	76.0					14																	32561296		2203	4297	6500	SO:0001583	missense	394	exon2			AAGAGGTATATGG	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1421T>C	14.37:g.32561296T>C	ENSP00000371897:p.Val474Ala	Somatic	109	2	0.0183486		WXS	Illumina HiSeq	Phase_I	102	6	0.0588235	NM_001173	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311365	0.60414	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.12039	2.72;2.72;2.72;2.72	6.02	6.02	0.97574	FF domain (1);	0.000000	0.85682	D	0.000000	T	0.25457	0.0619	L	0.40543	1.245	0.80722	D	1	P;P	0.49961	0.93;0.885	P;P	0.56042	0.79;0.622	T	0.00254	-1.1874	10	0.56958	D	0.05	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	474;474	Q13017-2;Q13017	.;RHG05_HUMAN	A	474	ENSP00000452222:V474A;ENSP00000441692:V474A;ENSP00000371897:V474A;ENSP00000393307:V474A	ENSP00000371897:V474A	V	+	2	0	ARHGAP5	31631047	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	8.040000	0.89188	2.299000	0.77371	0.528000	0.53228	GTA	T|0.999;C|0.001	0.001	weak		0.368	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
HAUS8	93323	hgsc.bcm.edu	37	19	17166719	17166719	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:17166719G>A	ENST00000253669.5	-	9	929	c.739C>T	c.(739-741)Ctg>Ttg	p.L247L	HAUS8_ENST00000593360.1_Silent_p.L186L|CTD-2528A14.3_ENST00000598893.1_RNA|HAUS8_ENST00000448593.2_Silent_p.L246L			Q9BT25	HAUS8_HUMAN	HAUS augmin-like complex, subunit 8	247					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	12						CTCACGGGCAGCTCGTGCCTG	0.632																																					p.L247L		Atlas-SNP	.											.	HAUS8	31	.	0			c.C739T						PASS	.						137.0	108.0	118.0					19																	17166719		2203	4300	6503	SO:0001819	synonymous_variant	93323	exon9			CGGGCAGCTCGTG	BC004398	CCDS32948.1, CCDS46009.1	19p13.11	2013-10-11	2009-04-20	2009-04-20	ENSG00000131351	ENSG00000131351		"""HAUS augmin-like complex subunits"""	30532	protein-coding gene	gene with protein product		613434	"""HEC1/NDC80 interacting, centrosome associated 1"""	HICE1		19427217	Standard	XM_005260154		Approved	MGC20533, NY-SAR-48	uc002nfe.3	Q9BT25		ENST00000253669.5:c.739C>T	19.37:g.17166719G>A		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	46	21	0.456522	NM_033417	B4DJA7|C9JBZ4|Q49AC4|Q86WF0|Q96FX3	Silent	SNP	ENST00000253669.5	37	CCDS32948.1																																																																																			.	.	none		0.632	HAUS8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463015.1	NM_001011699	
NACC2	138151	hgsc.bcm.edu	37	9	138903792	138903792	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr9:138903792C>T	ENST00000371753.1	-	5	1392	c.1334G>A	c.(1333-1335)cGc>cAc	p.R445H	NACC2_ENST00000277554.2_Missense_Mutation_p.R445H			Q96BF6	NACC2_HUMAN	NACC family member 2, BEN and BTB (POZ) domain containing	445	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.				cellular protein complex localization (GO:0034629)|histone deacetylation (GO:0016575)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle by negative regulation of transcription from RNA polymerase II promoter (GO:1900477)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|posttranscriptional regulation of gene expression (GO:0010608)|protein homooligomerization (GO:0051260)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5						GCGAACGCGGCGGGCGTTGGT	0.662																																					p.R445H		Atlas-SNP	.											.	NACC2	16	.	0			c.G1334A						PASS	.						33.0	28.0	30.0					9																	138903792		2198	4296	6494	SO:0001583	missense	138151	exon6			ACGCGGCGGGCGT	BC015649	CCDS6993.1	9q34.3	2013-01-09	2008-10-03	2008-10-03	ENSG00000148411	ENSG00000148411		"""BEN domain containing"", ""BTB/POZ domain containing"""	23846	protein-coding gene	gene with protein product	"""BEN domain containing 9"""	615786	"""BTB (POZ) domain containing 14A"""	BTBD14A		12477932	Standard	NM_144653		Approved	MGC23427, BEND9, BTBD31	uc004cgv.4	Q96BF6	OTTHUMG00000020921	ENST00000371753.1:c.1334G>A	9.37:g.138903792C>T	ENSP00000360818:p.Arg445His	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	83	39	0.46988	NM_144653		Missense_Mutation	SNP	ENST00000371753.1	37	CCDS6993.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023864	0.93462	.	.	ENSG00000148411	ENST00000371753;ENST00000277554	T;T	0.52295	0.67;0.67	5.23	4.33	0.51752	BEN domain (2);	0.000000	0.85682	D	0.000000	T	0.54078	0.1836	N	0.24115	0.695	0.47123	D	0.999329	D	0.89917	1.0	D	0.85130	0.997	T	0.59069	-0.7523	10	0.87932	D	0	.	13.0677	0.59043	0.0:0.9215:0.0:0.0785	.	445	Q96BF6	NACC2_HUMAN	H	445	ENSP00000360818:R445H;ENSP00000277554:R445H	ENSP00000277554:R445H	R	-	2	0	NACC2	138043613	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.626000	0.83164	1.193000	0.43086	0.313000	0.20887	CGC	.	.	none		0.662	NACC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055040.1	NM_144653	
AHNAK2	113146	hgsc.bcm.edu	37	14	105412163	105412163	+	Missense_Mutation	SNP	C	C	G	rs201181175		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr14:105412163C>G	ENST00000333244.5	-	7	9744	c.9625G>C	c.(9625-9627)Gtg>Ctg	p.V3209L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3209						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGAGCTTCACGTCCACCTGG	0.607																																					p.V3209L		Atlas-SNP	.											AHNAK2_ENST00000333244,NS,carcinoma,0,1	AHNAK2	719	1	0			c.G9625C						scavenged	.						108.0	70.0	83.0					14																	105412163		1920	3847	5767	SO:0001583	missense	113146	exon7			GCTTCACGTCCAC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9625G>C	14.37:g.105412163C>G	ENSP00000353114:p.Val3209Leu	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	82	3	0.0365854	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	9.043	0.990179	0.18966	.	.	ENSG00000185567	ENST00000333244	T	0.01119	5.31	2.98	-2.26	0.06867	.	.	.	.	.	T	0.00906	0.0030	L	0.35723	1.085	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.48875	-0.8996	9	0.22109	T	0.4	.	0.8864	0.01245	0.2903:0.3589:0.1435:0.2074	.	3209	Q8IVF2	AHNK2_HUMAN	L	3209	ENSP00000353114:V3209L	ENSP00000353114:V3209L	V	-	1	0	AHNAK2	104483208	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.193000	0.00564	-0.054000	0.13266	0.313000	0.20887	GTG	.	.	weak		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
DIP2C	22982	hgsc.bcm.edu	37	10	332259	332259	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr10:332259G>A	ENST00000280886.6	-	34	4160	c.4073C>T	c.(4072-4074)gCc>gTc	p.A1358V		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1358						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TTCTGGGTTGGCAATTATAAT	0.478																																					p.A1358V		Atlas-SNP	.											.	DIP2C	195	.	0			c.C4073T						PASS	.						175.0	184.0	181.0					10																	332259		2203	4300	6503	SO:0001583	missense	22982	exon34			GGGTTGGCAATTA	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.4073C>T	10.37:g.332259G>A	ENSP00000280886:p.Ala1358Val	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	76	35	0.460526	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	19.49	3.836606	0.71373	.	.	ENSG00000151240	ENST00000280886;ENST00000535541	T	0.33865	1.39	5.92	5.92	0.95590	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.26484	0.0647	N	0.04320	-0.23	0.80722	D	1	B	0.23854	0.092	B	0.39971	0.315	T	0.08973	-1.0696	10	0.02654	T	1	-36.6422	20.3214	0.98679	0.0:0.0:1.0:0.0	.	1358	Q9Y2E4	DIP2C_HUMAN	V	1358;283	ENSP00000280886:A1358V	ENSP00000280886:A1358V	A	-	2	0	DIP2C	322259	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.974000	0.63771	2.804000	0.96469	0.655000	0.94253	GCC	.	.	none		0.478	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
WASF1	8936	hgsc.bcm.edu	37	6	110429812	110429812	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:110429812C>T	ENST00000392589.1	-	6	1177	c.341G>A	c.(340-342)cGc>cAc	p.R114H	WASF1_ENST00000392588.1_Missense_Mutation_p.R114H|WASF1_ENST00000359451.2_Missense_Mutation_p.R114H|WASF1_ENST00000392587.2_Missense_Mutation_p.R114H|WASF1_ENST00000392586.1_Missense_Mutation_p.R114H	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	114					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		CAAAGTCTTGCGATCGAAAAG	0.368																																					p.R114H		Atlas-SNP	.											.	WASF1	35	.	0			c.G341A						PASS	.						100.0	93.0	95.0					6																	110429812		2203	4300	6503	SO:0001583	missense	8936	exon5			GTCTTGCGATCGA	D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.341G>A	6.37:g.110429812C>T	ENSP00000376368:p.Arg114His	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	88	5	0.0568182	NM_001024935	E1P5F2|Q5SZK7	Missense_Mutation	SNP	ENST00000392589.1	37	CCDS5080.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494252	0.85069	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451;ENST00000444391;ENST00000265601;ENST00000368938	T;T;T;T;T;T;T;T	0.48201	1.21;1.21;1.21;1.21;1.21;1.21;0.82;0.82	6.06	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.32823	0.0842	M	0.67953	2.075	0.58432	D	0.999998	B	0.10296	0.003	B	0.04013	0.001	T	0.21143	-1.0254	10	0.34782	T	0.22	.	15.5809	0.76439	0.0:0.934:0.0:0.066	.	114	Q92558	WASF1_HUMAN	H	114	ENSP00000376365:R114H;ENSP00000376366:R114H;ENSP00000376368:R114H;ENSP00000376367:R114H;ENSP00000352425:R114H;ENSP00000407041:R114H;ENSP00000265601:R114H;ENSP00000357934:R114H	ENSP00000265601:R114H	R	-	2	0	WASF1	110536505	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.653000	0.61462	1.574000	0.49760	0.650000	0.86243	CGC	.	.	none		0.368	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041784.3	NM_003931	
ZBTB40	9923	hgsc.bcm.edu	37	1	22838451	22838451	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:22838451A>C	ENST00000375647.4	+	11	2492	c.2285A>C	c.(2284-2286)aAg>aCg	p.K762T	ZBTB40_ENST00000374651.4_Missense_Mutation_p.K650T|ZBTB40_ENST00000404138.1_Missense_Mutation_p.K762T	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	762					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		CGGGTGGCTAAGAGCAAACAG	0.542																																					p.K762T		Atlas-SNP	.											.	ZBTB40	87	.	0			c.A2285C						PASS	.						73.0	71.0	72.0					1																	22838451		2203	4300	6503	SO:0001583	missense	9923	exon12			TGGCTAAGAGCAA	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.2285A>C	1.37:g.22838451A>C	ENSP00000364798:p.Lys762Thr	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	72	30	0.416667	NM_001083621	O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	37	CCDS224.1	.	.	.	.	.	.	.	.	.	.	A	15.93	2.979425	0.53827	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	T;T;T	0.28666	1.6;1.6;1.6	5.73	2.11	0.27256	.	0.333683	0.25500	N	0.030257	T	0.22936	0.0554	L	0.39085	1.19	0.30131	N	0.804809	P;B	0.35272	0.493;0.361	B;B	0.35971	0.215;0.107	T	0.10451	-1.0629	10	0.48119	T	0.1	-13.5347	8.9499	0.35783	0.705:0.0:0.295:0.0	.	650;762	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	T	762;762;650	ENSP00000384527:K762T;ENSP00000364798:K762T;ENSP00000363782:K650T	ENSP00000363782:K650T	K	+	2	0	ZBTB40	22711038	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.785000	0.38684	0.101000	0.17610	0.533000	0.62120	AAG	.	.	none		0.542	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
TRPC5	7224	hgsc.bcm.edu	37	X	111090430	111090430	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chrX:111090430G>T	ENST00000262839.2	-	6	2530	c.1612C>A	c.(1612-1614)Ctt>Att	p.L538I		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	538					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TAGAAGTAAAGCTGGTTCAGT	0.453																																					p.L538I		Atlas-SNP	.											.	TRPC5	142	.	0			c.C1612A						PASS	.						153.0	132.0	139.0					X																	111090430		2203	4300	6503	SO:0001583	missense	7224	exon6			AGTAAAGCTGGTT	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1612C>A	X.37:g.111090430G>T	ENSP00000262839:p.Leu538Ile	Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	216	56	0.259259	NM_012471	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	37	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843698	0.91197	.	.	ENSG00000072315	ENST00000262839	D	0.99080	-5.4	5.16	5.16	0.70880	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99140	0.9703	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.79784	0.971;0.993	D	0.99818	1.1045	10	0.49607	T	0.09	-5.426	17.8405	0.88714	0.0:0.0:1.0:0.0	.	539;538	Q59G51;Q9UL62	.;TRPC5_HUMAN	I	538	ENSP00000262839:L538I	ENSP00000262839:L538I	L	-	1	0	TRPC5	110977086	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.814000	0.99346	2.145000	0.66743	0.436000	0.28706	CTT	.	.	none		0.453	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471	
C1orf61	10485	hgsc.bcm.edu	37	1	156386596	156386596	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:156386596C>G	ENST00000368243.1	-	3	152	c.36G>C	c.(34-36)ttG>ttC	p.L12F		NM_006365.1	NP_006356.1	Q13536	CROC4_HUMAN	chromosome 1 open reading frame 61	12						nucleus (GO:0005634)				large_intestine(2)|lung(2)|skin(1)	5	Hepatocellular(266;0.158)					GGAAGTTCCTCAAGTTAAATG	0.458																																					p.L12F		Atlas-SNP	.											.	C1orf61	15	.	0			c.G36C						PASS	.						131.0	130.0	130.0					1																	156386596		2203	4300	6503	SO:0001583	missense	10485	exon3			GTTCCTCAAGTTA		CCDS1142.1	1q22	2014-03-17			ENSG00000125462	ENSG00000125462			30780	protein-coding gene	gene with protein product	"""contingent replication of cDNA-4"", ""transcriptional activator of the c fos promoter"""					10995546, 23012322	Standard	XM_005244832		Approved	CROC4	uc001fou.1	Q13536	OTTHUMG00000031022	ENST00000368243.1:c.36G>C	1.37:g.156386596C>G	ENSP00000357226:p.Leu12Phe	Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	177	39	0.220339	NM_006365	B1ALL5|B1ALL8	Missense_Mutation	SNP	ENST00000368243.1	37	CCDS1142.1	.	.	.	.	.	.	.	.	.	.	C	19.23	3.788423	0.70337	.	.	ENSG00000125462	ENST00000368243	.	.	.	2.64	2.64	0.31445	.	.	.	.	.	T	0.24353	0.0590	N	0.14661	0.345	0.23030	N	0.998407	D	0.71674	0.998	D	0.66979	0.948	T	0.07673	-1.0760	8	0.87932	D	0	.	8.9465	0.35762	0.0:1.0:0.0:0.0	.	12	Q13536	CROC4_HUMAN	F	12	.	ENSP00000357226:L12F	L	-	3	2	C1orf61	154653220	0.044000	0.20184	0.869000	0.34112	0.596000	0.36781	0.036000	0.13819	1.776000	0.52262	0.491000	0.48974	TTG	.	.	none		0.458	C1orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075988.1	NM_006365	
TBC1D10B	26000	hgsc.bcm.edu	37	16	30380609	30380609	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:30380609A>T	ENST00000409939.3	-	1	976	c.896T>A	c.(895-897)cTg>cAg	p.L299Q		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	299					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			GCGCAGGGCCAGCCCGTTTAT	0.607																																					p.L299Q		Atlas-SNP	.											.	TBC1D10B	32	.	0			c.T896A						PASS	.						42.0	29.0	33.0					16																	30380609		2196	4298	6494	SO:0001583	missense	26000	exon1			AGGGCCAGCCCGT	BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.896T>A	16.37:g.30380609A>T	ENSP00000386538:p.Leu299Gln	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	58	18	0.310345	NM_015527	B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Missense_Mutation	SNP	ENST00000409939.3	37	CCDS10676.2	.	.	.	.	.	.	.	.	.	.	A	16.03	3.007124	0.54361	.	.	ENSG00000169221	ENST00000409939	T	0.18960	2.18	4.1	4.1	0.47936	.	0.336532	0.23552	N	0.046944	T	0.17959	0.0431	L	0.43152	1.355	0.33877	D	0.635636	P	0.37731	0.607	B	0.34180	0.177	T	0.30937	-0.9961	10	0.46703	T	0.11	.	12.2043	0.54342	1.0:0.0:0.0:0.0	.	299	Q4KMP7	TB10B_HUMAN	Q	299	ENSP00000386538:L299Q	ENSP00000386538:L299Q	L	-	2	0	TBC1D10B	30288110	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.205000	0.51090	1.730000	0.51580	0.459000	0.35465	CTG	.	.	none		0.607	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255527.3	NM_015527	
OR5H14	403273	hgsc.bcm.edu	37	3	97868377	97868377	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:97868377T>C	ENST00000437310.1	+	1	208	c.148T>C	c.(148-150)Tgg>Cgg	p.W50R	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TGCTGTCATCTGGAAAGACCC	0.403																																					p.W50R		Atlas-SNP	.											OR5H14,NS,malignant_melanoma,-2,1	OR5H14	56	1	0			c.T148C						scavenged	.						311.0	313.0	312.0					3																	97868377		2203	4300	6503	SO:0001583	missense	403273	exon1			GTCATCTGGAAAG		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.148T>C	3.37:g.97868377T>C	ENSP00000401706:p.Trp50Arg	Somatic	383	3	0.0078329		WXS	Illumina HiSeq	Phase_I	390	5	0.0128205	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	37	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	T	3.061	-0.193169	0.06259	.	.	ENSG00000236032	ENST00000437310	T	0.03801	3.8	2.49	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.993003	0.08167	N	0.987570	T	0.06142	0.0159	N	0.10760	0.04	0.09310	N	1	D	0.56968	0.978	P	0.58266	0.836	T	0.50101	-0.8867	10	0.25106	T	0.35	.	8.4219	0.32705	0.0:0.0:0.0:1.0	.	50	A6NHG9	O5H14_HUMAN	R	50	ENSP00000401706:W50R	ENSP00000401706:W50R	W	+	1	0	OR5H14	99351067	0.000000	0.05858	0.995000	0.50966	0.396000	0.30629	-0.007000	0.12810	1.132000	0.42129	0.164000	0.16699	TGG	.	.	none		0.403	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
RBM12	10137	hgsc.bcm.edu	37	20	34242575	34242575	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr20:34242575G>T	ENST00000374114.3	-	3	933	c.670C>A	c.(670-672)Ccc>Acc	p.P224T	CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000397445.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000352393.4_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.P224T|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000317677.5_5'Flank|RBM12_ENST00000359646.1_Missense_Mutation_p.P224T	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	224	Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GGAATCGGGGGCACAGGAGGC	0.602																																					p.P224T		Atlas-SNP	.											.	RBM12	93	.	0			c.C670A						PASS	.						103.0	82.0	89.0					20																	34242575		2203	4300	6503	SO:0001583	missense	10137	exon2			TCGGGGGCACAGG	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.670C>A	20.37:g.34242575G>T	ENSP00000363228:p.Pro224Thr	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	67	32	0.477612	NM_001198840	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	ENST00000374114.3	37	CCDS13261.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.681847	0.29872	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942;ENST00000424458	T;T;T;T	0.27402	2.53;2.53;2.53;1.67	5.23	5.23	0.72850	.	0.074210	0.56097	D	0.000030	T	0.16769	0.0403	N	0.19112	0.55	0.80722	D	1	P	0.39480	0.675	B	0.26094	0.066	T	0.09228	-1.0684	10	0.08179	T	0.78	-2.6574	19.0135	0.92884	0.0:0.0:1.0:0.0	.	224	Q9NTZ6	RBM12_HUMAN	T	224;224;224;23;224	ENSP00000363228:P224T;ENSP00000352668:P224T;ENSP00000363217:P224T;ENSP00000411036:P224T	ENSP00000339879:P23T	P	-	1	0	RBM12	33705989	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.344000	0.59354	2.719000	0.93026	0.555000	0.69702	CCC	.	.	none		0.602	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
GRIPAP1	56850	hgsc.bcm.edu	37	X	48837643	48837643	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chrX:48837643G>A	ENST00000376441.1	-	21	1948	c.1914C>T	c.(1912-1914)aaC>aaT	p.N638N	GRIPAP1_ENST00000376444.3_Silent_p.N593N|GRIPAP1_ENST00000473581.1_5'UTR|GRIPAP1_ENST00000376423.4_Silent_p.N559N|GRIPAP1_ENST00000376425.3_Silent_p.N607N	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	638						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GGCTCTTGCTGTTAGTGAGGA	0.622																																					p.N638N		Atlas-SNP	.											.	GRIPAP1	128	.	0			c.C1914T						PASS	.						75.0	51.0	59.0					X																	48837643		2203	4300	6503	SO:0001819	synonymous_variant	56850	exon21			CTTGCTGTTAGTG	AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1914C>T	X.37:g.48837643G>A		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	199	124	0.623116	NM_020137	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Silent	SNP	ENST00000376441.1	37	CCDS35248.1																																																																																			.	.	none		0.622	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
FOXD4	2298	hgsc.bcm.edu	37	9	118097	118097	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr9:118097C>T	ENST00000382500.2	-	1	320	c.23G>A	c.(22-24)cGc>cAc	p.R8H		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	8					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		GGAGCGAAGGCGCTCAGCTCT	0.657																																					p.R8H		Atlas-SNP	.											FOXD4,colon,carcinoma,-1,1	FOXD4	75	1	0			c.G23A						PASS	.						67.0	77.0	74.0					9																	118097		2199	4295	6494	SO:0001583	missense	2298	exon1			CGAAGGCGCTCAG	U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.23G>A	9.37:g.118097C>T	ENSP00000371940:p.Arg8His	Somatic	204	0	0		WXS	Illumina HiSeq	Phase_I	247	32	0.129555	NM_207305	B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Missense_Mutation	SNP	ENST00000382500.2	37	CCDS34975.1	.	.	.	.	.	.	.	.	.	.	.	10.90	1.482692	0.26598	.	.	ENSG00000170122	ENST00000382500	D	0.95518	-3.73	2.31	1.34	0.21922	.	0.918410	0.08832	N	0.887090	D	0.87873	0.6287	N	0.14661	0.345	0.21762	N	0.999551	B	0.19935	0.04	B	0.08055	0.003	T	0.76000	-0.3119	10	0.19147	T	0.46	.	6.1292	0.20195	0.0:0.8198:0.0:0.1802	.	8	Q12950	FOXD4_HUMAN	H	8	ENSP00000371940:R8H	ENSP00000371940:R8H	R	-	2	0	FOXD4	108097	0.000000	0.05858	0.158000	0.22627	0.111000	0.19643	-0.054000	0.11826	0.271000	0.22005	0.291000	0.19559	CGC	.	.	none		0.657	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055433.1	NM_207305	
AGL	178	hgsc.bcm.edu	37	1	100327164	100327164	+	Missense_Mutation	SNP	G	G	A	rs199958942		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:100327164G>A	ENST00000294724.4	+	3	666	c.188G>A	c.(187-189)cGt>cAt	p.R63H	AGL_ENST00000361302.3_Missense_Mutation_p.R47H|AGL_ENST00000370163.3_Missense_Mutation_p.R63H|AGL_ENST00000370165.3_Missense_Mutation_p.R63H|AGL_ENST00000370161.2_Missense_Mutation_p.R47H|AGL_ENST00000361915.3_Missense_Mutation_p.R63H|AGL_ENST00000361522.4_Missense_Mutation_p.R46H	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	63					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GAAAAATTCCGTTCTCTGGAT	0.358													G|||	1	0.000199681	0.0	0.0	5008	,	,		16881	0.001		0.0	False		,,,				2504	0.0				p.R63H		Atlas-SNP	.											AGL,caecum,carcinoma,+1,2	AGL	137	2	0			c.G188A						PASS	.						67.0	70.0	69.0					1																	100327164		2203	4300	6503	SO:0001583	missense	178	exon3			AATTCCGTTCTCT	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.188G>A	1.37:g.100327164G>A	ENSP00000294724:p.Arg63His	Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	177	73	0.412429	NM_000644	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	CCDS759.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	12.80	2.045875	0.36085	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78	4.97	1.01	0.19927	.	0.387349	0.28989	N	0.013491	T	0.17152	0.0412	L	0.38175	1.15	0.36408	D	0.863555	B;B;B	0.12630	0.006;0.006;0.003	B;B;B	0.14578	0.011;0.008;0.005	T	0.04307	-1.0961	10	0.40728	T	0.16	.	8.5905	0.33684	0.4697:0.0:0.5303:0.0	.	46;47;63	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	H	63;63;63;63;47;47;46	ENSP00000355106:R63H;ENSP00000359184:R63H;ENSP00000359182:R63H;ENSP00000294724:R63H;ENSP00000354971:R47H;ENSP00000359180:R47H;ENSP00000354635:R46H	ENSP00000294724:R63H	R	+	2	0	AGL	100099752	0.382000	0.25148	0.945000	0.38365	0.993000	0.82548	0.745000	0.26259	-0.066000	0.12998	0.563000	0.77884	CGT	G|1.000;A|0.000	0.000	strong		0.358	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144856817	144856817	+	Splice_Site	SNP	T	T	C	rs3844239		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:144856817T>C	ENST00000369354.3	-	40	6857	c.6668A>G	c.(6667-6669)gAg>gGg	p.E2223G	PDE4DIP_ENST00000530740.1_Splice_Site_p.E2308G|PDE4DIP_ENST00000369356.4_Splice_Site_p.E2223G|PDE4DIP_ENST00000313382.9_Splice_Site_p.E2117G|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369359.4_Splice_Site_p.E2359G|RP4-791M13.4_ENST00000532137.1_RNA			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	2223					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.E2223G(2)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGTGATTACCTCTGTGCCTTG	0.478			T	PDGFRB	MPD																																p.E2223G		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	PDE4DIP_ENST00000369356,caecum,carcinoma,0,4	PDE4DIP	817	4	2	Substitution - Missense(2)	prostate(2)	c.A6668G						scavenged	.						52.0	38.0	43.0					1																	144856817		2202	4294	6496	SO:0001630	splice_region_variant	9659	exon40			ATTACCTCTGTGC	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.6669+1A>G	1.37:g.144856817T>C		Somatic	81	1	0.0123457		WXS	Illumina HiSeq	Phase_I	85	7	0.0823529	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	14.30|14.30	2.495079|2.495079	0.44352|0.44352	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359|ENST00000530130	T;T;T;T;T|.	0.01871|.	4.59;4.69;4.67;4.69;4.69|.	4.52|4.52	3.39|3.39	0.38822|0.38822	.|.	.|.	.|.	.|.	.|.	T|T	0.52885|0.52885	0.1762|0.1762	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	B;B|.	0.17852|.	0.0;0.024|.	B;B|.	0.20184|.	0.0;0.028|.	T|T	0.54193|0.54193	-0.8330|-0.8330	9|5	0.59425|.	D|.	0.04|.	.|.	8.6174|8.6174	0.33840|0.33840	0.0:0.0946:0.0:0.9054|0.0:0.0946:0.0:0.9054	rs3844239|rs3844239	2117;2223|.	Q5VU43-3;Q5VU43|.	.;MYOME_HUMAN|.	G|G	2117;2223;2223;2308;2359|300	ENSP00000327209:E2117G;ENSP00000358360:E2223G;ENSP00000358363:E2223G;ENSP00000435654:E2308G;ENSP00000358366:E2359G|.	ENSP00000327209:E2117G|.	E|R	-|-	2|1	0|2	PDE4DIP|PDE4DIP	143568174|143568174	1.000000|1.000000	0.71417|0.71417	0.886000|0.886000	0.34754|0.34754	0.224000|0.224000	0.24922|0.24922	3.513000|3.513000	0.53414|0.53414	0.702000|0.702000	0.31825|0.31825	-0.566000|-0.566000	0.04163|0.04163	GAG|AGG	.	.	weak		0.478	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	Missense_Mutation
FUK	197258	hgsc.bcm.edu	37	16	70515315	70515315	+	IGR	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:70515315G>A	ENST00000288078.6	+	0	4081				COG4_ENST00000323786.5_Nonsense_Mutation_p.R728*	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase							cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				AACTTGTCTCGGATGGTCCAG	0.607																																					p.R728X		Atlas-SNP	.											.	COG4	64	.	0			c.C2182T						PASS	.						100.0	97.0	98.0					16																	70515315		2198	4300	6498	SO:0001628	intergenic_variant	25839	exon18			TGTCTCGGATGGT		CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085		16.37:g.70515315G>A		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	61	16	0.262295	NM_015386	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Nonsense_Mutation	SNP	ENST00000288078.6	37	CCDS10891.2	.	.	.	.	.	.	.	.	.	.	G	22.1	4.237469	0.79800	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000526700;ENST00000539961	.	.	.	5.97	3.98	0.46160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.3333	14.2419	0.65963	0.0:0.0:0.6083:0.3917	.	.	.	.	X	728;703;184;386	.	ENSP00000315775:R728X	R	-	1	2	COG4	69072816	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.403000	0.52615	0.827000	0.34685	0.655000	0.94253	CGA	.	.	none		0.607	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157291.2	NM_145059	
ADAMTSL2	9719	hgsc.bcm.edu	37	9	136404949	136404949	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr9:136404949C>T	ENST00000354484.4	+	5	923	c.366C>T	c.(364-366)tcC>tcT	p.S122S	ADAMTSL2_ENST00000393060.1_Silent_p.S122S|ADAMTSL2_ENST00000393061.3_Silent_p.S231S	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	122					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		CCTTCAACTCCCACGTGTACA	0.672																																					p.S122S		Atlas-SNP	.											.	ADAMTSL2	40	.	0			c.C366T						PASS	.						45.0	37.0	40.0					9																	136404949		1939	3747	5686	SO:0001819	synonymous_variant	9719	exon5			CAACTCCCACGTG	AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.366C>T	9.37:g.136404949C>T		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	34	11	0.323529	NM_014694	B1B0D5|O60345	Silent	SNP	ENST00000354484.4	37	CCDS6976.1																																																																																			.	.	none		0.672	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254619.1	NM_014694	
PCF11	51585	hgsc.bcm.edu	37	11	82872427	82872427	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:82872427T>G	ENST00000298281.4	+	2	703	c.251T>G	c.(250-252)gTt>gGt	p.V84G		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	84	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GTGAAAAACGTTGGAAGAGAG	0.328																																					p.V84G		Atlas-SNP	.											.	PCF11	220	.	0			c.T251G						PASS	.						87.0	82.0	84.0					11																	82872427		1811	4075	5886	SO:0001583	missense	51585	exon2			AAAACGTTGGAAG	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.251T>G	11.37:g.82872427T>G	ENSP00000298281:p.Val84Gly	Somatic	191	0	0		WXS	Illumina HiSeq	Phase_I	151	60	0.397351	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.206596	0.79127	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.48522	0.81;0.81;0.81	5.66	5.66	0.87406	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);Domain of unknown function DUF618 (1);	0.000000	0.52532	D	0.000075	T	0.72930	0.3522	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.993;0.994	T	0.77387	-0.2607	9	.	.	.	.	16.2026	0.82095	0.0:0.0:0.0:1.0	.	84;84	E9PQ01;O94913	.;PCF11_HUMAN	G	84	ENSP00000298281:V84G;ENSP00000434540:V84G;ENSP00000431567:V84G	.	V	+	2	0	PCF11	82550075	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.965000	0.87945	2.285000	0.76669	0.533000	0.62120	GTT	.	.	none		0.328	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
KIF13A	63971	hgsc.bcm.edu	37	6	17788042	17788042	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:17788042A>C	ENST00000259711.6	-	27	3431	c.3326T>G	c.(3325-3327)cTg>cGg	p.L1109R	KIF13A_ENST00000378814.5_Missense_Mutation_p.L1096R|KIF13A_ENST00000378826.2_Missense_Mutation_p.L1109R|KIF13A_ENST00000378816.5_Missense_Mutation_p.L1109R|KIF13A_ENST00000378843.2_Missense_Mutation_p.L1096R	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1109					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CTGTTCATCCAGGTATTCTCG	0.398																																					p.L1109R		Atlas-SNP	.											.	KIF13A	276	.	0			c.T3326G						PASS	.						321.0	294.0	302.0					6																	17788042		1889	4121	6010	SO:0001583	missense	63971	exon27			TCATCCAGGTATT	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.3326T>G	6.37:g.17788042A>C	ENSP00000259711:p.Leu1109Arg	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	177	71	0.40113	NM_001105566	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.2|26.2	4.710033|4.710033	0.89018|0.89018	.|.	.|.	ENSG00000137177|ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816;ENST00000506044|ENST00000358380	D;T;D;D;D;D|.	0.82255|.	-1.57;0.67;-1.59;-1.56;-1.57;-1.55|.	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.70649|0.70649	0.3248|0.3248	M|M	0.77616|0.77616	2.38|2.38	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.999;1.0;1.0;0.999|.	T|T	0.72418|0.72418	-0.4300|-0.4300	10|5	0.87932|.	D|.	0|.	.|.	16.3245|16.3245	0.82970|0.82970	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1096;1109;1109;1096|.	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3|.	.;.;KI13A_HUMAN;.|.	R|G	1096;113;1109;1109;1096;1109;107|503	ENSP00000368091:L1096R;ENSP00000425616:L113R;ENSP00000259711:L1109R;ENSP00000368103:L1109R;ENSP00000368120:L1096R;ENSP00000368093:L1109R|.	ENSP00000259711:L1109R|.	L|W	-|-	2|1	0|0	KIF13A|KIF13A	17896021|17896021	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.956000|0.956000	0.61745|0.61745	9.287000|9.287000	0.95975|0.95975	2.254000|2.254000	0.74563|0.74563	0.460000|0.460000	0.39030|0.39030	CTG|TGG	.	.	none		0.398	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
HLA-DRB5	3127	hgsc.bcm.edu	37	6	32487265	32487265	+	Missense_Mutation	SNP	C	C	G	rs139485758	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:32487265C>G	ENST00000374975.3	-	3	596	c.534G>C	c.(532-534)caG>caC	p.Q178H		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5									p.Q178H(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						AGTCTCCATTCTGAATCAGGC	0.552													C|||	836	0.166933	0.2224	0.1326	5008	,	,		15097	0.1667		0.1531	False		,,,				2504	0.1309				p.Q178H		Atlas-SNP	.											HLA-DRB5,NS,NS,0,1	HLA-DRB5	31	1	1	Substitution - Missense(1)	NS(1)	c.G534C						scavenged	.						61.0	68.0	65.0					6																	32487265		1933	3889	5822	SO:0001583	missense	3127	exon3			TCCATTCTGAATC		CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.534G>C	6.37:g.32487265C>G	ENSP00000364114:p.Gln178His	Somatic	80	4	0.05		WXS	Illumina HiSeq	Phase_I	162	29	0.179012	NM_002125		Missense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	.	.	.	.	.	.	.	.	.	.	.	2.451	-0.326294	0.05350	.	.	ENSG00000198502	ENST00000374975	T	0.14391	2.51	4.6	-9.19	0.00685	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	1.115120	0.06656	N	0.763651	T	0.02193	0.0068	L	0.35487	1.065	0.80722	P	0.0	B;B	0.19445	0.036;0.003	B;B	0.33690	0.168;0.014	T	0.35871	-0.9771	9	0.35671	T	0.21	.	1.7649	0.03000	0.2235:0.402:0.1926:0.1818	.	105;178	Q29973;Q30154	.;DRB5_HUMAN	H	178	ENSP00000364114:Q178H	ENSP00000364114:Q178H	Q	-	3	2	HLA-DRB5	32595243	0.000000	0.05858	0.000000	0.03702	0.495000	0.33615	-4.437000	0.00234	-3.808000	0.00104	-0.273000	0.10243	CAG	A|0.003;C|0.930;G|0.067	0.067	strong		0.552	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
ZNF772	400720	hgsc.bcm.edu	37	19	57985566	57985566	+	Missense_Mutation	SNP	G	G	C	rs2074060	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:57985566G>C	ENST00000343280.4	-	5	806	c.546C>G	c.(544-546)tgC>tgG	p.C182W	ZNF772_ENST00000425074.3_3'UTR|AC004076.9_ENST00000415705.3_Intron|ZNF772_ENST00000601768.1_Intron|ZNF772_ENST00000427512.2_Missense_Mutation_p.C70W|AC004076.9_ENST00000596831.1_Intron|ZNF772_ENST00000356584.3_Missense_Mutation_p.C141W|ZNF772_ENST00000600175.1_Intron	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	182			C -> W (in dbSNP:rs2074060). {ECO:0000269|PubMed:17974005}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		TTGCACTGAAGCAGAACTGTT	0.498													C|||	3390	0.676917	0.6135	0.719	5008	,	,		22251	0.7014		0.6392	False		,,,				2504	0.7464				p.C182W	Melanoma(5;289 436 14293 15924 30817)	Atlas-SNP	.											.	ZNF772	42	.	0			c.C546G						PASS	.	C	TRP/CYS,TRP/CYS	2708,1698	512.6+/-368.1	833,1042,328	118.0	104.0	109.0		546,423	-1.1	0.0	19	dbSNP_96	109	5446,3154	479.5+/-370.1	1679,2088,533	yes	missense,missense	ZNF772	NM_001024596.2,NM_001144068.1	215,215	2512,3130,861	CC,CG,GG		36.6744,38.5384,37.3059	benign,benign	182/490,141/449	57985566	8154,4852	2203	4300	6503	SO:0001583	missense	400720	exon5			ACTGAAGCAGAAC	BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.546C>G	19.37:g.57985566G>C	ENSP00000341165:p.Cys182Trp	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	108	6	0.0555556	NM_001024596	A6NJK9|B4DH56|B4DYS0	Missense_Mutation	SNP	ENST00000343280.4	37	CCDS33133.1	1449|1449	0.6634615384615384|0.6634615384615384	299|299	0.6077235772357723|0.6077235772357723	255|255	0.7044198895027625|0.7044198895027625	411|411	0.7185314685314685|0.7185314685314685	484|484	0.6385224274406333|0.6385224274406333	C|C	0.004|0.004	-2.310840|-2.310840	0.00237|0.00237	0.614616|0.614616	0.633256|0.633256	ENSG00000197128|ENSG00000197128	ENST00000343280;ENST00000427512;ENST00000319969;ENST00000356584|ENST00000291809	T;T;T|.	0.07567|.	3.18;3.18;3.18|.	3.99|3.99	-1.09|-1.09	0.09904|0.09904	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.27053|0.27053	0.805|0.805	0.52501|0.52501	P|P	4.999999999999449E-5|4.999999999999449E-5	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.01281|.	0.0;0.0;0.0|.	T|T	0.28332|0.28332	-1.0047|-1.0047	8|5	0.34782|0.46703	T|T	0.22|0.11	.|.	1.1261|1.1261	0.01735|0.01735	0.3129:0.2295:0.3079:0.1498|0.3129:0.2295:0.3079:0.1498	rs2074060;rs57900222;rs2074060|rs2074060;rs57900222;rs2074060	70;141;182|.	Q68DY9-2;A6NJK9;Q68DY9|.	.;.;ZN772_HUMAN|.	W|M	182;70;128;141|107	ENSP00000341165:C182W;ENSP00000395967:C70W;ENSP00000348992:C141W|.	ENSP00000321015:C128W|ENSP00000291809:I107M	C|I	-|-	3|3	2|3	ZNF772|ZNF772	62677378|62677378	0.000000|0.000000	0.05858|0.05858	0.018000|0.018000	0.16275|0.16275	0.518000|0.518000	0.34316|0.34316	-1.716000|-1.716000	0.01878|0.01878	0.038000|0.038000	0.15604|0.15604	-0.322000|-0.322000	0.08575|0.08575	TGC|ATC	G|0.353;C|0.646	0.646	strong		0.498	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397447.1	NM_001024596	
C2orf91	400950	hgsc.bcm.edu	37	2	42180352	42180352	+	Silent	SNP	G	G	A	rs151243275	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr2:42180352G>A	ENST00000378711.2	-	2	173	c.84C>T	c.(82-84)taC>taT	p.Y28Y	C2orf91_ENST00000403980.1_5'UTR	NM_001242815.1	NP_001229744.1	Q6ZV80	CB091_HUMAN	chromosome 2 open reading frame 91	28																	CTTCTGGTCCGTAGGTCAGTG	0.557													G|||	26	0.00519169	0.0182	0.0029	5008	,	,		15280	0.0		0.0	False		,,,				2504	0.0				p.Y28Y		Atlas-SNP	.											.	.	.	.	0			c.C84T						PASS	.																																			SO:0001819	synonymous_variant	400950	exon2			TGGTCCGTAGGTC		CCDS56116.1	2p21	2012-02-17			ENSG00000205086	ENSG00000205086			42966	protein-coding gene	gene with protein product							Standard	NM_001242815		Approved		uc002rsf.1	Q6ZV80	OTTHUMG00000152307	ENST00000378711.2:c.84C>T	2.37:g.42180352G>A		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	111	42	0.378378	NM_001242815		Silent	SNP	ENST00000378711.2	37	CCDS56116.1																																																																																			G|0.995;A|0.005	0.005	strong		0.557	C2orf91-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000325755.1	NM_001242815	
MLLT6	4302	hgsc.bcm.edu	37	17	36865739	36865739	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:36865739C>T	ENST00000325718.7	+	6	554	c.463C>T	c.(463-465)Caa>Taa	p.Q155*	MLLT6_ENST00000378137.5_Nonsense_Mutation_p.Q155*	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	155					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					GGTTAGTGCCCAAATGGCAGG	0.572			T	MLL	AL																																p.Q155X		Atlas-SNP	.		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	MLLT6	80	.	0			c.C463T						PASS	.						110.0	85.0	94.0					17																	36865739		2203	4300	6503	SO:0001587	stop_gained	4302	exon6			AGTGCCCAAATGG		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.463C>T	17.37:g.36865739C>T	ENSP00000316426:p.Gln155*	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	78	22	0.282051	NM_005937	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Nonsense_Mutation	SNP	ENST00000325718.7	37	CCDS11327.1	.	.	.	.	.	.	.	.	.	.	C	37	6.433454	0.97564	.	.	ENSG00000108292	ENST00000325718;ENST00000378137	.	.	.	4.35	4.35	0.52113	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	15.9677	0.79987	0.0:1.0:0.0:0.0	.	.	.	.	X	155	.	ENSP00000316426:Q155X	Q	+	1	0	MLLT6	34119265	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.347000	0.79356	2.404000	0.81709	0.591000	0.81541	CAA	.	.	none		0.572	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	
CCDC40	55036	hgsc.bcm.edu	37	17	78064015	78064015	+	Intron	SNP	G	G	C	rs4889953|rs375858249	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:78064015G>C	ENST00000397545.4	+	17	2859				CCDC40_ENST00000374877.3_Missense_Mutation_p.K970N|CCDC40_ENST00000573903.1_Intron	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.K970N(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			cgtgcacgaagaacacgggac	0.607													C|||	3368	0.672524	0.7095	0.5389	5008	,	,		13699	0.6052		0.6968	False		,,,				2504	0.7618				p.K970N		Atlas-SNP	.											CCDC40_ENST00000374877,NS,other,0,1	CCDC40	198	1	1	Substitution - Missense(1)	pancreas(1)	c.G2910C						scavenged	.																																			SO:0001627	intron_variant	55036	exon18			CACGAAGAACACG	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2832+332G>C	17.37:g.78064015G>C		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	5	4	0.8	NM_001243342	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	ENST00000397545.4	37	CCDS42395.1	1314	0.6016483516483516	336	0.6829268292682927	169	0.46685082872928174	339	0.5926573426573427	470	0.6200527704485488	C	1.785	-0.481066	0.04383	.	.	ENSG00000141519	ENST00000374877	T	0.47869	0.83	.	.	.	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.43540	-0.9385	3	0.17369	T	0.5	.	.	.	.	rs4889953	.	.	.	N	970	ENSP00000364011:K970N	ENSP00000364011:K970N	K	+	3	2	CCDC40	75678610	0.003000	0.15002	0.003000	0.11579	0.003000	0.03518	-2.000000	0.01466	-1.966000	0.01009	-1.954000	0.00483	AAG	G|0.396;C|0.604	0.604	strong		0.607	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082	
KCNN3	3782	hgsc.bcm.edu	37	1	154842244	154842244	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:154842244A>T	ENST00000271915.4	-	1	512	c.197T>A	c.(196-198)cTt>cAt	p.L66H	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ctgctgctgaagctgcggagg	0.701																																					p.L66H		Atlas-SNP	.											KCNN3,NS,carcinoma,+1,3	KCNN3	141	3	0			c.T197A						scavenged	.																																			SO:0001583	missense	3782	exon1			TGCTGAAGCTGCG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.197T>A	1.37:g.154842244A>T	ENSP00000271915:p.Leu66His	Somatic	49	4	0.0816327		WXS	Illumina HiSeq	Phase_I	62	19	0.306452	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	37	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	a	9.986	1.229557	0.22542	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.58060	0.36	4.47	-1.06	0.10002	.	2.530250	0.01603	N	0.022141	T	0.17152	0.0412	N	0.08118	0	0.35103	D	0.765442	.	.	.	.	.	.	T	0.03807	-1.1002	8	0.72032	D	0.01	-1.1381	4.5154	0.11932	0.5982:0.0:0.2622:0.1396	.	.	.	.	H	66;161	ENSP00000271915:L66H	ENSP00000271915:L66H	L	-	2	0	KCNN3	153108868	0.001000	0.12720	0.839000	0.33178	0.980000	0.70556	0.019000	0.13444	0.013000	0.14918	0.460000	0.39030	CTT	.	.	none		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
ANKHD1	54882	hgsc.bcm.edu	37	5	139887371	139887371	+	Splice_Site	SNP	A	A	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:139887371A>G	ENST00000360839.2	+	20	3707	c.3553A>G	c.(3553-3555)Act>Gct	p.T1185A	ANKHD1_ENST00000297183.6_Splice_Site_p.T1185A|ANKHD1-EIF4EBP3_ENST00000532219.1_Splice_Site_p.T1185A	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1185						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCCTTTAGGACTGGGAGTAA	0.363																																					p.T1185A		Atlas-SNP	.											.	ANKHD1	233	.	0			c.A3553G						PASS	.						63.0	61.0	61.0					5																	139887371		2203	4300	6503	SO:0001630	splice_region_variant	54882	exon20			TTTAGGACTGGGA	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.3552-1A>G	5.37:g.139887371A>G		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	135	81	0.6	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.564615	0.86439	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000235510;ENST00000421134;ENST00000412116;ENST00000532219	T;T;T;T;T	0.68624	-0.29;-0.33;-0.25;-0.34;-0.33	5.72	5.72	0.89469	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.82591	0.5070	M	0.80508	2.5	0.80722	D	1	P;P;P;D;D	0.69078	0.88;0.945;0.587;0.997;0.992	P;P;B;D;D	0.79108	0.771;0.619;0.444;0.992;0.989	D	0.84613	0.0679	10	0.62326	D	0.03	.	16.3625	0.83273	1.0:0.0:0.0:0.0	.	396;1185;1204;1185;1185	E7ET58;Q8IWZ3-4;E9PDP5;Q8IWZ2;Q8IWZ3	.;.;.;.;ANKH1_HUMAN	A	1185;1218;1185;1185;719;396;1204;338;1185	ENSP00000354085:T1185A;ENSP00000297183:T1185A;ENSP00000394489:T1204A;ENSP00000405602:T338A;ENSP00000432016:T1185A	ENSP00000432016:T1185A	T	+	1	0	ANKHD1-EIF4EBP3;ANKHD1	139867555	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.306000	0.96204	2.319000	0.78375	0.524000	0.50904	ACT	.	.	none		0.363	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	Missense_Mutation
TLN2	83660	hgsc.bcm.edu	37	15	63128104	63128104	+	Silent	SNP	G	G	A	rs74020685		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr15:63128104G>A	ENST00000561311.1	+	56	7436	c.7206G>A	c.(7204-7206)gcG>gcA	p.A2402A	TLN2_ENST00000306829.6_Silent_p.A2402A|RP11-1069G10.1_ENST00000558404.1_RNA|RP11-1069G10.1_ENST00000558888.1_RNA			Q9Y4G6	TLN2_HUMAN	talin 2	2402	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GGATGGTGGCGGCTGCGACCA	0.622																																					p.A2402A		Atlas-SNP	.											.	TLN2	253	.	0			c.G7206A						PASS	.						59.0	64.0	62.0					15																	63128104		2203	4300	6503	SO:0001819	synonymous_variant	83660	exon54			GGTGGCGGCTGCG	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.7206G>A	15.37:g.63128104G>A		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	91	35	0.384615	NM_015059	A6NLB8	Silent	SNP	ENST00000561311.1	37	CCDS32261.1																																																																																			G|0.999;C|0.001	.	alt		0.622	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
H3F3A	3020	hgsc.bcm.edu	37	1	226252097	226252097	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:226252097A>C	ENST00000366813.1	+	1	420	c.45A>C	c.(43-45)aaA>aaC	p.K15N	H3F3A_ENST00000366814.3_Missense_Mutation_p.K15N|H3F3A_ENST00000366816.1_Missense_Mutation_p.K15N|H3F3A_ENST00000366815.3_Missense_Mutation_p.K15N|RP11-396C23.4_ENST00000609423.1_RNA			P84243	H33_HUMAN	H3 histone, family 3A	15					blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			central_nervous_system(116)|endometrium(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	123	Breast(184;0.179)			GBM - Glioblastoma multiforme(131;0.203)		CCGGTGGTAAAGCACCCAGGA	0.478			Mis		glioma						OREG0014293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K15N		Atlas-SNP	.		Dom	yes		1	1q42.12	3020	"""H3 histone, family 3A"""		O	.	H3F3A	245	.	0			c.A45C						PASS	.						29.0	30.0	30.0					1																	226252097		2203	4296	6499	SO:0001583	missense	3020	exon2			TGGTAAAGCACCC	BC029405	CCDS1550.1	1q42.12	2011-01-27			ENSG00000163041	ENSG00000163041		"""Histones / Replication-independent"""	4764	protein-coding gene	gene with protein product		601128		H3F3		3031613	Standard	NM_002107		Approved	H3.3A	uc001hpw.3	P84243	OTTHUMG00000037507	ENST00000366813.1:c.45A>C	1.37:g.226252097A>C	ENSP00000355778:p.Lys15Asn	Somatic	151	0	0	2311	WXS	Illumina HiSeq	Phase_I	239	148	0.619247	NM_002107	P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	Missense_Mutation	SNP	ENST00000366813.1	37	CCDS1550.1	.	.	.	.	.	.	.	.	.	.	A	9.163	1.019187	0.19355	.	.	ENSG00000163041	ENST00000366816;ENST00000366815;ENST00000366814;ENST00000366813	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	4.32	3.18	0.36537	Histone-fold (2);	0.000000	0.85682	D	0.000000	T	0.59266	0.2181	.	.	.	0.47276	D	0.999371	D;B	0.76494	0.999;0.001	D;B	0.78314	0.991;0.002	T	0.58618	-0.7605	9	0.72032	D	0.01	.	6.0363	0.19710	0.6485:0.0:0.3515:0.0	.	15;15	B4DEB1;P84243	.;H33_HUMAN	N	15	ENSP00000355781:K15N;ENSP00000355780:K15N;ENSP00000355779:K15N;ENSP00000355778:K15N	ENSP00000355778:K15N	K	+	3	2	H3F3A	224318720	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.096000	0.41738	0.626000	0.30322	0.533000	0.62120	AAA	.	.	none		0.478	H3F3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091324.1	NM_002107	
FAM186A	121006	hgsc.bcm.edu	37	12	50745677	50745677	+	Silent	SNP	T	T	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:50745677T>A	ENST00000327337.5	-	4	4937	c.4938A>T	c.(4936-4938)gcA>gcT	p.A1646A	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Silent_p.A1646A	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1646																	GGACTCCCAGTGCCTGGGCCT	0.607																																					p.A1646A	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											FAM186A_ENST00000327337,rectum,carcinoma,0,4	FAM186A	181	4	0			c.A4938T						scavenged	.						30.0	30.0	30.0					12																	50745677		692	1591	2283	SO:0001819	synonymous_variant	121006	exon4			TCCCAGTGCCTGG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4938A>T	12.37:g.50745677T>A		Somatic	76	2	0.0263158		WXS	Illumina HiSeq	Phase_I	112	7	0.0625	NM_001145475		Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																			.	.	none		0.607	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
KRT4	3851	hgsc.bcm.edu	37	12	53207603	53207603	+	Silent	SNP	A	A	G	rs7135148		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:53207603A>G	ENST00000551956.1	-	1	732	c.240T>C	c.(238-240)ttT>ttC	p.F80F	KRT4_ENST00000458244.2_Silent_p.F60F|KRT4_ENST00000293774.4_Silent_p.F154F			P19013	K2C4_HUMAN	keratin 4	80	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CACCAGTGCCAAAGCCTCCAG	0.602																																					p.F80F	Pancreas(190;284 2995 41444 45903)	Atlas-SNP	.											KRT4,rectum,carcinoma,0,1	KRT4	110	1	0			c.T240C						scavenged	.						82.0	99.0	94.0					12																	53207603		2119	4253	6372	SO:0001819	synonymous_variant	3851	exon1			AGTGCCAAAGCCT		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.240T>C	12.37:g.53207603A>G		Somatic	31	1	0.0322581		WXS	Illumina HiSeq	Phase_I	61	30	0.491803	NM_002272	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	37	CCDS41787.2																																																																																			A|1.000;|0.000	.	weak		0.602	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643066	1643066	+	Silent	SNP	A	A	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:1643066A>G	ENST00000399682.1	-	1	302	c.258T>C	c.(256-258)ggT>ggC	p.G86G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G86G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCCCTTGGAACCCCCACAAG	0.667																																					p.G86G		Atlas-SNP	.											KRTAP5-4,NS,carcinoma,0,3	KRTAP5-4	78	3	1	Substitution - coding silent(1)	endometrium(1)	c.T258C						scavenged	.						9.0	15.0	13.0					11																	1643066		683	1577	2260	SO:0001819	synonymous_variant	387267	exon1			CTTGGAACCCCCA	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.258T>C	11.37:g.1643066A>G		Somatic	53	2	0.0377358		WXS	Illumina HiSeq	Phase_I	62	6	0.0967742	NM_001012709		Silent	SNP	ENST00000399682.1	37																																																																																				.	.	none		0.667	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
TBX4	9496	hgsc.bcm.edu	37	17	59560607	59560607	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:59560607C>T	ENST00000240335.1	+	8	1413	c.1368C>T	c.(1366-1368)ccC>ccT	p.P456P	TBX4_ENST00000589449.1_3'UTR|TBX4_ENST00000393853.4_Silent_p.P457P	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	456					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CGCGGCTGCCCACCCTCTCCG	0.632																																					p.P456P		Atlas-SNP	.											.	TBX4	69	.	0			c.C1368T						PASS	.						81.0	76.0	78.0					17																	59560607		2203	4300	6503	SO:0001819	synonymous_variant	9496	exon8			GCTGCCCACCCTC	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.1368C>T	17.37:g.59560607C>T		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	75	25	0.333333	NM_018488	A5PKU7|B2RMT1|B7ZLV3	Silent	SNP	ENST00000240335.1	37	CCDS11629.1																																																																																			.	.	none		0.632	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488	
C5orf60	285679	hgsc.bcm.edu	37	5	179071892	179071892	+	Missense_Mutation	SNP	C	C	T	rs4990389	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:179071892C>T	ENST00000448248.2	-	1	155	c.130G>A	c.(130-132)Gtt>Att	p.V44I	C5orf60_ENST00000506142.1_Intron	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	44						integral component of membrane (GO:0016021)		p.V44I(2)		NS(1)|breast(1)|kidney(5)	7						CTGAACACAACAAAGAGGACG	0.517													-|||	83	0.0165735	0.0575	0.0058	5008	,	,		23834	0.0		0.002	False		,,,				2504	0.001				p.V44I		Atlas-SNP	.											C5orf60,NS,carcinoma,0,2	C5orf60	24	2	2	Substitution - Missense(2)	kidney(2)	c.G130A						scavenged	.						91.0	85.0	87.0					5																	179071892		692	1591	2283	SO:0001583	missense	285679	exon1			ACACAACAAAGAG	BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.130G>A	5.37:g.179071892C>T	ENSP00000404583:p.Val44Ile	Somatic	84	1	0.0119048		WXS	Illumina HiSeq	Phase_I	133	9	0.0676692	NM_001142306	A1L488|B7ZM52|B7ZM53	Missense_Mutation	SNP	ENST00000448248.2	37	CCDS47353.1	14	0.00641025641025641	10	0.02032520325203252	1	0.0027624309392265192	0	0.0	3	0.00395778364116095	N	0.001	-2.963530	0.00049	.	.	ENSG00000204661	ENST00000448248	T	0.23552	1.9	0.526	-1.05	0.10036	.	.	.	.	.	T	0.03827	0.0108	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27262	-1.0079	8	0.10902	T	0.67	.	.	.	.	rs4990389;rs7731272	44;44	A6NFR6-2;A6NFR6-4	.;.	I	44	ENSP00000404583:V44I	ENSP00000404583:V44I	V	-	1	0	C5orf60	179004498	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.627000	0.02033	-2.544000	0.00483	-2.140000	0.00339	GTT	C|0.994;T|0.006	0.006	strong		0.517	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372148.2	NM_001142306	
CDC27	996	hgsc.bcm.edu	37	17	45234350	45234350	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:45234350C>T	ENST00000066544.3	-	7	864	c.771G>A	c.(769-771)caG>caA	p.Q257Q	CDC27_ENST00000531206.1_Silent_p.Q257Q|CDC27_ENST00000527547.1_Silent_p.Q257Q|CDC27_ENST00000446365.2_Silent_p.Q196Q|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	257					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.Q257Q(3)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TATTTTGAACCTGTTTAGATA	0.383																																					p.Q257Q		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,0,8	CDC27	337	8	3	Substitution - coding silent(3)	prostate(3)	c.G771A						scavenged	.						57.0	63.0	61.0					17																	45234350		2198	4294	6492	SO:0001819	synonymous_variant	996	exon7			TTGAACCTGTTTA	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.771G>A	17.37:g.45234350C>T		Somatic	85	1	0.0117647		WXS	Illumina HiSeq	Phase_I	112	7	0.0625	NM_001114091	G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	37	CCDS11509.1																																																																																			.	.	none		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CHID1	66005	hgsc.bcm.edu	37	11	902268	902268	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:902268G>A	ENST00000449825.1	-	4	680	c.324C>T	c.(322-324)ccC>ccT	p.P108P	CHID1_ENST00000436108.2_Silent_p.P108P|CHID1_ENST00000336845.5_Silent_p.P133P|CHID1_ENST00000528581.1_Silent_p.P133P|CHID1_ENST00000429789.2_Silent_p.P108P|CHID1_ENST00000323541.7_Silent_p.P138P|CHID1_ENST00000526714.1_5'UTR|CHID1_ENST00000323578.8_Silent_p.P108P|CHID1_ENST00000454838.2_Silent_p.P133P	NM_001142675.1	NP_001136147.1	Q9BWS9	CHID1_HUMAN	chitinase domain containing 1	108					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|innate immune response (GO:0045087)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	chitinase activity (GO:0004568)|oligosaccharide binding (GO:0070492)			endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	13		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)		GCAGCCAGACGGGTGAGATCT	0.552																																					p.P133P	Pancreas(117;992 2327 5172 41921)	Atlas-SNP	.											.	CHID1	29	.	0			c.C399T						PASS	.						187.0	143.0	158.0					11																	902268		2203	4299	6502	SO:0001819	synonymous_variant	66005	exon5			CCAGACGGGTGAG	AK124697	CCDS7722.1, CCDS44510.1, CCDS44511.1	11p15.5	2005-10-27			ENSG00000177830	ENSG00000177830			28474	protein-coding gene	gene with protein product		615692					Standard	NM_023947		Approved	MGC3234, FLJ42707	uc001lsm.3	Q9BWS9	OTTHUMG00000133314	ENST00000449825.1:c.324C>T	11.37:g.902268G>A		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	65	26	0.4	NM_001142676	B3KWB0|Q8NBM9|Q96CZ3|Q96S93|Q96SK0|Q9BY52	Silent	SNP	ENST00000449825.1	37	CCDS7722.1																																																																																			.	.	none		0.552	CHID1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257112.1	NM_023947	
SOCS1	8651	hgsc.bcm.edu	37	16	11348972	11348972	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:11348972C>A	ENST00000332029.2	-	2	514	c.364G>T	c.(364-366)Gga>Tga	p.G122*	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	122	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.R107_I126del(1)|p.Y64fs*1(1)|p.K118_P123>T(1)|p.0?(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						CTCGTGGGTCCCGAGGCCATC	0.672			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.G122X	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	.	SOCS1	84	.	4	Whole gene deletion(1)|Complex - deletion inframe(1)|Deletion - In frame(1)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(4)	c.G364T						PASS	.						17.0	19.0	19.0					16																	11348972		2191	4297	6488	SO:0001587	stop_gained	8651	exon2			TGGGTCCCGAGGC	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.364G>T	16.37:g.11348972C>A	ENSP00000329418:p.Gly122*	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	37	16	0.432432	NM_003745	O15097|Q9NSA7	Nonsense_Mutation	SNP	ENST00000332029.2	37	CCDS10546.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.989914	0.93106	.	.	ENSG00000185338	ENST00000332029	.	.	.	4.19	4.19	0.49359	.	0.172438	0.50627	D	0.000106	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-21.9138	15.6933	0.77473	0.0:1.0:0.0:0.0	.	.	.	.	X	122	.	ENSP00000329418:G122X	G	-	1	0	SOCS1	11256473	0.999000	0.42202	1.000000	0.80357	0.485000	0.33311	2.783000	0.47766	2.176000	0.68965	0.561000	0.74099	GGA	.	.	none		0.672	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
BCL7A	605	hgsc.bcm.edu	37	12	122460020	122460020	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:122460020C>T	ENST00000261822.4	+	1	229	c.23C>T	c.(22-24)gCc>gTc	p.A8V	RP11-87C12.5_ENST00000538710.1_lincRNA|BCL7A_ENST00000538010.1_Missense_Mutation_p.A8V	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	8					negative regulation of transcription, DNA-templated (GO:0045892)					haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		TCGGTTCGAGCCGAGACGAGG	0.711			T	MYC	BNHL																																p.A8V	GBM(17;197 467 16477 23242 44349)	Atlas-SNP	.		Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	.	BCL7A	31	.	0			c.C23T						PASS	.						20.0	21.0	20.0					12																	122460020		2194	4293	6487	SO:0001583	missense	605	exon1			TTCGAGCCGAGAC	X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.23C>T	12.37:g.122460020C>T	ENSP00000261822:p.Ala8Val	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	59	26	0.440678	NM_020993	B4DJN6|B7ZB21|Q13843|Q14CT7	Missense_Mutation	SNP	ENST00000261822.4	37	CCDS53841.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029586	0.75504	.	.	ENSG00000110987	ENST00000538010;ENST00000261822	T;T	0.63096	-0.02;0.04	4.24	3.35	0.38373	.	0.000000	0.85682	U	0.000000	T	0.76054	0.3934	M	0.77820	2.39	0.80722	D	1	B;D	0.71674	0.006;0.998	B;D	0.73380	0.014;0.98	T	0.76974	-0.2760	10	0.87932	D	0	.	9.7713	0.40591	0.0:0.8948:0.0:0.1052	.	8;8	Q4VC05;Q4VC05-2	BCL7A_HUMAN;.	V	8	ENSP00000445868:A8V;ENSP00000261822:A8V	ENSP00000261822:A8V	A	+	2	0	BCL7A	120944403	1.000000	0.71417	0.997000	0.53966	0.418000	0.31294	5.746000	0.68681	0.781000	0.33589	0.460000	0.39030	GCC	.	.	none		0.711	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000401712.1		
HIST1H2BK	85236	hgsc.bcm.edu	37	6	27114569	27114569	+	Silent	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:27114569T>C	ENST00000356950.1	-	1	8	c.9A>G	c.(7-9)gaA>gaG	p.E3E	HIST1H2BK_ENST00000396891.4_Silent_p.E3E|HIST1H2AH_ENST00000377459.1_5'Flank|MIR3143_ENST00000584253.1_RNA			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	3					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						ACTTCGCTGGTTCCGGCATGT	0.562																																					p.E3E		Atlas-SNP	.											HIST1H2BK_ENST00000396891,NS,carcinoma,-2,2	HIST1H2BK	68	2	0			c.A9G						scavenged	.						51.0	51.0	51.0					6																	27114569		2203	4300	6503	SO:0001819	synonymous_variant	85236	exon1			CGCTGGTTCCGGC	AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.9A>G	6.37:g.27114569T>C		Somatic	108	7	0.0648148		WXS	Illumina HiSeq	Phase_I	105	7	0.0666667	NM_080593	A8K7P7|Q2VPI7	Silent	SNP	ENST00000356950.1	37	CCDS4621.1																																																																																			.	.	none		0.562	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040141.1	NM_080593	
SDCCAG8	10806	hgsc.bcm.edu	37	1	243437859	243437859	+	Silent	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:243437859T>C	ENST00000366541.3	+	4	439	c.321T>C	c.(319-321)caT>caC	p.H107H	SDCCAG8_ENST00000391846.1_Silent_p.H107H|SDCCAG8_ENST00000355875.4_Silent_p.H107H|SDCCAG8_ENST00000343783.6_Intron	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	107					establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		CATTAGAACATGAGGAAACCA	0.299																																					p.H107H		Atlas-SNP	.											.	SDCCAG8	73	.	0			c.T321C						PASS	.						80.0	78.0	79.0					1																	243437859		2203	4294	6497	SO:0001819	synonymous_variant	10806	exon4			AGAACATGAGGAA	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.321T>C	1.37:g.243437859T>C		Somatic	300	0	0		WXS	Illumina HiSeq	Phase_I	454	117	0.257709	NM_006642	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Silent	SNP	ENST00000366541.3	37	CCDS31075.1																																																																																			.	.	none		0.299	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642	
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493809	77493809	+	Silent	SNP	C	C	T	rs61991638		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr14:77493809C>T	ENST00000238647.3	-	1	1225	c.327G>A	c.(325-327)caG>caA	p.Q109Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	109	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgctgctgttgct	0.687																																					p.Q109Q		Atlas-SNP	.											.	IRF2BPL	40	.	0			c.G327A						PASS	.						2.0	2.0	2.0					14																	77493809		1179	2145	3324	SO:0001819	synonymous_variant	64207	exon1			CTGCTGCTGCTGT	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.327G>A	14.37:g.77493809C>T		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	36	7	0.194444	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																			C|0.978;T|0.022	0.022	strong		0.687	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
IRF1	3659	hgsc.bcm.edu	37	5	131825149	131825149	+	Missense_Mutation	SNP	T	T	C	rs121912469		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:131825149T>C	ENST00000245414.4	-	2	280	c.22A>G	c.(22-24)Atg>Gtg	p.M8V	IRF1_ENST00000405885.2_Missense_Mutation_p.M8V|IRF1_ENST00000463784.1_Intron	NM_002198.2	NP_002189.1	P10914	IRF1_HUMAN	interferon regulatory factor 1	8			M -> L (in GASC; somatic mutation; produces a protein with markedly reduced transcriptional activity but unaltered DNA-binding activity). {ECO:0000269|PubMed:9679752}.		apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell cycle arrest (GO:0007050)|cellular response to interferon-beta (GO:0035458)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000564)|regulation of cell cycle (GO:0051726)|regulation of innate immune response (GO:0045088)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		CAGGGTCTCATGCGCATCCGA	0.507																																					p.M8V		Atlas-SNP	.											.	IRF1	26	.	0			c.A22G						PASS	.						93.0	92.0	93.0					5																	131825149		2203	4300	6503	SO:0001583	missense	3659	exon2			GTCTCATGCGCAT		CCDS4155.1	5q23-q31	2008-07-18			ENSG00000125347	ENSG00000125347			6116	protein-coding gene	gene with protein product	"""interferon regulatory factor-1"""	147575				2726461, 1680796	Standard	NM_002198		Approved	MAR	uc003kxa.2	P10914	OTTHUMG00000059497	ENST00000245414.4:c.22A>G	5.37:g.131825149T>C	ENSP00000245414:p.Met8Val	Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	101	71	0.70297	NM_002198	Q96GG7	Missense_Mutation	SNP	ENST00000245414.4	37	CCDS4155.1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.203638	0.58234	.	.	ENSG00000125347	ENST00000245414;ENST00000405885;ENST00000437654;ENST00000458069	D;D;D;D	0.97850	-4.57;-4.57;-4.57;-4.57	5.59	5.59	0.84812	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.98476	0.9492	M	0.87827	2.91	0.80722	D	1	P;P	0.43352	0.744;0.804	P;B	0.53490	0.727;0.402	D	0.99568	1.0970	10	0.87932	D	0	-29.6414	16.0664	0.80878	0.0:0.0:0.0:1.0	.	8;8	Q5FBX3;P10914	.;IRF1_HUMAN	V	8	ENSP00000245414:M8V;ENSP00000384406:M8V;ENSP00000405655:M8V;ENSP00000396318:M8V	ENSP00000245414:M8V	M	-	1	0	IRF1	131853048	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.112000	0.71547	2.254000	0.74563	0.459000	0.35465	ATG	.	.	alt		0.507	IRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132340.1	NM_002198	
HMMR	3161	hgsc.bcm.edu	37	5	162894753	162894753	+	Splice_Site	SNP	A	A	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:162894753A>C	ENST00000358715.3	+	4	305	c.269A>C	c.(268-270)gAg>gCg	p.E90A	HMMR_ENST00000353866.3_Intron|HMMR_ENST00000393915.4_Splice_Site_p.E91A|HMMR_ENST00000432118.2_Intron			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	90					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	TTAGAGAAAGAGGTAAGCAGT	0.328																																					p.E91A		Atlas-SNP	.											.	HMMR	64	.	0			c.A272C						PASS	.						40.0	40.0	40.0					5																	162894753		2203	4295	6498	SO:0001630	splice_region_variant	3161	exon4			AGAAAGAGGTAAG	U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.270+1A>C	5.37:g.162894753A>C		Somatic	272	0	0		WXS	Illumina HiSeq	Phase_I	415	95	0.228916	NM_001142556	A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Missense_Mutation	SNP	ENST00000358715.3	37	CCDS4362.1	.	.	.	.	.	.	.	.	.	.	A	18.00	3.526392	0.64860	.	.	ENSG00000072571	ENST00000393915;ENST00000426586;ENST00000358715	T;T	0.78364	-1.17;-1.17	5.98	4.8	0.61643	.	0.092606	0.64402	D	0.000001	D	0.86209	0.5878	M	0.74258	2.255	0.42286	D	0.992116	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.86671	0.1910	10	0.72032	D	0.01	-19.9829	10.1931	0.43039	0.833:0.167:0.0:0.0	.	91;90	O75330-3;O75330	.;HMMR_HUMAN	A	91;91;90	ENSP00000377492:E91A;ENSP00000351554:E90A	ENSP00000351554:E90A	E	+	2	0	HMMR	162827331	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	4.080000	0.57620	1.047000	0.40274	0.482000	0.46254	GAG	.	.	none		0.328	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252752.1	NM_012484	Missense_Mutation
KRT4	3851	hgsc.bcm.edu	37	12	53207606	53207606	+	Silent	SNP	G	G	A	rs79164931		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:53207606G>A	ENST00000551956.1	-	1	729	c.237C>T	c.(235-237)ggC>ggT	p.G79G	KRT4_ENST00000458244.2_Silent_p.G59G|KRT4_ENST00000293774.4_Silent_p.G153G			P19013	K2C4_HUMAN	keratin 4	79	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CAGTGCCAAAGCCTCCAGCAC	0.597																																					p.G79G	Pancreas(190;284 2995 41444 45903)	Atlas-SNP	.											KRT4,rectum,carcinoma,0,3	KRT4	110	3	0			c.C237T						scavenged	.						85.0	102.0	96.0					12																	53207606		2113	4248	6361	SO:0001819	synonymous_variant	3851	exon1			GCCAAAGCCTCCA		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.237C>T	12.37:g.53207606G>A		Somatic	32	1	0.03125		WXS	Illumina HiSeq	Phase_I	58	26	0.448276	NM_002272	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	37	CCDS41787.2																																																																																			.	.	strong		0.597	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
ADCY4	196883	hgsc.bcm.edu	37	14	24802153	24802153	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr14:24802153G>A	ENST00000310677.4	-	3	314	c.201C>T	c.(199-201)tgC>tgT	p.C67C	ADCY4_ENST00000418030.2_Silent_p.C67C|ADCY4_ENST00000558563.1_5'UTR|ADCY4_ENST00000554068.2_Silent_p.C67C|ADCY4_ENST00000396747.3_5'UTR|RP11-934B9.3_ENST00000555591.1_Missense_Mutation_p.R134C	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	67					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		CGCCCAGCGCGCACAGCACAG	0.647											OREG0022624	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C67C		Atlas-SNP	.											.	ADCY4	86	.	0			c.C201T						PASS	.						27.0	36.0	33.0					14																	24802153		2202	4299	6501	SO:0001819	synonymous_variant	196883	exon3			CAGCGCGCACAGC	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.201C>T	14.37:g.24802153G>A		Somatic	67	0	0	774	WXS	Illumina HiSeq	Phase_I	47	22	0.468085	NM_001198592	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Silent	SNP	ENST00000310677.4	37	CCDS9627.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202543	0.58234	.	.	ENSG00000258973	ENST00000555591	.	.	.	5.66	-0.729	0.11158	.	.	.	.	.	T	0.50565	0.1623	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38178	-0.9673	4	.	.	.	.	5.6811	0.17776	0.5148:0.1478:0.3374:0.0	.	.	.	.	C	134	.	.	R	-	1	0	RP11-934B9.3	23871993	0.000000	0.05858	0.911000	0.35937	0.919000	0.55068	-0.592000	0.05747	-0.129000	0.11620	-0.266000	0.10368	CGC	.	.	none		0.647	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
ZBP1	81030	hgsc.bcm.edu	37	20	56195323	56195323	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr20:56195323C>T	ENST00000371173.3	-	1	206	c.29G>A	c.(28-30)aGa>aAa	p.R10K	ZBP1_ENST00000340462.4_Missense_Mutation_p.R10K|ZBP1_ENST00000343535.4_Missense_Mutation_p.R10K|ZBP1_ENST00000538947.1_5'UTR|ZBP1_ENST00000395822.3_Missense_Mutation_p.R10K|ZBP1_ENST00000541799.1_Missense_Mutation_p.R10K	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	10					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)			large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			TGTACCTTCTCTGCCCGGGTC	0.577																																					p.R10K		Atlas-SNP	.											.	ZBP1	65	.	0			c.G29A						PASS	.						39.0	34.0	35.0					20																	56195323		2198	4298	6496	SO:0001583	missense	81030	exon1			CCTTCTCTGCCCG	AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.29G>A	20.37:g.56195323C>T	ENSP00000360215:p.Arg10Lys	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	69	29	0.42029	NM_001160419	A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Missense_Mutation	SNP	ENST00000371173.3	37	CCDS13461.1	.	.	.	.	.	.	.	.	.	.	C	3.457	-0.110823	0.06924	.	.	ENSG00000124256	ENST00000371173;ENST00000395822;ENST00000340462;ENST00000357677;ENST00000343535;ENST00000541799	T;T;T;T;T	0.13778	3.17;2.56;3.17;3.14;2.81	3.23	-4.69	0.03299	Winged helix-turn-helix transcription repressor DNA-binding (1);	1.821130	0.03512	N	0.219696	T	0.04634	0.0126	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.39482	-0.9612	10	0.02654	T	1	4.3898	7.5004	0.27513	0.0:0.1146:0.632:0.2534	.	10;10;10;10	F5GYT1;A2RRL9;A2A2F7;Q9H171	.;.;.;ZBP1_HUMAN	K	10	ENSP00000360215:R10K;ENSP00000379167:R10K;ENSP00000344954:R10K;ENSP00000340584:R10K;ENSP00000440552:R10K	ENSP00000344954:R10K	R	-	2	0	ZBP1	55628729	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.844000	0.04345	-0.756000	0.04703	-0.658000	0.03865	AGA	.	.	none		0.577	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776	
RTN4RL1	146760	hgsc.bcm.edu	37	17	1840012	1840012	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:1840012C>T	ENST00000331238.6	-	2	1583	c.1104G>A	c.(1102-1104)gcG>gcA	p.A368A		NM_178568.2	NP_848663.1			reticulon 4 receptor-like 1											breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|prostate(2)|skin(1)	11						TCCCGGCGCCCGCCTTAGAGA	0.652																																					p.A368A	GBM(68;949 1139 14865 32798 38342)	Atlas-SNP	.											.	RTN4RL1	21	.	0			c.G1104A						PASS	.						27.0	32.0	30.0					17																	1840012		1892	4096	5988	SO:0001819	synonymous_variant	146760	exon2			GGCGCCCGCCTTA	AF532859	CCDS45569.1	17p13.3	2008-02-05				ENSG00000185924			21329	protein-coding gene	gene with protein product	"""nogo-66 receptor homolog 2"""	610461					Standard	NM_178568		Approved	NGRH2, NgR3, DKFZp547J144	uc002ftp.3	Q86UN2		ENST00000331238.6:c.1104G>A	17.37:g.1840012C>T		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	226	66	0.292035	NM_178568		Silent	SNP	ENST00000331238.6	37	CCDS45569.1																																																																																			.	.	none		0.652	RTN4RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450155.2	NM_178568	
MUC4	4585	hgsc.bcm.edu	37	3	195506482	195506482	+	Missense_Mutation	SNP	G	G	T	rs113936020	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:195506482G>T	ENST00000463781.3	-	2	12428	c.11969C>A	c.(11968-11970)aCt>aAt	p.T3990N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3990N|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTCGGTGAC	0.592																																					p.T3990N		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,1	MUC4	1505	1	0			c.C11969A						scavenged	.						10.0	7.0	8.0					3																	195506482		623	1357	1980	SO:0001583	missense	4585	exon2			GAGGAAGTGTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11969C>A	3.37:g.195506482G>T	ENSP00000417498:p.Thr3990Asn	Somatic	11	2	0.181818		WXS	Illumina HiSeq	Phase_I	11	6	0.545455	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	0.405	-0.916416	0.02415	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.46	0.481	0.481	0.16809	.	0.562686	0.09843	U	0.748557	T	0.35913	0.0948	N	0.14661	0.345	0.09310	N	1	D	0.57257	0.979	D	0.68192	0.956	T	0.29852	-0.9998	9	.	.	.	.	6.8687	0.24108	1.0E-4:0.0:0.9999:0.0	.	3862	E7ESK3	.	N	3990	ENSP00000417498:T3990N;ENSP00000420243:T3990N	.	T	-	2	0	MUC4	196991261	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-0.001000	0.12947	0.537000	0.28751	0.064000	0.15345	ACT	.	.	weak		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
KCNN3	3782	hgsc.bcm.edu	37	1	154842243	154842243	+	Silent	SNP	A	A	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:154842243A>C	ENST00000271915.4	-	1	513	c.198T>G	c.(196-198)ctT>ctG	p.L66L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgaagctgcggag	0.701																																					p.L66L		Atlas-SNP	.											KCNN3,NS,carcinoma,0,3	KCNN3	141	3	0			c.T198G						scavenged	.						6.0	4.0	5.0					1																	154842243		1926	3811	5737	SO:0001819	synonymous_variant	3782	exon1			CTGCTGAAGCTGC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.198T>G	1.37:g.154842243A>C		Somatic	48	3	0.0625		WXS	Illumina HiSeq	Phase_I	62	21	0.33871	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			.	.	none		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
ZNF676	163223	hgsc.bcm.edu	37	19	22363610	22363610	+	Silent	SNP	A	A	G	rs201622264	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:22363610A>G	ENST00000397121.2	-	3	1226	c.909T>C	c.(907-909)caT>caC	p.H303H		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TCTCTCCAGTATGAATTCTCT	0.443																																					p.H303H		Atlas-SNP	.											ZNF676,rectum,carcinoma,0,2	ZNF676	146	2	0			c.T909C						scavenged	.						81.0	83.0	83.0					19																	22363610		2112	4258	6370	SO:0001819	synonymous_variant	163223	exon3			TCCAGTATGAATT	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.909T>C	19.37:g.22363610A>G		Somatic	42	8	0.190476		WXS	Illumina HiSeq	Phase_I	52	7	0.134615	NM_001001411	A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																			A|0.793;G|0.207	0.207	strong		0.443	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
SCGN	10590	hgsc.bcm.edu	37	6	25701447	25701447	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:25701447G>A	ENST00000377961.2	+	11	883	c.715G>A	c.(715-717)Ggg>Agg	p.G239R	SCGN_ENST00000334979.6_3'UTR	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	239						cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CAGCATCAGCGGGGTGGACCT	0.512																																					p.G239R		Atlas-SNP	.											SCGN,NS,carcinoma,0,1	SCGN	57	1	0			c.G715A						PASS	.						100.0	87.0	91.0					6																	25701447		2203	4300	6503	SO:0001583	missense	10590	exon11			ATCAGCGGGGTGG	BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.715G>A	6.37:g.25701447G>A	ENSP00000367197:p.Gly239Arg	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	76	68	0.894737	NM_006998	A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Missense_Mutation	SNP	ENST00000377961.2	37	CCDS4561.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377577	0.82682	.	.	ENSG00000079689	ENST00000377961	D	0.85773	-2.03	5.43	5.43	0.79202	EF-hand-like domain (1);	0.048878	0.85682	D	0.000000	T	0.76471	0.3992	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	P	0.47981	0.563	T	0.74589	-0.3615	10	0.16896	T	0.51	.	17.9971	0.89187	0.0:0.0:1.0:0.0	.	239	O76038	SEGN_HUMAN	R	239	ENSP00000367197:G239R	ENSP00000367197:G239R	G	+	1	0	SCGN	25809426	1.000000	0.71417	0.948000	0.38648	0.989000	0.77384	7.758000	0.85224	2.518000	0.84900	0.655000	0.94253	GGG	.	.	none		0.512	SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040067.1		
OTOP1	133060	hgsc.bcm.edu	37	4	4228424	4228424	+	Silent	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr4:4228424T>C	ENST00000296358.4	-	1	192	c.168A>G	c.(166-168)aaA>aaG	p.K56K		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	56					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCTCGGCCAGTTTCTGTGGGA	0.741																																					p.K56K		Atlas-SNP	.											OTOP1,caecum,carcinoma,-1,2	OTOP1	118	2	0			c.A168G						scavenged	.						7.0	7.0	7.0					4																	4228424		2122	4154	6276	SO:0001819	synonymous_variant	133060	exon1			GGCCAGTTTCTGT	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.168A>G	4.37:g.4228424T>C		Somatic	38	1	0.0263158		WXS	Illumina HiSeq	Phase_I	42	9	0.214286	NM_177998	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.	.	weak		0.741	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
UPF3A	65110	hgsc.bcm.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		Atlas-SNP	.											UPF3A,bladder,carcinoma,0,14	UPF3A	47	14	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						scavenged	.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	50	2	0.04		WXS	Illumina HiSeq	Phase_I	57	5	0.0877193	NM_080687	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.	.	none		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
SYMPK	8189	hgsc.bcm.edu	37	19	46347378	46347378	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:46347378G>C	ENST00000245934.7	-	8	1001	c.757C>G	c.(757-759)Ctg>Gtg	p.L253V		NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	253					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GCTGTGGTCAGGTTGATGGAG	0.547																																					p.L253V		Atlas-SNP	.											.	SYMPK	104	.	0			c.C757G						PASS	.						173.0	133.0	147.0					19																	46347378		2203	4300	6503	SO:0001583	missense	8189	exon8			TGGTCAGGTTGAT	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.757C>G	19.37:g.46347378G>C	ENSP00000245934:p.Leu253Val	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	88	28	0.318182	NM_004819	O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	ENST00000245934.7	37	CCDS12676.2	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876042	0.91664	.	.	ENSG00000125755	ENST00000245934	T	0.33216	1.42	5.98	5.98	0.97165	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.56426	0.1984	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.91635	0.999;0.984	T	0.55679	-0.8103	10	0.87932	D	0	.	17.952	0.89056	0.0:0.0:1.0:0.0	.	268;253	Q4LE61;Q92797	.;SYMPK_HUMAN	V	253	ENSP00000245934:L253V	ENSP00000245934:L253V	L	-	1	2	SYMPK	51039218	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	8.941000	0.92964	2.835000	0.97688	0.650000	0.86243	CTG	.	.	none		0.547	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
ZNF703	80139	hgsc.bcm.edu	37	8	37555934	37555934	+	Silent	SNP	C	C	T	rs568050040	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr8:37555934C>T	ENST00000331569.4	+	2	1744	c.1515C>T	c.(1513-1515)agC>agT	p.S505S		NM_025069.1	NP_079345.1	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	505					adherens junction assembly (GO:0034333)|cellular response to estradiol stimulus (GO:0071392)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)		FGFR1/ZNF703(2)	breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)	7			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			GCCTGGGCAGcgccgccgccg	0.771																																					p.S505S		Atlas-SNP	.											.	ZNF703	16	.	0			c.C1515T						PASS	.						1.0	2.0	2.0					8																	37555934		1094	2312	3406	SO:0001819	synonymous_variant	80139	exon2			GGGCAGCGCCGCC	AK024361	CCDS6094.1	8p12	2008-05-02				ENSG00000183779			25883	protein-coding gene	gene with protein product						15897872	Standard	NM_025069		Approved	FLJ14299, ZNF503L	uc003xjy.1	Q9H7S9		ENST00000331569.4:c.1515C>T	8.37:g.37555934C>T		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	12	10	0.833333	NM_025069	Q5XG76	Silent	SNP	ENST00000331569.4	37	CCDS6094.1																																																																																			.	.	none		0.771	ZNF703-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376683.2	NM_025069	
ARHGAP6	395	hgsc.bcm.edu	37	X	11160430	11160430	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chrX:11160430A>C	ENST00000337414.4	-	12	3052	c.2180T>G	c.(2179-2181)cTg>cGg	p.L727R	ARHGAP6_ENST00000534860.1_Missense_Mutation_p.L552R|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.L524R|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.L524R	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	727					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CTCCTCTGACAGATCTAGGGA	0.323																																					p.L727R		Atlas-SNP	.											.	ARHGAP6	130	.	0			c.T2180G						PASS	.						80.0	78.0	79.0					X																	11160430		2203	4300	6503	SO:0001583	missense	395	exon12			TCTGACAGATCTA	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2180T>G	X.37:g.11160430A>C	ENSP00000338967:p.Leu727Arg	Somatic	400	1	0.0025		WXS	Illumina HiSeq	Phase_I	491	151	0.307536	NM_013427	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	37	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	A	13.73	2.323162	0.41096	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414	T;T;T;T	0.24723	1.84;1.91;1.91;1.91	5.24	4.07	0.47477	.	0.213907	0.32106	N	0.006562	T	0.11879	0.0289	N	0.08118	0	0.80722	D	1	B;P	0.34780	0.138;0.468	B;B	0.29267	0.021;0.1	T	0.13602	-1.0503	10	0.36615	T	0.2	.	10.2557	0.43397	0.921:0.0:0.079:0.0	.	727;727	O43182;A8KAL3	RHG06_HUMAN;.	R	552;524;524;727	ENSP00000438135:L552R;ENSP00000370112:L524R;ENSP00000302312:L524R;ENSP00000338967:L727R	ENSP00000302312:L524R	L	-	2	0	ARHGAP6	11070351	1.000000	0.71417	0.985000	0.45067	0.872000	0.50106	6.002000	0.70693	0.656000	0.30886	0.481000	0.45027	CTG	.	.	none		0.323	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427	
S1PR2	9294	hgsc.bcm.edu	37	19	10335123	10335123	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:10335123C>T	ENST00000590320.1	-	2	569	c.459G>A	c.(457-459)ggG>ggA	p.G153G	CTD-2369P2.2_ENST00000317726.4_lincRNA	NM_004230.3	NP_004221.3	O95136	S1PR2_HUMAN	sphingosine-1-phosphate receptor 2	153					activation of MAPK activity (GO:0000187)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of endothelial barrier (GO:1903142)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						GCCACGAGGCCCCGATGAGCA	0.637																																					p.G153G	Pancreas(194;229 3020 15179 45747)	Atlas-SNP	.											.	S1PR2	36	.	0			c.G459A						PASS	.						61.0	57.0	58.0					19																	10335123		2203	4300	6503	SO:0001819	synonymous_variant	9294	exon2			CGAGGCCCCGATG	AF034780	CCDS12229.1	19q13	2013-03-13	2008-04-30	2008-04-30	ENSG00000267534	ENSG00000267534		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3169	protein-coding gene	gene with protein product		605111	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 5"""	EDG5		8087418, 8878560	Standard	NM_004230		Approved	Gpcr13, H218, AGR16	uc002mnl.2	O95136	OTTHUMG00000180399	ENST00000590320.1:c.459G>A	19.37:g.10335123C>T		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	33	26	0.787879	NM_004230	Q86UN8	Silent	SNP	ENST00000590320.1	37	CCDS12229.1																																																																																			.	.	none		0.637	S1PR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451194.1	NM_004230	
PEX5L	51555	hgsc.bcm.edu	37	3	179537727	179537727	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:179537727C>T	ENST00000467460.1	-	9	1190	c.860G>A	c.(859-861)tGg>tAg	p.W287*	PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000392649.3_Nonsense_Mutation_p.W179*|PEX5L_ENST00000476138.1_Nonsense_Mutation_p.W244*|PEX5L_ENST00000485199.1_Nonsense_Mutation_p.W252*|PEX5L_ENST00000263962.8_Nonsense_Mutation_p.W285*|PEX5L_ENST00000472994.1_Nonsense_Mutation_p.W228*|PEX5L_ENST00000465751.1_Nonsense_Mutation_p.W263*|PEX5L_ENST00000464614.1_Nonsense_Mutation_p.W179*|PEX5L_ENST00000468741.1_Nonsense_Mutation_p.W95*	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	287					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			CATTTCTTCCCATTCTGCTTG	0.428																																					p.W287X		Atlas-SNP	.											.	PEX5L	104	.	0			c.G860A						PASS	.						208.0	185.0	193.0					3																	179537727		2203	4300	6503	SO:0001587	stop_gained	51555	exon9			TCTTCCCATTCTG	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.860G>A	3.37:g.179537727C>T	ENSP00000419975:p.Trp287*	Somatic	244	0	0		WXS	Illumina HiSeq	Phase_I	250	98	0.392	NM_016559	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Nonsense_Mutation	SNP	ENST00000467460.1	37	CCDS3236.1	.	.	.	.	.	.	.	.	.	.	C	38	6.700758	0.97772	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.2226	18.9841	0.92763	0.0:1.0:0.0:0.0	.	.	.	.	X	287;285;252;285;179;95;244;175;228;179;263	.	ENSP00000263962:W285X	W	-	2	0	PEX5L	181020421	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.185000	0.77714	2.593000	0.87608	0.655000	0.94253	TGG	.	.	none		0.428	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559	
GGN	199720	hgsc.bcm.edu	37	19	38876427	38876427	+	Missense_Mutation	SNP	T	T	G	rs202033519		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:38876427T>G	ENST00000334928.6	-	3	1607	c.1475A>C	c.(1474-1476)cAg>cCg	p.Q492P	SPRED3_ENST00000587013.1_5'Flank|AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_Intron	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	492	Interactions with ZNF403/GGNBP2 and OAZ3. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ggccggggcctggtcggcggc	0.766																																					p.Q492P		Atlas-SNP	.											.	GGN	50	.	0			c.A1475C						PASS	.						3.0	4.0	4.0					19																	38876427		1650	3429	5079	SO:0001583	missense	199720	exon3			GGGGCCTGGTCGG	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1475A>C	19.37:g.38876427T>G	ENSP00000334940:p.Gln492Pro	Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	28	9	0.321429	NM_152657	Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	37	CCDS12516.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.458502	0.26248	.	.	ENSG00000179168	ENST00000334928	.	.	.	2.63	1.58	0.23477	.	0.000000	0.30686	N	0.009099	T	0.34308	0.0893	L	0.27053	0.805	0.09310	N	1	D;P	0.58970	0.984;0.89	P;P	0.62560	0.904;0.702	T	0.09975	-1.0650	9	0.27785	T	0.31	-0.5168	4.7402	0.13008	0.0:0.1547:0.0:0.8453	.	409;492	Q86UU5-2;Q86UU5	.;GGN_HUMAN	P	492	.	ENSP00000334940:Q492P	Q	-	2	0	GGN	43568267	0.000000	0.05858	0.006000	0.13384	0.398000	0.30690	-0.456000	0.06754	0.399000	0.25367	0.374000	0.22700	CAG	.	.	weak		0.766	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
KRT79	338785	hgsc.bcm.edu	37	12	53216988	53216988	+	Silent	SNP	C	C	T	rs573197551		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:53216988C>T	ENST00000330553.5	-	7	1213	c.1179G>A	c.(1177-1179)gcG>gcA	p.A393A		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	393	Coil 2.|Rod.		A -> V (in dbSNP:rs17688627).			extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CACGCTGCTCCGCTTCCGCAA	0.622																																					p.A393A		Atlas-SNP	.											.	KRT79	78	.	0			c.G1179A						PASS	.						67.0	62.0	64.0					12																	53216988		2203	4300	6503	SO:0001819	synonymous_variant	338785	exon7			CTGCTCCGCTTCC	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.1179G>A	12.37:g.53216988C>T		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	101	68	0.673267	NM_175834	Q6P465|Q7Z793	Silent	SNP	ENST00000330553.5	37	CCDS8839.1																																																																																			.	.	none		0.622	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834	
AVIL	10677	hgsc.bcm.edu	37	12	58197059	58197059	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:58197059C>T	ENST00000257861.3	-	15	2363	c.1933G>A	c.(1933-1935)Gac>Aac	p.D645N	TSFM_ENST00000548851.1_Intron|RNU6-1083P_ENST00000384022.1_RNA|AVIL_ENST00000550083.1_5'Flank|RP11-571M6.17_ENST00000602802.1_lincRNA|AVIL_ENST00000537081.1_Missense_Mutation_p.D638N	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	645	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					AGCATCACGTCAGTAGGGTTC	0.478											OREG0021955	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D645N		Atlas-SNP	.											.	AVIL	60	.	0			c.G1933A						PASS	.						225.0	197.0	206.0					12																	58197059		2203	4300	6503	SO:0001583	missense	10677	exon15			TCACGTCAGTAGG	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.1933G>A	12.37:g.58197059C>T	ENSP00000257861:p.Asp645Asn	Somatic	125	0	0	1029	WXS	Illumina HiSeq	Phase_I	199	58	0.291457	NM_006576	B2RAU7|Q2NKM9	Missense_Mutation	SNP	ENST00000257861.3	37	CCDS8959.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.773527	0.69992	.	.	ENSG00000135407	ENST00000537081;ENST00000257861	T;T	0.22134	1.97;1.97	4.74	4.74	0.60224	Gelsolin domain (1);	0.000000	0.85682	D	0.000000	T	0.55561	0.1928	M	0.91663	3.23	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.75484	0.986;0.971	T	0.67260	-0.5715	10	0.87932	D	0	-11.8772	16.6465	0.85178	0.0:1.0:0.0:0.0	.	638;645	O75366-2;O75366	.;AVIL_HUMAN	N	638;645	ENSP00000443207:D638N;ENSP00000257861:D645N	ENSP00000257861:D645N	D	-	1	0	AVIL	56483326	1.000000	0.71417	0.627000	0.29227	0.033000	0.12548	7.605000	0.82844	2.458000	0.83093	0.561000	0.74099	GAC	.	.	none		0.478	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409276.1	NM_006576	
FOXD4	2298	hgsc.bcm.edu	37	9	117998	117998	+	Missense_Mutation	SNP	G	G	T	rs66612967	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr9:117998G>T	ENST00000382500.2	-	1	419	c.122C>A	c.(121-123)gCg>gAg	p.A41E		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	41					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A41E(1)		endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CTGGCTCGCCGCCTCCTCCTC	0.682													T|||	111	0.0221645	0.0749	0.013	5008	,	,		13954	0.001		0.002	False		,,,				2504	0.0				p.A41E		Atlas-SNP	.											FOXD4_ENST00000382500,NS,carcinoma,0,3	FOXD4	75	3	1	Substitution - Missense(1)	skin(1)	c.C122A						scavenged	.						38.0	53.0	48.0					9																	117998		2203	4298	6501	SO:0001583	missense	2298	exon1			CTCGCCGCCTCCT	U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.122C>A	9.37:g.117998G>T	ENSP00000371940:p.Ala41Glu	Somatic	249	18	0.0722892		WXS	Illumina HiSeq	Phase_I	237	28	0.118143	NM_207305	B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Missense_Mutation	SNP	ENST00000382500.2	37	CCDS34975.1	50	0.022893772893772892	43	0.08739837398373984	4	0.011049723756906077	3	0.005244755244755245	0	0.0	.	0.012	-1.673624	0.00758	.	.	ENSG00000170122	ENST00000382500	D	0.94457	-3.43	1.56	1.56	0.23342	.	.	.	.	.	T	0.13030	0.0316	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.57458	-0.7808	9	0.02654	T	1	.	4.5559	0.12136	0.0:0.0:0.3427:0.6573	.	41	Q12950	FOXD4_HUMAN	E	41	ENSP00000371940:A41E	ENSP00000371940:A41E	A	-	2	0	FOXD4	107998	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	-0.379000	0.07437	0.095000	0.17434	-1.316000	0.01300	GCG	G|0.977;T|0.023	0.023	strong		0.682	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055433.1	NM_207305	
OR5M11	219487	hgsc.bcm.edu	37	11	56310329	56310329	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:56310329C>T	ENST00000528616.2	-	1	428	c.405G>A	c.(403-405)acG>acA	p.T135T		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						CTCTCCTGGACGTTTTCACAC	0.498																																					p.T135T		Atlas-SNP	.											OR5M11,NS,carcinoma,0,2	OR5M11	60	2	0			c.G405A						PASS	.						51.0	54.0	53.0					11																	56310329		2179	4283	6462	SO:0001819	synonymous_variant	219487	exon1			CCTGGACGTTTTC	AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.405G>A	11.37:g.56310329C>T		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	48	26	0.541667	NM_001005245	B2RNL5|B2RNL7	Silent	SNP	ENST00000528616.2	37	CCDS53629.1																																																																																			.	.	none		0.498	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391608.1	NM_001005245	
SOCS1	8651	hgsc.bcm.edu	37	16	11349096	11349096	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:11349096G>A	ENST00000332029.2	-	2	390	c.240C>T	c.(238-240)taC>taT	p.Y80Y	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	80	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.Y64fs*1(1)|p.Y80*(1)|p.0?(1)|p.D63_Q108del(1)|p.S71fs*29(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						GGGGCCCCCAGTAGAATCCGC	0.726			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.Y80Y	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	SOCS1,lymph_node,lymphoid_neoplasm,0,1	SOCS1	84	1	5	Deletion - Frameshift(2)|Substitution - Nonsense(1)|Whole gene deletion(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(5)	c.C240T						PASS	.						3.0	4.0	4.0					16																	11349096		1833	3774	5607	SO:0001819	synonymous_variant	8651	exon2			CCCCCAGTAGAAT	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.240C>T	16.37:g.11349096G>A		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	25	8	0.32	NM_003745	O15097|Q9NSA7	Silent	SNP	ENST00000332029.2	37	CCDS10546.1																																																																																			.	.	none		0.726	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
CAD	790	hgsc.bcm.edu	37	2	27456274	27456274	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr2:27456274G>A	ENST00000403525.1	+	19	3041	c.2897G>A	c.(2896-2898)cGg>cAg	p.R966Q	CAD_ENST00000264705.4_Missense_Mutation_p.R1029Q			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGTTGCATCGGCAGCAGTGC	0.567																																					p.R1029Q		Atlas-SNP	.											CAD,NS,malignant_melanoma,+1,1	CAD	199	1	0			c.G3086A						PASS	.						57.0	55.0	56.0					2																	27456274		2203	4300	6503	SO:0001583	missense	790	exon20			TGCATCGGCAGCA	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.2897G>A	2.37:g.27456274G>A	ENSP00000384510:p.Arg966Gln	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	76	33	0.434211	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.	.	.	.	.	.	.	.	.	.	G	36	5.904524	0.97087	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.97328	-4.34;-4.34	5.62	5.62	0.85841	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98043	0.9355	L	0.61218	1.895	0.80722	D	1	D;D	0.89917	0.987;1.0	P;D	0.78314	0.782;0.991	D	0.98147	1.0439	10	0.51188	T	0.08	-9.735	18.5877	0.91196	0.0:0.0:1.0:0.0	.	966;1029	F8VPD4;P27708	.;PYR1_HUMAN	Q	1029;966	ENSP00000264705:R1029Q;ENSP00000384510:R966Q	ENSP00000264705:R1029Q	R	+	2	0	CAD	27309778	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.064000	0.71169	2.804000	0.96469	0.655000	0.94253	CGG	.	.	none		0.567	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
ERICH6	131831	hgsc.bcm.edu	37	3	150421519	150421519	+	Missense_Mutation	SNP	A	A	T	rs573303855	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:150421519A>T	ENST00000295910.6	-	1	219	c.167T>A	c.(166-168)gTg>gAg	p.V56E	RP11-103G8.2_ENST00000475393.1_RNA|RP11-103G8.2_ENST00000471093.1_RNA|FAM194A_ENST00000491361.1_Intron	NM_152394.3	NP_689607.2												p.V56E(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ctcctcctccaccacctcctc	0.607													A|||	41	0.0081869	0.0091	0.0144	5008	,	,		1681	0.0069		0.0089	False		,,,				2504	0.0031				p.V56E		Atlas-SNP	.											FAM194A,NS,carcinoma,0,1	FAM194A	91	1	1	Substitution - Missense(1)	endometrium(1)	c.T167A						scavenged	.						198.0	156.0	171.0					3																	150421519		2203	4299	6502	SO:0001583	missense	131831	exon1			TCCTCCACCACCT																												ENST00000295910.6:c.167T>A	3.37:g.150421519A>T	ENSP00000295910:p.Val56Glu	Somatic	40	2	0.05		WXS	Illumina HiSeq	Phase_I	52	5	0.0961538	NM_152394		Missense_Mutation	SNP	ENST00000295910.6	37	CCDS3151.2	.	.	.	.	.	.	.	.	.	.	A	4.695	0.129296	0.08981	.	.	ENSG00000163645	ENST00000295910	T	0.13538	2.58	3.11	-4.8	0.03190	.	1.710190	0.03876	N	0.276462	T	0.04318	0.0119	N	0.08118	0	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.29181	-1.0020	10	0.02654	T	1	-0.1027	0.7864	0.01049	0.1614:0.2002:0.316:0.3224	.	56	Q7L0X2	F194A_HUMAN	E	56	ENSP00000295910:V56E	ENSP00000295910:V56E	V	-	2	0	FAM194A	151904209	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.158000	0.03153	-0.978000	0.03533	-0.472000	0.04984	GTG	.	.	none		0.607	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1		
SALL1	6299	hgsc.bcm.edu	37	16	51175886	51175886	+	Missense_Mutation	SNP	C	C	T	rs376234367		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:51175886C>T	ENST00000251020.4	-	2	280	c.247G>A	c.(247-249)Gaa>Aaa	p.E83K	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_5'UTR|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	83					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E83K(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GAGAAGGTTTCGGGTGGGGAG	0.423																																					p.E83K	GBM(103;1352 1446 1855 4775 8890)	Atlas-SNP	.											SALL1,face,carcinoma,0,2	SALL1	301	2	1	Substitution - Missense(1)	skin(1)	c.G247A						scavenged	.						78.0	87.0	84.0					16																	51175886		2198	4300	6498	SO:0001583	missense	6299	exon2			AGGTTTCGGGTGG	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.247G>A	16.37:g.51175886C>T	ENSP00000251020:p.Glu83Lys	Somatic	101	1	0.00990099		WXS	Illumina HiSeq	Phase_I	170	95	0.558824	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.153321	0.38021	.	.	ENSG00000103449	ENST00000251020;ENST00000457559	T	0.08807	3.05	5.26	4.06	0.47325	.	0.301502	0.41396	N	0.000890	T	0.10637	0.0260	M	0.62723	1.935	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.05037	-1.0910	10	0.33940	T	0.23	.	11.2473	0.49004	0.0:0.8862:0.0:0.1138	.	83	Q9NSC2	SALL1_HUMAN	K	83	ENSP00000251020:E83K	ENSP00000251020:E83K	E	-	1	0	SALL1	49733387	1.000000	0.71417	0.253000	0.24343	0.946000	0.59487	6.065000	0.71176	0.867000	0.35654	0.555000	0.69702	GAA	.	.	weak		0.423	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
MICAL3	57553	hgsc.bcm.edu	37	22	18314712	18314712	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr22:18314712C>T	ENST00000441493.2	-	21	3315	c.2963G>A	c.(2962-2964)gGg>gAg	p.G988E		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	988	Glu-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		ATTCCCAGGCCCAAAGCTCTT	0.552																																					p.G988E		Atlas-SNP	.											.	MICAL3	53	.	0			c.G2963A						PASS	.						66.0	58.0	61.0					22																	18314712		1564	3575	5139	SO:0001583	missense	57553	exon21			CCAGGCCCAAAGC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2963G>A	22.37:g.18314712C>T	ENSP00000416015:p.Gly988Glu	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	80	38	0.475	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	C	2.016	-0.426009	0.04701	.	.	ENSG00000093100	ENST00000441493	T	0.59364	0.27	5.27	-7.39	0.01402	.	.	.	.	.	T	0.23133	0.0559	N	0.08118	0	0.40554	D	0.981146	B	0.02656	0.0	B	0.01281	0.0	T	0.37934	-0.9684	9	0.02654	T	1	.	5.9692	0.19342	0.1768:0.5039:0.0902:0.2291	.	988	Q7RTP6	MICA3_HUMAN	E	988	ENSP00000416015:G988E	ENSP00000416015:G988E	G	-	2	0	XXbac-B461K10.4	16694712	0.004000	0.15560	0.000000	0.03702	0.258000	0.26162	-0.169000	0.09911	-2.929000	0.00301	-1.183000	0.01708	GGG	.	.	none		0.552	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
HIST1H3B	8358	hgsc.bcm.edu	37	6	26031889	26031889	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:26031889C>G	ENST00000244661.2	-	1	399	c.400G>C	c.(400-402)Gaa>Caa	p.E134Q		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	134					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						TACGCTCTTTCTCCGCGAATG	0.458																																					p.E134Q		Atlas-SNP	.											.	HIST1H3B	59	.	0			c.G400C						PASS	.						58.0	61.0	60.0					6																	26031889		2203	4300	6503	SO:0001583	missense	8358	exon1			CTCTTTCTCCGCG	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.400G>C	6.37:g.26031889C>G	ENSP00000244661:p.Glu134Gln	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	60	51	0.85	NM_003537	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000244661.2	37	CCDS4573.1	.	.	.	.	.	.	.	.	.	.	c	14.81	2.646170	0.47258	.	.	ENSG00000124693	ENST00000244661	T	0.48201	0.82	5.17	5.17	0.71159	.	.	.	.	.	T	0.60676	0.2287	.	.	.	0.41871	D	0.990276	.	.	.	.	.	.	T	0.65647	-0.6117	6	0.87932	D	0	.	18.0207	0.89253	0.0:1.0:0.0:0.0	.	.	.	.	Q	134	ENSP00000244661:E134Q	ENSP00000244661:E134Q	E	-	1	0	HIST1H3B	26139868	1.000000	0.71417	0.976000	0.42696	0.130000	0.20726	7.492000	0.81482	2.545000	0.85829	0.561000	0.74099	GAA	.	.	none		0.458	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537	
KRTAP4-6	81871	hgsc.bcm.edu	37	17	39296423	39296423	+	Missense_Mutation	SNP	C	C	T	rs349790	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:39296423C>T	ENST00000345847.4	-	1	316	c.317G>A	c.(316-318)cGt>cAt	p.R106H		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	106	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						GCAGCTGGGACGGCAGCAAGT	0.652													C|||	64	0.0127796	0.0023	0.0303	5008	,	,		18713	0.006		0.0149	False		,,,				2504	0.0194				p.R106H		Atlas-SNP	.											KRTAP4-6,NS,carcinoma,0,2	KRTAP4-6	46	2	0			c.G317A						scavenged	.																																			SO:0001583	missense	81871	exon1			CTGGGACGGCAGC	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.317G>A	17.37:g.39296423C>T	ENSP00000328270:p.Arg106His	Somatic	56	6	0.107143		WXS	Illumina HiSeq	Phase_I	94	16	0.170213	NM_030976	Q9BYR1	Missense_Mutation	SNP	ENST00000345847.4	37	CCDS54125.1	31	0.014194139194139194	5	0.01016260162601626	4	0.011049723756906077	6	0.01048951048951049	16	0.021108179419525065	.	11.71	1.719810	0.30503	.	.	ENSG00000198090	ENST00000345847	T	0.01505	4.82	5.0	-8.28	0.01013	.	209.318000	0.00520	U	0.000185	T	0.01695	0.0054	M	0.76838	2.35	0.09310	N	1	.	.	.	.	.	.	T	0.38373	-0.9664	8	0.38643	T	0.18	.	4.1396	0.10188	0.0982:0.3223:0.0969:0.4827	.	.	.	.	H	106	ENSP00000328270:R106H	ENSP00000328270:R106H	R	-	2	0	KRTAP4-6	36549949	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.922000	0.04004	-1.133000	0.02903	-2.248000	0.00284	CGT	C|0.988;T|0.012	0.012	strong		0.652	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
ZNF569	148266	hgsc.bcm.edu	37	19	37904751	37904751	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:37904751T>C	ENST00000316950.6	-	6	1366	c.809A>G	c.(808-810)tAt>tGt	p.Y270C	ZNF569_ENST00000392149.2_Missense_Mutation_p.Y270C|ZNF569_ENST00000392150.2_Missense_Mutation_p.Y111C	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTTACATGCATAGGGCTTCTC	0.343																																					p.Y270C		Atlas-SNP	.											.	ZNF569	101	.	0			c.A809G						PASS	.						79.0	84.0	82.0					19																	37904751		2203	4299	6502	SO:0001583	missense	148266	exon6			CATGCATAGGGCT	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.809A>G	19.37:g.37904751T>C	ENSP00000325018:p.Tyr270Cys	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	89	36	0.404494	NM_152484	A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	37	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	T	11.12	1.546214	0.27652	.	.	ENSG00000196437	ENST00000316950;ENST00000392150	T;T	0.25414	1.8;1.8	3.89	3.89	0.44902	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34268	N	0.004102	T	0.45196	0.1330	M	0.71036	2.16	0.38461	D	0.947224	B;D	0.76494	0.411;0.999	B;D	0.81914	0.169;0.995	T	0.50215	-0.8854	10	0.72032	D	0.01	.	7.815	0.29254	0.1862:0.0:0.0:0.8138	.	111;270	Q17RR6;Q5MCW4	.;ZN569_HUMAN	C	270;111	ENSP00000325018:Y270C;ENSP00000375993:Y111C	ENSP00000325018:Y270C	Y	-	2	0	ZNF569	42596591	0.000000	0.05858	0.974000	0.42286	0.615000	0.37417	-0.981000	0.03766	1.745000	0.51790	0.533000	0.62120	TAT	.	.	none		0.343	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484	
RIMS4	140730	hgsc.bcm.edu	37	20	43385538	43385538	+	Splice_Site	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr20:43385538C>A	ENST00000372851.3	-	5	658		c.e5+1		RIMS4_ENST00000541604.2_Splice_Site	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				ATGCCCCTCACCTGGAGGACT	0.587																																					.		Atlas-SNP	.											.	RIMS4	47	.	0			c.594+1G>T						PASS	.						242.0	211.0	221.0					20																	43385538		2203	4300	6503	SO:0001630	splice_region_variant	140730	exon6			CCCTCACCTGGAG		CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.591+1G>T	20.37:g.43385538C>A		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	113	52	0.460177	NM_001205317	A4FU94|E1P613|Q3MI44|Q5JWT7	Splice_Site	SNP	ENST00000372851.3	37	CCDS13338.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.143738	0.77888	.	.	ENSG00000101098	ENST00000372851;ENST00000541604	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6881	0.91573	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RIMS4	42818952	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	7.818000	0.86416	2.404000	0.81709	0.462000	0.41574	.	.	.	none		0.587	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970	Intron
MAP1S	55201	hgsc.bcm.edu	37	19	17837421	17837421	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:17837421G>A	ENST00000324096.4	+	5	1379	c.1228G>A	c.(1228-1230)Gcc>Acc	p.A410T	CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000544059.2_Missense_Mutation_p.A384T|MAP1S_ENST00000597681.1_Intron	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	410	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						GCGCACGCTGGCCTCTGTGTG	0.726																																					p.A410T		Atlas-SNP	.											MAP1S,bladder,carcinoma,-2,1	MAP1S	74	1	0			c.G1228A						PASS	.																																			SO:0001583	missense	55201	exon5			ACGCTGGCCTCTG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1228G>A	19.37:g.17837421G>A	ENSP00000325313:p.Ala410Thr	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	67	31	0.462687	NM_018174	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	37	CCDS32954.1	.	.	.	.	.	.	.	.	.	.	G	0.125	-1.121058	0.01785	.	.	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.03635	3.86;3.86	3.39	3.39	0.38822	.	0.300651	0.23828	N	0.044172	T	0.01870	0.0059	N	0.16037	0.36	0.21064	N	0.999797	B;B;B	0.20671	0.047;0.047;0.026	B;B;B	0.17722	0.019;0.019;0.013	T	0.47341	-0.9125	10	0.02654	T	1	-11.0899	6.6284	0.22843	0.1361:0.0:0.8639:0.0	.	384;410;410	B4DH53;A8K940;Q66K74	.;.;MAP1S_HUMAN	T	410;384	ENSP00000325313:A410T;ENSP00000439243:A384T	ENSP00000325313:A410T	A	+	1	0	MAP1S	17698421	0.001000	0.12720	0.085000	0.20634	0.155000	0.21991	0.751000	0.26348	1.437000	0.47472	0.561000	0.74099	GCC	.	.	none		0.726	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
MROH2B	133558	hgsc.bcm.edu	37	5	41038933	41038933	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:41038933C>T	ENST00000399564.4	-	21	2569	c.2119G>A	c.(2119-2121)Gca>Aca	p.A707T	MROH2B_ENST00000506092.2_Missense_Mutation_p.A262T	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	707																	AGGGCCACTGCTCCATAGATG	0.463																																					p.A707T		Atlas-SNP	.											.	.	.	.	0			c.G2119A						PASS	.						77.0	74.0	75.0					5																	41038933		1891	4107	5998	SO:0001583	missense	133558	exon21			CCACTGCTCCATA		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2119G>A	5.37:g.41038933C>T	ENSP00000382476:p.Ala707Thr	Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	66	18	0.272727	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	7.393	0.631255	0.14322	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.67523	4.99;-0.27	5.93	0.268	0.15626	Armadillo-type fold (1);	0.920724	0.09128	N	0.844815	T	0.49355	0.1552	L	0.44542	1.39	0.09310	N	1	B	0.31548	0.328	B	0.24394	0.053	T	0.29488	-1.0010	10	0.24483	T	0.36	.	3.8653	0.09013	0.4933:0.2968:0.1285:0.0814	.	707	Q7Z745	HTRB2_HUMAN	T	262;412;707	ENSP00000441504:A262T;ENSP00000382476:A707T	ENSP00000296803:A412T	A	-	1	0	HEATR7B2	41074690	0.000000	0.05858	0.074000	0.20217	0.205000	0.24178	-0.383000	0.07398	0.367000	0.24454	0.655000	0.94253	GCA	.	.	none		0.463	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
HECW1	23072	hgsc.bcm.edu	37	7	43360271	43360271	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr7:43360271C>A	ENST00000395891.2	+	5	995	c.390C>A	c.(388-390)aaC>aaA	p.N130K	HECW1_ENST00000453890.1_Missense_Mutation_p.N130K	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	130					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						ACTATAAAAACCGTGGAGTCA	0.453																																					p.N130K		Atlas-SNP	.											.	HECW1	540	.	0			c.C390A						PASS	.						121.0	117.0	119.0					7																	43360271		1880	4111	5991	SO:0001583	missense	23072	exon5			TAAAAACCGTGGA	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.390C>A	7.37:g.43360271C>A	ENSP00000379228:p.Asn130Lys	Somatic	198	0	0		WXS	Illumina HiSeq	Phase_I	178	77	0.432584	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253889	0.80135	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.37235	1.21;1.21	5.94	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.54334	0.1852	M	0.68593	2.085	0.54753	D	0.999984	D;P;D	0.76494	0.999;0.918;0.999	D;P;D	0.80764	0.994;0.542;0.994	T	0.57394	-0.7819	10	0.87932	D	0	.	9.4899	0.38953	0.0:0.7338:0.0:0.2662	.	130;162;130	B4DH42;B3KR18;Q76N89	.;.;HECW1_HUMAN	K	130;130;129	ENSP00000379228:N130K;ENSP00000407774:N130K	ENSP00000265522:N129K	N	+	3	2	HECW1	43326796	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.241000	0.51376	1.526000	0.49068	0.650000	0.86243	AAC	.	.	none		0.453	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
HLA-DRB5	3127	hgsc.bcm.edu	37	6	32497960	32497960	+	Missense_Mutation	SNP	C	C	A	rs75457801	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:32497960C>A	ENST00000374975.3	-	1	104	c.42G>T	c.(40-42)aaG>aaT	p.K14N		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5									p.K14K(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						TCACTGTCAGCTTTGCCATGT	0.582																																					p.K14N		Atlas-SNP	.											HLA-DRB5,colon,carcinoma,-2,2	HLA-DRB5	31	2	1	Substitution - coding silent(1)	stomach(1)	c.G42T						scavenged	.						57.0	63.0	61.0					6																	32497960		2184	4279	6463	SO:0001583	missense	3127	exon1			TGTCAGCTTTGCC		CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.42G>T	6.37:g.32497960C>A	ENSP00000364114:p.Lys14Asn	Somatic	86	7	0.0813954		WXS	Illumina HiSeq	Phase_I	87	49	0.563218	NM_002125		Missense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	.	.	.	.	.	.	.	.	.	.	.	9.217	1.032387	0.19590	.	.	ENSG00000198502	ENST00000374975	T	0.00258	8.41	4.54	-2.98	0.05513	MHC classes I/II-like antigen recognition protein (1);	0.968061	0.08500	N	0.936540	T	0.00039	0.0001	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07809	-1.0753	10	0.87932	D	0	.	7.522	0.27633	0.5447:0.3723:0.0829:0.0	.	14	Q30154	DRB5_HUMAN	N	14	ENSP00000364114:K14N	ENSP00000364114:K14N	K	-	3	2	HLA-DRB5	32605938	0.326000	0.24669	0.001000	0.08648	0.001000	0.01503	0.963000	0.29293	-0.266000	0.09339	-3.775000	0.00021	AAG	A|0.157;C|0.738;T|0.105	0.157	strong		0.582	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
RHOT1	55288	hgsc.bcm.edu	37	17	30551748	30551748	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:30551748G>A	ENST00000333942.6	+	19	2092	c.1853G>A	c.(1852-1854)cGa>cAa	p.R618Q	RHOT1_ENST00000394692.2_Missense_Mutation_p.R650Q|RHOT1_ENST00000583994.1_Missense_Mutation_p.R523Q|RHOT1_ENST00000354266.3_Missense_Mutation_p.R597Q|RHOT1_ENST00000545287.2_Missense_Mutation_p.R659Q|RHOT1_ENST00000358365.3_Missense_Mutation_p.R691Q	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	618					cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TTGAAACAGCGATGATATAAA	0.353																																					p.R691Q		Atlas-SNP	.											RHOT1,NS,lymphoid_neoplasm,+1,1	RHOT1	69	1	0			c.G2072A						PASS	.						129.0	118.0	122.0					17																	30551748		2203	4300	6503	SO:0001583	missense	55288	exon21			AACAGCGATGATA	AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.1853G>A	17.37:g.30551748G>A	ENSP00000334724:p.Arg618Gln	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	96	50	0.520833	NM_001033568	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Missense_Mutation	SNP	ENST00000333942.6	37	CCDS32612.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.610185	0.46527	.	.	ENSG00000126858	ENST00000358365;ENST00000354266;ENST00000394692;ENST00000333942	T;T;T	0.78126	-1.15;-1.1;-0.92	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.85133	0.5627	L	0.44542	1.39	0.80722	D	1	P;P;D	0.76494	0.895;0.809;0.999	B;B;D	0.77557	0.358;0.082;0.99	T	0.83297	-0.0030	10	0.44086	T	0.13	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	650;618;691	Q8IXI2-2;Q8IXI2;Q8IXI2-3	.;MIRO1_HUMAN;.	Q	691;659;650;618	ENSP00000351132:R691Q;ENSP00000378184:R650Q;ENSP00000334724:R618Q	ENSP00000334724:R618Q	R	+	2	0	RHOT1	27575861	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.476000	0.97823	2.836000	0.97738	0.655000	0.94253	CGA	.	.	none		0.353	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000447097.1	NM_018307	
TMEM237	65062	hgsc.bcm.edu	37	2	202501530	202501530	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr2:202501530A>C	ENST00000409883.2	-	5	331	c.215T>G	c.(214-216)cTc>cGc	p.L72R	TMEM237_ENST00000409444.2_Missense_Mutation_p.L64R	NM_001044385.2	NP_001037850.1	Q96Q45	TM237_HUMAN	transmembrane protein 237	72					cilium assembly (GO:0042384)|regulation of Wnt signaling pathway (GO:0030111)	ciliary transition zone (GO:0035869)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(2)|kidney(1)|large_intestine(1)|lung(3)	7						GTGCTCTTTGAGTTCTTTAGT	0.453																																					p.L72R		Atlas-SNP	.											.	TMEM237	21	.	0			c.T215G						PASS	.						64.0	60.0	61.0					2																	202501530		1835	4093	5928	SO:0001583	missense	65062	exon4			TCTTTGAGTTCTT	AB053301	CCDS46489.1, CCDS46490.1	2q33	2012-05-08	2011-05-20	2011-05-20	ENSG00000155755	ENSG00000155755			14432	protein-coding gene	gene with protein product		614423	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4"""	ALS2CR4		11586298, 20375344	Standard	NM_001044385		Approved	JBTS14	uc021vvg.2	Q96Q45	OTTHUMG00000154526	ENST00000409883.2:c.215T>G	2.37:g.202501530A>C	ENSP00000386264:p.Leu72Arg	Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	35	19	0.542857	NM_001044385	B4E1R8|B4E2R8|E9PAR8|E9PBF8|E9PG24|E9PGX0|Q53TS9|Q53TT2|Q7Z3B6|Q8IZ18|Q8NBF8|Q96CY1	Missense_Mutation	SNP	ENST00000409883.2	37	CCDS46489.1	.	.	.	.	.	.	.	.	.	.	A	9.136	1.012703	0.19277	.	.	ENSG00000155755	ENST00000409444;ENST00000409883;ENST00000435876;ENST00000426684	T;T	0.51325	0.71;0.71	5.27	2.22	0.28083	.	0.509712	0.19376	N	0.115789	T	0.29321	0.0730	L	0.36672	1.1	0.09310	N	1	P;B	0.36837	0.571;0.343	B;B	0.33254	0.16;0.16	T	0.12630	-1.0540	10	0.15952	T	0.53	0.2704	6.1798	0.20465	0.3638:0.0:0.6362:0.0	.	72;96	E9PAR8;Q96Q45	.;TM237_HUMAN	R	64;72;72;94	ENSP00000387203:L64R;ENSP00000386264:L72R	ENSP00000387203:L64R	L	-	2	0	TMEM237	202209775	0.000000	0.05858	0.001000	0.08648	0.513000	0.34164	0.381000	0.20619	0.244000	0.21351	0.528000	0.53228	CTC	.	.	none		0.453	TMEM237-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335753.1	NM_152388	
SHROOM3	57619	hgsc.bcm.edu	37	4	77661110	77661110	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr4:77661110A>T	ENST00000296043.6	+	5	2737	c.1784A>T	c.(1783-1785)aAa>aTa	p.K595I		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	595					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CACAGTAACAAACCATCTTCT	0.557																																					p.K595I		Atlas-SNP	.											.	SHROOM3	134	.	0			c.A1784T						PASS	.						211.0	199.0	203.0					4																	77661110		2203	4300	6503	SO:0001583	missense	57619	exon5			GTAACAAACCATC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.1784A>T	4.37:g.77661110A>T	ENSP00000296043:p.Lys595Ile	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	59	23	0.38983	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	37	CCDS3579.2	.	.	.	.	.	.	.	.	.	.	A	7.364	0.625411	0.14257	.	.	ENSG00000138771	ENST00000296043	T	0.21191	2.02	5.46	-5.81	0.02340	.	2.025370	0.02041	N	0.049271	T	0.15392	0.0371	L	0.44542	1.39	0.09310	N	1	B;B;B	0.30763	0.294;0.139;0.139	B;B;B	0.30251	0.113;0.037;0.037	T	0.32322	-0.9911	10	0.72032	D	0.01	-1.1685	1.9131	0.03291	0.2337:0.2642:0.3582:0.144	.	419;595;373	B4E244;Q8TF72;B3KY47	.;SHRM3_HUMAN;.	I	595	ENSP00000296043:K595I	ENSP00000296043:K595I	K	+	2	0	SHROOM3	77880134	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.720000	0.04969	-0.486000	0.06744	0.379000	0.24179	AAA	.	.	none		0.557	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
BANP	54971	hgsc.bcm.edu	37	16	88039849	88039849	+	Silent	SNP	G	G	A	rs372273341		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:88039849G>A	ENST00000393207.1	+	6	830	c.609G>A	c.(607-609)acG>acA	p.T203T	BANP_ENST00000479780.2_Silent_p.T172T|BANP_ENST00000286122.7_Silent_p.T203T|BANP_ENST00000538234.1_Silent_p.T211T|BANP_ENST00000355163.5_Silent_p.T178T|BANP_ENST00000355022.4_Silent_p.T172T|BANP_ENST00000393208.2_Silent_p.T172T	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	203	Interaction with CUX1 and HDAC1. {ECO:0000250}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		GCAACGTCACGCTCATCACCC	0.582																																					p.T211T		Atlas-SNP	.											.	BANP	67	.	0			c.G633A						PASS	.	G	,,,,,,	1,4395	2.1+/-5.4	0,1,2197	74.0	75.0	75.0		633,534,516,633,609,516,516	-4.0	1.0	16		75	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	BANP	NM_001173539.1,NM_001173540.1,NM_001173541.1,NM_001173542.1,NM_001173543.1,NM_017869.3,NM_079837.2	,,,,,,	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,	211/506,178/498,172/467,211/509,203/520,172/470,172/492	88039849	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	54971	exon6			CGTCACGCTCATC	AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.609G>A	16.37:g.88039849G>A		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	78	48	0.615385	NM_001173542	A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Silent	SNP	ENST00000393207.1	37	CCDS54054.1																																																																																			.	.	weak		0.582	BANP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269166.1	NM_017869	
HLA-DQA2	3118	hgsc.bcm.edu	37	6	32713608	32713608	+	Silent	SNP	G	G	A	rs199931222		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:32713608G>A	ENST00000374940.3	+	3	474	c.372G>A	c.(370-372)acG>acA	p.T124T		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	124	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	TTCCTGTGACGCTGGGTCAGC	0.512																																					p.T124T		Atlas-SNP	.											HLA-DQA2,colon,carcinoma,+1,1	HLA-DQA2	27	1	0			c.G372A						scavenged	.						199.0	156.0	171.0					6																	32713608		1511	2709	4220	SO:0001819	synonymous_variant	3118	exon3			TGTGACGCTGGGT		CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.372G>A	6.37:g.32713608G>A		Somatic	176	9	0.0511364		WXS	Illumina HiSeq	Phase_I	236	68	0.288136	NM_020056	A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Silent	SNP	ENST00000374940.3	37	CCDS4753.1																																																																																			G|0.998;A|0.002	0.002	weak		0.512	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076179.2	NM_020056	
FLG2	388698	hgsc.bcm.edu	37	1	152326298	152326298	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:152326298T>A	ENST00000388718.5	-	3	4036	c.3964A>T	c.(3964-3966)Act>Tct	p.T1322S	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1322					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATGTCTAGTGGTATCTCCT	0.473																																					p.T1322S		Atlas-SNP	.											.	FLG2	431	.	0			c.A3964T						PASS	.						369.0	313.0	332.0					1																	152326298		2203	4300	6503	SO:0001583	missense	388698	exon3			GTCTAGTGGTATC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3964A>T	1.37:g.152326298T>A	ENSP00000373370:p.Thr1322Ser	Somatic	227	0	0		WXS	Illumina HiSeq	Phase_I	247	98	0.396761	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	T	0.971	-0.700293	0.03279	.	.	ENSG00000143520	ENST00000388718	T	0.35236	1.32	2.89	-5.77	0.02369	.	.	.	.	.	T	0.03305	0.0096	N	0.13235	0.315	0.09310	N	1	B	0.19073	0.033	B	0.14023	0.01	T	0.30534	-0.9975	9	0.02654	T	1	-4.0209	3.9618	0.09413	0.6078:0.166:0.0:0.2263	.	1322	Q5D862	FILA2_HUMAN	S	1322	ENSP00000373370:T1322S	ENSP00000373370:T1322S	T	-	1	0	FLG2	150592922	.	.	0.000000	0.03702	0.007000	0.05969	.	.	-1.185000	0.02716	0.254000	0.18369	ACT	.	.	none		0.473	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
TRIM48	79097	hgsc.bcm.edu	37	11	55032663	55032663	+	Missense_Mutation	SNP	T	T	C	rs200778682	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:55032663T>C	ENST00000417545.2	+	2	418	c.332T>C	c.(331-333)aTt>aCt	p.I111T		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	95						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ATGTGTGGCATTCACAGGGAG	0.498																																					p.I111T		Atlas-SNP	.											TRIM48_ENST00000417545,NS,carcinoma,0,4	TRIM48	149	4	0			c.T332C						scavenged	.						98.0	90.0	93.0					11																	55032663		2188	4256	6444	SO:0001583	missense	79097	exon2			GTGGCATTCACAG	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.332T>C	11.37:g.55032663T>C	ENSP00000402414:p.Ile111Thr	Somatic	531	10	0.0188324		WXS	Illumina HiSeq	Phase_I	440	11	0.025	NM_024114	Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	c	0	-2.612529	0.00120	.	.	ENSG00000150244	ENST00000417545	T	0.40476	1.03	0.596	0.596	0.17496	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, B-box (3);	.	.	.	.	T	0.13114	0.0318	N	0.03324	-0.35	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28038	-1.0056	9	0.02654	T	1	.	1.7225	0.02915	0.3221:0.4182:0.0:0.2597	.	95	Q8IWZ4	TRI48_HUMAN	T	111	ENSP00000402414:I111T	ENSP00000402414:I111T	I	+	2	0	TRIM48	54789239	0.000000	0.05858	0.154000	0.22540	0.130000	0.20726	-4.117000	0.00292	-0.174000	0.10743	-1.141000	0.01876	ATT	T|0.996;C|0.004	0.004	strong		0.498	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1		
IARS	3376	hgsc.bcm.edu	37	9	95021262	95021262	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr9:95021262G>A	ENST00000375643.3	-	19	2156	c.1890C>T	c.(1888-1890)tcC>tcT	p.S630S	IARS_ENST00000375629.3_5'UTR|IARS_ENST00000447699.2_Silent_p.S520S|IARS_ENST00000443024.2_Silent_p.S630S	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	630					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	TCACCACAGGGGAGTTAATCA	0.423																																					p.S630S		Atlas-SNP	.											IARS,NS,carcinoma,-2,1	IARS	74	1	0			c.C1890T						scavenged	.						63.0	60.0	61.0					9																	95021262		2203	4300	6503	SO:0001819	synonymous_variant	3376	exon19			CACAGGGGAGTTA	AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.1890C>T	9.37:g.95021262G>A		Somatic	61	1	0.0163934		WXS	Illumina HiSeq	Phase_I	44	10	0.227273	NM_013417	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Silent	SNP	ENST00000375643.3	37	CCDS6694.1																																																																																			.	.	none		0.423	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2	NM_002161	
OR2L2	26246	hgsc.bcm.edu	37	1	248202362	248202362	+	Nonsense_Mutation	SNP	C	C	T	rs546778867		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:248202362C>T	ENST00000366479.2	+	1	889	c.793C>T	c.(793-795)Cga>Tga	p.R265*	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			AAGATCCCTGCGATCTCCAAC	0.498													c|||	1	0.000199681	0.0	0.0014	5008	,	,		19946	0.0		0.0	False		,,,				2504	0.0				p.R265X		Atlas-SNP	.											OR2L2,face,carcinoma,-1,4	OR2L2	115	4	0			c.C793T						scavenged	.						138.0	125.0	130.0					1																	248202362		2203	4300	6503	SO:0001587	stop_gained	26246	exon1			TCCCTGCGATCTC	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.793C>T	1.37:g.248202362C>T	ENSP00000355435:p.Arg265*	Somatic	102	1	0.00980392		WXS	Illumina HiSeq	Phase_I	152	89	0.585526	NM_001004686	Q2M3T5	Nonsense_Mutation	SNP	ENST00000366479.2	37	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	16.24	3.067941	0.55539	.	.	ENSG00000203663	ENST00000366479	.	.	.	1.9	0.911	0.19343	.	0.000000	0.27636	U	0.018492	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	3.04	0.06135	0.243:0.5305:0.0:0.2264	.	.	.	.	X	265	.	ENSP00000355435:R265X	R	+	1	2	OR2L2	246268985	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	-2.234000	0.01203	0.005000	0.14708	0.194000	0.17425	CGA	.	.	none		0.498	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686	
HLA-DRB5	3127	hgsc.bcm.edu	37	6	32487353	32487353	+	Missense_Mutation	SNP	T	T	C	rs114293611	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:32487353T>C	ENST00000374975.3	-	3	508	c.446A>G	c.(445-447)aAt>aGt	p.N149S		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5									p.N149S(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						ATAGAAACCATTCACAGAGCA	0.537													T|||	2089	0.417133	0.559	0.415	5008	,	,		9822	0.3304		0.4414	False		,,,				2504	0.2914				p.N149S		Atlas-SNP	.											HLA-DRB5,NS,lymphoid_neoplasm,0,1	HLA-DRB5	31	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.A446G						scavenged	.	T	SER/ASN	1237,2619		353,531,1044	42.0	53.0	49.0		446	-9.4	0.0	6	dbSNP_132	49	2078,6142		542,994,2574	no	missense	HLA-DRB5	NM_002125.3	46	895,1525,3618	CC,CT,TT		25.2798,32.0799,27.4511	benign	149/267	32487353	3315,8761	1928	4110	6038	SO:0001583	missense	3127	exon3			AAACCATTCACAG		CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.446A>G	6.37:g.32487353T>C	ENSP00000364114:p.Asn149Ser	Somatic	70	6	0.0857143		WXS	Illumina HiSeq	Phase_I	57	50	0.877193	NM_002125		Missense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	1029	0.47115384615384615	246	0.5	177	0.4889502762430939	256	0.44755244755244755	350	0.46174142480211083	.	0.054	-1.240602	0.01493	0.320799	0.252798	ENSG00000198502	ENST00000374975	T	0.02606	4.23	4.69	-9.39	0.00619	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.532611	0.22458	N	0.059800	T	0.00210	0.0006	N	0.01242	-0.935	0.80722	P	0.0	B;B	0.10296	0.0;0.003	B;B	0.13407	0.009;0.005	T	0.39643	-0.9604	9	0.12766	T	0.61	.	3.7772	0.08665	0.0982:0.418:0.1992:0.2846	.	76;149	Q29973;Q30154	.;DRB5_HUMAN	S	149	ENSP00000364114:N149S	ENSP00000364114:N149S	N	-	2	0	HLA-DRB5	32595331	0.000000	0.05858	0.004000	0.12327	0.270000	0.26580	-1.167000	0.03126	-1.562000	0.01682	-1.365000	0.01206	AAT	T|0.525;C|0.475	0.475	strong		0.537	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
CTPS2	56474	hgsc.bcm.edu	37	X	16707682	16707682	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chrX:16707682C>T	ENST00000443824.1	-	8	1506	c.763G>A	c.(763-765)Gtg>Atg	p.V255M	CTPS2_ENST00000359276.4_Missense_Mutation_p.V255M|CTPS2_ENST00000380241.3_Missense_Mutation_p.V255M	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	255					'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					TCTAAAAGCACAGGAACTCGG	0.383																																					p.V255M		Atlas-SNP	.											.	CTPS2	49	.	0			c.G763A						PASS	.						127.0	112.0	117.0					X																	16707682		2203	4300	6503	SO:0001583	missense	56474	exon8			AAAGCACAGGAAC	AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.763G>A	X.37:g.16707682C>T	ENSP00000401264:p.Val255Met	Somatic	483	1	0.00207039		WXS	Illumina HiSeq	Phase_I	668	169	0.252994	NM_001144002	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Missense_Mutation	SNP	ENST00000443824.1	37	CCDS14175.1	.	.	.	.	.	.	.	.	.	.	c	12.35	1.911512	0.33721	.	.	ENSG00000047230	ENST00000443824;ENST00000380241;ENST00000359276	T;T;T	0.43688	0.94;0.94;0.94	5.81	0.87	0.19102	CTP synthase, N-terminal (1);	0.440911	0.20974	N	0.082328	T	0.14527	0.0351	N	0.02412	-0.56	0.23920	N	0.996468	B	0.18741	0.03	B	0.19946	0.027	T	0.16217	-1.0410	10	0.66056	D	0.02	-4.8399	1.1054	0.01693	0.1316:0.2687:0.2635:0.3362	.	255	Q9NRF8	PYRG2_HUMAN	M	255	ENSP00000401264:V255M;ENSP00000369590:V255M;ENSP00000352222:V255M	ENSP00000352222:V255M	V	-	1	0	CTPS2	16617603	0.666000	0.27475	0.693000	0.30195	0.920000	0.55202	0.573000	0.23699	-0.261000	0.09405	0.591000	0.81541	GTG	.	.	none		0.383	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055906.1	NM_019857	
ZNF492	57615	hgsc.bcm.edu	37	19	22848027	22848027	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:22848027A>G	ENST00000456783.2	+	4	1800	c.1556A>G	c.(1555-1557)aAg>aGg	p.K519R	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	519					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				AACATTGCAAAGATTTCCAAA	0.323																																					p.K519R		Atlas-SNP	.											ZNF492_ENST00000456783,NS,carcinoma,-1,1	ZNF492	129	1	0			c.A1556G						scavenged	.						18.0	17.0	17.0					19																	22848027		1781	4030	5811	SO:0001583	missense	57615	exon4			TTGCAAAGATTTC	AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.1556A>G	19.37:g.22848027A>G	ENSP00000413660:p.Lys519Arg	Somatic	829	1	0.00120627		WXS	Illumina HiSeq	Phase_I	761	235	0.308804	NM_020855	Q08EI7|Q08EI8	Missense_Mutation	SNP	ENST00000456783.2	37	CCDS46032.1	.	.	.	.	.	.	.	.	.	.	.	0.458	-0.890660	0.02491	.	.	ENSG00000229676	ENST00000456783	T	0.07567	3.18	1.03	1.03	0.20045	.	.	.	.	.	T	0.05181	0.0138	N	0.25380	0.74	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45600	-0.9250	9	0.16420	T	0.52	.	5.9322	0.19144	1.0:0.0:0.0:0.0	.	519	Q9P255	ZN492_HUMAN	R	519	ENSP00000413660:K519R	ENSP00000413660:K519R	K	+	2	0	ZNF492	22639867	0.000000	0.05858	0.005000	0.12908	0.029000	0.11900	-0.388000	0.07352	0.432000	0.26286	0.128000	0.15822	AAG	.	.	none		0.323	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464581.1	NM_020855	
ARHGAP30	257106	hgsc.bcm.edu	37	1	161026256	161026256	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:161026256G>A	ENST00000368013.3	-	3	587	c.267C>T	c.(265-267)tgC>tgT	p.C89C	ARHGAP30_ENST00000368016.3_Silent_p.C89C|ARHGAP30_ENST00000368015.1_Intron	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	89	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GGGAGGAGACGCAGTGAATGT	0.577																																					p.C89C		Atlas-SNP	.											.	ARHGAP30	105	.	0			c.C267T						PASS	.						85.0	76.0	79.0					1																	161026256		2203	4300	6503	SO:0001819	synonymous_variant	257106	exon3			GGAGACGCAGTGA	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.267C>T	1.37:g.161026256G>A		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	49	14	0.285714	NM_001025598	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Silent	SNP	ENST00000368013.3	37	CCDS30918.1																																																																																			.	.	none		0.577	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
CIITA	4261	hgsc.bcm.edu	37	16	11001721	11001721	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:11001721G>A	ENST00000324288.8	+	11	2505	c.2372G>A	c.(2371-2373)aGg>aAg	p.R791K	CIITA_ENST00000537380.1_Intron|CIITA_ENST00000381835.5_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	791					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						GTGCTTGCGAGGTACCTGAAG	0.697			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.R791K		Atlas-SNP	.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA	92	.	0			c.G2372A						PASS	.						23.0	30.0	28.0					16																	11001721		2182	4284	6466	SO:0001583	missense	4261	exon11			TTGCGAGGTACCT	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2372G>A	16.37:g.11001721G>A	ENSP00000316328:p.Arg791Lys	Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	42	22	0.52381	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	G	0.138	-1.105447	0.01828	.	.	ENSG00000179583	ENST00000324288;ENST00000388910	T	0.72394	-0.65	5.0	-0.459	0.12179	.	0.293212	0.25613	N	0.029465	T	0.52948	0.1766	L	0.35723	1.085	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.002	T	0.34428	-0.9829	10	0.14656	T	0.56	.	9.8101	0.40817	0.5445:0.0:0.4555:0.0	.	791;791;743;791	A0N0N9;P33076;F2Z2G8;Q96KL4	.;C2TA_HUMAN;.;.	K	791;743	ENSP00000316328:R791K	ENSP00000316328:R791K	R	+	2	0	CIITA	10909222	0.087000	0.21565	0.029000	0.17559	0.002000	0.02628	0.791000	0.26915	-0.059000	0.13154	-0.812000	0.03155	AGG	.	.	none		0.697	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
SGSH	6448	hgsc.bcm.edu	37	17	78184539	78184539	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:78184539G>A	ENST00000326317.6	-	8	1307	c.1221C>T	c.(1219-1221)acC>acT	p.T407T	SGSH_ENST00000534910.1_Silent_p.T204T	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase	407					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GGTCCTGGAAGGTGGGTGAGA	0.617																																					p.T407T		Atlas-SNP	.											.	SGSH	27	.	0			c.C1221T						PASS	.						181.0	164.0	170.0					17																	78184539		2203	4300	6503	SO:0001819	synonymous_variant	6448	exon8			CTGGAAGGTGGGT	BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688		ENST00000326317.6:c.1221C>T	17.37:g.78184539G>A		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	147	85	0.578231	NM_000199	A8K5E2	Silent	SNP	ENST00000326317.6	37	CCDS11770.1																																																																																			.	.	none		0.617	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437695.1	NM_000199	
IGSF3	3321	hgsc.bcm.edu	37	1	117122394	117122394	+	Missense_Mutation	SNP	C	C	T	rs374600687		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:117122394C>T	ENST00000369486.3	-	10	3719	c.2954G>A	c.(2953-2955)cGc>cAc	p.R985H	IGSF3_ENST00000369483.1_Missense_Mutation_p.R1005H|IGSF3_ENST00000318837.6_Missense_Mutation_p.R1005H	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	985	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CACAGCGAAGCGGGAGTCCTG	0.607																																					p.R1005H		Atlas-SNP	.											.	IGSF3	294	.	0			c.G3014A						PASS	.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	35.0	35.0	35.0		2954,3014	3.8	1.0	1		35	1,8599		0,1,4299	no	missense,missense	IGSF3	NM_001007237.1,NM_001542.2	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	985/1195,1005/1215	117122394	1,13005	2203	4300	6503	SO:0001583	missense	3321	exon11			GCGAAGCGGGAGT	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2954G>A	1.37:g.117122394C>T	ENSP00000358498:p.Arg985His	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	76	32	0.421053	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.714450	0.48622	0.0	1.16E-4	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.04551	3.75;3.6;3.6	4.67	3.76	0.43208	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.486707	0.22464	N	0.059711	T	0.01387	0.0045	N	0.16478	0.41	0.45914	D	0.998751	B;B	0.09022	0.002;0.002	B;B	0.06405	0.001;0.002	T	0.45425	-0.9262	10	0.45353	T	0.12	-27.7348	10.8654	0.46851	0.0:0.9072:0.0:0.0928	.	985;1005	O75054;A6NJZ6	IGSF3_HUMAN;.	H	985;1005;1005	ENSP00000358498:R985H;ENSP00000358495:R1005H;ENSP00000321184:R1005H	ENSP00000321184:R1005H	R	-	2	0	IGSF3	116923917	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.311000	0.43717	1.185000	0.42971	0.462000	0.41574	CGC	.	.	none		0.607	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
KLF2	10365	hgsc.bcm.edu	37	19	16437842	16437842	+	Nonstop_Mutation	SNP	G	G	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:16437842G>C	ENST00000248071.5	+	3	1175	c.1068G>C	c.(1066-1068)taG>taC	p.*356Y	KLF2_ENST00000592003.1_3'UTR|CTD-2562J15.6_ENST00000588799.1_RNA	NM_016270.2	NP_057354.1	Q9Y5W3	KLF2_HUMAN	Kruppel-like factor 2	0					cell morphogenesis (GO:0000902)|cellular response to cycloheximide (GO:0071409)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|cellular response to tumor necrosis factor (GO:0071356)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(3)|lung(1)|skin(1)	5						GGCACATGTAGCCGGGAcgcc	0.672																																					p.X356Y		Atlas-SNP	.											.	KLF2	10	.	0			c.G1068C						PASS	.						25.0	18.0	20.0					19																	16437842		2198	4292	6490	SO:0001578	stop_lost	10365	exon3			CATGTAGCCGGGA	AF123344	CCDS12343.1	19p13.11	2013-10-15	2013-10-15		ENSG00000127528	ENSG00000127528		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6347	protein-coding gene	gene with protein product		602016	"""Kruppel-like factor 2 (lung)"""			10217429, 10458913	Standard	NM_016270		Approved	LKLF	uc002ndw.3	Q9Y5W3	OTTHUMG00000182330	ENST00000248071.5:c.1068G>C	19.37:g.16437842G>C	ENSP00000248071:p.*356Tyrext*62	Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	38	17	0.447368	NM_016270	Q6IPC4|Q9UJS5|Q9UKR6	Missense_Mutation	SNP	ENST00000248071.5	37	CCDS12343.1	.	.	.	.	.	.	.	.	.	.	G	3.162	-0.171913	0.06421	.	.	ENSG00000127528	ENST00000248071	.	.	.	4.44	-0.542	0.11854	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.6784	0.05086	0.1736:0.1445:0.5337:0.1483	.	.	.	.	Y	356	.	.	X	+	3	2	KLF2	16298842	1.000000	0.71417	0.980000	0.43619	0.096000	0.18686	4.184000	0.58323	0.068000	0.16574	0.313000	0.20887	TAG	.	.	none		0.672	KLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460562.1		
FAS	355	hgsc.bcm.edu	37	10	90773125	90773125	+	Splice_Site	SNP	G	G	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr10:90773125G>C	ENST00000355740.2	+	8	896		c.e8+1		FAS_ENST00000357339.2_Splice_Site|FAS_ENST00000355279.2_Intron|FAS_ENST00000313771.5_Splice_Site|RP11-399O19.9_ENST00000562983.1_RNA|FAS_ENST00000352159.4_Splice_Site	NM_000043.4|NM_152871.2|NM_152872.2	NP_000034.1|NP_690610.1|NP_690611.1	P49327	FAS_HUMAN	Fas cell surface death receptor						acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	AATTTATCTGGTAAGGCTTTT	0.284																																					.		Atlas-SNP	.											.	FAS	47	.	0			c.613+1G>C	GRCh37	CS994526	FAS	S		PASS	.						70.0	78.0	75.0					10																	90773125		2201	4279	6480	SO:0001630	splice_region_variant	355	exon7			TATCTGGTAAGGC	M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355740.2:c.676+1G>C	10.37:g.90773125G>C		Somatic	156	1	0.00641026		WXS	Illumina HiSeq	Phase_I	100	66	0.66	NM_152871	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Splice_Site	SNP	ENST00000355740.2	37	CCDS7393.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.325140	0.24080	.	.	ENSG00000026103	ENST00000355740;ENST00000352159;ENST00000357339;ENST00000371875	.	.	.	3.54	3.54	0.40534	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9442	0.47292	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAS	90763105	1.000000	0.71417	0.996000	0.52242	0.376000	0.30014	3.482000	0.53186	2.283000	0.76528	0.563000	0.77884	.	.	.	none		0.284	FAS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049274.3		Intron
DNAH9	1770	hgsc.bcm.edu	37	17	11520880	11520880	+	Missense_Mutation	SNP	C	C	T	rs377415601		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:11520880C>T	ENST00000262442.4	+	5	1125	c.1057C>T	c.(1057-1059)Cgc>Tgc	p.R353C	DNAH9_ENST00000454412.2_Missense_Mutation_p.R353C	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	353	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAAGTCCTACCGCTCCCCGGG	0.622																																					p.R353C		Atlas-SNP	.											.	DNAH9	695	.	0			c.C1057T						PASS	.						67.0	65.0	65.0					17																	11520880		2203	4300	6503	SO:0001583	missense	1770	exon5			TCCTACCGCTCCC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.1057C>T	17.37:g.11520880C>T	ENSP00000262442:p.Arg353Cys	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	92	54	0.586957	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978052	0.34942	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.55413	0.52;0.52	5.91	2.42	0.29668	Dynein heavy chain, domain-1 (1);	0.416033	0.26010	N	0.026889	T	0.24699	0.0599	N	0.04018	-0.295	0.80722	D	1	B	0.11235	0.004	B	0.09377	0.004	T	0.03524	-1.1028	10	0.34782	T	0.22	.	5.084	0.14673	0.2294:0.5222:0.0:0.2484	.	353	Q9NYC9	DYH9_HUMAN	C	353	ENSP00000262442:R353C;ENSP00000414874:R353C	ENSP00000262442:R353C	R	+	1	0	DNAH9	11461605	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	1.847000	0.39299	0.839000	0.34971	0.655000	0.94253	CGC	.	.	alt		0.622	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
POLE	5426	hgsc.bcm.edu	37	12	133240614	133240614	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:133240614G>A	ENST00000320574.5	-	23	2725	c.2682C>T	c.(2680-2682)ggC>ggT	p.G894G	POLE_ENST00000535270.1_Silent_p.G867G	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	894					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	TCAACATGGCGCCTGGGTAGG	0.547								DNA polymerases (catalytic subunits)																													p.G894G		Atlas-SNP	.											.	POLE	416	.	0			c.C2682T						PASS	.						196.0	179.0	185.0					12																	133240614		2203	4300	6503	SO:0001819	synonymous_variant	5426	exon23			CATGGCGCCTGGG		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.2682C>T	12.37:g.133240614G>A		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	145	28	0.193103	NM_006231	Q13533|Q86VH9	Silent	SNP	ENST00000320574.5	37	CCDS9278.1																																																																																			.	.	none		0.547	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
GOLGA6L6	727832	hgsc.bcm.edu	37	15	20739696	20739696	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr15:20739696C>T	ENST00000427390.2	-	8	2144	c.2054G>A	c.(2053-2055)cGg>cAg	p.R685Q		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	685	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						ctcctgctcccgtatcttctt	0.522																																					p.R685Q		Atlas-SNP	.											GOLGA6L6,NS,carcinoma,-1,1	GOLGA6L6	37	1	0			c.G2054A						scavenged	.						5.0	7.0	6.0					15																	20739696		635	1503	2138	SO:0001583	missense	727832	exon8			TGCTCCCGTATCT	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.2054G>A	15.37:g.20739696C>T	ENSP00000398615:p.Arg685Gln	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	78	14	0.179487	NM_001145004	D3YTC0	Missense_Mutation	SNP	ENST00000427390.2	37	CCDS45184.1	.	.	.	.	.	.	.	.	.	.	C	3.636	-0.074620	0.07184	.	.	ENSG00000215405	ENST00000427390	T	0.09073	3.02	.	.	.	.	.	.	.	.	T	0.03608	0.0103	N	0.19112	0.55	0.09310	N	0.999999	B	0.22211	0.066	B	0.04013	0.001	T	0.45041	-0.9288	8	0.06891	T	0.86	.	2.9181	0.05760	0.4916:0.508:2.0E-4:2.0E-4	.	685	A8MZA4	GG6L6_HUMAN	Q	685	ENSP00000398615:R685Q	ENSP00000398615:R685Q	R	-	2	0	GOLGA6L6	18999710	0.001000	0.12720	0.012000	0.15200	0.012000	0.07955	0.061000	0.14366	0.159000	0.19401	0.162000	0.16502	CGG	.	.	none		0.522	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414660.3	NM_001145004	
IKZF3	22806	hgsc.bcm.edu	37	17	37944556	37944556	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:37944556C>T	ENST00000346872.3	-	6	725	c.664G>A	c.(664-666)Gag>Aag	p.E222K	IKZF3_ENST00000439016.2_Intron|IKZF3_ENST00000346243.3_Intron|IKZF3_ENST00000350532.3_Missense_Mutation_p.E222K|IKZF3_ENST00000535189.1_Missense_Mutation_p.E188K|IKZF3_ENST00000439167.2_Intron|IKZF3_ENST00000377952.2_Intron|IKZF3_ENST00000377945.3_Intron|IKZF3_ENST00000351680.3_Intron|IKZF3_ENST00000467757.1_Missense_Mutation_p.E166K|IKZF3_ENST00000377944.3_Missense_Mutation_p.E79K|IKZF3_ENST00000377958.2_Missense_Mutation_p.E135K|IKZF3_ENST00000394189.2_Intron	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	222					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CGGCAGCGCTCCTTGTGCTCC	0.498																																					p.E222K		Atlas-SNP	.											.	IKZF3	79	.	0			c.G664A						PASS	.						146.0	114.0	125.0					17																	37944556		2203	4300	6503	SO:0001583	missense	22806	exon6			AGCGCTCCTTGTG	AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.664G>A	17.37:g.37944556C>T	ENSP00000344544:p.Glu222Lys	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	145	88	0.606897	NM_012481	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Missense_Mutation	SNP	ENST00000346872.3	37	CCDS11346.1	.	.	.	.	.	.	.	.	.	.	C	37	6.027248	0.97216	.	.	ENSG00000161405	ENST00000488188;ENST00000377944;ENST00000377958;ENST00000535189;ENST00000350532;ENST00000467757	T;T;T;T;T	0.44482	0.92;3.65;3.65;3.43;4.18	6.04	6.04	0.98038	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.56097	D	0.000039	T	0.67933	0.2946	M	0.83012	2.62	0.80722	D	1	D;P;D;D;D;D	0.76494	0.972;0.669;0.998;0.979;0.999;0.997	P;B;D;P;D;D	0.76071	0.737;0.205;0.967;0.907;0.987;0.938	T	0.61667	-0.7016	10	0.20046	T	0.44	-17.2071	20.1899	0.98228	0.0:1.0:0.0:0.0	.	135;79;188;222;166;222	Q9UKT9-9;Q9UKT9-10;Q9UKT9-7;Q9UKT9-4;Q9UKT9-2;Q9UKT9	.;.;.;.;.;IKZF3_HUMAN	K	222;79;135;188;222;166	ENSP00000367179:E79K;ENSP00000367194:E135K;ENSP00000438972:E188K;ENSP00000344471:E222K;ENSP00000420463:E166K	ENSP00000344471:E222K	E	-	1	0	IKZF3	35198082	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.873000	0.98535	0.563000	0.77884	GAG	.	.	none		0.498	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2	NM_012481	
GALNT9	50614	hgsc.bcm.edu	37	12	132837584	132837584	+	Silent	SNP	G	G	A	rs530313026		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:132837584G>A	ENST00000328957.8	-	4	710	c.711C>T	c.(709-711)acC>acT	p.T237T	GALNT9_ENST00000535208.1_5'UTR	NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	237	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		CGACTGGGGCGGTGGCCGCCT	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		15137	0.0		0.001	False		,,,				2504	0.0				p.T237T	Colon(186;2147 2752 13553 41466)	Atlas-SNP	.											.	GALNT9	74	.	0			c.C711T						PASS	.						29.0	34.0	32.0					12																	132837584		692	1591	2283	SO:0001819	synonymous_variant	50614	exon4			TGGGGCGGTGGCC	AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.711C>T	12.37:g.132837584G>A		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	53	31	0.584906	NM_001122636	Q52LR8|Q6NT54|Q8NFR1	Silent	SNP	ENST00000328957.8	37																																																																																				.	.	none		0.657	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000402967.1	NM_001122636	
CDH11	1009	hgsc.bcm.edu	37	16	65016083	65016083	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:65016083A>G	ENST00000268603.4	-	8	1736	c.1121T>C	c.(1120-1122)gTa>gCa	p.V374A	CDH11_ENST00000566827.1_Missense_Mutation_p.V248A|CDH11_ENST00000394156.3_Missense_Mutation_p.V374A	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	374	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		AGCATCTTCTACTGAGATCTT	0.522			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.V374A		Atlas-SNP	.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	CDH11,colon,carcinoma,0,1	CDH11	260	1	0			c.T1121C						scavenged	.						168.0	138.0	148.0					16																	65016083		2203	4300	6503	SO:0001583	missense	1009	exon8			TCTTCTACTGAGA	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1121T>C	16.37:g.65016083A>G	ENSP00000268603:p.Val374Ala	Somatic	179	1	0.00558659		WXS	Illumina HiSeq	Phase_I	240	82	0.341667	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	A	19.17	3.775754	0.70107	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.68181	-0.31;-0.31	5.76	5.76	0.90799	Cadherin (4);Cadherin-like (1);	0.053752	0.85682	D	0.000000	D	0.88217	0.6377	H	0.97564	4.03	0.58432	D	0.999999	D;D	0.61080	0.989;0.988	P;D	0.76071	0.826;0.987	D	0.92067	0.5661	10	0.72032	D	0.01	.	15.544	0.76081	1.0:0.0:0.0:0.0	.	374;374	P55287-2;P55287	.;CAD11_HUMAN	A	374;374;357	ENSP00000268603:V374A;ENSP00000377711:V374A	ENSP00000268603:V374A	V	-	2	0	CDH11	63573584	1.000000	0.71417	0.141000	0.22245	0.251000	0.25915	8.818000	0.91991	2.324000	0.78689	0.533000	0.62120	GTA	.	.	none		0.522	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
CCDC81	60494	hgsc.bcm.edu	37	11	86133616	86133616	+	Splice_Site	SNP	G	G	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:86133616G>T	ENST00000445632.2	+	15	2090	c.1818G>T	c.(1816-1818)cgG>cgT	p.R606R	CCDC81_ENST00000278487.3_Splice_Site_p.R341R|CCDC81_ENST00000528728.1_Splice_Site_p.R341R|CCDC81_ENST00000354755.1_Splice_Site_p.R516R	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	606										kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				CTCTCCTCAGGGCTTCAGACA	0.557																																					p.R606R		Atlas-SNP	.											.	CCDC81	89	.	0			c.G1818T						PASS	.						67.0	64.0	65.0					11																	86133616		2202	4299	6501	SO:0001630	splice_region_variant	60494	exon15			CCTCAGGGCTTCA	AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.1818-1G>T	11.37:g.86133616G>T		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	42	20	0.47619	NM_001156474	A0AVL7|Q53FW3|Q9H5E5	Silent	SNP	ENST00000445632.2	37	CCDS53691.1																																																																																			.	.	none		0.557	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393756.1	NM_021827	Silent
PGD	5226	hgsc.bcm.edu	37	1	10479771	10479771	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:10479771G>A	ENST00000270776.8	+	13	1455	c.1417G>A	c.(1417-1419)Ggt>Agt	p.G473S	PGD_ENST00000498356.1_3'UTR|PGD_ENST00000541529.1_Missense_Mutation_p.G451S|PGD_ENST00000538557.1_Missense_Mutation_p.G460S	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	473					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	GACAGGCCATGGTGGCACCGT	0.547																																					p.G473S		Atlas-SNP	.											.	PGD	39	.	0			c.G1417A						PASS	.						197.0	165.0	176.0					1																	10479771		2203	4300	6503	SO:0001583	missense	5226	exon13			GGCCATGGTGGCA	BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.1417G>A	1.37:g.10479771G>A	ENSP00000270776:p.Gly473Ser	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	66	37	0.560606	NM_002631	A8K2Y9|B4DQJ8|Q9BWD8	Missense_Mutation	SNP	ENST00000270776.8	37	CCDS113.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792914	0.90453	.	.	ENSG00000142657	ENST00000541529;ENST00000543846;ENST00000270776;ENST00000538557	T;T;T	0.42900	0.96;0.96;0.96	5.08	5.08	0.68730	Fibritin/6-phosphogluconate dehydrogenase, C-terminal extension (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	T	0.63177	0.2489	L	0.59967	1.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.66031	-0.6024	10	0.87932	D	0	-18.254	18.8577	0.92259	0.0:0.0:1.0:0.0	.	451;473;473	F5H7U0;A8K2Y9;P52209	.;.;6PGD_HUMAN	S	451;419;473;460	ENSP00000442285:G451S;ENSP00000270776:G473S;ENSP00000437822:G460S	ENSP00000270776:G473S	G	+	1	0	PGD	10402358	1.000000	0.71417	0.751000	0.31187	0.446000	0.32137	9.279000	0.95777	2.521000	0.84997	0.555000	0.69702	GGT	.	.	none		0.547	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005398.1	NM_002631	
TECRL	253017	hgsc.bcm.edu	37	4	65165691	65165691	+	Splice_Site	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr4:65165691C>A	ENST00000381210.3	-	8	885		c.e8+1		TECRL_ENST00000513125.1_Splice_Site|TECRL_ENST00000507440.1_Splice_Site	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like						lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						ATGATACATACCAGAAAATTG	0.299																																					.		Atlas-SNP	.											.	TECRL	106	.	0			c.774+1G>T						PASS	.						115.0	127.0	123.0					4																	65165691		2203	4294	6497	SO:0001630	splice_region_variant	253017	exon9			TACATACCAGAAA	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.774+1G>T	4.37:g.65165691C>A		Somatic	361	1	0.00277008		WXS	Illumina HiSeq	Phase_I	398	159	0.399497	NM_001010874		Splice_Site	SNP	ENST00000381210.3	37	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376796	0.61735	.	.	ENSG00000205678	ENST00000507440;ENST00000381210	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8349	0.78791	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TECRL	64848286	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.791000	0.62460	2.592000	0.87571	0.460000	0.39030	.	.	.	none		0.299	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874	Intron
MBOAT2	129642	hgsc.bcm.edu	37	2	9002786	9002786	+	Silent	SNP	G	G	A	rs142879518		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr2:9002786G>A	ENST00000305997.3	-	11	1317	c.1119C>T	c.(1117-1119)caC>caT	p.H373H	MBOAT2_ENST00000486484.1_5'UTR	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	373					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GGTATACCCCGTGCCAAATGG	0.408													G|||	1	0.000199681	0.0	0.0	5008	,	,		19011	0.0		0.001	False		,,,				2504	0.0				p.H373H	Ovarian(194;1699 3813 22401)	Atlas-SNP	.											.	MBOAT2	36	.	0			c.C1119T						PASS	.	G		0,4406		0,0,2203	96.0	92.0	94.0		1119	-2.0	1.0	2	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MBOAT2	NM_138799.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		373/521	9002786	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	129642	exon11			TACCCCGTGCCAA	BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.1119C>T	2.37:g.9002786G>A		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	30	21	0.7	NM_138799	A9EDR2|Q8NCE7|Q96KY4	Silent	SNP	ENST00000305997.3	37	CCDS1660.1																																																																																			G|1.000;A|0.000	0.000	strong		0.408	MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206735.1	NM_138799	
NEB	4703	hgsc.bcm.edu	37	2	152486101	152486101	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr2:152486101G>A	ENST00000172853.10	-	64	9201	c.9054C>T	c.(9052-9054)gaC>gaT	p.D3018D	NEB_ENST00000397345.3_Silent_p.D3261D|NEB_ENST00000409198.1_Silent_p.D3018D|NEB_ENST00000604864.1_Silent_p.D3261D|NEB_ENST00000603639.1_Silent_p.D3261D|NEB_ENST00000427231.2_Silent_p.D3261D			P20929	NEBU_HUMAN	nebulin	3018					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGGGATGGCGTCACTTCGCA	0.458																																					p.D3261D		Atlas-SNP	.											.	NEB	1697	.	0			c.C9783T						PASS	.						158.0	160.0	159.0					2																	152486101		1947	4142	6089	SO:0001819	synonymous_variant	4703	exon68			GATGGCGTCACTT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.9054C>T	2.37:g.152486101G>A		Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	120	52	0.433333	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				.	.	none		0.458	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
TNXB	7148	hgsc.bcm.edu	37	6	32063896	32063896	+	Silent	SNP	G	G	A	rs41270458	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:32063896G>A	ENST00000479795.1	-	3	1874	c.1734C>T	c.(1732-1734)gaC>gaT	p.D578D	TNXB_ENST00000375244.3_Silent_p.D578D|TNXB_ENST00000375247.2_Silent_p.D578D			P22105	TENX_HUMAN	tenascin XB	578	EGF-like 14. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CAGAGTAGCCGTCCTCGCACA	0.672													G|||	66	0.0131789	0.0023	0.0216	5008	,	,		17603	0.004		0.0239	False		,,,				2504	0.0204				p.D578D		Atlas-SNP	.											TNXB_ENST00000375247,NS,carcinoma,0,2	TNXB	553	2	0			c.C1734T						PASS	.	G		22,4366		0,22,2172	16.0	17.0	17.0		1734	-5.0	0.0	6	dbSNP_127	17	197,8379		2,193,4093	no	coding-synonymous	TNXB	NM_019105.6		2,215,6265	AA,AG,GG		2.2971,0.5014,1.6893		578/4243	32063896	219,12745	2194	4288	6482	SO:0001819	synonymous_variant	7148	exon3			GTAGCCGTCCTCG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.1734C>T	6.37:g.32063896G>A		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	76	66	0.868421	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000479795.1	37																																																																																				G|0.985;A|0.015	0.015	strong		0.672	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	NM_019105	
BAI3	577	hgsc.bcm.edu	37	6	69772924	69772924	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:69772924C>A	ENST00000370598.1	+	16	3253	c.2432C>A	c.(2431-2433)gCt>gAt	p.A811D		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	811					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GCTCATTTGGCTAATGTAAGT	0.373																																					p.A811D		Atlas-SNP	.											.	BAI3	451	.	0			c.C2432A						PASS	.						134.0	111.0	119.0					6																	69772924		2203	4300	6503	SO:0001583	missense	577	exon16			ATTTGGCTAATGT	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2432C>A	6.37:g.69772924C>A	ENSP00000359630:p.Ala811Asp	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	76	59	0.776316	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.483456	0.44147	.	.	ENSG00000135298	ENST00000370598	T	0.20881	2.04	5.07	5.07	0.68467	.	0.267579	0.36740	N	0.002430	T	0.06142	0.0159	N	0.22421	0.69	0.80722	D	1	B	0.15473	0.013	B	0.16289	0.015	T	0.18085	-1.0348	10	0.14252	T	0.57	.	13.7386	0.62833	0.154:0.846:0.0:0.0	.	811	O60242	BAI3_HUMAN	D	811	ENSP00000359630:A811D	ENSP00000359630:A811D	A	+	2	0	BAI3	69829645	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	4.695000	0.61767	2.484000	0.83849	0.484000	0.47621	GCT	.	.	none		0.373	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
HIATL1	84641	hgsc.bcm.edu	37	9	97203305	97203305	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr9:97203305C>T	ENST00000375344.3	+	5	703	c.434C>T	c.(433-435)tCg>tTg	p.S145L	HIATL1_ENST00000428393.2_Missense_Mutation_p.S80L	NM_032558.2	NP_115947.2	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1	145					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	11		Acute lymphoblastic leukemia(62;0.136)				GGAGTCTTCTCGGTCACGTTT	0.383																																					p.S145L	Pancreas(77;1260 1915 1973 10423)	Atlas-SNP	.											.	HIATL1	31	.	0			c.C434T						PASS	.						132.0	125.0	127.0					9																	97203305		2203	4300	6503	SO:0001583	missense	84641	exon5			TCTTCTCGGTCAC	AK027659	CCDS6710.2	9q22.32	2009-12-04			ENSG00000148110	ENSG00000148110			23376	protein-coding gene	gene with protein product							Standard	XM_005252277		Approved	FLJ14753	uc004aur.3	Q5SR56	OTTHUMG00000020265	ENST00000375344.3:c.434C>T	9.37:g.97203305C>T	ENSP00000364493:p.Ser145Leu	Somatic	361	0	0		WXS	Illumina HiSeq	Phase_I	354	130	0.367232	NM_032558	B4DUE6|E9PD58|Q3KQT4|Q53GU5|Q8WU95|Q96SM4	Missense_Mutation	SNP	ENST00000375344.3	37	CCDS6710.2	.	.	.	.	.	.	.	.	.	.	C	32	5.118255	0.94385	.	.	ENSG00000148110	ENST00000375344;ENST00000428393	T;T	0.60920	0.15;0.15	4.16	4.16	0.48862	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.41294	D	0.000920	T	0.67822	0.2934	M	0.76002	2.32	0.80722	D	1	P;D	0.55800	0.948;0.973	P;P	0.52481	0.7;0.7	T	0.73914	-0.3832	10	0.87932	D	0	-7.144	14.7696	0.69665	0.0:1.0:0.0:0.0	.	80;145	B4DUE6;Q5SR56	.;HIAL1_HUMAN	L	145;80	ENSP00000364493:S145L;ENSP00000405909:S80L	ENSP00000364493:S145L	S	+	2	0	HIATL1	96243126	1.000000	0.71417	0.972000	0.41901	0.982000	0.71751	7.357000	0.79456	2.610000	0.88304	0.557000	0.71058	TCG	.	.	none		0.383	HIATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053184.1	NM_032558	
HLA-DRB1	3123	hgsc.bcm.edu	37	6	32557477	32557477	+	Silent	SNP	G	G	A	rs150644773	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:32557477G>A	ENST00000360004.5	-	1	148	c.43C>T	c.(43-45)Ctg>Ttg	p.L15L		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	15					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GTCACTGTCAGCGCTGTCATG	0.592										Multiple Myeloma(14;0.17)																											p.L15L		Atlas-SNP	.											HLA-DRB1,colon,carcinoma,0,1	HLA-DRB1	41	1	0			c.C43T						scavenged	.						87.0	106.0	99.0					6																	32557477		1511	2709	4220	SO:0001819	synonymous_variant	3123	exon1			CTGTCAGCGCTGT	AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.43C>T	6.37:g.32557477G>A		Somatic	138	8	0.057971		WXS	Illumina HiSeq	Phase_I	191	38	0.198953	NM_002124	P01914|Q9MYF5	Silent	SNP	ENST00000360004.5	37	CCDS47409.1																																																																																			G|0.868;A|0.132	0.132	strong		0.592	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
MYO1E	4643	hgsc.bcm.edu	37	15	59506886	59506886	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr15:59506886C>A	ENST00000288235.4	-	11	1540	c.1141G>T	c.(1141-1143)Gaa>Taa	p.E381*	AC092756.1_ENST00000401164.1_RNA|RNU4-80P_ENST00000363200.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	381	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		ATGTTGTATTCTTCATGGTCT	0.428																																					p.E381X		Atlas-SNP	.											.	MYO1E	99	.	0			c.G1141T						PASS	.						202.0	191.0	195.0					15																	59506886		2190	4290	6480	SO:0001587	stop_gained	4643	exon11			TGTATTCTTCATG	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.1141G>T	15.37:g.59506886C>A	ENSP00000288235:p.Glu381*	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	173	70	0.404624	NM_004998	Q14778	Nonsense_Mutation	SNP	ENST00000288235.4	37	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	C	35	5.546839	0.96488	.	.	ENSG00000157483	ENST00000288235	.	.	.	5.14	5.14	0.70334	.	0.043917	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	19.1568	0.93514	0.0:1.0:0.0:0.0	.	.	.	.	X	381	.	ENSP00000288235:E381X	E	-	1	0	MYO1E	57294178	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.651000	0.83577	2.832000	0.97577	0.655000	0.94253	GAA	.	.	none		0.428	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
LILRB1	10859	hgsc.bcm.edu	37	19	55148031	55148031	+	Silent	SNP	T	T	C	rs41308746	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:55148031T>C	ENST00000396331.1	+	15	2091	c.1734T>C	c.(1732-1734)ccT>ccC	p.P578P	LILRB1_ENST00000396332.4_Silent_p.P579P|LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000396327.3_Silent_p.P579P|LILRB1_ENST00000427581.2_Silent_p.P629P|LILRB1_ENST00000396317.1_Silent_p.P562P|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000434867.2_Silent_p.P578P|LILRB1_ENST00000396321.2_Silent_p.P578P|LILRB1_ENST00000418536.2_Silent_p.P562P|LILRB1_ENST00000396315.1_Silent_p.P580P|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000324602.7_Silent_p.P580P	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	578					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CCTCTCCTCCTTCCCCACTGT	0.582										HNSCC(37;0.09)			t|||	554	0.110623	0.1785	0.0893	5008	,	,		16680	0.0139		0.1491	False		,,,				2504	0.0941				p.P580P		Atlas-SNP	.											LILRB1,NS,carcinoma,+2,1	LILRB1	140	1	0			c.T1740C						scavenged	.						111.0	95.0	100.0					19																	55148031		2200	4295	6495	SO:0001819	synonymous_variant	10859	exon14			TCCTCCTTCCCCA	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1734T>C	19.37:g.55148031T>C		Somatic	142	1	0.00704225		WXS	Illumina HiSeq	Phase_I	131	4	0.0305344	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	ENST00000396331.1	37	CCDS42617.1																																																																																			.	.	weak		0.582	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
TTN	7273	hgsc.bcm.edu	37	2	179593297	179593297	+	Silent	SNP	G	G	A	rs369275615		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr2:179593297G>A	ENST00000591111.1	-	64	18629	c.18405C>T	c.(18403-18405)agC>agT	p.S6135S	TTN_ENST00000589042.1_Silent_p.S6452S|TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Silent_p.S5208S|RP11-171I2.1_ENST00000590024.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12922	Ig-like 42.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTACTGACCGCTGTCCTGCT	0.418																																					p.S6452S		Atlas-SNP	.											TTN_ENST00000356127,NS,carcinoma,0,3	TTN	18412	3	0			c.C19356T						PASS	.	G	,,,	1,3785		0,1,1892	69.0	61.0	64.0		,15624,,	-4.4	0.8	2		64	0,8244		0,0,4122	no	intron,coding-synonymous,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,1,6014	AA,AG,GG		0.0,0.0264,0.0083	,,,	,5208/33424,,	179593297	1,12029	1893	4122	6015	SO:0001819	synonymous_variant	7273	exon66			CTGACCGCTGTCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18405C>T	2.37:g.179593297G>A		Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	125	60	0.48	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.	.	weak		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PRDM9	56979	hgsc.bcm.edu	37	5	23527595	23527595	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:23527595G>T	ENST00000296682.3	+	11	2580	c.2398G>T	c.(2398-2400)Ggg>Tgg	p.G800W		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	800					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GACACACACAGGGGAGAAGCC	0.567										HNSCC(3;0.000094)																											p.G800W		Atlas-SNP	.											PRDM9,NS,carcinoma,-1,1	PRDM9	344	1	0			c.G2398T						scavenged	.						76.0	76.0	76.0					5																	23527595		2191	4296	6487	SO:0001583	missense	56979	exon11			CACACAGGGGAGA	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2398G>T	5.37:g.23527595G>T	ENSP00000296682:p.Gly800Trp	Somatic	118	1	0.00847458		WXS	Illumina HiSeq	Phase_I	172	102	0.593023	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203927	0.58234	.	.	ENSG00000164256	ENST00000296682	T	0.26810	1.71	3.07	3.07	0.35406	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.62575	0.2439	H	0.96691	3.865	0.53005	D	0.999964	D	0.89917	1.0	D	0.97110	1.0	T	0.75425	-0.3322	9	0.87932	D	0	.	12.3824	0.55313	0.0:0.0:1.0:0.0	.	800	Q9NQV7	PRDM9_HUMAN	W	800	ENSP00000296682:G800W	ENSP00000296682:G800W	G	+	1	0	PRDM9	23563352	1.000000	0.71417	1.000000	0.80357	0.613000	0.37349	4.641000	0.61375	2.033000	0.60031	0.465000	0.42564	GGG	.	.	none		0.567	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
FAT3	120114	hgsc.bcm.edu	37	11	92495108	92495108	+	Silent	SNP	C	C	G			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:92495108C>G	ENST00000298047.6	+	4	3773	c.3756C>G	c.(3754-3756)ccC>ccG	p.P1252P	RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000525166.1_Silent_p.P1102P|FAT3_ENST00000409404.2_Silent_p.P1252P			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1252	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACAACAAGCCCCAGTTCCCAG	0.473										TCGA Ovarian(4;0.039)																											p.P1252P		Atlas-SNP	.											.	FAT3	1822	.	0			c.C3756G						PASS	.						182.0	178.0	179.0					11																	92495108		1912	4122	6034	SO:0001819	synonymous_variant	120114	exon4			CAAGCCCCAGTTC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3756C>G	11.37:g.92495108C>G		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	104	42	0.403846	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																				.	.	none		0.473	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
CDC27	996	hgsc.bcm.edu	37	17	45234367	45234367	+	Missense_Mutation	SNP	A	A	T	rs200148949		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:45234367A>T	ENST00000066544.3	-	7	847	c.754T>A	c.(754-756)Tcc>Acc	p.S252T	CDC27_ENST00000531206.1_Missense_Mutation_p.S252T|CDC27_ENST00000527547.1_Missense_Mutation_p.S252T|CDC27_ENST00000446365.2_Missense_Mutation_p.S191T|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	252					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.S252T(3)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						GATAATATGGAAGTTCCTGTT	0.383																																					p.S252T		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,0,4	CDC27	337	4	3	Substitution - Missense(3)	prostate(3)	c.T754A						scavenged	.						54.0	60.0	58.0					17																	45234367		2197	4295	6492	SO:0001583	missense	996	exon7			ATATGGAAGTTCC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.754T>A	17.37:g.45234367A>T	ENSP00000066544:p.Ser252Thr	Somatic	98	1	0.0102041		WXS	Illumina HiSeq	Phase_I	118	7	0.059322	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	11.88	1.770710	0.31320	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68181	-0.31;-0.26;0.01;-0.31;0.83	5.44	2.92	0.33932	.	0.295461	0.32687	N	0.005769	T	0.46425	0.1392	N	0.24115	0.695	0.34835	D	0.740078	B;B;B;B	0.09022	0.002;0.001;0.001;0.0	B;B;B;B	0.08055	0.001;0.003;0.002;0.001	T	0.45702	-0.9243	10	0.19590	T	0.45	-13.824	7.977	0.30161	0.7316:0.1283:0.0:0.1401	.	191;252;252;252	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	T	252;252;191;252;252	ENSP00000066544:S252T;ENSP00000434614:S252T;ENSP00000392802:S191T;ENSP00000437339:S252T;ENSP00000432105:S252T	ENSP00000066544:S252T	S	-	1	0	CDC27	42589366	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.784000	0.47774	0.864000	0.35578	0.377000	0.23210	TCC	.	.	weak		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
RHOA	387	hgsc.bcm.edu	37	3	49413010	49413010	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:49413010G>A	ENST00000418115.1	-	2	397	c.13C>T	c.(13-15)Cgg>Tgg	p.R5W	RHOA_ENST00000422781.1_Missense_Mutation_p.R5W|RHOA_ENST00000454011.2_Missense_Mutation_p.R5W	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	5					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		AGTTTCTTCCGGATGGCAGCC	0.473																																					p.R5W		Atlas-SNP	.											RHOA,NS,lymphoid_neoplasm,+1,7	RHOA	46	7	0			c.C13T						PASS	.						103.0	95.0	98.0					3																	49413010		2203	4300	6503	SO:0001583	missense	387	exon2			TCTTCCGGATGGC	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.13C>T	3.37:g.49413010G>A	ENSP00000400175:p.Arg5Trp	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	93	43	0.462366	NM_001664	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961576	0.53400	.	.	ENSG00000067560	ENST00000418115;ENST00000454011;ENST00000422781;ENST00000445425;ENST00000431929	T;T;T;T;T	0.72051	-0.45;1.68;-0.48;-0.62;2.04	5.89	-0.78	0.10969	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	T	0.69904	0.3163	M	0.78344	2.41	0.80722	D	1	B	0.24920	0.114	B	0.17098	0.017	T	0.67130	-0.5748	10	0.59425	D	0.04	.	17.5915	0.87998	0.0:0.0:0.2927:0.7073	.	5	P61586	RHOA_HUMAN	W	5	ENSP00000400175:R5W;ENSP00000394483:R5W;ENSP00000413587:R5W;ENSP00000408402:R5W;ENSP00000400747:R5W	ENSP00000400175:R5W	R	-	1	2	RHOA	49388014	1.000000	0.71417	0.981000	0.43875	0.887000	0.51463	0.905000	0.28504	-0.467000	0.06932	-0.318000	0.08688	CGG	.	.	none		0.473	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
CYP4F3	4051	hgsc.bcm.edu	37	19	15760884	15760884	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:15760884T>C	ENST00000221307.8	+	7	856	c.809T>C	c.(808-810)gTc>gCc	p.V270A	CYP4F3_ENST00000591058.1_Missense_Mutation_p.V270A|CYP4F3_ENST00000586182.2_Missense_Mutation_p.V270A|CYP4F3_ENST00000585846.1_Missense_Mutation_p.V270A	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	270			V -> I (in dbSNP:rs28371536). {ECO:0000269|Ref.5}.		arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)			endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						ACAGATGCCGTCATCCAGGAG	0.567																																					p.V270A		Atlas-SNP	.											.	CYP4F3	69	.	0			c.T809C						PASS	.						110.0	101.0	104.0					19																	15760884		2203	4300	6503	SO:0001583	missense	4051	exon7			ATGCCGTCATCCA	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.809T>C	19.37:g.15760884T>C	ENSP00000221307:p.Val270Ala	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	100	34	0.34	NM_001199209	B7Z8Z3|O60634|Q5U740	Missense_Mutation	SNP	ENST00000221307.8	37	CCDS12332.1	.	.	.	.	.	.	.	.	.	.	.	12.84	2.059024	0.36373	.	.	ENSG00000186529	ENST00000538865;ENST00000221307	T	0.69561	-0.41	3.99	2.93	0.34026	.	0.182612	0.34802	N	0.003680	T	0.73297	0.3569	M	0.83603	2.65	0.42809	D	0.993958	B;B	0.20780	0.027;0.048	B;B	0.41202	0.35;0.35	T	0.71076	-0.4697	10	0.87932	D	0	.	6.846	0.23988	0.0:0.1253:0.0:0.8747	.	270;270	B7Z8Z3;Q08477	.;CP4F3_HUMAN	A	197;270	ENSP00000221307:V270A	ENSP00000221307:V270A	V	+	2	0	CYP4F3	15621884	1.000000	0.71417	0.697000	0.30258	0.576000	0.36127	3.349000	0.52217	0.432000	0.26286	0.260000	0.18958	GTC	.	.	none		0.567	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
NAV2	89797	hgsc.bcm.edu	37	11	20066704	20066704	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:20066704C>T	ENST00000396087.3	+	15	3558	c.3459C>T	c.(3457-3459)gcC>gcT	p.A1153A	NAV2-AS2_ENST00000533767.1_RNA|NAV2_ENST00000540292.1_Silent_p.A1084A|NAV2_ENST00000360655.4_Silent_p.A1066A|NAV2_ENST00000311043.8_Silent_p.A216A|NAV2_ENST00000533917.1_Silent_p.A216A|NAV2_ENST00000396085.1_Silent_p.A1130A|NAV2_ENST00000527559.2_Silent_p.A1082A|NAV2_ENST00000349880.4_Silent_p.A1130A	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1153					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						GTTCCGCCGCCGGCCTGGCCA	0.587																																					p.A1153A		Atlas-SNP	.											NAV2,NS,carcinoma,+2,1	NAV2	255	1	0			c.C3459T						PASS	.						71.0	69.0	70.0					11																	20066704		2203	4300	6503	SO:0001819	synonymous_variant	89797	exon15			CGCCGCCGGCCTG	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.3459C>T	11.37:g.20066704C>T		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	42	15	0.357143	NM_001244963	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	CCDS58126.1																																																																																			.	.	none		0.587	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
SEC61A2	55176	hgsc.bcm.edu	37	10	12200105	12200105	+	Splice_Site	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr10:12200105G>A	ENST00000298428.9	+	9	1064		c.e9+1		SEC61A2_ENST00000304267.8_Splice_Site|SEC61A2_ENST00000495368.1_Splice_Site|SEC61A2_ENST00000379033.3_Splice_Site|SEC61A2_ENST00000379020.4_Intron	NM_018144.3	NP_060614.2	Q9H9S3	S61A2_HUMAN	Sec61 alpha 2 subunit (S. cerevisiae)						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ribosome binding (GO:0043022)	p.?(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Renal(717;0.228)				ACAGTGGGCCGTGAGTATTAT	0.368																																					.		Atlas-SNP	.											SEC61A2,NS,carcinoma,0,1	SEC61A2	48	1	1	Unknown(1)	prostate(1)	c.975+1G>A						scavenged	.						62.0	59.0	60.0					10																	12200105		2203	4300	6503	SO:0001630	splice_region_variant	55176	exon9			TGGGCCGTGAGTA	AF346603	CCDS7088.1, CCDS44358.1, CCDS44359.1	10p14	2004-01-06			ENSG00000065665	ENSG00000065665			17702	protein-coding gene	gene with protein product							Standard	NM_018144		Approved	FLJ10578	uc001ile.2	Q9H9S3	OTTHUMG00000017679	ENST00000298428.9:c.975+1G>A	10.37:g.12200105G>A		Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	211	5	0.0236967	NM_018144	A8K8D0|B4DX72|F8W773	Splice_Site	SNP	ENST00000298428.9	37	CCDS7088.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357693	0.82243	.	.	ENSG00000065665	ENST00000379033;ENST00000298428;ENST00000304267;ENST00000426560	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5031	0.90889	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEC61A2	12240111	1.000000	0.71417	0.982000	0.44146	0.952000	0.60782	9.773000	0.98989	2.685000	0.91497	0.655000	0.94253	.	.	.	none		0.368	SEC61A2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046795.1	NM_018144	Intron
FAM135B	51059	hgsc.bcm.edu	37	8	139164971	139164971	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr8:139164971C>T	ENST00000395297.1	-	13	1917	c.1747G>A	c.(1747-1749)Gat>Aat	p.D583N		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	583										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CCATACTTATCTCTAGAGCTC	0.458										HNSCC(54;0.14)																											p.D583N		Atlas-SNP	.											LOC51059,rectum,carcinoma,0,2	FAM135B	423	2	0			c.G1747A						PASS	.						153.0	145.0	148.0					8																	139164971		1900	4119	6019	SO:0001583	missense	51059	exon13			ACTTATCTCTAGA	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1747G>A	8.37:g.139164971C>T	ENSP00000378710:p.Asp583Asn	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	129	77	0.596899	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	13.06	2.125028	0.37533	.	.	ENSG00000147724	ENST00000395297	T	0.15952	2.38	5.45	3.61	0.41365	.	1.013200	0.07872	N	0.968042	T	0.13798	0.0334	L	0.44542	1.39	0.09310	N	1	P;B;B	0.37207	0.587;0.091;0.03	B;B;B	0.32465	0.146;0.07;0.005	T	0.19095	-1.0316	10	0.25106	T	0.35	-1.7504	7.0725	0.25187	0.0:0.6997:0.1672:0.1331	.	583;583;583	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	N	583	ENSP00000378710:D583N	ENSP00000276737:D583N	D	-	1	0	FAM135B	139234153	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	0.393000	0.20817	1.423000	0.47198	-0.176000	0.13171	GAT	.	.	none		0.458	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
MYH14	79784	hgsc.bcm.edu	37	19	50779294	50779294	+	Missense_Mutation	SNP	C	C	T	rs373919106		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:50779294C>T	ENST00000596571.1	+	25	3391	c.3391C>T	c.(3391-3393)Cgg>Tgg	p.R1131W	MYH14_ENST00000440075.2_Missense_Mutation_p.R1172W|MYH14_ENST00000262269.8_Missense_Mutation_p.R1172W|MYH14_ENST00000425460.1_Missense_Mutation_p.R1139W|MYH14_ENST00000376970.2_Missense_Mutation_p.R1164W|MYH14_ENST00000601313.1_Missense_Mutation_p.R1172W|MYH14_ENST00000598205.1_Missense_Mutation_p.R1139W			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1131					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R1172W(1)|p.R1131W(1)		central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GAAATCCCTGCGGGAGGCTCA	0.677																																					p.R1172W		Atlas-SNP	.											MYH14_ENST00000262269,colon,carcinoma,0,4	MYH14	261	4	2	Substitution - Missense(2)	large_intestine(2)	c.C3514T						PASS	.						13.0	17.0	16.0					19																	50779294		1978	4162	6140	SO:0001583	missense	79784	exon28			TCCCTGCGGGAGG	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.3391C>T	19.37:g.50779294C>T	ENSP00000472819:p.Arg1131Trp	Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	88	39	0.443182	NM_001145809	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.874422	0.51695	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29	4.0	1.63	0.23807	Myosin tail (1);	.	.	.	.	D	0.86916	0.6048	M	0.71581	2.175	0.54753	D	0.999986	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.86838	0.2015	9	0.87932	D	0	.	10.4099	0.44287	0.3458:0.6542:0.0:0.0	.	1172;1131;1139	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	W	1131;1172;1164;1139;1131;1172	ENSP00000406273:R1172W;ENSP00000366169:R1164W;ENSP00000407879:R1139W;ENSP00000262269:R1172W	ENSP00000262269:R1172W	R	+	1	2	MYH14	55471106	0.996000	0.38824	0.988000	0.46212	0.268000	0.26511	1.177000	0.31969	1.031000	0.39867	0.455000	0.32223	CGG	.	.	alt		0.677	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
TBC1D29	26083	hgsc.bcm.edu	37	17	28887667	28887667	+	Silent	SNP	T	T	C	rs78888987	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:28887667T>C	ENST00000580161.1	+	4	2608	c.111T>C	c.(109-111)gaT>gaC	p.D37D	TBC1D29_ENST00000579181.1_Silent_p.D37D|TBC1D29_ENST00000584297.1_Silent_p.D37D|RP11-218M11.6_ENST00000582125.1_RNA			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	37	Rab-GAP TBC; truncated. {ECO:0000255|PROSITE-ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.D37D(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				GCCTGTGGGATATGTATTTGC	0.572																																					p.D37D		Atlas-SNP	.											TBC1D29,NS,carcinoma,0,1	TBC1D29	19	1	1	Substitution - coding silent(1)	lung(1)	c.T111C						scavenged	.						149.0	126.0	134.0					17																	28887667		2203	4300	6503	SO:0001819	synonymous_variant	26083	exon3			GTGGGATATGTAT	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.111T>C	17.37:g.28887667T>C		Somatic	28	2	0.0714286		WXS	Illumina HiSeq	Phase_I	54	11	0.203704	NM_015594		Silent	SNP	ENST00000580161.1	37	CCDS32606.1																																																																																			T|0.806;C|0.194	0.194	strong		0.572	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443632.1	NM_015594	
HIST1H2AM	8336	hgsc.bcm.edu	37	6	27860757	27860757	+	Silent	SNP	C	C	T	rs140056231		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr6:27860757C>T	ENST00000359611.2	-	1	206	c.171G>A	c.(169-171)gaG>gaA	p.E57E	HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H3J_ENST00000479986.1_5'UTR	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	57						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						CAGTTAGGTACTCCAGCACCG	0.657																																					p.E57E		Atlas-SNP	.											.	HIST1H2AM	27	.	0			c.G171A						PASS	.						58.0	65.0	63.0					6																	27860757		2202	4300	6502	SO:0001819	synonymous_variant	8336	exon1			TAGGTACTCCAGC	X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.171G>A	6.37:g.27860757C>T		Somatic	122	1	0.00819672		WXS	Illumina HiSeq	Phase_I	125	111	0.888	NM_003514	P02261|Q2M1R2|Q76PA6	Silent	SNP	ENST00000359611.2	37	CCDS4639.1																																																																																			C|1.000;G|0.000	.	alt		0.657	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040162.1	NM_003514	
CLCA2	9635	hgsc.bcm.edu	37	1	86905898	86905898	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:86905898A>C	ENST00000370565.4	+	8	1433	c.1271A>C	c.(1270-1272)aAg>aCg	p.K424T		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	424	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		GGAGATGATAAGCTTCTTGGC	0.443																																					p.K424T	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	Atlas-SNP	.											.	CLCA2	102	.	0			c.A1271C						PASS	.						160.0	154.0	156.0					1																	86905898		2203	4300	6503	SO:0001583	missense	9635	exon8			ATGATAAGCTTCT		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1271A>C	1.37:g.86905898A>C	ENSP00000359596:p.Lys424Thr	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	112	45	0.401786	NM_006536	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	37	CCDS708.1	.	.	.	.	.	.	.	.	.	.	A	11.42	1.633645	0.29068	.	.	ENSG00000137975	ENST00000370565	T	0.11930	2.73	5.77	0.481	0.16809	von Willebrand factor, type A (3);	0.877147	0.10076	N	0.719128	T	0.02012	0.0063	N	0.08118	0	0.09310	N	1	B	0.21309	0.054	B	0.19148	0.024	T	0.46162	-0.9211	10	0.56958	D	0.05	-1.0854	6.223	0.20691	0.5663:0.2085:0.2252:0.0	.	424	Q9UQC9	CLCA2_HUMAN	T	424	ENSP00000359596:K424T	ENSP00000359596:K424T	K	+	2	0	CLCA2	86678486	0.000000	0.05858	0.001000	0.08648	0.133000	0.20885	0.646000	0.24797	0.440000	0.26502	0.533000	0.62120	AAG	.	.	none		0.443	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
MUC2	4583	hgsc.bcm.edu	37	11	1093452	1093452	+	Silent	SNP	G	G	A	rs34136803		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr11:1093452G>A	ENST00000441003.2	+	30	5298	c.5271G>A	c.(5269-5271)ccG>ccA	p.P1757P	MUC2_ENST00000359061.5_Silent_p.P1724P|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.P45P	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1724P(1)|p.P1757P(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccgacacccaccg	0.617																																					p.P1757P		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,2	MUC2	614	2	2	Substitution - coding silent(2)	prostate(2)	c.G5271A						scavenged	.						107.0	134.0	125.0					11																	1093452		2040	4045	6085	SO:0001819	synonymous_variant	4583	exon30			AACCCCGACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5271G>A	11.37:g.1093452G>A		Somatic	18	5	0.277778		WXS	Illumina HiSeq	Phase_I	12	4	0.333333	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				A|1.000;|0.000	1.000	weak		0.617	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
PIEZO1	9780	hgsc.bcm.edu	37	16	88803982	88803982	+	Missense_Mutation	SNP	C	C	G	rs6500493	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr16:88803982C>G	ENST00000301015.9	-	10	1426	c.1180G>C	c.(1180-1182)Gtc>Ctc	p.V394L	RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	394					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CGCCGCAGGACGGAGCTCTGG	0.706													G|||	3792	0.757188	0.739	0.7695	5008	,	,		13470	0.8889		0.674	False		,,,				2504	0.7229				p.V394L		Atlas-SNP	.											.	PIEZO1	79	.	0			c.G1180C						PASS	.						32.0	35.0	34.0					16																	88803982		691	1585	2276	SO:0001583	missense	9780	exon10			GCAGGACGGAGCT	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.1180G>C	16.37:g.88803982C>G	ENSP00000301015:p.Val394Leu	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_001142864	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	1693|1693	0.7751831501831502|0.7751831501831502	384|384	0.7804878048780488|0.7804878048780488	271|271	0.7486187845303868|0.7486187845303868	509|509	0.8898601398601399|0.8898601398601399	529|529	0.6978891820580475|0.6978891820580475	G|G	1.996|1.996	-0.430634|-0.430634	0.04669|0.04669	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015	.|T	.|0.73047	.|-0.71	4.17|4.17	-7.76|-7.76	0.01232|0.01232	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.19112|0.19112	0.55|0.55	0.51767|0.51767	P|P	6.099999999997774E-5|6.099999999997774E-5	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.12041|0.12041	-1.0563|-1.0563	4|8	.|0.25751	.|T	.|0.34	.|.	8.2407|8.2407	0.31658|0.31658	0.0:0.2827:0.2605:0.4568|0.0:0.2827:0.2605:0.4568	rs6500493;rs6500493|rs6500493;rs6500493	.|394	.|Q92508	.|PIEZ1_HUMAN	P|L	339|394	.|ENSP00000301015:V394L	.|ENSP00000301015:V394L	R|V	-|-	2|1	0|0	FAM38A|FAM38A	87331483|87331483	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-3.838000|-3.838000	0.00354|0.00354	-2.239000|-2.239000	0.00711|0.00711	-3.133000|-3.133000	0.00060|0.00060	CGT|GTC	C|0.223;G|0.777	0.777	strong		0.706	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
CCDC66	285331	hgsc.bcm.edu	37	3	56650054	56650054	+	Missense_Mutation	SNP	T	T	C	rs112267342|rs111934125	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:56650054T>C	ENST00000394672.3	+	13	1886	c.1816T>C	c.(1816-1818)Tct>Cct	p.S606P	CCDC66_ENST00000436465.2_Missense_Mutation_p.S606P|CCDC66_ENST00000326595.7_Missense_Mutation_p.S572P	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	606					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		TTCTACGACTTCTAAGAAGGA	0.289																																					p.S606P		Atlas-SNP	.											CCDC66_ENST00000394672,caecum,carcinoma,0,2	CCDC66	145	2	0			c.T1816C						PASS	.						86.0	99.0	94.0					3																	56650054		2203	4291	6494	SO:0001583	missense	285331	exon13			ACGACTTCTAAGA	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.1816T>C	3.37:g.56650054T>C	ENSP00000378167:p.Ser606Pro	Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	141	11	0.0780142	NM_001141947	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	ENST00000394672.3	37	CCDS46852.1	.	.	.	.	.	.	.	.	.	.	T	11.57	1.676847	0.29783	.	.	ENSG00000180376	ENST00000422222;ENST00000394672;ENST00000326595;ENST00000436465	T;T;T;T	0.19105	2.17;2.28;2.28;2.28	5.5	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.32376	0.0827	M	0.72894	2.215	0.80722	D	1	D	0.58268	0.982	P	0.57911	0.829	T	0.40924	-0.9537	10	0.02654	T	1	-4.7355	10.7191	0.46030	0.0:0.0:0.1601:0.8399	.	606	A2RUB6	CCD66_HUMAN	P	562;606;572;606	ENSP00000401451:S562P;ENSP00000378167:S606P;ENSP00000326050:S572P;ENSP00000404320:S606P	ENSP00000326050:S572P	S	+	1	0	CCDC66	56625094	0.993000	0.37304	0.582000	0.28627	0.363000	0.29612	2.520000	0.45554	1.007000	0.39238	0.482000	0.46254	TCT	C|1.000;|0.000	1.000	weak		0.289	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
KRT33A	3883	hgsc.bcm.edu	37	17	39502849	39502849	+	Missense_Mutation	SNP	T	T	G	rs149308293	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr17:39502849T>G	ENST00000007735.3	-	6	992	c.948A>C	c.(946-948)agA>agC	p.R316S		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	316	Coil 2.|Rod.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				TGGTGATCAGTCTCTGCACCT	0.622													T|||	8	0.00159744	0.0	0.0014	5008	,	,		17084	0.0069		0.0	False		,,,				2504	0.0				p.R316S		Atlas-SNP	.											.	KRT33A	53	.	0			c.A948C						PASS	.						72.0	69.0	70.0					17																	39502849		2203	4300	6503	SO:0001583	missense	3883	exon6			GATCAGTCTCTGC	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.948A>C	17.37:g.39502849T>G	ENSP00000007735:p.Arg316Ser	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	132	30	0.227273	NM_004138	B2RA87|Q6NTB9|Q6ZZB9	Missense_Mutation	SNP	ENST00000007735.3	37	CCDS11388.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	T	0.240	-1.014576	0.02095	.	.	ENSG00000006059	ENST00000007735	D	0.88354	-2.37	4.54	0.231	0.15377	Filament (1);	0.604547	0.17674	N	0.165846	T	0.60196	0.2250	N	0.04148	-0.265	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.52675	-0.8544	10	0.10902	T	0.67	.	3.027	0.06094	0.1487:0.1188:0.4864:0.2461	.	316	O76009	KT33A_HUMAN	S	316	ENSP00000007735:R316S	ENSP00000007735:R316S	R	-	3	2	KRT33A	36756375	0.000000	0.05858	0.038000	0.18304	0.098000	0.18820	0.024000	0.13555	0.228000	0.21019	-0.148000	0.13756	AGA	T|0.999;G|0.001	0.001	strong		0.622	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257295.1	NM_004138	
OR10H3	26532	hgsc.bcm.edu	37	19	15852443	15852443	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr19:15852443C>T	ENST00000305892.1	+	1	241	c.241C>T	c.(241-243)Cgc>Tgc	p.R81C		NM_013938.1	NP_039226.1	O60404	O10H3_HUMAN	olfactory receptor, family 10, subfamily H, member 3	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						CATCACCCCTCGCATGCTGGC	0.507																																					p.R81C		Atlas-SNP	.											OR10H3,colon,carcinoma,0,2	OR10H3	53	2	0			c.C241T						scavenged	.						537.0	454.0	482.0					19																	15852443		2203	4300	6503	SO:0001583	missense	26532	exon1			ACCCCTCGCATGC		CCDS12334.1	19p13.1	2012-08-09				ENSG00000171936		"""GPCR / Class A : Olfactory receptors"""	8174	protein-coding gene	gene with protein product							Standard	NM_013938		Approved		uc010xoq.2	O60404		ENST00000305892.1:c.241C>T	19.37:g.15852443C>T	ENSP00000307130:p.Arg81Cys	Somatic	226	2	0.00884956		WXS	Illumina HiSeq	Phase_I	231	99	0.428571	NM_013938	Q2HIZ3|Q6IFQ0	Missense_Mutation	SNP	ENST00000305892.1	37	CCDS12334.1	.	.	.	.	.	.	.	.	.	.	.	2.565	-0.301047	0.05495	.	.	ENSG00000171936	ENST00000305892	T	0.80033	-1.33	2.35	1.1	0.20463	GPCR, rhodopsin-like superfamily (1);	0.823482	0.09938	U	0.736331	T	0.79358	0.4432	M	0.83603	2.65	0.09310	N	1	B	0.18968	0.032	B	0.18263	0.021	T	0.72207	-0.4360	10	0.72032	D	0.01	.	6.0982	0.20033	0.4683:0.5317:0.0:0.0	.	81	O60404	O10H3_HUMAN	C	81	ENSP00000307130:R81C	ENSP00000307130:R81C	R	+	1	0	OR10H3	15713443	0.000000	0.05858	0.416000	0.26546	0.147000	0.21601	-0.100000	0.10990	1.320000	0.45209	0.185000	0.17295	CGC	.	.	none		0.507	OR10H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460918.1		
NTN4	59277	hgsc.bcm.edu	37	12	96076600	96076600	+	Splice_Site	SNP	T	T	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:96076600T>C	ENST00000343702.4	-	7	1843		c.e7-2		NTN4_ENST00000538383.1_Splice_Site|NTN4_ENST00000344911.4_Splice_Site|NTN4_ENST00000553059.1_Splice_Site	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4						axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)				NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						TCTGTGTGGCTAACAAAATAG	0.413																																					.		Atlas-SNP	.											.	NTN4	67	.	0			c.1395-2A>G						PASS	.						100.0	89.0	93.0					12																	96076600		2203	4300	6503	SO:0001630	splice_region_variant	59277	exon8			TGTGGCTAACAAA	AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.1395-2A>G	12.37:g.96076600T>C		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	78	4	0.0512821	NM_021229	B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Splice_Site	SNP	ENST00000343702.4	37	CCDS9054.1	.	.	.	.	.	.	.	.	.	.	T	13.87	2.364696	0.41902	.	.	ENSG00000074527	ENST00000343702;ENST00000344911;ENST00000538383;ENST00000553059	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1749	0.72903	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NTN4	94600731	1.000000	0.71417	0.395000	0.26283	0.405000	0.30901	5.424000	0.66464	1.996000	0.58369	0.260000	0.18958	.	.	.	none		0.413	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408372.1	NM_021229	Intron
C7	730	hgsc.bcm.edu	37	5	40958155	40958155	+	Silent	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:40958155G>A	ENST00000313164.9	+	11	1640	c.1281G>A	c.(1279-1281)ctG>ctA	p.L427L		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	427	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				TATATGAGCTGGTAAAGGAAG	0.403																																					p.L427L		Atlas-SNP	.											.	C7	136	.	0			c.G1281A						PASS	.						84.0	76.0	79.0					5																	40958155		1854	4084	5938	SO:0001819	synonymous_variant	730	exon11			TGAGCTGGTAAAG	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1281G>A	5.37:g.40958155G>A		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	122	44	0.360656	NM_000587	Q6P3T5|Q92489	Silent	SNP	ENST00000313164.9	37	CCDS47201.1																																																																																			.	.	none		0.403	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1		
GABRG3	2567	hgsc.bcm.edu	37	15	27772698	27772698	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr15:27772698G>A	ENST00000333743.6	+	8	1239	c.985G>A	c.(985-987)Gcc>Acc	p.A329T	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	329					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTTTGTCTTCGCCGCGCTGAT	0.542																																					p.A329T	NSCLC(114;800 1656 7410 37729 45293)	Atlas-SNP	.											.	GABRG3	115	.	0			c.G985A						PASS	.						119.0	108.0	112.0					15																	27772698		2157	4267	6424	SO:0001583	missense	2567	exon8			GTCTTCGCCGCGC		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.985G>A	15.37:g.27772698G>A	ENSP00000331912:p.Ala329Thr	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	90	12	0.133333	NM_033223	G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422249	0.83559	.	.	ENSG00000182256	ENST00000333743	D	0.84660	-1.88	5.48	5.48	0.80851	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.90998	0.7169	M	0.67700	2.07	0.80722	D	1	D	0.69078	0.997	D	0.62955	0.909	D	0.91538	0.5247	10	0.66056	D	0.02	.	18.3414	0.90307	0.0:0.0:1.0:0.0	.	329	Q99928	GBRG3_HUMAN	T	329	ENSP00000331912:A329T	ENSP00000331912:A329T	A	+	1	0	GABRG3	25446293	1.000000	0.71417	0.987000	0.45799	0.552000	0.35366	6.201000	0.72124	2.562000	0.86427	0.563000	0.77884	GCC	.	.	none		0.542	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
CD163L1	283316	hgsc.bcm.edu	37	12	7556213	7556213	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr12:7556213C>A	ENST00000313599.3	-	6	1383	c.1326G>T	c.(1324-1326)gaG>gaT	p.E442D	CD163L1_ENST00000416109.2_Missense_Mutation_p.E452D|CD163L1_ENST00000396630.1_Missense_Mutation_p.E442D			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	442	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						AGAGAGCTGACTCATTCCCAG	0.443																																					p.E442D		Atlas-SNP	.											.	CD163L1	238	.	0			c.G1326T						PASS	.						137.0	128.0	131.0					12																	7556213		2203	4300	6503	SO:0001583	missense	283316	exon6			AGCTGACTCATTC	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.1326G>T	12.37:g.7556213C>A	ENSP00000315945:p.Glu442Asp	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	118	64	0.542373	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.956153	0.73902	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630;ENST00000545926	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	2.22	-1.83	0.07833	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.65811	0.2727	M	0.93062	3.375	0.24263	N	0.995277	D;D	0.89917	1.0;0.999	D;D	0.85130	0.99;0.997	T	0.54951	-0.8216	9	0.56958	D	0.05	.	6.6862	0.23146	0.0:0.42:0.0:0.58	.	452;442	E7EVK4;Q9NR16	.;C163B_HUMAN	D	442;452;442;88	ENSP00000315945:E442D;ENSP00000393474:E452D;ENSP00000379871:E442D;ENSP00000439921:E88D	ENSP00000315945:E442D	E	-	3	2	CD163L1	7447480	0.000000	0.05858	0.081000	0.20488	0.925000	0.55904	-1.439000	0.02414	-0.460000	0.07003	0.563000	0.77884	GAG	.	.	none		0.443	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
SEMA3C	10512	hgsc.bcm.edu	37	7	80418691	80418691	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr7:80418691A>T	ENST00000265361.3	-	12	1846	c.1285T>A	c.(1285-1287)Tat>Aat	p.Y429N	SEMA3C_ENST00000419255.2_Missense_Mutation_p.Y429N|SEMA3C_ENST00000544525.1_Missense_Mutation_p.Y447N	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	429	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						ATCTTTGTATACTTGTAGTCA	0.413																																					p.Y429N		Atlas-SNP	.											.	SEMA3C	106	.	0			c.T1285A						PASS	.						200.0	184.0	189.0					7																	80418691		2203	4300	6503	SO:0001583	missense	10512	exon12			TTGTATACTTGTA	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.1285T>A	7.37:g.80418691A>T	ENSP00000265361:p.Tyr429Asn	Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	240	100	0.416667	NM_006379	B4DRL8	Missense_Mutation	SNP	ENST00000265361.3	37	CCDS5596.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.710534	0.89018	.	.	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525	T;T;T	0.11385	2.78;2.78;2.78	5.94	5.94	0.96194	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.112982	0.64402	D	0.000006	T	0.30448	0.0765	M	0.71206	2.165	0.80722	D	1	P;P	0.51240	0.93;0.943	P;P	0.59171	0.771;0.853	T	0.01096	-1.1453	10	0.87932	D	0	.	16.3908	0.83537	1.0:0.0:0.0:0.0	.	447;429	F5H1Z7;Q99985	.;SEM3C_HUMAN	N	429;429;447	ENSP00000265361:Y429N;ENSP00000411193:Y429N;ENSP00000445649:Y447N	ENSP00000265361:Y429N	Y	-	1	0	SEMA3C	80256627	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.327000	0.79147	2.269000	0.75478	0.455000	0.32223	TAT	.	.	none		0.413	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1	NM_006379	
ALMS1	7840	hgsc.bcm.edu	37	2	73677595	73677595	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr2:73677595C>A	ENST00000264448.6	+	8	4049	c.3938C>A	c.(3937-3939)tCa>tAa	p.S1313*	ALMS1_ENST00000377715.1_Nonsense_Mutation_p.S1313*|ALMS1_ENST00000409009.1_Nonsense_Mutation_p.S1271*	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1313	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AAGAATGTTTCAGCGGTTCCT	0.448																																					p.S1313X		Atlas-SNP	.											.	ALMS1	384	.	0			c.C3938A						PASS	.						135.0	134.0	134.0					2																	73677595		1855	4100	5955	SO:0001587	stop_gained	7840	exon8			ATGTTTCAGCGGT	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.3938C>A	2.37:g.73677595C>A	ENSP00000264448:p.Ser1313*	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	90	34	0.377778	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Nonsense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	C	38	7.255527	0.98168	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	.	.	.	4.44	-1.82	0.07857	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.8702	0.35311	0.0:0.3542:0.0:0.6458	.	.	.	.	X	1271;1313;1313	.	ENSP00000264448:S1313X	S	+	2	0	ALMS1	73531103	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.394000	0.07296	-0.386000	0.07821	0.655000	0.94253	TCA	.	.	none		0.448	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
KIF4B	285643	hgsc.bcm.edu	37	5	154395805	154395805	+	Missense_Mutation	SNP	C	C	T	rs193075545		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:154395805C>T	ENST00000435029.4	+	1	2546	c.2386C>T	c.(2386-2388)Cgg>Tgg	p.R796W		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	796	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCCTAAACTCCGGAAGTGTAC	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		21789	0.0		0.001	False		,,,				2504	0.0				p.R796W		Atlas-SNP	.											.	KIF4B	307	.	0			c.C2386T						PASS	.						45.0	48.0	47.0					5																	154395805		2197	4299	6496	SO:0001583	missense	285643	exon1			AAACTCCGGAAGT	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2386C>T	5.37:g.154395805C>T	ENSP00000387875:p.Arg796Trp	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	149	80	0.536913	NM_001099293		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	c	8.273	0.813896	0.16537	.	.	ENSG00000226650	ENST00000435029	T	0.69926	-0.44	1.48	0.588	0.17445	.	.	.	.	.	T	0.71230	0.3315	L	0.61218	1.895	0.58432	D	0.999994	D	0.76494	0.999	P	0.60886	0.88	T	0.68213	-0.5468	9	0.56958	D	0.05	.	6.1007	0.20045	0.0:0.8141:0.0:0.1858	.	796	Q2VIQ3	KIF4B_HUMAN	W	796	ENSP00000387875:R796W	ENSP00000387875:R796W	R	+	1	2	KIF4B	154375998	0.985000	0.35326	0.652000	0.29579	0.146000	0.21551	0.570000	0.23653	0.200000	0.20447	-0.222000	0.12452	CGG	C|1.000;T|0.000	0.000	strong		0.428	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
ORC5	5001	hgsc.bcm.edu	37	7	103835607	103835607	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr7:103835607G>T	ENST00000297431.4	-	5	679	c.537C>A	c.(535-537)ttC>ttA	p.F179L	ORC5_ENST00000545943.1_Missense_Mutation_p.F47L|ORC5_ENST00000447452.2_Missense_Mutation_p.F179L|ORC5_ENST00000485726.1_5'UTR	NM_002553.3	NP_002544.1	O43913	ORC5_HUMAN	origin recognition complex, subunit 5	179					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)			kidney(1)|large_intestine(2)|lung(9)|pancreas(1)|upper_aerodigestive_tract(1)	14						TGTAATCAGGGAAATATAAGA	0.343																																					p.F179L		Atlas-SNP	.											.	ORC5	48	.	0			c.C537A						PASS	.						96.0	93.0	94.0					7																	103835607		2203	4300	6503	SO:0001583	missense	5001	exon5			ATCAGGGAAATAT		CCDS5734.1, CCDS47681.1	7q22.1	2014-06-13	2010-10-12	2010-10-12	ENSG00000164815	ENSG00000164815			8491	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 117"""	602331	"""origin recognition complex, subunit 5 (yeast homolog)-like"", ""origin recognition complex, subunit 5-like (yeast)"", ""origin recognition complex, subunit 5 homolog (yeast)"""	ORC5L		9417919, 9829972	Standard	NM_002553		Approved	Orc5p, ORC5T, PPP1R117	uc003vcb.3	O43913	OTTHUMG00000157275	ENST00000297431.4:c.537C>A	7.37:g.103835607G>T	ENSP00000297431:p.Phe179Leu	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	90	45	0.5	NM_002553	A4D0P8|O60590|O95268	Missense_Mutation	SNP	ENST00000297431.4	37	CCDS5734.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621348	0.28889	.	.	ENSG00000164815	ENST00000297431;ENST00000545943;ENST00000447452	T;T;T	0.59083	0.29;0.64;0.29	5.72	-2.03	0.07365	.	0.000000	0.85682	D	0.000000	T	0.60869	0.2302	L	0.37466	1.105	0.54753	D	0.999989	D;P;B	0.69078	0.997;0.886;0.125	D;P;B	0.70716	0.97;0.517;0.056	T	0.56902	-0.7902	10	0.40728	T	0.16	.	13.0489	0.58944	0.768:0.0:0.232:0.0	.	179;179;179	A4D0P7;O43913-2;O43913	.;.;ORC5_HUMAN	L	179;47;179	ENSP00000297431:F179L;ENSP00000438018:F47L;ENSP00000395747:F179L	ENSP00000297431:F179L	F	-	3	2	ORC5	103622843	0.999000	0.42202	0.978000	0.43139	0.964000	0.63967	0.560000	0.23500	-0.489000	0.06716	-0.137000	0.14449	TTC	.	.	none		0.343	ORC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348286.1	NM_002553	
DHRS2	10202	hgsc.bcm.edu	37	14	24108080	24108080	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr14:24108080T>A	ENST00000250383.6	+	2	483	c.7T>A	c.(7-9)Tca>Aca	p.S3T	DHRS2_ENST00000344777.7_Missense_Mutation_p.S3T|DHRS2_ENST00000553896.1_3'UTR	NM_005794.3	NP_005785.1	Q13268	DHRS2_HUMAN	dehydrogenase/reductase (SDR family) member 2	3					C21-steroid hormone metabolic process (GO:0008207)|cellular response to oxidative stress (GO:0034599)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	carbonyl reductase (NADPH) activity (GO:0004090)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00659)		CACTATGCTGTCAGCAGTTGC	0.532																																					p.S3T		Atlas-SNP	.											.	DHRS2	78	.	0			c.T7A						PASS	.						116.0	114.0	115.0					14																	24108080		2203	4300	6503	SO:0001583	missense	10202	exon2			ATGCTGTCAGCAG		CCDS9604.1, CCDS41927.1	14q11.2	2011-09-14			ENSG00000100867	ENSG00000100867		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18349	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 1"""	615194				7556196, 11944995, 16685466, 19027726	Standard	NM_182908		Approved	HEP27, SDR25C1	uc001wkt.4	Q13268	OTTHUMG00000028771	ENST00000250383.6:c.7T>A	14.37:g.24108080T>A	ENSP00000250383:p.Ser3Thr	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	55	22	0.4	NM_182908	D3DS54|Q53GS4|Q7Z789|Q9H2R2	Missense_Mutation	SNP	ENST00000250383.6	37	CCDS9604.1	.	.	.	.	.	.	.	.	.	.	.	12.39	1.923926	0.34002	.	.	ENSG00000100867	ENST00000432832;ENST00000250383;ENST00000344777	D;T;D	0.81996	-1.53;-1.49;-1.56	5.34	-4.87	0.03123	.	2.990420	0.01149	N	0.006375	T	0.62588	0.2440	N	0.08118	0	0.09310	N	1	B;B	0.17667	0.023;0.007	B;B	0.15870	0.014;0.008	T	0.50783	-0.8787	10	0.54805	T	0.06	.	0.6026	0.00747	0.3661:0.2175:0.1113:0.305	.	3;3	C9JZP6;D3DS54	.;.	T	3	ENSP00000401213:S3T;ENSP00000250383:S3T;ENSP00000344674:S3T	ENSP00000250383:S3T	S	+	1	0	DHRS2	23177920	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.808000	0.04515	-0.712000	0.04988	-0.251000	0.11542	TCA	.	.	none		0.532	DHRS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000071842.2	NM_182908	
APCS	325	hgsc.bcm.edu	37	1	159557958	159557958	+	Silent	SNP	G	G	T	rs371650621		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr1:159557958G>T	ENST00000255040.2	+	2	229	c.132G>T	c.(130-132)ccG>ccT	p.P44P		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	44	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)	p.P44P(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					TGATCACACCGCTGGAGAAGC	0.443																																					p.P44P		Atlas-SNP	.											APCS,NS,carcinoma,0,1	APCS	48	1	1	Substitution - coding silent(1)	kidney(1)	c.G132T						scavenged	.						103.0	101.0	102.0					1																	159557958		2203	4300	6503	SO:0001819	synonymous_variant	325	exon2			CACACCGCTGGAG		CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.132G>T	1.37:g.159557958G>T		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	116	3	0.0258621	NM_001639		Silent	SNP	ENST00000255040.2	37	CCDS1186.1																																																																																			.	.	none		0.443	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059024.2	NM_001639	
FAM153B	202134	hgsc.bcm.edu	37	5	175528584	175528584	+	Splice_Site	SNP	C	C	T	rs200684937		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:175528584C>T	ENST00000253490.4	+	12	721	c.664C>T	c.(664-666)Ctt>Ttt	p.L222F	FAM153B_ENST00000512862.1_Intron|FAM153B_ENST00000510151.1_Splice_Site_p.L145F|FAM153B_ENST00000515817.1_Splice_Site_p.L145F			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	222								p.L222F(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		ACTGGCCGAACGTACGTATTC	0.463																																					p.L145F		Atlas-SNP	.											FAM153B,NS,carcinoma,0,1	FAM153B	28	1	1	Substitution - Missense(1)	prostate(1)	c.C433T						scavenged	.																																			SO:0001630	splice_region_variant	202134	exon11			GCCGAACGTACGT	AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.664+1C>T	5.37:g.175528584C>T		Somatic	330	5	0.0151515		WXS	Illumina HiSeq	Phase_I	440	16	0.0363636	NM_001265615	A8MTI1	Missense_Mutation	SNP	ENST00000253490.4	37		.	.	.	.	.	.	.	.	.	.	C	6.188	0.402789	0.11696	.	.	ENSG00000182230	ENST00000515817;ENST00000253490	.	.	.	0.752	-0.292	0.12839	.	.	.	.	.	T	0.10423	0.0255	N	0.08118	0	0.09310	N	1	D	0.60575	0.988	B	0.40982	0.345	T	0.17410	-1.0370	8	0.38643	T	0.18	.	4.5589	0.12151	0.0:0.421:0.579:0.0	.	222	P0C7A2	F153B_HUMAN	F	145;222	.	ENSP00000253490:L222F	L	+	1	0	FAM153B	175461190	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	-4.439000	0.00234	-0.089000	0.12484	-1.402000	0.01139	CTT	C|0.500;T|0.500	0.500	strong		0.463	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001079529	Missense_Mutation
LRP2	4036	hgsc.bcm.edu	37	2	170134323	170134323	+	Silent	SNP	C	C	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr2:170134323C>T	ENST00000263816.3	-	13	1989	c.1704G>A	c.(1702-1704)tcG>tcA	p.S568S	LRP2_ENST00000443831.1_Intron	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	568					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAACACGCTTCGATATCATAT	0.413																																					p.S568S		Atlas-SNP	.											.	LRP2	751	.	0			c.G1704A						PASS	.						143.0	139.0	140.0					2																	170134323		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon13			ACGCTTCGATATC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.1704G>A	2.37:g.170134323C>T		Somatic	209	0	0		WXS	Illumina HiSeq	Phase_I	219	107	0.488584	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	37	CCDS2232.1																																																																																			.	.	none		0.413	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
KLHL14	57565	hgsc.bcm.edu	37	18	30350456	30350456	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr18:30350456G>C	ENST00000359358.4	-	2	537	c.99C>G	c.(97-99)tgC>tgG	p.C33W	AC012123.1_ENST00000426194.1_Intron|KLHL14_ENST00000358095.4_Missense_Mutation_p.C33W	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	33	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						GGGTCACGTCGCAAAACAGCT	0.642																																					p.C33W		Atlas-SNP	.											.	KLHL14	92	.	0			c.C99G						PASS	.						73.0	52.0	59.0					18																	30350456		2203	4300	6503	SO:0001583	missense	57565	exon2			CACGTCGCAAAAC	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.99C>G	18.37:g.30350456G>C	ENSP00000352314:p.Cys33Trp	Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	53	18	0.339623	NM_020805	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	37	CCDS32813.1	.	.	.	.	.	.	.	.	.	.	G	5.357	0.251139	0.10130	.	.	ENSG00000197705	ENST00000359358;ENST00000358095	T;T	0.72167	-0.63;-0.63	4.29	4.29	0.51040	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.233665	0.46442	D	0.000298	T	0.81851	0.4910	M	0.78285	2.405	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.83402	0.0023	10	0.87932	D	0	.	9.3029	0.37856	0.1005:0.0:0.8995:0.0	.	33	Q9P2G3	KLH14_HUMAN	W	33	ENSP00000352314:C33W;ENSP00000350808:C33W	ENSP00000350808:C33W	C	-	3	2	KLHL14	28604454	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.623000	0.54224	2.223000	0.72356	0.460000	0.39030	TGC	.	.	none		0.642	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1		
OTOP1	133060	hgsc.bcm.edu	37	4	4228479	4228479	+	Missense_Mutation	SNP	G	G	C	rs199890951		TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr4:4228479G>C	ENST00000296358.4	-	1	137	c.113C>G	c.(112-114)tCc>tGc	p.S38C		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	38					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ggATTCCGGGGACCTCGGGGC	0.746																																					p.S38C		Atlas-SNP	.											OTOP1,NS,carcinoma,0,1	OTOP1	118	1	0			c.C113G						scavenged	.						3.0	3.0	3.0					4																	4228479		1773	3481	5254	SO:0001583	missense	133060	exon1			TCCGGGGACCTCG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.113C>G	4.37:g.4228479G>C	ENSP00000296358:p.Ser38Cys	Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	27	3	0.111111	NM_177998	A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	G	7.656	0.683978	0.14907	.	.	ENSG00000163982	ENST00000296358	T	0.08896	3.04	2.01	0.00709	0.14069	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	P	0.52463	0.953	B	0.31390	0.129	T	0.44559	-0.9320	9	0.49607	T	0.09	-0.0197	7.5462	0.27768	0.0:0.5332:0.4668:0.0	.	38	Q7RTM1	OTOP1_HUMAN	C	38	ENSP00000296358:S38C	ENSP00000296358:S38C	S	-	2	0	OTOP1	4279380	0.001000	0.12720	0.002000	0.10522	0.057000	0.15508	0.411000	0.21115	-0.016000	0.14127	-0.472000	0.04984	TCC	.	.	weak		0.746	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
MUC4	4585	hgsc.bcm.edu	37	3	195506005	195506005	+	Missense_Mutation	SNP	A	A	C	rs202017381	byFrequency	TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr3:195506005A>C	ENST00000463781.3	-	2	12905	c.12446T>G	c.(12445-12447)aTc>aGc	p.I4149S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.I4149S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.I4149S(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGGGATGGTGACAGG	0.587													.|||	15	0.00299521	0.0076	0.0	5008	,	,		11242	0.0		0.001	False		,,,				2504	0.0041				p.I4149S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	2	Substitution - Missense(2)	kidney(1)|endometrium(1)	c.T12446G						scavenged	.						41.0	23.0	28.0					3																	195506005		646	1562	2208	SO:0001583	missense	4585	exon2			GAAGGGATGGTGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12446T>G	3.37:g.195506005A>C	ENSP00000417498:p.Ile4149Ser	Somatic	102	6	0.0588235		WXS	Illumina HiSeq	Phase_I	74	4	0.0540541	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.001	-3.494649	0.00010	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36157	1.3;1.27	.	.	.	.	.	.	.	.	T	0.10208	0.0250	N	0.08118	0	0.09310	N	1	B	0.31931	0.347	B	0.20577	0.03	T	0.06552	-1.0820	7	.	.	.	.	2.1553	0.03810	0.4926:0.2533:0.0:0.254	.	4021	E7ESK3	.	S	4149	ENSP00000417498:I4149S;ENSP00000420243:I4149S	.	I	-	2	0	MUC4	196990784	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.259000	0.18405	-4.179000	0.00067	-4.128000	0.00010	ATC	.	.	weak		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MROH2B	133558	hgsc.bcm.edu	37	5	41038932	41038932	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A7Q1-01A-11D-A382-10	TCGA-FA-A7Q1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c377b8a-f2c6-4113-8515-8eb29e95690c	722874f7-34b9-4f67-8cf3-700ec8f4c50e	g.chr5:41038932G>T	ENST00000399564.4	-	21	2570	c.2120C>A	c.(2119-2121)gCa>gAa	p.A707E	MROH2B_ENST00000506092.2_Missense_Mutation_p.A262E	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	707																	GAGGGCCACTGCTCCATAGAT	0.468																																					p.A707E		Atlas-SNP	.											.	.	.	.	0			c.C2120A						PASS	.						76.0	74.0	75.0					5																	41038932		1891	4108	5999	SO:0001583	missense	133558	exon21			GCCACTGCTCCAT		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2120C>A	5.37:g.41038932G>T	ENSP00000382476:p.Ala707Glu	Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	65	18	0.276923	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	G	6.769	0.510869	0.12883	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.66280	5.01;-0.2	5.93	2.03	0.26663	Armadillo-type fold (1);	0.920724	0.09128	N	0.844815	T	0.45617	0.1351	L	0.44542	1.39	0.09310	N	1	P	0.35272	0.493	B	0.27380	0.079	T	0.32561	-0.9902	10	0.32370	T	0.25	.	3.4263	0.07412	0.1609:0.1346:0.5664:0.138	.	707	Q7Z745	HTRB2_HUMAN	E	262;412;707	ENSP00000441504:A262E;ENSP00000382476:A707E	ENSP00000296803:A412E	A	-	2	0	HEATR7B2	41074689	0.002000	0.14202	0.055000	0.19348	0.200000	0.23975	1.065000	0.30592	0.857000	0.35407	0.655000	0.94253	GCA	.	.	none		0.468	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
