#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SETD1B	23067	hgsc.bcm.edu	37	12	122242657	122242658	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr12:122242657_122242658insC	ENST00000604567.1	+	2	82_83	c.14_15insC	c.(13-18)caccccfs	p.HP5fs	RHOF_ENST00000545544.1_5'Flank|SETD1B_ENST00000267197.5_Frame_Shift_Ins_p.HP5fs|SETD1B_ENST00000542440.1_Frame_Shift_Ins_p.HP5fs|RP11-347I19.8_ENST00000609067.1_lincRNA			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	5					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.H8fs*27(2)		NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GAGAACAGTCACCCCCCCCACC	0.629																																					p.H5fs		Atlas-Indel	.											.	SETD1B	105	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.14_15insC						PASS	.			9,1819		1,7,906						1.9	1.0			42	13,3745		3,7,1869	no	frameshift	SETD1B	NM_015048.1		4,14,2775	A1A1,A1R,RR		0.3459,0.4923,0.3938				22,5564				SO:0001589	frameshift_variant	23067	exon1			.	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.22dupC	12.37:g.122242665_122242665dupC	ENSP00000474253:p.His5fs	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	57	12	0.210526	NM_015048	F6MFW1	Frame_Shift_Ins	INS	ENST00000604567.1	37																																																																																				.	.	none		0.629	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
E2F1	1869	hgsc.bcm.edu	37	20	32267687	32267690	+	Frame_Shift_Del	DEL	CCGT	CCGT	-			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	CCGT	CCGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr20:32267687_32267690delCCGT	ENST00000343380.5	-	3	582_585	c.443_446delACGG	c.(442-447)gacggtfs	p.DG148fs		NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	148	Interaction with BIRC2/c-IAP1.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						GTCGACGACACCGTCAGCCGAGTG	0.593																																					p.148_149del		Atlas-Indel	.											.	E2F1	41	.	0			c.444_447del						PASS	.																																			SO:0001589	frameshift_variant	1869	exon3			.		CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.443_446delACGG	20.37:g.32267687_32267690delCCGT	ENSP00000345571:p.Asp148fs	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	91	12	0.131868	NM_005225	Q13143|Q92768	Frame_Shift_Del	DEL	ENST00000343380.5	37	CCDS13224.1																																																																																			.	.	none		0.593	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078731.2		
TNFAIP3	7128	hgsc.bcm.edu	37	6	138198239	138198240	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr6:138198239_138198240delAG	ENST00000237289.4	+	6	898_899	c.832_833delAG	c.(832-834)agafs	p.R278fs	TNFAIP3_ENST00000485192.1_3'UTR	NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	278	TRAF-binding.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		ACTTGTTAACAGAGACCGGGGA	0.342			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.277_278del	GBM(130;153 1739 22295 28918 47987)	Atlas-Indel	.		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	TNFAIP3	340	.	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)	c.831_832del						PASS	.																																			SO:0001589	frameshift_variant	7128	exon6			.	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.832_833delAG	6.37:g.138198241_138198242delAG	ENSP00000237289:p.Arg278fs	Somatic	286	0	0		WXS	Illumina HiSeq	Phase_I	165	12	0.0727273	NM_001270508	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Frame_Shift_Del	DEL	ENST00000237289.4	37	CCDS5187.1																																																																																			.	.	none		0.342	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
SCN9A	6335	hgsc.bcm.edu	37	2	167055184	167055185	+	Stop_Codon_Ins	INS	-	-	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr2:167055184_167055185insT	ENST00000409435.1	-	0	5963_5964				AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Stop_Codon_Ins|SCN9A_ENST00000409672.1_Stop_Codon_Ins|SCN9A_ENST00000375387.4_Stop_Codon_Ins			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit						behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGAAGCTCTATTTTTTGCTTT	0.327																																					p.X1978delinsI		Atlas-Indel	.											.	SCN9A	296	.	0			c.5932_5933insA						PASS	.																																			SO:0001567	stop_retained_variant	6335	exon27			.	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.5965dupA	2.37:g.167055190_167055190dupT	ENSP00000386330:p.*1989Ileext*?	Somatic	372	0	0		WXS	Illumina HiSeq	Phase_I	243	22	0.090535	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Frame_Shift_Ins	INS	ENST00000409435.1	37	CCDS46441.1																																																																																			.	.	none		0.327	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
ARID1A	8289	hgsc.bcm.edu	37	1	27101417	27101417	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:27101417delC	ENST00000324856.7	+	18	5070	c.4699delC	c.(4699-4701)cccfs	p.P1569fs	ARID1A_ENST00000457599.2_Intron|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.P1186fs|ARID1A_ENST00000540690.1_Intron	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1569					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CATGACAAGGCCCCCTCCATC	0.632			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.R1566fs		Atlas-Indel	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.4698delG						PASS	.						51.0	50.0	51.0					1																	27101417		2203	4300	6503	SO:0001589	frameshift_variant	8289	exon18			.	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4699delC	1.37:g.27101417delC	ENSP00000320485:p.Pro1569fs	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	119	28	0.235294	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	37	CCDS285.1																																																																																			.	.	none		0.632	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
KMT2D	8085	hgsc.bcm.edu	37	12	49436376	49436377	+	Frame_Shift_Ins	INS	-	-	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr12:49436376_49436377insG	ENST00000301067.7	-	27	5833_5834	c.5834_5835insC	c.(5833-5835)ccafs	p.P1945fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1945					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGCAGAGGCCTGGGTAGGAGTC	0.559																																					p.P1945fs		Atlas-Indel	.											.	MLL2	1173	.	0			c.5835_5836insC						PASS	.																																			SO:0001589	frameshift_variant	8085	exon27			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.5835dupC	12.37:g.49436379_49436379dupG	ENSP00000301067:p.Pro1945fs	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	66	11	0.166667	NM_003482	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	37	CCDS44873.1																																																																																			.	.	none		0.559	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
CTSH	1512	hgsc.bcm.edu	37	15	79221796	79221797	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr15:79221796_79221797insT	ENST00000220166.5	-	8	696_697	c.587_588insA	c.(586-588)aacfs	p.N196fs	CTSH_ENST00000534533.1_5'UTR	NM_004390.3	NP_004381.2	P09668	CATH_HUMAN	cathepsin H	196					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|bradykinin catabolic process (GO:0010815)|cellular response to thyroid hormone stimulus (GO:0097067)|dichotomous subdivision of terminal units involved in lung branching (GO:0060448)|ERK1 and ERK2 cascade (GO:0070371)|immune response-regulating signaling pathway (GO:0002764)|membrane protein proteolysis (GO:0033619)|metanephros development (GO:0001656)|negative regulation of apoptotic process (GO:0043066)|neuropeptide catabolic process (GO:0010813)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidase activity (GO:0010952)|protein destabilization (GO:0031648)|proteolysis (GO:0006508)|response to retinoic acid (GO:0032526)|spermatogenesis (GO:0007283)|surfactant homeostasis (GO:0043129)|T cell mediated cytotoxicity (GO:0001913)|zymogen activation (GO:0031638)	acrosomal vesicle (GO:0001669)|alveolar lamellar body (GO:0097208)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|outer dense fiber (GO:0001520)	aminopeptidase activity (GO:0004177)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)|HLA-A specific activating MHC class I receptor activity (GO:0030108)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|thyroid hormone binding (GO:0070324)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)	10						TGATCCCCTTGTTGTACAGGAT	0.579																																					p.N196fs		Atlas-Indel	.											.	CTSH	23	.	0			c.588_589insA						PASS	.																																			SO:0001589	frameshift_variant	1512	exon8			.	X07549	CCDS10308.1	15q25.1	2014-01-28			ENSG00000103811	ENSG00000103811	3.4.22.16	"""Cathepsins"""	2535	protein-coding gene	gene with protein product		116820		CPSB		2849458	Standard	NM_004390		Approved	ACC-4, ACC-5	uc021srk.1	P09668	OTTHUMG00000144171	ENST00000220166.5:c.588dupA	15.37:g.79221798_79221798dupT	ENSP00000220166:p.Asn196fs	Somatic	226	0	0		WXS	Illumina HiSeq	Phase_I	129	12	0.0930233	NM_004390	B2RBK0|Q96NY6|Q9BUM7	Frame_Shift_Ins	INS	ENST00000220166.5	37	CCDS10308.1																																																																																			.	.	none		0.579	CTSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291370.1	NM_004390	
OR2T34	127068	hgsc.bcm.edu	37	1	248737510	248737511	+	Frame_Shift_Ins	INS	-	-	A	rs150608839	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:248737510_248737511insA	ENST00000328782.2	-	1	569_570	c.548_549insT	c.(547-549)ttcfs	p.F183fs		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F183S(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAGTCTCACAGAAAAAACTCAG	0.515																																					p.F183fs		Atlas-Indel	.											OR2T34,NS,haematopoietic_neoplasm,-1,2	OR2T34	72	2	1	Substitution - Missense(1)	stomach(1)	c.549_550insT						PASS	.																																			SO:0001589	frameshift_variant	127068	exon1			.	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.549dupT	1.37:g.248737516_248737516dupA	ENSP00000330904:p.Phe183fs	Somatic	333	0	0		WXS	Illumina HiSeq	Phase_I	230	39	0.169565	NM_001001821	B2RNJ8|Q6IEY5|Q96R31	Frame_Shift_Ins	INS	ENST00000328782.2	37	CCDS31120.1																																																																																			.	.	none		0.515	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821	
RIMS1	22999	hgsc.bcm.edu	37	6	73023228	73023228	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr6:73023228A>G	ENST00000521978.1	+	28	3983	c.3983A>G	c.(3982-3984)cAg>cGg	p.Q1328R	RIMS1_ENST00000518273.1_Intron|RIMS1_ENST00000538414.1_Missense_Mutation_p.Q134R|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000401910.3_Missense_Mutation_p.Q648R|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000491071.2_Missense_Mutation_p.Q1151R|RIMS1_ENST00000264839.7_Missense_Mutation_p.Q1177R|RIMS1_ENST00000425662.2_Intron|RIMS1_ENST00000348717.5_Missense_Mutation_p.Q1120R|RIMS1_ENST00000517960.1_Missense_Mutation_p.Q1120R	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1328					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CATAAAGATCAGTACAGAAGC	0.403																																					p.Q1328R		Atlas-SNP	.											.	RIMS1	278	.	0			c.A3983G						PASS	.						57.0	60.0	59.0					6																	73023228		1962	4152	6114	SO:0001583	missense	22999	exon28			AAGATCAGTACAG	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3983A>G	6.37:g.73023228A>G	ENSP00000428417:p.Gln1328Arg	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	78	19	0.24359	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.95|11.95	1.792225|1.792225	0.31685|0.31685	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000264839;ENST00000517960;ENST00000521978;ENST00000401910;ENST00000453976;ENST00000370420;ENST00000538414|ENST00000522211	T;T;T;T;T;T;T;T;T|.	0.18338|.	2.55;2.68;2.6;2.68;2.58;2.67;2.55;2.28;2.22|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.000000|.	0.64402|.	D|.	0.000007|.	T|T	0.59266|0.59266	0.2181|0.2181	L|L	0.50333|0.50333	1.59|1.59	0.47308|0.47308	D|D	0.999389|0.999389	B;P;P;B;D;B;P|.	0.56035|.	0.017;0.949;0.885;0.003;0.974;0.016;0.936|.	B;D;P;B;P;B;P|.	0.64042|.	0.016;0.921;0.549;0.003;0.521;0.01;0.885|.	T|T	0.58869|0.58869	-0.7560|-0.7560	10|5	0.07990|.	T|.	0.79|.	-18.4387|-18.4387	16.0343|16.0343	0.80612|0.80612	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	134;1177;648;1120;404;1151;1328|.	B7Z7W2;E9PHR1;E9PF48;E7ENC2;Q5JY21;C9JNW6;Q86UR5|.	.;.;.;.;.;.;RIMS1_HUMAN|.	R|G	1151;1177;1151;1120;1177;1120;1328;648;493;376;134|246	ENSP00000430101:Q1151R;ENSP00000275037:Q1120R;ENSP00000264839:Q1177R;ENSP00000429959:Q1120R;ENSP00000428417:Q1328R;ENSP00000385649:Q648R;ENSP00000389503:Q493R;ENSP00000359448:Q376R;ENSP00000439730:Q134R|.	ENSP00000264839:Q1177R|.	Q|S	+|+	2|1	0|0	RIMS1|RIMS1	73079949|73079949	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.914000|6.914000	0.75764|0.75764	2.198000|2.198000	0.70561|0.70561	0.533000|0.533000	0.62120|0.62120	CAG|AGT	.	.	none		0.403	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
SMAD9	4093	hgsc.bcm.edu	37	13	37453460	37453460	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr13:37453460C>T	ENST00000399275.2	-	1	506	c.367G>A	c.(367-369)Gaa>Aaa	p.E123K	SMAD9_ENST00000483941.1_5'Flank|SMAD9_ENST00000379826.4_Missense_Mutation_p.E123K|SMAD9_ENST00000350148.5_Missense_Mutation_p.E123K			O15198	SMAD9_HUMAN	SMAD family member 9	123	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		ATGCACACTTCTTTCTGCTTG	0.557																																					p.E123K		Atlas-SNP	.											.	SMAD9	91	.	0			c.G367A						PASS	.						38.0	41.0	40.0					13																	37453460		2202	4300	6502	SO:0001583	missense	4093	exon2			ACACTTCTTTCTG		CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.367G>A	13.37:g.37453460C>T	ENSP00000382216:p.Glu123Lys	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	52	6	0.115385	NM_005905	A2A2Y6|O14989|Q5TBA1	Missense_Mutation	SNP	ENST00000399275.2	37	CCDS45032.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715825	0.89112	.	.	ENSG00000120693	ENST00000399275;ENST00000350148;ENST00000379826	T;T;T	0.77098	-1.07;-1.07;-1.07	5.47	5.47	0.80525	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.092522	0.64402	D	0.000001	D	0.87481	0.6188	M	0.85859	2.78	0.80722	D	1	B;D	0.53745	0.408;0.962	B;P	0.56216	0.138;0.794	D	0.89288	0.3617	10	0.72032	D	0.01	.	18.3033	0.90171	0.0:1.0:0.0:0.0	.	123;123	O15198-2;O15198	.;SMAD9_HUMAN	K	123	ENSP00000382216:E123K;ENSP00000239885:E123K;ENSP00000369154:E123K	ENSP00000239885:E123K	E	-	1	0	SMAD9	36351460	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	7.762000	0.85270	2.565000	0.86533	0.514000	0.50259	GAA	.	.	none		0.557	SMAD9-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044525.2	NM_005905	
KCNN4	3783	hgsc.bcm.edu	37	19	44278489	44278489	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr19:44278489G>C	ENST00000262888.3	-	3	933	c.538C>G	c.(538-540)Cgc>Ggc	p.R180G		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	180					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	CCGATGCTGCGGTAGGAAGCG	0.662											OREG0025535	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R180G		Atlas-SNP	.											.	KCNN4	37	.	0			c.C538G						PASS	.						27.0	25.0	26.0					19																	44278489		2196	4300	6496	SO:0001583	missense	3783	exon3			TGCTGCGGTAGGA	AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.538C>G	19.37:g.44278489G>C	ENSP00000262888:p.Arg180Gly	Somatic	119	0	0	922	WXS	Illumina HiSeq	Phase_I	98	11	0.112245	NM_002250	Q53XR4	Missense_Mutation	SNP	ENST00000262888.3	37	CCDS12630.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628785	0.67015	.	.	ENSG00000104783	ENST00000262888;ENST00000407385	D	0.99896	-7.6	4.38	3.33	0.38152	.	0.053759	0.64402	D	0.000002	D	0.99789	0.9911	M	0.74467	2.265	0.50039	D	0.999843	D;D	0.89917	0.98;1.0	P;D	0.87578	0.67;0.998	D	0.98041	1.0382	10	0.87932	D	0	-21.927	5.9886	0.19448	0.1001:0.0:0.7138:0.1861	.	74;180	D1MQ10;O15554	.;KCNN4_HUMAN	G	180;48	ENSP00000262888:R180G	ENSP00000262888:R180G	R	-	1	0	KCNN4	48970329	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.516000	0.45520	0.972000	0.38314	-0.300000	0.09419	CGC	.	.	none		0.662	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463598.1	NM_002250	
IRF4	3662	hgsc.bcm.edu	37	6	394899	394899	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr6:394899T>C	ENST00000380956.4	+	3	421	c.295T>C	c.(295-297)Tgc>Cgc	p.C99R	IRF4_ENST00000495137.1_3'UTR	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	99					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		GCGCCTGCGGTGCGCTTTGAA	0.542			T	IGH@	MM																																p.C99R		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	IRF4_ENST00000380956,NS,carcinoma,-1,1	IRF4	65	1	0			c.T295C						PASS	.						89.0	94.0	92.0					6																	394899		2203	4300	6503	SO:0001583	missense	3662	exon3			CTGCGGTGCGCTT	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.295T>C	6.37:g.394899T>C	ENSP00000370343:p.Cys99Arg	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	46	8	0.173913	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.011366	0.54468	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.99418	-5.87	5.81	5.81	0.92471	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.99664	0.9875	M	0.94063	3.49	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.97583	1.0112	10	0.87932	D	0	-17.4096	16.1535	0.81640	0.0:0.0:0.0:1.0	.	99;99;99	F2Z3D5;Q15306-2;Q15306	.;.;IRF4_HUMAN	R	99;129	ENSP00000370343:C99R	ENSP00000370343:C99R	C	+	1	0	IRF4	339899	1.000000	0.71417	0.108000	0.21378	0.035000	0.12851	7.586000	0.82596	2.217000	0.71921	0.528000	0.53228	TGC	.	.	none		0.542	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
PRAMEF2	65122	hgsc.bcm.edu	37	1	12921137	12921137	+	Missense_Mutation	SNP	T	T	A	rs17039283	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:12921137T>A	ENST00000240189.2	+	4	1015	c.928T>A	c.(928-930)Ttg>Atg	p.L310M		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	310			L -> M (in dbSNP:rs17039283).		negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGAAGAGGACTTGAAGTGTCT	0.493																																					p.L310M		Atlas-SNP	.											PRAMEF2,NS,carcinoma,0,1	PRAMEF2	85	1	0			c.T928A						scavenged	.						132.0	134.0	133.0					1																	12921137		2202	4297	6499	SO:0001583	missense	65122	exon4			GAGGACTTGAAGT		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.928T>A	1.37:g.12921137T>A	ENSP00000240189:p.Leu310Met	Somatic	118	2	0.0169492		WXS	Illumina HiSeq	Phase_I	87	4	0.045977	NM_023014		Missense_Mutation	SNP	ENST00000240189.2	37	CCDS149.1	.	.	.	.	.	.	.	.	.	.	G	2.970	-0.212708	0.06140	.	.	ENSG00000120952	ENST00000240189	T	0.01076	5.37	0.824	-1.65	0.08291	.	0.471727	0.17963	N	0.156117	T	0.00936	0.0031	N	0.25825	0.765	0.09310	N	1	B	0.06786	0.001	B	0.21360	0.034	T	0.44742	-0.9308	10	0.38643	T	0.18	.	5.2047	0.15285	0.0:0.0:0.2907:0.7093	rs17039283	310	O60811	PRAM2_HUMAN	M	310	ENSP00000240189:L310M	ENSP00000240189:L310M	L	+	1	2	PRAMEF2	12843724	0.011000	0.17503	0.001000	0.08648	0.011000	0.07611	-0.072000	0.11486	-1.430000	0.01985	-1.205000	0.01647	TTG	T|1.000;|0.000	.	weak		0.493	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
KCTD3	51133	hgsc.bcm.edu	37	1	215751396	215751396	+	Silent	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:215751396C>T	ENST00000259154.4	+	6	663	c.369C>T	c.(367-369)gtC>gtT	p.V123V		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	123					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		GTGGCAGTGTCCTTTTTCATG	0.348																																					p.V123V		Atlas-SNP	.											.	KCTD3	101	.	0			c.C369T						PASS	.						187.0	180.0	182.0					1																	215751396		2203	4300	6503	SO:0001819	synonymous_variant	51133	exon6			CAGTGTCCTTTTT	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.369C>T	1.37:g.215751396C>T		Somatic	297	0	0		WXS	Illumina HiSeq	Phase_I	184	23	0.125	NM_016121	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Silent	SNP	ENST00000259154.4	37	CCDS1515.1	.	.	.	.	.	.	.	.	.	.	C	9.424	1.083728	0.20309	.	.	ENSG00000136636	ENST00000448333	.	.	.	5.8	0.154	0.14901	.	.	.	.	.	T	0.60818	0.2298	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57596	-0.7784	4	.	.	.	-26.6937	12.4313	0.55575	0.0:0.4808:0.4559:0.0632	.	.	.	.	S	96	.	.	P	+	1	0	KCTD3	213818019	0.883000	0.30277	0.984000	0.44739	0.988000	0.76386	-0.075000	0.11431	0.050000	0.15949	-0.479000	0.04858	CCT	.	.	none		0.348	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
RNF145	153830	hgsc.bcm.edu	37	5	158630642	158630642	+	5'UTR	SNP	T	T	C	rs74770414|rs202186112		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr5:158630642T>C	ENST00000424310.2	-	0	343				RNF145_ENST00000521606.2_Missense_Mutation_p.K12R|RNF145_ENST00000274542.2_Missense_Mutation_p.K23R|RNF145_ENST00000518802.1_Missense_Mutation_p.K25R|RNF145_ENST00000519865.1_5'UTR|RNF145_ENST00000520638.1_Missense_Mutation_p.K9R	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tttttttttcttttttttttt	0.363																																					p.K25R		Atlas-SNP	.											RNF145,NS,carcinoma,0,2	RNF145	110	2	0			c.A74G						scavenged	.						31.0	34.0	33.0					5																	158630642		2202	4300	6502	SO:0001623	5_prime_UTR_variant	153830	exon2			TTTTTCTTTTTTT	BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.-17A>G	5.37:g.158630642T>C		Somatic	63	1	0.015873		WXS	Illumina HiSeq	Phase_I	40	3	0.075	NM_001199380	B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	ENST00000424310.2	37	CCDS56390.1	.	.	.	.	.	.	.	.	.	.	T	0.109	-1.141491	0.01728	.	.	ENSG00000145860	ENST00000274542;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000520638	T;T;T;T;T	0.77229	-1.07;-1.06;-1.05;-1.08;-1.05	2.19	-4.37	0.03633	.	6.604780	0.00166	N	0.000010	T	0.49508	0.1561	N	0.08118	0	0.09310	N	0.999998	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.56282	-0.8005	10	0.02654	T	1	.	0.9232	0.01319	0.1799:0.1427:0.3534:0.324	.	11;12;9;25;23	E7EW26;B7Z949;B7Z903;E7EVI7;Q96MT1-2	.;.;.;.;.	R	23;11;12;25;9	ENSP00000274542:K23R;ENSP00000430753:K11R;ENSP00000445115:K12R;ENSP00000430955:K25R;ENSP00000429071:K9R	ENSP00000274542:K23R	K	-	2	0	RNF145	158563220	0.009000	0.17119	0.000000	0.03702	0.001000	0.01503	1.862000	0.39448	-2.940000	0.00297	-1.381000	0.01174	AAG	.	.	weak		0.363	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
FAT1	2195	hgsc.bcm.edu	37	4	187539303	187539303	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr4:187539303G>T	ENST00000441802.2	-	10	8646	c.8437C>A	c.(8437-8439)Cca>Aca	p.P2813T		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2813	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GCCTCATATGGACTAGATTCA	0.463										HNSCC(5;0.00058)																											p.P2813T	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.C8437A						PASS	.						125.0	120.0	122.0					4																	187539303		1879	4121	6000	SO:0001583	missense	2195	exon10			CATATGGACTAGA	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8437C>A	4.37:g.187539303G>T	ENSP00000406229:p.Pro2813Thr	Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	103	14	0.135922	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897051	0.33535	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.37411	1.2	5.0	5.0	0.66597	Cadherin (2);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.42653	0.1212	N	0.16862	0.45	0.80722	D	1	D	0.76494	0.999	D	0.69142	0.962	T	0.16512	-1.0400	10	0.17832	T	0.49	.	18.8402	0.92180	0.0:0.0:1.0:0.0	.	2813	Q14517	FAT1_HUMAN	T	2813;2815	ENSP00000406229:P2813T	ENSP00000260147:P2815T	P	-	1	0	FAT1	187776297	1.000000	0.71417	0.268000	0.24571	0.914000	0.54420	7.674000	0.83992	2.757000	0.94681	0.655000	0.94253	CCA	.	.	none		0.463	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
GPC1	2817	hgsc.bcm.edu	37	2	241401695	241401695	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr2:241401695C>T	ENST00000264039.2	+	3	661	c.413C>T	c.(412-414)gCg>gTg	p.A138V		NM_002081.2	NP_002072.2	P35052	GPC1_HUMAN	glypican 1	138					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|myelin assembly (GO:0032288)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|phototransduction, visible light (GO:0007603)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|retinoid metabolic process (GO:0001523)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|laminin binding (GO:0043236)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	9		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		ACGCAGAACGCGAGGGCCTTC	0.672																																					p.A138V		Atlas-SNP	.											.	GPC1	32	.	0			c.C413T						PASS	.						21.0	23.0	22.0					2																	241401695		2190	4296	6486	SO:0001583	missense	2817	exon3			AGAACGCGAGGGC	AK095397	CCDS2534.1	2q35-q37	2008-02-05			ENSG00000063660	ENSG00000063660		"""Proteoglycans / Cell Surface : Glypicans"""	4449	protein-coding gene	gene with protein product	"""glypican proteoglycan 1"""	600395				7774946	Standard	NM_002081		Approved	glypican	uc002vyw.4	P35052	OTTHUMG00000133349	ENST00000264039.2:c.413C>T	2.37:g.241401695C>T	ENSP00000264039:p.Ala138Val	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	111	11	0.0990991	NM_002081	B3KTD1|Q53QM4	Missense_Mutation	SNP	ENST00000264039.2	37	CCDS2534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	12.09|12.09	1.832212|1.832212	0.32421|0.32421	.|.	.|.	ENSG00000063660|ENSG00000063660	ENST00000264039;ENST00000426280|ENST00000427506;ENST00000425056	T;T|.	0.52057|.	0.68;0.68|.	3.1|3.1	1.2|1.2	0.21068|0.21068	.|.	1.004560|.	0.08007|.	N|.	0.989674|.	T|.	0.36331|.	0.0963|.	L|L	0.53617|0.53617	1.68|1.68	0.09310|0.09310	N|N	1|1	B|.	0.30193|.	0.272|.	B|.	0.39617|.	0.305|.	T|.	0.31641|.	-0.9936|.	10|.	0.52906|.	T|.	0.07|.	-13.7881|-13.7881	1.889|1.889	0.03243|0.03243	0.2067:0.4686:0.2019:0.1227|0.2067:0.4686:0.2019:0.1227	.|.	138|.	P35052|.	GPC1_HUMAN|.	V|X	138;88|95;134	ENSP00000264039:A138V;ENSP00000410251:A88V|.	ENSP00000264039:A138V|.	A|R	+|+	2|1	0|2	GPC1|GPC1	241050368|241050368	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.583000|0.583000	0.36354|0.36354	-0.002000|-0.002000	0.12924|0.12924	0.161000|0.161000	0.19458|0.19458	0.586000|0.586000	0.80456|0.80456	GCG|CGA	.	.	none		0.672	GPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257179.3	NM_002081	
XRCC2	7516	hgsc.bcm.edu	37	7	152346254	152346254	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr7:152346254C>A	ENST00000359321.1	-	3	401	c.316G>T	c.(316-318)Gaa>Taa	p.E106*	XRCC2_ENST00000495707.1_5'UTR	NM_005431.1	NP_005422.1	O43543	XRCC2_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 2	106					centrosome organization (GO:0051297)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of neurogenesis (GO:0050769)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|strand invasion (GO:0042148)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			NS(1)|breast(1)|large_intestine(5)|liver(1)|lung(1)|prostate(2)	11		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)		TTGATTATTTCTTCAGAGCTT	0.378								Homologous recombination																													p.E106X		Atlas-SNP	.											.	XRCC2	30	.	0			c.G316T						PASS	.						81.0	83.0	82.0					7																	152346254		2203	4300	6503	SO:0001587	stop_gained	7516	exon3			TTATTTCTTCAGA	Y08837	CCDS5933.1	7q36	2006-05-04			ENSG00000196584	ENSG00000196584			12829	protein-coding gene	gene with protein product	"""RAD51-like"""	600375				7607692, 10422536	Standard	NM_005431		Approved		uc003wld.3	O43543	OTTHUMG00000151470	ENST00000359321.1:c.316G>T	7.37:g.152346254C>A	ENSP00000352271:p.Glu106*	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	35	5	0.142857	NM_005431	B2R925	Nonsense_Mutation	SNP	ENST00000359321.1	37	CCDS5933.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.911472	0.52439	.	.	ENSG00000196584	ENST00000359321	.	.	.	5.11	5.11	0.69529	.	0.363029	0.29522	N	0.011904	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-13.1414	17.5401	0.87845	0.0:1.0:0.0:0.0	.	.	.	.	X	106	.	ENSP00000352271:E106X	E	-	1	0	XRCC2	151977187	1.000000	0.71417	0.763000	0.31416	0.118000	0.20060	4.693000	0.61753	2.367000	0.80283	0.591000	0.81541	GAA	.	.	none		0.378	XRCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322783.1	NM_005431	
NOTCH2NL	388677	hgsc.bcm.edu	37	1	145248876	145248876	+	Missense_Mutation	SNP	A	A	G	rs200866084		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:145248876A>G	ENST00000369340.3	+	3	464	c.20A>G	c.(19-21)aAt>aGt	p.N7S	RP11-458D21.5_ENST00000468030.1_Missense_Mutation_p.N7S|NOTCH2NL_ENST00000344859.3_Missense_Mutation_p.N7S|NOTCH2NL_ENST00000362074.6_Missense_Mutation_p.N7S			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like	7	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.N7S(2)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						ACCTACCACAATGGCACAGGA	0.348																																					p.N7S		Atlas-SNP	.											NOTCH2NL_ENST00000362074,colon,carcinoma,0,2	NOTCH2NL	100	2	2	Substitution - Missense(2)	large_intestine(2)	c.A20G						scavenged	.						11.0	10.0	10.0					1																	145248876		2011	4104	6115	SO:0001583	missense	388677	exon2			ACCACAATGGCAC		CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000369340.3:c.20A>G	1.37:g.145248876A>G	ENSP00000358346:p.Asn7Ser	Somatic	2916	491	0.168381		WXS	Illumina HiSeq	Phase_I	2062	334	0.161979	NM_203458	Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	Missense_Mutation	SNP	ENST00000369340.3	37	CCDS909.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.596096	0.46318	.	.	ENSG00000213240	ENST00000362074;ENST00000344859;ENST00000369340	T;T;T	0.63255	-0.03;-0.03;-0.03	3.15	3.15	0.36227	Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.47432	0.1445	L	0.35793	1.09	0.22552	N	0.998997	D;D	0.63880	0.993;0.988	P;P	0.55391	0.775;0.6	T	0.26087	-1.0113	9	0.49607	T	0.09	.	7.9433	0.29971	1.0:0.0:0.0:0.0	.	7;7	Q7Z3S9-2;Q7Z3S9	.;NT2NL_HUMAN	S	7	ENSP00000354929:N7S;ENSP00000344557:N7S;ENSP00000358346:N7S	ENSP00000344557:N7S	N	+	2	0	NOTCH2NL	143960233	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.487000	0.60293	1.439000	0.47511	0.329000	0.21502	AAT	.	.	weak		0.348	NOTCH2NL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038546.1	NM_203458	
HIST1H2BD	3017	hgsc.bcm.edu	37	6	26158776	26158776	+	Nonstop_Mutation	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr6:26158776T>C	ENST00000289316.2	+	1	403	c.379T>C	c.(379-381)Taa>Caa	p.*127Q	HIST1H2BD_ENST00000377777.4_Nonstop_Mutation_p.*127Q	NM_138720.2	NP_619790.1	P58876	H2B1D_HUMAN	histone cluster 1, H2bd	0					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	24						CAGTTCCAAGTAACTTTGCCA	0.512																																					p.X127Q		Atlas-SNP	.											.	HIST1H2BD	45	.	0			c.T379C						PASS	.						61.0	66.0	64.0					6																	26158776		2203	4300	6503	SO:0001578	stop_lost	3017	exon1			TCCAAGTAACTTT	M60751	CCDS4587.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158373	ENSG00000158373		"""Histones / Replication-dependent"""	4747	protein-coding gene	gene with protein product		602799	"""H2B histone family, member B"", ""histone 1, H2bd"""	H2BFB		1916825, 12408966	Standard	NM_021063		Approved	H2B/b	uc003ngr.3	P58876	OTTHUMG00000014426	ENST00000289316.2:c.379T>C	6.37:g.26158776T>C	ENSP00000289316:p.*127Glnext*13	Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	105	14	0.133333	NM_021063		Missense_Mutation	SNP	ENST00000289316.2	37	CCDS4587.1	.	.	.	.	.	.	.	.	.	.	.	8.266	0.812203	0.16537	.	.	ENSG00000158373	ENST00000377777;ENST00000289316	.	.	.	5.1	3.89	0.44902	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.6541	0.17633	0.155:0.0888:0.0:0.7563	.	.	.	.	Q	127	.	.	X	+	1	0	HIST1H2BD	26266755	1.000000	0.71417	0.599000	0.28851	0.305000	0.27757	4.678000	0.61641	0.988000	0.38734	0.529000	0.55759	TAA	.	.	none		0.512	HIST1H2BD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040088.1	NM_021063	
CYP2F1	1572	hgsc.bcm.edu	37	19	41628014	41628014	+	Missense_Mutation	SNP	G	G	C	rs75405062		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr19:41628014G>C	ENST00000331105.2	+	6	870	c.798G>C	c.(796-798)caG>caC	p.Q266H		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	266			Q -> H (in allele CYP2F1*3). {ECO:0000269|PubMed:11827709}.		naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						ACTTCATCCAGTGCTTCCTCA	0.572																																					p.Q266H		Atlas-SNP	.											CYP2F1,NS,carcinoma,+2,1	CYP2F1	60	1	0			c.G798C						scavenged	.	C	HIS/GLN	162,3888		1,160,1864	50.0	48.0	48.0		798	-4.7	0.4	19	dbSNP_132	48	113,8171		0,113,4029	no	missense	CYP2F1	NM_000774.3	24	1,273,5893	CC,CG,GG		1.3641,4.0,2.2296	benign	266/492	41628014	275,12059	2025	4142	6167	SO:0001583	missense	1572	exon6			CATCCAGTGCTTC	J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.798G>C	19.37:g.41628014G>C	ENSP00000333534:p.Gln266His	Somatic	41	11	0.268293		WXS	Illumina HiSeq	Phase_I	34	7	0.205882	NM_000774	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Missense_Mutation	SNP	ENST00000331105.2	37	CCDS12572.1	449	0.20558608058608058	107	0.21747967479674796	82	0.2265193370165746	109	0.19055944055944055	151	0.19920844327176782	N	5.932	0.355925	0.11239	0.04	0.013641	ENSG00000197446	ENST00000331105	T	0.12569	2.67	3.27	-4.65	0.03339	.	0.052380	0.64402	U	0.000001	T	0.00012	0.0000	N	0.02247	-0.625	0.51767	P	6.20000000000065E-5	D;B;B	0.64830	0.994;0.227;0.021	P;B;B	0.59595	0.86;0.017;0.007	T	0.42310	-0.9459	9	0.87932	D	0	.	8.662	0.34099	0.0:0.6997:0.1315:0.1688	.	52;266;266	B4DL83;Q32MN5;P24903	.;.;CP2F1_HUMAN	H	266	ENSP00000333534:Q266H	ENSP00000333534:Q266H	Q	+	3	2	CYP2F1	46319854	0.006000	0.16342	0.412000	0.26496	0.011000	0.07611	0.096000	0.15147	-1.780000	0.01279	-2.252000	0.00282	CAG	G|0.250;C|0.750	0.750	weak		0.572	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394527.2		
NBEA	26960	hgsc.bcm.edu	37	13	35729913	35729913	+	Silent	SNP	C	C	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr13:35729913C>A	ENST00000400445.3	+	19	2982	c.2448C>A	c.(2446-2448)atC>atA	p.I816I	NBEA_ENST00000540320.1_Silent_p.I816I|NBEA_ENST00000310336.4_Silent_p.I816I|NBEA_ENST00000379939.2_Silent_p.I816I	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	816					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTTTTCAGATCTTGACAGAAC	0.323																																					p.I816I		Atlas-SNP	.											.	NBEA	340	.	0			c.C2448A						PASS	.						92.0	86.0	88.0					13																	35729913		1846	4092	5938	SO:0001819	synonymous_variant	26960	exon19			TCAGATCTTGACA	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2448C>A	13.37:g.35729913C>A		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	64	9	0.140625	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	37	CCDS45026.1																																																																																			.	.	none		0.323	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
FBXL6	26233	hgsc.bcm.edu	37	8	145579967	145579967	+	Silent	SNP	T	T	C	rs77157066	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr8:145579967T>C	ENST00000331890.5	-	7	1282	c.1218A>G	c.(1216-1218)ccA>ccG	p.P406P	SLC52A2_ENST00000526752.1_5'Flank|SLC52A2_ENST00000540505.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|FBXL6_ENST00000526524.1_5'UTR|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000532887.1_5'Flank|FBXL6_ENST00000455319.2_Silent_p.P400P|SLC52A2_ENST00000530047.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	406					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GACCCCGACATGGCAGATCCT	0.642																																					p.P406P		Atlas-SNP	.											FBXL6,colon,carcinoma,0,1	FBXL6	26	1	0			c.A1218G						scavenged	.						40.0	40.0	40.0					8																	145579967		2201	4298	6499	SO:0001819	synonymous_variant	26233	exon7			CCGACATGGCAGA	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.1218A>G	8.37:g.145579967T>C		Somatic	50	5	0.1		WXS	Illumina HiSeq	Phase_I	54	6	0.111111	NM_012162	Q53G43|Q9H5W9|Q9UKC7	Silent	SNP	ENST00000331890.5	37	CCDS6422.1																																																																																			T|0.926;C|0.074	0.074	strong		0.642	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	NM_024555	
DCDC1	341019	hgsc.bcm.edu	37	11	31329373	31329373	+	Missense_Mutation	SNP	C	C	T	rs2761591	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:31329373C>T	ENST00000452803.1	-	4	448	c.247G>A	c.(247-249)Gtg>Atg	p.V83M	RP1-296L11.1_ENST00000528872.1_RNA|DCDC1_ENST00000597505.1_Missense_Mutation_p.V83M	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	83			V -> M (in dbSNP:rs2761591).		intracellular signal transduction (GO:0035556)			p.V83M(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GCTGAATGCACGAGTCTGTTG	0.423													C|||	552	0.110224	0.329	0.1354	5008	,	,		18700	0.0198		0.002	False		,,,				2504	0.001				p.V83M		Atlas-SNP	.											DCDC1,NS,carcinoma,0,1	DCDC1	74	1	1	Substitution - Missense(1)	stomach(1)	c.G247A						PASS	.	C	MET/VAL	1322,3082	444.1+/-347.2	194,934,1074	250.0	233.0	239.0		247	0.9	1.0	11	dbSNP_100	239	31,8567	20.4+/-63.3	1,29,4269	yes	missense	DCDC1	NM_181807.3	21	195,963,5343	TT,TC,CC		0.3605,30.0182,10.4061	benign	83/355	31329373	1353,11649	2202	4299	6501	SO:0001583	missense	341019	exon4			AATGCACGAGTCT	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.247G>A	11.37:g.31329373C>T	ENSP00000389792:p.Val83Met	Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	84	5	0.0595238	NM_181807	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000452803.1	37	CCDS7872.1	193	0.08836996336996338	140	0.2845528455284553	44	0.12154696132596685	9	0.015734265734265736	0	0.0	C	12.62	1.991495	0.35131	0.300182	0.003605	ENSG00000188682	ENST00000452803	T	0.34667	1.35	5.9	0.907	0.19321	.	0.629315	0.13069	N	0.416247	T	0.00012	0.0000	N	0.14661	0.345	0.53688	P	2.1000000000048757E-5	P	0.47409	0.895	B	0.34652	0.187	T	0.40421	-0.9564	9	0.52906	T	0.07	.	4.4324	0.11535	0.4048:0.3536:0.2416:0.0	rs2761591;rs52799655;rs2761591	83	P59894	DCDC1_HUMAN	M	83	ENSP00000389792:V83M	ENSP00000343496:V83M	V	-	1	0	DCDC1	31285949	0.106000	0.21978	0.965000	0.40720	0.595000	0.36748	0.436000	0.21526	0.150000	0.19136	-0.271000	0.10264	GTG	C|0.894;T|0.106	0.106	strong		0.423	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1	NM_181807	
OR1S2	219958	hgsc.bcm.edu	37	11	57971203	57971203	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:57971203C>G	ENST00000302592.6	-	1	450	c.451G>C	c.(451-453)Gcc>Ccc	p.A151P		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				CCGAACCTGGCCCGCATGAAA	0.473																																					p.A151P		Atlas-SNP	.											OR1S2,NS,carcinoma,0,3	OR1S2	119	3	0			c.G451C						scavenged	.						163.0	154.0	157.0					11																	57971203		2201	4296	6497	SO:0001583	missense	219958	exon1			ACCTGGCCCGCAT	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.451G>C	11.37:g.57971203C>G	ENSP00000305469:p.Ala151Pro	Somatic	195	1	0.00512821		WXS	Illumina HiSeq	Phase_I	140	8	0.0571429	NM_001004459	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.753352	0.00085	.	.	ENSG00000197887	ENST00000302592	T	0.34275	1.37	4.47	-1.08	0.09936	GPCR, rhodopsin-like superfamily (1);	0.857144	0.09920	N	0.738596	T	0.04770	0.0129	N	0.00089	-2.185	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30149	-0.9988	10	0.02654	T	1	.	0.1523	0.00094	0.2967:0.2321:0.2346:0.2366	.	151	Q8NGQ3	OR1S2_HUMAN	P	151	ENSP00000305469:A151P	ENSP00000305469:A151P	A	-	1	0	OR1S2	57727779	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.298000	0.02756	-0.572000	0.06006	-0.120000	0.15030	GCC	.	.	none		0.473	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
PTBP1	5725	hgsc.bcm.edu	37	19	804886	804886	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr19:804886T>C	ENST00000349038.4	+	7	737	c.664T>C	c.(664-666)Ttc>Ctc	p.F222L	PTBP1_ENST00000356948.6_Missense_Mutation_p.F222L|PTBP1_ENST00000350092.4_Intron|MIR4745_ENST00000577608.1_RNA|PTBP1_ENST00000394601.4_Missense_Mutation_p.F222L	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	222	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAACAACCAGTTCCAGGCCCT	0.662																																					p.F222L		Atlas-SNP	.											PTBP1,larynx,carcinoma,-2,1	PTBP1	43	1	0			c.T664C						scavenged	.						100.0	90.0	94.0					19																	804886		2203	4300	6503	SO:0001583	missense	5725	exon7			AACCAGTTCCAGG	X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.664T>C	19.37:g.804886T>C	ENSP00000014112:p.Phe222Leu	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	63	3	0.047619	NM_031990	Q9BUQ0	Missense_Mutation	SNP	ENST00000349038.4	37	CCDS32859.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.851512	0.91355	.	.	ENSG00000011304	ENST00000356948;ENST00000394601;ENST00000349038	T;T;T	0.50548	0.74;0.77;1.06	5.09	5.09	0.68999	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.207707	0.51477	D	0.000096	T	0.63838	0.2545	L	0.53561	1.675	0.80722	D	1	D;D;P	0.89917	1.0;0.964;0.923	D;P;P	0.83275	0.996;0.884;0.856	T	0.67241	-0.5720	10	0.87932	D	0	-30.2985	14.045	0.64700	0.0:0.0:0.0:1.0	.	222;222;222	P26599;P26599-2;Q9BUQ0	PTBP1_HUMAN;.;.	L	222	ENSP00000349428:F222L;ENSP00000408096:F222L;ENSP00000014112:F222L	ENSP00000014112:F222L	F	+	1	0	PTBP1	755886	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	7.904000	0.87408	1.915000	0.55452	0.460000	0.39030	TTC	.	.	none		0.662	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457605.1		
AGGF1	55109	hgsc.bcm.edu	37	5	76332530	76332530	+	Silent	SNP	T	T	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr5:76332530T>G	ENST00000312916.7	+	4	1048	c.666T>G	c.(664-666)ggT>ggG	p.G222G		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	222					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		ACAGCACTGGTTTCTATTATG	0.423																																					p.G222G		Atlas-SNP	.											AGGF1,NS,carcinoma,+2,1	AGGF1	71	1	0			c.T666G						scavenged	.						48.0	49.0	49.0					5																	76332530		2203	4300	6503	SO:0001819	synonymous_variant	55109	exon4			CACTGGTTTCTAT	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.666T>G	5.37:g.76332530T>G		Somatic	158	1	0.00632911		WXS	Illumina HiSeq	Phase_I	107	2	0.0186916	NM_018046	O00581|Q53YS3|Q9BU84|Q9NW66	Silent	SNP	ENST00000312916.7	37	CCDS4035.1																																																																																			.	.	none		0.423	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	NM_018046	
FRG1	2483	hgsc.bcm.edu	37	4	190873379	190873379	+	Missense_Mutation	SNP	A	A	G	rs112612436		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr4:190873379A>G	ENST00000226798.4	+	3	418	c.196A>G	c.(196-198)Aag>Gag	p.K66E	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	66			K -> E (in dbSNP:rs17406826).		mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K66E(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGAAATGGATAAGGGAACCTA	0.383																																					p.K66E		Atlas-SNP	.											FRG1,arm,malignant_melanoma,0,1	FRG1	76	1	1	Substitution - Missense(1)	skin(1)	c.A196G						scavenged	.						101.0	115.0	110.0					4																	190873379		2203	4298	6501	SO:0001583	missense	2483	exon3			ATGGATAAGGGAA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.196A>G	4.37:g.190873379A>G	ENSP00000226798:p.Lys66Glu	Somatic	133	12	0.0902256		WXS	Illumina HiSeq	Phase_I	80	13	0.1625	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	11.33	1.608104	0.28623	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.44083	2.07;0.93	3.47	2.23	0.28157	Actin cross-linking (1);	0.148940	0.64402	D	0.000013	T	0.29288	0.0729	L	0.52011	1.625	0.42341	D	0.992332	B	0.02656	0.0	B	0.04013	0.001	T	0.10314	-1.0635	10	0.06757	T	0.87	-8.6418	8.2577	0.31766	0.7983:0.2017:0.0:0.0	rs17406826	66	Q14331	FRG1_HUMAN	E	66;3	ENSP00000226798:K66E;ENSP00000435943:K3E	ENSP00000226798:K66E	K	+	1	0	FRG1	191110373	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.931000	0.48932	0.668000	0.31126	0.441000	0.28932	AAG	.	.	weak		0.383	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
ZNF880	400713	hgsc.bcm.edu	37	19	52877609	52877609	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr19:52877609G>A	ENST00000422689.2	+	3	212	c.197G>A	c.(196-198)cGg>cAg	p.R66Q	ZNF880_ENST00000600321.1_Missense_Mutation_p.R66Q|ZNF880_ENST00000344085.5_Missense_Mutation_p.R66Q|ZNF880_ENST00000424032.2_Missense_Mutation_p.R66Q|ZNF880_ENST00000597976.1_Missense_Mutation_p.R66Q	NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						AGAGATCCCCGGAATCTGCAG	0.458																																					p.R66Q		Atlas-SNP	.											.	ZNF880	45	.	0			c.G197A						PASS	.						79.0	71.0	73.0					19																	52877609		692	1591	2283	SO:0001583	missense	400713	exon3			ATCCCCGGAATCT	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.197G>A	19.37:g.52877609G>A	ENSP00000406318:p.Arg66Gln	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	138	13	0.0942029	NM_001145434	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	G	4.337	0.061871	0.08339	.	.	ENSG00000221923	ENST00000424032;ENST00000344085;ENST00000422689	T;T;T	0.06294	5.42;5.46;3.32	1.13	0.00405	0.14057	Krueppel-associated box (2);	.	.	.	.	T	0.03305	0.0096	N	0.12527	0.23	0.09310	N	1	B	0.16603	0.018	B	0.01281	0.0	T	0.42015	-0.9476	9	0.54805	T	0.06	.	3.5828	0.07959	0.2752:0.0:0.7248:0.0	.	66	Q6PDB4	ZN880_HUMAN	Q	66	ENSP00000414470:R66Q;ENSP00000343625:R66Q;ENSP00000406318:R66Q	ENSP00000343625:R66Q	R	+	2	0	ZNF880	57569421	0.002000	0.14202	0.002000	0.10522	0.006000	0.05464	0.073000	0.14640	0.044000	0.15775	0.448000	0.29417	CGG	.	.	none		0.458	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
PTPRQ	374462	hgsc.bcm.edu	37	12	81046571	81046571	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr12:81046571C>G	ENST00000266688.5	+	43	6061	c.6061C>G	c.(6061-6063)Cct>Gct	p.P2021A				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	2058					regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TGCTGATCTGCCTTGGAATAG	0.328																																					p.P1853A		Atlas-SNP	.											.	PTPRQ	119	.	0			c.C5557G						PASS	.						114.0	97.0	103.0					12																	81046571		692	1590	2282	SO:0001583	missense	374462	exon35			GATCTGCCTTGGA	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.6061C>G	12.37:g.81046571C>G	ENSP00000266688:p.Pro2021Ala	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	117	5	0.042735	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.4|26.4	4.737635|4.737635	0.89573|0.89573	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000532722;ENST00000547881|ENST00000266688	.|T	.|0.12465	.|2.68	5.78|5.78	5.78|5.78	0.91487|0.91487	.|Protein-tyrosine phosphatase, receptor/non-receptor type (2);	.|.	.|.	.|.	.|.	T|T	0.39627|0.39627	0.1085|0.1085	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	T|T	0.01748|0.01748	-1.1282|-1.1282	4|8	.|0.37606	.|T	.|0.19	.|.	19.9918|19.9918	0.97368|0.97368	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2058	.|Q9UMZ3	.|PTPRQ_HUMAN	W|A	1721;110|2021	.|ENSP00000266688:P2021A	.|ENSP00000266688:P2021A	C|P	+|+	3|1	2|0	PTPRQ|PTPRQ	79570702|79570702	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	6.826000|6.826000	0.75298|0.75298	2.728000|2.728000	0.93425|0.93425	0.585000|0.585000	0.79938|0.79938	TGC|CCT	.	.	none		0.328	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
MYOM1	8736	hgsc.bcm.edu	37	18	3089200	3089200	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr18:3089200C>A	ENST00000356443.4	-	29	4442	c.4109G>T	c.(4108-4110)gGt>gTt	p.G1370V	MYOM1_ENST00000400569.3_Missense_Mutation_p.G1370V|MYOM1_ENST00000261606.7_Missense_Mutation_p.G1274V	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1370	Ig-like C2-type 4.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						ATTACATTCACCAGTCACTTC	0.308																																					p.G1370V		Atlas-SNP	.											.	MYOM1	192	.	0			c.G4109T						PASS	.						80.0	74.0	76.0					18																	3089200		1820	4083	5903	SO:0001583	missense	8736	exon29			CATTCACCAGTCA	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4109G>T	18.37:g.3089200C>A	ENSP00000348821:p.Gly1370Val	Somatic	492	0	0		WXS	Illumina HiSeq	Phase_I	316	52	0.164557	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.980320	0.34942	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.70399	-0.48;-0.48;-0.48	5.98	4.19	0.49359	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.528555	0.22207	N	0.063145	T	0.48187	0.1486	N	0.08118	0	0.53688	D	0.999972	B;B	0.25235	0.099;0.121	B;B	0.31191	0.076;0.125	T	0.33777	-0.9855	10	0.33141	T	0.24	.	5.6992	0.17873	0.0:0.5235:0.2513:0.2252	.	1274;1370	P52179-2;P52179	.;MYOM1_HUMAN	V	1370;1370;1274	ENSP00000348821:G1370V;ENSP00000383413:G1370V;ENSP00000261606:G1274V	ENSP00000261606:G1274V	G	-	2	0	MYOM1	3079200	0.943000	0.32029	0.999000	0.59377	0.996000	0.88848	1.552000	0.36244	0.851000	0.35264	0.591000	0.81541	GGT	.	.	none		0.308	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
NKTR	4820	hgsc.bcm.edu	37	3	42674280	42674280	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr3:42674280A>C	ENST00000232978.8	+	9	926	c.738A>C	c.(736-738)gaA>gaC	p.E246D	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	246					protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		GCAGTTCAGAAGAGCCAAGGA	0.393																																					p.E246D		Atlas-SNP	.											.	NKTR	116	.	0			c.A738C						PASS	.						91.0	96.0	94.0					3																	42674280		2203	4300	6503	SO:0001583	missense	4820	exon9			TTCAGAAGAGCCA		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.738A>C	3.37:g.42674280A>C	ENSP00000232978:p.Glu246Asp	Somatic	214	0	0		WXS	Illumina HiSeq	Phase_I	127	18	0.141732	NM_005385		Missense_Mutation	SNP	ENST00000232978.8	37	CCDS2702.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.317054	0.81469	.	.	ENSG00000114857	ENST00000232978	T	0.13196	2.61	5.83	-1.96	0.07525	.	0.387908	0.30142	N	0.010302	T	0.22166	0.0534	M	0.63428	1.95	0.80722	D	1	P;D	0.62365	0.935;0.991	B;P	0.53689	0.315;0.732	T	0.03818	-1.1001	10	0.62326	D	0.03	-10.0199	12.9061	0.58154	0.3415:0.0:0.6585:0.0	.	126;246	Q59EC3;P30414	.;NKTR_HUMAN	D	246	ENSP00000232978:E246D	ENSP00000232978:E246D	E	+	3	2	NKTR	42649284	1.000000	0.71417	0.990000	0.47175	0.899000	0.52679	0.525000	0.22956	-0.326000	0.08564	0.533000	0.62120	GAA	.	.	none		0.393	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385	
PCDH15	65217	hgsc.bcm.edu	37	10	55626476	55626476	+	Silent	SNP	T	T	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr10:55626476T>G	ENST00000320301.6	-	27	4037	c.3643A>C	c.(3643-3645)Aga>Cga	p.R1215R	PCDH15_ENST00000395432.2_Silent_p.R1178R|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000373965.2_Silent_p.R1222R|PCDH15_ENST00000395430.1_Silent_p.R1215R|PCDH15_ENST00000395438.1_Silent_p.R1215R|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395445.1_Silent_p.R1222R|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395433.1_Silent_p.R1193R|PCDH15_ENST00000361849.3_Silent_p.R1215R|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000409834.1_Silent_p.R826R|PCDH15_ENST00000414778.1_Silent_p.R1220R|PCDH15_ENST00000437009.1_Silent_p.R1144R	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1215	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AAGTAGGATCTCCTCATATTA	0.403										HNSCC(58;0.16)																											p.R1220R		Atlas-SNP	.											.	PCDH15	1715	.	0			c.A3658C						PASS	.						145.0	127.0	133.0					10																	55626476		2203	4300	6503	SO:0001819	synonymous_variant	65217	exon28			AGGATCTCCTCAT	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3643A>C	10.37:g.55626476T>G		Somatic	214	0	0		WXS	Illumina HiSeq	Phase_I	145	6	0.0413793	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																			.	.	none		0.403	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
GYPB	2994	hgsc.bcm.edu	37	4	145041720	145041720	+	Intron	SNP	A	A	G	rs7682260	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr4:145041720A>G	ENST00000283126.7	-	1	93				GYPA_ENST00000360771.4_Missense_Mutation_p.L20S|GYPA_ENST00000324022.10_Intron|GYPA_ENST00000504786.1_Missense_Mutation_p.L20S|GYPA_ENST00000512064.1_Missense_Mutation_p.L20S|RP11-673E1.4_ENST00000506982.1_RNA|GYPA_ENST00000512789.1_Intron|GYPA_ENST00000503627.1_Missense_Mutation_p.L20S|GYPA_ENST00000535709.1_5'UTR			P06028	GLPB_HUMAN	glycophorin B (MNS blood group)							integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					AGTGGTACTTAATGCTGATAT	0.353													G|||	1428	0.285144	0.1944	0.3545	5008	,	,		12360	0.3125		0.2813	False		,,,				2504	0.3344				p.L20S		Atlas-SNP	.											GYPA,NS,carcinoma,0,1	GYPA	27	1	0			c.T59C						scavenged	.	G	SER/LEU	737,3513		243,251,1631	57.0	30.0	39.0		59	-3.4	0.0	4	dbSNP_116	39	1997,6329		706,585,2872	no	missense	GYPA	NM_002099.6	145	949,836,4503	GG,GA,AA		23.9851,17.3412,21.7398	benign	20/151	145041720	2734,9842	2125	4163	6288	SO:0001627	intron_variant	2993	exon2			GTACTTAATGCTG		CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000283126.7:c.37+20031T>C	4.37:g.145041720A>G		Somatic	192	35	0.182292		WXS	Illumina HiSeq	Phase_I	125	29	0.232	NM_002099	B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Missense_Mutation	SNP	ENST00000283126.7	37		.	.	.	.	.	.	.	.	.	.	G	2.787	-0.252207	0.05829	0.173412	0.239851	ENSG00000170180	ENST00000360771;ENST00000512064;ENST00000504786;ENST00000503627;ENST00000394119	T;T;T;T	0.04809	4.59;4.61;4.54;3.55	1.71	-3.42	0.04825	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	1.0000000000287557E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.46555	-0.9183	7	0.52906	T	0.07	.	0.8306	0.01129	0.3297:0.3169:0.194:0.1595	rs7682260;rs17845377;rs17858231	20;20;20	E9PD10;E7EQF3;Q16336	.;.;.	S	20	ENSP00000354003:L20S;ENSP00000426130:L20S;ENSP00000425549:L20S;ENSP00000421243:L20S	ENSP00000354003:L20S	L	-	2	0	GYPA	145261170	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.801000	0.04550	-2.458000	0.00538	-2.395000	0.00226	TTA	A|0.519;G|0.481	0.481	strong		0.353	GYPB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_002100	
CTNNA3	29119	hgsc.bcm.edu	37	10	67829199	67829199	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr10:67829199G>T	ENST00000433211.2	-	15	2200	c.2026C>A	c.(2026-2028)Caa>Aaa	p.Q676K	CTNNA3_ENST00000373735.1_5'UTR|CTNNA3_ENST00000373744.4_Missense_Mutation_p.Q676K	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TCAGCAACTTGCTCAGCAATC	0.378																																					p.Q676K		Atlas-SNP	.											.	CTNNA3	401	.	0			c.C2026A						PASS	.						207.0	178.0	188.0					10																	67829199		2203	4300	6503	SO:0001583	missense	29119	exon15			CAACTTGCTCAGC	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2026C>A	10.37:g.67829199G>T	ENSP00000389714:p.Gln676Lys	Somatic	260	0	0		WXS	Illumina HiSeq	Phase_I	150	16	0.106667	NM_013266		Missense_Mutation	SNP	ENST00000433211.2	37	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815033	0.90790	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000373735	T;T;T	0.39787	1.06;1.06;1.06	5.29	5.29	0.74685	.	0.000000	0.49916	D	0.000129	T	0.69223	0.3087	M	0.88105	2.93	0.80722	D	1	D	0.53885	0.963	D	0.71414	0.973	T	0.71494	-0.4576	10	0.37606	T	0.19	-13.4866	16.4194	0.83753	0.0:0.0:1.0:0.0	.	676	Q9UI47	CTNA3_HUMAN	K	676;676;15	ENSP00000389714:Q676K;ENSP00000362849:Q676K;ENSP00000362840:Q15K	ENSP00000362840:Q15K	Q	-	1	0	CTNNA3	67499205	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.492000	0.97957	2.483000	0.83821	0.591000	0.81541	CAA	.	.	none		0.378	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
VEZF1	7716	hgsc.bcm.edu	37	17	56056604	56056604	+	Silent	SNP	T	T	C	rs57786397|rs138088904|rs369163670	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr17:56056604T>C	ENST00000581208.1	-	5	1087	c.1047A>G	c.(1045-1047)caA>caG	p.Q349Q	VEZF1_ENST00000584396.1_Silent_p.Q340Q	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	349	Poly-Gln.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gttgttgttgttgctgctgct	0.468													-|||	285	0.0569089	0.0938	0.036	5008	,	,		16688	0.0099		0.0656	False		,,,				2504	0.0613				p.Q349Q		Atlas-SNP	.											VEZF1,colon,carcinoma,0,2	VEZF1	50	2	0			c.A1047G						scavenged	.	-		1,4405		0,1,2202	161.0	149.0	153.0		1047		0.4	17	dbSNP_134	153	2,8598		0,2,4298	no	coding-synonymous	VEZF1	NM_007146.2		0,3,6500	CC,CT,TT		0.0233,0.0227,0.0231		349/522	56056604	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	7716	exon5			TTGTTGTTGCTGC	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1047A>G	17.37:g.56056604T>C		Somatic	158	2	0.0126582		WXS	Illumina HiSeq	Phase_I	111	13	0.117117	NM_007146		Silent	SNP	ENST00000581208.1	37	CCDS32687.1																																																																																			T|0.999;C|0.001	0.001	strong		0.468	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
FBXL6	26233	hgsc.bcm.edu	37	8	145579964	145579964	+	Silent	SNP	A	A	G	rs75159950	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr8:145579964A>G	ENST00000331890.5	-	7	1285	c.1221T>C	c.(1219-1221)tgT>tgC	p.C407C	SLC52A2_ENST00000526752.1_5'Flank|SLC52A2_ENST00000540505.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|FBXL6_ENST00000526524.1_5'UTR|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000532887.1_5'Flank|FBXL6_ENST00000455319.2_Silent_p.C401C|SLC52A2_ENST00000530047.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	407					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GCTGACCCCGACATGGCAGAT	0.642																																					p.C407C		Atlas-SNP	.											FBXL6,colon,carcinoma,0,1	FBXL6	26	1	0			c.T1221C						scavenged	.																																			SO:0001819	synonymous_variant	26233	exon7			ACCCCGACATGGC	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.1221T>C	8.37:g.145579964A>G		Somatic	51	5	0.0980392		WXS	Illumina HiSeq	Phase_I	52	6	0.115385	NM_012162	Q53G43|Q9H5W9|Q9UKC7	Silent	SNP	ENST00000331890.5	37	CCDS6422.1																																																																																			A|0.928;G|0.072	0.072	strong		0.642	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	NM_024555	
DLX4	1748	hgsc.bcm.edu	37	17	48051195	48051195	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr17:48051195T>C	ENST00000240306.3	+	3	906	c.611T>C	c.(610-612)cTc>cCc	p.L204P	DLX4_ENST00000411890.2_Missense_Mutation_p.L132P	NM_138281.2	NP_612138.1	Q92988	DLX4_HUMAN	distal-less homeobox 4	204					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(3)	10						CTCCCCTCCCTCTGGGATCTA	0.592																																					p.L204P		Atlas-SNP	.											.	DLX4	25	.	0			c.T611C						PASS	.						57.0	61.0	60.0					17																	48051195		2203	4300	6503	SO:0001583	missense	1748	exon3			CCTCCCTCTGGGA		CCDS11555.1, CCDS45728.1	17q21.33	2011-06-20			ENSG00000108813	ENSG00000108813		"""Homeoboxes / ANTP class : NKL subclass"""	2917	protein-coding gene	gene with protein product		601911		DLX7, DLX9			Standard	NM_138281		Approved	DLX8, BP1	uc002ipv.3	Q92988	OTTHUMG00000161839	ENST00000240306.3:c.611T>C	17.37:g.48051195T>C	ENSP00000240306:p.Leu204Pro	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	70	11	0.157143	NM_138281	D3DTX2|D3DTX3|O60480|Q13265|Q6PJK0|Q9HBE0	Missense_Mutation	SNP	ENST00000240306.3	37	CCDS11555.1	.	.	.	.	.	.	.	.	.	.	T	11.42	1.633462	0.29068	.	.	ENSG00000108813	ENST00000240306;ENST00000411890	D;D	0.93189	-2.97;-3.18	5.14	2.91	0.33838	.	.	.	.	.	D	0.94318	0.8174	L	0.60455	1.87	0.32491	N	0.540234	D;B	0.60160	0.987;0.001	P;B	0.62649	0.905;0.0	D	0.92773	0.6234	9	0.54805	T	0.06	-12.0893	8.3009	0.32014	0.0:0.1652:0.0:0.8348	.	132;204	Q92988-2;Q92988	.;DLX4_HUMAN	P	204;132	ENSP00000240306:L204P;ENSP00000410622:L132P	ENSP00000240306:L204P	L	+	2	0	DLX4	45406194	0.443000	0.25641	0.650000	0.29550	0.931000	0.56810	3.111000	0.50360	0.406000	0.25560	-0.411000	0.06167	CTC	.	.	none		0.592	DLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366214.1		
NAA25	80018	hgsc.bcm.edu	37	12	112516526	112516526	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr12:112516526T>C	ENST00000261745.4	-	6	745	c.497A>G	c.(496-498)gAa>gGa	p.E166G		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	166						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						TGAGAGGTTTTCATCCTGTGC	0.373																																					p.E166G		Atlas-SNP	.											.	NAA25	105	.	0			c.A497G						PASS	.						150.0	136.0	141.0					12																	112516526		2203	4300	6503	SO:0001583	missense	80018	exon6			AGGTTTTCATCCT	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.497A>G	12.37:g.112516526T>C	ENSP00000261745:p.Glu166Gly	Somatic	219	0	0		WXS	Illumina HiSeq	Phase_I	153	10	0.0653595	NM_024953	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	ENST00000261745.4	37	CCDS9159.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.7|25.7	4.661054|4.661054	0.88154|0.88154	.|.	.|.	ENSG00000111300|ENSG00000111300	ENST00000261745|ENST00000547133	T|.	0.26223|.	1.75|.	6.05|6.05	6.05|6.05	0.98169|0.98169	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.55609|.	0.1931|.	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.69307|.	0.963;0.963|.	T|.	0.51694|.	-0.8673|.	10|.	0.44086|.	T|.	0.13|.	-17.6823|-17.6823	16.5932|16.5932	0.84781|0.84781	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	166;166|.	A8K8X0;Q14CX7|.	.;NAA25_HUMAN|.	G|W	166|127	ENSP00000261745:E166G|.	ENSP00000261745:E166G|.	E|X	-|-	2|3	0|0	NAA25|NAA25	111000909|111000909	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.454000|7.454000	0.80714|0.80714	2.320000|2.320000	0.78422|0.78422	0.528000|0.528000	0.53228|0.53228	GAA|TGA	.	.	none		0.373	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953	
LRRC4	64101	hgsc.bcm.edu	37	7	127669744	127669744	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr7:127669744T>C	ENST00000249363.3	-	2	1207	c.950A>G	c.(949-951)gAg>gGg	p.E317G	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	317	LRRCT.				postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		GGGTATATACTCTCGAAGCCA	0.572																																					p.E317G		Atlas-SNP	.											.	LRRC4	72	.	0			c.A950G						PASS	.						44.0	38.0	40.0					7																	127669744		2203	4300	6503	SO:0001583	missense	64101	exon2			ATATACTCTCGAA	AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.950A>G	7.37:g.127669744T>C	ENSP00000249363:p.Glu317Gly	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	110	17	0.154545	NM_022143	A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Missense_Mutation	SNP	ENST00000249363.3	37	CCDS5799.1	.	.	.	.	.	.	.	.	.	.	T	12.70	2.016570	0.35606	.	.	ENSG00000128594	ENST00000249363	T	0.02656	4.21	4.46	4.46	0.54185	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.02767	0.0083	L	0.45137	1.4	0.80722	D	1	P	0.40515	0.719	B	0.29524	0.103	T	0.58567	-0.7614	10	0.39692	T	0.17	.	11.7482	0.51832	0.0:0.0:0.0:1.0	.	317	Q9HBW1	LRRC4_HUMAN	G	317	ENSP00000249363:E317G	ENSP00000249363:E317G	E	-	2	0	LRRC4	127456980	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.854000	0.86942	1.858000	0.53909	0.533000	0.62120	GAG	.	.	none		0.572	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349170.1	NM_022143	
LCP2	3937	hgsc.bcm.edu	37	5	169695446	169695446	+	Silent	SNP	C	C	T	rs2292254	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr5:169695446C>T	ENST00000046794.5	-	8	1179	c.564G>A	c.(562-564)gtG>gtA	p.V188V	LCP2_ENST00000521416.1_5'Flank	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	188					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		TCTGGGGGGGCACAGGAGGCT	0.627											OREG0017023	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2279	0.455072	0.2927	0.4856	5008	,	,		6718	0.6538		0.4245	False		,,,				2504	0.4796				p.V188V		Atlas-SNP	.											LCP2_ENST00000046794,NS,carcinoma,0,2	LCP2	133	2	0			c.G564A						scavenged	.	C		775,2241		158,459,891	2.0	3.0	2.0		564	3.3	0.8	5	dbSNP_100	2	2547,4561		602,1343,1609	no	coding-synonymous	LCP2	NM_005565.3		760,1802,2500	TT,TC,CC		35.8329,25.6963,32.8131		188/534	169695446	3322,6802	1508	3554	5062	SO:0001819	synonymous_variant	3937	exon8			GGGGGGCACAGGA		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.564G>A	5.37:g.169695446C>T		Somatic	8	1	0.125	1879	WXS	Illumina HiSeq	Phase_I	9	7	0.777778	NM_005565	A8KA25|Q53XV4	Silent	SNP	ENST00000046794.5	37	CCDS47339.1																																																																																			C|0.530;T|0.470	0.470	strong		0.627	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	
AGTR2	186	hgsc.bcm.edu	37	X	115304549	115304549	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chrX:115304549G>T	ENST00000371906.4	+	3	1206	c.1016G>T	c.(1015-1017)tGg>tTg	p.W339L		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	339					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	CCAATTACTTGGCTCCAAGGG	0.433																																					p.W339L		Atlas-SNP	.											.	AGTR2	62	.	0			c.G1016T						PASS	.						121.0	112.0	115.0					X																	115304549		2203	4300	6503	SO:0001583	missense	186	exon3			TTACTTGGCTCCA	AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.1016G>T	X.37:g.115304549G>T	ENSP00000360973:p.Trp339Leu	Somatic	334	0	0		WXS	Illumina HiSeq	Phase_I	215	12	0.055814	NM_000686	B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	ENST00000371906.4	37	CCDS14569.1	.	.	.	.	.	.	.	.	.	.	G	3.385	-0.125487	0.06795	.	.	ENSG00000180772	ENST00000371906	T	0.35421	1.31	4.63	3.68	0.42216	.	0.416542	0.24431	N	0.038588	T	0.13841	0.0335	N	0.08118	0	0.27245	N	0.959054	B	0.09022	0.002	B	0.01281	0.0	T	0.22138	-1.0225	10	0.09843	T	0.71	-0.0597	4.2132	0.10521	0.1367:0.237:0.6263:0.0	.	339	P50052	AGTR2_HUMAN	L	339	ENSP00000360973:W339L	ENSP00000360973:W339L	W	+	2	0	AGTR2	115218577	0.999000	0.42202	1.000000	0.80357	0.917000	0.54804	2.382000	0.44345	2.129000	0.65627	0.506000	0.49869	TGG	.	.	none		0.433	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686	
HIST2H2BE	8349	hgsc.bcm.edu	37	1	149857825	149857825	+	Silent	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:149857825G>A	ENST00000369155.2	-	1	407	c.366C>T	c.(364-366)taC>taT	p.Y122Y	BOLA1_ENST00000369153.2_5'Flank|HIST2H2AC_ENST00000331380.2_5'Flank	NM_003528.2	NP_003519.1	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	122					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	14	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			TGGAGCTGGTGTACTTGGTGA	0.657																																					p.Y122Y		Atlas-SNP	.											.	HIST2H2BE	33	.	0			c.C366T						PASS	.						30.0	35.0	33.0					1																	149857825		2202	4299	6501	SO:0001819	synonymous_variant	8349	exon1			GCTGGTGTACTTG	AY131979	CCDS936.1	1q21.2	2011-01-27	2006-10-11	2003-03-07	ENSG00000184678	ENSG00000184678		"""Histones / Replication-dependent"""	4760	protein-coding gene	gene with protein product		601831	"""H2B histone family, member Q"", ""histone 2, H2be"""	H2B, H2BFQ		1469070, 12408966	Standard	NM_003528		Approved	H2B/q, H2B.1	uc001etc.3	Q16778	OTTHUMG00000012095	ENST00000369155.2:c.366C>T	1.37:g.149857825G>A		Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	166	9	0.0542169	NM_003528	A3KMC7|A8K110|Q4KMY1|Q5QNX0|Q9UE88	Silent	SNP	ENST00000369155.2	37	CCDS936.1																																																																																			.	.	none		0.657	HIST2H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033455.1	NM_003528	
PSG1	5669	hgsc.bcm.edu	37	19	43382402	43382402	+	Silent	SNP	G	G	A	rs17423717	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr19:43382402G>A	ENST00000436291.2	-	2	209	c.93C>T	c.(91-93)ccC>ccT	p.P31P	PSG1_ENST00000403380.3_Silent_p.P31P|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000595124.1_Silent_p.P31P|PSG1_ENST00000312439.6_Silent_p.P31P|PSG1_ENST00000595356.1_Silent_p.P31P|PSG1_ENST00000244296.2_Silent_p.P31P	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	31					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				GGGCAGTGGTGGGCAGGTTCC	0.493													.|||	52	0.0103834	0.0212	0.0072	5008	,	,		19198	0.005		0.002	False		,,,				2504	0.0123				p.P31P		Atlas-SNP	.											PSG1_ENST00000312439,NS,carcinoma,-1,4	PSG1	196	4	0			c.C93T						scavenged	.						142.0	154.0	150.0					19																	43382402		2203	4299	6502	SO:0001819	synonymous_variant	5669	exon2			AGTGGTGGGCAGG		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.93C>T	19.37:g.43382402G>A		Somatic	159	2	0.0125786		WXS	Illumina HiSeq	Phase_I	114	7	0.0614035	NM_001184826	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Silent	SNP	ENST00000436291.2	37	CCDS54275.1																																																																																			G|0.996;A|0.004	0.004	strong		0.493	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1		
PIK3C2G	5288	hgsc.bcm.edu	37	12	18491371	18491371	+	Silent	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr12:18491371T>C	ENST00000266497.5	+	8	1322	c.1284T>C	c.(1282-1284)taT>taC	p.Y428Y	PIK3C2G_ENST00000433979.1_Silent_p.Y428Y|PIK3C2G_ENST00000538779.1_Silent_p.Y428Y|PIK3C2G_ENST00000535651.1_Silent_p.Y428Y			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	428					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				AAAACGTGTATAATATTATTG	0.308																																					p.Y428Y		Atlas-SNP	.											.	PIK3C2G	315	.	0			c.T1284C						PASS	.						81.0	83.0	82.0					12																	18491371		1824	4063	5887	SO:0001819	synonymous_variant	5288	exon9			CGTGTATAATATT	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1284T>C	12.37:g.18491371T>C		Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	124	7	0.0564516	NM_004570	A1L3U0	Silent	SNP	ENST00000266497.5	37	CCDS44839.1																																																																																			.	.	none		0.308	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
ABCB5	340273	hgsc.bcm.edu	37	7	20683092	20683092	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr7:20683092A>G	ENST00000404938.2	+	7	1167	c.515A>G	c.(514-516)gAc>gGc	p.D172G		NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	172	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						AGTGACATTGACAAAATCAGT	0.368																																					p.D172G		Atlas-SNP	.											.	ABCB5	357	.	0			c.A515G						PASS	.						224.0	197.0	205.0					7																	20683092		1568	3582	5150	SO:0001583	missense	340273	exon7			ACATTGACAAAAT	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.515A>G	7.37:g.20683092A>G	ENSP00000384881:p.Asp172Gly	Somatic	214	0	0		WXS	Illumina HiSeq	Phase_I	149	17	0.114094	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	A	9.693	1.152310	0.21371	.	.	ENSG00000004846	ENST00000404938	D	0.90261	-2.64	3.85	-0.101	0.13618	.	.	.	.	.	D	0.82472	0.5044	L	0.41492	1.28	0.80722	D	1	B	0.18013	0.025	B	0.23275	0.045	T	0.67480	-0.5660	9	0.25106	T	0.35	.	4.5733	0.12221	0.6388:0.1667:0.1946:0.0	.	172	A7BKA4	.	G	172	ENSP00000384881:D172G	ENSP00000384881:D172G	D	+	2	0	ABCB5	20649617	1.000000	0.71417	0.999000	0.59377	0.371000	0.29859	2.424000	0.44714	-0.012000	0.14223	0.460000	0.39030	GAC	.	.	none		0.368	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
MUC7	4589	hgsc.bcm.edu	37	4	71347060	71347060	+	Missense_Mutation	SNP	A	A	C	rs74904873	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr4:71347060A>C	ENST00000304887.5	+	3	789	c.599A>C	c.(598-600)cAa>cCa	p.Q200P	MUC7_ENST00000413702.1_Missense_Mutation_p.Q200P|MUC7_ENST00000456088.1_Missense_Mutation_p.Q200P	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	200	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.Q200P(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			GCAACTACACAAGCTCCACCA	0.597													A|||	6	0.00119808	0.0015	0.0	5008	,	,		20514	0.002		0.001	False		,,,				2504	0.001				p.Q200P		Atlas-SNP	.											MUC7,pharynx,carcinoma,0,1	MUC7	91	1	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.A599C						scavenged	.						489.0	395.0	427.0					4																	71347060		2203	4300	6503	SO:0001583	missense	4589	exon4			CTACACAAGCTCC	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.599A>C	4.37:g.71347060A>C	ENSP00000302021:p.Gln200Pro	Somatic	218	6	0.0275229		WXS	Illumina HiSeq	Phase_I	136	2	0.0147059	NM_001145007	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.465514	0.01053	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.48522	0.81;0.81;0.81	2.05	1.2	0.21068	.	.	.	.	.	T	0.20129	0.0484	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25433	-1.0132	8	.	.	.	3.0933	9.4049	0.38455	0.2401:0.7599:0.0:0.0	.	200	Q8TAX7	MUC7_HUMAN	P	200	ENSP00000407422:Q200P;ENSP00000400585:Q200P;ENSP00000302021:Q200P	.	Q	+	2	0	MUC7	71381649	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.162000	0.03141	0.022000	0.15160	-0.710000	0.03640	CAA	A|0.500;C|0.500	0.500	strong		0.597	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
MUC4	4585	hgsc.bcm.edu	37	3	195506987	195506987	+	Missense_Mutation	SNP	T	T	C	rs200157887	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr3:195506987T>C	ENST00000463781.3	-	2	11923	c.11464A>G	c.(11464-11466)Acc>Gcc	p.T3822A	MUC4_ENST00000475231.1_Missense_Mutation_p.T3822A|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3822A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGTGTCACCTGTG	0.582													.|||	203	0.0405351	0.0537	0.0476	5008	,	,		9489	0.0188		0.0368	False		,,,				2504	0.044				p.T3822A		Atlas-SNP	.											MUC4_ENST00000463781,extremity,malignant_melanoma,0,2	MUC4	1505	2	2	Substitution - Missense(2)	skin(2)	c.A11464G						scavenged	.																																			SO:0001583	missense	4585	exon2			GGGTGGTGTCACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11464A>G	3.37:g.195506987T>C	ENSP00000417498:p.Thr3822Ala	Somatic	79	4	0.0506329		WXS	Illumina HiSeq	Phase_I	69	4	0.057971	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	t	2.846	-0.239335	0.05944	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31247	1.52;1.5	.	.	.	.	.	.	.	.	T	0.12305	0.0299	N	0.19112	0.55	0.09310	N	1	P	0.37985	0.613	B	0.25140	0.058	T	0.15838	-1.0423	7	.	.	.	.	2.8304	0.05498	3.0E-4:2.0E-4:0.4983:0.5012	.	3694	E7ESK3	.	A	3822	ENSP00000417498:T3822A;ENSP00000420243:T3822A	.	T	-	1	0	MUC4	196991766	0.069000	0.21087	0.113000	0.21522	0.113000	0.19764	1.804000	0.38873	0.056000	0.16144	0.055000	0.15244	ACC	T|0.816;C|0.185	0.185	strong		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274150	39274150	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr17:39274150T>A	ENST00000391413.2	-	1	456	c.418A>T	c.(418-420)Agc>Tgc	p.S140C		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	140	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.S140C(2)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ctggagatgctgcagctgggg	0.672																																					p.S140C		Atlas-SNP	.											KRTAP4-11,NS,carcinoma,0,5	KRTAP4-11	94	5	2	Substitution - Missense(2)	prostate(1)|kidney(1)	c.A418T						scavenged	.						8.0	13.0	12.0					17																	39274150		686	1587	2273	SO:0001583	missense	653240	exon1			AGATGCTGCAGCT	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.418A>T	17.37:g.39274150T>A	ENSP00000375232:p.Ser140Cys	Somatic	81	1	0.0123457		WXS	Illumina HiSeq	Phase_I	56	3	0.0535714	NM_033059	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	6.114	0.389323	0.11581	.	.	ENSG00000212721	ENST00000391413	T	0.00832	5.64	3.95	-4.72	0.03269	.	.	.	.	.	T	0.00178	0.0005	N	0.00010	-3.035	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48139	-0.9061	9	0.02654	T	1	.	4.7994	0.13289	0.3484:0.2238:0.0:0.4278	.	140	Q9BYQ6	KR411_HUMAN	C	140	ENSP00000375232:S140C	ENSP00000375232:S140C	S	-	1	0	KRTAP4-11	36527676	0.000000	0.05858	0.000000	0.03702	0.829000	0.46940	0.038000	0.13862	-0.681000	0.05204	-0.924000	0.02725	AGC	.	.	none		0.672	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
PCSK5	5125	hgsc.bcm.edu	37	9	78923585	78923585	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr9:78923585G>C	ENST00000545128.1	+	28	4086	c.3548G>C	c.(3547-3549)tGt>tCt	p.C1183S		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1183	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						CTCCAGCCTTGTCATTCTTCT	0.428																																					p.C1183S		Atlas-SNP	.											.	PCSK5	329	.	0			c.G3548C						PASS	.						47.0	46.0	46.0					9																	78923585		876	1991	2867	SO:0001583	missense	5125	exon28			AGCCTTGTCATTC		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.3548G>C	9.37:g.78923585G>C	ENSP00000446280:p.Cys1183Ser	Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	105	5	0.047619	NM_001190482	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981331	0.34942	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.68181	0.56;-0.31	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.89996	0.6877	H	0.99475	4.585	0.52501	D	0.999954	.	.	.	.	.	.	D	0.93690	0.7006	8	0.87932	D	0	-12.5672	15.7567	0.78037	0.0:0.0:1.0:0.0	.	.	.	.	S	1183;913;883	ENSP00000446280:C1183S;ENSP00000411654:C883S	ENSP00000365945:C913S	C	+	2	0	PCSK5	78113405	1.000000	0.71417	0.678000	0.29963	0.410000	0.31052	5.660000	0.68018	2.793000	0.96121	0.561000	0.74099	TGT	.	.	none		0.428	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
RANBP2	5903	hgsc.bcm.edu	37	2	109371681	109371681	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr2:109371681T>G	ENST00000283195.6	+	17	2558	c.2432T>G	c.(2431-2433)cTg>cGg	p.L811R		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	811					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.L811R(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AATTCTTTACTGAAAATGATT	0.353																																					p.L811R		Atlas-SNP	.											RANBP2_ENST00000283195,NS,carcinoma,0,2	RANBP2	488	2	2	Substitution - Missense(2)	kidney(2)	c.T2432G						scavenged	.						154.0	172.0	166.0					2																	109371681		2202	4299	6501	SO:0001583	missense	5903	exon17			CTTTACTGAAAAT	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.2432T>G	2.37:g.109371681T>G	ENSP00000283195:p.Leu811Arg	Somatic	840	0	0		WXS	Illumina HiSeq	Phase_I	594	7	0.0117845	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	t	18.76	3.693006	0.68271	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.25579	1.79	5.8	5.8	0.92144	.	.	.	.	.	T	0.42494	0.1205	L	0.36672	1.1	0.35947	D	0.833639	D	0.89917	1.0	D	0.87578	0.998	T	0.50101	-0.8867	9	0.49607	T	0.09	-3.3039	16.1496	0.81605	0.0:0.0:0.0:1.0	.	811	P49792	RBP2_HUMAN	R	811	ENSP00000283195:L811R	ENSP00000283195:L811R	L	+	2	0	RANBP2	108738113	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	6.914000	0.75764	2.210000	0.71456	0.443000	0.29094	CTG	.	.	none		0.353	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
SPEN	23013	hgsc.bcm.edu	37	1	16255388	16255388	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:16255388G>T	ENST00000375759.3	+	11	2857	c.2653G>T	c.(2653-2655)Gag>Tag	p.E885*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	885					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TCGAGTGAAAGAGAAAGAGGG	0.453																																					p.E885X		Atlas-SNP	.											.	SPEN	374	.	0			c.G2653T						PASS	.						104.0	110.0	108.0					1																	16255388		2203	4300	6503	SO:0001587	stop_gained	23013	exon11			GTGAAAGAGAAAG		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2653G>T	1.37:g.16255388G>T	ENSP00000364912:p.Glu885*	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	66	6	0.0909091	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	40	8.364123	0.98779	.	.	ENSG00000065526	ENST00000375759	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-13.6494	18.3094	0.90194	0.0:0.0:1.0:0.0	.	.	.	.	X	885	.	ENSP00000364912:E885X	E	+	1	0	SPEN	16127975	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.792000	0.91856	2.548000	0.85928	0.591000	0.81541	GAG	.	.	none		0.453	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
NPAS3	64067	hgsc.bcm.edu	37	14	34270175	34270175	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr14:34270175G>A	ENST00000356141.4	+	12	2662	c.2662G>A	c.(2662-2664)Gca>Aca	p.A888T	NPAS3_ENST00000551492.1_Missense_Mutation_p.A893T|NPAS3_ENST00000346562.2_Missense_Mutation_p.A856T|NPAS3_ENST00000548645.1_Missense_Mutation_p.A858T|NPAS3_ENST00000357798.5_Missense_Mutation_p.A875T			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	888					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GTTCGGCGGCGCAGTGAGCGC	0.652																																					p.A888T		Atlas-SNP	.											.	NPAS3	266	.	0			c.G2662A						PASS	.						31.0	20.0	24.0					14																	34270175		2201	4289	6490	SO:0001583	missense	64067	exon12			GGCGGCGCAGTGA	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2662G>A	14.37:g.34270175G>A	ENSP00000348460:p.Ala888Thr	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	55	7	0.127273	NM_001164749	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	37	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	G	6.253	0.414758	0.11870	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.08458	3.35;3.22;3.23;3.23;3.22;3.09	5.68	3.85	0.44370	.	0.169134	0.52532	N	0.000071	T	0.06508	0.0167	N	0.19112	0.55	0.80722	D	1	B;B;B;B	0.15719	0.014;0.008;0.014;0.014	B;B;B;B	0.11329	0.006;0.003;0.006;0.006	T	0.23119	-1.0197	10	0.59425	D	0.04	.	11.8985	0.52669	0.1404:0.0:0.8595:0.0	.	858;888;856;875	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	T	862;893;856;858;888;875	ENSP00000448373:A862T;ENSP00000450392:A893T;ENSP00000319610:A856T;ENSP00000448916:A858T;ENSP00000348460:A888T;ENSP00000350446:A875T	ENSP00000319610:A856T	A	+	1	0	NPAS3	33339926	1.000000	0.71417	0.869000	0.34112	0.006000	0.05464	5.397000	0.66302	1.398000	0.46701	-0.300000	0.09419	GCA	.	.	none		0.652	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
RGPD4	285190	hgsc.bcm.edu	37	2	108487901	108487901	+	Silent	SNP	A	A	G	rs372225810	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr2:108487901A>G	ENST00000408999.3	+	20	3518	c.3441A>G	c.(3439-3441)ttA>ttG	p.L1147L	RGPD4_ENST00000354986.4_Silent_p.L1147L	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1147	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TAGAGCGGTTAGCAGCAAAAT	0.448													N|||	2709	0.540935	0.8086	0.402	5008	,	,		8200	0.13		0.5895	False		,,,				2504	0.6513				p.L1147L		Atlas-SNP	.											RGPD4,NS,carcinoma,0,1	RGPD4	112	1	0			c.A3441G						scavenged	.																																			SO:0001819	synonymous_variant	285190	exon20			GCGGTTAGCAGCA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3441A>G	2.37:g.108487901A>G		Somatic	10	1	0.1		WXS	Illumina HiSeq	Phase_I	16	4	0.25	NM_182588	B9A029	Silent	SNP	ENST00000408999.3	37	CCDS46381.1																																																																																			G|1.000;|0.000	1.000	weak		0.448	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
DDIT4L	115265	hgsc.bcm.edu	37	4	101108876	101108876	+	Silent	SNP	T	T	C	rs56763427|rs58706659	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr4:101108876T>C	ENST00000273990.2	-	3	754	c.540A>G	c.(538-540)aaA>aaG	p.K180K	RP11-15B17.1_ENST00000515026.1_RNA|RP11-588P8.1_ENST00000515782.1_RNA	NM_145244.3	NP_660287.1	Q96D03	DDT4L_HUMAN	DNA-damage-inducible transcript 4-like	180					negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)		p.K180fs*5(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(2)	12				OV - Ovarian serous cystadenocarcinoma(123;5.75e-09)		GTGAGTAAAGTTTTTTCTTAA	0.383																																					p.K180K		Atlas-SNP	.											DDIT4L,NS,carcinoma,-1,1	DDIT4L	33	1	1	Deletion - Frameshift(1)	pancreas(1)	c.A540G						scavenged	.						54.0	58.0	57.0					4																	101108876		2200	4294	6494	SO:0001819	synonymous_variant	115265	exon3			GTAAAGTTTTTTC	BC013592	CCDS34036.1	4q23	2008-02-05				ENSG00000145358			30555	protein-coding gene	gene with protein product	"""regulated in development and DNA damage response 2"", "" similar to Smhs1 protein"""	607730				12477932	Standard	NM_145244		Approved	REDD2, Rtp801L	uc003hvq.3	Q96D03		ENST00000273990.2:c.540A>G	4.37:g.101108876T>C		Somatic	354	166	0.468927		WXS	Illumina HiSeq	Phase_I	210	82	0.390476	NM_145244	B2R7C3	Silent	SNP	ENST00000273990.2	37	CCDS34036.1																																																																																			T|0.913;C|0.087	0.087	strong		0.383	DDIT4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363423.1	NM_145244	
SLC5A9	200010	hgsc.bcm.edu	37	1	48688529	48688529	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:48688529G>C	ENST00000438567.2	+	1	173	c.121G>C	c.(121-123)Gtg>Ctg	p.V41L	SLC5A9_ENST00000533824.1_Missense_Mutation_p.V41L|SLC5A9_ENST00000420136.2_Missense_Mutation_p.V34L|SLC5A9_ENST00000236495.5_Missense_Mutation_p.V41L	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	41					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						CATCAGCGTGGTGGTCATCTA	0.587																																					p.V41L		Atlas-SNP	.											.	SLC5A9	82	.	0			c.G121C						PASS	.						147.0	100.0	116.0					1																	48688529		2203	4300	6503	SO:0001583	missense	200010	exon1			AGCGTGGTGGTCA	BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.121G>C	1.37:g.48688529G>C	ENSP00000401730:p.Val41Leu	Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	135	9	0.0666667	NM_001135181	B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Missense_Mutation	SNP	ENST00000438567.2	37	CCDS30709.2	.	.	.	.	.	.	.	.	.	.	G	11.22	1.575087	0.28092	.	.	ENSG00000117834	ENST00000533824;ENST00000438567;ENST00000236495;ENST00000420136	D;D;D;D	0.87412	-2.14;-2.15;-2.25;-1.56	4.83	3.92	0.45320	.	0.132348	0.49916	N	0.000137	T	0.76205	0.3955	N	0.16656	0.425	0.48830	D	0.999719	B;B;B	0.09022	0.002;0.001;0.002	B;B;B	0.08055	0.001;0.003;0.001	T	0.69034	-0.5252	10	0.19590	T	0.45	.	13.2689	0.60150	0.0:0.2305:0.7695:0.0	.	41;41;41	E9PJ08;Q2M3M2;E9PAK4	.;SC5A9_HUMAN;.	L	41;41;41;34	ENSP00000431900:V41L;ENSP00000401730:V41L;ENSP00000236495:V41L;ENSP00000408881:V34L	ENSP00000236495:V41L	V	+	1	0	SLC5A9	48461116	0.971000	0.33674	0.977000	0.42913	0.648000	0.38561	1.581000	0.36558	1.365000	0.46057	0.557000	0.71058	GTG	.	.	none		0.587	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022061.3	XM_117174	
ANKRD30A	91074	hgsc.bcm.edu	37	10	37508026	37508026	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr10:37508026A>T	ENST00000602533.1	+	34	3317	c.3218A>T	c.(3217-3219)gAa>gTa	p.E1073V	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.E1192V|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.E1073V			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1129					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CAGGAAAAGGAAAATAAATAC	0.318																																					p.E1073V		Atlas-SNP	.											.	ANKRD30A	448	.	0			c.A3218T						PASS	.						77.0	77.0	77.0					10																	37508026		1813	4064	5877	SO:0001583	missense	91074	exon34			AAAAGGAAAATAA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3218A>T	10.37:g.37508026A>T	ENSP00000473551:p.Glu1073Val	Somatic	216	0	0		WXS	Illumina HiSeq	Phase_I	160	12	0.075	NM_052997	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	a	9.278	1.047446	0.19827	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.28454	1.61;1.61	2.81	2.81	0.32909	.	.	.	.	.	T	0.52533	0.1740	M	0.81112	2.525	0.32056	N	0.596317	D	0.69078	0.997	D	0.68483	0.958	T	0.61481	-0.7054	9	0.87932	D	0	.	8.8066	0.34941	1.0:0.0:0.0:0.0	.	1129	Q9BXX3	AN30A_HUMAN	V	1073;1192	ENSP00000354432:E1073V;ENSP00000363792:E1192V	ENSP00000354432:E1073V	E	+	2	0	ANKRD30A	37548032	1.000000	0.71417	0.063000	0.19743	0.004000	0.04260	3.826000	0.55738	1.151000	0.42436	0.381000	0.24937	GAA	.	.	none		0.318	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
EFNB1	1947	hgsc.bcm.edu	37	X	68058642	68058642	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chrX:68058642C>A	ENST00000204961.4	+	2	1091	c.311C>A	c.(310-312)cCa>cAa	p.P104Q		NM_004429.4	NP_004420.1	P98172	EFNB1_HUMAN	ephrin-B1	104	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|embryonic pattern specification (GO:0009880)|ephrin receptor signaling pathway (GO:0048013)|neural crest cell migration (GO:0001755)|positive regulation of T cell proliferation (GO:0042102)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ephrin receptor binding (GO:0046875)			breast(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	22						TGCAATAGGCCAGAGCAGGAA	0.532																																					p.P104Q		Atlas-SNP	.											.	EFNB1	37	.	0			c.C311A						PASS	.						110.0	62.0	78.0					X																	68058642		2203	4300	6503	SO:0001583	missense	1947	exon2			ATAGGCCAGAGCA	U09303	CCDS14391.1	Xq12	2011-03-09			ENSG00000090776	ENSG00000090776		"""Ephrins"""	3226	protein-coding gene	gene with protein product		300035	"""craniofrontonasal syndrome (craniofrontonasal dysplasia)"""	EPLG2, CFNS		7774950, 16526919	Standard	NM_004429		Approved	LERK2, Elk-L	uc004dxd.4	P98172	OTTHUMG00000021751	ENST00000204961.4:c.311C>A	X.37:g.68058642C>A	ENSP00000204961:p.Pro104Gln	Somatic	389	0	0		WXS	Illumina HiSeq	Phase_I	195	9	0.0461538	NM_004429	D3DVU0	Missense_Mutation	SNP	ENST00000204961.4	37	CCDS14391.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519345	0.85495	.	.	ENSG00000090776	ENST00000204961	D	0.97303	-4.33	5.13	5.13	0.70059	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.98419	0.9474	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99218	1.0878	10	0.66056	D	0.02	-10.4548	14.8667	0.70422	0.0:1.0:0.0:0.0	.	104	P98172	EFNB1_HUMAN	Q	104	ENSP00000204961:P104Q	ENSP00000204961:P104Q	P	+	2	0	EFNB1	67975367	1.000000	0.71417	0.996000	0.52242	0.871000	0.50021	7.320000	0.79064	2.390000	0.81377	0.436000	0.28706	CCA	.	.	none		0.532	EFNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057029.1	NM_004429	
ZFHX4	79776	hgsc.bcm.edu	37	8	77616927	77616927	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr8:77616927G>T	ENST00000521891.2	+	2	1052	c.604G>T	c.(604-606)Ggg>Tgg	p.G202W	ZFHX4_ENST00000455469.2_Missense_Mutation_p.G202W|ZFHX4_ENST00000050961.6_Missense_Mutation_p.G202W|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.G202W	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	202					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G202W(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTCATCCCTCGGGAAACCATT	0.488										HNSCC(33;0.089)																											p.G202W		Atlas-SNP	.											ZFHX4,colon,carcinoma,0,3	ZFHX4	878	3	1	Substitution - Missense(1)	lung(1)	c.G604T						scavenged	.						86.0	79.0	81.0					8																	77616927		1975	4168	6143	SO:0001583	missense	79776	exon2			TCCCTCGGGAAAC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.604G>T	8.37:g.77616927G>T	ENSP00000430497:p.Gly202Trp	Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	118	2	0.0169492	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	13.85	2.360528	0.41801	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.54866	0.55;0.59;0.56;0.55	5.42	5.42	0.78866	.	0.000000	0.45361	U	0.000372	T	0.71126	0.3303	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	T	0.72297	-0.4335	10	0.87932	D	0	.	19.416	0.94700	0.0:0.0:1.0:0.0	.	202;202;202;202	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	W	202	ENSP00000430497:G202W;ENSP00000399605:G202W;ENSP00000050961:G202W;ENSP00000430848:G202W	ENSP00000050961:G202W	G	+	1	0	ZFHX4	77779482	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.821000	0.97095	0.650000	0.86243	GGG	.	.	none		0.488	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
UHRF1BP1	54887	hgsc.bcm.edu	37	6	34825160	34825160	+	Missense_Mutation	SNP	C	C	T	rs201864059		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr6:34825160C>T	ENST00000192788.5	+	12	1657	c.1486C>T	c.(1486-1488)Cgg>Tgg	p.R496W	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.R496W	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	496							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						TTCCTGCAGTCGGAAACTTCA	0.433																																					p.R496W		Atlas-SNP	.											.	UHRF1BP1	102	.	0			c.C1486T						PASS	.						124.0	118.0	120.0					6																	34825160		1875	4119	5994	SO:0001583	missense	54887	exon12			TGCAGTCGGAAAC	AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.1486C>T	6.37:g.34825160C>T	ENSP00000192788:p.Arg496Trp	Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	105	9	0.0857143	NM_017754	Q9NXE0	Missense_Mutation	SNP	ENST00000192788.5	37	CCDS43455.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014324	0.75161	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.12879	2.64;2.64	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.21718	0.0523	L	0.50333	1.59	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.00196	-1.1931	10	0.87932	D	0	-22.6533	11.8255	0.52265	0.2922:0.7078:0.0:0.0	.	496	Q6BDS2	URFB1_HUMAN	W	496	ENSP00000192788:R496W;ENSP00000400628:R496W	ENSP00000192788:R496W	R	+	1	2	UHRF1BP1	34933138	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.939000	0.48995	2.758000	0.94735	0.563000	0.77884	CGG	.	.	weak		0.433	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754	
SYNE1	23345	hgsc.bcm.edu	37	6	152768599	152768599	+	Silent	SNP	C	C	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr6:152768599C>G	ENST00000367255.5	-	29	4264	c.3663G>C	c.(3661-3663)ctG>ctC	p.L1221L	SYNE1_ENST00000413186.2_Silent_p.L1221L|SYNE1_ENST00000448038.1_Silent_p.L1228L|SYNE1_ENST00000367248.3_Silent_p.L1211L|SYNE1_ENST00000341594.5_Silent_p.L1287L|SYNE1_ENST00000265368.4_Silent_p.L1221L|SYNE1_ENST00000423061.1_Silent_p.L1228L|SYNE1_ENST00000367253.4_Silent_p.L1221L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1221					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTACCTCTGACAGCAGCGTCA	0.413										HNSCC(10;0.0054)																											p.L1228L		Atlas-SNP	.											.	SYNE1	3227	.	0			c.G3684C						PASS	.						55.0	55.0	55.0					6																	152768599		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon29			CTCTGACAGCAGC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3663G>C	6.37:g.152768599C>G		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	69	7	0.101449	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																			.	.	none		0.413	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
APOBEC3B	9582	hgsc.bcm.edu	37	22	39382074	39382074	+	Silent	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr22:39382074C>T	ENST00000333467.3	+	3	477	c.432C>T	c.(430-432)cgC>cgT	p.R144R	APOBEC3B_ENST00000402182.3_Silent_p.R144R|APOBEC3B_ENST00000407298.3_Silent_p.R144R	NM_001270411.1|NM_004900.4	NP_001257340.1|NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B	144					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|negative regulation of transposition (GO:0010529)	nucleus (GO:0005634)	deoxycytidine deaminase activity (GO:0047844)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	13	Melanoma(58;0.04)					CAGGAGCCCGCGTGACGATCA	0.587																																					p.R144R		Atlas-SNP	.											APOBEC3B,NS,carcinoma,+1,1	APOBEC3B	32	1	0			c.C432T						scavenged	.						51.0	56.0	54.0					22																	39382074		2197	4279	6476	SO:0001819	synonymous_variant	9582	exon3			AGCCCGCGTGACG	AK024854	CCDS13982.1, CCDS58807.1	22q13.1-q13.2	2008-05-15			ENSG00000179750	ENSG00000179750		"""Apolipoprotein B mRNA editing enzymes"""	17352	protein-coding gene	gene with protein product	"""phorbolin 3"""	607110				11863358, 10469298	Standard	NM_004900		Approved	PHRBNL, FLJ21201	uc003awo.2	Q9UH17	OTTHUMG00000151085	ENST00000333467.3:c.432C>T	22.37:g.39382074C>T		Somatic	83	1	0.0120482		WXS	Illumina HiSeq	Phase_I	61	3	0.0491803	NM_004900	B0QYD2|O95618|Q20WL1|Q5IFJ4|Q7Z2N3|Q7Z6D6|Q9UE74	Silent	SNP	ENST00000333467.3	37	CCDS13982.1																																																																																			.	.	none		0.587	APOBEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321233.1	NM_004900	
OR1S2	219958	hgsc.bcm.edu	37	11	57971351	57971351	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:57971351G>C	ENST00000302592.6	-	1	302	c.303C>G	c.(301-303)aaC>aaG	p.N101K		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				TGGATTGGCTGTTGGTTTGAA	0.443																																					p.N101K		Atlas-SNP	.											OR1S2,NS,adenoma,-1,1	OR1S2	119	1	0			c.C303G						scavenged	.						177.0	168.0	171.0					11																	57971351		2201	4296	6497	SO:0001583	missense	219958	exon1			TTGGCTGTTGGTT	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.303C>G	11.37:g.57971351G>C	ENSP00000305469:p.Asn101Lys	Somatic	368	2	0.00543478		WXS	Illumina HiSeq	Phase_I	266	5	0.018797	NM_001004459	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	g	0.009	-1.800641	0.00611	.	.	ENSG00000197887	ENST00000302592	T	0.01981	4.52	4.47	-8.37	0.00976	GPCR, rhodopsin-like superfamily (1);	1.336330	0.04978	N	0.465118	T	0.00815	0.0027	N	0.01250	-0.93	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50482	-0.8823	10	0.36615	T	0.2	.	4.0571	0.09821	0.2759:0.3611:0.2766:0.0863	.	101	Q8NGQ3	OR1S2_HUMAN	K	101	ENSP00000305469:N101K	ENSP00000305469:N101K	N	-	3	2	OR1S2	57727927	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-3.209000	0.00557	-1.926000	0.01061	-2.533000	0.00181	AAC	.	.	none		0.443	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
PYY	5697	hgsc.bcm.edu	37	17	42030694	42030694	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr17:42030694C>T	ENST00000360085.2	-	5	698	c.158G>A	c.(157-159)cGc>cAc	p.R53H	PYY_ENST00000592796.1_Missense_Mutation_p.R53H	NM_004160.4	NP_004151	P10082	PYY_HUMAN	peptide YY	53					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|digestion (GO:0007586)|eating behavior (GO:0042755)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)			endometrium(1)|ovary(1)	2		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.12)		GAGGTAGTGGCGCAGGGAGGC	0.726																																					p.R53H		Atlas-SNP	.											.	PYY	11	.	0			c.G158A						PASS	.						17.0	19.0	19.0					17																	42030694		2200	4297	6497	SO:0001583	missense	5697	exon5			TAGTGGCGCAGGG		CCDS32662.1	17q21.1	2013-02-28				ENSG00000131096		"""Endogenous ligands"""	9748	protein-coding gene	gene with protein product	"""prepro-PYY"""	600781				7782089	Standard	NM_004160		Approved	PYY1	uc002ieq.3	P10082		ENST00000360085.2:c.158G>A	17.37:g.42030694C>T	ENSP00000353198:p.Arg53His	Somatic	188	0	0		WXS	Illumina HiSeq	Phase_I	178	13	0.0730337	NM_004160	Q5U5Q6|Q6FGH8	Missense_Mutation	SNP	ENST00000360085.2	37	CCDS32662.1	.	.	.	.	.	.	.	.	.	.	.	35	5.542943	0.96474	.	.	ENSG00000131096	ENST00000360085	T	0.52983	0.64	4.64	4.64	0.57946	Pancreatic hormone-like, conserved site (1);	.	.	.	.	T	0.67804	0.2932	.	.	.	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.72673	-0.4222	8	0.87932	D	0	-1.6458	12.9887	0.58606	0.0:1.0:0.0:0.0	.	53	P10082	PYY_HUMAN	H	53	ENSP00000353198:R53H	ENSP00000353198:R53H	R	-	2	0	PYY	39386220	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.097000	0.64542	2.109000	0.64355	0.549000	0.68633	CGC	.	.	none		0.726	PYY-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000457658.1	NM_004160	
AQP7	364	hgsc.bcm.edu	37	9	33385690	33385690	+	Missense_Mutation	SNP	G	G	T	rs139024279		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr9:33385690G>T	ENST00000537089.1	-	6	742	c.424C>A	c.(424-426)Cgc>Agc	p.R142S	AQP7_ENST00000539936.1_Missense_Mutation_p.R234S|AQP7_ENST00000377425.4_Missense_Mutation_p.R177S|AQP7_ENST00000541274.1_Missense_Mutation_p.P102Q			O14520	AQP7_HUMAN	aquaporin 7	234					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)	p.R234fs*35(1)		NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GTGAAGATGCGGGGGGGCAGG	0.577																																					p.R234S		Atlas-SNP	.											AQP7,colon,carcinoma,0,1	AQP7	58	1	1	Insertion - Frameshift(1)	lung(1)	c.C700A						scavenged	.						74.0	81.0	78.0					9																	33385690		2203	4300	6503	SO:0001583	missense	364	exon7			AGATGCGGGGGGG	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.424C>A	9.37:g.33385690G>T	ENSP00000441619:p.Arg142Ser	Somatic	22	1	0.0454545		WXS	Illumina HiSeq	Phase_I	24	7	0.291667	NM_001170	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	14.50|14.50	2.553881|2.553881	0.45487|0.45487	.|.	.|.	ENSG00000165269|ENSG00000165269	ENST00000541274|ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503	T|T;T;T;T;T;T;T;T;T	0.57273|0.13196	0.41|2.61;2.61;2.61;2.61;2.61;2.61;2.61;2.61;2.61	5.04|5.04	4.07|4.07	0.47477|0.47477	.|Aquaporin-like (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49474|0.49474	0.1559|0.1559	H|H	0.97315|0.97315	3.98|3.98	0.58432|0.58432	D|D	0.999997|0.999997	P|D;P;P;P	0.39216|0.55800	0.664|0.973;0.872;0.525;0.795	B|D;D;P;P	0.36289|0.67900	0.221|0.954;0.923;0.814;0.878	T|T	0.64550|0.64550	-0.6381|-0.6381	9|10	0.87932|0.66056	D|D	0|0.02	-16.683|-16.683	12.4686|12.4686	0.55773|0.55773	0.0:0.0:0.8227:0.1772|0.0:0.0:0.8227:0.1772	.|.	102|233;234;177;234	B7Z7F6|Q5T5M0;B7Z4U2;Q6P5T0;O14520	.|.;.;.;AQP7_HUMAN	Q|S	102|142;233;102;234;177;142;233;234;170	ENSP00000438860:P102Q|ENSP00000441619:R142S;ENSP00000368821:R233S;ENSP00000412868:R102S;ENSP00000297988:R234S;ENSP00000396111:R177S;ENSP00000410138:R142S;ENSP00000368820:R233S;ENSP00000439534:R234S;ENSP00000368817:R170S	ENSP00000438860:P102Q|ENSP00000297988:R234S	P|R	-|-	2|1	0|0	AQP7|AQP7	33375690|33375690	0.731000|0.731000	0.28111|0.28111	0.404000|0.404000	0.26397|0.26397	0.223000|0.223000	0.24884|0.24884	1.249000|1.249000	0.32839|0.32839	2.621000|2.621000	0.88768|0.88768	0.550000|0.550000	0.68814|0.68814	CCG|CGC	G|0.986;T|0.014	0.014	strong		0.577	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230409	23230409	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr22:23230409G>A	ENST00000526893.1	+	1	450	c.176G>A	c.(175-177)aGc>aAc	p.S59N	IGLL5_ENST00000532223.2_Missense_Mutation_p.S59N|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.S59N	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	59						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GTTGGAAGCAGCCGATCCAGC	0.657																																					p.S59N		Atlas-SNP	.											.	IGLL5	26	.	0			c.G176A						PASS	.																																			SO:0001583	missense	100423062	exon1			GAAGCAGCCGATC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.176G>A	22.37:g.23230409G>A	ENSP00000431254:p.Ser59Asn	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	102	14	0.137255	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	10.14	1.267343	0.23136	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00583	6.41;6.41	3.92	-0.797	0.10909	.	.	.	.	.	T	0.00440	0.0014	N	0.19112	0.55	0.09310	N	1	B	0.21821	0.061	B	0.17098	0.017	T	0.45056	-0.9287	9	0.59425	D	0.04	.	3.0635	0.06207	0.2132:0.0:0.4153:0.3715	.	59	B9A064	IGLL5_HUMAN	N	59	ENSP00000436353:S59N;ENSP00000431254:S59N	ENSP00000431254:S59N	S	+	2	0	IGLL5	21560409	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.100000	0.10990	-0.036000	0.13669	-0.196000	0.12772	AGC	.	.	none		0.657	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651412	1651412	+	Silent	SNP	G	G	C	rs569811286		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:1651412G>C	ENST00000399676.2	+	1	380	c.342G>C	c.(340-342)ggG>ggC	p.G114G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	114	8 X 4 AA repeats of C-C-X-P.			Missing (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.G114G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTGTGGGGGGTCCAAGGGGG	0.706													N|||	1	0.000199681	0.0	0.0	5008	,	,		3556	0.001		0.0	False		,,,				2504	0.0				p.G114G		Atlas-SNP	.											KRTAP5-5,NS,carcinoma,+1,2	KRTAP5-5	86	2	1	Substitution - coding silent(1)	prostate(1)	c.G342C						scavenged	.						20.0	31.0	27.0					11																	1651412		2083	4147	6230	SO:0001819	synonymous_variant	439915	exon1			TGGGGGGTCCAAG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.342G>C	11.37:g.1651412G>C		Somatic	37	1	0.027027		WXS	Illumina HiSeq	Phase_I	32	2	0.0625	NM_001001480	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.	.	none		0.706	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
OR4S1	256148	hgsc.bcm.edu	37	11	48328231	48328231	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:48328231C>T	ENST00000319988.1	+	1	457	c.457C>T	c.(457-459)Cat>Tat	p.H153Y		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						TGGCTTCCTGCATTCCATCCT	0.567																																					p.H153Y		Atlas-SNP	.											.	OR4S1	52	.	0			c.C457T						PASS	.						119.0	102.0	108.0					11																	48328231		2201	4298	6499	SO:0001583	missense	256148	exon1			TTCCTGCATTCCA	AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.457C>T	11.37:g.48328231C>T	ENSP00000321447:p.His153Tyr	Somatic	191	0	0		WXS	Illumina HiSeq	Phase_I	113	10	0.0884956	NM_001004725	Q6IFB4	Missense_Mutation	SNP	ENST00000319988.1	37	CCDS31488.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.558614	0.65538	.	.	ENSG00000176555	ENST00000319988	T	0.36699	1.24	5.02	5.02	0.67125	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.60090	0.2242	M	0.66506	2.035	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.53781	-0.8390	9	0.87932	D	0	.	16.186	0.81950	0.0:1.0:0.0:0.0	.	153	Q8NGB4	OR4S1_HUMAN	Y	153	ENSP00000321447:H153Y	ENSP00000321447:H153Y	H	+	1	0	OR4S1	48284807	0.000000	0.05858	0.759000	0.31340	0.986000	0.74619	-0.017000	0.12590	2.497000	0.84241	0.655000	0.94253	CAT	.	.	none		0.567	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390556.1	NM_001004725	
KCNH1	3756	hgsc.bcm.edu	37	1	210856924	210856924	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:210856924C>T	ENST00000271751.4	-	11	2696	c.2669G>A	c.(2668-2670)cGc>cAc	p.R890H	KCNH1_ENST00000367007.4_Missense_Mutation_p.R863H			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	890					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GTTGTCCAGGCGCAAGTCGCT	0.592																																					p.R890H		Atlas-SNP	.											.	KCNH1	199	.	0			c.G2669A						PASS	.						73.0	67.0	69.0					1																	210856924		2203	4300	6503	SO:0001583	missense	3756	exon11			TCCAGGCGCAAGT	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2669G>A	1.37:g.210856924C>T	ENSP00000271751:p.Arg890His	Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	136	6	0.0441176	NM_172362	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.870929	0.72065	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.99537	-6.03;-6.11	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.99444	0.9803	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.71184	0.858;0.972	D	0.98847	1.0757	10	0.56958	D	0.05	.	18.1618	0.89710	0.0:1.0:0.0:0.0	.	863;890	Q14CL3;O95259	.;KCNH1_HUMAN	H	890;863	ENSP00000271751:R890H;ENSP00000355974:R863H	ENSP00000271751:R890H	R	-	2	0	KCNH1	208923547	1.000000	0.71417	0.907000	0.35723	0.337000	0.28794	7.538000	0.82048	2.290000	0.77057	0.561000	0.74099	CGC	.	.	none		0.592	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
HNF4G	3174	hgsc.bcm.edu	37	8	76471075	76471075	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr8:76471075T>C	ENST00000354370.1	+	9	1055	c.785T>C	c.(784-786)aTg>aCg	p.M262T	HNF4G_ENST00000396423.2_Missense_Mutation_p.M299T			Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	262					endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	37	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			ATTAAGAACATGAGGTTCCAA	0.448																																					p.M299T		Atlas-SNP	.											.	HNF4G	111	.	0			c.T896C						PASS	.						81.0	75.0	77.0					8																	76471075		2203	4300	6503	SO:0001583	missense	3174	exon8			AGAACATGAGGTT		CCDS6220.2	8q21-q22	2013-01-16			ENSG00000164749	ENSG00000164749		"""Nuclear hormone receptors"""	5026	protein-coding gene	gene with protein product		605966				8622695, 12220494	Standard	NM_004133		Approved	NR2A2	uc003yar.3	Q14541	OTTHUMG00000149920	ENST00000354370.1:c.785T>C	8.37:g.76471075T>C	ENSP00000346339:p.Met262Thr	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	89	9	0.101124	NM_004133	Q7Z2V9|Q9UH81|Q9UIS6	Missense_Mutation	SNP	ENST00000354370.1	37		.	.	.	.	.	.	.	.	.	.	T	21.4	4.150652	0.78001	.	.	ENSG00000164749	ENST00000354370;ENST00000396423	D;D	0.96427	-4.01;-4.01	5.62	5.62	0.85841	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.033448	0.85682	D	0.000000	D	0.96728	0.8932	L	0.42245	1.32	0.80722	D	1	B;P	0.42409	0.121;0.779	B;P	0.57620	0.234;0.824	D	0.97499	1.0059	10	0.87932	D	0	.	15.8221	0.78662	0.0:0.0:0.0:1.0	.	299;262	F1D8Q4;Q14541	.;HNF4G_HUMAN	T	262;299	ENSP00000346339:M262T;ENSP00000379701:M299T	ENSP00000346339:M262T	M	+	2	0	HNF4G	76633630	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.991000	0.88244	2.139000	0.66308	0.533000	0.62120	ATG	.	.	none		0.448	HNF4G-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000313914.2	NM_004133	
AQP7	364	hgsc.bcm.edu	37	9	33385667	33385667	+	Silent	SNP	A	A	G	rs79779983	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr9:33385667A>G	ENST00000537089.1	-	6	765	c.447T>C	c.(445-447)ggT>ggC	p.G149G	AQP7_ENST00000539936.1_Silent_p.G241G|AQP7_ENST00000377425.4_Silent_p.G184G|AQP7_ENST00000541274.1_Silent_p.L110L			O14520	AQP7_HUMAN	aquaporin 7	241					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GTTTGCCCCAACCAGCAATGA	0.592																																					p.G241G		Atlas-SNP	.											AQP7,colon,carcinoma,0,1	AQP7	58	1	0			c.T723C						scavenged	.						67.0	75.0	73.0					9																	33385667		2203	4300	6503	SO:0001819	synonymous_variant	364	exon7			GCCCCAACCAGCA	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.447T>C	9.37:g.33385667A>G		Somatic	21	1	0.047619		WXS	Illumina HiSeq	Phase_I	25	10	0.4	NM_001170	Q08E94|Q5T5L9|Q8NHM3	Silent	SNP	ENST00000537089.1	37																																																																																				A|0.710;G|0.290	0.290	strong		0.592	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
F7	2155	hgsc.bcm.edu	37	13	113773002	113773002	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr13:113773002A>G	ENST00000375581.3	+	9	1116	c.1081A>G	c.(1081-1083)Aac>Gac	p.N361D	F7_ENST00000541084.1_Missense_Mutation_p.N292D|F7_ENST00000346342.3_Missense_Mutation_p.N339D	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	361	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	CATGGTCCTCAACGTGCCCCG	0.632																																					p.N361D		Atlas-SNP	.											.	F7	49	.	0			c.A1081G						PASS	.						33.0	32.0	32.0					13																	113773002		2202	4298	6500	SO:0001583	missense	2155	exon9			GTCCTCAACGTGC		CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.1081A>G	13.37:g.113773002A>G	ENSP00000364731:p.Asn361Asp	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	100	22	0.22	NM_000131	B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Missense_Mutation	SNP	ENST00000375581.3	37	CCDS9528.1	.	.	.	.	.	.	.	.	.	.	A	0.753	-0.772186	0.02951	.	.	ENSG00000057593	ENST00000346342;ENST00000541084;ENST00000375581	D;D;D	0.88741	-2.42;-2.42;-2.42	4.17	-1.31	0.09230	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.595590	0.03454	N	0.211073	T	0.76521	0.3999	N	0.04820	-0.15	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.63305	-0.6667	10	0.24483	T	0.36	.	8.5642	0.33530	0.2473:0.4789:0.2738:0.0	.	292;339;361	F5H8B0;P08709-2;P08709	.;.;FA7_HUMAN	D	339;292;361	ENSP00000329546:N339D;ENSP00000442051:N292D;ENSP00000364731:N361D	ENSP00000329546:N339D	N	+	1	0	F7	112821003	0.003000	0.15002	0.001000	0.08648	0.008000	0.06430	0.407000	0.21049	-0.234000	0.09782	0.383000	0.25322	AAC	.	.	none		0.632	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045838.4	NM_000131	
TSHZ3	57616	hgsc.bcm.edu	37	19	31768074	31768074	+	Silent	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr19:31768074G>A	ENST00000240587.4	-	2	2952	c.2625C>T	c.(2623-2625)gaC>gaT	p.D875D		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	875					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GAGTGGCCCCGTCAATGTCAG	0.572																																					p.D875D		Atlas-SNP	.											.	TSHZ3	549	.	0			c.C2625T						PASS	.						70.0	65.0	66.0					19																	31768074		2203	4300	6503	SO:0001819	synonymous_variant	57616	exon2			GGCCCCGTCAATG	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2625C>T	19.37:g.31768074G>A		Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	90	19	0.211111	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																			.	.	none		0.572	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
H2AFV	94239	hgsc.bcm.edu	37	7	44874131	44874131	+	Missense_Mutation	SNP	A	A	G	rs114398265		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr7:44874131A>G	ENST00000308153.4	-	5	447	c.356T>C	c.(355-357)aTt>aCt	p.I119T	H2AFV_ENST00000437072.1_Intron|H2AFV_ENST00000222690.6_Intron|H2AFV_ENST00000349299.3_Missense_Mutation_p.I81T|H2AFV_ENST00000350771.3_Missense_Mutation_p.I93T|H2AFV_ENST00000521529.1_3'UTR|H2AFV_ENST00000381124.5_3'UTR	NM_012412.4	NP_036544.1	Q71UI9	H2AV_HUMAN	H2A histone family, member V	119						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.I119T(1)		endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	9						CTTCTTTCCAATCAGAGATTT	0.368																																					p.I119T		Atlas-SNP	.											H2AFV,NS,carcinoma,0,1	H2AFV	14	1	1	Substitution - Missense(1)	prostate(1)	c.T356C						scavenged	.						88.0	76.0	80.0					7																	44874131		2203	4300	6503	SO:0001583	missense	94239	exon5			TTTCCAATCAGAG	AF081192	CCDS5495.1, CCDS5496.1, CCDS5497.1, CCDS5498.1, CCDS47581.1	7p13	2011-01-27		2004-03-26	ENSG00000105968	ENSG00000105968		"""Histones / Replication-independent"""	20664	protein-coding gene	gene with protein product				H2AV			Standard	NM_012412		Approved	MGC10170, MGC10831, MGC1947	uc003tma.2	Q71UI9	OTTHUMG00000129217	ENST00000308153.4:c.356T>C	7.37:g.44874131A>G	ENSP00000308405:p.Ile119Thr	Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	147	7	0.047619	NM_012412	A6NFA8|A6NKY0|A6NN01|A8MQC5|Q59GV8|Q6PK98	Missense_Mutation	SNP	ENST00000308153.4	37	CCDS5496.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.801702	0.50315	.	.	ENSG00000105968	ENST00000349299;ENST00000308153;ENST00000350771	T;D;T	0.83163	0.93;-1.69;0.89	5.61	5.61	0.85477	Histone-fold (1);Histone H2A (2);	.	.	.	.	D	0.82444	0.5038	M	0.69523	2.12	0.80722	D	1	B;B;B	0.17852	0.001;0.024;0.0	B;B;B	0.18871	0.005;0.023;0.001	T	0.80027	-0.1554	9	0.62326	D	0.03	-10.9595	14.0456	0.64704	1.0:0.0:0.0:0.0	.	93;81;119	A6NKY0;A6NFA8;Q71UI9	.;.;H2AV_HUMAN	T	81;119;93	ENSP00000342714:I81T;ENSP00000308405:I119T;ENSP00000340708:I93T	ENSP00000308405:I119T	I	-	2	0	H2AFV	44840656	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.631000	0.90991	2.261000	0.74972	0.533000	0.62120	ATT	A|0.999;G|0.001	0.001	weak		0.368	H2AFV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251305.1	NM_012412	
MPEG1	219972	hgsc.bcm.edu	37	11	58979509	58979509	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:58979509C>T	ENST00000361050.3	-	1	915	c.830G>A	c.(829-831)aGc>aAc	p.S277N	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	277	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				CCCTCCAATGCTCTGCACCCT	0.542																																					p.S277N		Atlas-SNP	.											.	MPEG1	72	.	0			c.G830A						PASS	.						29.0	26.0	27.0					11																	58979509		1851	4082	5933	SO:0001583	missense	219972	exon1			CCAATGCTCTGCA	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.830G>A	11.37:g.58979509C>T	ENSP00000354335:p.Ser277Asn	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	117	11	0.0940171	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	37	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930767	0.73327	.	.	ENSG00000197629	ENST00000361050	D	0.84589	-1.87	5.38	5.38	0.77491	Membrane attack complex component/perforin (MACPF) domain (3);	0.000000	0.85682	D	0.000000	D	0.91297	0.7256	M	0.67953	2.075	0.50313	D	0.999864	D	0.89917	1.0	D	0.91635	0.999	D	0.91418	0.5156	10	0.54805	T	0.06	-33.9117	16.1079	0.81237	0.0:1.0:0.0:0.0	.	277	Q2M385	MPEG1_HUMAN	N	277	ENSP00000354335:S277N	ENSP00000354335:S277N	S	-	2	0	MPEG1	58736085	1.000000	0.71417	0.677000	0.29947	0.973000	0.67179	7.032000	0.76498	2.541000	0.85698	0.650000	0.86243	AGC	.	.	none		0.542	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
TRAM1L1	133022	hgsc.bcm.edu	37	4	118005633	118005633	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr4:118005633G>A	ENST00000310754.4	-	1	1103	c.917C>T	c.(916-918)aCg>aTg	p.T306M		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	306	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						GGCTTGGATCGTGCAACTGGA	0.453																																					p.T306M		Atlas-SNP	.											.	TRAM1L1	55	.	0			c.C917T						PASS	.						129.0	120.0	123.0					4																	118005633		2203	4300	6503	SO:0001583	missense	133022	exon1			TGGATCGTGCAAC	AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.917C>T	4.37:g.118005633G>A	ENSP00000309402:p.Thr306Met	Somatic	225	0	0		WXS	Illumina HiSeq	Phase_I	179	18	0.100559	NM_152402	Q8N2L7	Missense_Mutation	SNP	ENST00000310754.4	37	CCDS3707.1	.	.	.	.	.	.	.	.	.	.	G	7.466	0.645766	0.14451	.	.	ENSG00000174599	ENST00000310754	D	0.85258	-1.96	3.74	2.87	0.33458	TRAM/LAG1/CLN8 homology domain (3);	0.890367	0.09839	N	0.749176	T	0.79936	0.4532	L	0.29908	0.895	0.09310	N	1	P	0.48089	0.905	P	0.45946	0.498	T	0.67837	-0.5567	10	0.45353	T	0.12	-6.284	9.0284	0.36243	0.0:0.2389:0.7611:0.0	.	306	Q8N609	TR1L1_HUMAN	M	306	ENSP00000309402:T306M	ENSP00000309402:T306M	T	-	2	0	TRAM1L1	118225081	0.009000	0.17119	0.428000	0.26697	0.038000	0.13279	1.409000	0.34680	1.113000	0.41760	0.650000	0.86243	ACG	.	.	none		0.453	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256513.1	NM_152402	
UBXN11	91544	hgsc.bcm.edu	37	1	26608843	26608843	+	Missense_Mutation	SNP	C	C	A	rs151149897|rs66614970|rs6667693		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:26608843C>A	ENST00000374222.1	-	16	1974	c.1510G>T	c.(1510-1512)Ggt>Tgt	p.G504C	UBXN11_ENST00000374217.2_Missense_Mutation_p.G471C|UBXN11_ENST00000374221.3_Missense_Mutation_p.G504C|UBXN11_ENST00000374223.1_Missense_Mutation_p.G261C|UBXN11_ENST00000357089.4_Missense_Mutation_p.G471C|UBXN11_ENST00000314675.7_Missense_Mutation_p.G384C			Q5T124	UBX11_HUMAN	UBX domain protein 11	504	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P503_G504insCP(1)|p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						ggaccgggaccgggactgggg	0.731																																					p.G504C		Atlas-SNP	.											UBXN11,NS,carcinoma,0,1	UBXN11	54	1	2	Insertion - In frame(1)|Deletion - In frame(1)	upper_aerodigestive_tract(1)|ovary(1)	c.G1510T						scavenged	.						16.0	17.0	17.0					1																	26608843		1719	3939	5658	SO:0001583	missense	91544	exon16			CGGGACCGGGACT	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1510G>T	1.37:g.26608843C>A	ENSP00000363339:p.Gly504Cys	Somatic	26	5	0.192308		WXS	Illumina HiSeq	Phase_I	23	9	0.391304	NM_183008	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	.	.	.	.	.	.	.	.	.	.	-	8.299	0.819400	0.16607	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.23950	1.88;1.92;2.21;2.14;2.14;2.21	.	.	.	.	.	.	.	.	T	0.24236	0.0587	N	0.08118	0	0.20638	N	0.999871	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.79108	0.992;0.992;0.981	T	0.14172	-1.0482	8	0.72032	D	0.01	.	4.6597	0.12636	0.0:1.0:0.0:0.0	rs6667693	471;384;504	Q5T124-2;Q5T124-3;Q5T124	.;.;UBX11_HUMAN	C	384;261;471;504;504;471	ENSP00000324721:G384C;ENSP00000363340:G261C;ENSP00000349601:G471C;ENSP00000363338:G504C;ENSP00000363339:G504C;ENSP00000363334:G471C	ENSP00000324721:G384C	G	-	1	0	UBXN11	26481430	0.005000	0.15991	0.167000	0.22817	0.175000	0.22909	-0.694000	0.05115	-0.000000	0.14550	0.000000	0.15137	GGT	C|0.500;A|0.500	0.500	weak		0.731	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
SPRR3	6707	hgsc.bcm.edu	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000331860.3_Silent_p.G73G|SPRR3_ENST00000542696.1_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		Atlas-SNP	.											SPRR3,colon,carcinoma,0,3	SPRR3	45	3	0			c.C219T						PASS	.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	67	13	0.19403	NM_001097589	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			.	.	none		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
MUC4	4585	hgsc.bcm.edu	37	3	195508478	195508478	+	Missense_Mutation	SNP	G	G	C	rs76305071	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr3:195508478G>C	ENST00000463781.3	-	2	10432	c.9973C>G	c.(9973-9975)Cac>Gac	p.H3325D	MUC4_ENST00000475231.1_Missense_Mutation_p.H3325D|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3305_S3336delVSTGHATPLLVTDASSASTGHATPLHVTSPSS(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGCGTGACCTGTGGAT	0.582													.|||	36	0.0071885	0.025	0.0043	5008	,	,		11084	0.0		0.0	False		,,,				2504	0.0				p.H3325D		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,+2,3	MUC4	1505	3	1	Deletion - In frame(1)	stomach(1)	c.C9973G						scavenged	.						16.0	16.0	16.0					3																	195508478		681	1566	2247	SO:0001583	missense	4585	exon2			TGGCGTGACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9973C>G	3.37:g.195508478G>C	ENSP00000417498:p.His3325Asp	Somatic	97	1	0.0103093		WXS	Illumina HiSeq	Phase_I	81	4	0.0493827	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	2.541	-0.306191	0.05458	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.26957	1.7;1.7	1.03	-0.504	0.11997	.	.	.	.	.	T	0.11110	0.0271	N	0.14661	0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33854	-0.9852	7	.	.	.	.	2.6532	0.05004	0.0:0.4387:0.3046:0.2566	.	3197	E7ESK3	.	D	3325	ENSP00000417498:H3325D;ENSP00000420243:H3325D	.	H	-	1	0	MUC4	196993257	0.129000	0.22400	0.000000	0.03702	0.009000	0.06853	0.657000	0.24963	-2.022000	0.00938	-1.954000	0.00483	CAC	G|0.990;C|0.010	0.010	strong		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
BMP1	649	hgsc.bcm.edu	37	8	22052356	22052356	+	Silent	SNP	G	G	A	rs11552824		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr8:22052356G>A	ENST00000306385.5	+	12	2233	c.1563G>A	c.(1561-1563)acG>acA	p.T521T	BMP1_ENST00000397814.3_Silent_p.T521T|BMP1_ENST00000397816.3_Silent_p.T521T|BMP1_ENST00000354870.5_3'UTR|BMP1_ENST00000306349.8_Silent_p.T521T	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	521	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		TCAAGAGCACGTCCAGCCGCC	0.567																																					p.T521T		Atlas-SNP	.											.	BMP1	131	.	0			c.G1563A						PASS	.						84.0	83.0	83.0					8																	22052356		2203	4300	6503	SO:0001819	synonymous_variant	649	exon12			GAGCACGTCCAGC		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.1563G>A	8.37:g.22052356G>A		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	70	10	0.142857	NM_001199	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Silent	SNP	ENST00000306385.5	37	CCDS6026.1																																																																																			.	.	alt		0.567	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	NM_006132	
KCNB2	9312	hgsc.bcm.edu	37	8	73848718	73848718	+	Silent	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr8:73848718C>T	ENST00000523207.1	+	3	1716	c.1128C>T	c.(1126-1128)acC>acT	p.T376T		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	376					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GGTGGGCCACCATCACCATGA	0.448																																					p.T376T		Atlas-SNP	.											KCNB2,right_upper_lobe,carcinoma,0,1	KCNB2	228	1	0			c.C1128T						scavenged	.						107.0	106.0	106.0					8																	73848718		2203	4300	6503	SO:0001819	synonymous_variant	9312	exon3			GGCCACCATCACC	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1128C>T	8.37:g.73848718C>T		Somatic	244	1	0.00409836		WXS	Illumina HiSeq	Phase_I	174	2	0.0114943	NM_004770	Q7Z7D0|Q9BXD3	Silent	SNP	ENST00000523207.1	37	CCDS6209.1																																																																																			.	.	none		0.448	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
PAK2	5062	hgsc.bcm.edu	37	3	196530013	196530013	+	Silent	SNP	A	A	G	rs73205842	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr3:196530013A>G	ENST00000327134.3	+	4	736	c.414A>G	c.(412-414)aaA>aaG	p.K138K		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	138					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		TGAAGCAGAAATATCTGAGCT	0.418																																					p.K138K		Atlas-SNP	.											PAK2_ENST00000327134,rectum,carcinoma,0,2	PAK2	113	2	0			c.A414G						scavenged	.						92.0	84.0	87.0					3																	196530013		2203	4300	6503	SO:0001819	synonymous_variant	5062	exon4			GCAGAAATATCTG	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.414A>G	3.37:g.196530013A>G		Somatic	56	2	0.0357143		WXS	Illumina HiSeq	Phase_I	56	6	0.107143	NM_002577	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1																																																																																			A|0.970;G|0.030	0.030	strong		0.418	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
NPAT	4863	hgsc.bcm.edu	37	11	108044437	108044437	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:108044437T>A	ENST00000278612.8	-	13	1379	c.1274A>T	c.(1273-1275)aAa>aTa	p.K425I	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	425					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		AAAGGCCTTTTTCTGTATGCT	0.378																																					p.K425I		Atlas-SNP	.											.	NPAT	124	.	0			c.A1274T						PASS	.						151.0	141.0	144.0					11																	108044437		1861	4089	5950	SO:0001583	missense	4863	exon13			GCCTTTTTCTGTA	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.1274A>T	11.37:g.108044437T>A	ENSP00000278612:p.Lys425Ile	Somatic	543	0	0		WXS	Illumina HiSeq	Phase_I	391	34	0.0869565	NM_002519	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	37	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447588	0.43429	.	.	ENSG00000149308	ENST00000278612	T	0.05925	3.37	5.54	5.54	0.83059	.	0.119077	0.56097	D	0.000025	T	0.23688	0.0573	M	0.69823	2.125	0.42227	D	0.991876	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00386	-1.1772	10	0.56958	D	0.05	-24.8189	13.7058	0.62639	0.0:0.0:0.0:1.0	.	425;425	B9EG70;Q14207	.;NPAT_HUMAN	I	425	ENSP00000278612:K425I	ENSP00000278612:K425I	K	-	2	0	NPAT	107549647	1.000000	0.71417	1.000000	0.80357	0.089000	0.18198	2.613000	0.46351	2.231000	0.72958	0.455000	0.32223	AAA	.	.	none		0.378	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
CDH3	1001	hgsc.bcm.edu	37	16	68716273	68716273	+	Silent	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr16:68716273C>T	ENST00000264012.4	+	9	1609	c.1065C>T	c.(1063-1065)gaC>gaT	p.D355D	CDH3_ENST00000581171.1_Silent_p.D300D|CDH3_ENST00000429102.2_Silent_p.D355D	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	355	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		CTGATCTGGACGCCCCCAACT	0.592																																					p.D355D		Atlas-SNP	.											.	CDH3	68	.	2	Unknown(2)	breast(2)	c.C1065T						PASS	.						102.0	73.0	83.0					16																	68716273		2198	4300	6498	SO:0001819	synonymous_variant	1001	exon9			TCTGGACGCCCCC	X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.1065C>T	16.37:g.68716273C>T		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	63	8	0.126984	NM_001793	B2R6F4|Q05DI6	Silent	SNP	ENST00000264012.4	37	CCDS10868.1																																																																																			.	.	none		0.592	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2	NM_001793	
FRG2B	441581	hgsc.bcm.edu	37	10	135439015	135439015	+	Missense_Mutation	SNP	T	T	C	rs75470891		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr10:135439015T>C	ENST00000425520.1	-	4	477	c.425A>G	c.(424-426)gAt>gGt	p.D142G	FRG2B_ENST00000443774.1_Missense_Mutation_p.D143G	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	142						nucleus (GO:0005634)		p.D143G(1)|p.D142G(1)		endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ATGGTGGGCATCACAGGTCTC	0.517																																					p.D142G		Atlas-SNP	.											FRG2B,NS,carcinoma,0,1	FRG2B	47	1	2	Substitution - Missense(2)	prostate(2)	c.A425G						scavenged	.						94.0	106.0	102.0					10																	135439015		2200	4298	6498	SO:0001583	missense	441581	exon4			TGGGCATCACAGG	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.425A>G	10.37:g.135439015T>C	ENSP00000401310:p.Asp142Gly	Somatic	397	7	0.0176322		WXS	Illumina HiSeq	Phase_I	298	7	0.0234899	NM_001080998	Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	7.820	0.717602	0.15372	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.46063	0.88;0.88	.	.	.	.	2.387620	0.01707	N	0.027493	T	0.45115	0.1326	N	0.19112	0.55	0.80722	P	0.0	D	0.61697	0.99	D	0.66351	0.943	T	0.44967	-0.9293	7	0.25751	T	0.34	-0.0211	.	.	.	.	142	Q96QU4	FRG2B_HUMAN	G	143;142	ENSP00000408343:D143G;ENSP00000401310:D142G	ENSP00000401310:D142G	D	-	2	0	FRG2B	135289005	0.038000	0.19896	0.258000	0.24420	0.260000	0.26232	0.264000	0.18497	0.103000	0.17682	0.102000	0.15555	GAT	C|1.000;|0.000	1.000	weak		0.517	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
CD36	948	hgsc.bcm.edu	37	7	80285936	80285936	+	Silent	SNP	C	C	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr7:80285936C>A	ENST00000435819.1	+	7	885	c.201C>A	c.(199-201)atC>atA	p.I67I	CD36_ENST00000309881.7_Silent_p.I67I|CD36_ENST00000544133.1_Silent_p.I67I|CD36_ENST00000538969.1_Silent_p.I67I|CD36_ENST00000394788.3_Silent_p.I67I|CD36_ENST00000441109.2_3'UTR|CD36_ENST00000447544.2_Silent_p.I67I|CD36_ENST00000534394.1_5'UTR|CD36_ENST00000432207.1_Silent_p.I67I|CD36_ENST00000433696.2_Silent_p.I67I			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	67					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						AGTTTTGGATCTTTGATGTGC	0.378																																					p.I67I		Atlas-SNP	.											.	CD36	185	.	0			c.C201A						PASS	.						92.0	88.0	90.0					7																	80285936		2203	4300	6503	SO:0001819	synonymous_variant	948	exon2			TTGGATCTTTGAT	Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.201C>A	7.37:g.80285936C>A		Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	126	22	0.174603	NM_001127444	D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Silent	SNP	ENST00000435819.1	37	CCDS34673.1																																																																																			.	.	none		0.378	CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339767.6	NM_001001547	
UTS2B	257313	hgsc.bcm.edu	37	3	190999976	190999976	+	Start_Codon_SNP	SNP	C	C	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr3:190999976C>A	ENST00000340524.5	-	5	789	c.3G>T	c.(1-3)atG>atT	p.M1I	UTS2B_ENST00000427544.2_Start_Codon_SNP_p.M1I	NM_198152.3	NP_937795.2	Q765I0	UTS2B_HUMAN	urotensin 2B	1					regulation of blood pressure (GO:0008217)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)											GGATCTTGTTCATGTTAAAAA	0.383																																					p.M1I		Atlas-SNP	.											.	.	.	.	0			c.G3T						PASS	.						70.0	65.0	66.0					3																	190999976		2203	4300	6503	SO:0001582	initiator_codon_variant	257313	exon5			CTTGTTCATGTTA	AB116021	CCDS3300.1	3q28	2013-02-28	2013-02-28	2013-02-28	ENSG00000188958	ENSG00000188958		"""Endogenous ligands"""	30894	protein-coding gene	gene with protein product	"""prepro-URP"""		"""urotensin 2 domain containing"""	UTS2D		14550283	Standard	NM_198152		Approved	URP, U2B	uc003fsu.3	Q765I0	OTTHUMG00000156192	ENST00000340524.5:c.3G>T	3.37:g.190999976C>A	ENSP00000340526:p.Met1Ile	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	120	5	0.0416667	NM_198152	B3KQY8|D3DNW1|Q2M1Z2	Missense_Mutation	SNP	ENST00000340524.5	37	CCDS3300.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.904784	0.33628	.	.	ENSG00000188958	ENST00000340524;ENST00000427544;ENST00000432514	T;T;T	0.60548	0.68;0.68;0.18	4.9	4.03	0.46877	.	0.451571	0.18931	N	0.127207	T	0.62319	0.2418	.	.	.	0.80722	D	1	D	0.57571	0.98	P	0.52598	0.703	T	0.62539	-0.6833	9	0.45353	T	0.12	-11.1179	9.5763	0.39459	0.0:0.9049:0.0:0.0951	.	1	Q765I0	UTS2B_HUMAN	I	1	ENSP00000340526:M1I;ENSP00000398761:M1I;ENSP00000401028:M1I	ENSP00000340526:M1I	M	-	3	0	UTS2D	192482670	0.996000	0.38824	0.656000	0.29637	0.046000	0.14306	1.515000	0.35845	1.447000	0.47661	-0.133000	0.14855	ATG	.	.	none		0.383	UTS2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343353.1	NM_198152	Missense_Mutation
AQP7	364	hgsc.bcm.edu	37	9	33385808	33385808	+	Missense_Mutation	SNP	G	G	T	rs62542744		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr9:33385808G>T	ENST00000537089.1	-	6	624	c.306C>A	c.(304-306)aaC>aaA	p.N102K	AQP7_ENST00000539936.1_Missense_Mutation_p.N194K|AQP7_ENST00000377425.4_Missense_Mutation_p.N137K|AQP7_ENST00000541274.1_Missense_Mutation_p.Q63K			O14520	AQP7_HUMAN	aquaporin 7	194					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GTGCTGGGTTGTTCTCCTGGT	0.607																																					p.N194K		Atlas-SNP	.											AQP7,colon,carcinoma,0,1	AQP7	58	1	0			c.C582A						scavenged	.						122.0	107.0	112.0					9																	33385808		2203	4300	6503	SO:0001583	missense	364	exon7			TGGGTTGTTCTCC	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.306C>A	9.37:g.33385808G>T	ENSP00000441619:p.Asn102Lys	Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	30	6	0.2	NM_001170	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	15.08|15.08	2.727222|2.727222	0.48833|0.48833	.|.	.|.	ENSG00000165269|ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503|ENST00000541274	D;D;D;D;D;D;D;D;D|T	0.83755|0.43688	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76|0.94	5.02|5.02	4.12|4.12	0.48240|0.48240	Aquaporin-like (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.54711|0.54711	0.1875|0.1875	L|L	0.56396|0.56396	1.775|1.775	0.80722|0.80722	D|D	1|1	D;D;D;D|D	0.89917|0.76494	1.0;0.999;1.0;1.0|0.999	D;D;D;D|D	0.87578|0.72338	0.995;0.995;0.993;0.998|0.977	T|T	0.53143|0.53143	-0.8480|-0.8480	10|8	0.87932|.	D|.	0|.	-24.7401|-24.7401	7.8517|7.8517	0.29459|0.29459	0.1855:0.0:0.8145:0.0|0.1855:0.0:0.8145:0.0	rs62542744|rs62542744	193;194;137;194|63	Q5T5M0;B7Z4U2;Q6P5T0;O14520|B7Z7F6	.;.;.;AQP7_HUMAN|.	K|K	102;193;62;194;137;102;193;194;130|63	ENSP00000441619:N102K;ENSP00000368821:N193K;ENSP00000412868:N62K;ENSP00000297988:N194K;ENSP00000396111:N137K;ENSP00000410138:N102K;ENSP00000368820:N193K;ENSP00000439534:N194K;ENSP00000368817:N130K|ENSP00000438860:Q63K	ENSP00000297988:N194K|.	N|Q	-|-	3|1	2|0	AQP7|AQP7	33375808|33375808	1.000000|1.000000	0.71417|0.71417	0.740000|0.740000	0.30986|0.30986	0.116000|0.116000	0.19942|0.19942	2.130000|2.130000	0.42064|0.42064	1.319000|1.319000	0.45190|0.45190	0.645000|0.645000	0.84053|0.84053	AAC|CAA	.	.	weak		0.607	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
TCHH	7062	hgsc.bcm.edu	37	1	152082269	152082269	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:152082269C>T	ENST00000368804.1	-	2	3423	c.3424G>A	c.(3424-3426)Gag>Aag	p.E1142K		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1142	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			tcctcttcctcccgatattgc	0.602																																					p.E1142K		Atlas-SNP	.											TCHH,NS,malignant_melanoma,0,1	TCHH	275	1	0			c.G3424A						scavenged	.						88.0	86.0	87.0					1																	152082269		1995	4159	6154	SO:0001583	missense	7062	exon3			CTTCCTCCCGATA	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3424G>A	1.37:g.152082269C>T	ENSP00000357794:p.Glu1142Lys	Somatic	214	2	0.00934579		WXS	Illumina HiSeq	Phase_I	211	7	0.0331754	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.334416	0.24253	.	.	ENSG00000159450	ENST00000368804	T	0.05786	3.39	2.89	1.94	0.25998	.	.	.	.	.	T	0.01489	0.0048	N	0.24115	0.695	0.09310	N	1	P	0.47762	0.9	B	0.37989	0.262	T	0.48445	-0.9035	9	0.46703	T	0.11	.	9.5203	0.39131	0.0:0.7829:0.2171:0.0	.	1142	Q07283	TRHY_HUMAN	K	1142	ENSP00000357794:E1142K	ENSP00000357794:E1142K	E	-	1	0	TCHH	150348893	0.001000	0.12720	0.001000	0.08648	0.229000	0.25112	0.771000	0.26633	0.375000	0.24679	0.455000	0.32223	GAG	.	.	none		0.602	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
FRAS1	80144	hgsc.bcm.edu	37	4	79328899	79328899	+	Silent	SNP	C	C	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr4:79328899C>G	ENST00000325942.6	+	31	4652	c.4212C>G	c.(4210-4212)acC>acG	p.T1404T	FRAS1_ENST00000264895.6_Silent_p.T1404T	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1404					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GGACAGCTACCCCCACCAGCA	0.597																																					p.T1404T		Atlas-SNP	.											.	FRAS1	779	.	0			c.C4212G						PASS	.						80.0	87.0	85.0					4																	79328899		2124	4233	6357	SO:0001819	synonymous_variant	80144	exon31			AGCTACCCCCACC	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4212C>G	4.37:g.79328899C>G		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	98	8	0.0816327	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000325942.6	37	CCDS54772.1																																																																																			.	.	none		0.597	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
AQP7	364	hgsc.bcm.edu	37	9	33385815	33385815	+	Missense_Mutation	SNP	T	T	C	rs62542745		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr9:33385815T>C	ENST00000537089.1	-	6	617	c.299A>G	c.(298-300)cAg>cGg	p.Q100R	AQP7_ENST00000539936.1_Missense_Mutation_p.Q192R|AQP7_ENST00000377425.4_Missense_Mutation_p.Q135R|AQP7_ENST00000541274.1_Silent_p.P60P			O14520	AQP7_HUMAN	aquaporin 7	192					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GTTGTTCTCCTGGTCCGTGAT	0.612																																					p.Q192R		Atlas-SNP	.											AQP7,NS,carcinoma,0,1	AQP7	58	1	0			c.A575G						scavenged	.						123.0	107.0	113.0					9																	33385815		2203	4300	6503	SO:0001583	missense	364	exon7			TTCTCCTGGTCCG	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.299A>G	9.37:g.33385815T>C	ENSP00000441619:p.Gln100Arg	Somatic	26	1	0.0384615		WXS	Illumina HiSeq	Phase_I	33	6	0.181818	NM_001170	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.	.	.	.	.	.	.	.	.	.	t	2.177	-0.388519	0.04932	.	.	ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503	D;D;D;D;D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93	5.02	3.85	0.44370	Aquaporin-like (2);	0.260173	0.44483	D	0.000447	T	0.69360	0.3102	N	0.20483	0.58	0.09310	N	1	B;B;B;B	0.14012	0.001;0.001;0.001;0.009	B;B;B;B	0.17098	0.006;0.006;0.01;0.017	T	0.51260	-0.8728	10	0.13853	T	0.58	-14.4887	4.9508	0.14013	0.0:0.0932:0.1892:0.7176	rs62542745	191;192;135;192	Q5T5M0;B7Z4U2;Q6P5T0;O14520	.;.;.;AQP7_HUMAN	R	100;191;60;192;135;100;191;192;128	ENSP00000441619:Q100R;ENSP00000368821:Q191R;ENSP00000412868:Q60R;ENSP00000297988:Q192R;ENSP00000396111:Q135R;ENSP00000410138:Q100R;ENSP00000368820:Q191R;ENSP00000439534:Q192R;ENSP00000368817:Q128R	ENSP00000297988:Q192R	Q	-	2	0	AQP7	33375815	0.007000	0.16637	0.339000	0.25562	0.162000	0.22319	0.341000	0.19909	0.903000	0.36546	0.524000	0.50904	CAG	.	.	weak		0.612	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
MUC4	4585	hgsc.bcm.edu	37	3	195510910	195510910	+	Missense_Mutation	SNP	G	G	T	rs576459717		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr3:195510910G>T	ENST00000463781.3	-	2	8000	c.7541C>A	c.(7540-7542)cCt>cAt	p.P2514H	MUC4_ENST00000475231.1_Missense_Mutation_p.P2514H|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGTAGAGGGGT	0.562																																					p.P2514H		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	0			c.C7541A						scavenged	.						90.0	72.0	77.0					3																	195510910		661	1591	2252	SO:0001583	missense	4585	exon2			GTGACAGGTAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7541C>A	3.37:g.195510910G>T	ENSP00000417498:p.Pro2514His	Somatic	319	8	0.0250784		WXS	Illumina HiSeq	Phase_I	213	14	0.0657277	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.532	0.466443	0.12402	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.3;1.37	.	.	.	.	.	.	.	.	T	0.29524	0.0736	N	0.19112	0.55	0.20489	N	0.999893	D	0.54964	0.969	P	0.52710	0.707	T	0.18840	-1.0324	7	.	.	.	.	6.8646	0.24086	1.0E-4:0.0:0.9999:0.0	.	2514	E7ESK3	.	H	2514	ENSP00000417498:P2514H;ENSP00000420243:P2514H	.	P	-	2	0	MUC4	196995305	0.082000	0.21442	0.000000	0.03702	0.000000	0.00434	0.551000	0.23361	-0.000000	0.14550	0.000000	0.15137	CCT	.	.	none		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DDC	1644	hgsc.bcm.edu	37	7	50531011	50531011	+	Missense_Mutation	SNP	G	G	A	rs147562019		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr7:50531011G>A	ENST00000444124.2	-	14	1561	c.1361C>T	c.(1360-1362)aCg>aTg	p.T454M	DDC_ENST00000426377.1_Missense_Mutation_p.T376M|DDC_ENST00000357936.5_Missense_Mutation_p.T454M|DDC_ENST00000431062.1_Missense_Mutation_p.T361M	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	454					catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	AGATTCCACCGTGCGAGAACA	0.547																																					p.T454M		Atlas-SNP	.											.	DDC	100	.	0			c.C1361T						PASS	.	G	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	1,4405		0,1,2202	120.0	104.0	110.0		1361,1361,1247,1217,1127,1082	2.6	0.0	7	dbSNP_134	110	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense	DDC	NM_000790.3,NM_001082971.1,NM_001242886.1,NM_001242887.1,NM_001242888.1,NM_001242889.1	81,81,81,81,81,81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	454/481,454/481,416/443,406/433,376/403,361/388	50531011	1,13005	2203	4300	6503	SO:0001583	missense	1644	exon14			TCCACCGTGCGAG		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.1361C>T	7.37:g.50531011G>A	ENSP00000403644:p.Thr454Met	Somatic	218	0	0		WXS	Illumina HiSeq	Phase_I	165	14	0.0848485	NM_001082971	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	ENST00000444124.2	37	CCDS5511.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.557|7.557	0.663813|0.663813	0.14710|0.14710	2.27E-4|2.27E-4	0.0|0.0	ENSG00000132437|ENSG00000132437	ENST00000430300|ENST00000357936;ENST00000431062;ENST00000426377;ENST00000444124	.|T;T;T;T	.|0.38077	.|1.16;1.16;1.16;1.16	5.44|5.44	2.61|2.61	0.31194|0.31194	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.388045	.|0.31102	.|N	.|0.008259	T|T	0.35451|0.35451	0.0932|0.0932	M|M	0.73962|0.73962	2.25|2.25	0.27720|0.27720	N|N	0.945142|0.945142	.|B;B	.|0.21147	.|0.052;0.052	.|B;B	.|0.12156	.|0.007;0.007	T|T	0.33548|0.33548	-0.9864|-0.9864	5|10	.|0.59425	.|D	.|0.04	-7.455|-7.455	7.8343|7.8343	0.29362|0.29362	0.1397:0.0:0.728:0.1323|0.1397:0.0:0.728:0.1323	.|.	.|454;454	.|Q53Y41;P20711	.|.;DDC_HUMAN	W|M	335|454;361;376;454	.|ENSP00000350616:T454M;ENSP00000399184:T361M;ENSP00000395069:T376M;ENSP00000403644:T454M	.|ENSP00000350616:T454M	R|T	-|-	1|2	2|0	DDC|DDC	50498505|50498505	0.021000|0.021000	0.18746|0.18746	0.002000|0.002000	0.10522|0.10522	0.066000|0.066000	0.16364|0.16364	0.704000|0.704000	0.25661|0.25661	0.245000|0.245000	0.21373|0.21373	0.655000|0.655000	0.94253|0.94253	CGG|ACG	G|1.000;A|0.000	0.000	weak		0.547	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1		
MUC17	140453	hgsc.bcm.edu	37	7	100681303	100681303	+	Silent	SNP	T	T	C	rs143516283		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr7:100681303T>C	ENST00000306151.4	+	3	6670	c.6606T>C	c.(6604-6606)ccT>ccC	p.P2202P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2202	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTTCATCTCCTACAACTTCTG	0.507																																					p.P2202P		Atlas-SNP	.											MUC17,rectum,carcinoma,0,1	MUC17	804	1	0			c.T6606C						scavenged	.						311.0	311.0	311.0					7																	100681303		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			ATCTCCTACAACT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6606T>C	7.37:g.100681303T>C		Somatic	88	6	0.0681818		WXS	Illumina HiSeq	Phase_I	60	6	0.1	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																			.	.	weak		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
TRIM51	84767	hgsc.bcm.edu	37	11	55655597	55655597	+	Silent	SNP	A	A	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:55655597A>G	ENST00000449290.2	+	4	689	c.597A>G	c.(595-597)gaA>gaG	p.E199E	TRIM51_ENST00000244891.3_Silent_p.E56E	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	199						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										ATCACTTGGAAAGGCTGCGAA	0.433																																					p.E199E		Atlas-SNP	.											SPRYD5_ENST00000327733,NS,carcinoma,+2,2	.	.	2	0			c.A597G						scavenged	.						61.0	58.0	59.0					11																	55655597		2201	4296	6497	SO:0001819	synonymous_variant	84767	exon4			CTTGGAAAGGCTG	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.597A>G	11.37:g.55655597A>G		Somatic	412	11	0.026699		WXS	Illumina HiSeq	Phase_I	274	15	0.0547445	NM_032681	A6NMG2	Silent	SNP	ENST00000449290.2	37																																																																																				.	.	none		0.433	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
TLX1	3195	hgsc.bcm.edu	37	10	102896618	102896618	+	Missense_Mutation	SNP	A	A	G	rs567197994	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr10:102896618A>G	ENST00000370196.6	+	3	2983	c.941A>G	c.(940-942)gAc>gGc	p.D314G	RP11-31L23.3_ENST00000411459.1_RNA|TLX1_ENST00000467928.2_3'UTR			P31314	TLX1_HUMAN	T-cell leukemia homeobox 1	314					cell fate commitment (GO:0045165)|central nervous system development (GO:0007417)|neuron differentiation (GO:0030182)|organ formation (GO:0048645)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spleen development (GO:0048536)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|upper_aerodigestive_tract(1)	2				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CCGTGGTCTGACGACTCGACC	0.647			T	"""TRB@, TRD@"""	T-ALL																																p.D314G		Atlas-SNP	.		Dom	yes		10	10q24	3195	""" T-cell leukemia, homeobox 1 (HOX11)"""		L	TLX1,NS,carcinoma,-1,1	TLX1	20	1	0			c.A941G						PASS	.						87.0	71.0	76.0					10																	102896618		2203	4300	6503	SO:0001583	missense	3195	exon3			GGTCTGACGACTC	M62626	CCDS7510.1, CCDS55725.1	10q24.32	2011-06-20	2005-12-22	2002-05-31	ENSG00000107807	ENSG00000107807		"""Homeoboxes / ANTP class : NKL subclass"""	5056	protein-coding gene	gene with protein product	"""Homeo box-11 (T-cell leukemia-3 associated breakpoint, homologous to Drosophila Notch)"", ""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"""	186770	"""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"", ""T-cell leukemia, homeobox 1"""	TCL3, HOX11		1676542, 1973146	Standard	NM_005521		Approved		uc001ksw.3	P31314	OTTHUMG00000019341	ENST00000370196.6:c.941A>G	10.37:g.102896618A>G	ENSP00000359215:p.Asp314Gly	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	124	18	0.145161	NM_005521	A1L4G3|O75699|Q5VXP2|Q9HCA0|Q9UD59	Missense_Mutation	SNP	ENST00000370196.6	37	CCDS7510.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.333134	0.81801	.	.	ENSG00000107807	ENST00000370196	D	0.90069	-2.61	4.39	4.39	0.52855	.	0.048467	0.85682	D	0.000000	D	0.82458	0.5041	L	0.31664	0.95	0.80722	D	1	P	0.37864	0.61	B	0.34873	0.191	D	0.84604	0.0674	10	0.72032	D	0.01	.	13.8955	0.63768	1.0:0.0:0.0:0.0	.	314	P31314	TLX1_HUMAN	G	314	ENSP00000359215:D314G	ENSP00000359215:D314G	D	+	2	0	TLX1	102886608	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.774000	0.91767	1.750000	0.51863	0.379000	0.24179	GAC	.	.	none		0.647	TLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051193.3	NM_005521	
ITPRIPL2	162073	hgsc.bcm.edu	37	16	19126812	19126812	+	Silent	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr16:19126812G>A	ENST00000381440.3	+	1	1559	c.1029G>A	c.(1027-1029)gcG>gcA	p.A343A	CTD-2349B8.1_ENST00000564808.2_Intron	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2	343						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GCCTGCGTGCGGAGGCACTGT	0.667																																					p.A343A		Atlas-SNP	.											.	ITPRIPL2	40	.	0			c.G1029A						PASS	.						32.0	36.0	35.0					16																	19126812		2197	4300	6497	SO:0001819	synonymous_variant	162073	exon1			GCGTGCGGAGGCA		CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.1029G>A	16.37:g.19126812G>A		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	44	4	0.0909091	NM_001034841		Silent	SNP	ENST00000381440.3	37	CCDS32395.1																																																																																			.	.	none		0.667	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435827.3	NM_001034841	
BICC1	80114	hgsc.bcm.edu	37	10	60549152	60549152	+	Missense_Mutation	SNP	G	G	A	rs192860241	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr10:60549152G>A	ENST00000373886.3	+	7	735	c.731G>A	c.(730-732)cGt>cAt	p.R244H		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	244					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						TTTAAACAGCGTTCCCGAATG	0.388													G|||	2	0.000399361	0.0	0.0014	5008	,	,		18107	0.0		0.0	False		,,,				2504	0.001				p.R244H		Atlas-SNP	.											BICC1,colon,carcinoma,+1,1	BICC1	121	1	0			c.G731A						PASS	.						138.0	132.0	134.0					10																	60549152		2203	4300	6503	SO:0001583	missense	80114	exon7			AACAGCGTTCCCG	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.731G>A	10.37:g.60549152G>A	ENSP00000362993:p.Arg244His	Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	155	10	0.0645161	NM_001080512		Missense_Mutation	SNP	ENST00000373886.3	37	CCDS31206.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	26.2	4.712381	0.89112	.	.	ENSG00000122870	ENST00000373886	T	0.32023	1.47	5.66	5.66	0.87406	.	0.048305	0.85682	D	0.000000	T	0.51075	0.1653	L	0.60455	1.87	0.80722	D	1	D	0.76494	0.999	P	0.60117	0.869	T	0.46871	-0.9160	10	0.56958	D	0.05	-7.8917	19.756	0.96291	0.0:0.0:1.0:0.0	.	244	Q9H694	BICC1_HUMAN	H	244	ENSP00000362993:R244H	ENSP00000362993:R244H	R	+	2	0	BICC1	60219158	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.939000	0.70179	2.665000	0.90641	0.655000	0.94253	CGT	G|1.000;A|0.000	0.000	strong		0.388	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044	
SLC6A14	11254	hgsc.bcm.edu	37	X	115588850	115588850	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chrX:115588850G>A	ENST00000371900.4	+	13	1778	c.1690G>A	c.(1690-1692)Gct>Act	p.A564T	SLC6A14_ENST00000463626.1_Intron	NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	564					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CTGGGGAGTTGCTTTAGGCTG	0.368																																					p.A564T		Atlas-SNP	.											.	SLC6A14	56	.	0			c.G1690A						PASS	.						205.0	184.0	191.0					X																	115588850		2203	4300	6503	SO:0001583	missense	11254	exon13			GGAGTTGCTTTAG	AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.1690G>A	X.37:g.115588850G>A	ENSP00000360967:p.Ala564Thr	Somatic	252	0	0		WXS	Illumina HiSeq	Phase_I	136	8	0.0588235	NM_007231	Q5H942	Missense_Mutation	SNP	ENST00000371900.4	37	CCDS14570.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.516113	0.44763	.	.	ENSG00000087916	ENST00000371900	T	0.74947	-0.89	5.17	4.31	0.51392	.	0.169081	0.51477	D	0.000091	T	0.69477	0.3115	L	0.51914	1.62	0.39830	D	0.972966	B	0.32604	0.377	B	0.37047	0.24	T	0.68243	-0.5460	10	0.44086	T	0.13	.	10.5295	0.44969	0.0965:0.0:0.9035:0.0	.	564	Q9UN76	S6A14_HUMAN	T	564	ENSP00000360967:A564T	ENSP00000360967:A564T	A	+	1	0	SLC6A14	115502878	0.998000	0.40836	0.991000	0.47740	0.970000	0.65996	3.357000	0.52277	0.974000	0.38366	0.538000	0.68166	GCT	.	.	none		0.368	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		
MUC6	4588	hgsc.bcm.edu	37	11	1017483	1017483	+	Missense_Mutation	SNP	T	T	G	rs79986665		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:1017483T>G	ENST00000421673.2	-	31	5368	c.5318A>C	c.(5317-5319)cAc>cCc	p.H1773P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1773	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTACTGGTGTGGTTGGGGGT	0.577																																					p.H1773P		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	0			c.A5318C						scavenged	.						544.0	541.0	542.0					11																	1017483		2199	4294	6493	SO:0001583	missense	4588	exon31			CTGGTGTGGTTGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5318A>C	11.37:g.1017483T>G	ENSP00000406861:p.His1773Pro	Somatic	592	110	0.185811		WXS	Illumina HiSeq	Phase_I	377	72	0.190981	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	T	4.174	0.030796	0.08101	.	.	ENSG00000184956	ENST00000421673	T	0.17528	2.27	2.91	0.844	0.18943	.	.	.	.	.	T	0.04907	0.0132	N	0.01109	-1.01	0.09310	N	1	B	0.15930	0.015	B	0.14023	0.01	T	0.43065	-0.9414	9	0.22706	T	0.39	.	6.6218	0.22808	0.0:0.1732:0.4682:0.3586	.	1773	Q6W4X9	MUC6_HUMAN	P	1773	ENSP00000406861:H1773P	ENSP00000406861:H1773P	H	-	2	0	MUC6	1007483	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.094000	0.11094	0.066000	0.16515	-0.743000	0.03520	CAC	T|0.500;G|0.500	0.500	weak		0.577	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
ATN1	1822	hgsc.bcm.edu	37	12	7045906	7045906	+	Silent	SNP	G	G	A	rs377147612		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr12:7045906G>A	ENST00000356654.4	+	5	1713	c.1476G>A	c.(1474-1476)caG>caA	p.Q492Q	ATN1_ENST00000396684.2_Silent_p.Q492Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	492	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.647																																					p.Q492Q		Atlas-SNP	.											.	ATN1	95	.	0			c.G1476A						PASS	.						43.0	53.0	49.0					12																	7045906		2188	4263	6451	SO:0001819	synonymous_variant	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1476G>A	12.37:g.7045906G>A		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	46	5	0.108696	NM_001007026	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																			.	.	none		0.647	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
TPPP	11076	hgsc.bcm.edu	37	5	678087	678087	+	Missense_Mutation	SNP	C	C	T	rs570878136	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr5:678087C>T	ENST00000360578.5	-	2	210	c.89G>A	c.(88-90)aGg>aAg	p.R30K	CTD-2589H19.6_ENST00000607068.1_RNA	NM_007030.2	NP_008961.1	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	30	Mediates interaction with LIMK1.				microtubule bundle formation (GO:0001578)|microtubule polymerization (GO:0046785)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein polymerization (GO:0032273)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.R30K(1)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		CAGCGACAGCCTCTTGGCTGC	0.677													C|||	15	0.00299521	0.0061	0.0	5008	,	,		16462	0.0069		0.0	False		,,,				2504	0.0				p.R30K		Atlas-SNP	.											TPPP,NS,carcinoma,0,1	TPPP	24	1	1	Substitution - Missense(1)	prostate(1)	c.G89A						scavenged	.						14.0	17.0	16.0					5																	678087		2199	4295	6494	SO:0001583	missense	11076	exon2			GACAGCCTCTTGG	AB017016	CCDS3856.1	5p15.33	2008-02-05			ENSG00000171368	ENSG00000171368			24164	protein-coding gene	gene with protein product	"""brain specific protein p25 alpha"""	608773				10083737, 12093283, 15590652, 17105200	Standard	NM_007030		Approved	p25alpha, TPPP1, p25, TPPP/p25	uc003jbh.4	O94811	OTTHUMG00000131011	ENST00000360578.5:c.89G>A	5.37:g.678087C>T	ENSP00000353785:p.Arg30Lys	Somatic	265	5	0.0188679		WXS	Illumina HiSeq	Phase_I	257	8	0.0311284	NM_007030		Missense_Mutation	SNP	ENST00000360578.5	37	CCDS3856.1	.	.	.	.	.	.	.	.	.	.	c	14.67	2.605282	0.46423	.	.	ENSG00000171368	ENST00000360578	T	0.45276	0.9	5.23	5.23	0.72850	.	0.149935	0.44902	D	0.000407	T	0.29588	0.0738	L	0.29908	0.895	0.44635	D	0.997618	B	0.15141	0.012	B	0.13407	0.009	T	0.11867	-1.0570	10	0.05436	T	0.98	-54.1656	16.5545	0.84482	0.0:1.0:0.0:0.0	.	30	O94811	TPPP_HUMAN	K	30	ENSP00000353785:R30K	ENSP00000353785:R30K	R	-	2	0	TPPP	731087	1.000000	0.71417	0.998000	0.56505	0.405000	0.30901	4.081000	0.57627	2.437000	0.82529	0.491000	0.48974	AGG	.	.	none		0.677	TPPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253645.3	NM_007030	
MUC2	4583	hgsc.bcm.edu	37	11	1093286	1093286	+	Missense_Mutation	SNP	C	C	G	rs201333212		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:1093286C>G	ENST00000441003.2	+	30	5132	c.5105C>G	c.(5104-5106)aCc>aGc	p.T1702S	MUC2_ENST00000359061.5_Missense_Mutation_p.T1669S|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1669S(1)|p.T1702S(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	acacccatcaccaccaccact	0.632																																					p.T1702S		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,6	MUC2	614	6	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.C5105G						scavenged	.						116.0	161.0	145.0					11																	1093286		1870	3438	5308	SO:0001583	missense	4583	exon30			CCATCACCACCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5105C>G	11.37:g.1093286C>G	ENSP00000415183:p.Thr1702Ser	Somatic	11	1	0.0909091		WXS	Illumina HiSeq	Phase_I	9	3	0.333333	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	1.291	-0.607547	0.03717	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.12361	2.84;2.69	1.6	-3.2	0.05156	.	194.215000	0.04190	U	0.328173	T	0.04998	0.0134	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.28202	-1.0051	9	0.10111	T	0.7	.	0.5419	0.00647	0.3852:0.249:0.1961:0.1696	.	1702	E7EUV1	.	S	1702;1669	ENSP00000415183:T1702S;ENSP00000351956:T1669S	ENSP00000351956:T1669S	T	+	2	0	MUC2	1083286	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.007000	0.03667	-1.356000	0.02183	0.184000	0.17185	ACC	.	.	weak		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MPEG1	219972	hgsc.bcm.edu	37	11	58978519	58978519	+	Missense_Mutation	SNP	G	G	A	rs376216311		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:58978519G>A	ENST00000361050.3	-	1	1905	c.1820C>T	c.(1819-1821)aCc>aTc	p.T607I		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	607						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				GACAGTATTGGTGGCAGCCTG	0.582																																					p.T607I		Atlas-SNP	.											.	MPEG1	72	.	0			c.C1820T						PASS	.						108.0	114.0	112.0					11																	58978519		1948	4124	6072	SO:0001583	missense	219972	exon1			GTATTGGTGGCAG	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1820C>T	11.37:g.58978519G>A	ENSP00000354335:p.Thr607Ile	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	126	15	0.119048	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	37	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.559489	0.27827	.	.	ENSG00000197629	ENST00000361050	T	0.25085	1.82	5.69	5.69	0.88448	.	0.113776	0.64402	D	0.000019	T	0.47619	0.1455	M	0.72894	2.215	0.43300	D	0.995291	D	0.65815	0.995	P	0.59424	0.857	T	0.40608	-0.9554	10	0.54805	T	0.06	-19.9386	16.7224	0.85413	0.0:0.0:1.0:0.0	.	607	Q2M385	MPEG1_HUMAN	I	607	ENSP00000354335:T607I	ENSP00000354335:T607I	T	-	2	0	MPEG1	58735095	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	3.083000	0.50136	2.682000	0.91365	0.655000	0.94253	ACC	.	.	alt		0.582	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
PADI1	29943	hgsc.bcm.edu	37	1	17566209	17566209	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:17566209C>G	ENST00000375471.4	+	14	1655	c.1563C>G	c.(1561-1563)caC>caG	p.H521Q	PADI1_ENST00000460293.1_3'UTR|PADI1_ENST00000413717.2_Missense_Mutation_p.H78Q|PADI1_ENST00000537499.1_Missense_Mutation_p.H78Q|PADI1_ENST00000536552.1_5'UTR	NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	521					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	GGTTAAAACACCAGGCAAAAA	0.517																																					p.H521Q	Esophageal Squamous(80;414 1257 4580 27746 50832)	Atlas-SNP	.											.	PADI1	77	.	0			c.C1563G						PASS	.						63.0	61.0	62.0					1																	17566209		2203	4300	6503	SO:0001583	missense	29943	exon14			AAAACACCAGGCA	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.1563C>G	1.37:g.17566209C>G	ENSP00000364620:p.His521Gln	Somatic	203	0	0		WXS	Illumina HiSeq	Phase_I	128	14	0.109375	NM_013358	A1L4K6|Q70SX6	Missense_Mutation	SNP	ENST00000375471.4	37	CCDS178.1	.	.	.	.	.	.	.	.	.	.	C	3.748	-0.052131	0.07362	.	.	ENSG00000142623	ENST00000375471;ENST00000537499;ENST00000413717	T;T;T	0.21361	2.01;2.01;2.01	5.0	-3.5	0.04710	Protein-arginine deiminase, C-terminal (1);	1.843040	0.02096	N	0.053523	T	0.14141	0.0342	L	0.39898	1.24	0.18873	N	0.999982	B;B	0.13594	0.008;0.002	B;B	0.14578	0.011;0.005	T	0.15549	-1.0433	10	0.23302	T	0.38	-5.7269	0.9834	0.01441	0.1784:0.3415:0.1289:0.3512	.	78;521	B4DPX6;Q9ULC6	.;PADI1_HUMAN	Q	521;78;78	ENSP00000364620:H521Q;ENSP00000444032:H78Q;ENSP00000396697:H78Q	ENSP00000364620:H521Q	H	+	3	2	PADI1	17438796	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.834000	0.01693	-0.305000	0.08831	0.563000	0.77884	CAC	.	.	none		0.517	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006621.1	NM_013358	
VIPR2	7434	hgsc.bcm.edu	37	7	158935181	158935181	+	Silent	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr7:158935181T>C	ENST00000262178.2	-	2	293	c.108A>G	c.(106-108)acA>acG	p.T36T	VIPR2_ENST00000421760.2_Silent_p.T36T|VIPR2_ENST00000402066.1_Silent_p.T177T	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	36					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		CTGCACATTTTGTTTCTTCCT	0.423																																					p.T36T	Pancreas(154;1876 1931 2329 17914 20079)	Atlas-SNP	.											.	VIPR2	53	.	0			c.A108G						PASS	.						217.0	202.0	207.0					7																	158935181		2203	4298	6501	SO:0001819	synonymous_variant	7434	exon2			ACATTTTGTTTCT	CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.108A>G	7.37:g.158935181T>C		Somatic	264	0	0		WXS	Illumina HiSeq	Phase_I	190	21	0.110526	NM_003382	Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Silent	SNP	ENST00000262178.2	37	CCDS5950.1	.	.	.	.	.	.	.	.	.	.	T	14.89	2.671893	0.47781	.	.	ENSG00000106018	ENST00000418475	.	.	.	5.09	-3.04	0.05412	.	.	.	.	.	T	0.49012	0.1532	.	.	.	0.53688	D	0.999975	.	.	.	.	.	.	T	0.45234	-0.9275	4	.	.	.	.	6.3447	0.21343	0.0:0.1642:0.4153:0.4205	.	.	.	.	R	31	.	.	Q	-	2	0	VIPR2	158627942	0.850000	0.29656	0.923000	0.36655	0.980000	0.70556	-0.238000	0.08977	-0.256000	0.09473	0.482000	0.46254	CAA	.	.	none		0.423	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322675.1	NM_003382	
MPEG1	219972	hgsc.bcm.edu	37	11	58979544	58979544	+	Silent	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:58979544G>A	ENST00000361050.3	-	1	880	c.795C>T	c.(793-795)agC>agT	p.S265S	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	265	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				TTGAGAGGTAGCTCTTGGTGA	0.532																																					p.S265S		Atlas-SNP	.											.	MPEG1	72	.	0			c.C795T						PASS	.						38.0	36.0	37.0					11																	58979544		1901	4108	6009	SO:0001819	synonymous_variant	219972	exon1			GAGGTAGCTCTTG	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.795C>T	11.37:g.58979544G>A		Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	133	12	0.0902256	NM_001039396	Q2M1T6|Q8TEF8	Silent	SNP	ENST00000361050.3	37	CCDS41650.1																																																																																			.	.	none		0.532	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
KRTAP10-12	386685	hgsc.bcm.edu	37	21	46117576	46117576	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr21:46117576C>T	ENST00000400365.3	+	1	490	c.460C>T	c.(460-462)Ccc>Tcc	p.P154S	TSPEAR_ENST00000323084.4_Intron	NM_198699.1	NP_941972.1	P60413	KR10C_HUMAN	keratin associated protein 10-12	154	19 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(8)	9						CTGCTGTGTGCCCGTCTGCTG	0.617																																					p.P154S		Atlas-SNP	.											KRTAP10-12,rectum,carcinoma,0,2	KRTAP10-12	21	2	0			c.C460T						scavenged	.						177.0	182.0	180.0					21																	46117576		2203	4300	6503	SO:0001583	missense	386685	exon1			TGTGTGCCCGTCT	AB076364	CCDS42967.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000189169	ENSG00000189169		"""Keratin associated proteins"""	20533	protein-coding gene	gene with protein product			"""keratin associated protein 18-12"""	KRTAP18-12			Standard	NM_198699		Approved	KRTAP18.12, KAP10.12	uc002zfw.1	P60413	OTTHUMG00000057629	ENST00000400365.3:c.460C>T	21.37:g.46117576C>T	ENSP00000383216:p.Pro154Ser	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	64	4	0.0625	NM_198699	B2RPA3	Missense_Mutation	SNP	ENST00000400365.3	37	CCDS42967.1	.	.	.	.	.	.	.	.	.	.	c	2.310	-0.358108	0.05138	.	.	ENSG00000189169	ENST00000400365;ENST00000452870	T	0.00648	5.99	3.7	1.73	0.24493	.	.	.	.	.	T	0.00815	0.0027	L	0.49778	1.585	0.09310	N	1	B	0.24963	0.115	B	0.25884	0.064	T	0.44360	-0.9333	9	0.15952	T	0.53	.	10.0177	0.42024	0.3626:0.6374:0.0:0.0	.	154	P60413	KR10C_HUMAN	S	154;62	ENSP00000383216:P154S	ENSP00000383216:P154S	P	+	1	0	KRTAP10-12	44942004	0.001000	0.12720	0.001000	0.08648	0.016000	0.09150	0.087000	0.14958	0.117000	0.18138	0.305000	0.20034	CCC	.	.	none		0.617	KRTAP10-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128032.1	NM_198699	
HS6ST2	90161	hgsc.bcm.edu	37	X	132091067	132091067	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chrX:132091067C>A	ENST00000370836.2	-	3	1131	c.716G>T	c.(715-717)gGc>gTc	p.G239V	HS6ST2_ENST00000370833.2_Missense_Mutation_p.G93V|HS6ST2_ENST00000521489.1_Missense_Mutation_p.G239V	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	239	5'-phosphosulfate-binding. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					GAAAGTGGTGCCCCCGGTCTT	0.617																																					p.G239V		Atlas-SNP	.											.	HS6ST2	89	.	0			c.G716T						PASS	.						28.0	34.0	32.0					X																	132091067		2186	4279	6465	SO:0001583	missense	90161	exon3			GTGGTGCCCCCGG	AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.716G>T	X.37:g.132091067C>A	ENSP00000359873:p.Gly239Val	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	100	8	0.08	NM_001077188	B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	ENST00000370836.2	37	CCDS48169.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909561	0.72868	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000370833;ENST00000319809	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.70613	0.3244	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78375	-0.2228	10	0.87932	D	0	-18.7584	15.4915	0.75607	0.0:1.0:0.0:0.0	.	239;239	Q96MM7;E9PDY5	H6ST2_HUMAN;.	V	93;239;239;93;80	ENSP00000359874:G93V;ENSP00000359873:G239V;ENSP00000429473:G239V;ENSP00000359870:G93V	ENSP00000324617:G80V	G	-	2	0	HS6ST2	131918749	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.244000	0.78228	2.212000	0.71576	0.529000	0.55759	GGC	.	.	none		0.617	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058332.3	NM_147174	
TBC1D29	26083	hgsc.bcm.edu	37	17	28887667	28887667	+	Silent	SNP	T	T	C	rs78888987	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr17:28887667T>C	ENST00000580161.1	+	4	2608	c.111T>C	c.(109-111)gaT>gaC	p.D37D	TBC1D29_ENST00000584297.1_Silent_p.D37D|RP11-218M11.6_ENST00000582125.1_RNA|TBC1D29_ENST00000579181.1_Silent_p.D37D			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	37	Rab-GAP TBC; truncated. {ECO:0000255|PROSITE-ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.D37D(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				GCCTGTGGGATATGTATTTGC	0.572																																					p.D37D		Atlas-SNP	.											TBC1D29,NS,carcinoma,0,1	TBC1D29	19	1	1	Substitution - coding silent(1)	lung(1)	c.T111C						scavenged	.						149.0	126.0	134.0					17																	28887667		2203	4300	6503	SO:0001819	synonymous_variant	26083	exon3			GTGGGATATGTAT	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.111T>C	17.37:g.28887667T>C		Somatic	56	1	0.0178571		WXS	Illumina HiSeq	Phase_I	44	6	0.136364	NM_015594		Silent	SNP	ENST00000580161.1	37	CCDS32606.1																																																																																			T|0.806;C|0.194	0.194	strong		0.572	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443632.1	NM_015594	
DRD5	1816	hgsc.bcm.edu	37	4	9784542	9784542	+	Missense_Mutation	SNP	A	A	C	rs2227851		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr4:9784542A>C	ENST00000304374.2	+	1	1285	c.889A>C	c.(889-891)Acc>Ccc	p.T297P		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	297			T -> P (in dbSNP:rs2227851).		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GGTTCTCAAGACCCTGTCGGT	0.632																																					p.T297P		Atlas-SNP	.											DRD5,colon,carcinoma,0,1	DRD5	119	1	0			c.A889C						scavenged	.						54.0	51.0	52.0					4																	9784542		2202	4297	6499	SO:0001583	missense	1816	exon1			CTCAAGACCCTGT	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.889A>C	4.37:g.9784542A>C	ENSP00000306129:p.Thr297Pro	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	32	3	0.09375	NM_000798	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	a	19.24	3.788678	0.70337	.	.	ENSG00000169676	ENST00000304374	T	0.40225	1.04	4.73	4.73	0.59995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.79879	0.4522	H	0.99668	4.69	0.09310	P	0.999999880898	D	0.89917	1.0	D	0.97110	1.0	D	0.89804	0.3977	9	0.87932	D	0	.	13.5854	0.61928	1.0:0.0:0.0:0.0	rs2227851	297	P21918	DRD5_HUMAN	P	297	ENSP00000306129:T297P	ENSP00000306129:T297P	T	+	1	0	DRD5	9393640	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	8.711000	0.91396	1.990000	0.58119	0.377000	0.23210	ACC	A|0.989;C|0.011	0.011	weak		0.632	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
BTG1	694	hgsc.bcm.edu	37	12	92539203	92539203	+	Silent	SNP	G	G	A	rs369374957		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr12:92539203G>A	ENST00000256015.3	-	1	470	c.109C>T	c.(109-111)Ctg>Ttg	p.L37L	C12orf79_ENST00000551563.2_5'Flank|C12orf79_ENST00000546975.1_5'Flank|RP11-796E2.4_ENST00000499685.2_RNA|RP11-796E2.4_ENST00000501008.2_RNA|C12orf79_ENST00000549802.1_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	37					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)	p.L37L(1)		haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				AAGGTCTGCAGCTGTCGCTCG	0.677			T	MYC	BCLL																																p.L37L		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	BTG1,NS,lymphoid_neoplasm,0,3	BTG1	30	3	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.C109T						PASS	.						38.0	41.0	40.0					12																	92539203		2203	4300	6503	SO:0001819	synonymous_variant	694	exon1			TCTGCAGCTGTCG		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.109C>T	12.37:g.92539203G>A		Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	181	8	0.0441989	NM_001731	P31607	Silent	SNP	ENST00000256015.3	37	CCDS9043.1																																																																																			.	.	alt		0.677	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
KIF25	3834	hgsc.bcm.edu	37	6	168443315	168443315	+	Missense_Mutation	SNP	G	G	A	rs146787013	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr6:168443315G>A	ENST00000443060.2	+	9	1295	c.904G>A	c.(904-906)Gtc>Atc	p.V302I	KIF25_ENST00000351261.3_Intron|KIF25_ENST00000354419.2_Missense_Mutation_p.V302I			Q9UIL4	KIF25_HUMAN	kinesin family member 25	302	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CCTGGCAGGCGTCCTGGGGGC	0.647													G|||	46	0.0091853	0.0318	0.0058	5008	,	,		16877	0.0		0.0	False		,,,				2504	0.0				p.V302I		Atlas-SNP	.											KIF25,NS,carcinoma,-2,1	KIF25	75	1	0			c.G904A						PASS	.	G	,ILE/VAL	88,4318	73.6+/-111.7	0,88,2115	98.0	95.0	96.0		,904	3.2	0.3	6	dbSNP_134	96	0,8600		0,0,4300	yes	intron,missense	KIF25	NM_005355.3,NM_030615.2	,29	0,88,6415	AA,AG,GG		0.0,1.9973,0.6766	,probably-damaging	,302/385	168443315	88,12918	2203	4300	6503	SO:0001583	missense	3834	exon8			GCAGGCGTCCTGG	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.904G>A	6.37:g.168443315G>A	ENSP00000388878:p.Val302Ile	Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	62	12	0.193548	NM_030615	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	CCDS5305.1	14	0.00641025641025641	11	0.022357723577235773	3	0.008287292817679558	0	0.0	0	0.0	G	14.81	2.647615	0.47258	0.019973	0.0	ENSG00000125337	ENST00000443060;ENST00000354419	T;T	0.79454	-1.27;-1.27	4.13	3.24	0.37175	Kinesin, motor domain (3);	0.000000	0.64402	D	0.000002	D	0.84433	0.5471	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.86005	0.1497	10	0.87932	D	0	-20.8353	9.7087	0.40231	0.1042:0.0:0.8958:0.0	.	302	Q9UIL4	KIF25_HUMAN	I	302	ENSP00000388878:V302I;ENSP00000346401:V302I	ENSP00000346401:V302I	V	+	1	0	KIF25	168186164	1.000000	0.71417	0.297000	0.24988	0.082000	0.17680	4.083000	0.57643	0.839000	0.34971	0.543000	0.68304	GTC	G|0.993;A|0.007	0.007	strong		0.647	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1		
PCDH17	27253	hgsc.bcm.edu	37	13	58209024	58209024	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr13:58209024G>A	ENST00000377918.3	+	1	2370	c.2344G>A	c.(2344-2346)Gtc>Atc	p.V782I		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	782					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CGCCATGAACGTCATGAACGT	0.597																																					p.V782I	Melanoma(72;952 1291 1619 12849 33676)	Atlas-SNP	.											.	PCDH17	304	.	0			c.G2344A						PASS	.						106.0	99.0	102.0					13																	58209024		2203	4300	6503	SO:0001583	missense	27253	exon1			ATGAACGTCATGA	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2344G>A	13.37:g.58209024G>A	ENSP00000367151:p.Val782Ile	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	41	5	0.121951	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.976644	0.34848	.	.	ENSG00000118946	ENST00000377918	T	0.53640	0.61	5.21	5.21	0.72293	.	0.055010	0.64402	D	0.000001	T	0.40272	0.1110	L	0.36672	1.1	0.46131	D	0.998881	B;B	0.23442	0.085;0.051	B;B	0.18263	0.021;0.011	T	0.15292	-1.0442	9	.	.	.	.	18.9482	0.92630	0.0:0.0:1.0:0.0	.	782;782	O14917-2;O14917	.;PCD17_HUMAN	I	782	ENSP00000367151:V782I	.	V	+	1	0	PCDH17	57107025	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.375000	0.79646	2.708000	0.92522	0.467000	0.42956	GTC	.	.	none		0.597	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
ITCH	83737	hgsc.bcm.edu	37	20	32996580	32996580	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr20:32996580G>A	ENST00000262650.6	+	4	330	c.194G>A	c.(193-195)tGg>tAg	p.W65*	ITCH_ENST00000374864.4_Nonsense_Mutation_p.W65*|ITCH_ENST00000535650.1_Intron			Q96J02	ITCH_HUMAN	itchy E3 ubiquitin protein ligase	65	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of defense response to virus (GO:0050687)|negative regulation of JNK cascade (GO:0046329)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cell growth (GO:0001558)|regulation of protein deubiquitination (GO:0090085)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	CXCR chemokine receptor binding (GO:0045236)|ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(9)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(13)|skin(1)|upper_aerodigestive_tract(1)	36						AGTCCCAAGTGGAAGCAACCC	0.353																																					p.W65X		Atlas-SNP	.											.	ITCH	73	.	0			c.G194A						PASS	.						127.0	117.0	120.0					20																	32996580		2203	4300	6503	SO:0001587	stop_gained	83737	exon4			CCAAGTGGAAGCA	AF095745	CCDS13234.1, CCDS58768.1, CCDS58769.1	20q11.22	2014-09-17	2012-02-23		ENSG00000078747	ENSG00000078747			13890	protein-coding gene	gene with protein product		606409	"""itchy (mouse homolog) E3 ubiquitin protein ligase"", ""itchy E3 ubiquitin protein ligase homolog (mouse)"""			11318614	Standard	NM_001257137		Approved	AIP4	uc010geu.2	Q96J02	OTTHUMG00000032300	ENST00000262650.6:c.194G>A	20.37:g.32996580G>A	ENSP00000262650:p.Trp65*	Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	105	10	0.0952381	NM_001257137	A6NEW4|B4E234|E1P5P3|F5H217|O43584|Q5QP37|Q5TEL0|Q96F66|Q9BY75|Q9H451|Q9H4U5	Nonsense_Mutation	SNP	ENST00000262650.6	37	CCDS58768.1	.	.	.	.	.	.	.	.	.	.	G	36	5.743412	0.96873	.	.	ENSG00000078747	ENST00000374864;ENST00000262650	.	.	.	5.24	5.24	0.73138	.	0.177655	0.53938	D	0.000057	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4283	0.90617	0.0:0.0:1.0:0.0	.	.	.	.	X	65	.	ENSP00000262650:W65X	W	+	2	0	ITCH	32460241	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.385000	0.97223	2.464000	0.83262	0.655000	0.94253	TGG	.	.	none		0.353	ITCH-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078783.2		
AHNAK2	113146	hgsc.bcm.edu	37	14	105411852	105411852	+	Silent	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr14:105411852T>C	ENST00000333244.5	-	7	10055	c.9936A>G	c.(9934-9936)aaA>aaG	p.K3312K	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3312						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCATCTTGAATTTGGGCATTT	0.622																																					p.K3312K		Atlas-SNP	.											AHNAK2_ENST00000333244,NS,carcinoma,-1,1	AHNAK2	719	1	0			c.A9936G						scavenged	.						205.0	199.0	201.0					14																	105411852		2003	4164	6167	SO:0001819	synonymous_variant	113146	exon7			CTTGAATTTGGGC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9936A>G	14.37:g.105411852T>C		Somatic	140	1	0.00714286		WXS	Illumina HiSeq	Phase_I	114	2	0.0175439	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.	.	none		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
SFR1	119392	hgsc.bcm.edu	37	10	105883796	105883796	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr10:105883796G>A	ENST00000369727.3	+	3	479	c.460G>A	c.(460-462)Gct>Act	p.A154T	SFR1_ENST00000336358.5_Missense_Mutation_p.A216T|SFR1_ENST00000369729.3_Missense_Mutation_p.A141T	NM_001002759.1	NP_001002759.1	Q86XK3	SFR1_HUMAN	SWI5-dependent recombination repair 1	154					double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)											AAGATTAAACGCTGAAAAAGC	0.393																																					p.A154T		Atlas-SNP	.											MEIR5,NS,carcinoma,-2,1	.	.	1	0			c.G460A						PASS	.						44.0	46.0	45.0					10																	105883796		2203	4300	6503	SO:0001583	missense	119392	exon3			TTAAACGCTGAAA	BC020892	CCDS31279.1, CCDS31280.1	10q25.1	2013-10-11	2011-08-01	2011-08-01	ENSG00000156384	ENSG00000156384			29574	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 78"", ""MEI5 recombination repair protein homolog (S. cerevisiae)"""	C10orf78, MEIR5		21252223, 21779174, 20976249	Standard	NM_145247		Approved	MEI5, bA373N18.1, FLJ41960	uc001kxu.3	Q86XK3	OTTHUMG00000019000	ENST00000369727.3:c.460G>A	10.37:g.105883796G>A	ENSP00000358742:p.Ala154Thr	Somatic	297	0	0		WXS	Illumina HiSeq	Phase_I	203	24	0.118227	NM_001002759	A8K569|B2RTV8|Q5JT39|Q5JT40|Q8WW47	Missense_Mutation	SNP	ENST00000369727.3	37	CCDS31279.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.524280	0.44866	.	.	ENSG00000156384	ENST00000369729;ENST00000369727;ENST00000336358	T;T;T	0.45276	0.95;0.94;0.9	5.72	2.67	0.31697	.	0.329743	0.32190	N	0.006447	T	0.18759	0.0450	N	0.08118	0	0.09310	N	0.999995	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.20739	-1.0266	10	0.17369	T	0.5	-5.8542	7.0584	0.25111	0.1524:0.2566:0.591:0.0	.	216;154	Q86XK3-2;Q86XK3	.;SFR1_HUMAN	T	141;154;216	ENSP00000358744:A141T;ENSP00000358742:A154T;ENSP00000338089:A216T	ENSP00000338089:A216T	A	+	1	0	SFR1	105873786	1.000000	0.71417	0.879000	0.34478	0.681000	0.39784	2.676000	0.46883	0.350000	0.24002	0.655000	0.94253	GCT	.	.	none		0.393	SFR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050191.1	NM_145247	
TAB3	257397	hgsc.bcm.edu	37	X	30873153	30873153	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chrX:30873153G>T	ENST00000378933.1	-	3	806	c.629C>A	c.(628-630)cCa>cAa	p.P210Q	TAB3_ENST00000378932.2_Missense_Mutation_p.P210Q|TAB3_ENST00000378928.1_5'Flank|TAB3_ENST00000288422.2_Missense_Mutation_p.P210Q|TAB3_ENST00000378930.3_Missense_Mutation_p.P210Q|TAB3-AS2_ENST00000445240.1_RNA	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	210	Pro-rich.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						TAAAGCTCTTGGTACAGTCTG	0.428																																					p.P210Q	Pancreas(164;1598 1985 29022 43301 49529)	Atlas-SNP	.											.	TAB3	82	.	0			c.C629A						PASS	.						74.0	67.0	69.0					X																	30873153		2202	4300	6502	SO:0001583	missense	257397	exon6			GCTCTTGGTACAG	AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.629C>A	X.37:g.30873153G>T	ENSP00000368215:p.Pro210Gln	Somatic	243	0	0		WXS	Illumina HiSeq	Phase_I	170	22	0.129412	NM_152787	A6NDD9|Q6VQR0	Missense_Mutation	SNP	ENST00000378933.1	37	CCDS14226.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805702	0.50315	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932	D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.84	5.31	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.87625	0.6224	L	0.54323	1.7	0.58432	D	0.999996	B;B	0.33318	0.408;0.286	B;B	0.31101	0.124;0.058	D	0.87804	0.2627	10	0.51188	T	0.08	-3.3679	14.5534	0.68084	0.0:0.0:0.8535:0.1465	.	210;210	Q8N5C8-2;Q8N5C8	.;TAB3_HUMAN	Q	210	ENSP00000368215:P210Q;ENSP00000368212:P210Q;ENSP00000288422:P210Q;ENSP00000368214:P210Q	ENSP00000288422:P210Q	P	-	2	0	TAB3	30783074	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.915000	0.69973	2.219000	0.72066	0.600000	0.82982	CCA	.	.	none		0.428	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056173.1	NM_152787	
TBP	6908	hgsc.bcm.edu	37	6	170871058	170871058	+	Silent	SNP	G	G	A	rs113440919		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr6:170871058G>A	ENST00000392092.2	+	3	513	c.234G>A	c.(232-234)caG>caA	p.Q78Q	TBP_ENST00000230354.6_Silent_p.Q78Q|TBP_ENST00000540980.1_Silent_p.Q58Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	78	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcagcagcagcagc	0.577																																					p.Q78Q		Atlas-SNP	.											TBP,caecum,carcinoma,0,1	TBP	58	1	0			c.G234A						scavenged	.						13.0	18.0	16.0					6																	170871058		1927	3786	5713	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.234G>A	6.37:g.170871058G>A		Somatic	39	1	0.025641		WXS	Illumina HiSeq	Phase_I	33	4	0.121212	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			G|0.500;A|0.500	0.500	weak		0.577	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
ELOVL6	79071	hgsc.bcm.edu	37	4	111119485	111119485	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr4:111119485T>G	ENST00000394607.3	-	2	170	c.7A>C	c.(7-9)Atg>Ctg	p.M3L	ELOVL6_ENST00000302274.3_Missense_Mutation_p.M3L|ELOVL6_ENST00000506461.1_5'UTR			Q9H5J4	ELOV6_HUMAN	ELOVL fatty acid elongase 6	3					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty acid biosynthetic process (GO:0042759)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	8				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		AACACTGACATGTTCATTGGG	0.428																																					p.M3L		Atlas-SNP	.											.	ELOVL6	27	.	0			c.A7C						PASS	.						200.0	174.0	183.0					4																	111119485		2203	4300	6503	SO:0001583	missense	79071	exon2			CTGACATGTTCAT	AK027031	CCDS3690.1	4q25	2011-05-25	2011-05-25		ENSG00000170522	ENSG00000170522			15829	protein-coding gene	gene with protein product		611546	"""ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"""			11567032	Standard	NM_024090		Approved	FLJ23378, MGC5487, LCE	uc003hzz.3	Q9H5J4	OTTHUMG00000132547	ENST00000394607.3:c.7A>C	4.37:g.111119485T>G	ENSP00000378105:p.Met3Leu	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	102	7	0.0686275	NM_001130721	Q4W5L0|Q8NCD1	Missense_Mutation	SNP	ENST00000394607.3	37	CCDS3690.1	.	.	.	.	.	.	.	.	.	.	T	16.99	3.274309	0.59649	.	.	ENSG00000170522	ENST00000394607;ENST00000302274;ENST00000506625;ENST00000503885	T;T	0.20200	2.09;2.09	5.68	5.68	0.88126	.	0.150731	0.64402	D	0.000016	T	0.14399	0.0348	N	0.19112	0.55	0.47511	D	0.999443	B	0.02656	0.0	B	0.01281	0.0	T	0.11131	-1.0600	10	0.16420	T	0.52	-11.0653	14.9246	0.70866	0.0:0.0:0.0:1.0	.	3	Q9H5J4	ELOV6_HUMAN	L	3	ENSP00000378105:M3L;ENSP00000304736:M3L	ENSP00000304736:M3L	M	-	1	0	ELOVL6	111338934	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.985000	0.76193	2.168000	0.68352	0.533000	0.62120	ATG	.	.	none		0.428	ELOVL6-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255748.1	NM_024090	
CDH11	1009	hgsc.bcm.edu	37	16	64981740	64981740	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr16:64981740G>T	ENST00000268603.4	-	13	2772	c.2157C>A	c.(2155-2157)gaC>gaA	p.D719E	CDH11_ENST00000566827.1_Missense_Mutation_p.D593E|CDH11_ENST00000394156.3_3'UTR	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	719					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TGTTGATGAAGTCATCGACAT	0.527			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.D719E		Atlas-SNP	.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	CDH11	260	.	0			c.C2157A						PASS	.						120.0	110.0	114.0					16																	64981740		2203	4300	6503	SO:0001583	missense	1009	exon13			GATGAAGTCATCG	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.2157C>A	16.37:g.64981740G>T	ENSP00000268603:p.Asp719Glu	Somatic	190	0	0		WXS	Illumina HiSeq	Phase_I	162	15	0.0925926	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	G	7.665	0.685808	0.14973	.	.	ENSG00000140937	ENST00000268603;ENST00000538390	T	0.76709	-1.04	6.02	2.6	0.31112	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	T	0.54679	0.1873	N	0.05012	-0.13	0.48135	D	0.999594	B	0.13594	0.008	B	0.24006	0.05	T	0.39961	-0.9588	10	0.18276	T	0.48	.	9.6097	0.39654	0.3055:0.0:0.6945:0.0	.	719	P55287	CAD11_HUMAN	E	719;702	ENSP00000268603:D719E	ENSP00000268603:D719E	D	-	3	2	CDH11	63539241	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.451000	0.52964	0.890000	0.36211	0.655000	0.94253	GAC	.	.	none		0.527	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
ITLN1	55600	hgsc.bcm.edu	37	1	160850422	160850422	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:160850422C>T	ENST00000326245.3	-	6	756	c.641G>A	c.(640-642)gGc>gAc	p.G214D	ITLN1_ENST00000487531.1_5'UTR	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	214	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CTGGGCGTCGCCAAAATCATA	0.438																																					p.G214D		Atlas-SNP	.											ITLN1,caecum,carcinoma,+1,1	ITLN1	45	1	0			c.G641A						PASS	.						181.0	181.0	181.0					1																	160850422		2203	4300	6503	SO:0001583	missense	55600	exon6			GCGTCGCCAAAAT	AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.641G>A	1.37:g.160850422C>T	ENSP00000323587:p.Gly214Asp	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	91	22	0.241758	NM_017625	Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Missense_Mutation	SNP	ENST00000326245.3	37	CCDS1211.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.496243	0.44352	.	.	ENSG00000179914	ENST00000326245	T	0.20200	2.09	4.17	3.25	0.37280	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	0.000000	0.64402	D	0.000005	T	0.41282	0.1152	M	0.91510	3.215	0.45194	D	0.998203	D	0.89917	1.0	D	0.97110	1.0	T	0.50866	-0.8777	10	0.87932	D	0	-11.3367	9.6915	0.40131	0.0:0.8959:0.0:0.1041	.	214	Q8WWA0	ITLN1_HUMAN	D	214	ENSP00000323587:G214D	ENSP00000323587:G214D	G	-	2	0	ITLN1	159117046	0.856000	0.29760	0.825000	0.32803	0.184000	0.23303	4.577000	0.60922	0.942000	0.37525	0.655000	0.94253	GGC	.	.	none		0.438	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071462.1	NM_017625	
KRTAP10-2	386679	hgsc.bcm.edu	37	21	45971108	45971108	+	Silent	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr21:45971108C>T	ENST00000391621.1	-	1	280	c.234G>A	c.(232-234)tcG>tcA	p.S78S	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron|KRTAP10-2_ENST00000498210.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	78	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						GCTGGCAGCACGAGGGCGTGC	0.687																																					p.S78S		Atlas-SNP	.											KRTAP10-2,caecum,carcinoma,-1,1	KRTAP10-2	21	1	0			c.G234A						scavenged	.						52.0	56.0	55.0					21																	45971108		2202	4293	6495	SO:0001819	synonymous_variant	386679	exon1			GCAGCACGAGGGC	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.234G>A	21.37:g.45971108C>T		Somatic	86	3	0.0348837		WXS	Illumina HiSeq	Phase_I	75	4	0.0533333	NM_198693	Q70LJ5	Silent	SNP	ENST00000391621.1	37	CCDS42955.1																																																																																			.	.	none		0.687	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
NDUFV2	4729	hgsc.bcm.edu	37	18	9122638	9122638	+	Missense_Mutation	SNP	G	G	C	rs148158107	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr18:9122638G>C	ENST00000318388.6	+	5	542	c.428G>C	c.(427-429)cGa>cCa	p.R143P	RP11-21J18.1_ENST00000579126.1_RNA|RP11-143J12.2_ENST00000583081.1_RNA|NDUFV2_ENST00000465096.1_3'UTR|NDUFV2_ENST00000400033.1_Missense_Mutation_p.R146P|RP11-143J12.2_ENST00000582375.1_RNA	NM_021074.4	NP_066552.2	P19404	NDUV2_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa	143					cardiac muscle tissue development (GO:0048738)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|nervous system development (GO:0007399)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.R143P(1)		breast(1)|lung(4)|ovary(1)|stomach(1)	7						TGCATGCTTCGAAACTCTGAC	0.373																																					p.R143P		Atlas-SNP	.											NDUFV2,colon,carcinoma,+1,3	NDUFV2	17	3	1	Substitution - Missense(1)	stomach(1)	c.G428C						scavenged	.						101.0	90.0	94.0					18																	9122638		2203	4300	6503	SO:0001583	missense	4729	exon5			TGCTTCGAAACTC	X84421	CCDS11842.1	18p11.22	2011-07-04	2002-08-29		ENSG00000178127	ENSG00000178127	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7717	protein-coding gene	gene with protein product	"""complex I 24kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial"""	600532	"""NADH dehydrogenase (ubiquinone) flavoprotein 2 (24kD)"""			9763677, 7607668	Standard	NM_021074		Approved	CI-24k	uc002knu.3	P19404	OTTHUMG00000131593	ENST00000318388.6:c.428G>C	18.37:g.9122638G>C	ENSP00000327268:p.Arg143Pro	Somatic	199	10	0.0502513		WXS	Illumina HiSeq	Phase_I	139	9	0.0647482	NM_021074	Q9BV41	Missense_Mutation	SNP	ENST00000318388.6	37	CCDS11842.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.399441	0.83120	.	.	ENSG00000178127	ENST00000318388;ENST00000400033	T;T	0.49720	0.78;0.77	5.93	5.93	0.95920	Thioredoxin-like fold (2);	0.054528	0.85682	D	0.000000	T	0.78272	0.4257	H	0.95611	3.695	0.80722	D	1	D	0.64830	0.994	D	0.69307	0.963	T	0.79412	-0.1814	10	0.29301	T	0.29	-4.6044	20.3397	0.98756	0.0:0.0:1.0:0.0	.	143	P19404	NDUV2_HUMAN	P	143;146	ENSP00000327268:R143P;ENSP00000382908:R146P	ENSP00000327268:R143P	R	+	2	0	NDUFV2	9112638	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.623000	0.98386	2.803000	0.96430	0.585000	0.79938	CGA	G|0.996;C|0.005	0.005	strong		0.373	NDUFV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254475.2	NM_021074	
KLHDC4	54758	hgsc.bcm.edu	37	16	87748161	87748161	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr16:87748161C>T	ENST00000270583.5	-	8	836	c.778G>A	c.(778-780)Gac>Aac	p.D260N	KLHDC4_ENST00000566349.1_5'UTR|KLHDC4_ENST00000347925.5_Missense_Mutation_p.D229N|KLHDC4_ENST00000353170.5_Missense_Mutation_p.D203N	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	260										breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		GTGCCCTTGTCCACGTCTTTC	0.567																																					p.D260N		Atlas-SNP	.											.	KLHDC4	45	.	0			c.G778A						PASS	.						231.0	191.0	204.0					16																	87748161		2198	4300	6498	SO:0001583	missense	54758	exon8			CCTTGTCCACGTC	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.778G>A	16.37:g.87748161C>T	ENSP00000270583:p.Asp260Asn	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	138	7	0.0507246	NM_017566	D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Missense_Mutation	SNP	ENST00000270583.5	37	CCDS10963.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812535	0.70912	.	.	ENSG00000104731	ENST00000270583;ENST00000316853;ENST00000347925;ENST00000353170	T;T;T	0.67698	-0.28;-0.28;-0.28	5.21	5.21	0.72293	Kelch-type beta propeller (1);	0.093608	0.64402	D	0.000001	D	0.84293	0.5440	M	0.89095	3.005	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.992	D;D;D;D	0.78314	0.991;0.991;0.971;0.925	D	0.85106	0.0960	10	0.38643	T	0.18	-18.2028	17.7521	0.88438	0.0:1.0:0.0:0.0	.	79;203;229;260	Q9UF94;Q8TBB5-2;Q8TBB5-3;Q8TBB5	.;.;.;KLDC4_HUMAN	N	260;79;229;203	ENSP00000270583:D260N;ENSP00000325717:D229N;ENSP00000262530:D203N	ENSP00000270583:D260N	D	-	1	0	KLHDC4	86305662	1.000000	0.71417	1.000000	0.80357	0.066000	0.16364	7.012000	0.76366	2.427000	0.82271	0.561000	0.74099	GAC	.	.	none		0.567	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269109.2	NM_017566	
INPP5B	3633	hgsc.bcm.edu	37	1	38355355	38355355	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:38355355G>A	ENST00000373026.1	-	8	911	c.911C>T	c.(910-912)tCc>tTc	p.S304F	INPP5B_ENST00000373024.3_Missense_Mutation_p.S224F|INPP5B_ENST00000458109.2_5'Flank|INPP5B_ENST00000467066.1_5'Flank|INPP5B_ENST00000373023.2_Missense_Mutation_p.S304F|INPP5B_ENST00000373027.1_Missense_Mutation_p.S60F			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	304					in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GATAGTGGAGGAGCGAACCAT	0.393																																					p.S224F		Atlas-SNP	.											.	INPP5B	76	.	0			c.C671T						PASS	.						157.0	146.0	149.0					1																	38355355		1845	4092	5937	SO:0001583	missense	3633	exon9			GTGGAGGAGCGAA	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.911C>T	1.37:g.38355355G>A	ENSP00000362117:p.Ser304Phe	Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	122	6	0.0491803	NM_005540	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	ENST00000373026.1	37		.	.	.	.	.	.	.	.	.	.	G	18.95	3.732267	0.69189	.	.	ENSG00000204084	ENST00000373027;ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373024	D;D;D;D	0.93488	-3.23;-3.11;-3.11;-3.07	5.85	5.85	0.93711	.	0.446945	0.25549	N	0.029904	D	0.96722	0.8930	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.983	D	0.96665	0.9492	10	0.87932	D	0	.	20.1731	0.98165	0.0:0.0:1.0:0.0	.	304;224	P32019;P32019-2	I5P2_HUMAN;.	F	60;304;304;304;224	ENSP00000362118:S60F;ENSP00000362114:S304F;ENSP00000362117:S304F;ENSP00000362115:S224F	ENSP00000362114:S304F	S	-	2	0	INPP5B	38127942	1.000000	0.71417	0.998000	0.56505	0.482000	0.33219	4.276000	0.58933	2.768000	0.95171	0.655000	0.94253	TCC	.	.	none		0.393	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000012968.1	NM_005540	
XKR4	114786	hgsc.bcm.edu	37	8	56270333	56270333	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr8:56270333A>C	ENST00000327381.6	+	2	1002	c.902A>C	c.(901-903)gAt>gCt	p.D301A		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	301						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			GAGTATGCGGATGTGAGTATG	0.458																																					p.D301A		Atlas-SNP	.											XKR4,NS,carcinoma,+1,1	XKR4	104	1	0			c.A902C						scavenged	.						180.0	160.0	167.0					8																	56270333		2203	4300	6503	SO:0001583	missense	114786	exon2			ATGCGGATGTGAG	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.902A>C	8.37:g.56270333A>C	ENSP00000328326:p.Asp301Ala	Somatic	210	0	0		WXS	Illumina HiSeq	Phase_I	134	4	0.0298507	NM_052898	Q96PZ8	Missense_Mutation	SNP	ENST00000327381.6	37	CCDS34893.1	.	.	.	.	.	.	.	.	.	.	A	19.45	3.829401	0.71258	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	T	0.76060	-0.99	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.86863	0.6035	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87718	0.2571	10	0.54805	T	0.06	-20.1083	16.4447	0.83919	1.0:0.0:0.0:0.0	.	301	Q5GH76	XKR4_HUMAN	A	301	ENSP00000328326:D301A	ENSP00000328326:D301A	D	+	2	0	XKR4	56432887	1.000000	0.71417	0.919000	0.36401	0.276000	0.26787	9.339000	0.96797	2.284000	0.76573	0.528000	0.53228	GAT	.	.	none		0.458	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898	
PRPF31	26121	hgsc.bcm.edu	37	19	54632434	54632434	+	Silent	SNP	C	C	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr19:54632434C>A	ENST00000321030.4	+	12	1498	c.1149C>A	c.(1147-1149)atC>atA	p.I383I	PRPF31_ENST00000391755.1_Silent_p.I377I|PRPF31_ENST00000419967.1_Silent_p.I383I	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31	383					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CCCCCTAGATCGAGGAGGACG	0.682																																					p.I383I		Atlas-SNP	.											.	PRPF31	48	.	0			c.C1149A						PASS	.						21.0	20.0	21.0					19																	54632434		2176	4259	6435	SO:0001819	synonymous_variant	26121	exon12			CTAGATCGAGGAG	AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.1149C>A	19.37:g.54632434C>A		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	51	8	0.156863	NM_015629	Q17RB4|Q8N7F9|Q9H271|Q9Y439	Silent	SNP	ENST00000321030.4	37	CCDS12879.1																																																																																			.	.	none		0.682	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141417.2		
CYBB	1536	hgsc.bcm.edu	37	X	37663373	37663373	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chrX:37663373A>T	ENST00000378588.4	+	9	1208	c.1141A>T	c.(1141-1143)Aaa>Taa	p.K381*	TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000545017.1_Nonsense_Mutation_p.K349*|CYBB_ENST00000536160.1_Nonsense_Mutation_p.K114*	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	381	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	AGATGCGTGGAAACTACCTAA	0.428																																					p.K381X		Atlas-SNP	.											.	CYBB	62	.	0			c.A1141T						PASS	.						66.0	61.0	63.0					X																	37663373		2202	4300	6502	SO:0001587	stop_gained	1536	exon9			GCGTGGAAACTAC	X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.1141A>T	X.37:g.37663373A>T	ENSP00000367851:p.Lys381*	Somatic	324	0	0		WXS	Illumina HiSeq	Phase_I	196	24	0.122449	NM_000397	A8K138|Q2PP16	Nonsense_Mutation	SNP	ENST00000378588.4	37	CCDS14242.1	.	.	.	.	.	.	.	.	.	.	A	39	7.610350	0.98387	.	.	ENSG00000165168	ENST00000378588;ENST00000545017;ENST00000536160	.	.	.	5.77	5.77	0.91146	.	0.042364	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0692	0.72021	1.0:0.0:0.0:0.0	.	.	.	.	X	381;349;114	.	ENSP00000367851:K381X	K	+	1	0	CYBB	37548317	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.161000	0.64935	1.941000	0.56285	0.441000	0.28932	AAA	.	.	none		0.428	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080881.1		
LYRM5	144363	hgsc.bcm.edu	37	12	25357062	25357062	+	Missense_Mutation	SNP	A	A	C	rs534127550	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr12:25357062A>C	ENST00000381356.4	+	3	248	c.89A>C	c.(88-90)gAc>gCc	p.D30A	LYRM5_ENST00000556402.1_3'UTR|LYRM5_ENST00000555711.1_Missense_Mutation_p.R36S|LYRM5_ENST00000557540.2_Missense_Mutation_p.D28A|LYRM5_ENST00000556885.1_Missense_Mutation_p.D28A|LYRM5_ENST00000554266.1_3'UTR|LYRM5_ENST00000553788.1_Intron|LYRM5_ENST00000556351.1_Missense_Mutation_p.D28A|LYRM5_ENST00000556927.1_Missense_Mutation_p.D28A	NM_001001660.2	NP_001001660.2	Q6IPR1	LYRM5_HUMAN	LYR motif containing 5	30						mitochondrion (GO:0005739)				large_intestine(3)	3	all_cancers(2;4.75e-35)|all_epithelial(2;1.91e-37)|all_lung(3;1.07e-23)|Lung NSC(3;5.49e-23)|Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.0016)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;2.21e-21)|Epithelial(3;8.04e-19)|all cancers(3;2.26e-16)|STAD - Stomach adenocarcinoma(2;0.00138)			AAAGGAGCAGACTATTTTAAA	0.303																																					p.D30A		Atlas-SNP	.											.	LYRM5	10	.	0			c.A89C						PASS	.						28.0	25.0	26.0					12																	25357062		1786	4064	5850	SO:0001583	missense	144363	exon3			GAGCAGACTATTT	AK057730	CCDS53764.1	12p12.1	2006-09-19				ENSG00000205707		"""LYR motif containing"""	27052	protein-coding gene	gene with protein product							Standard	NM_001001660		Approved		uc001rgn.3	Q6IPR1		ENST00000381356.4:c.89A>C	12.37:g.25357062A>C	ENSP00000370761:p.Asp30Ala	Somatic	260	0	0		WXS	Illumina HiSeq	Phase_I	194	26	0.134021	NM_001001660	J3KPI7	Missense_Mutation	SNP	ENST00000381356.4	37	CCDS53764.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.182|8.182	0.794003|0.794003	0.16327|0.16327	.|.	.|.	ENSG00000205707|ENSG00000205707	ENST00000557540;ENST00000381356;ENST00000556885;ENST00000556351;ENST00000556927;ENST00000556198|ENST00000555711	T;T;T;T;T|.	0.68331|.	-0.32;-0.32;-0.32;-0.32;-0.32|.	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	0.179966|.	0.64402|.	D|.	0.000015|.	T|T	0.61451|0.61451	0.2348|0.2348	.|.	.|.	.|.	0.48135|0.48135	D|D	0.999595|0.999595	B;B|.	0.17268|.	0.001;0.021|.	B;B|.	0.18561|.	0.009;0.022|.	T|T	0.60954|0.60954	-0.7160|-0.7160	9|4	0.19590|.	T|.	0.45|.	.|.	9.8919|9.8919	0.41296|0.41296	0.9246:0.0:0.0753:0.0|0.9246:0.0:0.0753:0.0	.|.	28;28|.	Q6IPR1;G3V521|.	LYRM5_HUMAN;.|.	A|S	28;30;28;28;28;28|36	ENSP00000450584:D28A;ENSP00000370761:D30A;ENSP00000451494:D28A;ENSP00000452146:D28A;ENSP00000450443:D28A|.	ENSP00000370761:D30A|.	D|R	+|+	2|3	0|2	LYRM5|LYRM5	25248329|25248329	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.399000|4.399000	0.59703|0.59703	2.239000|2.239000	0.73571|0.73571	0.533000|0.533000	0.62120|0.62120	GAC|AGA	.	.	none		0.303	LYRM5-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001001660	
AMBRA1	55626	hgsc.bcm.edu	37	11	46419037	46419037	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr11:46419037T>C	ENST00000458649.2	-	18	4278	c.3860A>G	c.(3859-3861)gAc>gGc	p.D1287G	AMBRA1_ENST00000314845.3_Missense_Mutation_p.D1197G|AMBRA1_ENST00000533727.1_Missense_Mutation_p.D1168G|AMBRA1_ENST00000528950.1_Missense_Mutation_p.D1258G|AMBRA1_ENST00000298834.3_Missense_Mutation_p.D1227G|AMBRA1_ENST00000534300.1_Missense_Mutation_p.D1227G|AMBRA1_ENST00000426438.1_Missense_Mutation_p.D1258G			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1287					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GCCTGCAGCGTCCCCCCTGCT	0.602																																					p.D1290G		Atlas-SNP	.											AMBRA1_ENST00000458649,bladder,carcinoma,0,2	AMBRA1	201	2	0			c.A3869G						scavenged	.						99.0	92.0	94.0					11																	46419037		2202	4299	6501	SO:0001583	missense	55626	exon20			GCAGCGTCCCCCC	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3860A>G	11.37:g.46419037T>C	ENSP00000415327:p.Asp1287Gly	Somatic	64	1	0.015625		WXS	Illumina HiSeq	Phase_I	50	6	0.12	NM_001267782	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	37		.	.	.	.	.	.	.	.	.	.	T	3.583	-0.085189	0.07097	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000526545;ENST00000528950	T;T;T;T;T;T;T	0.71103	-0.39;-0.54;-0.13;-0.25;-0.13;-0.25;-0.25	4.22	4.22	0.49857	.	0.672381	0.14331	N	0.326324	T	0.49304	0.1549	N	0.08118	0	0.20196	N	0.999929	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0	T	0.41680	-0.9495	10	0.66056	D	0.02	.	8.3457	0.32272	0.0:0.0907:0.0:0.9093	.	1287;1258;1227;1168;1290;1197	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	G	1197;1168;1227;1258;1227;1287;245;1258	ENSP00000318313:D1197G;ENSP00000433372:D1168G;ENSP00000431926:D1227G;ENSP00000410899:D1258G;ENSP00000298834:D1227G;ENSP00000415327:D1287G;ENSP00000433945:D1258G	ENSP00000298834:D1227G	D	-	2	0	AMBRA1	46375613	0.641000	0.27251	0.867000	0.34043	0.009000	0.06853	1.775000	0.38584	2.135000	0.66039	0.459000	0.35465	GAC	.	.	none		0.602	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
SORCS3	22986	hgsc.bcm.edu	37	10	106959775	106959775	+	Silent	SNP	C	C	T			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr10:106959775C>T	ENST00000369701.3	+	15	2255	c.2028C>T	c.(2026-2028)agC>agT	p.S676S	SORCS3_ENST00000369699.4_5'UTR	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	676					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GCCACTTCAGCCTCCGCTCCG	0.502																																					p.S676S	NSCLC(116;1497 1690 7108 13108 14106)	Atlas-SNP	.											.	SORCS3	282	.	0			c.C2028T						PASS	.						112.0	100.0	104.0					10																	106959775		2203	4300	6503	SO:0001819	synonymous_variant	22986	exon15			CTTCAGCCTCCGC	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2028C>T	10.37:g.106959775C>T		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	81	9	0.111111	NM_014978	Q5VXF9|Q9NQJ2	Silent	SNP	ENST00000369701.3	37	CCDS7558.1																																																																																			.	.	none		0.502	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
LCE1F	353137	hgsc.bcm.edu	37	1	152749039	152749039	+	Silent	SNP	T	T	C	rs202038292|rs149277953	byFrequency	TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:152749039T>C	ENST00000334371.2	+	1	192	c.192T>C	c.(190-192)ggT>ggC	p.G64G		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	64	Poly-Gly.				keratinization (GO:0031424)			p.G64_G65delGG(1)		kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTCTGGGGGTGGTGGCTGCT	0.672																																					p.G64G		Atlas-SNP	.											LCE1F,NS,carcinoma,+2,1	LCE1F	42	1	1	Deletion - In frame(1)	stomach(1)	c.T192C						scavenged	.						30.0	33.0	32.0					1																	152749039		2201	4299	6500	SO:0001819	synonymous_variant	353137	exon1			TGGGGGTGGTGGC		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.192T>C	1.37:g.152749039T>C		Somatic	107	2	0.0186916		WXS	Illumina HiSeq	Phase_I	111	10	0.0900901	NM_178354		Silent	SNP	ENST00000334371.2	37	CCDS1023.1																																																																																			T|0.954;C|0.046	0.046	strong		0.672	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
ZNF496	84838	hgsc.bcm.edu	37	1	247492064	247492064	+	Silent	SNP	G	G	A	rs146066456		TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr1:247492064G>A	ENST00000294753.4	-	4	959	c.495C>T	c.(493-495)aaC>aaT	p.N165N	ZNF496_ENST00000366498.2_Silent_p.N165N	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	165					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			GGGCATCCTGGTTCTTTGCAA	0.627																																					p.N165N		Atlas-SNP	.											.	ZNF496	80	.	0			c.C495T						PASS	.						131.0	133.0	133.0					1																	247492064		2203	4300	6503	SO:0001819	synonymous_variant	84838	exon4			ATCCTGGTTCTTT	BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.495C>T	1.37:g.247492064G>A		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	93	5	0.0537634	NM_032752	Q8TBS2	Silent	SNP	ENST00000294753.4	37	CCDS1631.1																																																																																			G|1.000;T|0.000	.	alt		0.627	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098655.2	NM_032752	
IRS4	8471	hgsc.bcm.edu	37	X	107977810	107977810	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chrX:107977810C>A	ENST00000372129.2	-	1	1841	c.1765G>T	c.(1765-1767)Ggg>Tgg	p.G589W	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	589					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TTGCCCCCCCCAGAGTTCTTG	0.552																																					p.G589W		Atlas-SNP	.											.	IRS4	253	.	0			c.G1765T						PASS	.						165.0	171.0	169.0					X																	107977810		2203	4300	6503	SO:0001583	missense	8471	exon1			CCCCCCCAGAGTT	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1765G>T	X.37:g.107977810C>A	ENSP00000361202:p.Gly589Trp	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	76	7	0.0921053	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	4.030	0.003029	0.07866	.	.	ENSG00000133124	ENST00000372129	T	0.36340	1.26	4.9	4.02	0.46733	.	0.343723	0.21762	N	0.069500	T	0.48677	0.1513	M	0.66939	2.045	0.09310	N	1	D	0.69078	0.997	P	0.58577	0.841	T	0.38286	-0.9668	10	0.62326	D	0.03	-4.4135	8.2031	0.31436	0.0:0.8871:0.0:0.1129	.	589	O14654	IRS4_HUMAN	W	589	ENSP00000361202:G589W	ENSP00000361202:G589W	G	-	1	0	IRS4	107864466	0.147000	0.22687	0.968000	0.41197	0.287000	0.27160	1.500000	0.35682	2.257000	0.74773	0.600000	0.82982	GGG	.	.	none		0.552	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
MYBL1	4603	hgsc.bcm.edu	37	8	67492515	67492515	+	Silent	SNP	A	A	G			TCGA-FA-A86F-01A-11D-A382-10	TCGA-FA-A86F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b8a8bb7b-4ae4-40f5-8d6e-e942b0288c71	c6136d19-d490-4585-bc8a-f8ee1c7d7906	g.chr8:67492515A>G	ENST00000522677.3	-	9	1364	c.954T>C	c.(952-954)acT>acC	p.T318T	MYBL1_ENST00000524176.2_Silent_p.T318T|MYBL1_ENST00000517885.1_Intron	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	318	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			AAAACTCACTAGTGTGCTCGT	0.438																																					p.T318T		Atlas-SNP	.											.	MYBL1	73	.	0			c.T954C						PASS	.						72.0	71.0	71.0					8																	67492515		1917	4134	6051	SO:0001819	synonymous_variant	4603	exon9			CTCACTAGTGTGC	X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.954T>C	8.37:g.67492515A>G		Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	87	6	0.0689655	NM_001080416	E7EW29|Q495F9	Silent	SNP	ENST00000522677.3	37	CCDS47867.1																																																																																			.	.	none		0.438	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3	XM_034274	
