#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KMT2D	8085	hgsc.bcm.edu	37	12	49441815	49441816	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:49441815_49441816insC	ENST00000301067.7	-	14	4167_4168	c.4168_4169insG	c.(4168-4170)gcafs	p.A1390fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1390					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GTGGCCCTCTGCCCCCCGGCCA	0.564																																					p.A1390fs		Pindel,Atlas-Indel	.											.	MLL2	1173	.	0			c.4169_4170insG						PASS	.																																			SO:0001589	frameshift_variant	8085	exon14			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.4169dupG	12.37:g.49441821_49441821dupC	ENSP00000301067:p.Ala1390fs	Somatic	67	.	.		WXS	Illumina HiSeq	Phase_I	55	17	0.309	NM_003482	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	37	CCDS44873.1																																																																																			.	.	none		0.564	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KCNA6	3742	hgsc.bcm.edu	37	12	4919954	4919957	+	Frame_Shift_Del	DEL	CTCA	CTCA	-			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	CTCA	CTCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:4919954_4919957delCTCA	ENST00000280684.3	+	1	1613_1616	c.747_750delCTCA	c.(745-750)tcctcafs	p.SS249fs	KCNA6_ENST00000433855.1_Frame_Shift_Del_p.SS249fs|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	249					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	GGGGCTCCTCCTCACTCAGTACTC	0.554										HNSCC(72;0.22)																											p.249_250del		Pindel,Atlas-Indel	.											.	KCNA6	122	.	0			c.746_749del						PASS	.																																			SO:0001589	frameshift_variant	3742	exon1			.	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.747_750delCTCA	12.37:g.4919958_4919961delCTCA	ENSP00000280684:p.Ser249fs	Somatic	149	.	.		WXS	Illumina HiSeq	Phase_I	121	36	0.298	NM_002235		Frame_Shift_Del	DEL	ENST00000280684.3	37	CCDS8534.1																																																																																			.	.	none		0.554	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235	
MCM3AP	8888	hgsc.bcm.edu	37	21	47704722	47704723	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr21:47704722_47704723insC	ENST00000397708.1	-	2	732_733	c.478_479insG	c.(478-480)gctfs	p.A160fs	YBEY_ENST00000329319.3_5'Flank|YBEY_ENST00000397691.1_5'Flank|YBEY_ENST00000397694.1_5'Flank|YBEY_ENST00000397701.4_5'Flank|MCM3AP_ENST00000291688.1_Frame_Shift_Ins_p.A160fs|YBEY_ENST00000397692.1_5'Flank|YBEY_ENST00000339195.6_5'Flank			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	160	FG-repeats.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CTCAGATTCAGCCCCCAGTATT	0.446																																					p.A160fs		Pindel,Atlas-Indel	.											.	MCM3AP	146	.	0			c.479_480insG						PASS	.																																			SO:0001589	frameshift_variant	8888	exon1			.	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.479dupG	21.37:g.47704727_47704727dupC	ENSP00000380820:p.Ala160fs	Somatic	49	.	.		WXS	Illumina HiSeq	Phase_I	39	15	0.385	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Frame_Shift_Ins	INS	ENST00000397708.1	37	CCDS13734.1																																																																																			.	.	none		0.446	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
TTN	7273	hgsc.bcm.edu	37	2	179428230	179428233	+	Frame_Shift_Del	DEL	TCTG	TCTG	-			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	TCTG	TCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:179428230_179428233delTCTG	ENST00000591111.1	-	276	77927_77930	c.77703_77706delCAGA	c.(77701-77706)ttcagafs	p.FR25901fs	TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Frame_Shift_Del_p.FR27542fs|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Frame_Shift_Del_p.FR18602fs|TTN_ENST00000460472.2_Frame_Shift_Del_p.FR18477fs|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Frame_Shift_Del_p.FR18669fs|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Frame_Shift_Del_p.FR24974fs|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25901	Fibronectin type-III 88. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCAGCAACTCTGAATTCATAGG	0.495																																					p.27543_27544del		Pindel,Atlas-Indel	.											.	TTN	18412	.	0			c.82627_82630del						PASS	.																																			SO:0001589	frameshift_variant	7273	exon326			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.77703_77706delCAGA	2.37:g.179428230_179428233delTCTG	ENSP00000465570:p.Phe25901fs	Somatic	157	.	.		WXS	Illumina HiSeq	Phase_I	108	31	0.287	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	37																																																																																				.	.	none		0.495	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ASXL1	171023	hgsc.bcm.edu	37	20	31023636	31023636	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr20:31023636delG	ENST00000375687.4	+	13	3545	c.3121delG	c.(3121-3123)gccfs	p.A1041fs	ASXL1_ENST00000306058.5_Frame_Shift_Del_p.A1036fs	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1041					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GAACCAATCTGCCCCACTGTC	0.542			"""F, N, Mis"""		"""MDS, CMML"""																																p.S1040fs		Pindel,Atlas-Indel	.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	1114	.	0			c.3120delT						PASS	.						226.0	187.0	200.0					20																	31023636		2203	4300	6503	SO:0001589	frameshift_variant	171023	exon12			.	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.3121delG	20.37:g.31023636delG	ENSP00000364839:p.Ala1041fs	Somatic	121	.	.		WXS	Illumina HiSeq	Phase_I	136	32	0.235	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Frame_Shift_Del	DEL	ENST00000375687.4	37	CCDS13201.1																																																																																			.	.	none		0.542	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
CACNA1B	774	hgsc.bcm.edu	37	9	140918171	140918185	+	In_Frame_Del	DEL	GGAGAAGGAGACCAC	GGAGAAGGAGACCAC	-	rs145816559|rs11137342|rs370787788|rs551405755	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	GGAGAAGGAGACCAC	GGAGAAGGAGACCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:140918171_140918185delGGAGAAGGAGACCAC	ENST00000371372.1	+	19	3121_3135	c.2976_2990delGGAGAAGGAGACCAC	c.(2974-2991)gtggagaaggagaccacg>gtg	p.EKETT993del	CACNA1B_ENST00000371357.1_In_Frame_Del_p.EKETT994del|CACNA1B_ENST00000277549.5_In_Frame_Del_p.EKETT185del|CACNA1B_ENST00000277551.2_In_Frame_Del_p.EKETT993del|CACNA1B_ENST00000371367.5_5'UTR|CACNA1B_ENST00000371355.4_In_Frame_Del_p.EKETT994del|CACNA1B_ENST00000545473.1_5'Flank|CACNA1B_ENST00000371363.1_In_Frame_Del_p.EKETT993del	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	993					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.T996_E1000delTTEKE(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	ACGAGGCTGTGGAGAAGGAGACCACGGAGAAGGAG	0.735														1990	0.397364	0.6225	0.1282	5008	,	,		9031	0.6349		0.1521	False		,,,				2504	0.2914				p.992_997del		Atlas-Indel	.											.	CACNA1B	266	.	1	Deletion - In frame(1)	breast(1)	c.2975_2989del						PASS	.			1091,1197		364,363,417						-1.3	0.0		dbSNP_134	8	691,4399		126,439,1980	no	coding	CACNA1B	NM_000718.3		490,802,2397	A1A1,A1R,RR		13.5756,47.6836,24.1529				1782,5596				SO:0001651	inframe_deletion	774	exon19			.	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.2976_2990delGGAGAAGGAGACCAC	9.37:g.140918171_140918185delGGAGAAGGAGACCAC	ENSP00000360423:p.Glu993_Thr997del	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	53	14	0.264151	NM_001243812	B1AQK5	In_Frame_Del	DEL	ENST00000371372.1	37	CCDS59522.1																																																																																			GGAGAAGGAGACCAC|0.621;-|0.379	0.379	strong		0.735	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
RAI1	10743	hgsc.bcm.edu	37	17	17699094	17699095	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:17699094_17699095delCT	ENST00000353383.1	+	3	3301_3302	c.2832_2833delCT	c.(2830-2835)tcctctfs	p.SS944fs	RAI1_ENST00000261641.6_Frame_Shift_Del_p.SS944fs	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	944					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		GGTTTGAGTCCTCTCTGTCACA	0.634																																					p.944_944del		Pindel,Atlas-Indel	.											.	RAI1	121	.	0			c.2831_2832del						PASS	.																																			SO:0001589	frameshift_variant	10743	exon3			.	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.2832_2833delCT	17.37:g.17699098_17699099delCT	ENSP00000323074:p.Ser944fs	Somatic	125	.	.		WXS	Illumina HiSeq	Phase_I	126	41	0.325	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Frame_Shift_Del	DEL	ENST00000353383.1	37	CCDS11188.1																																																																																			.	.	none		0.634	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
HIST1H2AC	8334	hgsc.bcm.edu	37	6	26124573	26124585	+	Frame_Shift_Del	DEL	GCAACTACGCAGA	GCAACTACGCAGA	-			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	GCAACTACGCAGA	GCAACTACGCAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:26124573_26124585delGCAACTACGCAGA	ENST00000602637.1	+	1	143_155	c.113_125delGCAACTACGCAGA	c.(112-126)ggcaactacgcagagfs	p.GNYAE38fs	HIST1H2BC_ENST00000314332.5_5'Flank|HIST1H2BC_ENST00000396984.1_5'Flank|HIST1H2AC_ENST00000377791.2_Frame_Shift_Del_p.GNYAE38fs			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	38						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E42Q(1)		NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						CTCCGTAAAGGCAACTACGCAGAGCGGGTTGGG	0.657																																					p.38_42del		Atlas-Indel	.											.	HIST1H2AC	29	.	1	Substitution - Missense(1)	NS(1)	c.112_124del						PASS	.																																			SO:0001589	frameshift_variant	8334	exon1			.	Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.113_125delGCAACTACGCAGA	6.37:g.26124573_26124585delGCAACTACGCAGA	ENSP00000473534:p.Gly38fs	Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	196	35	0.178571	NM_003512	B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Frame_Shift_Del	DEL	ENST00000602637.1	37	CCDS4585.1																																																																																			.	.	none		0.657	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468023.1	NM_003512	
JAKMIP3	282973	hgsc.bcm.edu	37	10	133954074	133954151	+	Splice_Site	DEL	CTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGGCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGG	CTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGGCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGG	-	rs111390655|rs376494575|rs186558312|rs377397710|rs9733324|rs373132662|rs375807579|rs531085140|rs370170942|rs565380893	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	CTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGGCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGG	CTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGGCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:133954074_133954151delCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGGCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGG	ENST00000298622.4	+	9	1602_1611	c.1464_1473delCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGGCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGG	c.(1462-1473)gacttggaggag>ga	p.DLEE488del		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	488						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CGGACGATGACTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGGCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGGCTTGGAGGAG	0.644														1120	0.223642	0.2284	0.2363	5008	,	,		23752	0.3056		0.1899	False		,,,				2504	0.1585				p.488_491del		Pindel	.											.	JAKMIP3	69	.	0			c.1463_1473del						PASS	.																																			SO:0001630	splice_region_variant	282973	exon9			.	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1473+1CTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGGCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGG>-	10.37:g.133954074_133954151delCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGGCTTGGAGGAGGTAACGAGGGTCTCCTGCCGGGTCCTGGG		Somatic	34	.	.		WXS	Illumina HiSeq	Phase_I	44	26	0.591	NM_001105521	A6PW00|Q69YM6|Q6ZT29	Frame_Shift_Del	DEL	ENST00000298622.4	37	CCDS44494.1																																																																																			.	.	none		0.644	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303	In_Frame_Del
RIC8A	60626	hgsc.bcm.edu	37	11	209895	209897	+	In_Frame_Del	DEL	CCC	CCC	-	rs201633036|rs200641500|rs3832797|rs398102296|rs571957041	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:209895_209897delCCC	ENST00000526104.1	+	3	1965_1967	c.621_623delCCC	c.(619-624)aacccc>aac	p.P210del	RIC8A_ENST00000325207.5_In_Frame_Del_p.P210del|RIC8A_ENST00000527696.1_In_Frame_Del_p.P204del|BET1L_ENST00000325147.9_5'Flank|BET1L_ENST00000410108.1_5'Flank|BET1L_ENST00000332865.6_5'Flank|BET1L_ENST00000486280.1_5'Flank|BET1L_ENST00000382762.3_5'Flank|BET1L_ENST00000529614.2_5'Flank			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	210					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTGAAGGGAACCCCCCACCCACG	0.601														2073	0.413938	0.2519	0.428	5008	,	,		21433	0.7629		0.327	False		,,,				2504	0.3528				p.207_208del		Pindel	.											.	RIC8A	45	.	0			c.620_622del						PASS	.			1167,8,3089		173,0,821,4,0,1134						1.2	0.0		dbSNP_107	49	2820,12,5422		493,0,1834,6,0,1794	no	codingComplex	RIC8A	NM_021932.4		666,0,2655,10,0,2928	A1A1,A1A2,A1R,A2A2,A2R,RR		34.3106,27.5563,32.0099				3987,20,8511				SO:0001651	inframe_deletion	60626	exon3			.	AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.621_623delCCC	11.37:g.209898_209900delCCC	ENSP00000432008:p.Pro210del	Somatic	14	.	.		WXS	Illumina HiSeq	Phase_I	27	15	0.556	NM_021932	Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	In_Frame_Del	DEL	ENST00000526104.1	37																																																																																				CCC|0.579;-|0.421	0.421	strong		0.601	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000384761.1	NM_021932	
KRTAP10-7	386675	hgsc.bcm.edu	37	21	46020656	46020670	+	In_Frame_Del	DEL	CTGCTGCGCCCCCAG	CTGCTGCGCCCCCAG	-	rs36208679|rs60739860|rs373191083		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	CTGCTGCGCCCCCAG	CTGCTGCGCCCCCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr21:46020656_46020670delCTGCTGCGCCCCCAG	ENST00000380102.2	+	1	160_174	c.135_149delCTGCTGCGCCCCCAG	c.(133-150)ccctgctgcgcccccagc>ccc	p.CCAPS46del	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	46	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S50_P54delSCCAP(1)		breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						GCGAGCCCCCCTGCTGCGCCCCCAGCTGCTGCGCC	0.698																																					p.45_45del		Pindel	.											.	KRTAP10-7	41	.	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.134_134del						PASS	.		,	2258,1042		849,560,241					,	-0.7	1.0		dbSNP_126	22	6001,1123		2605,791,166	no	coding,intron	TSPEAR,KRTAP10-7	NM_198689.2,NM_144991.2	,	3454,1351,407	A1A1,A1R,RR		15.7636,31.5758,20.7694	,	,		8259,2165				SO:0001651	inframe_deletion	386675	exon1			.	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.135_149delCTGCTGCGCCCCCAG	21.37:g.46020656_46020670delCTGCTGCGCCCCCAG	ENSP00000369445:p.Cys46_Ser50del	Somatic	56	.	.		WXS	Illumina HiSeq	Phase_I	35	15	0.429	NM_198689	Q0VDJ8|Q70LJ2	Frame_Shift_Del	DEL	ENST00000380102.2	37																																																																																				.	.	weak		0.698	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
ZNF384	171017	hgsc.bcm.edu	37	12	6777070	6777072	+	In_Frame_Del	DEL	TGC	TGC	-	rs78573212|rs72393318|rs544124628|rs3835029	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	TGC	TGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:6777070_6777072delTGC	ENST00000396801.3	-	11	1749_1751	c.1542_1544delGCA	c.(1540-1545)cagcaa>caa	p.514_515QQ>Q	ZNF384_ENST00000361959.3_In_Frame_Del_p.514_515QQ>Q|ZNF384_ENST00000355772.4_In_Frame_Del_p.398_399QQ>Q|ZNF384_ENST00000319770.3_In_Frame_Del_p.437_438QQ>Q|RP4-761J14.8_ENST00000589924.1_RNA|RP4-761J14.8_ENST00000586338.1_RNA|ZNF384_ENST00000396795.1_In_Frame_Del_p.453_454QQ>Q|ZNF384_ENST00000396799.2_In_Frame_Del_p.453_454QQ>Q	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	514	Gln-rich.				nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.L139delL(6)|p.Q455delQ(3)|p.Q516delQ(3)	EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						TGGTGgctgttgctgctgctgct	0.665			T	"""EWSR1, TAF15 """	ALL									4006	0.79992	0.8253	0.8501	5008	,	,		14338	0.8125		0.7753	False		,,,				2504	0.7423				p.515_515del		Pindel	.		Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	ZNF384_ENST00000361959,caecum,carcinoma,0,4	ZNF384	102	4	12	Deletion - In frame(12)	breast(12)	c.1543_1545del						PASS	.																																			SO:0001651	inframe_deletion	171017	exon11			.	U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.1542_1544delGCA	12.37:g.6777079_6777081delTGC	ENSP00000380019:p.Gln516del	Somatic	36	.	.		WXS	Illumina HiSeq	Phase_I	36	12	0.333	NM_001135734	O15407|Q7Z722|Q8N938	In_Frame_Del	DEL	ENST00000396801.3	37	CCDS44817.1																																																																																			.	.	strong		0.665	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1		
ADAMTS7	11173	hgsc.bcm.edu	37	15	79058183	79058184	+	Frame_Shift_Ins	INS	-	-	TGGGTCC			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:79058183_79058184insTGGGTCC	ENST00000388820.4	-	19	4279_4280	c.4069_4070insGGACCCA	c.(4069-4071)aagfs	p.K1357fs	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1357					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						AGGCTGACCCTTGGGTCCTGGG	0.653																																					p.K1357fs		Pindel	.											.	ADAMTS7	142	.	0			c.4070_4071insGGACCCA						PASS	.			119,2525		11,97,1214						-5.9	0.0			8	119,5765		2,115,2825	no	frameshift	ADAMTS7	NM_014272.3		13,212,4039	A1A1,A1R,RR		2.0224,4.5008,2.7908				238,8290				SO:0001589	frameshift_variant	11173	exon19			.	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4063_4069dupGGACCCA	15.37:g.79058184_79058190dupTGGGTCC	ENSP00000373472:p.Lys1357fs	Somatic	62	.	.		WXS	Illumina HiSeq	Phase_I	82	17	0.207	NM_014272	Q14F51|Q6P7J9	Frame_Shift_Ins	INS	ENST00000388820.4	37	CCDS32303.1																																																																																			TGGGTCC|1.000;|0.000	1.000	weak		0.653	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
DENND2A	27147	hgsc.bcm.edu	37	7	140246733	140246733	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:140246733C>T	ENST00000275884.6	-	12	2461	c.2044G>A	c.(2044-2046)Gat>Aat	p.D682N	DENND2A_ENST00000496613.1_Missense_Mutation_p.D682N|DENND2A_ENST00000537639.1_Missense_Mutation_p.D682N|DENND2A_ENST00000492720.1_Missense_Mutation_p.D682N			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	682	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					TCCACCTCATCCAAGATCTGC	0.532																																					p.D682N		Atlas-SNP	.											DENND2A,colon,carcinoma,+2,1	DENND2A	132	1	0			c.G2044A						scavenged	.						63.0	65.0	65.0					7																	140246733		1959	4176	6135	SO:0001583	missense	27147	exon11			CCTCATCCAAGAT	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.2044G>A	7.37:g.140246733C>T	ENSP00000275884:p.Asp682Asn	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	182	3	0.0164835	NM_015689	C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	ENST00000275884.6	37	CCDS43659.1	.	.	.	.	.	.	.	.	.	.	C	35	5.491710	0.96339	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000469373;ENST00000492720	T;T;T;T;T	0.11277	2.79;2.79;2.79;2.79;2.79	5.63	5.63	0.86233	DENN (3);	0.000000	0.85682	D	0.000000	T	0.24236	0.0587	L	0.28694	0.88	0.80722	D	1	D;P	0.89917	1.0;0.942	D;D	0.85130	0.997;0.98	T	0.00978	-1.1493	10	0.35671	T	0.21	-23.4839	19.6692	0.95905	0.0:1.0:0.0:0.0	.	682;682	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	N	682;682;682;29;682	ENSP00000275884:D682N;ENSP00000442245:D682N;ENSP00000419654:D682N;ENSP00000420145:D29N;ENSP00000419464:D682N	ENSP00000275884:D682N	D	-	1	0	DENND2A	139893202	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.657000	0.83745	2.664000	0.90586	0.561000	0.74099	GAT	.	.	none		0.532	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689	
PAX5	5079	hgsc.bcm.edu	37	9	36923482	36923482	+	Splice_Site	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:36923482C>T	ENST00000358127.4	-	7	855		c.e7-1		PAX5_ENST00000377847.2_Splice_Site|PAX5_ENST00000377853.2_Splice_Site|PAX5_ENST00000523145.1_Splice_Site|PAX5_ENST00000523241.1_Intron|PAX5_ENST00000522003.1_Splice_Site|PAX5_ENST00000446742.1_Splice_Site|PAX5_ENST00000520154.1_Intron|PAX5_ENST00000377852.2_Splice_Site|PAX5_ENST00000414447.1_Splice_Site|PAX5_ENST00000520281.1_Splice_Site	NM_001280554.1|NM_001280556.1|NM_016734.1	NP_001267483.1|NP_001267485.1|NP_057953.1	Q02548	PAX5_HUMAN	paired box 5						humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(19)	PAX5/JAK2(18)	NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(151)|kidney(1)|lung(10)|prostate(1)|skin(1)	171		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		ACTCTGTGGTCTGAAAGAAGA	0.562			"""T, Mis, D, F, S"""	"""IGH@, ETV6, PML, FOXP1, ZNF521, ELN"""	"""NHL, ALL, B-ALL"""																																.		Atlas-SNP	.		Dom	yes		9	9p13	5079	paired box gene 5 (B-cell lineage specific activator protein)		L	.	PAX5	250	.	19	Unknown(19)	haematopoietic_and_lymphoid_tissue(19)	c.781-1G>A						PASS	.						51.0	55.0	53.0					9																	36923482		2203	4300	6503	SO:0001630	splice_region_variant	5079	exon8			TGTGGTCTGAAAG		CCDS6607.1, CCDS65039.1, CCDS65040.1, CCDS65041.1, CCDS65042.1, CCDS65043.1, CCDS65044.1, CCDS65045.1, CCDS65046.1, CCDS65047.1, CCDS65048.1	9p13.2	2011-06-20	2007-07-12		ENSG00000196092	ENSG00000196092		"""Paired boxes"", ""Homeoboxes / PRD class"""	8619	protein-coding gene	gene with protein product	"""B-cell lineage specific activator"""	167414	"""paired box gene 5 (B-cell lineage specific activator protein)"", ""paired box gene 5 (B-cell lineage specific activator)"""			1516825, 8431641	Standard	NM_016734		Approved	BSAP	uc003zzo.1	Q02548	OTTHUMG00000019907	ENST00000358127.4:c.781-1G>A	9.37:g.36923482C>T		Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	29	15	0.517241	NM_016734	A3QVP6|A3QVP7|A3QVP8|C0KTF6|C0KTF7|C0KTF8|C0KTF9|C0KTG0|O75933|Q5SFM2|Q6S728|Q6S729|Q6S730|Q6S731|Q6S732	Splice_Site	SNP	ENST00000358127.4	37	CCDS6607.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003406	0.74932	.	.	ENSG00000196092	ENST00000358127;ENST00000377849;ENST00000377853;ENST00000377852;ENST00000520281;ENST00000446742;ENST00000522003;ENST00000523145;ENST00000414447;ENST00000377847;ENST00000524340	.	.	.	6.03	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.1148	0.36750	0.1484:0.7782:0.0:0.0734	.	.	.	.	.	-1	.	.	.	-	.	.	PAX5	36913482	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.657000	0.74402	1.544000	0.49359	0.655000	0.94253	.	.	.	none		0.562	PAX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052433.1		Intron
CCT6A	908	hgsc.bcm.edu	37	7	56129454	56129454	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:56129454C>G	ENST00000275603.4	+	12	1581	c.1362C>G	c.(1360-1362)aaC>aaG	p.N454K	CCT6A_ENST00000462133.1_3'UTR|CCT6A_ENST00000540286.1_Missense_Mutation_p.N423K|SNORA15_ENST00000384439.1_RNA|SUMF2_ENST00000413756.1_5'Flank|CCT6A_ENST00000335503.3_Missense_Mutation_p.N409K|SUMF2_ENST00000395435.2_5'Flank|SUMF2_ENST00000434526.2_5'Flank|SUMF2_ENST00000275607.9_5'Flank|SUMF2_ENST00000395436.2_5'Flank|SUMF2_ENST00000437307.2_5'Flank|SUMF2_ENST00000342190.6_5'Flank	NM_001762.3	NP_001753.1	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A (zeta 1)	454					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|cervix(2)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	15	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TTGCTCAGAACTCTGGTTTTG	0.318																																					p.N454K		Atlas-SNP	.											.	CCT6A	44	.	0			c.C1362G						PASS	.						41.0	42.0	41.0					7																	56129454		2203	4300	6503	SO:0001583	missense	908	exon12			TCAGAACTCTGGT	M94083	CCDS5523.1, CCDS34640.1	7p11.2	2011-09-02			ENSG00000146731	ENSG00000146731		"""Heat Shock Proteins / Chaperonins"""	1620	protein-coding gene	gene with protein product		104613		CCT6		1352881, 8034610	Standard	NM_001762		Approved	TTCP20, TCPZ, Cctz, HTR3, TCP20	uc003trl.1	P40227	OTTHUMG00000022842	ENST00000275603.4:c.1362C>G	7.37:g.56129454C>G	ENSP00000275603:p.Asn454Lys	Somatic	303	0	0		WXS	Illumina HiSeq	Phase_I	295	66	0.223729	NM_001762	A6NCD2|Q3KP28|Q75LP4|Q96S46	Missense_Mutation	SNP	ENST00000275603.4	37	CCDS5523.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.148303	0.57151	.	.	ENSG00000146731	ENST00000275603;ENST00000335503;ENST00000540286;ENST00000539340	D;D;D	0.86366	-2.11;-2.11;-2.11	4.96	2.18	0.27775	.	0.044542	0.85682	N	0.000000	D	0.94703	0.8291	H	0.97587	4.035	0.80722	D	1	P;P;P	0.37663	0.566;0.604;0.559	P;P;P	0.56278	0.598;0.795;0.711	D	0.93087	0.6496	10	0.87932	D	0	-14.3993	9.0157	0.36168	0.0:0.7582:0.0:0.2418	.	423;409;454	B4DPJ8;A6NCD2;P40227	.;.;TCPZ_HUMAN	K	454;409;423;312	ENSP00000275603:N454K;ENSP00000352019:N409K;ENSP00000438488:N423K	ENSP00000275603:N454K	N	+	3	2	CCT6A	56096948	0.746000	0.28272	1.000000	0.80357	0.988000	0.76386	-0.053000	0.11846	0.157000	0.19338	0.456000	0.33151	AAC	.	.	none		0.318	CCT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251526.2	NM_001762	
LILRB5	10990	hgsc.bcm.edu	37	19	54756239	54756239	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:54756239C>T	ENST00000316219.5	-	11	1670	c.1563G>A	c.(1561-1563)gaG>gaA	p.E521E	LILRB5_ENST00000449561.2_Silent_p.E522E|CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000450632.1_Silent_p.E513E|LILRB5_ENST00000345866.6_Silent_p.E422E	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	521					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGAGAATTTCCTCCTGGATGT	0.617																																					p.E522E		Atlas-SNP	.											LILRB5_ENST00000450632,NS,carcinoma,0,2	LILRB5	176	2	0			c.G1566A						scavenged	.						89.0	87.0	87.0					19																	54756239		2203	4300	6503	SO:0001819	synonymous_variant	10990	exon11			AATTTCCTCCTGG	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1563G>A	19.37:g.54756239C>T		Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	180	2	0.0111111	NM_001081442	Q8N760	Silent	SNP	ENST00000316219.5	37	CCDS12885.1																																																																																			.	.	none		0.617	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
ROBO1	6091	hgsc.bcm.edu	37	3	78667095	78667095	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:78667095C>T	ENST00000464233.1	-	27	4085	c.3972G>A	c.(3970-3972)acG>acA	p.T1324T	ROBO1_ENST00000495273.1_Silent_p.T1279T|ROBO1_ENST00000436010.2_Silent_p.T1285T|ROBO1_ENST00000467549.1_Silent_p.T1224T	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1324					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CTGGCGCATCCGTATCCATAT	0.557																																					p.T1324T		Atlas-SNP	.											ROBO1_ENST00000495273,NS,carcinoma,-1,4	ROBO1	833	4	0			c.G3972A						scavenged	.						58.0	65.0	63.0					3																	78667095		2002	4165	6167	SO:0001819	synonymous_variant	6091	exon27			CGCATCCGTATCC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3972G>A	3.37:g.78667095C>T		Somatic	178	1	0.00561798		WXS	Illumina HiSeq	Phase_I	192	55	0.286458	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	37	CCDS54611.1																																																																																			.	.	none		0.557	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
MUC4	4585	hgsc.bcm.edu	37	3	195515304	195515304	+	Silent	SNP	T	T	A	rs202019266		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:195515304T>A	ENST00000463781.3	-	2	3606	c.3147A>T	c.(3145-3147)gcA>gcT	p.A1049A	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.A1049A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	479					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A1049A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CACCTGTGGATGCTGAGGAAA	0.562																																					p.A1049A		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	2	Substitution - coding silent(2)	kidney(1)|endometrium(1)	c.A3147T						scavenged	.																																			SO:0001819	synonymous_variant	4585	exon2			TGTGGATGCTGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3147A>T	3.37:g.195515304T>A		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	116	3	0.0258621	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	weak		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
GGT1	2678	hgsc.bcm.edu	37	22	25016911	25016911	+	Missense_Mutation	SNP	C	C	T	rs199703506	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr22:25016911C>T	ENST00000400382.1	+	9	1362	c.607C>T	c.(607-609)Cgg>Tgg	p.R203W	GGT1_ENST00000466310.1_Intron|GGT1_ENST00000248923.4_Missense_Mutation_p.R203W|GGT1_ENST00000400380.1_Missense_Mutation_p.R203W|GGT1_ENST00000406383.2_Missense_Mutation_p.R203W|GGT1_ENST00000400383.1_Missense_Mutation_p.R203W			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	203					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.R203W(1)		breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	AAAGGTGCTTCGGGAGGGGGA	0.652																																					p.R203W		Atlas-SNP	.											GGT1,NS,carcinoma,0,1	GGT1	68	1	1	Substitution - Missense(1)	breast(1)	c.C607T						scavenged	.						20.0	22.0	21.0					22																	25016911		1981	4142	6123	SO:0001583	missense	2678	exon9			GTGCTTCGGGAGG	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.607C>T	22.37:g.25016911C>T	ENSP00000383232:p.Arg203Trp	Somatic	541	16	0.0295749		WXS	Illumina HiSeq	Phase_I	486	15	0.0308642	NM_013430	Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000400382.1	37	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	.	16.88	3.244872	0.59103	.	.	ENSG00000100031	ENST00000248923;ENST00000412658;ENST00000400382;ENST00000400383;ENST00000400380;ENST00000406383	T;T;T;T;T;T	0.08193	3.12;3.12;3.12;3.12;3.12;3.12	3.94	1.51	0.23008	.	0.465560	0.21948	U	0.066770	T	0.18841	0.0452	M	0.62016	1.91	0.29917	N	0.823045	D	0.76494	0.999	P	0.58970	0.849	T	0.03121	-1.1070	10	0.87932	D	0	-23.2527	10.8877	0.46976	0.3395:0.6605:0.0:0.0	.	203	P19440	GGT1_HUMAN	W	203	ENSP00000248923:R203W;ENSP00000393537:R203W;ENSP00000383232:R203W;ENSP00000383233:R203W;ENSP00000383231:R203W;ENSP00000385975:R203W	ENSP00000248923:R203W	R	+	1	2	GGT1	23346911	0.047000	0.20315	0.042000	0.18584	0.549000	0.35272	1.263000	0.33004	0.735000	0.32537	0.555000	0.69702	CGG	C|0.996;T|0.004	0.004	strong		0.652	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430	
GPC2	221914	hgsc.bcm.edu	37	7	99774749	99774749	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:99774749T>C	ENST00000292377.2	-	1	241	c.74A>G	c.(73-75)gAg>gGg	p.E25G	GPC2_ENST00000471050.1_5'Flank|STAG3_ENST00000426455.1_5'Flank|STAG3_ENST00000317296.5_5'Flank|STAG3_ENST00000394018.2_5'Flank	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	25					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GACCTTTGCCTCGCTCCCGGG	0.647																																					p.E25G		Atlas-SNP	.											GPC2,NS,carcinoma,-1,1	GPC2	49	1	0			c.A74G						scavenged	.						23.0	27.0	26.0					7																	99774749		2202	4299	6501	SO:0001583	missense	221914	exon1			TTTGCCTCGCTCC	BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.74A>G	7.37:g.99774749T>C	ENSP00000292377:p.Glu25Gly	Somatic	140	1	0.00714286		WXS	Illumina HiSeq	Phase_I	246	3	0.0121951	NM_152742	A4D2A7	Missense_Mutation	SNP	ENST00000292377.2	37	CCDS5689.1	.	.	.	.	.	.	.	.	.	.	T	16.88	3.244691	0.59103	.	.	ENSG00000213420	ENST00000292377	T	0.51325	0.71	4.72	4.72	0.59763	.	0.488362	0.18367	N	0.143400	T	0.37489	0.1005	L	0.36672	1.1	0.24090	N	0.995919	B	0.18461	0.028	B	0.21546	0.035	T	0.19128	-1.0315	10	0.32370	T	0.25	-7.0628	10.4988	0.44794	0.0:0.0:0.0:1.0	.	25	Q8N158	GPC2_HUMAN	G	25	ENSP00000292377:E25G	ENSP00000292377:E25G	E	-	2	0	GPC2	99612685	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.186000	0.32078	1.989000	0.58080	0.387000	0.25754	GAG	.	.	none		0.647	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337556.1	NM_152742	
KMT2D	8085	hgsc.bcm.edu	37	12	49415922	49415922	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:49415922A>T	ENST00000301067.7	-	53	16424	c.16425T>A	c.(16423-16425)caT>caA	p.H5475Q	RP11-386G11.5_ENST00000547866.1_RNA|PRKAG1_ENST00000548065.1_5'Flank|RP11-386G11.5_ENST00000552933.1_RNA	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5475	S-adenosyl-L-methionine binding. {ECO:0000250}.|SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGGCACAGGAATGGTTAATGT	0.507																																					p.H5475Q		Atlas-SNP	.											.	MLL2	1173	.	0			c.T16425A						PASS	.						159.0	154.0	156.0					12																	49415922		2065	4208	6273	SO:0001583	missense	8085	exon53			ACAGGAATGGTTA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.16425T>A	12.37:g.49415922A>T	ENSP00000301067:p.His5475Gln	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	47	16	0.340426	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	a	12.42	1.932692	0.34096	.	.	ENSG00000167548	ENST00000301067;ENST00000526209	D;D	0.99503	-6.03;-6.03	4.97	2.62	0.31277	SET domain (3);	0.000000	0.36740	N	0.002439	D	0.99704	0.9887	H	0.99732	4.735	0.47476	D	0.999434	D	0.89917	1.0	D	0.91635	0.999	D	0.97764	1.0222	10	0.87932	D	0	.	6.8531	0.24026	0.7287:0.0:0.2713:0.0	.	5475	O14686	MLL2_HUMAN	Q	5475;156	ENSP00000301067:H5475Q;ENSP00000435714:H156Q	ENSP00000301067:H5475Q	H	-	3	2	MLL2	47702189	0.942000	0.31987	1.000000	0.80357	0.995000	0.86356	0.105000	0.15333	0.877000	0.35895	0.450000	0.29827	CAT	.	.	none		0.507	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
BCR	613	hgsc.bcm.edu	37	22	23654017	23654017	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr22:23654017G>A	ENST00000305877.8	+	19	4067	c.3316G>A	c.(3316-3318)Gac>Aac	p.D1106N	BCR_ENST00000359540.3_Missense_Mutation_p.D1062N|BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	1106	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.		D -> N. {ECO:0000269|PubMed:17344846}.		actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	GGCAGCCTTCGACGTCAGTGA	0.632			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.D1106N		Atlas-SNP	.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	BCR,NS,carcinoma,0,1	BCR	74	1	0			c.G3316A						scavenged	.						63.0	47.0	52.0					22																	23654017		2203	4300	6503	SO:0001583	missense	613	exon19			GCCTTCGACGTCA		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3316G>A	22.37:g.23654017G>A	ENSP00000303507:p.Asp1106Asn	Somatic	281	6	0.0213523		WXS	Illumina HiSeq	Phase_I	284	7	0.0246479	NM_004327	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	ENST00000305877.8	37	CCDS13806.1	.	.	.	.	.	.	.	.	.	.	G	33	5.284738	0.95517	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;T	0.12672	2.66;2.66	4.49	4.49	0.54785	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.21962	0.0529	L	0.37750	1.13	0.80722	D	1	D;P;D	0.59767	0.986;0.87;0.976	P;P;P	0.55222	0.771;0.509;0.752	T	0.01065	-1.1463	10	0.42905	T	0.14	.	16.6324	0.85037	0.0:0.0:1.0:0.0	.	695;1062;1106	B4E065;P11274-2;P11274	.;.;BCR_HUMAN	N	1106;1062;771	ENSP00000303507:D1106N;ENSP00000352535:D1062N	ENSP00000303507:D1106N	D	+	1	0	BCR	21984017	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.533000	0.98059	2.258000	0.74832	0.449000	0.29647	GAC	.	.	none		0.632	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
NIT2	56954	hgsc.bcm.edu	37	3	100065064	100065064	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:100065064G>A	ENST00000394140.4	+	6	561	c.470G>A	c.(469-471)cGg>cAg	p.R157Q		NM_020202.4	NP_064587.1	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	157	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				asparagine metabolic process (GO:0006528)|glutamine metabolic process (GO:0006541)|oxaloacetate metabolic process (GO:0006107)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	omega-amidase activity (GO:0050152)			breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)	17						TACGACATGCGGTTTGCAGAG	0.493																																					p.R157Q		Atlas-SNP	.											NIT2,NS,carcinoma,0,1	NIT2	35	1	0			c.G470A						scavenged	.						234.0	181.0	199.0					3																	100065064		2203	4300	6503	SO:0001583	missense	56954	exon6			ACATGCGGTTTGC	AF284574	CCDS33806.1	3q12.3	2004-07-12			ENSG00000114021	ENSG00000114021			29878	protein-coding gene	gene with protein product						10959838	Standard	NM_020202		Approved		uc003dtv.3	Q9NQR4	OTTHUMG00000159066	ENST00000394140.4:c.470G>A	3.37:g.100065064G>A	ENSP00000377696:p.Arg157Gln	Somatic	207	0	0		WXS	Illumina HiSeq	Phase_I	227	3	0.0132159	NM_020202	B2R9A3|D3DN47|Q8WUF0	Missense_Mutation	SNP	ENST00000394140.4	37	CCDS33806.1	.	.	.	.	.	.	.	.	.	.	G	35	5.541973	0.96474	.	.	ENSG00000114021	ENST00000394140	D	0.87029	-2.2	5.49	5.49	0.81192	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.000000	0.85682	D	0.000000	D	0.96914	0.8992	H	0.99464	4.58	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98468	1.0599	10	0.87932	D	0	-1.399	19.3536	0.94401	0.0:0.0:1.0:0.0	.	157	Q9NQR4	NIT2_HUMAN	Q	157	ENSP00000377696:R157Q	ENSP00000377696:R157Q	R	+	2	0	NIT2	101547754	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.938000	0.92943	2.733000	0.93635	0.655000	0.94253	CGG	.	.	none		0.493	NIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353142.2	NM_020202	
AMOT	154796	hgsc.bcm.edu	37	X	112033851	112033851	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:112033851G>C	ENST00000524145.1	-	8	2160	c.2086C>G	c.(2086-2088)Ctg>Gtg	p.L696V	AMOT_ENST00000371959.3_Missense_Mutation_p.L696V|AMOT_ENST00000371958.1_Missense_Mutation_p.L464V|AMOT_ENST00000371962.1_Missense_Mutation_p.L464V|AMOT_ENST00000304758.1_Missense_Mutation_p.L287V			Q4VCS5	AMOT_HUMAN	angiomotin	696					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						GCAGCATCCAGAGCAAAATGT	0.473																																					p.L696V		Atlas-SNP	.											.	AMOT	204	.	0			c.C2086G						PASS	.						245.0	226.0	233.0					X																	112033851		2203	4300	6503	SO:0001583	missense	154796	exon7			CATCCAGAGCAAA	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2086C>G	X.37:g.112033851G>C	ENSP00000429013:p.Leu696Val	Somatic	424	0	0		WXS	Illumina HiSeq	Phase_I	191	116	0.60733	NM_001113490	Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	ENST00000524145.1	37	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377766	0.61735	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	T;T;T;T;T	0.22945	1.99;2.2;2.46;2.2;1.93	5.86	4.08	0.47627	Angiomotin, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.34571	0.0902	L	0.39898	1.24	0.46749	D	0.999188	D	0.67145	0.996	D	0.65573	0.936	T	0.04216	-1.0968	10	0.25751	T	0.34	-11.8944	9.0425	0.36327	0.2535:0.0:0.7465:0.0	.	696	Q4VCS5	AMOT_HUMAN	V	287;696;464;696;464	ENSP00000305557:L287V;ENSP00000361027:L696V;ENSP00000361030:L464V;ENSP00000429013:L696V;ENSP00000361026:L464V	ENSP00000305557:L287V	L	-	1	2	AMOT	111920507	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.017000	0.40981	1.211000	0.43351	0.600000	0.82982	CTG	.	.	none		0.473	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265	
CNOT3	4849	hgsc.bcm.edu	37	19	54646891	54646891	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:54646891G>T	ENST00000406403.1	+	2	1665	c.62G>T	c.(61-63)gGc>gTc	p.G21V	CNOT3_ENST00000221232.5_Missense_Mutation_p.G21V|CNOT3_ENST00000358389.3_5'UTR			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	21					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GTGTCCGAGGGCGTGGAGCAG	0.557																																					p.G21V		Atlas-SNP	.											.	CNOT3	133	.	0			c.G62T						PASS	.						171.0	171.0	171.0					19																	54646891		2203	4300	6503	SO:0001583	missense	4849	exon3			CCGAGGGCGTGGA	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.62G>T	19.37:g.54646891G>T	ENSP00000383954:p.Gly21Val	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	65	23	0.353846	NM_014516	Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	37	CCDS12880.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738074	0.89573	.	.	ENSG00000088038	ENST00000221232;ENST00000406403	T;T	0.74632	-0.86;-0.86	5.04	5.04	0.67666	Not CCR4-Not complex component, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88855	0.6550	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91135	0.4941	10	0.87932	D	0	-25.3415	17.5375	0.87837	0.0:0.0:1.0:0.0	.	21;21	B7Z6J7;O75175	.;CNOT3_HUMAN	V	21	ENSP00000221232:G21V;ENSP00000383954:G21V	ENSP00000221232:G21V	G	+	2	0	CNOT3	59338703	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	8.832000	0.92079	2.512000	0.84698	0.655000	0.94253	GGC	.	.	none		0.557	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516	
ADCY5	111	hgsc.bcm.edu	37	3	123167249	123167249	+	Silent	SNP	G	G	A	rs4678027	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:123167249G>A	ENST00000462833.1	-	1	1356	c.144C>T	c.(142-144)ggC>ggT	p.G48G		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	48					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CGCGGGCAGAGCCCCCGGGGG	0.756													A|||	4941	0.986621	0.9501	0.9986	5008	,	,		7224	1.0		1.0	False		,,,				2504	1.0				p.G48G		Atlas-SNP	.											.	ADCY5	169	.	0			c.C144T						PASS	.	A		2646,76		1285,76,0	2.0	2.0	2.0		144	-2.7	0.8	3	dbSNP_111	2	5980,0		2990,0,0	no	coding-synonymous	ADCY5	NM_183357.2		4275,76,0	AA,AG,GG		0.0,2.7921,0.8734		48/1262	123167249	8626,76	1361	2990	4351	SO:0001819	synonymous_variant	111	exon1			GGCAGAGCCCCCG	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.144C>T	3.37:g.123167249G>A		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	ENST00000462833.1	37	CCDS3022.1																																																																																			G|0.027;A|0.973	0.973	strong		0.756	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
PROX1	5629	hgsc.bcm.edu	37	1	214178516	214178516	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:214178516A>C	ENST00000366958.4	+	3	2342	c.1734A>C	c.(1732-1734)gaA>gaC	p.E578D	PROX1_ENST00000435016.1_Missense_Mutation_p.E578D|PROX1_ENST00000261454.4_Missense_Mutation_p.E578D|PROX1_ENST00000498508.2_Missense_Mutation_p.E578D	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	578					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		ACATGCAGGAAGGATTGTCAC	0.473																																					p.E578D		Atlas-SNP	.											.	PROX1	124	.	0			c.A1734C						PASS	.						107.0	106.0	106.0					1																	214178516		2203	4300	6503	SO:0001583	missense	5629	exon3			GCAGGAAGGATTG	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1734A>C	1.37:g.214178516A>C	ENSP00000355925:p.Glu578Asp	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	98	31	0.316327	NM_001270616	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	ENST00000366958.4	37	CCDS31021.1	.	.	.	.	.	.	.	.	.	.	A	16.78	3.219080	0.58560	.	.	ENSG00000117707	ENST00000541470;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.78	5.78	0.91487	Homeo-prospero domain (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.58906	0.2155	M	0.81942	2.565	0.80722	D	1	P	0.38455	0.632	P	0.46389	0.515	T	0.64390	-0.6419	10	0.72032	D	0.01	-4.296	10.4496	0.44513	0.9278:0.0:0.0722:0.0	.	578	Q92786	PROX1_HUMAN	D	150;578;578;578;578	ENSP00000420283:E578D;ENSP00000355925:E578D;ENSP00000400694:E578D;ENSP00000261454:E578D	ENSP00000261454:E578D	E	+	3	2	PROX1	212245139	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.179000	0.50887	2.200000	0.70718	0.460000	0.39030	GAA	.	.	none		0.473	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763	
FRG1	2483	hgsc.bcm.edu	37	4	190876268	190876268	+	Missense_Mutation	SNP	A	A	G	rs528665769		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:190876268A>G	ENST00000226798.4	+	5	616	c.394A>G	c.(394-396)Att>Gtt	p.I132V	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	132					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TTCAGATGCAATTGGACCAAG	0.358																																					p.I132V		Atlas-SNP	.											FRG1,trunk,malignant_melanoma,-1,1	FRG1	76	1	0			c.A394G						scavenged	.						91.0	91.0	91.0					4																	190876268		2203	4300	6503	SO:0001583	missense	2483	exon5			GATGCAATTGGAC	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.394A>G	4.37:g.190876268A>G	ENSP00000226798:p.Ile132Val	Somatic	362	0	0		WXS	Illumina HiSeq	Phase_I	250	4	0.016	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	11.81	1.749824	0.30955	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.44083	2.0;0.93	4.04	4.04	0.47022	Actin cross-linking (1);	0.133249	0.64402	D	0.000004	T	0.31918	0.0812	L	0.42686	1.345	0.80722	D	1	B	0.18741	0.03	B	0.26693	0.072	T	0.07009	-1.0795	10	0.06891	T	0.86	2.1537	11.3071	0.49342	1.0:0.0:0.0:0.0	.	132	Q14331	FRG1_HUMAN	V	132;69	ENSP00000226798:I132V;ENSP00000435943:I69V	ENSP00000226798:I132V	I	+	1	0	FRG1	191113262	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.941000	0.75922	1.599000	0.50093	0.462000	0.41574	ATT	.	.	none		0.358	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
RPRD2	23248	hgsc.bcm.edu	37	1	150443782	150443782	+	Silent	SNP	A	A	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:150443782A>T	ENST00000369068.4	+	11	2362	c.2358A>T	c.(2356-2358)gtA>gtT	p.V786V	RPRD2_ENST00000539519.1_Silent_p.V760V|RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Silent_p.V760V	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	786	Ser-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CCAATTCTGTATCTACATATC	0.493																																					p.V786V		Atlas-SNP	.											RPRD2_ENST00000369068,NS,carcinoma,+2,2	RPRD2	189	2	0			c.A2358T						scavenged	.						84.0	77.0	79.0					1																	150443782		1884	4113	5997	SO:0001819	synonymous_variant	23248	exon11			TTCTGTATCTACA	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.2358A>T	1.37:g.150443782A>T		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	158	2	0.0126582	NM_015203	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Silent	SNP	ENST00000369068.4	37	CCDS44216.1																																																																																			.	.	none		0.493	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
SLAMF6	114836	hgsc.bcm.edu	37	1	160461146	160461146	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:160461146T>C	ENST00000368057.3	-	3	475	c.415A>G	c.(415-417)Agt>Ggt	p.S139G	SLAMF6_ENST00000368059.3_Missense_Mutation_p.S139G|SLAMF6_ENST00000368055.1_Missense_Mutation_p.S28G			Q96DU3	SLAF6_HUMAN	SLAM family member 6	139	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			AATAGCTGACTGTGATTGGTA	0.428																																					p.S139G		Atlas-SNP	.											.	SLAMF6	46	.	0			c.A415G						PASS	.						109.0	104.0	106.0					1																	160461146		2203	4300	6503	SO:0001583	missense	114836	exon3			GCTGACTGTGATT	AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.415A>G	1.37:g.160461146T>C	ENSP00000357036:p.Ser139Gly	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	95	36	0.378947	NM_052931	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Missense_Mutation	SNP	ENST00000368057.3	37	CCDS53394.1	.	.	.	.	.	.	.	.	.	.	T	13.47	2.247160	0.39697	.	.	ENSG00000162739	ENST00000368059;ENST00000368057;ENST00000368055	T;T;T	0.38887	1.11;1.11;1.11	4.37	-3.72	0.04411	Immunoglobulin-like fold (1);	1.726580	0.02671	N	0.108596	T	0.18718	0.0449	M	0.65975	2.015	0.09310	N	1	P;P;D;D;D;D	0.61080	0.897;0.897;0.986;0.986;0.989;0.989	P;P;P;B;P;P	0.46299	0.459;0.459;0.494;0.376;0.511;0.511	T	0.20405	-1.0276	10	0.23891	T	0.37	-0.0012	0.4572	0.00511	0.3174:0.2848:0.1478:0.25	.	28;28;90;139;139;139	B7Z6A7;Q5TAS6;B4E1U5;Q96DU3-2;Q96DU3;B2R8X8	.;.;.;.;SLAF6_HUMAN;.	G	139;139;28	ENSP00000357038:S139G;ENSP00000357036:S139G;ENSP00000357034:S28G	ENSP00000357034:S28G	S	-	1	0	SLAMF6	158727770	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.900000	0.04097	-0.582000	0.05929	0.533000	0.62120	AGT	.	.	none		0.428	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059010.1	NM_052931	
PLCXD3	345557	hgsc.bcm.edu	37	5	41381956	41381956	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:41381956T>G	ENST00000377801.3	-	2	858	c.784A>C	c.(784-786)Agt>Cgt	p.S262R	PLCXD3_ENST00000328457.3_Missense_Mutation_p.S262R			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	262					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						CTGAGGCCACTTGCCACCCCT	0.418																																					p.S262R		Atlas-SNP	.											.	PLCXD3	86	.	0			c.A784C						PASS	.						80.0	84.0	83.0					5																	41381956		2203	4300	6503	SO:0001583	missense	345557	exon2			GGCCACTTGCCAC		CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.784A>C	5.37:g.41381956T>G	ENSP00000367032:p.Ser262Arg	Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	144	54	0.375	NM_001005473	A6NL04	Missense_Mutation	SNP	ENST00000377801.3	37	CCDS34150.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.980845	0.53827	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	.	.	.	6.07	4.9	0.64082	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.036051	0.85682	D	0.000000	T	0.65059	0.2655	L	0.48642	1.525	0.80722	D	1	D	0.61697	0.99	D	0.66497	0.944	T	0.59841	-0.7378	9	0.15499	T	0.54	-11.2139	12.7602	0.57359	0.1231:0.0:0.0:0.8769	.	262	Q63HM9	PLCX3_HUMAN	R	262	.	ENSP00000333751:S262R	S	-	1	0	PLCXD3	41417713	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	3.912000	0.56386	1.097000	0.41459	0.533000	0.62120	AGT	.	.	none		0.418	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367109.1	XM_293875	
ZNF443	10224	hgsc.bcm.edu	37	19	12542646	12542646	+	Missense_Mutation	SNP	C	C	T	rs199587788		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:12542646C>T	ENST00000301547.5	-	4	537	c.340G>A	c.(340-342)Ggt>Agt	p.G114S	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	114					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						GATGAATGACCCATGACTTTT	0.433																																					p.G114S		Atlas-SNP	.											ZNF443,caecum,carcinoma,0,1	ZNF443	63	1	0			c.G340A						PASS	.						137.0	117.0	124.0					19																	12542646		2203	4300	6503	SO:0001583	missense	10224	exon4			AATGACCCATGAC	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.340G>A	19.37:g.12542646C>T	ENSP00000301547:p.Gly114Ser	Somatic	244	0	0		WXS	Illumina HiSeq	Phase_I	200	90	0.45	NM_005815		Missense_Mutation	SNP	ENST00000301547.5	37	CCDS32918.1	.	.	.	.	.	.	.	.	.	.	C	6.531	0.466301	0.12402	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	T	0.06849	3.25	1.37	-2.74	0.05932	.	.	.	.	.	T	0.09862	0.0242	L	0.28400	0.85	0.09310	N	1	D	0.62365	0.991	P	0.60949	0.881	T	0.19943	-1.0290	9	0.16896	T	0.51	.	4.7986	0.13284	0.0:0.3592:0.3668:0.274	.	114	Q9Y2A4	ZN443_HUMAN	S	114	ENSP00000301547:G114S	ENSP00000301547:G114S	G	-	1	0	ZNF443	12403646	0.000000	0.05858	0.002000	0.10522	0.049000	0.14656	-1.109000	0.03309	-0.783000	0.04534	-0.384000	0.06662	GGT	.	.	alt		0.433	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815	
UGT1A9	54600	hgsc.bcm.edu	37	2	234580967	234580967	+	Silent	SNP	A	A	G	rs28946876	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:234580967A>G	ENST00000354728.4	+	1	469	c.387A>G	c.(385-387)aaA>aaG	p.K129K	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Silent_p.K129K			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	129					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	GTTTGTTTAAAGACAAAAAAT	0.313																																					p.K129K		Atlas-SNP	.											UGT1A9,colon,carcinoma,0,1	UGT1A9	79	1	0			c.A387G						scavenged	.						99.0	101.0	101.0					2																	234580967		2203	4300	6503	SO:0001819	synonymous_variant	54600	exon1			GTTTAAAGACAAA	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.387A>G	2.37:g.234580967A>G		Somatic	119	2	0.0168067		WXS	Illumina HiSeq	Phase_I	117	9	0.0769231	NM_021027	B8K285|P36509|Q9HAX0	Silent	SNP	ENST00000354728.4	37	CCDS2505.1																																																																																			.	.	alt		0.313	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
OR5H15	403274	hgsc.bcm.edu	37	3	97888302	97888302	+	Silent	SNP	C	C	A	rs115424559	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:97888302C>A	ENST00000356526.2	+	1	759	c.759C>A	c.(757-759)ggC>ggA	p.G253G		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						TATACTATGGCCCCCTTCTCT	0.433													C|||	51	0.0101837	0.0008	0.0043	5008	,	,		15699	0.0		0.0427	False		,,,				2504	0.0041				p.G253G		Atlas-SNP	.											OR5H15,rectum,carcinoma,0,1	OR5H15	70	1	0			c.C759A						scavenged	.	C		31,4373		1,29,2172	96.0	100.0	98.0		759	-2.5	0.1	3	dbSNP_132	98	212,8388		3,206,4091	no	coding-synonymous	OR5H15	NM_001005515.1		4,235,6263	AA,AC,CC		2.4651,0.7039,1.8687		253/314	97888302	243,12761	2202	4300	6502	SO:0001819	synonymous_variant	403274	exon1			CTATGGCCCCCTT		CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.759C>A	3.37:g.97888302C>A		Somatic	201	0	0		WXS	Illumina HiSeq	Phase_I	285	14	0.0491228	NM_001005515		Silent	SNP	ENST00000356526.2	37	CCDS33799.1																																																																																			C|0.981;A|0.019	0.019	strong		0.433	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359109.1		
LRRK1	79705	hgsc.bcm.edu	37	15	101595359	101595359	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:101595359C>T	ENST00000388948.3	+	27	4622	c.4263C>T	c.(4261-4263)gcC>gcT	p.A1421A	LRRK1_ENST00000284395.5_Silent_p.A1418A|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ATGAGGGCGCCCTAGGCGTGG	0.572																																					p.A1421A		Atlas-SNP	.											LRRK1_ENST00000388948,brain,primitive_neuroectodermal_tumour-medulloblastoma,+2,2	LRRK1	310	2	0			c.C4263T						scavenged	.						77.0	77.0	77.0					15																	101595359		2025	4177	6202	SO:0001819	synonymous_variant	79705	exon27			GGGCGCCCTAGGC	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.4263C>T	15.37:g.101595359C>T		Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	222	3	0.0135135	NM_024652		Silent	SNP	ENST00000388948.3	37	CCDS42086.1																																																																																			.	.	none		0.572	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
GALNT1	2589	hgsc.bcm.edu	37	18	33283603	33283603	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:33283603C>T	ENST00000269195.5	+	10	1632	c.1529C>T	c.(1528-1530)cCa>cTa	p.P510L	GALNT1_ENST00000537549.1_Missense_Mutation_p.P450L	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	510	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						GAGTATGACCCAGTGGTAAGT	0.388																																					p.P510L		Atlas-SNP	.											.	GALNT1	53	.	0			c.C1529T						PASS	.						72.0	71.0	71.0					18																	33283603		2203	4300	6503	SO:0001583	missense	2589	exon10			ATGACCCAGTGGT		CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.1529C>T	18.37:g.33283603C>T	ENSP00000269195:p.Pro510Leu	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	100	14	0.14	NM_020474	Q86TJ7|Q9UM86	Missense_Mutation	SNP	ENST00000269195.5	37	CCDS11915.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.879507	0.51801	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	T;T	0.77877	-1.13;-1.13	5.72	4.83	0.62350	Ricin B-related lectin (1);Ricin B lectin (3);	0.045423	0.85682	D	0.000000	T	0.68183	0.2973	L	0.29908	0.895	0.80722	D	1	B	0.14438	0.01	B	0.17722	0.019	T	0.63950	-0.6521	10	0.46703	T	0.11	.	13.7188	0.62714	0.1552:0.8448:0.0:0.0	.	510	Q10472	GALT1_HUMAN	L	510;510;450	ENSP00000269195:P510L;ENSP00000440910:P450L	ENSP00000269195:P510L	P	+	2	0	GALNT1	31537601	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.777000	0.62361	1.373000	0.46208	0.585000	0.79938	CCA	.	.	none		0.388	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255771.2	NM_020474	
SCN2A	6326	hgsc.bcm.edu	37	2	166245192	166245192	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:166245192C>T	ENST00000375437.2	+	27	5166	c.4876C>T	c.(4876-4878)Cga>Tga	p.R1626*	SCN2A_ENST00000283256.6_Nonsense_Mutation_p.R1626*|SCN2A_ENST00000357398.3_Nonsense_Mutation_p.R1626*|SCN2A_ENST00000375427.2_Nonsense_Mutation_p.R1626*	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1626					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TACCCTGTTCCGAGTGATCCG	0.428																																					p.R1626X		Atlas-SNP	.											SCN2A_ENST00000375437,NS,carcinoma,0,2	SCN2A	589	2	0			c.C4876T						scavenged	.						107.0	108.0	108.0					2																	166245192		2203	4300	6503	SO:0001587	stop_gained	6326	exon26			CTGTTCCGAGTGA	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4876C>T	2.37:g.166245192C>T	ENSP00000364586:p.Arg1626*	Somatic	248	1	0.00403226		WXS	Illumina HiSeq	Phase_I	185	2	0.0108108	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Nonsense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	C	42	9.753121	0.99255	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	.	.	.	5.49	5.49	0.81192	.	0.000000	0.56097	D	0.000032	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8661	0.63590	0.2683:0.7317:0.0:0.0	.	.	.	.	X	1626	.	ENSP00000283256:R1626X	R	+	1	2	SCN2A	165953438	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.052000	0.41316	2.751000	0.94390	0.552000	0.68991	CGA	.	.	none		0.428	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
NTRK3	4916	hgsc.bcm.edu	37	15	88727487	88727487	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:88727487C>T	ENST00000360948.2	-	3	453	c.292G>A	c.(292-294)Gac>Aac	p.D98N	NTRK3_ENST00000540489.2_Missense_Mutation_p.D98N|NTRK3_ENST00000317501.3_Missense_Mutation_p.D98N|NTRK3_ENST00000394480.2_Missense_Mutation_p.D98N|NTRK3_ENST00000542733.2_5'UTR|NTRK3_ENST00000558676.1_Missense_Mutation_p.D98N|NTRK3_ENST00000557856.1_Missense_Mutation_p.D98N|NTRK3_ENST00000357724.2_Missense_Mutation_p.D98N|NTRK3_ENST00000355254.2_Missense_Mutation_p.D98N	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	98					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGCTCCATGTCCACGGCGTTG	0.577			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.D98N		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	587	.	0			c.G292A						PASS	.						110.0	81.0	91.0					15																	88727487		2201	4299	6500	SO:0001583	missense	4916	exon4			CCATGTCCACGGC	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.292G>A	15.37:g.88727487C>T	ENSP00000354207:p.Asp98Asn	Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	99	21	0.212121	NM_001243101	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.601130	0.87055	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000540489;ENST00000317501	D;D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6;-2.6	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.87422	0.6173	N	0.08118	0	0.40417	D	0.979807	D;D;D;D;D	0.89917	0.993;0.997;1.0;0.996;0.982	D;D;D;D;P	0.83275	0.977;0.971;0.996;0.993;0.855	D	0.89666	0.3880	10	0.72032	D	0.01	.	12.4109	0.55466	0.0:1.0:0.0:0.0	.	98;98;98;98;98	E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;NTRK3_HUMAN	N	98	ENSP00000377990:D98N;ENSP00000354207:D98N;ENSP00000350356:D98N;ENSP00000347397:D98N;ENSP00000444673:D98N;ENSP00000318328:D98N	ENSP00000318328:D98N	D	-	1	0	NTRK3	86528491	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	5.258000	0.65479	2.299000	0.77371	0.655000	0.94253	GAC	.	.	none		0.577	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
SLC35G3	146861	hgsc.bcm.edu	37	17	33520358	33520358	+	Silent	SNP	A	A	G	rs74740601		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:33520358A>G	ENST00000297307.5	-	1	1054	c.969T>C	c.(967-969)atT>atC	p.I323I	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	323	EamA 2.					integral component of membrane (GO:0016021)		p.I323I(1)									TCTGGGCTGTAATGATGGCAA	0.547																																					p.I323I		Atlas-SNP	.											AMAC1,NS,carcinoma,0,1	.	.	1	1	Substitution - coding silent(1)	lung(1)	c.T969C						scavenged	.																																			SO:0001819	synonymous_variant	146861	exon1			GGCTGTAATGATG	AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.969T>C	17.37:g.33520358A>G		Somatic	186	2	0.0107527		WXS	Illumina HiSeq	Phase_I	167	4	0.0239521	NM_152462	B9EGE9	Silent	SNP	ENST00000297307.5	37	CCDS11293.1																																																																																			.	.	weak		0.547	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256445.2	NM_152462	
CCNA1	8900	hgsc.bcm.edu	37	13	37011846	37011846	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr13:37011846G>A	ENST00000255465.4	+	3	642	c.378G>A	c.(376-378)ggG>ggA	p.G126G	CCNA1_ENST00000418263.1_Silent_p.G125G|CCNA1_ENST00000440264.1_Silent_p.G82G|CCNA1_ENST00000463403.1_3'UTR|CCNA1_ENST00000449823.1_Silent_p.G82G			P78396	CCNA1_HUMAN	cyclin A1	126					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		CTGACTGTGGGGTCCAAGAGC	0.498																																					p.G126G		Atlas-SNP	.											CCNA1,NS,carcinoma,+1,1	CCNA1	91	1	0			c.G378A						scavenged	.						83.0	89.0	87.0					13																	37011846		2203	4300	6503	SO:0001819	synonymous_variant	8900	exon3			CTGTGGGGTCCAA	U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.378G>A	13.37:g.37011846G>A		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	77	2	0.025974	NM_003914	B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Silent	SNP	ENST00000255465.4	37	CCDS9357.1																																																																																			.	.	none		0.498	CCNA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044514.2	NM_003914	
HUNK	30811	hgsc.bcm.edu	37	21	33371236	33371236	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr21:33371236C>T	ENST00000270112.2	+	11	2244	c.1884C>T	c.(1882-1884)aaC>aaT	p.N628N		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	628					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						AAGATAAGAACAGCCCCCCAA	0.597																																					p.N628N		Atlas-SNP	.											.	HUNK	74	.	0			c.C1884T						PASS	.						48.0	48.0	48.0					21																	33371236		2203	4300	6503	SO:0001819	synonymous_variant	30811	exon11			TAAGAACAGCCCC	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1884C>T	21.37:g.33371236C>T		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	100	33	0.33	NM_014586		Silent	SNP	ENST00000270112.2	37	CCDS13610.1																																																																																			.	.	none		0.597	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
PPP1R3A	5506	hgsc.bcm.edu	37	7	113519070	113519070	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:113519070T>C	ENST00000284601.3	-	4	2145	c.2077A>G	c.(2077-2079)Agg>Ggg	p.R693G		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	693					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TTCAAACTCCTCGTATTATCT	0.398																																					p.R693G		Atlas-SNP	.											PPP1R3A,NS,carcinoma,+1,1	PPP1R3A	317	1	0			c.A2077G						scavenged	.						253.0	247.0	249.0					7																	113519070		2203	4300	6503	SO:0001583	missense	5506	exon4			AACTCCTCGTATT	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2077A>G	7.37:g.113519070T>C	ENSP00000284601:p.Arg693Gly	Somatic	252	0	0		WXS	Illumina HiSeq	Phase_I	353	4	0.0113314	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	T	4.900	0.167344	0.09339	.	.	ENSG00000154415	ENST00000284601	T	0.19938	2.11	5.69	3.31	0.37934	.	0.421244	0.27901	N	0.017381	T	0.16214	0.0390	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.20538	-1.0272	10	0.51188	T	0.08	-2.58	5.8524	0.18699	0.0:0.2251:0.1296:0.6453	.	693	Q16821	PPR3A_HUMAN	G	693	ENSP00000284601:R693G	ENSP00000284601:R693G	R	-	1	2	PPP1R3A	113306306	0.000000	0.05858	0.001000	0.08648	0.660000	0.38997	-0.075000	0.11431	0.428000	0.26173	0.528000	0.53228	AGG	.	.	none		0.398	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
EEFSEC	60678	hgsc.bcm.edu	37	3	128060190	128060190	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:128060190G>A	ENST00000254730.6	+	5	955	c.901G>A	c.(901-903)Ggg>Agg	p.G301R	EEFSEC_ENST00000483569.1_3'UTR|EEFSEC_ENST00000483457.1_Missense_Mutation_p.G246R	NM_021937.3	NP_068756.2	P57772	SELB_HUMAN	eukaryotic elongation factor, selenocysteine-tRNA-specific	301					selenocysteine incorporation (GO:0001514)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)|translation elongation factor activity (GO:0003746)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)	25						GCTGGAGCGCGGGTTGGTGTG	0.592																																					p.G301R		Atlas-SNP	.											EEFSEC,colon,carcinoma,0,2	EEFSEC	53	2	0			c.G901A						scavenged	.						87.0	80.0	82.0					3																	128060190		2203	4300	6503	SO:0001583	missense	60678	exon5			GAGCGCGGGTTGG		CCDS33849.1	3q21.3	2007-05-25			ENSG00000132394	ENSG00000132394			24614	protein-coding gene	gene with protein product	"""elongation factor for selenoprotein translation"""	607695				10970870, 15229221	Standard	XM_005247696		Approved	SELB, EFSEC	uc003eki.3	P57772	OTTHUMG00000159659	ENST00000254730.6:c.901G>A	3.37:g.128060190G>A	ENSP00000254730:p.Gly301Arg	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	215	3	0.0139535	NM_021937	Q96HZ6	Missense_Mutation	SNP	ENST00000254730.6	37	CCDS33849.1	.	.	.	.	.	.	.	.	.	.	G	31	5.093277	0.94149	.	.	ENSG00000132394	ENST00000254730;ENST00000483457	T;T	0.70516	-0.42;-0.49	5.34	5.34	0.76211	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.92074	0.7488	H	0.99740	4.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95724	0.8769	10	0.87932	D	0	-15.2532	19.0252	0.92930	0.0:0.0:1.0:0.0	.	246;301	C9J8T0;P57772	.;SELB_HUMAN	R	301;246	ENSP00000254730:G301R;ENSP00000417660:G246R	ENSP00000254730:G301R	G	+	1	0	EEFSEC	129542880	1.000000	0.71417	0.976000	0.42696	0.961000	0.63080	9.849000	0.99510	2.480000	0.83734	0.591000	0.81541	GGG	.	.	none		0.592	EEFSEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356738.2	NM_021937	
EXT1	2131	hgsc.bcm.edu	37	8	118812014	118812014	+	Silent	SNP	G	G	A	rs557560039	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr8:118812014G>A	ENST00000378204.2	-	11	2984	c.2178C>T	c.(2176-2178)ccC>ccT	p.P726P		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	726					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TAAAGAGGACGGGGTCGAGCC	0.537			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses				G|||	2	0.000399361	0.0	0.0	5008	,	,		17425	0.0		0.0	False		,,,				2504	0.002				p.P726P		Atlas-SNP	.	yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	.	EXT1	98	.	0			c.C2178T						PASS	.						88.0	84.0	85.0					8																	118812014		2203	4300	6503	SO:0001819	synonymous_variant	2131	exon11	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	GAGGACGGGGTCG	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.2178C>T	8.37:g.118812014G>A		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	188	26	0.138298	NM_000127	B2R7V2|Q9BVI9	Silent	SNP	ENST00000378204.2	37	CCDS6324.1																																																																																			.	.	none		0.537	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
FMOD	2331	hgsc.bcm.edu	37	1	203316506	203316506	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:203316506A>G	ENST00000354955.4	-	2	1356	c.893T>C	c.(892-894)cTa>cCa	p.L298P	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	298					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			GGAGAGGTCTAGCTCAAGGAG	0.562																																					p.L298P		Atlas-SNP	.											FMOD,NS,carcinoma,0,2	FMOD	49	2	0			c.T893C						scavenged	.						153.0	144.0	147.0					1																	203316506		2203	4300	6503	SO:0001583	missense	2331	exon2			AGGTCTAGCTCAA	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.893T>C	1.37:g.203316506A>G	ENSP00000347041:p.Leu298Pro	Somatic	339	0	0		WXS	Illumina HiSeq	Phase_I	259	4	0.015444	NM_002023	Q15331|Q8IV47	Missense_Mutation	SNP	ENST00000354955.4	37	CCDS30976.1	.	.	.	.	.	.	.	.	.	.	A	19.03	3.747207	0.69418	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	D	0.81908	-1.55	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.94739	0.8302	H	0.98754	4.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96566	0.9419	10	0.87932	D	0	-18.5485	13.8772	0.63660	1.0:0.0:0.0:0.0	.	298	Q06828	FMOD_HUMAN	P	285;298	ENSP00000347041:L298P	ENSP00000347041:L298P	L	-	2	0	FMOD	201583129	1.000000	0.71417	0.962000	0.40283	0.994000	0.84299	8.962000	0.93254	1.956000	0.56807	0.533000	0.62120	CTA	.	.	none		0.562	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087472.1	NM_002023	
TMPRSS12	283471	hgsc.bcm.edu	37	12	51237782	51237782	+	Silent	SNP	G	G	A	rs374807523		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:51237782G>A	ENST00000398458.3	+	2	377	c.345G>A	c.(343-345)agG>agA	p.R115R	RN7SL519P_ENST00000497925.2_RNA|TMPRSS12_ENST00000551456.1_Silent_p.R115R	NM_182559.2	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane (C-terminal) protease, serine 12	115	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	18						TGAGAGAGAGGTGGGTCCTCA	0.498																																					p.R115R		Atlas-SNP	.											.	TMPRSS12	33	.	0			c.G345A						PASS	.	G		0,4136		0,0,2068	49.0	51.0	51.0		345	-2.0	0.2	12		51	2,8434		0,2,4216	no	coding-synonymous	TMPRSS12	NM_182559.2		0,2,6284	AA,AG,GG		0.0237,0.0,0.0159		115/349	51237782	2,12570	2068	4218	6286	SO:0001819	synonymous_variant	283471	exon2			AGAGAGGTGGGTC	BC048112	CCDS44881.1	12q13.12	2014-08-12	2010-04-21		ENSG00000186452	ENSG00000186452		"""Serine peptidases / Transmembrane"""	28779	protein-coding gene	gene with protein product			"""transmembrane protease, serine 12"""				Standard	NM_182559		Approved	MGC57341, CT151	uc001rwx.4	Q86WS5	OTTHUMG00000169483	ENST00000398458.3:c.345G>A	12.37:g.51237782G>A		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	90	40	0.444444	NM_182559	B9ZVX2	Silent	SNP	ENST00000398458.3	37	CCDS44881.1																																																																																			.	.	weak		0.498	TMPRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404289.1	NM_182559	
COL5A2	1290	hgsc.bcm.edu	37	2	189927788	189927788	+	Splice_Site	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:189927788C>T	ENST00000374866.3	-	28	2145	c.1871G>A	c.(1870-1872)gGt>gAt	p.G624D		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	624					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCCAGGGTCACCCTAAAGAAT	0.368																																					p.G624D		Atlas-SNP	.											.	COL5A2	230	.	0			c.G1871A						PASS	.						97.0	114.0	108.0					2																	189927788		2202	4300	6502	SO:0001630	splice_region_variant	1290	exon28			GGGTCACCCTAAA	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1870-1G>A	2.37:g.189927788C>T		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	68	8	0.117647	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.342360	0.81911	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99619	-6.28	4.74	4.74	0.60224	.	0.000000	0.49305	D	0.000156	D	0.99746	0.9899	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97117	0.9808	9	.	.	.	.	18.1082	0.89527	0.0:1.0:0.0:0.0	.	264;624	Q5PR22;P05997	.;CO5A2_HUMAN	D	624;264	ENSP00000364000:G624D	.	G	-	2	0	COL5A2	189636033	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	7.445000	0.80570	2.339000	0.79563	0.467000	0.42956	GGT	.	.	none		0.368	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	Missense_Mutation
NRXN3	9369	hgsc.bcm.edu	37	14	79175759	79175759	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:79175759A>G	ENST00000554719.1	+	4	793	c.302A>G	c.(301-303)gAc>gGc	p.D101G	RP11-232C2.2_ENST00000555680.1_RNA|NRXN3_ENST00000335750.5_Missense_Mutation_p.D101G	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	0	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ATCTCCTTTGACTTCCGCACC	0.517																																					p.D101G		Atlas-SNP	.											.	NRXN3	342	.	0			c.A302G						PASS	.						131.0	116.0	121.0					14																	79175759		2203	4300	6503	SO:0001583	missense	9369	exon4			CCTTTGACTTCCG	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.302A>G	14.37:g.79175759A>G	ENSP00000451648:p.Asp101Gly	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	163	46	0.282209	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.269142	0.80469	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000553631;ENST00000554719;ENST00000335750;ENST00000557081	T;T;T;T	0.79141	-1.22;-1.24;-1.24;-1.22	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.000000	0.85682	D	0.000000	D	0.88119	0.6351	M	0.87547	2.89	0.80722	D	1	D;P	0.67145	0.996;0.782	P;P	0.61477	0.889;0.569	D	0.89852	0.4010	9	.	.	.	.	15.3852	0.74691	1.0:0.0:0.0:0.0	.	474;101	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	G	474;472;45;101;101;45	ENSP00000451947:D45G;ENSP00000451648:D101G;ENSP00000338349:D101G;ENSP00000450462:D45G	.	D	+	2	0	NRXN3	78245512	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.339000	0.96797	2.037000	0.60232	0.460000	0.39030	GAC	.	.	none		0.517	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
TBP	6908	hgsc.bcm.edu	37	6	170871058	170871058	+	Silent	SNP	G	G	A	rs113440919		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:170871058G>A	ENST00000392092.2	+	3	513	c.234G>A	c.(232-234)caG>caA	p.Q78Q	TBP_ENST00000230354.6_Silent_p.Q78Q|TBP_ENST00000540980.1_Silent_p.Q58Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	78	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcagcagcagcagc	0.577																																					p.Q78Q		Atlas-SNP	.											TBP,caecum,carcinoma,0,1	TBP	58	1	0			c.G234A						scavenged	.						13.0	18.0	16.0					6																	170871058		1927	3786	5713	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.234G>A	6.37:g.170871058G>A		Somatic	87	1	0.0114943		WXS	Illumina HiSeq	Phase_I	105	3	0.0285714	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			G|0.500;A|0.500	0.500	weak		0.577	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
GTF3C2	2976	hgsc.bcm.edu	37	2	27549652	27549652	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:27549652G>A	ENST00000359541.2	-	19	3055	c.2626C>T	c.(2626-2628)Cgt>Tgt	p.R876C	MPV17_ENST00000357186.6_5'Flank|GTF3C2_ENST00000264720.3_Missense_Mutation_p.R876C			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	876					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCTGCATACGGTGGCCCAGT	0.592																																					p.A876S		Atlas-SNP	.											GTF3C2,caecum,carcinoma,+1,1	GTF3C2	73	1	0			c.G2626T						scavenged	.						101.0	100.0	100.0					2																	27549652		2203	4300	6503	SO:0001583	missense	2976	exon20			GCATACGGTGGCC	D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.2626C>T	2.37:g.27549652G>A	ENSP00000352536:p.Arg876Cys	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	113	3	0.0265487	NM_001521	D6W557|Q16632|Q9BWI7	Missense_Mutation	SNP	ENST00000359541.2	37	CCDS1749.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.958706	0.74016	.	.	ENSG00000115207	ENST00000359541;ENST00000264720	T;T	0.76060	-0.99;-0.99	5.31	5.31	0.75309	.	0.116998	0.56097	D	0.000023	T	0.75474	0.3854	N	0.24115	0.695	0.50171	D	0.999852	D	0.89917	1.0	D	0.67548	0.952	T	0.77294	-0.2641	10	0.72032	D	0.01	-4.6885	11.4194	0.49971	0.0:0.0:0.8202:0.1798	.	876	Q8WUA4	TF3C2_HUMAN	C	876	ENSP00000352536:R876C;ENSP00000264720:R876C	ENSP00000264720:R876C	R	-	1	0	GTF3C2	27403156	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.739000	0.38217	2.758000	0.94735	0.655000	0.94253	CGT	.	.	none		0.592	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2		
FAT4	79633	hgsc.bcm.edu	37	4	126408517	126408517	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:126408517A>G	ENST00000394329.3	+	16	12847	c.12834A>G	c.(12832-12834)gtA>gtG	p.V4278V	FAT4_ENST00000335110.5_Silent_p.V2519V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4278	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATGGCAAAGTATATTTTACAT	0.299																																					p.V4278V		Atlas-SNP	.											.	FAT4	1752	.	0			c.A12834G						PASS	.						48.0	51.0	50.0					4																	126408517		2203	4298	6501	SO:0001819	synonymous_variant	79633	exon16			CAAAGTATATTTT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.12834A>G	4.37:g.126408517A>G		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	36	10	0.277778	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																			.	.	none		0.299	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
KLRC3	3823	hgsc.bcm.edu	37	12	10588526	10588526	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:10588526C>T	ENST00000539033.1	-	1	74	c.60G>A	c.(58-60)caG>caA	p.Q20Q	KLRC2_ENST00000381901.1_Silent_p.Q20Q|KLRC2_ENST00000536833.2_Intron|KLRC2_ENST00000381902.2_Silent_p.Q20Q																							GTTTCCTTTGCTGCCGCTTTG	0.428																																					p.Q20Q		Atlas-SNP	.											KLRC2,colon,carcinoma,-2,1	KLRC2	29	1	0			c.G60A						scavenged	.						254.0	253.0	254.0					12																	10588526		2203	4300	6503	SO:0001819	synonymous_variant	3822	exon1			CCTTTGCTGCCGC																												ENST00000539033.1:c.60G>A	12.37:g.10588526C>T		Somatic	599	1	0.00166945		WXS	Illumina HiSeq	Phase_I	517	5	0.00967118	NM_002260		Silent	SNP	ENST00000539033.1	37																																																																																				.	.	none		0.428	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000400274.1		
OR5H1	26341	hgsc.bcm.edu	37	3	97852237	97852237	+	Silent	SNP	A	A	G	rs150614363		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:97852237A>G	ENST00000354565.2	+	1	696	c.696A>G	c.(694-696)aaA>aaG	p.K232K	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						AATCTGATAAAGGTGTAAGGA	0.388																																					p.K232K		Atlas-SNP	.											.	OR5H1	71	.	0			c.A696G						PASS	.	A		3,4403	4.2+/-10.8	0,3,2200	90.0	98.0	95.0		696	-1.9	0.0	3	dbSNP_134	95	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	OR5H1	NM_001005338.1		0,4,6498	GG,GA,AA		0.0116,0.0681,0.0308		232/314	97852237	4,13000	2203	4299	6502	SO:0001819	synonymous_variant	26341	exon1			TGATAAAGGTGTA	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.696A>G	3.37:g.97852237A>G		Somatic	257	0	0		WXS	Illumina HiSeq	Phase_I	237	35	0.147679	NM_001005338		Silent	SNP	ENST00000354565.2	37	CCDS33797.1																																																																																			A|1.000;G|0.000	0.000	weak		0.388	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
FILIP1	27145	hgsc.bcm.edu	37	6	76018589	76018589	+	Missense_Mutation	SNP	G	G	A	rs369386052		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:76018589G>A	ENST00000237172.7	-	6	3790	c.3460C>T	c.(3460-3462)Cgg>Tgg	p.R1154W	FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000393004.2_Missense_Mutation_p.R1154W|FILIP1_ENST00000370020.1_Missense_Mutation_p.R1055W	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	1154										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						GGTGTAGGCCGCTGGGATGAC	0.493																																					p.R1154W		Atlas-SNP	.											FILIP1,right_upper_lobe,carcinoma,0,1	FILIP1	173	1	0			c.C3460T						PASS	.	G	TRP/ARG	0,4406		0,0,2203	93.0	90.0	91.0		3460	5.9	1.0	6		91	1,8599	1.2+/-3.3	0,1,4299	no	missense	FILIP1	NM_015687.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1154/1214	76018589	1,13005	2203	4300	6503	SO:0001583	missense	27145	exon6			TAGGCCGCTGGGA	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.3460C>T	6.37:g.76018589G>A	ENSP00000237172:p.Arg1154Trp	Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	174	57	0.327586	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	ENST00000237172.7	37	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.958904	0.74016	0.0	1.16E-4	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.27720	1.66;1.65;1.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.45994	0.1370	M	0.61703	1.905	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.992;0.997	T	0.40869	-0.9540	10	0.87932	D	0	-16.9412	14.9358	0.70954	0.0:0.0:0.8235:0.1765	.	1154;1154;1154	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	W	1154;1154;1055	ENSP00000376728:R1154W;ENSP00000237172:R1154W;ENSP00000359037:R1055W	ENSP00000237172:R1154W	R	-	1	2	FILIP1	76075309	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.609000	0.54117	2.794000	0.96219	0.655000	0.94253	CGG	.	.	weak		0.493	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
PYDC2	152138	hgsc.bcm.edu	37	3	191179233	191179233	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:191179233G>A	ENST00000518817.1	+	1	282	c.282G>A	c.(280-282)atG>atA	p.M94I		NM_001083308.1	NP_001076777.1	Q56P42	PYDC2_HUMAN	pyrin domain containing 2	94	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10						ACTGTGTGATGCCCCCACCTT	0.507																																					p.M94I		Atlas-SNP	.											PYDC2,NS,carcinoma,0,1	PYDC2	24	1	0			c.G282A						scavenged	.						83.0	86.0	85.0					3																	191179233		2106	4257	6363	SO:0001583	missense	152138	exon1			TGTGATGCCCCCA			3q28	2008-07-29				ENSG00000253548			33512	protein-coding gene	gene with protein product		615701				17178784	Standard	NM_001083308		Approved	POP2	uc011bso.2	Q56P42		ENST00000518817.1:c.282G>A	3.37:g.191179233G>A	ENSP00000428325:p.Met94Ile	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	119	4	0.0336134	NM_001083308		Missense_Mutation	SNP	ENST00000518817.1	37		.	.	.	.	.	.	.	.	.	.	G	2.961	-0.214674	0.06101	.	.	ENSG00000253548	ENST00000518817	T	0.63744	-0.06	0.158	0.158	0.14942	Pyrin (1);DEATH-like (1);	.	.	.	.	T	0.45577	0.1349	.	.	.	0.09310	N	1	B	0.25169	0.119	B	0.14578	0.011	T	0.38023	-0.9680	7	0.66056	D	0.02	.	.	.	.	.	94	Q56P42	PYDC2_HUMAN	I	94	ENSP00000428325:M94I	ENSP00000428325:M94I	M	+	3	0	PYDC2	192661927	0.012000	0.17670	0.006000	0.13384	0.006000	0.05464	0.251000	0.18257	0.202000	0.20498	0.205000	0.17691	ATG	.	.	none		0.507	PYDC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000343231.2	NM_001083308	
CDKL2	8999	hgsc.bcm.edu	37	4	76507055	76507055	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:76507055T>G	ENST00000429927.2	-	11	2173	c.1470A>C	c.(1468-1470)gaA>gaC	p.E490D	CDKL2_ENST00000307465.4_Missense_Mutation_p.E567D	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	490					sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AGTGCTGGTGTTCCATTTGAG	0.428																																					p.E490D		Atlas-SNP	.											.	CDKL2	58	.	0			c.A1470C						PASS	.						88.0	81.0	83.0					4																	76507055		2203	4300	6503	SO:0001583	missense	8999	exon11			CTGGTGTTCCATT	U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.1470A>C	4.37:g.76507055T>G	ENSP00000412365:p.Glu490Asp	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	91	40	0.43956	NM_003948	B2R695	Missense_Mutation	SNP	ENST00000429927.2	37	CCDS3570.1	.	.	.	.	.	.	.	.	.	.	T	11.06	1.528127	0.27299	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	T;T	0.72725	-0.55;-0.68	4.75	-5.16	0.02857	.	.	.	.	.	T	0.65647	0.2711	N	0.08118	0	0.21627	N	0.999612	D;D	0.58970	0.984;0.984	D;D	0.68192	0.956;0.956	T	0.65117	-0.6246	9	0.87932	D	0	-14.3407	13.6115	0.62080	0.0:0.6766:0.0:0.3234	.	567;490	B4DH08;Q92772	.;CDKL2_HUMAN	D	490;567	ENSP00000412365:E490D;ENSP00000306340:E567D	ENSP00000306340:E567D	E	-	3	2	CDKL2	76726079	0.746000	0.28272	0.961000	0.40146	0.689000	0.40095	-0.848000	0.04326	-0.800000	0.04433	-0.424000	0.05967	GAA	.	.	none		0.428	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252409.2	NM_003948	
TMSB4X	7114	hgsc.bcm.edu	37	X	12994407	12994407	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:12994407G>C	ENST00000380635.1	+	2	243	c.27G>C	c.(25-27)gaG>gaC	p.E9D	TMSB4X_ENST00000380633.1_Missense_Mutation_p.E9D|TMSB4X_ENST00000380636.1_Missense_Mutation_p.E9D|TMSB4X_ENST00000451311.2_Missense_Mutation_p.E9D			P62328	TYB4_HUMAN	thymosin beta 4, X-linked	9					actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sequestering of actin monomers (GO:0042989)	cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	poly(A) RNA binding (GO:0044822)			upper_aerodigestive_tract(1)	1						ATATGGCTGAGATCGAGAAAT	0.527																																					p.E9D		Atlas-SNP	.											.	TMSB4X	3	.	0			c.G27C						PASS	.						65.0	63.0	64.0					X																	12994407		2203	4298	6501	SO:0001583	missense	7114	exon2			GGCTGAGATCGAG		CCDS35202.1	Xp22.2	2013-05-14	2008-02-25		ENSG00000205542	ENSG00000205542			11881	protein-coding gene	gene with protein product		300159	"""thymosin, beta 4, X chromosome"""	TMSB4		2677145, 9381176	Standard	NM_021109		Approved	TB4X	uc004cvf.3	P62328	OTTHUMG00000021144	ENST00000380635.1:c.27G>C	X.37:g.12994407G>C	ENSP00000370009:p.Glu9Asp	Somatic	366	0	0		WXS	Illumina HiSeq	Phase_I	212	141	0.665094	NM_021109	P01253|P01254|Q546P5|Q63576|Q9UE55	Missense_Mutation	SNP	ENST00000380635.1	37	CCDS35202.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544587	0.65198	.	.	ENSG00000205542	ENST00000451311;ENST00000380636;ENST00000380635;ENST00000380633	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	4.66	4.66	0.58398	.	0.000000	0.64402	U	0.000010	T	0.69396	0.3106	.	.	.	0.36331	D	0.858899	D	0.62365	0.991	P	0.59595	0.86	T	0.78041	-0.2359	9	0.66056	D	0.02	-11.1719	11.3215	0.49424	0.0926:0.0:0.9074:0.0	.	9	P62328	TYB4_HUMAN	D	9	ENSP00000414376:E9D;ENSP00000370010:E9D;ENSP00000370009:E9D;ENSP00000370007:E9D	ENSP00000370007:E9D	E	+	3	2	TMSB4X	12904328	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.324000	0.43831	2.064000	0.61679	0.600000	0.82982	GAG	.	.	none		0.527	TMSB4X-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000055779.1	NM_021109	
MUC17	140453	hgsc.bcm.edu	37	7	100680261	100680261	+	Missense_Mutation	SNP	C	C	G	rs141195508	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:100680261C>G	ENST00000306151.4	+	3	5628	c.5564C>G	c.(5563-5565)aCc>aGc	p.T1855S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1855	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T1855N(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCTGAAGGTACCAGCATAGCA	0.478													-|||	488	0.0974441	0.0877	0.0144	5008	,	,		24680	0.1855		0.004	False		,,,				2504	0.1748				p.T1855S		Atlas-SNP	.											MUC17,NS,carcinoma,0,1	MUC17	804	1	1	Substitution - Missense(1)	lung(1)	c.C5564G						scavenged	.						209.0	218.0	215.0					7																	100680261		2203	4300	6503	SO:0001583	missense	140453	exon3			AAGGTACCAGCAT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5564C>G	7.37:g.100680261C>G	ENSP00000302716:p.Thr1855Ser	Somatic	69	9	0.130435		WXS	Illumina HiSeq	Phase_I	86	25	0.290698	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	1.911	-0.450614	0.04572	.	.	ENSG00000169876	ENST00000306151	T	0.02323	4.34	0.824	-0.378	0.12497	.	.	.	.	.	T	0.01320	0.0043	N	0.14661	0.345	0.09310	N	1	P	0.46912	0.886	B	0.31245	0.126	T	0.51521	-0.8695	9	0.24483	T	0.36	.	5.8673	0.18783	0.3073:0.6927:0.0:0.0	.	1855	Q685J3	MUC17_HUMAN	S	1855	ENSP00000302716:T1855S	ENSP00000302716:T1855S	T	+	2	0	MUC17	100466981	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.049000	0.11924	-0.088000	0.12506	0.134000	0.15878	ACC	C|0.997;G|0.002	0.002	alt		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
CYP2A13	1553	hgsc.bcm.edu	37	19	41599616	41599616	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:41599616A>G	ENST00000330436.3	+	6	913	c.913A>G	c.(913-915)Acc>Gcc	p.T305A		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	305					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GGGCACTGAGACCGTGAGCAC	0.577																																					p.T305A		Atlas-SNP	.											CYP2A13,mucosal,malignant_melanoma,-1,1	CYP2A13	90	1	0			c.A913G						scavenged	.						115.0	95.0	101.0					19																	41599616		2203	4300	6503	SO:0001583	missense	1553	exon6			ACTGAGACCGTGA	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.913A>G	19.37:g.41599616A>G	ENSP00000332679:p.Thr305Ala	Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	189	3	0.015873	NM_000766	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	37	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	16.34	3.095389	0.56075	.	.	ENSG00000197838	ENST00000330436	D	0.87571	-2.27	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	D	0.92857	0.7728	M	0.89353	3.025	0.35878	D	0.828761	P	0.51933	0.949	P	0.57911	0.829	D	0.96277	0.9203	10	0.87932	D	0	.	13.1064	0.59249	1.0:0.0:0.0:0.0	.	305	Q16696	CP2AD_HUMAN	A	305	ENSP00000332679:T305A	ENSP00000332679:T305A	T	+	1	0	CYP2A13	46291456	1.000000	0.71417	0.679000	0.29978	0.204000	0.24138	8.465000	0.90383	1.945000	0.56424	0.397000	0.26171	ACC	.	.	none		0.577	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
MYADM	91663	hgsc.bcm.edu	37	19	54377236	54377236	+	Silent	SNP	C	C	T	rs376434685		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:54377236C>T	ENST00000391769.2	+	3	733	c.453C>T	c.(451-453)taC>taT	p.Y151Y	MYADM_ENST00000336967.3_Silent_p.Y151Y|MYADM_ENST00000391771.1_Silent_p.Y151Y|MYADM_ENST00000391768.2_Silent_p.Y151Y|MYADM_ENST00000391770.4_Silent_p.Y151Y|AC008440.5_ENST00000413496.2_RNA	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	151	MARVEL 1. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		GTGTGGCTTACGCCACCGAAG	0.652																																					p.Y151Y		Atlas-SNP	.											.	MYADM	39	.	0			c.C453T						PASS	.	C	,,,,	0,4406		0,0,2203	54.0	55.0	54.0		453,453,453,453,453	-5.3	0.1	19		54	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MYADM	NM_001020818.1,NM_001020819.1,NM_001020820.1,NM_001020821.1,NM_138373.3	,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,	151/323,151/323,151/323,151/323,151/323	54377236	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	91663	exon3			GGCTTACGCCACC	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.453C>T	19.37:g.54377236C>T		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	84	36	0.428571	NM_138373	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Silent	SNP	ENST00000391769.2	37	CCDS12866.1																																																																																			.	.	weak		0.652	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	NM_138373	
OR5T1	390155	hgsc.bcm.edu	37	11	56043714	56043714	+	Silent	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:56043714T>G	ENST00000313033.2	+	1	686	c.600T>G	c.(598-600)tcT>tcG	p.S200S		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S200S(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TTGCTATTTCTTGTTCTGACA	0.398																																					p.S200S		Atlas-SNP	.											OR5T1,NS,carcinoma,0,1	OR5T1	95	1	1	Substitution - coding silent(1)	lung(1)	c.T600G						PASS	.						236.0	224.0	228.0					11																	56043714		2201	4296	6497	SO:0001819	synonymous_variant	390155	exon1			TATTTCTTGTTCT	AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.600T>G	11.37:g.56043714T>G		Somatic	402	0	0		WXS	Illumina HiSeq	Phase_I	315	115	0.365079	NM_001004745	B2RNM9	Silent	SNP	ENST00000313033.2	37	CCDS31525.1																																																																																			.	.	none		0.398	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745	
DRC1	92749	hgsc.bcm.edu	37	2	26654770	26654770	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:26654770C>T	ENST00000288710.2	+	7	858	c.784C>T	c.(784-786)Cgc>Tgc	p.R262C	DRC1_ENST00000483675.1_3'UTR	NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	262					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											TCTTAACAACCGCATGAAGAA	0.493																																					p.R262C		Atlas-SNP	.											CCDC164,NS,carcinoma,-1,1	CCDC164	84	1	0			c.C784T						scavenged	.						150.0	147.0	148.0					2																	26654770		2203	4300	6503	SO:0001583	missense	92749	exon7			AACAACCGCATGA	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.784C>T	2.37:g.26654770C>T	ENSP00000288710:p.Arg262Cys	Somatic	203	1	0.00492611		WXS	Illumina HiSeq	Phase_I	156	3	0.0192308	NM_145038	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Missense_Mutation	SNP	ENST00000288710.2	37	CCDS1723.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.277876	0.59758	.	.	ENSG00000157856	ENST00000288710;ENST00000442810	T	0.18960	2.18	5.65	5.65	0.86999	.	0.142077	0.64402	D	0.000005	T	0.51295	0.1666	M	0.80847	2.515	0.47441	D	0.999428	D	0.89917	1.0	D	0.85130	0.997	T	0.51988	-0.8635	10	0.56958	D	0.05	-15.95	18.4958	0.90864	0.0:1.0:0.0:0.0	.	262	Q96MC2	CC164_HUMAN	C	262;91	ENSP00000288710:R262C	ENSP00000288710:R262C	R	+	1	0	CCDC164	26508274	0.992000	0.36948	0.999000	0.59377	0.186000	0.23388	2.977000	0.49297	2.659000	0.90383	0.655000	0.94253	CGC	.	.	none		0.493	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1	NM_145038	
PADI6	353238	hgsc.bcm.edu	37	1	17701957	17701957	+	RNA	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:17701957C>T	ENST00000434762.2	+	0	380							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	ACGAGGATGCCCCCGTGGGCA	0.622																																					p.A110A		Atlas-SNP	.											.	PADI6	51	.	0			c.C330T						PASS	.						49.0	50.0	50.0					1																	17701957		2064	4204	6268			353238	exon3			GGATGCCCCCGTG	AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17701957C>T		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	60	4	0.0666667	NM_207421	Q330K5|Q70SX3	Silent	SNP	ENST00000434762.2	37																																																																																				.	.	none		0.622	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4	NM_207421	
KLF15	28999	hgsc.bcm.edu	37	3	126070934	126070934	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:126070934A>C	ENST00000296233.3	-	2	1062	c.832T>G	c.(832-834)Ttt>Gtt	p.F278V	KLF15_ENST00000509675.1_5'Flank	NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	278					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		ATGCGCACAAACTTGGAGGGC	0.627																																					p.F278V		Atlas-SNP	.											.	KLF15	40	.	0			c.T832G						PASS	.						33.0	24.0	27.0					3																	126070934		2173	4274	6447	SO:0001583	missense	28999	exon2			GCACAAACTTGGA	AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.832T>G	3.37:g.126070934A>C	ENSP00000296233:p.Phe278Val	Somatic	331	0	0		WXS	Illumina HiSeq	Phase_I	389	96	0.246787	NM_014079		Missense_Mutation	SNP	ENST00000296233.3	37	CCDS3036.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.060597	0.76074	.	.	ENSG00000163884	ENST00000296233	T	0.08896	3.04	4.98	4.98	0.66077	.	0.046500	0.85682	D	0.000000	T	0.21761	0.0524	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	T	0.01448	-1.1352	10	0.26408	T	0.33	.	12.9208	0.58230	1.0:0.0:0.0:0.0	.	278	Q9UIH9	KLF15_HUMAN	V	278	ENSP00000296233:F278V	ENSP00000296233:F278V	F	-	1	0	KLF15	127553624	1.000000	0.71417	0.999000	0.59377	0.869000	0.49853	9.264000	0.95635	2.003000	0.58678	0.398000	0.26397	TTT	.	.	none		0.627	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370096.1	NM_014079	
PARD3B	117583	hgsc.bcm.edu	37	2	206110509	206110509	+	Silent	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:206110509T>C	ENST00000406610.2	+	16	2355	c.2148T>C	c.(2146-2148)gaT>gaC	p.D716D	PARD3B_ENST00000349953.3_Silent_p.D716D|PARD3B_ENST00000351153.1_Silent_p.D716D|PARD3B_ENST00000358768.2_Silent_p.D654D|PARD3B_ENST00000462231.1_Silent_p.D716D	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	716					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CAGTGCCAGATGAAAGCAAGG	0.363																																					p.D716D		Atlas-SNP	.											.	PARD3B	314	.	0			c.T2148C						PASS	.						152.0	142.0	145.0					2																	206110509		1828	4090	5918	SO:0001819	synonymous_variant	117583	exon16			GCCAGATGAAAGC	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.2148T>C	2.37:g.206110509T>C		Somatic	234	0	0		WXS	Illumina HiSeq	Phase_I	169	61	0.360947	NM_205863	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Silent	SNP	ENST00000406610.2	37																																																																																				.	.	none		0.363	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177	
DRC7	84229	hgsc.bcm.edu	37	16	57764952	57764952	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr16:57764952G>A	ENST00000360716.3	+	18	2722	c.2501G>A	c.(2500-2502)cGc>cAc	p.R834H	CCDC135_ENST00000336825.8_Missense_Mutation_p.R769H|CCDC135_ENST00000394337.4_Missense_Mutation_p.R834H			Q8IY82	CC135_HUMAN		834					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						GCCATGTTCCGCATCCGCATC	0.592																																					p.R834H		Atlas-SNP	.											CCDC135,NS,carcinoma,+1,1	CCDC135	97	1	0			c.G2501A						scavenged	.						101.0	89.0	93.0					16																	57764952		2198	4300	6498	SO:0001583	missense	84229	exon17			TGTTCCGCATCCG																												ENST00000360716.3:c.2501G>A	16.37:g.57764952G>A	ENSP00000353942:p.Arg834His	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	127	2	0.015748	NM_032269	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	37	CCDS10787.1	.	.	.	.	.	.	.	.	.	.	g	21.1	4.099293	0.76983	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.55234	0.53;0.53;0.53	5.04	5.04	0.67666	.	0.274751	0.35646	N	0.003074	T	0.76104	0.3941	M	0.85197	2.74	0.54753	D	0.999983	D;D	0.89917	0.999;1.0	P;D	0.91635	0.87;0.999	T	0.80589	-0.1315	10	0.87932	D	0	-22.0214	17.4019	0.87463	0.0:0.0:1.0:0.0	.	769;834	Q8IY82-2;Q8IY82	.;CC135_HUMAN	H	834;769;834	ENSP00000377869:R834H;ENSP00000338938:R769H;ENSP00000353942:R834H	ENSP00000338938:R769H	R	+	2	0	CCDC135	56322453	1.000000	0.71417	1.000000	0.80357	0.433000	0.31745	5.620000	0.67736	2.524000	0.85096	0.639000	0.83563	CGC	.	.	none		0.592	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2		
NPFFR2	10886	hgsc.bcm.edu	37	4	72994352	72994352	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:72994352C>T	ENST00000308744.6	+	2	448	c.350C>T	c.(349-351)cCc>cTc	p.P117L	NPFFR2_ENST00000344413.5_Intron|NPFFR2_ENST00000358749.3_Missense_Mutation_p.P15L|NPFFR2_ENST00000395999.1_Missense_Mutation_p.P18L	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	117					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			AACTGGCATCCCATCTGGAAT	0.368																																					p.P117L		Atlas-SNP	.											NPFFR2,NS,malignant_melanoma,+1,1	NPFFR2	98	1	0			c.C350T						scavenged	.						100.0	90.0	93.0					4																	72994352		2203	4300	6503	SO:0001583	missense	10886	exon2			GGCATCCCATCTG	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.350C>T	4.37:g.72994352C>T	ENSP00000307822:p.Pro117Leu	Somatic	200	0	0		WXS	Illumina HiSeq	Phase_I	156	2	0.0128205	NM_004885	Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	37	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	C	4.785	0.146025	0.09134	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.35789	1.29;1.29;1.29	5.9	-1.11	0.09840	.	1.028200	0.07712	N	0.942143	T	0.13841	0.0335	N	0.03608	-0.345	0.09310	N	1	B;B	0.14805	0.0;0.011	B;B	0.15870	0.0;0.014	T	0.30937	-0.9961	10	0.07175	T	0.84	.	8.0353	0.30488	0.2517:0.5885:0.0613:0.0984	.	18;117	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	L	117;18;15	ENSP00000307822:P117L;ENSP00000379321:P18L;ENSP00000351599:P15L	ENSP00000307822:P117L	P	+	2	0	NPFFR2	73213216	0.002000	0.14202	0.000000	0.03702	0.044000	0.14063	1.344000	0.33941	-0.330000	0.08514	-0.813000	0.03139	CCC	.	.	none		0.368	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885	
BMS1	9790	hgsc.bcm.edu	37	10	43316002	43316002	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:43316002G>A	ENST00000374518.5	+	17	2879	c.2816G>A	c.(2815-2817)cGa>cAa	p.R939Q		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	939					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.R939Q(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTCAAGTCCCGAGATCCAATC	0.453																																					p.R939Q		Atlas-SNP	.											BMS1,colon,carcinoma,0,3	BMS1	132	3	1	Substitution - Missense(1)	endometrium(1)	c.G2816A						scavenged	.						28.0	30.0	29.0					10																	43316002		2161	4226	6387	SO:0001583	missense	9790	exon17			AGTCCCGAGATCC	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2816G>A	10.37:g.43316002G>A	ENSP00000363642:p.Arg939Gln	Somatic	198	1	0.00505051		WXS	Illumina HiSeq	Phase_I	173	2	0.0115607	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504715	0.85176	.	.	ENSG00000165733	ENST00000374518	T	0.16324	2.35	4.97	4.97	0.65823	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.128731	0.52532	D	0.000066	T	0.30510	0.0767	L	0.46947	1.48	0.51012	D	0.999904	D	0.67145	0.996	D	0.63381	0.914	T	0.00814	-1.1555	10	0.51188	T	0.08	.	12.0822	0.53677	0.0798:0.0:0.9202:0.0	.	939	Q14692	BMS1_HUMAN	Q	939	ENSP00000363642:R939Q	ENSP00000363642:R939Q	R	+	2	0	BMS1	42636008	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.473000	0.66774	2.470000	0.83445	0.454000	0.30748	CGA	.	.	none		0.453	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
TEX10	54881	hgsc.bcm.edu	37	9	103090132	103090132	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:103090132C>T	ENST00000374902.4	-	8	1914	c.1738G>A	c.(1738-1740)Gct>Act	p.A580T	TEX10_ENST00000535814.1_Missense_Mutation_p.A583T	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	580						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		CGTGCTGCAGCGGTATGAATG	0.423																																					p.A583T		Atlas-SNP	.											.	TEX10	99	.	0			c.G1747A						PASS	.						113.0	102.0	106.0					9																	103090132		2203	4300	6503	SO:0001583	missense	54881	exon8			CTGCAGCGGTATG	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1738G>A	9.37:g.103090132C>T	ENSP00000364037:p.Ala580Thr	Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	125	51	0.408	NM_001161584	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	ENST00000374902.4	37	CCDS6748.1	.	.	.	.	.	.	.	.	.	.	C	35	5.531474	0.96446	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.72391	0.3454	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.985	T	0.71922	-0.4446	9	0.46703	T	0.11	-10.4144	19.6241	0.95671	0.0:1.0:0.0:0.0	.	583;448;580	B4DYV2;E7ERG2;Q9NXF1	.;.;TEX10_HUMAN	T	583;580;448	.	ENSP00000364037:A580T	A	-	1	0	TEX10	102129953	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.064000	0.76721	2.640000	0.89533	0.655000	0.94253	GCT	.	.	none		0.423	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746	
PRAMEF2	65122	hgsc.bcm.edu	37	1	12919098	12919098	+	Silent	SNP	G	G	A	rs2281065		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:12919098G>A	ENST00000240189.2	+	2	321	c.234G>A	c.(232-234)ttG>ttA	p.L78L		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	78					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGGAGCCATTGAAAGCATTGC	0.567																																					p.L78L		Atlas-SNP	.											PRAMEF2,colon,carcinoma,0,1	PRAMEF2	85	1	0			c.G234A						scavenged	.						168.0	179.0	175.0					1																	12919098		2201	4296	6497	SO:0001819	synonymous_variant	65122	exon2			GCCATTGAAAGCA		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.234G>A	1.37:g.12919098G>A		Somatic	222	4	0.018018		WXS	Illumina HiSeq	Phase_I	210	5	0.0238095	NM_023014		Silent	SNP	ENST00000240189.2	37	CCDS149.1																																																																																			G|1.000;|0.000	.	weak		0.567	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
AQP7	364	hgsc.bcm.edu	37	9	33385750	33385750	+	Missense_Mutation	SNP	C	C	T	rs114484742		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:33385750C>T	ENST00000537089.1	-	6	682	c.364G>A	c.(364-366)Ggg>Agg	p.G122R	AQP7_ENST00000539936.1_Missense_Mutation_p.G214R|AQP7_ENST00000377425.4_Missense_Mutation_p.G157R|AQP7_ENST00000541274.1_Missense_Mutation_p.R82Q			O14520	AQP7_HUMAN	aquaporin 7	214					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AGGGACACCCCGATGATGACC	0.587																																					p.G214R		Atlas-SNP	.											AQP7,colon,carcinoma,0,1	AQP7	58	1	0			c.G640A						scavenged	.						118.0	109.0	112.0					9																	33385750		2203	4300	6503	SO:0001583	missense	364	exon7			ACACCCCGATGAT	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.364G>A	9.37:g.33385750C>T	ENSP00000441619:p.Gly122Arg	Somatic	70	11	0.157143		WXS	Illumina HiSeq	Phase_I	65	13	0.2	NM_001170	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	15.12|15.12	2.740362|2.740362	0.49045|0.49045	.|.	.|.	ENSG00000165269|ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503|ENST00000541274	T;T;T;T;T;T;T;T;T|T	0.12569|0.55413	2.67;2.67;2.67;2.67;2.67;2.67;2.67;2.67;2.67|0.52	4.89|4.89	4.89|4.89	0.63831|0.63831	Aquaporin-like (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.45034|0.45034	0.1322|0.1322	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	P;B;B;B|B	0.41910|0.24317	0.764;0.383;0.26;0.385|0.101	B;B;B;B|B	0.40659|0.13407	0.336;0.288;0.194;0.311|0.009	T|T	0.37502|0.37502	-0.9703|-0.9703	9|8	0.54805|0.44086	T|T	0.06|0.13	-15.8325|-15.8325	15.6188|15.6188	0.76790|0.76790	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	213;214;157;214|82	Q5T5M0;B7Z4U2;Q6P5T0;O14520|B7Z7F6	.;.;.;AQP7_HUMAN|.	R|Q	122;213;82;214;157;122;213;214;150|82	ENSP00000441619:G122R;ENSP00000368821:G213R;ENSP00000412868:G82R;ENSP00000297988:G214R;ENSP00000396111:G157R;ENSP00000410138:G122R;ENSP00000368820:G213R;ENSP00000439534:G214R;ENSP00000368817:G150R|ENSP00000438860:R82Q	ENSP00000297988:G214R|ENSP00000438860:R82Q	G|R	-|-	1|2	0|0	AQP7|AQP7	33375750|33375750	0.994000|0.994000	0.37717|0.37717	0.198000|0.198000	0.23420|0.23420	0.010000|0.010000	0.07245|0.07245	3.614000|3.614000	0.54160|0.54160	2.540000|2.540000	0.85666|0.85666	0.550000|0.550000	0.68814|0.68814	GGG|CGG	.	.	weak		0.587	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
AADACL3	126767	hgsc.bcm.edu	37	1	12785877	12785877	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:12785877C>T	ENST00000359318.5	+	4	1172	c.967C>T	c.(967-969)Ctc>Ttc	p.L323F	AADACL3_ENST00000332530.3_Missense_Mutation_p.L253F	NM_001103170.1	NP_001096640.1	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3	323							hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	15	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CCATGGAGTGCTCAGGACCAT	0.483																																					p.L323F		Atlas-SNP	.											.	AADACL3	84	.	0			c.C967T						PASS	.						75.0	72.0	73.0					1																	12785877		1972	4161	6133	SO:0001583	missense	126767	exon4			GGAGTGCTCAGGA		CCDS41253.1	1p36.21	2014-07-17			ENSG00000188984	ENSG00000188984			32037	protein-coding gene	gene with protein product							Standard	XM_006710337		Approved	OTTHUMG00000001887	uc009vnn.1	Q5VUY0	OTTHUMG00000001887	ENST00000359318.5:c.967C>T	1.37:g.12785877C>T	ENSP00000352268:p.Leu323Phe	Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	137	52	0.379562	NM_001103170	B3KXR9|Q5VUY1	Missense_Mutation	SNP	ENST00000359318.5	37	CCDS41253.1	.	.	.	.	.	.	.	.	.	.	C	6.539	0.467660	0.12402	.	.	ENSG00000188984	ENST00000332530;ENST00000359318	T;T	0.12039	2.72;2.72	5.54	-1.38	0.09027	Alpha/beta hydrolase fold-3 (1);	0.292854	0.28533	N	0.015012	T	0.07324	0.0185	N	0.21448	0.665	0.19300	N	0.99998	B;B	0.24675	0.109;0.079	B;B	0.35312	0.2;0.099	T	0.28839	-1.0031	10	0.25751	T	0.34	-9.5847	0.808	0.01088	0.1831:0.207:0.3041:0.3058	.	323;253	Q5VUY0;Q5VUY0-2	ADCL3_HUMAN;.	F	253;323	ENSP00000333352:L253F;ENSP00000352268:L323F	ENSP00000333352:L253F	L	+	1	0	AADACL3	12708464	0.639000	0.27234	0.006000	0.13384	0.044000	0.14063	0.255000	0.18333	-0.211000	0.10124	-0.339000	0.08088	CTC	.	.	none		0.483	AADACL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005324.2	NM_001103170	
PRAMEF2	65122	hgsc.bcm.edu	37	1	12921136	12921136	+	Silent	SNP	C	C	T	rs368491327	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:12921136C>T	ENST00000240189.2	+	4	1014	c.927C>T	c.(925-927)gaC>gaT	p.D309D		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	309					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.D309D(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TAGAAGAGGACTTGAAGTGTC	0.498													.|||	12	0.00239617	0.0038	0.0058	5008	,	,		21997	0.001		0.001	False		,,,				2504	0.001				p.D309D		Atlas-SNP	.											PRAMEF2,pharynx,carcinoma,0,1	PRAMEF2	85	1	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C927T						scavenged	.						131.0	134.0	133.0					1																	12921136		2202	4297	6499	SO:0001819	synonymous_variant	65122	exon4			AGAGGACTTGAAG		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.927C>T	1.37:g.12921136C>T		Somatic	214	3	0.0140187		WXS	Illumina HiSeq	Phase_I	197	3	0.0152284	NM_023014		Silent	SNP	ENST00000240189.2	37	CCDS149.1																																																																																			.	.	none		0.498	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
OR5H1	26341	hgsc.bcm.edu	37	3	97851659	97851659	+	Missense_Mutation	SNP	A	A	T	rs199787047	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:97851659A>T	ENST00000354565.2	+	1	118	c.118A>T	c.(118-120)Atg>Ttg	p.M40L	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M40L(3)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						CATCACCATCATGGGGAATCT	0.413																																					p.M40L		Atlas-SNP	.											OR5H1,NS,carcinoma,-2,7	OR5H1	71	7	3	Substitution - Missense(3)	kidney(2)|endometrium(1)	c.A118T						scavenged	.						45.0	49.0	48.0					3																	97851659		2174	4242	6416	SO:0001583	missense	26341	exon1			ACCATCATGGGGA	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.118A>T	3.37:g.97851659A>T	ENSP00000346575:p.Met40Leu	Somatic	654	3	0.00458716		WXS	Illumina HiSeq	Phase_I	810	11	0.0135802	NM_001005338		Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	A	3.067	-0.192020	0.06299	.	.	ENSG00000231192	ENST00000354565	T	0.00241	8.46	3.63	-0.16	0.13375	.	0.578292	0.14348	N	0.325303	T	0.00073	0.0002	N	0.04116	-0.275	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04976	-1.0914	10	0.33940	T	0.23	.	7.0903	0.25279	0.5661:0.0:0.4339:0.0	.	40	A6NKK0	OR5H1_HUMAN	L	40	ENSP00000346575:M40L	ENSP00000346575:M40L	M	+	1	0	OR5H1	99334349	0.000000	0.05858	0.016000	0.15963	0.102000	0.19082	-3.263000	0.00535	-0.297000	0.08934	0.164000	0.16699	ATG	A|0.978;T|0.022	0.022	strong		0.413	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
UNC5B	219699	hgsc.bcm.edu	37	10	73053316	73053316	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:73053316C>T	ENST00000335350.6	+	12	2343	c.1927C>T	c.(1927-1929)Cag>Tag	p.Q643*	UNC5B_ENST00000373192.4_Nonsense_Mutation_p.Q632*	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	643	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CCAGGCCCACCAGGGCCACTG	0.642																																					p.Q643X		Atlas-SNP	.											.	UNC5B	123	.	0			c.C1927T						PASS	.						58.0	59.0	59.0					10																	73053316		2203	4300	6503	SO:0001587	stop_gained	219699	exon12			GCCCACCAGGGCC	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.1927C>T	10.37:g.73053316C>T	ENSP00000334329:p.Gln643*	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	45	23	0.511111	NM_170744	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Nonsense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	C	42	9.790481	0.99264	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	.	.	.	4.76	3.84	0.44239	.	0.168672	0.43416	D	0.000573	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-19.7677	12.3129	0.54938	0.0:0.9181:0.0:0.0819	.	.	.	.	X	643;632	.	ENSP00000334329:Q643X	Q	+	1	0	UNC5B	72723322	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.041000	0.57339	2.208000	0.71279	0.462000	0.41574	CAG	.	.	none		0.642	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
MBD1	4152	hgsc.bcm.edu	37	18	47799950	47799950	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:47799950G>T	ENST00000591416.1	-	12	1861	c.1430C>A	c.(1429-1431)aCa>aAa	p.T477K	MBD1_ENST00000457839.2_Missense_Mutation_p.T502K|MBD1_ENST00000269471.5_Missense_Mutation_p.T454K|MBD1_ENST00000585595.1_Missense_Mutation_p.T502K|MBD1_ENST00000339998.6_Missense_Mutation_p.T477K|MBD1_ENST00000347968.3_Missense_Mutation_p.T421K|MBD1_ENST00000398495.2_Missense_Mutation_p.T446K|MBD1_ENST00000424334.2_Missense_Mutation_p.T528K|MBD1_ENST00000436910.1_Missense_Mutation_p.T454K|MBD1_ENST00000398493.1_Missense_Mutation_p.T421K|MBD1_ENST00000269468.5_Missense_Mutation_p.T477K|MBD1_ENST00000349085.2_Missense_Mutation_p.T421K|MBD1_ENST00000398488.1_Missense_Mutation_p.T421K|MBD1_ENST00000588937.1_Missense_Mutation_p.T454K|MBD1_ENST00000353909.3_Missense_Mutation_p.T428K|MBD1_ENST00000590208.1_Missense_Mutation_p.T477K|MBD1_ENST00000587605.1_Missense_Mutation_p.T421K|MBD1_ENST00000382948.5_Missense_Mutation_p.T477K|MBD1_ENST00000585672.1_Missense_Mutation_p.T427K|MBD1_ENST00000591535.1_Missense_Mutation_p.T454K			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	477					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						CAGGGCTTCTGTGGAAGCTGC	0.637																																					p.T502K		Atlas-SNP	.											MBD1_ENST00000457839,NS,malignant_melanoma,-1,4	MBD1	228	4	0			c.C1505A						scavenged	.						37.0	38.0	38.0					18																	47799950		2203	4300	6503	SO:0001583	missense	4152	exon13			GCTTCTGTGGAAG	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1430C>A	18.37:g.47799950G>T	ENSP00000467017:p.Thr477Lys	Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	88	2	0.0227273	NM_001204137	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Missense_Mutation	SNP	ENST00000591416.1	37	CCDS11943.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676006	0.47886	.	.	ENSG00000141644	ENST00000382948;ENST00000353909;ENST00000349085;ENST00000269468;ENST00000347968;ENST00000436910;ENST00000269471;ENST00000424334;ENST00000339998;ENST00000398495;ENST00000457839;ENST00000398493;ENST00000398488	D;D;D;D;D;D;D;D;D;D;D;D	0.97256	-3.88;-3.9;-4.31;-3.88;-3.95;-3.85;-3.86;-3.91;-3.84;-3.89;-3.95;-4.31	4.45	2.65	0.31530	.	0.437084	0.22193	N	0.063346	D	0.96147	0.8744	L	0.29908	0.895	0.31860	N	0.621095	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.995;1.0;0.986;1.0;1.0;0.992;0.996;0.986;1.0;0.986;1.0	D;D;D;P;D;D;D;D;P;D;P;D	0.87578	0.996;0.989;0.997;0.905;0.998;0.998;0.921;0.99;0.905;0.998;0.905;0.998	D	0.93881	0.7171	10	0.62326	D	0.03	-0.5633	6.2534	0.20859	0.0997:0.187:0.7133:0.0	.	421;528;454;477;477;454;428;421;477;421;502;421	B4DUR3;B4DI41;Q9UIS9-8;A8K654;Q9UIS9-6;Q9UIS9-2;Q9UIS9-5;Q9UIS9-4;Q9UIS9;Q9UIS9-7;B4DXJ5;Q9UIS9-3	.;.;.;.;.;.;.;.;MBD1_HUMAN;.;.;.	K	477;428;421;477;421;454;454;528;477;477;502;421;421	ENSP00000372407:T477K;ENSP00000269469:T428K;ENSP00000342531:T421K;ENSP00000269468:T477K;ENSP00000285102:T421K;ENSP00000409561:T454K;ENSP00000269471:T454K;ENSP00000408846:T528K;ENSP00000339546:T477K;ENSP00000405268:T502K;ENSP00000381506:T421K;ENSP00000381502:T421K	ENSP00000269468:T477K	T	-	2	0	MBD1	46053948	1.000000	0.71417	0.980000	0.43619	0.853000	0.48598	0.954000	0.29175	0.805000	0.34159	0.561000	0.74099	ACA	.	.	none		0.637	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	
UGT1A3	54659	hgsc.bcm.edu	37	2	234638243	234638243	+	Silent	SNP	C	C	T	rs375083511		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:234638243C>T	ENST00000482026.1	+	1	490	c.471C>T	c.(469-471)tgC>tgT	p.C157C	UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000609767.1_Silent_p.C157C			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	157					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)			breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	TTAACCTCTGCGCGGCAGTGC	0.458																																					p.C157C		Atlas-SNP	.											.	UGT1A3	91	.	0			c.C471T						PASS	.						187.0	194.0	191.0					2																	234638243		2203	4300	6503	SO:0001819	synonymous_variant	54659	exon1			CCTCTGCGCGGCA	M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.471C>T	2.37:g.234638243C>T		Somatic	277	1	0.00361011		WXS	Illumina HiSeq	Phase_I	258	105	0.406977	NM_019093	B8K287	Silent	SNP	ENST00000482026.1	37	CCDS2509.1																																																																																			.	.	weak		0.458	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130983.1	NM_019093	
RIMBP2	23504	hgsc.bcm.edu	37	12	130926675	130926675	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:130926675C>T	ENST00000261655.4	-	8	1334	c.1171G>A	c.(1171-1173)Gtg>Atg	p.V391M	RIMBP2_ENST00000536002.1_Missense_Mutation_p.V299M|RIMBP2_ENST00000535703.1_Missense_Mutation_p.V299M	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	391					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GGGGCCACCACCACGTCCTTG	0.637																																					p.V391M		Atlas-SNP	.											RIMBP2,colon,carcinoma,+2,1	RIMBP2	220	1	0			c.G1171A						PASS	.						106.0	89.0	94.0					12																	130926675		2203	4300	6503	SO:0001583	missense	23504	exon8			CCACCACCACGTC	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1171G>A	12.37:g.130926675C>T	ENSP00000261655:p.Val391Met	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	127	52	0.409449	NM_015347	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	c	15.13	2.743213	0.49151	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.54071	0.59;0.59;0.59	4.23	3.18	0.36537	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.305389	0.30483	N	0.009533	T	0.53174	0.1780	L	0.57536	1.79	0.33880	D	0.636045	P;P;P	0.43477	0.664;0.745;0.808	B;P;B	0.51516	0.388;0.672;0.391	T	0.61118	-0.7127	10	0.30078	T	0.28	-23.0745	5.5813	0.17250	0.0:0.6862:0.0:0.3138	.	299;299;391	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	M	391;299;299;299	ENSP00000261655:V391M;ENSP00000440347:V299M;ENSP00000439159:V299M	ENSP00000261655:V391M	V	-	1	0	RIMBP2	129492628	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	3.020000	0.49643	1.867000	0.54127	0.537000	0.68136	GTG	.	.	none		0.637	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
TRIM34	53840	hgsc.bcm.edu	37	11	5664047	5664047	+	Splice_Site	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:5664047A>G	ENST00000514226.1	+	7	1212	c.875A>G	c.(874-876)gAa>gGa	p.E292G	TRIM34_ENST00000495668.1_3'UTR|TRIM34_ENST00000429814.2_Splice_Site_p.E292G|TRIM6-TRIM34_ENST00000457787.2_Splice_Site_p.E292G|HBG2_ENST00000380259.2_Intron|TRIM6-TRIM34_ENST00000354852.5_Splice_Site_p.E646G	NM_001003827.1	NP_001003827.1	Q9BYJ4	TRI34_HUMAN	tripartite motif containing 34	292	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	17		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;5.72e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATTATTTCAGAACTGACAGCT	0.358																																					p.E646G		Atlas-SNP	.											.	TRIM6-TRIM34	68	.	0			c.A1937G						PASS	.						68.0	66.0	67.0					11																	5664047		2201	4297	6498	SO:0001630	splice_region_variant	445372	exon13			TTTCAGAACTGAC	AB039902	CCDS31391.1	11p15	2013-01-09	2011-01-25	2001-11-23		ENSG00000258659		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10063	protein-coding gene	gene with protein product		605684	"""tripartite motif-containing 34"""	RNF21			Standard	NM_130390		Approved			Q9BYJ4	OTTHUMG00000066892	ENST00000514226.1:c.875-1A>G	11.37:g.5664047A>G		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	97	4	0.0412371	NM_001003819	D3DQS7|Q9C016|Q9HCR0|Q9HCR1|Q9HCR2	Missense_Mutation	SNP	ENST00000514226.1	37	CCDS31391.1	.	.	.	.	.	.	.	.	.	.	A	10.03	1.237849	0.22711	.	.	ENSG00000258659;ENSG00000258659;ENSG00000258659;ENSG00000258659;ENSG00000258588	ENST00000337072;ENST00000514226;ENST00000429814;ENST00000457787;ENST00000354852	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.45	3.02	3.02	0.34903	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.61362	0.2341	L	0.54908	1.71	0.26629	N	0.972503	B;B	0.32939	0.009;0.391	B;B	0.37780	0.008;0.258	T	0.53781	-0.8390	8	.	.	.	.	7.8167	0.29263	1.0:0.0:0.0:0.0	.	292;646	Q9BYJ4;B2RNG4	TRI34_HUMAN;.	G	646;292;292;292;646	ENSP00000422947:E292G;ENSP00000402595:E292G;ENSP00000395982:E292G;ENSP00000346916:E646G	.	E	+	2	0	TRIM34;TRIM6-TRIM34	5620623	0.733000	0.28132	0.972000	0.41901	0.555000	0.35460	1.063000	0.30567	1.617000	0.50277	0.377000	0.23210	GAA	.	.	none		0.358	TRIM34-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143357.2	NM_001003827	Missense_Mutation
OR5H14	403273	hgsc.bcm.edu	37	3	97868377	97868377	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:97868377T>C	ENST00000437310.1	+	1	208	c.148T>C	c.(148-150)Tgg>Cgg	p.W50R	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TGCTGTCATCTGGAAAGACCC	0.403																																					p.W50R		Atlas-SNP	.											OR5H14,NS,malignant_melanoma,-2,1	OR5H14	56	1	0			c.T148C						scavenged	.						311.0	313.0	312.0					3																	97868377		2203	4300	6503	SO:0001583	missense	403273	exon1			GTCATCTGGAAAG		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.148T>C	3.37:g.97868377T>C	ENSP00000401706:p.Trp50Arg	Somatic	686	8	0.0116618		WXS	Illumina HiSeq	Phase_I	809	8	0.00988875	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	37	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	T	3.061	-0.193169	0.06259	.	.	ENSG00000236032	ENST00000437310	T	0.03801	3.8	2.49	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.993003	0.08167	N	0.987570	T	0.06142	0.0159	N	0.10760	0.04	0.09310	N	1	D	0.56968	0.978	P	0.58266	0.836	T	0.50101	-0.8867	10	0.25106	T	0.35	.	8.4219	0.32705	0.0:0.0:0.0:1.0	.	50	A6NHG9	O5H14_HUMAN	R	50	ENSP00000401706:W50R	ENSP00000401706:W50R	W	+	1	0	OR5H14	99351067	0.000000	0.05858	0.995000	0.50966	0.396000	0.30629	-0.007000	0.12810	1.132000	0.42129	0.164000	0.16699	TGG	.	.	none		0.403	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
CHD4	1108	hgsc.bcm.edu	37	12	6702746	6702746	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:6702746G>C	ENST00000357008.2	-	16	2513	c.2350C>G	c.(2350-2352)Ctt>Gtt	p.L784V	CHD4_ENST00000544040.1_Missense_Mutation_p.L777V|CHD4_ENST00000544484.1_Missense_Mutation_p.L781V|CHD4_ENST00000309577.6_Missense_Mutation_p.L784V	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	784	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						ATGGTAGAAAGAGGGGCGCTC	0.547																																					p.L784V	Colon(32;586 792 4568 16848 45314)	Atlas-SNP	.											.	CHD4	539	.	0			c.C2350G						PASS	.						83.0	82.0	82.0					12																	6702746		2203	4300	6503	SO:0001583	missense	1108	exon16			TAGAAAGAGGGGC	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2350C>G	12.37:g.6702746G>C	ENSP00000349508:p.Leu784Val	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	77	25	0.324675	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938881	0.73557	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31	4.8	4.8	0.61643	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.64402	D	0.000001	D	0.95645	0.8584	M	0.69248	2.105	0.80722	D	1	D;D;D	0.76494	0.999;0.995;0.996	D;D;D	0.79784	0.993;0.955;0.986	D	0.95649	0.8705	10	0.87932	D	0	-0.7394	12.4824	0.55852	0.0801:0.0:0.9199:0.0	.	784;784;777	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	V	781;777;784;784;758	ENSP00000440392:L781V;ENSP00000440542:L777V;ENSP00000312419:L784V;ENSP00000349508:L784V	ENSP00000312419:L784V	L	-	1	0	CHD4	6573007	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.793000	0.85851	2.493000	0.84123	0.591000	0.81541	CTT	.	.	none		0.547	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
MUC4	4585	hgsc.bcm.edu	37	3	195507064	195507064	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:195507064G>C	ENST00000463781.3	-	2	11846	c.11387C>G	c.(11386-11388)aCc>aGc	p.T3796S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3796S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3796S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGAAGTGTCGGTGACAGGAAG	0.602																																					p.T3796S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - Missense(1)	endometrium(1)	c.C11387G						scavenged	.						7.0	7.0	7.0					3																	195507064		638	1493	2131	SO:0001583	missense	4585	exon2			GTGTCGGTGACAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11387C>G	3.37:g.195507064G>C	ENSP00000417498:p.Thr3796Ser	Somatic	165	3	0.0181818		WXS	Illumina HiSeq	Phase_I	177	6	0.0338983	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	5.869	0.344521	0.11126	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37752	1.26;1.18	.	.	.	.	1.826270	0.06000	U	0.647533	T	0.22475	0.0542	N	0.19112	0.55	0.19300	N	0.999973	P	0.42584	0.784	B	0.39706	0.307	T	0.19451	-1.0305	8	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	3668	E7ESK3	.	S	3796	ENSP00000417498:T3796S;ENSP00000420243:T3796S	.	T	-	2	0	MUC4	196991843	0.000000	0.05858	0.066000	0.19879	0.066000	0.16364	-0.667000	0.05274	0.064000	0.16427	0.064000	0.15345	ACC	.	.	none		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SLC22A23	63027	hgsc.bcm.edu	37	6	3273638	3273638	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:3273638C>T	ENST00000406686.3	-	10	1711	c.1712G>A	c.(1711-1713)gGg>gAg	p.G571E	SLC22A23_ENST00000436008.2_Missense_Mutation_p.G579E|SLC22A23_ENST00000380302.4_Missense_Mutation_p.G290E|PSMG4_ENST00000451246.2_Intron|SLC22A23_ENST00000490273.1_Missense_Mutation_p.G290E	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	571					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				CAGCCCCAGCCCGCCACACCT	0.642																																					p.G571E		Atlas-SNP	.											SLC22A23_ENST00000406686,colon,carcinoma,-1,2	SLC22A23	89	2	0			c.G1712A						PASS	.						44.0	38.0	40.0					6																	3273638		2177	4257	6434	SO:0001583	missense	63027	exon10			CCCAGCCCGCCAC	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.1712G>A	6.37:g.3273638C>T	ENSP00000385028:p.Gly571Glu	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	92	27	0.293478	NM_015482	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	ENST00000406686.3	37	CCDS47363.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708450	0.89018	.	.	ENSG00000137266	ENST00000436008;ENST00000406686;ENST00000380302;ENST00000490273	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	5.41	5.41	0.78517	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.85164	0.5634	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86066	0.1535	10	0.87932	D	0	-29.3275	18.5442	0.91040	0.0:1.0:0.0:0.0	.	571	A1A5C7	S22AN_HUMAN	E	579;571;290;290	ENSP00000410245:G579E;ENSP00000385028:G571E;ENSP00000369657:G290E;ENSP00000419463:G290E	ENSP00000369657:G290E	G	-	2	0	SLC22A23	3218637	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	5.521000	0.67086	2.689000	0.91719	0.561000	0.74099	GGG	.	.	none		0.642	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945	
CCR3	1232	hgsc.bcm.edu	37	3	46307515	46307515	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:46307515T>G	ENST00000357422.2	+	4	1409	c.866T>G	c.(865-867)aTc>aGc	p.I289S	CCR3_ENST00000395940.2_Missense_Mutation_p.I289S|CCR3_ENST00000541018.1_Missense_Mutation_p.I289S|CCR3_ENST00000545097.1_Missense_Mutation_p.I310S|CCR3_ENST00000395942.2_Missense_Mutation_p.I289S			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	289					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		ACAGAGGTGATCGCCTACTCC	0.517																																					p.I310S		Atlas-SNP	.											.	CCR3	52	.	0			c.T929G						PASS	.						125.0	105.0	112.0					3																	46307515		2203	4300	6503	SO:0001583	missense	1232	exon3			AGGTGATCGCCTA	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.866T>G	3.37:g.46307515T>G	ENSP00000350003:p.Ile289Ser	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	142	45	0.316901	NM_178328	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	T	19.72	3.881031	0.72294	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15	5.73	5.73	0.89815	GPCR, rhodopsin-like superfamily (1);	0.272597	0.28236	N	0.016084	T	0.73032	0.3535	H	0.97103	3.94	0.58432	D	0.999995	D;D	0.67145	0.987;0.996	D;D	0.72625	0.956;0.978	T	0.83140	-0.0109	10	0.87932	D	0	.	16.0235	0.80516	0.0:0.0:0.0:1.0	.	310;289	F5GWL6;P51677	.;CCR3_HUMAN	S	289;310;289;289;289	ENSP00000350003:I289S;ENSP00000441600:I310S;ENSP00000440097:I289S;ENSP00000379271:I289S;ENSP00000379273:I289S	ENSP00000350003:I289S	I	+	2	0	CCR3	46282519	1.000000	0.71417	0.954000	0.39281	0.493000	0.33554	8.036000	0.88901	2.177000	0.69029	0.533000	0.62120	ATC	.	.	none		0.517	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
NCOR1	9611	hgsc.bcm.edu	37	17	16068468	16068468	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:16068468G>T	ENST00000268712.3	-	5	700	c.443C>A	c.(442-444)gCa>gAa	p.A148E	NCOR1_ENST00000395851.1_Missense_Mutation_p.A148E|NCOR1_ENST00000395848.1_Missense_Mutation_p.A39E	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	148	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GCCTCCGAATGCTGGATCCTT	0.383																																					p.A148E		Atlas-SNP	.											NCOR1,NS,carcinoma,-1,1	NCOR1	240	1	0			c.C443A						scavenged	.						101.0	94.0	97.0					17																	16068468		2203	4300	6503	SO:0001583	missense	9611	exon4			CCGAATGCTGGAT	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.443C>A	17.37:g.16068468G>T	ENSP00000268712:p.Ala148Glu	Somatic	394	0	0		WXS	Illumina HiSeq	Phase_I	329	3	0.00911854	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	37	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364350	0.24684	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828	T;T;T	0.52526	0.95;1.53;0.66	5.04	5.04	0.67666	.	0.537909	0.21203	N	0.078426	T	0.30039	0.0752	N	0.14661	0.345	0.80722	D	1	B;B;B;B;P;B;B	0.37985	0.046;0.046;0.199;0.046;0.613;0.394;0.16	B;B;B;B;B;B;B	0.34590	0.028;0.028;0.075;0.028;0.186;0.157;0.059	T	0.11251	-1.0595	10	0.29301	T	0.29	-4.273	13.5205	0.61566	0.0:0.2793:0.7207:0.0	.	148;148;148;148;39;148;148	E7EU93;E7EV02;Q3B773;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;.;NCOR1_HUMAN;.	E	148;148;39;148;39;148;148	ENSP00000268712:A148E;ENSP00000379192:A148E;ENSP00000379189:A39E	ENSP00000268712:A148E	A	-	2	0	NCOR1	16009193	0.998000	0.40836	1.000000	0.80357	0.879000	0.50718	1.772000	0.38552	2.349000	0.79799	0.478000	0.44815	GCA	.	.	none		0.383	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
CCDC102B	79839	hgsc.bcm.edu	37	18	66721311	66721311	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:66721311G>A	ENST00000360242.5	+	8	1596	c.1479G>A	c.(1477-1479)ctG>ctA	p.L493L	CCDC102B_ENST00000319445.6_Silent_p.L493L	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	493										breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				AGAGGTCTCTGGATGAAGAGA	0.373																																					p.L493L		Atlas-SNP	.											CCDC102B,NS,carcinoma,0,1	CCDC102B	92	1	0			c.G1479A						PASS	.						81.0	79.0	80.0					18																	66721311		2203	4300	6503	SO:0001819	synonymous_variant	79839	exon10			GTCTCTGGATGAA	AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.1479G>A	18.37:g.66721311G>A		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	39	15	0.384615	NM_001093729	Q7Z467|Q8NDK7|Q9H5C1	Silent	SNP	ENST00000360242.5	37	CCDS11996.2																																																																																			.	.	none		0.373	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256225.2	NM_024781	
MKRN2	23609	hgsc.bcm.edu	37	3	12610409	12610409	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:12610409A>G	ENST00000170447.7	+	2	199	c.62A>G	c.(61-63)cAg>cGg	p.Q21R	MKRN2_ENST00000448482.1_Missense_Mutation_p.Q21R|MKRN2_ENST00000411987.1_Intron	NM_001271707.1|NM_014160.3	NP_001258636.1|NP_054879.3	Q9H000	MKRN2_HUMAN	makorin ring finger protein 2	21					protein ubiquitination (GO:0016567)	intracellular (GO:0005622)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(3)	16						GAAGGAAGTCAGTGCCTATTC	0.453																																					p.Q21R		Atlas-SNP	.											.	MKRN2	32	.	0			c.A62G						PASS	.						203.0	170.0	181.0					3																	12610409		2203	4300	6503	SO:0001583	missense	23609	exon2			GAAGTCAGTGCCT		CCDS33702.1, CCDS63545.1	3p25	2008-08-13	2008-08-13		ENSG00000075975	ENSG00000075975		"""RING-type (C3HC4) zinc fingers"""	7113	protein-coding gene	gene with protein product		608426				11597136	Standard	NM_014160		Approved	RNF62, HSPC070	uc003bxd.4	Q9H000	OTTHUMG00000155371	ENST00000170447.7:c.62A>G	3.37:g.12610409A>G	ENSP00000170447:p.Gln21Arg	Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	172	42	0.244186	NM_014160	A6NIA2|B3KRC5|B4DPR4|Q8N391|Q96BD4|Q9BUY2|Q9NRY1	Missense_Mutation	SNP	ENST00000170447.7	37	CCDS33702.1	.	.	.	.	.	.	.	.	.	.	A	12.41	1.928178	0.34002	.	.	ENSG00000075975	ENST00000170447;ENST00000448482	T;T	0.41758	0.99;0.99	5.78	5.78	0.91487	Zinc finger, CCCH-type (2);	0.276343	0.31859	N	0.006945	T	0.14570	0.0352	N	0.01352	-0.895	0.28154	N	0.929267	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18840	-1.0324	10	0.12430	T	0.62	.	8.7215	0.34443	0.8586:0.0:0.1414:0.0	.	21;21	C9J494;Q9H000	.;MKRN2_HUMAN	R	21	ENSP00000170447:Q21R;ENSP00000397983:Q21R	ENSP00000170447:Q21R	Q	+	2	0	MKRN2	12585409	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.757000	0.47557	2.333000	0.79357	0.482000	0.46254	CAG	.	.	none		0.453	MKRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339679.1	NM_014160	
PCDHB10	56126	hgsc.bcm.edu	37	5	140574381	140574381	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:140574381G>T	ENST00000239446.4	+	1	2440	c.2256G>T	c.(2254-2256)caG>caT	p.Q752H		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	752					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAGCTACCAGTATGAGGTGT	0.622																																					p.Q752H		Atlas-SNP	.											.	PCDHB10	177	.	0			c.G2256T						PASS	.						78.0	86.0	83.0					5																	140574381		2203	4300	6503	SO:0001583	missense	56126	exon1			CTACCAGTATGAG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2256G>T	5.37:g.140574381G>T	ENSP00000239446:p.Gln752His	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	128	64	0.5	NM_018930	Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	G	7.623	0.677262	0.14841	.	.	ENSG00000120324	ENST00000239446	T	0.49432	0.78	3.28	1.41	0.22369	.	.	.	.	.	T	0.59676	0.2211	M	0.75615	2.305	0.31114	N	0.709598	D	0.76494	0.999	D	0.67900	0.954	T	0.58702	-0.7590	9	0.56958	D	0.05	.	3.3998	0.07319	0.3694:0.203:0.4276:0.0	.	752	Q9UN67	PCDBA_HUMAN	H	752	ENSP00000239446:Q752H	ENSP00000239446:Q752H	Q	+	3	2	PCDHB10	140554565	0.000000	0.05858	0.996000	0.52242	0.394000	0.30568	-1.938000	0.01546	0.213000	0.20722	0.298000	0.19748	CAG	.	.	none		0.622	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
MUC2	4583	hgsc.bcm.edu	37	11	1093448	1093448	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:1093448C>A	ENST00000441003.2	+	30	5294	c.5267C>A	c.(5266-5268)aCc>aAc	p.T1756N	MUC2_ENST00000333592.6_Missense_Mutation_p.T44N|MUC2_ENST00000359061.5_Missense_Mutation_p.T1723N|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1756N(3)|p.T1723N(3)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gtgaccccaaccccgacaccc	0.622																																					p.T1756N		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,8	MUC2	614	8	6	Substitution - Missense(6)	kidney(6)	c.C5267A						scavenged	.						133.0	160.0	151.0					11																	1093448		2049	4049	6098	SO:0001583	missense	4583	exon30			CCCCAACCCCGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5267C>A	11.37:g.1093448C>A	ENSP00000415183:p.Thr1756Asn	Somatic	89	2	0.0224719		WXS	Illumina HiSeq	Phase_I	62	4	0.0645161	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	7.928	0.739947	0.15642	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.12465	2.73;2.68;2.81	1.81	0.625	0.17665	.	1.255720	0.06522	U	0.739910	T	0.10852	0.0265	.	.	.	0.09310	N	1	B	0.16802	0.019	B	0.15052	0.012	T	0.35176	-0.9799	9	0.62326	D	0.03	.	6.7886	0.23687	0.2734:0.7266:0.0:0.0	.	1756	E7EUV1	.	N	1756;1723;44	ENSP00000415183:T1756N;ENSP00000351956:T1723N;ENSP00000331373:T44N	ENSP00000331373:T44N	T	+	2	0	MUC2	1083448	0.012000	0.17670	0.001000	0.08648	0.007000	0.05969	0.908000	0.28545	1.004000	0.39156	0.195000	0.17529	ACC	.	.	none		0.622	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
GABRB1	2560	hgsc.bcm.edu	37	4	47427752	47427752	+	Missense_Mutation	SNP	C	C	T	rs539587921		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:47427752C>T	ENST00000295454.3	+	9	1434	c.1142C>T	c.(1141-1143)tCg>tTg	p.S381L	GABRB1_ENST00000538619.1_Missense_Mutation_p.S311L	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	381					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACGAGTGGCTCGGAAGTGCTC	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		16678	0.0		0.0	False		,,,				2504	0.001				p.S381L		Atlas-SNP	.											GABRB1,NS,carcinoma,-1,1	GABRB1	107	1	0			c.C1142T						PASS	.						64.0	66.0	66.0					4																	47427752		2203	4300	6503	SO:0001583	missense	2560	exon9			GTGGCTCGGAAGT		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.1142C>T	4.37:g.47427752C>T	ENSP00000295454:p.Ser381Leu	Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	74	30	0.405405	NM_000812	B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	ENST00000295454.3	37	CCDS3474.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.976578	0.34848	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	D;D	0.84370	-1.84;-1.84	5.48	4.64	0.57946	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.455620	0.05312	U	0.524982	T	0.80199	0.4579	N	0.21097	0.63	0.47441	D	0.999423	B;B	0.18013	0.025;0.004	B;B	0.13407	0.009;0.003	T	0.56105	-0.8034	10	0.40728	T	0.16	-5.7084	14.2643	0.66107	0.0:0.9292:0.0:0.0708	.	311;381	F5GXV5;P18505	.;GBRB1_HUMAN	L	381;311	ENSP00000295454:S381L;ENSP00000440330:S311L	ENSP00000295454:S381L	S	+	2	0	GABRB1	47122509	0.997000	0.39634	0.890000	0.34922	0.042000	0.13812	3.301000	0.51842	1.558000	0.49541	0.650000	0.86243	TCG	.	.	none		0.597	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1		
GPCPD1	56261	hgsc.bcm.edu	37	20	5559162	5559162	+	Nonsense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr20:5559162A>C	ENST00000379019.4	-	8	781	c.569T>G	c.(568-570)tTa>tGa	p.L190*	GPCPD1_ENST00000481038.1_5'UTR	NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	190					glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						GTCGCTTATTAAGGATATCTC	0.483																																					p.L190X		Atlas-SNP	.											.	GPCPD1	52	.	0			c.T569G						PASS	.						126.0	103.0	111.0					20																	5559162		2203	4300	6503	SO:0001587	stop_gained	56261	exon8			CTTATTAAGGATA		CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.569T>G	20.37:g.5559162A>C	ENSP00000368305:p.Leu190*	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	154	71	0.461039	NM_019593	D3DW06|Q9BQL8|Q9NUX0	Nonsense_Mutation	SNP	ENST00000379019.4	37	CCDS13090.1	.	.	.	.	.	.	.	.	.	.	A	38	6.968935	0.97971	.	.	ENSG00000125772	ENST00000379019	.	.	.	5.35	5.35	0.76521	.	0.128536	0.50627	D	0.000106	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-2.9154	15.6389	0.76981	1.0:0.0:0.0:0.0	.	.	.	.	X	190	.	ENSP00000368305:L190X	L	-	2	0	GPCPD1	5507162	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	7.334000	0.79224	2.156000	0.67533	0.533000	0.62120	TTA	.	.	none		0.483	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1	NM_019593	
VWDE	221806	hgsc.bcm.edu	37	7	12397001	12397001	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:12397001T>G	ENST00000275358.3	-	17	3603	c.3415A>C	c.(3415-3417)Agt>Cgt	p.S1139R		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1139						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						GAGGAAACACTTGCCCCTTCA	0.423																																					p.S1139R		Atlas-SNP	.											.	VWDE	123	.	0			c.A3415C						PASS	.						117.0	102.0	106.0					7																	12397001		692	1591	2283	SO:0001583	missense	221806	exon17			AAACACTTGCCCC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.3415A>C	7.37:g.12397001T>G	ENSP00000275358:p.Ser1139Arg	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	133	37	0.278196	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	t	0.733	-0.779228	0.02929	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.82433	-1.61	3.96	0.0994	0.14502	.	1.106550	0.06689	N	0.769402	T	0.71143	0.3305	L	0.38175	1.15	0.21105	N	0.999786	B	0.10296	0.003	B	0.08055	0.003	T	0.49698	-0.8912	10	0.13853	T	0.58	.	4.7955	0.13270	0.0:0.1795:0.1603:0.6602	.	1139	Q8N2E2	VWDE_HUMAN	R	1139;593	ENSP00000275358:S1139R	ENSP00000275358:S1139R	S	-	1	0	VWDE	12363526	0.007000	0.16637	0.124000	0.21820	0.281000	0.26958	0.060000	0.14342	-0.062000	0.13088	0.528000	0.53228	AGT	.	.	none		0.423	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
NBPF15	284565	hgsc.bcm.edu	37	1	148594455	148594455	+	Missense_Mutation	SNP	A	A	G	rs1043751	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:148594455A>G	ENST00000369187.3	+	19	2317	c.1828A>G	c.(1828-1830)Aga>Gga	p.R610G	NBPF15_ENST00000442702.2_Missense_Mutation_p.R610G	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	610	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					CTCACTGGATAGATGTTATTC	0.453																																					p.R610G		Atlas-SNP	.											NBPF15,NS,carcinoma,-1,1	NBPF15	20	1	0			c.A1828G						scavenged	.						193.0	250.0	231.0					1																	148594455		2203	4299	6502	SO:0001583	missense	284565	exon19			CTGGATAGATGTT	BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.1828A>G	1.37:g.148594455A>G	ENSP00000358188:p.Arg610Gly	Somatic	319	32	0.100313		WXS	Illumina HiSeq	Phase_I	289	33	0.114187	NM_173638	Q3BBV9|Q8IX77	Missense_Mutation	SNP	ENST00000369187.3	37	CCDS932.1	.	.	.	.	.	.	.	.	.	.	.	3.941	-0.014253	0.07681	.	.	ENSG00000243452	ENST00000442702;ENST00000369187	T;T	0.07908	3.15;3.15	0.502	-0.965	0.10323	DUF1220 (2);	.	.	.	.	T	0.02083	0.0065	L	0.45470	1.425	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.44544	-0.9321	8	0.38643	T	0.18	.	.	.	.	rs1043751;rs3183409	610	Q8N660	NBPFF_HUMAN	G	610	ENSP00000416864:R610G;ENSP00000358188:R610G	ENSP00000358188:R610G	R	+	1	2	NBPF15	146861079	0.958000	0.32768	0.000000	0.03702	0.002000	0.02628	-0.245000	0.08890	-0.355000	0.08199	0.310000	0.20435	AGA	A|0.996;G|0.004	0.004	strong		0.453	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038609.3	NM_173638	
DNAI2	64446	hgsc.bcm.edu	37	17	72287205	72287205	+	Silent	SNP	C	C	T	rs539461253		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:72287205C>T	ENST00000311014.6	+	6	724	c.657C>T	c.(655-657)ctC>ctT	p.L219L	DNAI2_ENST00000579490.1_Silent_p.L276L|DNAI2_ENST00000582036.1_Silent_p.L219L|DNAI2_ENST00000446837.2_Silent_p.L219L|DNAI2_ENST00000307504.5_Silent_p.L76L			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	219					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CGTCTCCACTCGTGACGTTGG	0.463									Kartagener syndrome																												p.L219L		Atlas-SNP	.											.	DNAI2	102	.	0			c.C657T						PASS	.						183.0	189.0	187.0					17																	72287205		2203	4300	6503	SO:0001819	synonymous_variant	64446	exon6	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TCCACTCGTGACG	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.657C>T	17.37:g.72287205C>T		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	111	53	0.477477	NM_001172810	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Silent	SNP	ENST00000311014.6	37	CCDS11697.1																																																																																			.	.	none		0.463	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036	
NEDD4L	23327	hgsc.bcm.edu	37	18	56057939	56057939	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:56057939C>T	ENST00000400345.3	+	29	3000	c.2717C>T	c.(2716-2718)tCg>tTg	p.S906L	NEDD4L_ENST00000586263.1_Missense_Mutation_p.S878L|NEDD4L_ENST00000382850.4_Missense_Mutation_p.S886L|NEDD4L_ENST00000256830.9_Missense_Mutation_p.S802L|NEDD4L_ENST00000589054.1_Missense_Mutation_p.S37L|NEDD4L_ENST00000435432.2_Missense_Mutation_p.S765L|NEDD4L_ENST00000456986.1_Missense_Mutation_p.S785L|NEDD4L_ENST00000431212.2_Missense_Mutation_p.S785L|NEDD4L_ENST00000456173.2_Missense_Mutation_p.S765L|NEDD4L_ENST00000356462.6_Missense_Mutation_p.S842L|NEDD4L_ENST00000256832.7_Missense_Mutation_p.S766L|NEDD4L_ENST00000357895.5_Missense_Mutation_p.S898L	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	906	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						ACAGGGACATCGCGAGTACCT	0.507																																					p.S906L		Atlas-SNP	.											.	NEDD4L	126	.	0			c.C2717T						PASS	.						116.0	111.0	113.0					18																	56057939		2036	4184	6220	SO:0001583	missense	23327	exon29			GGACATCGCGAGT	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.2717C>T	18.37:g.56057939C>T	ENSP00000383199:p.Ser906Leu	Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	211	44	0.208531	NM_001144967	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	37	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	C	36	5.713196	0.96830	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	T;T;T;T;T;T;T;T;T;T	0.61040	0.14;0.14;0.14;0.14;0.14;0.14;0.14;0.14;0.14;0.14	5.66	5.66	0.87406	HECT (4);	0.106741	0.64402	D	0.000003	D	0.87103	0.6094	H	0.99211	4.47	0.80722	D	1	D;D;P;D;D;D	0.89917	1.0;1.0;0.931;0.978;1.0;1.0	D;D;B;B;D;D	0.75020	0.974;0.974;0.279;0.305;0.977;0.985	D	0.92318	0.5863	10	0.87932	D	0	.	19.7559	0.96291	0.0:1.0:0.0:0.0	.	878;898;765;842;906;886	Q96PU5-6;Q96PU5-7;Q3LSM7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;.;NED4L_HUMAN;.	L	906;886;842;802;766;785;898;765;765;785	ENSP00000383199:S906L;ENSP00000372301:S886L;ENSP00000348847:S842L;ENSP00000256830:S802L;ENSP00000256832:S766L;ENSP00000411947:S785L;ENSP00000350569:S898L;ENSP00000393395:S765L;ENSP00000405440:S765L;ENSP00000389406:S785L	ENSP00000256830:S802L	S	+	2	0	NEDD4L	54208919	1.000000	0.71417	0.971000	0.41717	0.938000	0.57974	7.773000	0.85462	2.656000	0.90262	0.655000	0.94253	TCG	.	.	none		0.507	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
THRB	7068	hgsc.bcm.edu	37	3	24231565	24231565	+	Splice_Site	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:24231565C>T	ENST00000356447.4	-	4	567	c.283G>A	c.(283-285)Ggg>Agg	p.G95R	THRB_ENST00000416420.1_Splice_Site_p.G95R|THRB_ENST00000396671.2_Splice_Site_p.G95R	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	95	Modulating.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	ATCTGGTTACCTTTACATTTC	0.393																																					p.G95R	Melanoma(21;896 1043 15021 37958)	Atlas-SNP	.											.	THRB	52	.	0			c.G283A						PASS	.						159.0	151.0	154.0					3																	24231565		2203	4300	6503	SO:0001630	splice_region_variant	7068	exon4			GGTTACCTTTACA		CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.283+1G>A	3.37:g.24231565C>T		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	103	26	0.252427	NM_000461	B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Missense_Mutation	SNP	ENST00000356447.4	37	CCDS2641.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.612710	0.66672	.	.	ENSG00000151090	ENST00000396671;ENST00000356447;ENST00000416420;ENST00000413780;ENST00000415021;ENST00000447875;ENST00000453729;ENST00000431815;ENST00000447414	D;D;D;D	0.96745	-3.3;-3.3;-3.3;-4.11	6.07	6.07	0.98685	.	.	.	.	.	D	0.96765	0.8944	L	0.32530	0.975	0.80722	D	1	D	0.71674	0.998	D	0.66847	0.947	D	0.97177	0.9848	9	0.72032	D	0.01	.	18.8399	0.92180	0.0:1.0:0.0:0.0	.	95	P10828	THB_HUMAN	R	95;95;95;64;95;95;95;95;95	ENSP00000379904:G95R;ENSP00000348827:G95R;ENSP00000414444:G95R;ENSP00000414100:G64R	ENSP00000348827:G95R	G	-	1	0	THRB	24206569	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	4.956000	0.63645	2.885000	0.99019	0.655000	0.94253	GGG	.	.	none		0.393	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252877.3	NM_000461	Missense_Mutation
ANKRD30B	374860	hgsc.bcm.edu	37	18	14787093	14787093	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:14787093T>A	ENST00000358984.4	+	15	1908	c.1728T>A	c.(1726-1728)gaT>gaA	p.D576E	ANKRD30B_ENST00000447268.2_Missense_Mutation_p.D576E|ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	576										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						ATTCTTGGGATTCTGAGGTAC	0.313																																					p.D576E		Atlas-SNP	.											.	ANKRD30B	237	.	0			c.T1728A						PASS	.						163.0	140.0	147.0					18																	14787093		692	1585	2277	SO:0001583	missense	374860	exon15			TTGGGATTCTGAG	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1728T>A	18.37:g.14787093T>A	ENSP00000351875:p.Asp576Glu	Somatic	367	0	0		WXS	Illumina HiSeq	Phase_I	478	74	0.154812	NM_001145029	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	14.45	2.540315	0.45176	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.58210	0.37;0.35	1.15	1.15	0.20763	.	.	.	.	.	T	0.60560	0.2278	L	0.61218	1.895	0.20975	N	0.999819	D	0.55605	0.972	P	0.62184	0.899	T	0.46331	-0.9199	9	0.51188	T	0.08	.	4.5356	0.12026	0.0:0.0:0.0:1.0	.	576	F8WAG3	.	E	576	ENSP00000351875:D576E;ENSP00000399031:D576E	ENSP00000351875:D576E	D	+	3	2	ANKRD30B	14777093	0.996000	0.38824	0.911000	0.35937	0.011000	0.07611	1.029000	0.30140	0.788000	0.33755	0.241000	0.17934	GAT	.	.	none		0.313	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
FAM96A	84191	hgsc.bcm.edu	37	15	64380994	64380994	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:64380994C>T	ENST00000300030.3	-	2	430	c.181G>A	c.(181-183)Gtg>Atg	p.V61M	FAM96A_ENST00000559950.1_Missense_Mutation_p.V61M|FAM96A_ENST00000380290.3_Missense_Mutation_p.V61M|FAM96A_ENST00000557835.1_Missense_Mutation_p.V61M	NM_032231.4	NP_115607.1	Q9H5X1	FA96A_HUMAN	family with sequence similarity 96, member A	61					chromosome segregation (GO:0007059)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	9						TCCGAGACCACTTCCAGTTCT	0.383																																					p.V61M		Atlas-SNP	.											FAM96A,NS,carcinoma,+2,1	FAM96A	18	1	0			c.G181A						scavenged	.						82.0	76.0	78.0					15																	64380994		2203	4300	6503	SO:0001583	missense	84191	exon2			AGACCACTTCCAG		CCDS10189.1, CCDS45278.1	15q22.31	2014-01-16			ENSG00000166797	ENSG00000166797			26235	protein-coding gene	gene with protein product						23891004	Standard	NM_032231		Approved	FLJ22875	uc002amt.1	Q9H5X1	OTTHUMG00000132961	ENST00000300030.3:c.181G>A	15.37:g.64380994C>T	ENSP00000300030:p.Val61Met	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	168	2	0.0119048	NM_032231	A6NKS1|B2R5F8|B7Z8Z5	Missense_Mutation	SNP	ENST00000300030.3	37	CCDS10189.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916722	0.92249	.	.	ENSG00000166797	ENST00000300030;ENST00000380290	.	.	.	5.78	5.78	0.91487	Domain of unknown function DUF59 (1);	0.130479	0.51477	D	0.000088	D	0.86789	0.6017	M	0.93898	3.47	0.58432	D	0.999997	D;D	0.89917	1.0;0.997	D;D	0.97110	1.0;0.959	D	0.89636	0.3859	9	0.87932	D	0	-21.0365	17.573	0.87940	0.0:1.0:0.0:0.0	.	61;61	B7Z8Z5;Q9H5X1	.;FA96A_HUMAN	M	61	.	ENSP00000300030:V61M	V	-	1	0	FAM96A	62168047	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.407000	0.80029	2.735000	0.93741	0.650000	0.86243	GTG	.	.	none		0.383	FAM96A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256520.1	NM_032231	
OR8I2	120586	hgsc.bcm.edu	37	11	55861587	55861587	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:55861587C>T	ENST00000302124.2	+	1	835	c.804C>T	c.(802-804)acC>acT	p.T268T		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T268T(2)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					CATCGCTGACCCAGGCGCAGG	0.458																																					p.T268T		Atlas-SNP	.											OR8I2,NS,carcinoma,0,2	OR8I2	119	2	2	Substitution - coding silent(2)	lung(2)	c.C804T						scavenged	.						97.0	94.0	95.0					11																	55861587		2201	4296	6497	SO:0001819	synonymous_variant	120586	exon1			GCTGACCCAGGCG	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.804C>T	11.37:g.55861587C>T		Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	105	2	0.0190476	NM_001003750	B2RNN4|Q6IFC0|Q96RC5	Silent	SNP	ENST00000302124.2	37	CCDS31517.1																																																																																			.	.	none		0.458	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750	
ANTXR2	118429	hgsc.bcm.edu	37	4	80899206	80899206	+	Silent	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:80899206T>C	ENST00000307333.7	-	15	1304	c.1302A>G	c.(1300-1302)aaA>aaG	p.K434K	ANTXR2_ENST00000403729.2_Silent_p.K434K|ANTXR2_ENST00000346652.6_Silent_p.K331K|ANTXR2_ENST00000404191.1_Silent_p.K357K	NM_001145794.1	NP_001139266.1	P58335	ANTR2_HUMAN	anthrax toxin receptor 2	434					reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						GGTGTGTGGGTTTGGGTCGAG	0.453									Juvenile Hyaline Fibromatosis																												p.K434K		Atlas-SNP	.											.	ANTXR2	97	.	0			c.A1302G						PASS	.						275.0	269.0	271.0					4																	80899206		1922	4130	6052	SO:0001819	synonymous_variant	118429	exon15	Familial Cancer Database	incl. Infantile Systemic Hyalinosis	TGTGGGTTTGGGT	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000307333.7:c.1302A>G	4.37:g.80899206T>C		Somatic	331	1	0.00302115		WXS	Illumina HiSeq	Phase_I	296	105	0.35473	NM_001145794	Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	Silent	SNP	ENST00000307333.7	37	CCDS47086.1																																																																																			.	.	none		0.453	ANTXR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324663.1	NM_058172	
SLC35G5	83650	hgsc.bcm.edu	37	8	11188884	11188884	+	Missense_Mutation	SNP	G	G	A	rs141484171	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr8:11188884G>A	ENST00000382435.4	+	1	488	c.269G>A	c.(268-270)cGt>cAt	p.R90H		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	90	EamA 1.					integral component of membrane (GO:0016021)											CTTAAACTGCGTGGCGACCCC	0.582													g|||	20	0.00399361	0.0053	0.0029	5008	,	,		21791	0.003		0.001	False		,,,				2504	0.0072				p.R90H		Atlas-SNP	.											AMAC1L2,NS,carcinoma,+1,1	.	.	1	0			c.G269A						scavenged	.	A	HIS/ARG	11,4395	17.9+/-39.9	0,11,2192	181.0	189.0	186.0		269	-0.7	0.1	8	dbSNP_134	186	4,8596	3.0+/-9.4	0,4,4296	no	missense	SLC35G5	NM_054028.1	29	0,15,6488	AA,AG,GG		0.0465,0.2497,0.1153	possibly-damaging	90/339	11188884	15,12991	2203	4300	6503	SO:0001583	missense	83650	exon1			AACTGCGTGGCGA	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.269G>A	8.37:g.11188884G>A	ENSP00000371872:p.Arg90His	Somatic	244	3	0.0122951		WXS	Illumina HiSeq	Phase_I	239	18	0.0753138	NM_054028	A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	CCDS5980.1	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	g	8.531	0.871012	0.17322	0.002497	4.65E-4	ENSG00000177710	ENST00000382435	T	0.69561	-0.41	0.34	-0.68	0.11346	.	0.209985	0.24298	N	0.039751	T	0.53578	0.1805	N	0.24115	0.695	0.24566	N	0.993947	D	0.55605	0.972	P	0.55871	0.786	T	0.53322	-0.8455	9	0.15952	T	0.53	-1.5188	.	.	.	.	90	Q96KT7	S35G5_HUMAN	H	90	ENSP00000371872:R90H	ENSP00000371872:R90H	R	+	2	0	SLC35G5	11226294	0.002000	0.14202	0.073000	0.20177	0.023000	0.10783	-2.309000	0.01130	-1.230000	0.02561	-1.863000	0.00559	CGT	G|0.999;A|0.001	0.001	strong		0.582	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
CBWD6	644019	hgsc.bcm.edu	37	9	69247582	69247582	+	Splice_Site	SNP	G	G	C	rs201502273		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:69247582G>C	ENST00000377457.5	-	5	536		c.e5-1		CBWD6_ENST00000377449.1_Splice_Site|CBWD6_ENST00000382399.4_Intron	NM_001085457.1	NP_001078926.1	Q4V339	CBWD6_HUMAN	COBW domain containing 6								ATP binding (GO:0005524)			lung(4)	4						GCCACTGCACGTGAAAATATA	0.289																																					.		Atlas-SNP	.											CBWD6,NS,neuroblastoma,0,1	CBWD6	19	1	0			c.431-1C>G						scavenged	.						19.0	13.0	15.0					9																	69247582		1960	3639	5599	SO:0001630	splice_region_variant	644019	exon6			CTGCACGTGAAAA		CCDS43827.1	9q13	2006-06-30			ENSG00000204790	ENSG00000204790			31978	protein-coding gene	gene with protein product							Standard	NM_001085457		Approved	OTTHUMG00000066820	uc004afj.4	Q4V339	OTTHUMG00000066820	ENST00000377457.5:c.431-1C>G	9.37:g.69247582G>C		Somatic	52	1	0.0192308		WXS	Illumina HiSeq	Phase_I	54	2	0.037037	NM_001085457		Splice_Site	SNP	ENST00000377457.5	37	CCDS43827.1	.	.	.	.	.	.	.	.	.	.	g	8.385	0.838326	0.16891	.	.	ENSG00000204790	ENST00000377457;ENST00000377450;ENST00000377449;ENST00000377445;ENST00000536466	.	.	.	2.63	2.63	0.31362	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.326	0.37993	0.0:0.7769:0.2231:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CBWD6	68537402	1.000000	0.71417	1.000000	0.80357	0.305000	0.27757	5.187000	0.65087	0.454000	0.26884	-1.123000	0.02005	.	G|0.500;C|0.500	0.500	weak		0.289	CBWD6-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143172.2	XM_928822	Intron
KMT2C	58508	hgsc.bcm.edu	37	7	151919670	151919670	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:151919670G>A	ENST00000262189.6	-	21	3639	c.3421C>T	c.(3421-3423)Cct>Tct	p.P1141S	KMT2C_ENST00000355193.2_Missense_Mutation_p.P1141S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1141					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P1141S(2)									TTAGACGCAGGCATATAGGGT	0.398																																					p.P1141S		Atlas-SNP	.											MLL3_ENST00000355193,NS,carcinoma,0,2	MLL3	1564	2	2	Substitution - Missense(2)	lung(2)	c.C3421T						scavenged	.						49.0	39.0	42.0					7																	151919670		2202	4299	6501	SO:0001583	missense	58508	exon21			ACGCAGGCATATA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3421C>T	7.37:g.151919670G>A	ENSP00000262189:p.Pro1141Ser	Somatic	334	7	0.0209581		WXS	Illumina HiSeq	Phase_I	297	9	0.030303	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.713743	0.30413	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.62498	0.02;0.02	5.73	5.73	0.89815	Zinc finger, FYVE/PHD-type (1);	0.146146	0.31290	N	0.007906	T	0.73999	0.3659	M	0.76838	2.35	0.80722	D	1	D;B	0.57899	0.981;0.42	P;B	0.52109	0.69;0.099	T	0.76030	-0.3108	10	0.51188	T	0.08	.	18.0799	0.89439	0.0:0.0:1.0:0.0	.	1141;202	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	S	1141	ENSP00000262189:P1141S;ENSP00000347325:P1141S	ENSP00000262189:P1141S	P	-	1	0	MLL3	151550603	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	3.113000	0.50376	2.703000	0.92315	0.650000	0.86243	CCT	.	.	none		0.398	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
RNF220	55182	hgsc.bcm.edu	37	1	44878186	44878186	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:44878186C>T	ENST00000355387.2	+	2	867	c.417C>T	c.(415-417)gcC>gcT	p.A139A	RNF220_ENST00000361799.2_Silent_p.A139A|RNF220_ENST00000372247.2_Silent_p.A139A			Q5VTB9	RN220_HUMAN	ring finger protein 220	139					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						TTACGCCGGCCAAGCGACTTA	0.552																																					p.A139A		Atlas-SNP	.											RNF220,NS,carcinoma,+2,2	RNF220	56	2	0			c.C417T						scavenged	.						84.0	84.0	84.0					1																	44878186		2203	4300	6503	SO:0001819	synonymous_variant	55182	exon2			GCCGGCCAAGCGA	AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.417C>T	1.37:g.44878186C>T		Somatic	164	1	0.00609756		WXS	Illumina HiSeq	Phase_I	195	2	0.0102564	NM_018150	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Silent	SNP	ENST00000355387.2	37	CCDS510.1																																																																																			.	.	none		0.552	RNF220-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020683.4	NM_018150	
KLHL10	317719	hgsc.bcm.edu	37	17	39994253	39994253	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:39994253G>A	ENST00000293303.4	+	1	222	c.69G>A	c.(67-69)gcG>gcA	p.A23A	NT5C3B_ENST00000521789.1_5'Flank|KLHL10_ENST00000485613.1_3'UTR|RN7SL871P_ENST00000583512.1_RNA|NT5C3B_ENST00000435506.2_5'Flank|NT5C3B_ENST00000269534.8_5'Flank	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	23					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				AGATGAGTGCGATGGCCTGTG	0.562																																					p.A23A		Atlas-SNP	.											KLHL10,caecum,carcinoma,+1,1	KLHL10	67	1	0			c.G69A						scavenged	.						144.0	143.0	144.0					17																	39994253		2083	4210	6293	SO:0001819	synonymous_variant	317719	exon1			GAGTGCGATGGCC	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.69G>A	17.37:g.39994253G>A		Somatic	193	0	0		WXS	Illumina HiSeq	Phase_I	182	3	0.0164835	NM_152467	Q6NW28|Q96MC0	Silent	SNP	ENST00000293303.4	37	CCDS42340.1																																																																																			.	.	none		0.562	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467	
RAF1	5894	hgsc.bcm.edu	37	3	12627284	12627284	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:12627284C>T	ENST00000251849.4	-	14	1871	c.1432G>A	c.(1432-1434)Gaa>Aaa	p.E478K	RAF1_ENST00000534997.1_Missense_Mutation_p.E263K|RAF1_ENST00000442415.2_Missense_Mutation_p.E498K|RAF1_ENST00000542177.1_Missense_Mutation_p.E397K	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	478	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	GTTAAGCCTTCATGGAGAAAT	0.388			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.E478K		Atlas-SNP	.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	RAF1,NS,lymphoid_neoplasm,0,2	RAF1	66	2	0			c.G1432A						PASS	.						99.0	98.0	98.0					3																	12627284		2203	4300	6503	SO:0001583	missense	5894	exon14	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	AGCCTTCATGGAG	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.1432G>A	3.37:g.12627284C>T	ENSP00000251849:p.Glu478Lys	Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	81	16	0.197531	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	C	36	5.763115	0.96906	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67	5.26	5.26	0.73747	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85401	0.5688	N	0.17872	0.535	0.80722	D	1	D;P;D	0.53619	0.96;0.762;0.961	D;P;D	0.68039	0.91;0.893;0.955	D	0.87465	0.2410	10	0.87932	D	0	.	19.0661	0.93110	0.0:1.0:0.0:0.0	.	397;263;478	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	K	478;498;357;263;397	ENSP00000251849:E478K;ENSP00000401888:E498K;ENSP00000398591:E357K;ENSP00000441186:E263K;ENSP00000443567:E397K	ENSP00000251849:E478K	E	-	1	0	RAF1	12602284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.646000	0.83445	2.746000	0.94184	0.655000	0.94253	GAA	.	.	none		0.388	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
INSIG2	51141	hgsc.bcm.edu	37	2	118864361	118864361	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:118864361C>A	ENST00000245787.4	+	4	624	c.418C>A	c.(418-420)Cta>Ata	p.L140I	INSIG2_ENST00000485520.1_3'UTR	NM_016133.2	NP_057217.2	Q9Y5U4	INSI2_HUMAN	insulin induced gene 2	140					cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						ACTGGCTGCACTATCCATTGG	0.403																																					p.L140I		Atlas-SNP	.											INSIG2,NS,carcinoma,-1,2	INSIG2	30	2	0			c.C418A						scavenged	.						231.0	212.0	219.0					2																	118864361		2203	4300	6503	SO:0001583	missense	51141	exon4			GCTGCACTATCCA	AF527632	CCDS2122.1	2q14.1	2008-02-05			ENSG00000125629	ENSG00000125629			20452	protein-coding gene	gene with protein product		608660				12242332	Standard	NM_016133		Approved		uc002tlk.3	Q9Y5U4	OTTHUMG00000058518	ENST00000245787.4:c.418C>A	2.37:g.118864361C>A	ENSP00000245787:p.Leu140Ile	Somatic	224	0	0		WXS	Illumina HiSeq	Phase_I	185	2	0.0108108	NM_016133	A8K5W8|Q8TBI8	Missense_Mutation	SNP	ENST00000245787.4	37	CCDS2122.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396683	0.62177	.	.	ENSG00000125629	ENST00000245787	.	.	.	5.55	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.75932	0.3917	M	0.73598	2.24	0.58432	D	0.999999	D;D	0.76494	0.999;0.997	D;D	0.80764	0.994;0.987	T	0.76107	-0.3080	9	0.41790	T	0.15	.	10.9248	0.47185	0.0:0.8581:0.0:0.1418	.	32;140	B4DQ23;Q9Y5U4	.;INSI2_HUMAN	I	140	.	ENSP00000245787:L140I	L	+	1	2	INSIG2	118580831	0.911000	0.30947	0.997000	0.53966	0.980000	0.70556	1.852000	0.39348	1.598000	0.50083	-0.198000	0.12761	CTA	.	.	none		0.403	INSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129624.1	NM_016133	
SYCP3	50511	hgsc.bcm.edu	37	12	102131710	102131710	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:102131710C>T	ENST00000392927.3	-	2	135	c.4G>A	c.(4-6)Gtg>Atg	p.V2M	SYCP3_ENST00000392924.1_Missense_Mutation_p.V2M|SYCP3_ENST00000266743.2_Missense_Mutation_p.V2M	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	2					male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						CCGGAGGACACCATATTTAGA	0.353																																					p.V2M		Atlas-SNP	.											.	SYCP3	19	.	0			c.G4A						PASS	.						142.0	143.0	143.0					12																	102131710		2203	4300	6503	SO:0001583	missense	50511	exon2			AGGACACCATATT	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.4G>A	12.37:g.102131710C>T	ENSP00000376658:p.Val2Met	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	70	4	0.0571429	NM_001177949		Missense_Mutation	SNP	ENST00000392927.3	37	CCDS9087.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589299	0.46214	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	5.23	3.36	0.38483	.	0.992267	0.08182	N	0.985316	T	0.36054	0.0953	L	0.46157	1.445	0.29107	N	0.881125	B	0.32653	0.379	B	0.28305	0.088	T	0.25293	-1.0136	9	0.36615	T	0.2	-46.7494	10.1367	0.42710	0.0:0.7867:0.1387:0.0746	.	2	Q8IZU3	SYCP3_HUMAN	M	2	.	ENSP00000266743:V2M	V	-	1	0	SYCP3	100655841	1.000000	0.71417	0.175000	0.22980	0.193000	0.23685	1.638000	0.37165	1.170000	0.42753	0.655000	0.94253	GTG	.	.	none		0.353	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316478.2	NM_153694	
SDPR	8436	hgsc.bcm.edu	37	2	192700876	192700876	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:192700876T>G	ENST00000304141.4	-	2	1380	c.1051A>C	c.(1051-1053)Att>Ctt	p.I351L		NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			TCCTCTGCAATTTCCCCTTCC	0.567																																					p.I351L		Atlas-SNP	.											.	SDPR	67	.	0			c.A1051C						PASS	.						116.0	113.0	114.0					2																	192700876		2203	4300	6503	SO:0001583	missense	8436	exon2			CTGCAATTTCCCC	AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.1051A>C	2.37:g.192700876T>G	ENSP00000305675:p.Ile351Leu	Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	128	51	0.398438	NM_004657		Missense_Mutation	SNP	ENST00000304141.4	37	CCDS2313.1	.	.	.	.	.	.	.	.	.	.	T	11.27	1.588786	0.28357	.	.	ENSG00000168497	ENST00000304141	T	0.62639	0.01	4.66	-2.51	0.06365	.	2.341900	0.01171	N	0.006876	T	0.40886	0.1135	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30387	-0.9980	10	0.49607	T	0.09	0.7853	5.9015	0.18970	0.0:0.3185:0.1309:0.5506	.	351	O95810	SDPR_HUMAN	L	351	ENSP00000305675:I351L	ENSP00000305675:I351L	I	-	1	0	SDPR	192409121	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.388000	0.20735	-0.632000	0.05553	-0.371000	0.07208	ATT	.	.	none		0.567	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657	
FLG	2312	hgsc.bcm.edu	37	1	152284337	152284337	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:152284337G>C	ENST00000368799.1	-	3	3060	c.3025C>G	c.(3025-3027)Cac>Gac	p.H1009D	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1009	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCTCTGCGTGAGGAGTTCCT	0.582									Ichthyosis																												p.H1009D		Atlas-SNP	.											.	FLG	900	.	0			c.C3025G						PASS	.						304.0	306.0	305.0					1																	152284337		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CTGCGTGAGGAGT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3025C>G	1.37:g.152284337G>C	ENSP00000357789:p.His1009Asp	Somatic	440	1	0.00227273		WXS	Illumina HiSeq	Phase_I	342	121	0.353801	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	g	3.802	-0.041479	0.07452	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.00801	5.68	1.92	1.92	0.25849	.	.	.	.	.	T	0.00384	0.0012	M	0.76574	2.34	0.09310	N	1	P	0.41232	0.743	B	0.26094	0.066	T	0.38845	-0.9642	9	0.12430	T	0.62	.	7.4495	0.27229	0.0:0.0:1.0:0.0	.	1009	P20930	FILA_HUMAN	D	1009;216	ENSP00000357789:H1009D	ENSP00000357789:H1009D	H	-	1	0	FLG	150550961	0.023000	0.18921	0.002000	0.10522	0.005000	0.04900	0.112000	0.15479	1.409000	0.46915	0.291000	0.19559	CAC	.	.	none		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
RITA1	84934	hgsc.bcm.edu	37	12	113629195	113629195	+	Missense_Mutation	SNP	G	G	A	rs368110690	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:113629195G>A	ENST00000548278.1	+	4	1075	c.383G>A	c.(382-384)cGg>cAg	p.R128Q	C12orf52_ENST00000549621.1_Missense_Mutation_p.R128Q|C12orf52_ENST00000552495.1_Missense_Mutation_p.R152Q|RP11-545P7.4_ENST00000552525.1_RNA	NM_032848.1	NP_116237.1	Q96K30	RITA1_HUMAN		128	Interaction with RBPJ/RBPSUH.				negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|nuclear export (GO:0051168)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	tubulin binding (GO:0015631)	p.R128Q(1)		large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	5						GGGGCCCCGCGGATGGCGAAG	0.642													G|||	4	0.000798722	0.0	0.0	5008	,	,		14839	0.0		0.0	False		,,,				2504	0.0041				p.R128Q		Atlas-SNP	.											C12orf52,colon,carcinoma,0,1	C12orf52	19	1	1	Substitution - Missense(1)	large_intestine(1)	c.G383A						PASS	.	G	GLN/ARG	0,4406		0,0,2203	27.0	30.0	29.0		383	3.7	0.0	12		29	1,8599	1.2+/-3.3	0,1,4299	no	missense	C12orf52	NM_032848.1	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	128/270	113629195	1,13005	2203	4300	6503	SO:0001583	missense	84934	exon4			CCCCGCGGATGGC																												ENST00000548278.1:c.383G>A	12.37:g.113629195G>A	ENSP00000449841:p.Arg128Gln	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	51	16	0.313726	NM_032848	B3KVZ4|C9JIN1|F8VRG5|Q53GM3|Q96K25	Missense_Mutation	SNP	ENST00000548278.1	37	CCDS9166.1	.	.	.	.	.	.	.	.	.	.	G	5.660	0.306471	0.10733	0.0	1.16E-4	ENSG00000139405	ENST00000549621;ENST00000548278;ENST00000552495;ENST00000436053;ENST00000299731;ENST00000266813	T;T;T	0.32988	1.45;1.45;1.43	4.6	3.71	0.42584	.	0.364168	0.23708	N	0.045345	T	0.12603	0.0306	N	0.12182	0.205	0.09310	N	1	D;P;D	0.55800	0.973;0.951;0.973	B;B;B	0.35278	0.199;0.199;0.199	T	0.10776	-1.0615	10	0.26408	T	0.33	-2.164	8.434	0.32775	0.1057:0.0:0.8943:0.0	.	128;152;128	Q96K30-2;F8VRG5;Q96K30	.;.;RITA_HUMAN	Q	128;128;152;128;128;125	ENSP00000448289:R128Q;ENSP00000449841:R128Q;ENSP00000448680:R152Q	ENSP00000266813:R125Q	R	+	2	0	C12orf52	112113578	0.993000	0.37304	0.023000	0.16930	0.004000	0.04260	2.374000	0.44274	1.151000	0.42436	-0.136000	0.14681	CGG	.	.	weak		0.642	C12orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405239.1		
UNC13C	440279	hgsc.bcm.edu	37	15	54792317	54792317	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:54792317G>C	ENST00000260323.11	+	20	5101	c.5101G>C	c.(5101-5103)Gaa>Caa	p.E1701Q	UNC13C_ENST00000545554.1_Missense_Mutation_p.E1701Q|UNC13C_ENST00000537900.1_Missense_Mutation_p.E1699Q	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1701	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AGATGAAAACGAAGATGTGTC	0.348																																					p.E1701Q		Atlas-SNP	.											.	UNC13C	674	.	0			c.G5101C						PASS	.						131.0	122.0	125.0					15																	54792317		1847	4102	5949	SO:0001583	missense	440279	exon19			GAAAACGAAGATG	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5101G>C	15.37:g.54792317G>C	ENSP00000260323:p.Glu1701Gln	Somatic	225	0	0		WXS	Illumina HiSeq	Phase_I	207	73	0.352657	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664366	0.88251	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.80123	-1.33;-1.34;-1.33	5.5	5.5	0.81552	Munc13 homology 1 (1);	0.105919	0.64402	D	0.000007	D	0.90000	0.6878	M	0.77820	2.39	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.89805	0.3978	10	0.52906	T	0.07	.	18.7617	0.91855	0.0:0.0:1.0:0.0	.	1701	Q8NB66	UN13C_HUMAN	Q	1701;1701;1699	ENSP00000260323:E1701Q;ENSP00000438156:E1701Q;ENSP00000442569:E1699Q	ENSP00000260323:E1701Q	E	+	1	0	UNC13C	52579609	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.683000	0.98657	2.744000	0.94065	0.655000	0.94253	GAA	.	.	none		0.348	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
ABCB9	23457	hgsc.bcm.edu	37	12	123465786	123465786	+	5'UTR	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:123465786A>G	ENST00000542678.1	-	0	410				ARL6IP4_ENST00000426960.2_Missense_Mutation_p.R34G|ARL6IP4_ENST00000453766.2_Missense_Mutation_p.R157G|ARL6IP4_ENST00000392435.2_Missense_Mutation_p.R157G|ARL6IP4_ENST00000439686.2_Missense_Mutation_p.R34G|ARL6IP4_ENST00000412505.2_Missense_Mutation_p.R34G|RP11-197N18.2_ENST00000540866.2_RNA|ARL6IP4_ENST00000543566.1_Missense_Mutation_p.R157G|ARL6IP4_ENST00000454885.2_Missense_Mutation_p.R34G|ARL6IP4_ENST00000357866.4_Missense_Mutation_p.R34G|ARL6IP4_ENST00000315580.5_Missense_Mutation_p.R157G			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9						peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		AGACACCTCGAGGAACTGCTC	0.657																																					p.R157G	Ovarian(49;786 1333 9175 38236)	Atlas-SNP	.											ARL6IP4,NS,carcinoma,-2,1	ARL6IP4	14	1	0			c.A469G						PASS	.						48.0	42.0	44.0					12																	123465786		1879	3582	5461	SO:0001623	5_prime_UTR_variant	51329	exon2			ACCTCGAGGAACT	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.-2429T>C	12.37:g.123465786A>G		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	139	45	0.323741	NM_018694	B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Missense_Mutation	SNP	ENST00000542678.1	37	CCDS9241.1	.	.	.	.	.	.	.	.	.	.	A	13.98	2.397855	0.42512	.	.	ENSG00000182196	ENST00000544323;ENST00000543566;ENST00000315580;ENST00000542099;ENST00000392435;ENST00000413381;ENST00000426960;ENST00000453766;ENST00000454885;ENST00000412505;ENST00000439686;ENST00000456762;ENST00000357866	T;T;T;T;T;T;T;T;T;T;T;T;T	0.55052	1.13;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.73;0.54;0.54;0.76	4.73	-2.5	0.06384	.	1.340920	0.05558	N	0.568681	T	0.47820	0.1466	M	0.66939	2.045	0.09310	N	1	B;B;B;B;B;B	0.09022	0.0;0.0;0.002;0.002;0.002;0.002	B;B;B;B;B;B	0.12156	0.001;0.001;0.006;0.007;0.007;0.004	T	0.47749	-0.9093	10	0.56958	D	0.05	.	5.3709	0.16138	0.3465:0.3857:0.2678:0.0	.	34;157;157;157;157;157	B3V0L1;Q66PJ3-5;Q66PJ3-4;B3V0L0;Q66PJ3;Q66PJ3-2	.;.;.;.;AR6P4_HUMAN;.	G	157;157;157;157;157;34;34;157;34;34;34;35;34	ENSP00000445309:R157G;ENSP00000442718:R157G;ENSP00000313422:R157G;ENSP00000442200:R157G;ENSP00000376230:R157G;ENSP00000441406:R34G;ENSP00000406036:R34G;ENSP00000414847:R157G;ENSP00000396723:R34G;ENSP00000413132:R34G;ENSP00000396365:R34G;ENSP00000391598:R35G;ENSP00000350532:R34G	ENSP00000313422:R157G	R	+	1	2	ARL6IP4	122031739	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	0.197000	0.17197	-0.238000	0.09724	0.444000	0.29173	AGG	.	.	none		0.657	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624	
LRRFIP1	9208	hgsc.bcm.edu	37	2	238688143	238688143	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:238688143G>A	ENST00000308482.9	+	24	1960	c.1891G>A	c.(1891-1893)Gca>Aca	p.A631T		NM_001137550.1	NP_001131022.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	477					innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		AAAAATGAAAGCAAATCGGAG	0.493																																					p.A631T		Atlas-SNP	.											.	LRRFIP1	171	.	0			c.G1891A						PASS	.						76.0	71.0	72.0					2																	238688143		1568	3582	5150	SO:0001583	missense	9208	exon24			ATGAAAGCAAATC	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000308482.9:c.1891G>A	2.37:g.238688143G>A	ENSP00000310109:p.Ala631Thr	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	55	24	0.436364	NM_001137550	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	ENST00000308482.9	37	CCDS46551.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.031177	0.54790	.	.	ENSG00000124831	ENST00000308482;ENST00000391999	T	0.48201	0.82	4.85	4.85	0.62838	.	.	.	.	.	T	0.41696	0.1170	L	0.42245	1.32	0.80722	D	1	B;P	0.48503	0.298;0.911	B;B	0.39027	0.178;0.288	T	0.44205	-0.9343	9	0.45353	T	0.12	.	17.3552	0.87334	0.0:0.0:1.0:0.0	.	385;631	B4DPC0;E9PGZ2	.;.	T	631;621	ENSP00000310109:A631T	ENSP00000310109:A631T	A	+	1	0	LRRFIP1	238352882	1.000000	0.71417	0.987000	0.45799	0.618000	0.37518	4.253000	0.58791	2.409000	0.81822	0.563000	0.77884	GCA	.	.	none		0.493	LRRFIP1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000257169.3	NM_004735	
TARBP1	6894	hgsc.bcm.edu	37	1	234603278	234603278	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:234603278C>T	ENST00000040877.1	-	4	1217	c.1218G>A	c.(1216-1218)aaG>aaA	p.K406K		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	406					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.K406N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			ATGGAAGAATCTTTGTTTCAT	0.373																																					p.K406K		Atlas-SNP	.											TARBP1,NS,carcinoma,0,1	TARBP1	111	1	1	Substitution - Missense(1)	endometrium(1)	c.G1218A						scavenged	.						116.0	116.0	116.0					1																	234603278		2203	4300	6503	SO:0001819	synonymous_variant	6894	exon4			AAGAATCTTTGTT		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.1218G>A	1.37:g.234603278C>T		Somatic	243	0	0		WXS	Illumina HiSeq	Phase_I	208	3	0.0144231	NM_005646	Q9H581	Silent	SNP	ENST00000040877.1	37	CCDS1601.1																																																																																			.	.	none		0.373	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646	
MUC4	4585	hgsc.bcm.edu	37	3	195505763	195505763	+	Missense_Mutation	SNP	G	G	A	rs534260673	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:195505763G>A	ENST00000463781.3	-	2	13147	c.12688C>T	c.(12688-12690)Ctt>Ttt	p.L4230F	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L4230F	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	987					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.L4230F(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGACA	0.582																																					p.L4230F		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,4	MUC4	1505	4	2	Substitution - Missense(2)	kidney(2)	c.C12688T						scavenged	.						42.0	42.0	42.0					3																	195505763		2092	4200	6292	SO:0001583	missense	4585	exon2			AGGAAAGGCTGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12688C>T	3.37:g.195505763G>A	ENSP00000417498:p.Leu4230Phe	Somatic	160	3	0.01875		WXS	Illumina HiSeq	Phase_I	167	5	0.0299401	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	10.21	1.286628	0.23478	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.48;1.49	1.78	0.849	0.18972	.	.	.	.	.	T	0.13756	0.0333	N	0.19112	0.55	0.09310	N	1	P	0.35139	0.486	B	0.19946	0.027	T	0.16276	-1.0408	8	.	.	.	.	6.3726	0.21489	0.0:0.3086:0.6914:0.0	.	4102	E7ESK3	.	F	4230	ENSP00000417498:L4230F;ENSP00000420243:L4230F	.	L	-	1	0	MUC4	196990542	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.092000	0.11129	0.347000	0.23924	-0.229000	0.12294	CTT	.	.	none		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PLEKHM3	389072	hgsc.bcm.edu	37	2	208795754	208795754	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:208795754G>T	ENST00000427836.2	-	5	2271	c.1782C>A	c.(1780-1782)caC>caA	p.H594Q	PLEKHM3_ENST00000457206.1_Missense_Mutation_p.H594Q|PLEKHM3_ENST00000389247.4_Missense_Mutation_p.H594Q	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	594					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GCGGCTCTGCGTGGTGGTACA	0.622																																					p.H594Q		Atlas-SNP	.											.	PLEKHM3	101	.	0			c.C1782A						PASS	.						69.0	75.0	73.0					2																	208795754		2024	4186	6210	SO:0001583	missense	389072	exon5			CTCTGCGTGGTGG	AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.1782C>A	2.37:g.208795754G>T	ENSP00000417003:p.His594Gln	Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	150	66	0.44	NM_001080475	B9EKV2|Q8WW68	Missense_Mutation	SNP	ENST00000427836.2	37	CCDS42808.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.33|14.33	2.504060|2.504060	0.44558|0.44558	.|.	.|.	ENSG00000178385|ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206|ENST00000447645	D;D;D|.	0.84146|.	-1.74;-1.74;-1.81|.	5.79|5.79	-0.289|-0.289	0.12851|0.12851	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.55081|0.55081	0.1898|0.1898	L|L	0.46670|0.46670	1.46|1.46	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.76494|.	0.999;0.984|.	D;D|.	0.79108|.	0.992;0.921|.	T|T	0.49263|0.49263	-0.8958|-0.8958	10|5	0.87932|.	D|.	0|.	0.1349|0.1349	10.7072|10.7072	0.45962|0.45962	0.5176:0.0:0.4824:0.0|0.5176:0.0:0.4824:0.0	.|.	594;594|.	C9J119;Q6ZWE6|.	.;PKHM3_HUMAN|.	Q|S	594|346	ENSP00000417003:H594Q;ENSP00000373899:H594Q;ENSP00000400150:H594Q|.	ENSP00000373899:H594Q|.	H|R	-|-	3|1	2|0	PLEKHM3|PLEKHM3	208503999|208503999	0.897000|0.897000	0.30589|0.30589	0.964000|0.964000	0.40570|0.40570	0.034000|0.034000	0.12701|0.12701	0.063000|0.063000	0.14410|0.14410	0.036000|0.036000	0.15547|0.15547	0.460000|0.460000	0.39030|0.39030	CAC|CGC	.	.	none		0.622	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337036.1	NM_001080475	
HPDL	84842	hgsc.bcm.edu	37	1	45793485	45793485	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:45793485G>A	ENST00000334815.3	+	1	941	c.665G>A	c.(664-666)gGc>gAc	p.G222D		NM_032756.2	NP_116145.1	Q96IR7	HPDL_HUMAN	4-hydroxyphenylpyruvate dioxygenase-like	222					aromatic amino acid family metabolic process (GO:0009072)		4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4	Acute lymphoblastic leukemia(166;0.155)					GCCCAGCCGGGCAGCATTGTC	0.662																																					p.G222D		Atlas-SNP	.											.	HPDL	14	.	0			c.G665A						PASS	.						49.0	53.0	52.0					1																	45793485		2203	4300	6503	SO:0001583	missense	84842	exon1			AGCCGGGCAGCAT	BC007293	CCDS519.1	1p34.1	2008-02-05	2007-03-14	2007-03-14	ENSG00000186603	ENSG00000186603			28242	protein-coding gene	gene with protein product			"""glyoxalase domain containing 1"""	GLOXD1		12477932	Standard	NM_032756		Approved	MGC15668, 4-HPPD-L	uc001cne.3	Q96IR7	OTTHUMG00000007681	ENST00000334815.3:c.665G>A	1.37:g.45793485G>A	ENSP00000335060:p.Gly222Asp	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	79	31	0.392405	NM_032756	B2R9B0	Missense_Mutation	SNP	ENST00000334815.3	37	CCDS519.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.651635	0.00785	.	.	ENSG00000186603	ENST00000334815	T	0.66099	-0.19	5.31	2.43	0.29744	.	0.671557	0.15482	N	0.260037	T	0.57227	0.2039	M	0.76938	2.355	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.52117	-0.8618	10	0.41790	T	0.15	-1.1847	4.4552	0.11640	0.3094:0.0:0.5451:0.1454	.	222	Q96IR7	HPDL_HUMAN	D	222	ENSP00000335060:G222D	ENSP00000335060:G222D	G	+	2	0	HPDL	45566072	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.435000	0.21510	0.378000	0.24764	-0.258000	0.10820	GGC	.	.	none		0.662	HPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020527.1	NM_032756	
ZBTB20	26137	hgsc.bcm.edu	37	3	114057923	114057923	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:114057923C>T	ENST00000474710.1	-	5	2333	c.2155G>A	c.(2155-2157)Gtc>Atc	p.V719I	ZBTB20_ENST00000481632.1_Missense_Mutation_p.V646I|ZBTB20_ENST00000471418.1_Missense_Mutation_p.V646I|ZBTB20_ENST00000464560.1_Missense_Mutation_p.V646I|ZBTB20_ENST00000462705.1_Missense_Mutation_p.V646I|ZBTB20_ENST00000393785.2_Missense_Mutation_p.V646I|ZBTB20_ENST00000357258.3_Missense_Mutation_p.V646I	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	719						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GCTGGGCAGACGGAGCAGACG	0.582																																					p.V719I	NSCLC(69;748 1344 9802 11203 30933)	Atlas-SNP	.											ZBTB20_ENST00000474710,NS,carcinoma,0,4	ZBTB20	157	4	0			c.G2155A						scavenged	.						74.0	71.0	72.0					3																	114057923		2203	4300	6503	SO:0001583	missense	26137	exon5			GGCAGACGGAGCA	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.2155G>A	3.37:g.114057923C>T	ENSP00000419153:p.Val719Ile	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	99	2	0.020202	NM_001164342	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719251	0.68844	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.11495	2.79;2.79;2.79;2.79;2.77;2.79;2.79	5.87	5.87	0.94306	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.127904	0.52532	D	0.000067	T	0.27098	0.0664	L	0.37850	1.14	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.00128	-1.2017	10	0.62326	D	0.03	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	719	Q9HC78	ZBT20_HUMAN	I	646;646;646;646;719;646;646	ENSP00000420324:V646I;ENSP00000377375:V646I;ENSP00000418092:V646I;ENSP00000419902:V646I;ENSP00000419153:V719I;ENSP00000349803:V646I;ENSP00000417307:V646I	ENSP00000349803:V646I	V	-	1	0	ZBTB20	115540613	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.746000	0.68681	2.941000	0.99782	0.655000	0.94253	GTC	.	.	none		0.582	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642	
COL11A1	1301	hgsc.bcm.edu	37	1	103449740	103449740	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:103449740A>G	ENST00000370096.3	-	31	2822	c.2510T>C	c.(2509-2511)cTt>cCt	p.L837P	COL11A1_ENST00000512756.1_Missense_Mutation_p.L721P|COL11A1_ENST00000358392.2_Missense_Mutation_p.L849P|COL11A1_ENST00000353414.4_Missense_Mutation_p.L798P	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	837	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGGAACTCCAAGTTTTCCCTA	0.249																																					p.L849P		Atlas-SNP	.											COL11A1_ENST00000370096,right_lower_lobe,carcinoma,+1,4	COL11A1	972	4	0			c.T2546C						PASS	.						62.0	62.0	62.0					1																	103449740		2203	4297	6500	SO:0001583	missense	1301	exon31			ACTCCAAGTTTTC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2510T>C	1.37:g.103449740A>G	ENSP00000359114:p.Leu837Pro	Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	12	6	0.5	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	A	18.39	3.613637	0.66672	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.84133	0.5405	N	0.00303	-1.675	0.80722	D	1	P;D;D;D	0.89917	0.575;0.999;1.0;0.998	P;D;D;D	0.91635	0.563;0.998;0.999;0.995	D	0.91528	0.5240	10	0.41790	T	0.15	.	15.224	0.73336	1.0:0.0:0.0:0.0	.	721;798;849;837	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	P	837;849;798;721	ENSP00000359114:L837P;ENSP00000351163:L849P;ENSP00000302551:L798P;ENSP00000426533:L721P	ENSP00000302551:L798P	L	-	2	0	COL11A1	103222328	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.417000	0.90247	2.171000	0.68590	0.528000	0.53228	CTT	.	.	none		0.249	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
PGBD4	161779	hgsc.bcm.edu	37	15	34396115	34396115	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:34396115C>A	ENST00000397766.2	+	1	1842	c.1383C>A	c.(1381-1383)caC>caA	p.H461Q	EMC7_ENST00000256545.4_5'Flank|EMC7_ENST00000532113.1_5'Flank	NM_152595.4	NP_689808.2	Q96DM1	PGBD4_HUMAN	piggyBac transposable element derived 4	461										breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)|prostate(1)	16		all_lung(180;1.76e-08)		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)		ATCTTCTACACATTACAGTGC	0.423																																					p.H461Q		Atlas-SNP	.											.	PGBD4	58	.	0			c.C1383A						PASS	.						75.0	70.0	71.0					15																	34396115		2201	4298	6499	SO:0001583	missense	161779	exon1			TCTACACATTACA	AK057200	CCDS10033.1	15q13.1	2002-10-25			ENSG00000182405	ENSG00000182405			19401	protein-coding gene	gene with protein product							Standard	NM_152595		Approved	FLJ32638, FLJ37497	uc001zho.3	Q96DM1	OTTHUMG00000129370	ENST00000397766.2:c.1383C>A	15.37:g.34396115C>A	ENSP00000380872:p.His461Gln	Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	45	14	0.311111	NM_152595	A1L487|A8K0C6|Q8N9E8	Missense_Mutation	SNP	ENST00000397766.2	37	CCDS10033.1	.	.	.	.	.	.	.	.	.	.	c	5.706	0.314803	0.10789	.	.	ENSG00000182405	ENST00000397766	T	0.15718	2.4	0.7	-0.4	0.12411	.	0.778304	0.10025	U	0.725529	T	0.04452	0.0122	N	0.01352	-0.895	0.20926	N	0.999826	B	0.15473	0.013	B	0.04013	0.001	T	0.37337	-0.9710	10	0.31617	T	0.26	.	1.6567	0.02783	0.3278:0.4027:0.0:0.2695	.	461	Q96DM1	PGBD4_HUMAN	Q	461	ENSP00000380872:H461Q	ENSP00000380872:H461Q	H	+	3	2	PGBD4	32183407	1.000000	0.71417	0.542000	0.28115	0.953000	0.61014	2.024000	0.41049	-0.152000	0.11156	0.306000	0.20318	CAC	.	.	none		0.423	PGBD4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251522.1		
PRDM10	56980	hgsc.bcm.edu	37	11	129801147	129801147	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:129801147G>A	ENST00000360871.3	-	11	1525	c.1294C>T	c.(1294-1296)Cta>Tta	p.L432L	PRDM10_ENST00000304538.6_Silent_p.L346L|PRDM10_ENST00000526082.1_Silent_p.L346L|PRDM10_ENST00000423662.2_Silent_p.L346L|PRDM10_ENST00000358825.5_Silent_p.L432L|PRDM10_ENST00000528746.1_Silent_p.L406L	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	432					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		GGAAAATGTAGCAAGTCCTGA	0.458																																					p.L432L		Atlas-SNP	.											.	PRDM10	120	.	0			c.C1294T						PASS	.						92.0	95.0	94.0					11																	129801147		2201	4297	6498	SO:0001819	synonymous_variant	56980	exon11			AATGTAGCAAGTC	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.1294C>T	11.37:g.129801147G>A		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	140	43	0.307143	NM_020228	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Silent	SNP	ENST00000360871.3	37	CCDS8484.1																																																																																			.	.	none		0.458	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
ZNF461	92283	hgsc.bcm.edu	37	19	37129817	37129817	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:37129817G>A	ENST00000588268.1	-	6	1657	c.1430C>T	c.(1429-1431)gCc>gTc	p.A477V	ZNF461_ENST00000540605.2_5'UTR|ZNF461_ENST00000360357.4_Missense_Mutation_p.A454V	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	477					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AAGTCTAAAGGCCTTACCACA	0.388																																					p.A477V		Atlas-SNP	.											.	ZNF461	73	.	0			c.C1430T						PASS	.						62.0	66.0	65.0					19																	37129817		2201	4297	6498	SO:0001583	missense	92283	exon6			CTAAAGGCCTTAC	BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.1430C>T	19.37:g.37129817G>A	ENSP00000467931:p.Ala477Val	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	94	34	0.361702	NM_153257	A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	ENST00000588268.1	37	CCDS54257.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.776220	0.49786	.	.	ENSG00000197808	ENST00000396893;ENST00000396896;ENST00000360357;ENST00000540605;ENST00000396892	T	0.19105	2.17	3.48	3.48	0.39840	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29389	0.0732	N	0.25031	0.7	0.09310	N	1	P;D;P	0.76494	0.901;0.999;0.901	P;D;P	0.70487	0.707;0.969;0.767	T	0.06041	-1.0849	9	0.72032	D	0.01	.	9.8006	0.40761	0.0:0.358:0.6419:0.0	.	454;399;477	B4DRP8;Q59G30;Q8TAF7	.;.;ZN461_HUMAN	V	477;208;454;350;171	ENSP00000353515:A454V	ENSP00000353515:A454V	A	-	2	0	ZNF461	41821657	0.000000	0.05858	1.000000	0.80357	0.919000	0.55068	0.018000	0.13422	1.941000	0.56285	0.491000	0.48974	GCC	.	.	none		0.388	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453202.1	NM_153257	
ENPP4	22875	hgsc.bcm.edu	37	6	46111076	46111076	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:46111076C>T	ENST00000321037.4	+	4	1291	c.1061C>T	c.(1060-1062)cCt>cTt	p.P354L		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	354					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						GCCCACGGACCTGCATTTCAC	0.393																																					p.P354L		Atlas-SNP	.											.	ENPP4	44	.	0			c.C1061T						PASS	.						146.0	136.0	139.0					6																	46111076		2203	4300	6503	SO:0001583	missense	22875	exon4			ACGGACCTGCATT	AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.1061C>T	6.37:g.46111076C>T	ENSP00000318066:p.Pro354Leu	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	100	4	0.04	NM_014936	A8K5G1|Q7L2N1	Missense_Mutation	SNP	ENST00000321037.4	37	CCDS34468.1	.	.	.	.	.	.	.	.	.	.	C	32	5.171481	0.94807	.	.	ENSG00000001561	ENST00000321037;ENST00000371401	D	0.81579	-1.51	5.9	5.9	0.94986	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.93481	0.7920	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94748	0.7925	10	0.87932	D	0	-18.2243	20.2789	0.98501	0.0:1.0:0.0:0.0	.	354	Q9Y6X5	ENPP4_HUMAN	L	354	ENSP00000318066:P354L	ENSP00000318066:P354L	P	+	2	0	ENPP4	46219035	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.487000	0.81328	2.788000	0.95919	0.650000	0.86243	CCT	.	.	none		0.393	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040777.2		
MYOM1	8736	hgsc.bcm.edu	37	18	3188926	3188926	+	Silent	SNP	C	C	T	rs532272499		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:3188926C>T	ENST00000356443.4	-	4	924	c.591G>A	c.(589-591)acG>acA	p.T197T	RP13-270P17.2_ENST00000580139.1_RNA|MYOM1_ENST00000400569.3_Silent_p.T197T|MYOM1_ENST00000261606.7_Silent_p.T197T	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	197	6 X 6 AA tandem repeats.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.T197T(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GCTTGGATGCCGTGGACTGCT	0.537																																					p.T197T		Atlas-SNP	.											MYOM1,NS,carcinoma,0,1	MYOM1	192	1	1	Substitution - coding silent(1)	endometrium(1)	c.G591A						scavenged	.						310.0	295.0	300.0					18																	3188926		2061	4192	6253	SO:0001819	synonymous_variant	8736	exon4			GGATGCCGTGGAC	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.591G>A	18.37:g.3188926C>T		Somatic	269	2	0.00743494		WXS	Illumina HiSeq	Phase_I	462	6	0.012987	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Silent	SNP	ENST00000356443.4	37	CCDS45824.1																																																																																			.	.	none		0.537	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
TPSB2	64499	hgsc.bcm.edu	37	16	1279438	1279438	+	RNA	SNP	C	C	T	rs202041848	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr16:1279438C>T	ENST00000339687.6	-	0	275				TPSB2_ENST00000445910.1_RNA|TPSB2_ENST00000430512.2_RNA			P20231	TRYB2_HUMAN	tryptase beta 2 (gene/pseudogene)							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|upper_aerodigestive_tract(1)	2		Hepatocellular(780;0.00369)				ACCCTGAGGGCGGCCAGATCC	0.667													C|||	1791	0.357628	0.267	0.2853	5008	,	,		12166	0.5149		0.3469	False		,,,				2504	0.3804				p.A85T		Atlas-SNP	.											TPSB2,NS,carcinoma,0,1	TPSB2	8	1	0			c.G253A						scavenged	.						2.0	2.0	2.0					16																	1279438		1068	2864	3932			64499	exon4			TGAGGGCGGCCAG	AF099143		16p13.3	2009-11-20	2009-11-18		ENSG00000197253	ENSG00000197253			14120	protein-coding gene	gene with protein product	"""tryptase beta II"", ""tryptase beta III"""	191081	"""tryptase beta 2"""			19748655	Standard	NM_024164		Approved		uc002cky.3	P20231	OTTHUMG00000155926		16.37:g.1279438C>T		Somatic	135	24	0.177778		WXS	Illumina HiSeq	Phase_I	137	26	0.189781	NM_024164	D2E6S0|D2E6S2|O95827|Q15664|Q9UQI6|Q9UQI7	Missense_Mutation	SNP	ENST00000339687.6	37		.	.	.	.	.	.	.	.	.	.	C	3.062	-0.193122	0.06259	.	.	ENSG00000197253	ENST00000430512	D	0.88975	-2.45	3.7	-6.35	0.01975	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	2.192380	0.02106	N	0.054344	T	0.71719	0.3373	.	.	.	0.80722	P	0.0	B	0.10296	0.003	B	0.06405	0.002	T	0.65286	-0.6205	8	0.13470	T	0.59	.	0.1285	0.00071	0.2587:0.2665:0.1762:0.2985	.	85	P20231	TRYB2_HUMAN	T	85	ENSP00000412409:A85T	ENSP00000412409:A85T	A	-	1	0	TPSB2	1219439	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.877000	0.00344	-1.596000	0.01611	-0.448000	0.05591	GCC	.	.	weak		0.667	TPSB2-002	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000342364.1	NM_024164	
CUX1	1523	hgsc.bcm.edu	37	7	101559405	101559405	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:101559405A>G	ENST00000292535.7	+	2	79	c.41A>G	c.(40-42)gAt>gGt	p.D14G	CUX1_ENST00000360264.3_Missense_Mutation_p.D25G|CUX1_ENST00000547394.2_Missense_Mutation_p.D25G|CUX1_ENST00000546411.2_Missense_Mutation_p.D14G|CUX1_ENST00000437600.4_Missense_Mutation_p.D25G|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000292538.4_Missense_Mutation_p.D25G|CUX1_ENST00000549414.2_Missense_Mutation_p.D14G|CUX1_ENST00000556210.1_Missense_Mutation_p.D14G|CUX1_ENST00000550008.2_Missense_Mutation_p.D14G|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000425244.2_Missense_Mutation_p.D25G	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	14					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.D25V(1)|p.D14V(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AGAGAACTCGATGCCACCGCA	0.502																																					p.D25G		Atlas-SNP	.											CUX1_ENST00000292538,colon,carcinoma,-1,4	CUX1	253	4	2	Substitution - Missense(2)	ovary(2)	c.A74G						scavenged	.						154.0	149.0	151.0					7																	101559405		2203	4300	6503	SO:0001583	missense	1523	exon2			AACTCGATGCCAC	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.41A>G	7.37:g.101559405A>G	ENSP00000292535:p.Asp14Gly	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	206	4	0.0194175	NM_001202544	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.067755	0.76301	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000393824;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T;T	0.59224	1.41;0.28;1.41;1.41;1.41;1.41;1.41;1.41;1.41;1.41	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000001	T	0.70657	0.3249	L	0.52011	1.625	0.80722	D	1	D;D;D;D;B;D	0.89917	0.996;0.997;0.998;0.998;0.289;1.0	P;D;D;D;B;D	0.77557	0.906;0.989;0.927;0.99;0.045;0.983	T	0.72721	-0.4208	10	0.62326	D	0.03	-15.4583	14.5506	0.68065	1.0:0.0:0.0:0.0	.	14;25;25;25;25;25	P39880;B3KV79;G3V1Z6;Q13948-2;Q13948;P39880-3	CUX1_HUMAN;.;.;.;CASP_HUMAN;.	G	25;25;25;25;25;25;14;14;14;14;14	ENSP00000292538:D25G;ENSP00000449371:D25G;ENSP00000353401:D25G;ENSP00000409745:D25G;ENSP00000414091:D25G;ENSP00000292535:D14G;ENSP00000446630:D14G;ENSP00000447373:D14G;ENSP00000450125:D14G;ENSP00000451558:D14G	ENSP00000292535:D14G	D	+	2	0	CUX1	101346125	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.294000	0.89934	2.169000	0.68431	0.533000	0.62120	GAT	.	.	none		0.502	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
PCDHA13	56136	hgsc.bcm.edu	37	5	140264046	140264046	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:140264046G>A	ENST00000289272.2	+	1	2193	c.2193G>A	c.(2191-2193)gcG>gcA	p.A731A	PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA13_ENST00000409494.1_Silent_p.A731A|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	731					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGAGGGCGCGTGCGCGCCGG	0.672																																					p.A731A	Melanoma(147;1739 1852 5500 27947 37288)	Atlas-SNP	.											.	PCDHA13	213	.	0			c.G2193A						PASS	.						61.0	66.0	64.0					5																	140264046		2203	4297	6500	SO:0001819	synonymous_variant	56136	exon1			GGGCGCGTGCGCG	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.2193G>A	5.37:g.140264046G>A		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	103	79	0.76699	NM_031865	O75277	Silent	SNP	ENST00000289272.2	37	CCDS4240.1																																																																																			.	.	none		0.672	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
FLG	2312	hgsc.bcm.edu	37	1	152276386	152276386	+	Missense_Mutation	SNP	G	G	T	rs199655799		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:152276386G>T	ENST00000368799.1	-	3	11011	c.10976C>A	c.(10975-10977)tCc>tAc	p.S3659Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3659	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACTACCACTGGACCCTCGGTG	0.587									Ichthyosis																												p.S3659Y		Atlas-SNP	.											FLG,NS,carcinoma,-1,1	FLG	900	1	0			c.C10976A						scavenged	.						34.0	37.0	36.0					1																	152276386		2198	4265	6463	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CCACTGGACCCTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10976C>A	1.37:g.152276386G>T	ENSP00000357789:p.Ser3659Tyr	Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	212	3	0.0141509	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.490828	0.26774	.	.	ENSG00000143631	ENST00000368799	T	0.09073	3.02	4.47	2.48	0.30137	.	.	.	.	.	T	0.02455	0.0075	M	0.64997	1.995	0.09310	N	1	B	0.27416	0.178	B	0.35039	0.194	T	0.48703	-0.9012	9	0.02654	T	1	.	5.7821	0.18312	0.1012:0.0:0.7095:0.1893	.	3659	P20930	FILA_HUMAN	Y	3659	ENSP00000357789:S3659Y	ENSP00000357789:S3659Y	S	-	2	0	FLG	150543010	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.583000	0.23849	0.561000	0.29186	0.552000	0.68991	TCC	.	.	weak		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CDC27	996	hgsc.bcm.edu	37	17	45219311	45219311	+	Missense_Mutation	SNP	T	T	C	rs140737545		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:45219311T>C	ENST00000066544.3	-	12	1552	c.1459A>G	c.(1459-1461)Att>Gtt	p.I487V	CDC27_ENST00000446365.2_Missense_Mutation_p.I426V|CDC27_ENST00000527547.1_Missense_Mutation_p.I486V|CDC27_ENST00000531206.1_Missense_Mutation_p.I493V	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	487					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGGCTCAAAATATTTATAGCT	0.383																																					p.I493V		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,0,20	CDC27	337	20	0			c.A1477G						scavenged	.						112.0	118.0	116.0					17																	45219311		2203	4299	6502	SO:0001583	missense	996	exon12			TCAAAATATTTAT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1459A>G	17.37:g.45219311T>C	ENSP00000066544:p.Ile487Val	Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	39	8	0.205128	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	4.731	0.135890	0.09032	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77	5.92	3.6	0.41247	.	0.089833	0.85682	D	0.000000	T	0.53384	0.1793	L	0.31476	0.935	0.49798	D	0.999821	B;B;B;B	0.23316	0.05;0.083;0.083;0.024	B;B;B;B	0.17098	0.008;0.017;0.017;0.005	T	0.44590	-0.9318	10	0.02654	T	1	-23.2923	6.9274	0.24422	0.0:0.0792:0.1504:0.7704	.	426;486;493;487	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	V	487;493;426;486	ENSP00000066544:I487V;ENSP00000434614:I493V;ENSP00000392802:I426V;ENSP00000437339:I486V	ENSP00000066544:I487V	I	-	1	0	CDC27	42574310	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.907000	0.63300	1.072000	0.40860	0.528000	0.53228	ATT	.	.	weak		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
GRID1	2894	hgsc.bcm.edu	37	10	87615870	87615870	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:87615870C>T	ENST00000327946.7	-	7	1114	c.1029G>A	c.(1027-1029)tgG>tgA	p.W343*		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	343					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CCATGCTATGCCACTTCCGGT	0.522										Multiple Myeloma(13;0.14)																											p.W343X		Atlas-SNP	.											.	GRID1	204	.	0			c.G1029A						PASS	.						137.0	112.0	120.0					10																	87615870		2203	4300	6503	SO:0001587	stop_gained	2894	exon7			GCTATGCCACTTC	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1029G>A	10.37:g.87615870C>T	ENSP00000330148:p.Trp343*	Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	138	57	0.413043	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Nonsense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	C	38	7.285199	0.98186	.	.	ENSG00000182771	ENST00000327946	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	18.0162	0.89241	0.0:1.0:0.0:0.0	.	.	.	.	X	343	.	ENSP00000330148:W343X	W	-	3	0	GRID1	87605850	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.811000	0.86092	2.501000	0.84356	0.655000	0.94253	TGG	.	.	none		0.522	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
VWF	7450	hgsc.bcm.edu	37	12	6125705	6125705	+	Missense_Mutation	SNP	C	C	T	rs373074982		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:6125705C>T	ENST00000261405.5	-	30	5542	c.5288G>A	c.(5287-5289)cGg>cAg	p.R1763Q		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1763	VWFA 3; main binding site for collagens type I and III. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GCCTCCCTCCCGCTGCATGAC	0.547																																					p.R1763Q		Atlas-SNP	.											VWF,NS,carcinoma,+1,1	VWF	338	1	0			c.G5288A						scavenged	.	C	GLN/ARG	0,4406		0,0,2203	44.0	40.0	42.0		5288	-6.7	0.3	12		42	1,8595		0,1,4297	no	missense	VWF	NM_000552.3	43	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	benign	1763/2814	6125705	1,13001	2203	4298	6501	SO:0001583	missense	7450	exon30			CCCTCCCGCTGCA		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.5288G>A	12.37:g.6125705C>T	ENSP00000261405:p.Arg1763Gln	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	112	4	0.0357143	NM_000552	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	.	11.16	1.555924	0.27827	0.0	1.16E-4	ENSG00000110799	ENST00000261405	T	0.77229	-1.08	4.34	-6.71	0.01760	von Willebrand factor, type A (3);	0.826641	0.10191	N	0.704579	T	0.55386	0.1917	N	0.17594	0.5	0.28115	N	0.930832	B	0.09022	0.002	B	0.06405	0.002	T	0.36163	-0.9759	10	0.27785	T	0.31	.	9.3941	0.38392	0.0993:0.1777:0.0:0.723	.	1763	P04275	VWF_HUMAN	Q	1763	ENSP00000261405:R1763Q	ENSP00000261405:R1763Q	R	-	2	0	VWF	5995966	0.002000	0.14202	0.340000	0.25575	0.710000	0.40934	-0.563000	0.05943	-1.163000	0.02793	0.555000	0.69702	CGG	.	.	weak		0.547	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
ZNF462	58499	hgsc.bcm.edu	37	9	109689973	109689973	+	Silent	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:109689973G>T	ENST00000277225.5	+	3	4069	c.3780G>T	c.(3778-3780)acG>acT	p.T1260T	ZNF462_ENST00000457913.1_Silent_p.T1260T|ZNF462_ENST00000441147.2_Silent_p.T105T			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1260					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T1260T(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GGGACAAAACGAAACTCCGAG	0.542																																					p.T1260T		Atlas-SNP	.											ZNF462,rectum,carcinoma,0,1	ZNF462	322	1	1	Substitution - coding silent(1)	large_intestine(1)	c.G3780T						PASS	.						154.0	162.0	159.0					9																	109689973		2203	4300	6503	SO:0001819	synonymous_variant	58499	exon3			CAAAACGAAACTC	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3780G>T	9.37:g.109689973G>T		Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	71	28	0.394366	NM_021224	Q5T0T4|Q8N408	Silent	SNP	ENST00000277225.5	37	CCDS35096.1																																																																																			.	.	none		0.542	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
TDRD10	126668	hgsc.bcm.edu	37	1	154519897	154519897	+	Missense_Mutation	SNP	C	C	T	rs372155332		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:154519897C>T	ENST00000368480.3	+	12	1050	c.965C>T	c.(964-966)tCg>tTg	p.S322L	TDRD10_ENST00000368482.4_Missense_Mutation_p.S322L|TDRD10_ENST00000479937.1_3'UTR			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	322							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.S322L(2)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			ATTTTGAGTTCGTATGAGGTT	0.517																																					p.S322L		Atlas-SNP	.											TDRD10,caecum,carcinoma,0,2	TDRD10	48	2	2	Substitution - Missense(2)	large_intestine(2)	c.C965T						scavenged	.	C	LEU/SER,LEU/SER	0,4406		0,0,2203	188.0	143.0	158.0		965,965	3.2	0.0	1		158	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TDRD10	NM_182499.3,NM_001098475.1	145,145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	322/352,322/367	154519897	1,13005	2203	4300	6503	SO:0001583	missense	126668	exon12			TGAGTTCGTATGA	AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.965C>T	1.37:g.154519897C>T	ENSP00000357465:p.Ser322Leu	Somatic	231	0	0		WXS	Illumina HiSeq	Phase_I	228	3	0.0131579	NM_182499	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	ENST00000368480.3	37	CCDS41406.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.161244	0.78226	0.0	1.16E-4	ENSG00000163239	ENST00000368482;ENST00000368480	T;T	0.37235	1.24;1.21	5.08	3.17	0.36434	.	0.133058	0.32503	N	0.006013	T	0.05273	0.0140	N	0.19112	0.55	0.09310	N	1	B;B	0.24132	0.059;0.098	B;B	0.16722	0.013;0.016	T	0.40590	-0.9555	10	0.05721	T	0.95	-1.2775	6.7139	0.23292	0.0:0.7261:0.1792:0.0947	.	322;322	Q5VZ19;Q5VZ19-2	TDR10_HUMAN;.	L	322	ENSP00000357467:S322L;ENSP00000357465:S322L	ENSP00000357465:S322L	S	+	2	0	TDRD10	152786521	0.000000	0.05858	0.001000	0.08648	0.453000	0.32348	0.436000	0.21526	0.708000	0.31955	0.655000	0.94253	TCG	.	.	none		0.517	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499	
LRRC16B	90668	hgsc.bcm.edu	37	14	24534335	24534335	+	Silent	SNP	A	A	C	rs8020089		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:24534335A>C	ENST00000342740.5	+	33	3403	c.3249A>C	c.(3247-3249)ccA>ccC	p.P1083P	LRRC16B_ENST00000334420.7_Silent_p.P179P	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	1083	Pro-rich.					cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		CTCCACCCCCACCCCCTCCCC	0.701																																					p.P1083P		Atlas-SNP	.											LRRC16B,NS,carcinoma,0,1	LRRC16B	120	1	0			c.A3249C						scavenged	.						3.0	4.0	4.0					14																	24534335		1256	2763	4019	SO:0001819	synonymous_variant	90668	exon33			ACCCCCACCCCCT	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.3249A>C	14.37:g.24534335A>C		Somatic	70	18	0.257143		WXS	Illumina HiSeq	Phase_I	66	21	0.318182	NM_138360	Q8TEF7|Q96HS9	Silent	SNP	ENST00000342740.5	37	CCDS32054.1																																																																																			.	.	weak		0.701	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
FCRL5	83416	hgsc.bcm.edu	37	1	157494098	157494098	+	Missense_Mutation	SNP	C	C	T	rs182413546		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:157494098C>T	ENST00000361835.3	-	10	2367	c.2210G>A	c.(2209-2211)cGc>cAc	p.R737H	FCRL5_ENST00000461387.1_5'Flank|FCRL5_ENST00000368191.3_Missense_Mutation_p.R652H|FCRL5_ENST00000356953.4_Missense_Mutation_p.R737H|FCRL5_ENST00000368190.3_Missense_Mutation_p.R737H	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	737	Ig-like C2-type 7.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CATCTCACTGCGCTGGGCCTC	0.562													c|||	1	0.000199681	0.0	0.0014	5008	,	,		20570	0.0		0.0	False		,,,				2504	0.0				p.R737H		Atlas-SNP	.											FCRL5,right_upper_lobe,carcinoma,-1,1	FCRL5	177	1	0			c.G2210A						scavenged	.						51.0	55.0	53.0					1																	157494098		2203	4300	6503	SO:0001583	missense	83416	exon10			TCACTGCGCTGGG	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2210G>A	1.37:g.157494098C>T	ENSP00000354691:p.Arg737His	Somatic	339	0	0		WXS	Illumina HiSeq	Phase_I	311	4	0.0128617	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	10.07	1.249286	0.22880	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191	T;T;T;T	0.03496	3.91;3.91;3.91;3.91	4.83	-9.65	0.00537	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00754	0.0025	L	0.33710	1.025	0.09310	N	1	B;B;B;B	0.29378	0.206;0.243;0.061;0.061	B;B;B;B	0.28232	0.052;0.087;0.072;0.049	T	0.31024	-0.9958	9	0.29301	T	0.29	.	8.5595	0.33503	0.13:0.2841:0.0:0.5859	.	652;737;737;737	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9	.;.;.;FCRL5_HUMAN	H	737;737;737;652	ENSP00000354691:R737H;ENSP00000349434:R737H;ENSP00000357173:R737H;ENSP00000357174:R652H	ENSP00000349434:R737H	R	-	2	0	FCRL5	155760722	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.872000	0.00720	-2.855000	0.00329	-0.142000	0.14014	CGC	C|1.000;T|0.000	0.000	strong		0.562	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
SDHAF2	54949	hgsc.bcm.edu	37	11	61205178	61205178	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:61205178C>T	ENST00000543265.1	+	2	121	c.118C>T	c.(118-120)Cca>Tca	p.P40S	SDHAF2_ENST00000534878.1_Missense_Mutation_p.P40S|RP11-286N22.8_ENST00000544880.1_3'UTR|SDHAF2_ENST00000542074.1_Intron|SDHAF2_ENST00000537782.1_Missense_Mutation_p.P40S|RP11-286N22.8_ENST00000543044.1_Missense_Mutation_p.P28S|SDHAF2_ENST00000301761.2_Missense_Mutation_p.P40S					succinate dehydrogenase complex assembly factor 2											large_intestine(3)|lung(4)|ovary(2)	9						AGGTGACAGCCCAACAGATTC	0.468																																					p.P40S		Atlas-SNP	.											.	SDHAF2	26	.	0			c.C118T						PASS	.						179.0	177.0	177.0					11																	61205178		2202	4299	6501	SO:0001583	missense	54949	exon2			GACAGCCCAACAG	AK000494	CCDS8007.1	11q12.2	2014-09-17	2009-08-10	2009-08-10	ENSG00000167985	ENSG00000167985		"""Mitochondrial respiratory chain complex assembly factors"""	26034	protein-coding gene	gene with protein product		613019	"""paraganglioma or familial glomus tumors 2"", ""chromosome 11 open reading frame 79"""	PGL2, C11orf79		19628817	Standard	NM_017841		Approved	FLJ20487, SDH5	uc001nrt.3	Q9NX18	OTTHUMG00000168279	ENST00000543265.1:c.118C>T	11.37:g.61205178C>T	ENSP00000443660:p.Pro40Ser	Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	171	78	0.45614	NM_017841		Missense_Mutation	SNP	ENST00000543265.1	37		.	.	.	.	.	.	.	.	.	.	C	16.56	3.156855	0.57259	.	.	ENSG00000256591;ENSG00000167985;ENSG00000167985	ENST00000541135;ENST00000301761;ENST00000543265	T;T;T	0.78126	-1.14;-1.1;-1.15	5.87	2.88	0.33553	.	0.155706	0.64402	D	0.000017	T	0.70798	0.3265	M	0.76002	2.32	0.42212	D	0.991818	P	0.35077	0.483	B	0.30943	0.122	T	0.64605	-0.6368	10	0.37606	T	0.19	-2.9957	6.0537	0.19799	0.2891:0.5695:0.0:0.1414	.	40	Q9NX18	SDHF2_HUMAN	S	40	ENSP00000443130:P40S;ENSP00000301761:P40S;ENSP00000443660:P40S	ENSP00000440939:P40S	P	+	1	0	SDHAF2;RP11-286N22.8	60961754	0.999000	0.42202	0.990000	0.47175	0.952000	0.60782	2.180000	0.42537	0.415000	0.25817	0.655000	0.94253	CCA	.	.	none		0.468	SDHAF2-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000398484.1	NM_017841	
MPP7	143098	hgsc.bcm.edu	37	10	28412969	28412969	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:28412969T>C	ENST00000375732.1	-	8	865	c.606A>G	c.(604-606)atA>atG	p.I202M	MPP7_ENST00000375719.3_Missense_Mutation_p.I202M|MPP7_ENST00000540098.1_Missense_Mutation_p.I202M|MPP7_ENST00000445954.2_Missense_Mutation_p.I77M|MPP7_ENST00000337532.5_Missense_Mutation_p.I202M|MPP7_ENST00000481244.1_5'Flank			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	202	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						CCAAAATCTGTATTATTTCCT	0.343																																					p.I202M		Atlas-SNP	.											.	MPP7	60	.	0			c.A606G						PASS	.						85.0	88.0	87.0					10																	28412969		2203	4300	6503	SO:0001583	missense	143098	exon10			AATCTGTATTATT	BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.606A>G	10.37:g.28412969T>C	ENSP00000364884:p.Ile202Met	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	51	19	0.372549	NM_173496	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Missense_Mutation	SNP	ENST00000375732.1	37	CCDS7158.1	.	.	.	.	.	.	.	.	.	.	T	17.80	3.477566	0.63849	.	.	ENSG00000150054	ENST00000375732;ENST00000337532;ENST00000540098;ENST00000375719;ENST00000445954	T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64	5.58	1.86	0.25419	PDZ/DHR/GLGF (4);	0.039978	0.85682	D	0.000000	T	0.44746	0.1308	M	0.69358	2.11	0.58432	D	0.999999	D	0.58620	0.983	D	0.64321	0.924	T	0.17228	-1.0376	10	0.32370	T	0.25	.	8.3462	0.32275	0.1678:0.0:0.1068:0.7254	.	202	Q5T2T1	MPP7_HUMAN	M	202;202;202;202;77	ENSP00000364884:I202M;ENSP00000337907:I202M;ENSP00000438693:I202M;ENSP00000364871:I202M;ENSP00000405397:I77M	ENSP00000337907:I202M	I	-	3	3	MPP7	28452975	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	1.284000	0.33249	0.117000	0.18138	0.454000	0.30748	ATA	.	.	none		0.343	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047345.1	NM_173496	
EPHB3	2049	hgsc.bcm.edu	37	3	184290807	184290807	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:184290807G>A	ENST00000330394.2	+	3	1151	c.699G>A	c.(697-699)tcG>tcA	p.S233S	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	233	Cys-rich.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			AGCCCACCTCGCTGGTCATTG	0.632																																					p.S233S		Atlas-SNP	.											.	EPHB3	114	.	0			c.G699A						PASS	.						53.0	59.0	57.0					3																	184290807		2203	4299	6502	SO:0001819	synonymous_variant	2049	exon3			CACCTCGCTGGTC	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.699G>A	3.37:g.184290807G>A		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	139	45	0.323741	NM_004443	Q7Z740	Silent	SNP	ENST00000330394.2	37	CCDS3268.1																																																																																			.	.	none		0.632	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443	
DMP1	1758	hgsc.bcm.edu	37	4	88580612	88580612	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:88580612A>C	ENST00000339673.6	+	5	264	c.165A>C	c.(163-165)aaA>aaC	p.K55N	DMP1_ENST00000282479.7_Intron|RP11-742B18.1_ENST00000506814.1_RNA|RP11-742B18.1_ENST00000506480.1_RNA|RP11-742B18.1_ENST00000507894.1_RNA	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	55					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		AAGGCAGTAAAGTTAGCTCAG	0.358																																					p.K55N		Atlas-SNP	.											.	DMP1	72	.	0			c.A165C						PASS	.						102.0	109.0	107.0					4																	88580612		2203	4300	6503	SO:0001583	missense	1758	exon5			CAGTAAAGTTAGC	U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.165A>C	4.37:g.88580612A>C	ENSP00000340935:p.Lys55Asn	Somatic	217	0	0		WXS	Illumina HiSeq	Phase_I	175	61	0.348571	NM_004407	A1L4L3|O43265	Missense_Mutation	SNP	ENST00000339673.6	37	CCDS3623.1	.	.	.	.	.	.	.	.	.	.	A	10.51	1.371693	0.24771	.	.	ENSG00000152592	ENST00000339673	T	0.52754	0.65	6.07	4.86	0.63082	.	0.309128	0.27787	N	0.017854	T	0.53045	0.1772	L	0.32530	0.975	0.80722	D	1	D	0.64830	0.994	D	0.63793	0.918	T	0.52313	-0.8592	10	0.51188	T	0.08	-8.5836	10.2286	0.43241	0.8335:0.1665:0.0:0.0	.	55	Q13316	DMP1_HUMAN	N	55	ENSP00000340935:K55N	ENSP00000340935:K55N	K	+	3	2	DMP1	88799636	1.000000	0.71417	0.987000	0.45799	0.071000	0.16799	1.915000	0.39976	1.066000	0.40716	0.533000	0.62120	AAA	.	.	none		0.358	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253047.1		
MUC17	140453	hgsc.bcm.edu	37	7	100680017	100680017	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:100680017A>G	ENST00000306151.4	+	3	5384	c.5320A>G	c.(5320-5322)Att>Gtt	p.I1774V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1774	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGCAACTCCTATTGACACCAG	0.493																																					p.I1774V		Atlas-SNP	.											MUC17,right_lower_lobe,carcinoma,-1,1	MUC17	804	1	0			c.A5320G						scavenged	.						279.0	291.0	287.0					7																	100680017		2203	4300	6503	SO:0001583	missense	140453	exon3			ACTCCTATTGACA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5320A>G	7.37:g.100680017A>G	ENSP00000302716:p.Ile1774Val	Somatic	97	3	0.0309278		WXS	Illumina HiSeq	Phase_I	166	4	0.0240964	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	g	0.003	-2.528736	0.00147	.	.	ENSG00000169876	ENST00000306151	T	0.01933	4.55	0.932	-1.86	0.07760	.	.	.	.	.	T	0.01124	0.0037	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42982	-0.9419	9	0.11794	T	0.64	.	4.2197	0.10552	0.2353:0.4114:0.3533:0.0	.	1774	Q685J3	MUC17_HUMAN	V	1774	ENSP00000302716:I1774V	ENSP00000302716:I1774V	I	+	1	0	MUC17	100466737	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.563000	0.00430	-4.292000	0.00058	-3.891000	0.00017	ATT	.	.	none		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
ERBB3	2065	hgsc.bcm.edu	37	12	56481846	56481846	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:56481846C>T	ENST00000267101.3	+	7	1214	c.774C>T	c.(772-774)cgC>cgT	p.R258R	ERBB3_ENST00000415288.2_Silent_p.R199R|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	258					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GTGTACCTCGCTGTCCACAGC	0.522																																					p.R258R		Atlas-SNP	.											ERBB3_ENST00000267101,NS,carcinoma,+2,2	ERBB3	350	2	0			c.C774T						scavenged	.						91.0	85.0	87.0					12																	56481846		2203	4300	6503	SO:0001819	synonymous_variant	2065	exon7			ACCTCGCTGTCCA	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.774C>T	12.37:g.56481846C>T		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	98	2	0.0204082	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Silent	SNP	ENST00000267101.3	37	CCDS31833.1																																																																																			.	.	none		0.522	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
PCNX	22990	hgsc.bcm.edu	37	14	71514637	71514637	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:71514637A>G	ENST00000304743.2	+	22	4720	c.4274A>G	c.(4273-4275)gAc>gGc	p.D1425G	PCNX_ENST00000238570.5_Missense_Mutation_p.D1425G|PCNX_ENST00000439984.3_Missense_Mutation_p.D1314G	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1425						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TTCAAATTTGACTATGAAGCT	0.358																																					p.D1425G		Atlas-SNP	.											PCNX,NS,carcinoma,+1,1	PCNX	198	1	0			c.A4274G						scavenged	.						171.0	153.0	159.0					14																	71514637		2202	4300	6502	SO:0001583	missense	22990	exon22			AATTTGACTATGA	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.4274A>G	14.37:g.71514637A>G	ENSP00000304192:p.Asp1425Gly	Somatic	236	0	0		WXS	Illumina HiSeq	Phase_I	378	5	0.0132275	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.45|17.45	3.392778|3.392778	0.62066|0.62066	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984|ENST00000554691	T;T;T|.	0.17528|.	2.74;2.27;2.41|.	5.32|5.32	4.16|4.16	0.48862|0.48862	.|.	0.147268|.	0.64402|.	N|.	0.000010|.	T|T	0.77831|0.77831	0.4189|0.4189	M|M	0.88775|0.88775	2.98|2.98	0.58432|0.58432	D|D	0.999999|0.999999	B;P;B|.	0.34780|.	0.016;0.468;0.009|.	B;B;B|.	0.32533|.	0.024;0.147;0.011|.	T|T	0.79769|0.79769	-0.1664|-0.1664	10|5	0.51188|.	T|.	0.08|.	.|.	11.3901|11.3901	0.49809|0.49809	0.9285:0.0:0.0715:0.0|0.9285:0.0:0.0715:0.0	.|.	1425;1314;1425|.	Q96RV3-3;B2RTR6;Q96RV3|.	.;.;PCX1_HUMAN|.	G|A	1425;1425;1314|484	ENSP00000304192:D1425G;ENSP00000238570:D1425G;ENSP00000396617:D1314G|.	ENSP00000238570:D1425G|.	D|T	+|+	2|1	0|0	PCNX|PCNX	70584390|70584390	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.287000|9.287000	0.95975|0.95975	0.951000|0.951000	0.37770|0.37770	0.482000|0.482000	0.46254|0.46254	GAC|ACT	.	.	none		0.358	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
MYO1F	4542	hgsc.bcm.edu	37	19	8601222	8601222	+	Missense_Mutation	SNP	C	C	T	rs199663368		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:8601222C>T	ENST00000338257.8	-	19	2224	c.1957G>A	c.(1957-1959)Gtc>Atc	p.V653I		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	653	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						AGGTGCTGGACGCCCTGGCGT	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		12969	0.001		0.0	False		,,,				2504	0.0				p.V653I		Atlas-SNP	.											.	MYO1F	128	.	0			c.G1957A						PASS	.						60.0	62.0	62.0					19																	8601222		2039	4212	6251	SO:0001583	missense	4542	exon19			GCTGGACGCCCTG	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.1957G>A	19.37:g.8601222C>T	ENSP00000344871:p.Val653Ile	Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	24	11	0.458333	NM_012335	Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	37	CCDS42494.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	13.83	2.353346	0.41700	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.87491	-2.26	4.51	3.44	0.39384	Myosin head, motor domain (2);	0.154695	0.42420	N	0.000713	T	0.79907	0.4527	L	0.35593	1.075	0.51012	D	0.9999	B	0.27823	0.19	B	0.26864	0.074	T	0.74850	-0.3524	10	0.39692	T	0.17	.	11.8667	0.52496	0.0:0.9123:0.0:0.0877	.	653	O00160	MYO1F_HUMAN	I	698;653	ENSP00000344871:V653I	ENSP00000304899:V698I	V	-	1	0	MYO1F	8507222	0.999000	0.42202	0.873000	0.34254	0.921000	0.55340	4.018000	0.57174	0.876000	0.35872	0.454000	0.30748	GTC	C|1.000;T|0.000	0.000	strong		0.632	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
PTPN4	5775	hgsc.bcm.edu	37	2	120725435	120725435	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:120725435G>A	ENST00000263708.2	+	26	3352	c.2581G>A	c.(2581-2583)Gtt>Att	p.V861I	PTPN4_ENST00000544261.1_Missense_Mutation_p.V494I	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	861	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	AAGAACTGGGGTTCTTATTAC	0.378																																					p.V861I		Atlas-SNP	.											.	PTPN4	89	.	0			c.G2581A						PASS	.						160.0	160.0	160.0					2																	120725435		2203	4300	6503	SO:0001583	missense	5775	exon26			ACTGGGGTTCTTA		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.2581G>A	2.37:g.120725435G>A	ENSP00000263708:p.Val861Ile	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	52	19	0.365385	NM_002830	B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	CCDS2129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.437199|5.437199	0.96168|0.96168	.|.	.|.	ENSG00000088179|ENSG00000088179	ENST00000441089|ENST00000263708;ENST00000544261	T|T;T	0.29142|0.15256	1.58|2.44;2.44	5.2|5.2	5.2|5.2	0.72013|0.72013	.|Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.34542|0.34542	0.0901|0.0901	M|M	0.88906|0.88906	2.99|2.99	0.80722|0.80722	D|D	1|1	.|B	.|0.26876	.|0.162	.|B	.|0.32342	.|0.144	T|T	0.37407|0.37407	-0.9707|-0.9707	7|10	0.87932|0.87932	D|D	0|0	.|.	18.7366|18.7366	0.91757|0.91757	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|861	.|P29074	.|PTN4_HUMAN	D|I	144|861;494	ENSP00000394706:G144D|ENSP00000263708:V861I;ENSP00000445841:V494I	ENSP00000394706:G144D|ENSP00000263708:V861I	G|V	+|+	2|1	0|0	PTPN4|PTPN4	120441905|120441905	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.756000|9.756000	0.98918|0.98918	2.426000|2.426000	0.82243|0.82243	0.585000|0.585000	0.79938|0.79938	GGT|GTT	.	.	none		0.378	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2		
SERPINH1	871	hgsc.bcm.edu	37	11	75277624	75277624	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:75277624C>T	ENST00000524558.1	+	2	1665	c.230C>T	c.(229-231)tCg>tTg	p.S77L	SERPINH1_ENST00000530284.1_Missense_Mutation_p.S77L|SERPINH1_ENST00000525876.1_5'Flank|SERPINH1_ENST00000358171.3_Missense_Mutation_p.S77L|SERPINH1_ENST00000533603.1_Missense_Mutation_p.S77L			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	77					chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					GTGGCCTCGTCGCTAGGGCTC	0.706																																					p.S77L		Atlas-SNP	.											.	SERPINH1	33	.	0			c.C230T						PASS	.						45.0	32.0	36.0					11																	75277624		2197	4292	6489	SO:0001583	missense	871	exon2			CCTCGTCGCTAGG	X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.230C>T	11.37:g.75277624C>T	ENSP00000434412:p.Ser77Leu	Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	12	5	0.416667	NM_001235	B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Missense_Mutation	SNP	ENST00000524558.1	37	CCDS8239.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598021	0.87055	.	.	ENSG00000149257	ENST00000533603;ENST00000358171;ENST00000526242;ENST00000526397;ENST00000421448;ENST00000529643;ENST00000530284;ENST00000532356;ENST00000524558;ENST00000528990;ENST00000533449;ENST00000525611;ENST00000528760	D;D;D;D;D;D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.28	5.28	0.74379	Serpin domain (3);	0.055957	0.64402	D	0.000001	D	0.91405	0.7288	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.65010	0.931;0.931	D	0.92387	0.5918	10	0.87932	D	0	.	16.4242	0.83809	0.0:1.0:0.0:0.0	.	77;77	E9PPV6;P50454	.;SERPH_HUMAN	L	77;77;52;77;77;77;77;77;77;77;77;77;77	ENSP00000434657:S77L;ENSP00000350894:S77L;ENSP00000431384:S52L;ENSP00000434964:S77L;ENSP00000435936:S77L;ENSP00000436305:S77L;ENSP00000436040:S77L;ENSP00000434412:S77L;ENSP00000431827:S77L;ENSP00000435452:S77L;ENSP00000437108:S77L	ENSP00000350894:S77L	S	+	2	0	SERPINH1	74955272	1.000000	0.71417	0.874000	0.34290	0.562000	0.35680	7.731000	0.84895	2.470000	0.83445	0.563000	0.77884	TCG	.	.	none		0.706	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383610.1	NM_004353	
LTV1	84946	hgsc.bcm.edu	37	6	144171346	144171346	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:144171346C>T	ENST00000367576.5	+	4	522	c.388C>T	c.(388-390)Cca>Tca	p.P130S		NM_032860.3	NP_116249.2	Q96GA3	LTV1_HUMAN	LTV1 ribosome biogenesis factor	130						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		TAAAGCAGCTCCAGTTTCAGG	0.318																																					p.P130S		Atlas-SNP	.											LTV1,NS,carcinoma,0,2	LTV1	48	2	0			c.C388T						scavenged	.						176.0	174.0	174.0					6																	144171346		2203	4300	6503	SO:0001583	missense	84946	exon4			GCAGCTCCAGTTT	BC009855	CCDS5201.1	6q24.2	2014-02-03	2014-02-03	2006-02-06	ENSG00000135521	ENSG00000135521			21173	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 93"", ""LTV1 homolog (S. cerevisiae)"""	C6orf93			Standard	NM_032860		Approved	FLJ14909, dJ468K18.4	uc003qjs.3	Q96GA3	OTTHUMG00000015733	ENST00000367576.5:c.388C>T	6.37:g.144171346C>T	ENSP00000356548:p.Pro130Ser	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	164	3	0.0182927	NM_032860	Q96JX8	Missense_Mutation	SNP	ENST00000367576.5	37	CCDS5201.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.260973	0.80246	.	.	ENSG00000135521	ENST00000367576	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.71392	0.3334	M	0.71581	2.175	0.80722	D	1	D	0.60575	0.988	P	0.59761	0.863	T	0.66060	-0.6017	9	0.32370	T	0.25	.	20.3409	0.98764	0.0:1.0:0.0:0.0	.	130	Q96GA3	LTV1_HUMAN	S	130	.	ENSP00000356548:P130S	P	+	1	0	LTV1	144213039	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	7.146000	0.77373	2.814000	0.96858	0.655000	0.94253	CCA	.	.	none		0.318	LTV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042532.1	NM_032860	
POM121	9883	hgsc.bcm.edu	37	7	72412427	72412427	+	Missense_Mutation	SNP	G	G	A	rs201876140		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:72412427G>A	ENST00000434423.2	+	11	1895	c.1895G>A	c.(1894-1896)aGc>aAc	p.S632N	POM121_ENST00000257622.4_Missense_Mutation_p.S367N|POM121_ENST00000395270.1_Missense_Mutation_p.S367N|POM121_ENST00000358357.3_Missense_Mutation_p.S367N|POM121_ENST00000446813.1_Missense_Mutation_p.S367N			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	632	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.S367N(2)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				AAGACACCCAGCCTCCTACCC	0.547																																					p.S367N		Atlas-SNP	.											POM121,NS,malignant_melanoma,0,2	POM121	131	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.G1100A						scavenged	.						3.0	3.0	3.0					7																	72412427		1270	2943	4213	SO:0001583	missense	9883	exon11			CACCCAGCCTCCT	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.1895G>A	7.37:g.72412427G>A	ENSP00000405562:p.Ser632Asn	Somatic	352	20	0.0568182		WXS	Illumina HiSeq	Phase_I	595	51	0.0857143	NM_172020	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000434423.2	37		.	.	.	.	.	.	.	.	.	.	G	7.496	0.651738	0.14516	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.08102	3.13;3.17;3.13;3.17;3.39	2.7	2.7	0.31948	.	0.155531	0.31257	N	0.007975	T	0.09862	0.0242	L	0.58969	1.84	0.43263	D	0.995207	P;P	0.36535	0.557;0.554	B;B	0.35971	0.215;0.157	T	0.12066	-1.0562	10	0.49607	T	0.09	.	10.9555	0.47356	0.0:0.0:1.0:0.0	.	367;632	A8MXF9;Q96HA1	.;P121A_HUMAN	N	367;367;367;367;632	ENSP00000393020:S367N;ENSP00000257622:S367N;ENSP00000378687:S367N;ENSP00000351124:S367N;ENSP00000405562:S632N	ENSP00000257622:S367N	S	+	2	0	POM121	72050363	0.502000	0.26107	0.893000	0.35052	0.018000	0.09664	1.430000	0.34914	1.503000	0.48686	0.173000	0.16961	AGC	.	.	weak		0.547	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
TMEM201	199953	hgsc.bcm.edu	37	1	9670573	9670573	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:9670573C>T	ENST00000340381.6	+	9	1484	c.1475C>T	c.(1474-1476)tCt>tTt	p.S492F	TMEM201_ENST00000377376.4_Missense_Mutation_p.S468F	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	492	Ser-rich.				fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		GATTACTTCTCTCTTCTGTCG	0.607																																					p.S492F		Atlas-SNP	.											.	TMEM201	63	.	0			c.C1475T						PASS	.						17.0	16.0	16.0					1																	9670573		692	1590	2282	SO:0001583	missense	199953	exon9			ACTTCTCTCTTCT		CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.1475C>T	1.37:g.9670573C>T	ENSP00000344503:p.Ser492Phe	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	39	14	0.358974	NM_001130924	B9EH90|Q5SNT3	Missense_Mutation	SNP	ENST00000340381.6	37	CCDS44055.2	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644780	0.67358	.	.	ENSG00000188807	ENST00000377376;ENST00000340381	.	.	.	4.98	4.98	0.66077	.	0.141592	0.49305	D	0.000154	T	0.51143	0.1657	L	0.32530	0.975	0.38522	D	0.948745	P	0.48834	0.916	P	0.49953	0.627	T	0.56165	-0.8024	9	0.48119	T	0.1	-6.3899	13.771	0.63023	0.0:0.847:0.153:0.0	.	468	E9PBR6	.	F	468;492	.	ENSP00000344503:S492F	S	+	2	0	TMEM201	9593160	1.000000	0.71417	0.996000	0.52242	0.737000	0.42083	5.405000	0.66351	2.312000	0.78011	0.561000	0.74099	TCT	.	.	none		0.607	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127672.1	NM_001010866	
FAM171A1	221061	hgsc.bcm.edu	37	10	15255310	15255310	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:15255310A>G	ENST00000378116.4	-	8	2283	c.2277T>C	c.(2275-2277)gcT>gcC	p.A759A	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	759						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GCAGAGACAAAGCATCTCCCC	0.547																																					p.A759A		Atlas-SNP	.											FAM171A1,caecum,carcinoma,-1,1	FAM171A1	252	1	0			c.T2277C						scavenged	.						123.0	84.0	97.0					10																	15255310		2203	4300	6503	SO:0001819	synonymous_variant	221061	exon8			AGACAAAGCATCT	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2277T>C	10.37:g.15255310A>G		Somatic	164	0	0		WXS	Illumina HiSeq	Phase_I	203	4	0.0197044	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	ENST00000378116.4	37	CCDS31154.1																																																																																			.	.	none		0.547	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
KRTAP19-5	337972	hgsc.bcm.edu	37	21	31874363	31874363	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr21:31874363C>T	ENST00000334151.2	-	1	72	c.46G>A	c.(46-48)Gga>Aga	p.G16R		NM_181611.1	NP_853642.1	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	16						intermediate filament (GO:0005882)		p.G16R(1)		endometrium(1)|large_intestine(5)|lung(4)|pancreas(1)|prostate(1)	12						TCGAAGCCTCCGTAGCCGTAG	0.577																																					p.G16R		Atlas-SNP	.											KRTAP19-5,NS,carcinoma,0,1	KRTAP19-5	32	1	1	Substitution - Missense(1)	endometrium(1)	c.G46A						scavenged	.						143.0	121.0	128.0					21																	31874363		2203	4300	6503	SO:0001583	missense	337972	exon1			AGCCTCCGTAGCC	AP001708	CCDS13597.1	21q22.1	2006-03-13			ENSG00000186977	ENSG00000186977		"""Keratin associated proteins"""	18940	protein-coding gene	gene with protein product						12359730	Standard	NM_181611		Approved	KAP19.5	uc011ada.2	Q3LI72	OTTHUMG00000057774	ENST00000334151.2:c.46G>A	21.37:g.31874363C>T	ENSP00000334985:p.Gly16Arg	Somatic	151	1	0.00662252		WXS	Illumina HiSeq	Phase_I	129	4	0.0310078	NM_181611	A4IF22	Missense_Mutation	SNP	ENST00000334151.2	37	CCDS13597.1	.	.	.	.	.	.	.	.	.	.	C	6.390	0.439985	0.12104	.	.	ENSG00000186977	ENST00000334151	T	0.13901	2.55	4.61	-1.15	0.09709	.	1.410960	0.05750	N	0.603023	T	0.07954	0.0199	.	.	.	0.09310	N	1	P	0.37731	0.607	B	0.30646	0.118	T	0.30119	-0.9989	9	0.87932	D	0	1.2087	1.6256	0.02722	0.1512:0.3439:0.3157:0.1892	.	16	Q3LI72	KR195_HUMAN	R	16	ENSP00000334985:G16R	ENSP00000334985:G16R	G	-	1	0	KRTAP19-5	30796234	0.000000	0.05858	0.001000	0.08648	0.412000	0.31113	-0.228000	0.09114	-0.025000	0.13918	0.591000	0.81541	GGA	.	.	none		0.577	KRTAP19-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128226.2		
MLLT4	4301	hgsc.bcm.edu	37	6	168369872	168369872	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:168369872C>T	ENST00000447894.2	+	32	5315	c.5315C>T	c.(5314-5316)tCt>tTt	p.S1772F	MLLT4_ENST00000366806.2_Missense_Mutation_p.S1772F|MLLT4_ENST00000392112.1_Missense_Mutation_p.S1691F|MLLT4_ENST00000351017.4_Missense_Mutation_p.S1779F|MLLT4_ENST00000400822.3_Missense_Mutation_p.S1782F			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1772					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GAGAAGCGCTCTAAAAGGTAT	0.468			T	MLL	AL																																p.S1691F		Atlas-SNP	.		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4	351	.	0			c.C5072T						PASS	.						107.0	113.0	111.0					6																	168369872		1981	4159	6140	SO:0001583	missense	4301	exon31			AGCGCTCTAAAAG	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.5315C>T	6.37:g.168369872C>T	ENSP00000404595:p.Ser1772Phe	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	84	28	0.333333	NM_001207008	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37		.	.	.	.	.	.	.	.	.	.	C	14.91	2.676349	0.47886	.	.	ENSG00000130396	ENST00000351017;ENST00000366806;ENST00000392112;ENST00000400822;ENST00000447894	T;T;T;T;T	0.04862	3.69;3.79;3.54;3.69;3.69	4.81	2.97	0.34412	.	0.783620	0.11677	N	0.540149	T	0.03564	0.0102	M	0.72479	2.2	0.09310	N	1	B	0.31227	0.314	B	0.32342	0.144	T	0.34875	-0.9811	10	0.59425	D	0.04	-2.7937	8.6982	0.34310	0.0:0.6327:0.2889:0.0784	.	1782	P55196-5	.	F	1779;1772;1691;1782;1772	ENSP00000252692:S1779F;ENSP00000355771:S1772F;ENSP00000375960:S1691F;ENSP00000383623:S1782F;ENSP00000404595:S1772F	ENSP00000252692:S1779F	S	+	2	0	MLLT4	168112721	0.001000	0.12720	0.001000	0.08648	0.721000	0.41392	1.210000	0.32370	0.418000	0.25898	0.655000	0.94253	TCT	.	.	none		0.468	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
ENOX1	55068	hgsc.bcm.edu	37	13	43987001	43987001	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr13:43987001A>G	ENST00000261488.6	-	4	627	c.50T>C	c.(49-51)cTt>cCt	p.L17P	ENOX1_ENST00000412891.1_Missense_Mutation_p.L17P	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	17					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		CATCTGAGGAAGCTCCTGGGG	0.493																																					p.L17P		Atlas-SNP	.											.	ENOX1	158	.	0			c.T50C						PASS	.						126.0	112.0	116.0					13																	43987001		2203	4300	6503	SO:0001583	missense	55068	exon4			TGAGGAAGCTCCT	EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.50T>C	13.37:g.43987001A>G	ENSP00000261488:p.Leu17Pro	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	64	22	0.34375	NM_017993	A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	ENST00000261488.6	37	CCDS9389.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.452066	0.43531	.	.	ENSG00000120658	ENST00000261488;ENST00000412891	T;T	0.48201	0.82;0.82	5.91	5.91	0.95273	.	0.312364	0.26594	N	0.023508	T	0.27098	0.0664	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11348	-1.0591	10	0.32370	T	0.25	-3.7208	10.059	0.42263	0.9229:0.0:0.0771:0.0	.	17	Q8TC92	ENOX1_HUMAN	P	17	ENSP00000261488:L17P;ENSP00000415054:L17P	ENSP00000261488:L17P	L	-	2	0	ENOX1	42885001	0.998000	0.40836	0.997000	0.53966	0.989000	0.77384	2.011000	0.40922	2.254000	0.74563	0.533000	0.62120	CTT	.	.	none		0.493	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993	
NKAPL	222698	hgsc.bcm.edu	37	6	28227333	28227333	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:28227333G>A	ENST00000343684.3	+	1	236	c.184G>A	c.(184-186)Gct>Act	p.A62T	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	62										breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						GGACGTGGGCGCTCTTTACCC	0.622																																					p.A62T		Atlas-SNP	.											.	NKAPL	72	.	0			c.G184A						PASS	.						54.0	59.0	57.0					6																	28227333		2203	4300	6503	SO:0001583	missense	222698	exon1			GTGGGCGCTCTTT	BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.184G>A	6.37:g.28227333G>A	ENSP00000345716:p.Ala62Thr	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	80	44	0.55	NM_001007531	Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	ENST00000343684.3	37	CCDS34353.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944889	0.34283	.	.	ENSG00000189134	ENST00000343684	T	0.13778	2.56	4.21	-0.871	0.10642	.	1.031910	0.07675	N	0.936094	T	0.02342	0.0072	L	0.42245	1.32	0.09310	N	1	B	0.21147	0.052	B	0.08055	0.003	T	0.45862	-0.9232	10	0.08179	T	0.78	-0.4142	5.0106	0.14310	0.3089:0.3156:0.3754:0.0	.	62	Q5M9Q1	NKAPL_HUMAN	T	62	ENSP00000345716:A62T	ENSP00000345716:A62T	A	+	1	0	NKAPL	28335312	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.408000	0.21065	-0.318000	0.08665	-0.136000	0.14681	GCT	.	.	none		0.622	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040185.1		
VCAN	1462	hgsc.bcm.edu	37	5	82834917	82834917	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:82834917A>C	ENST00000265077.3	+	8	6660	c.6095A>C	c.(6094-6096)aAg>aCg	p.K2032T	VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.K1045T|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2032	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GCTGTGCAAAAGTTTTCTGGT	0.478																																					p.K2032T		Atlas-SNP	.											.	VCAN	498	.	0			c.A6095C						PASS	.						65.0	70.0	68.0					5																	82834917		2203	4300	6503	SO:0001583	missense	1462	exon8			TGCAAAAGTTTTC	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.6095A>C	5.37:g.82834917A>C	ENSP00000265077:p.Lys2032Thr	Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	103	44	0.427184	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.460599	0.26248	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.86865	-2.16;-2.18;3.01	5.39	-2.02	0.07388	.	1.361960	0.04546	N	0.389071	T	0.76723	0.4027	L	0.38175	1.15	0.09310	N	0.999999	B;B	0.30361	0.277;0.1	B;B	0.24394	0.053;0.024	T	0.58595	-0.7609	10	0.15499	T	0.54	.	4.4646	0.11682	0.5024:0.0:0.1504:0.3472	.	1045;2032	P13611-2;P13611	.;CSPG2_HUMAN	T	2032;1045;1045	ENSP00000265077:K2032T;ENSP00000340062:K1045T;ENSP00000426251:K1045T	ENSP00000265077:K2032T	K	+	2	0	VCAN	82870673	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.107000	0.15375	-0.896000	0.03915	-2.845000	0.00104	AAG	.	.	none		0.478	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
NR2E3	10002	hgsc.bcm.edu	37	15	72103180	72103180	+	RNA	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:72103180G>T	ENST00000398840.2	+	0	287							Q9Y5X4	NR2E3_HUMAN	nuclear receptor subfamily 2, group E, member 3						eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction (GO:0007602)|positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(1)	3						AGGCAGATGGGGCCTGGGGGA	0.642																																					p.G33C		Atlas-SNP	.											.	NR2E3	53	.	0			c.G97T						PASS	.						10.0	12.0	11.0					15																	72103180		1868	4092	5960			10002	exon1			AGATGGGGCCTGG		CCDS73750.1, CCDS73751.1	15q23	2013-01-16			ENSG00000031544	ENSG00000278570		"""Nuclear hormone receptors"""	7974	protein-coding gene	gene with protein product		604485				10220376	Standard	NM_016346		Approved	PNR, rd7, RP37	uc002ath.1	Q9Y5X4	OTTHUMG00000172841		15.37:g.72103180G>T		Somatic	260	0	0		WXS	Illumina HiSeq	Phase_I	283	64	0.226148	NM_016346	B6ZGU0|Q9UHM4	Missense_Mutation	SNP	ENST00000398840.2	37		.	.	.	.	.	.	.	.	.	.	G	12.04	1.817162	0.32145	.	.	ENSG00000031544	ENST00000398840	.	.	.	3.15	3.15	0.36227	.	0.163797	0.37393	N	0.002104	T	0.42787	0.1218	N	0.08118	0	0.43540	D	0.995838	D	0.76494	0.999	P	0.61201	0.885	T	0.59495	-0.7444	8	0.56958	D	0.05	.	12.1851	0.54234	0.0:0.0:1.0:0.0	.	33	Q9Y5X4	NR2E3_HUMAN	C	33	.	ENSP00000381820:G33C	G	+	1	0	NR2E3	69890234	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.240000	0.43088	2.037000	0.60232	0.655000	0.94253	GGC	.	.	none		0.642	NR2E3-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014249	
KCNJ5	3762	hgsc.bcm.edu	37	11	128781671	128781671	+	Missense_Mutation	SNP	T	T	C	rs386352318		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:128781671T>C	ENST00000338350.4	+	3	855	c.503T>C	c.(502-504)cTc>cCc	p.L168P	KCNJ5_ENST00000533599.1_Missense_Mutation_p.L168P|KCNJ5_ENST00000529694.1_Missense_Mutation_p.L168P			P48544	KCNJ5_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 5	168			L -> R (in APA; somatic mutation; recurrent mutation; results in loss of channel selectivity and membrane depolarization). {ECO:0000269|PubMed:21311022, ECO:0000269|PubMed:22203740, ECO:0000269|PubMed:22275527, ECO:0000269|PubMed:22848660}.		potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			NS(1)|breast(1)|endometrium(4)|large_intestine(4)|liver(2)|lung(9)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glyburide(DB01016)	ATTATACTCCTCTTGGTCCAG	0.537																																					p.L168P	Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)	Atlas-SNP	.											KCNJ5,adrenal_gland,adrenal_cortical_adenoma,0,173	KCNJ5	560	173	0			c.T503C						scavenged	.						156.0	159.0	158.0					11																	128781671		2201	4297	6498	SO:0001583	missense	3762	exon2			TACTCCTCTTGGT	D50134	CCDS8479.1	11q24	2014-09-17				ENSG00000120457		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6266	protein-coding gene	gene with protein product		600734				16382105	Standard	NM_000890		Approved	Kir3.4, CIR, KATP1, GIRK4, LQT13	uc001qet.3	P48544		ENST00000338350.4:c.503T>C	11.37:g.128781671T>C	ENSP00000339960:p.Leu168Pro	Somatic	219	0	0		WXS	Illumina HiSeq	Phase_I	268	3	0.011194	NM_000890	B2R744|Q6DK13|Q6DK14|Q92807	Missense_Mutation	SNP	ENST00000338350.4	37	CCDS8479.1	.	.	.	.	.	.	.	.	.	.	T	13.69	2.313251	0.40895	.	.	ENSG00000120457	ENST00000529694;ENST00000338350;ENST00000533599	D;D;D	0.95656	-3.77;-3.77;-3.77	5.46	5.46	0.80206	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.85682	D	0.000000	D	0.98131	0.9383	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99305	1.0902	10	0.87932	D	0	.	15.5352	0.75996	0.0:0.0:0.0:1.0	.	168	P48544	IRK5_HUMAN	P	168	ENSP00000433295:L168P;ENSP00000339960:L168P;ENSP00000434266:L168P	ENSP00000339960:L168P	L	+	2	0	KCNJ5	128286881	1.000000	0.71417	0.148000	0.22405	0.042000	0.13812	8.040000	0.89188	2.068000	0.61886	0.459000	0.35465	CTC	.	.	none		0.537	KCNJ5-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386239.1	NM_000890	
AUTS2	26053	hgsc.bcm.edu	37	7	70231244	70231244	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:70231244C>T	ENST00000342771.4	+	9	1934	c.1613C>T	c.(1612-1614)aCg>aTg	p.T538M	AUTS2_ENST00000406775.2_Missense_Mutation_p.T538M	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	538	His-rich.							p.T538M(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		caccagcacacgcaccagcac	0.667																																					p.T538M		Atlas-SNP	.											AUTS2,caecum,carcinoma,-1,2	AUTS2	173	2	1	Substitution - Missense(1)	endometrium(1)	c.C1613T						scavenged	.						286.0	266.0	273.0					7																	70231244		2203	4300	6503	SO:0001583	missense	26053	exon9			AGCACACGCACCA	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1613C>T	7.37:g.70231244C>T	ENSP00000344087:p.Thr538Met	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	163	2	0.0122699	NM_001127231	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	CCDS5539.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.626237|4.626237	0.87560|0.87560	.|.	.|.	ENSG00000158321|ENSG00000158321	ENST00000443672|ENST00000406775;ENST00000342771	.|T;T	.|0.53640	.|0.61;0.61	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	.|0.049222	.|0.85682	.|D	.|0.000000	T|T	0.66386|0.66386	0.2784|0.2784	L|L	0.52905|0.52905	1.665|1.665	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	T|T	0.61637|0.61637	-0.7022|-0.7022	5|9	.|.	.|.	.|.	-12.9426|-12.9426	19.9983|19.9983	0.97395|0.97395	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|538;538	.|Q8WXX7-2;Q8WXX7	.|.;AUTS2_HUMAN	C|M	80|538	.|ENSP00000385263:T538M;ENSP00000344087:T538M	.|.	R|T	+|+	1|2	0|0	AUTS2|AUTS2	69869180|69869180	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.994000|0.994000	0.84299|0.84299	7.433000|7.433000	0.80362|0.80362	2.724000|2.724000	0.93272|0.93272	0.561000|0.561000	0.74099|0.74099	CGC|ACG	.	.	none		0.667	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
GPRIN2	9721	hgsc.bcm.edu	37	10	46998893	46998893	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:46998893C>T	ENST00000374317.1	+	3	286	c.13C>T	c.(13-15)Cgc>Tgc	p.R5C	GPRIN2_ENST00000374314.4_Missense_Mutation_p.R5C	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	5			R -> H (in dbSNP:rs3127817). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9628581}.							breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						GAGCTCCAGCCGCCCCGAGCC	0.642																																					p.R5C		Atlas-SNP	.											GPRIN2,NS,carcinoma,-1,1	GPRIN2	94	1	0			c.C13T						scavenged	.						50.0	69.0	62.0					10																	46998893		2178	4262	6440	SO:0001583	missense	9721	exon3			TCCAGCCGCCCCG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.13C>T	10.37:g.46998893C>T	ENSP00000363436:p.Arg5Cys	Somatic	218	0	0		WXS	Illumina HiSeq	Phase_I	163	2	0.0122699	NM_014696	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.591664	0.46214	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03635	3.86;3.86	5.33	3.38	0.38709	.	1.094990	0.07068	N	0.834916	T	0.07413	0.0187	L	0.51422	1.61	0.29188	N	0.876053	D	0.67145	0.996	P	0.47705	0.555	T	0.28996	-1.0026	10	0.62326	D	0.03	-0.4433	8.1416	0.31086	0.0:0.7506:0.1592:0.0902	.	5	O60269	GRIN2_HUMAN	C	5	ENSP00000363436:R5C;ENSP00000363433:R5C	ENSP00000363433:R5C	R	+	1	0	GPRIN2	46418899	0.722000	0.28017	0.924000	0.36721	0.739000	0.42172	1.074000	0.30703	1.391000	0.46566	0.655000	0.94253	CGC	.	.	none		0.642	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
TTC21A	199223	hgsc.bcm.edu	37	3	39174704	39174704	+	Silent	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:39174704C>A	ENST00000431162.2	+	20	2879	c.2745C>A	c.(2743-2745)gtC>gtA	p.V915V	TTC21A_ENST00000493856.1_3'UTR|TTC21A_ENST00000301819.6_Silent_p.V916V|TTC21A_ENST00000440121.1_Silent_p.V867V			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	915										NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		ATAAGGATGTCTTCTCCTACT	0.507																																					p.V915V		Atlas-SNP	.											.	TTC21A	96	.	0			c.C2745A						PASS	.						86.0	88.0	87.0					3																	39174704		2044	4192	6236	SO:0001819	synonymous_variant	199223	exon20			GGATGTCTTCTCC	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.2745C>A	3.37:g.39174704C>A		Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	108	34	0.314815	NM_145755	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Silent	SNP	ENST00000431162.2	37	CCDS46800.1																																																																																			.	.	none		0.507	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755	
RC3H2	54542	hgsc.bcm.edu	37	9	125620209	125620209	+	Missense_Mutation	SNP	C	C	T	rs368828068		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:125620209C>T	ENST00000373670.1	-	12	3047	c.2447G>A	c.(2446-2448)cGt>cAt	p.R816H	RC3H2_ENST00000357244.2_Missense_Mutation_p.R816H|RC3H2_ENST00000423239.2_Missense_Mutation_p.R816H			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	816					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						TACATCCGCACGAAAGTCTAC	0.428																																					p.R816H		Atlas-SNP	.											RC3H2_ENST00000423239,NS,carcinoma,-1,2	RC3H2	150	2	0			c.G2447A						scavenged	.						136.0	137.0	137.0					9																	125620209		1992	4159	6151	SO:0001583	missense	54542	exon13			TCCGCACGAAAGT	AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.2447G>A	9.37:g.125620209C>T	ENSP00000362774:p.Arg816His	Somatic	202	0	0		WXS	Illumina HiSeq	Phase_I	160	4	0.025	NM_018835	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	ENST00000373670.1	37	CCDS43874.1	.	.	.	.	.	.	.	.	.	.	C	8.812	0.935409	0.18206	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239	T;T;T	0.44482	0.92;0.92;0.93	5.79	5.79	0.91817	.	0.393209	0.27759	N	0.017980	T	0.18635	0.0447	N	0.03608	-0.345	0.80722	D	1	B;B	0.33904	0.431;0.263	B;B	0.29862	0.108;0.07	T	0.19778	-1.0295	10	0.13108	T	0.6	-27.9101	12.544	0.56188	0.0:0.9211:0.0:0.0789	.	816;816	Q9HBD1;Q9HBD1-4	RC3H2_HUMAN;.	H	816;816;687;816	ENSP00000362774:R816H;ENSP00000349783:R816H;ENSP00000411767:R816H	ENSP00000349783:R816H	R	-	2	0	RC3H2	124660030	1.000000	0.71417	0.966000	0.40874	0.943000	0.58893	2.774000	0.47694	2.733000	0.93635	0.655000	0.94253	CGT	.	.	alt		0.428	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835	
ADAMTS15	170689	hgsc.bcm.edu	37	11	130343214	130343214	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:130343214T>C	ENST00000299164.2	+	8	2351	c.2351T>C	c.(2350-2352)cTc>cCc	p.L784P		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	784	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GTGGAGGTCCTCTCCGTGGGG	0.667																																					p.L784P		Atlas-SNP	.											ADAMTS15,NS,carcinoma,+1,1	ADAMTS15	103	1	0			c.T2351C						scavenged	.						62.0	67.0	65.0					11																	130343214		2201	4297	6498	SO:0001583	missense	170689	exon8			AGGTCCTCTCCGT	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2351T>C	11.37:g.130343214T>C	ENSP00000299164:p.Leu784Pro	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	133	3	0.0225564	NM_139055	Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	37	CCDS8488.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.183325	0.78677	.	.	ENSG00000166106	ENST00000299164	T	0.68181	-0.31	5.91	4.77	0.60923	ADAM-TS Spacer 1 (1);	.	.	.	.	D	0.84165	0.5412	M	0.91561	3.22	0.80722	D	1	D	0.71674	0.998	D	0.74674	0.984	D	0.86808	0.1996	9	0.87932	D	0	.	12.5366	0.56145	0.1249:0.0:0.0:0.8751	.	784	Q8TE58	ATS15_HUMAN	P	784	ENSP00000299164:L784P	ENSP00000299164:L784P	L	+	2	0	ADAMTS15	129848424	1.000000	0.71417	0.983000	0.44433	0.998000	0.95712	5.968000	0.70413	1.045000	0.40225	0.533000	0.62120	CTC	.	.	none		0.667	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055	
PEAR1	375033	hgsc.bcm.edu	37	1	156883019	156883019	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:156883019A>T	ENST00000338302.3	+	20	2681	c.2456A>T	c.(2455-2457)aAc>aTc	p.N819I	PEAR1_ENST00000292357.7_Missense_Mutation_p.N819I			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	819	Pro-rich.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TACTACTCCAACCCCAGCTAC	0.602																																					p.N819I		Atlas-SNP	.											.	PEAR1	118	.	0			c.A2456T						PASS	.						134.0	127.0	130.0					1																	156883019		2203	4300	6503	SO:0001583	missense	375033	exon19			ACTCCAACCCCAG	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.2456A>T	1.37:g.156883019A>T	ENSP00000344465:p.Asn819Ile	Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	108	50	0.462963	NM_001080471	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	A	30	5.050917	0.93740	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	D;D	0.92446	-3.04;-3.04	5.41	5.41	0.78517	.	0.000000	0.52532	D	0.000068	D	0.94568	0.8250	M	0.71036	2.16	0.54753	D	0.999983	D	0.89917	1.0	D	0.87578	0.998	D	0.95172	0.8291	10	0.72032	D	0.01	.	13.4467	0.61144	1.0:0.0:0.0:0.0	.	819	Q5VY43	PEAR1_HUMAN	I	819	ENSP00000344465:N819I;ENSP00000292357:N819I	ENSP00000292357:N819I	N	+	2	0	PEAR1	155149643	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.227000	0.89787	2.272000	0.75746	0.460000	0.39030	AAC	.	.	none		0.602	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
HCN4	10021	hgsc.bcm.edu	37	15	73616204	73616204	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:73616204G>T	ENST00000261917.3	-	8	3223	c.2230C>A	c.(2230-2232)Cag>Aag	p.Q744K		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	744					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TGCACAATCTGCTGGATGATC	0.617																																					p.Q744K		Atlas-SNP	.											.	HCN4	150	.	0			c.C2230A						PASS	.						65.0	71.0	69.0					15																	73616204		2198	4297	6495	SO:0001583	missense	10021	exon8			CAATCTGCTGGAT	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.2230C>A	15.37:g.73616204G>T	ENSP00000261917:p.Gln744Lys	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	77	6	0.0779221	NM_005477	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.138747	0.37728	.	.	ENSG00000138622	ENST00000261917	T	0.42900	0.96	3.46	3.46	0.39613	.	.	.	.	.	T	0.39091	0.1065	M	0.63843	1.955	0.37183	D	0.903603	B	0.25667	0.131	B	0.22386	0.039	T	0.41980	-0.9478	9	0.15499	T	0.54	.	15.125	0.72475	0.0:0.0:1.0:0.0	.	744	Q9Y3Q4	HCN4_HUMAN	K	744	ENSP00000261917:Q744K	ENSP00000261917:Q744K	Q	-	1	0	HCN4	71403257	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	3.267000	0.51577	1.761000	0.52028	0.313000	0.20887	CAG	.	.	none		0.617	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
LRRK1	79705	hgsc.bcm.edu	37	15	101605852	101605852	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:101605852C>T	ENST00000388948.3	+	32	5569	c.5210C>T	c.(5209-5211)aCg>aTg	p.T1737M	LRRK1_ENST00000284395.5_Missense_Mutation_p.T1734M|LRRK1_ENST00000532145.1_3'UTR|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TCCATGGTTACGTCAGTCGTG	0.617																																					p.T1737M		Atlas-SNP	.											LRRK1_ENST00000388948,NS,adenocarcinoma,0,3	LRRK1	310	3	0			c.C5210T						scavenged	.						66.0	78.0	74.0					15																	101605852		2111	4230	6341	SO:0001583	missense	79705	exon32			TGGTTACGTCAGT	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.5210C>T	15.37:g.101605852C>T	ENSP00000373600:p.Thr1737Met	Somatic	86	2	0.0232558		WXS	Illumina HiSeq	Phase_I	108	2	0.0185185	NM_024652		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	C	3.625	-0.076657	0.07184	.	.	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000529762;ENST00000542170	T;T	0.72725	-0.68;-0.68	5.7	1.81	0.25067	WD40 repeat-like-containing domain (1);	0.496080	0.24020	N	0.042298	T	0.51924	0.1703	L	0.33485	1.01	0.09310	N	1	P	0.34562	0.457	B	0.22152	0.038	T	0.38457	-0.9660	10	0.48119	T	0.1	.	8.9983	0.36066	0.0:0.5825:0.0:0.4175	.	1737	Q38SD2	LRRK1_HUMAN	M	1737;1734;428;291	ENSP00000373600:T1737M;ENSP00000284395:T1734M	ENSP00000284395:T1734M	T	+	2	0	LRRK1	99423375	0.006000	0.16342	0.004000	0.12327	0.001000	0.01503	1.086000	0.30853	0.088000	0.17205	-0.768000	0.03414	ACG	.	.	none		0.617	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
DOPEY2	9980	hgsc.bcm.edu	37	21	37665692	37665692	+	Silent	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr21:37665692C>A	ENST00000399151.3	+	37	6805	c.6720C>A	c.(6718-6720)atC>atA	p.I2240I		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	2240					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TTTCCAGCATCAGGCAGTTGA	0.458																																					p.I2240I		Atlas-SNP	.											DOPEY2,bladder,carcinoma,0,1	DOPEY2	184	1	0			c.C6720A						scavenged	.						88.0	82.0	84.0					21																	37665692		2203	4300	6503	SO:0001819	synonymous_variant	9980	exon37			CAGCATCAGGCAG	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.6720C>A	21.37:g.37665692C>A		Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	119	2	0.0168067	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	ENST00000399151.3	37	CCDS13643.1																																																																																			.	.	none		0.458	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
SLC1A7	6512	hgsc.bcm.edu	37	1	53569135	53569135	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:53569135G>T	ENST00000371494.4	-	5	707	c.580C>A	c.(580-582)Cat>Aat	p.H194N		NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7	194					dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		TTCTGCACATGGGAGCCATTC	0.627																																					p.H194N	NSCLC(128;80 1811 21245 38490 51715)	Atlas-SNP	.											.	SLC1A7	65	.	0			c.C580A						PASS	.						41.0	46.0	44.0					1																	53569135		2203	4300	6503	SO:0001583	missense	6512	exon5			GCACATGGGAGCC	U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.580C>A	1.37:g.53569135G>T	ENSP00000360549:p.His194Asn	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	90	34	0.377778	NM_006671	Q5VVZ0|Q969Z8|Q9BW45	Missense_Mutation	SNP	ENST00000371494.4	37	CCDS574.1	.	.	.	.	.	.	.	.	.	.	G	1.852	-0.464809	0.04476	.	.	ENSG00000162383	ENST00000371494	T	0.47528	0.84	4.82	3.84	0.44239	.	0.682012	0.15341	N	0.267509	T	0.21186	0.0510	N	0.01874	-0.695	0.22511	N	0.999034	B	0.02656	0.0	B	0.01281	0.0	T	0.07366	-1.0776	10	0.16896	T	0.51	-16.8183	12.8002	0.57582	0.0:0.0:0.7557:0.2443	.	194	O00341	EAA5_HUMAN	N	194	ENSP00000360549:H194N	ENSP00000360549:H194N	H	-	1	0	SLC1A7	53341723	0.170000	0.23016	0.077000	0.20336	0.232000	0.25224	3.331000	0.52075	2.346000	0.79739	0.563000	0.77884	CAT	.	.	none		0.627	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024746.1	NM_006671	
FBXO15	201456	hgsc.bcm.edu	37	18	71749236	71749236	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:71749236T>A	ENST00000419743.2	-	9	1268	c.1189A>T	c.(1189-1191)Aac>Tac	p.N397Y	FBXO15_ENST00000269500.5_Missense_Mutation_p.N321Y|FBXO15_ENST00000580806.1_5'UTR	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	397						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		TGTTCTCTGTTATTTTTTAAA	0.333																																					p.N397Y		Atlas-SNP	.											.	FBXO15	97	.	0			c.A1189T						PASS	.						103.0	97.0	99.0					18																	71749236		2203	4300	6503	SO:0001583	missense	201456	exon9			CTCTGTTATTTTT	AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.1189A>T	18.37:g.71749236T>A	ENSP00000393154:p.Asn397Tyr	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	187	30	0.160428	NM_001142958	B3KST3	Missense_Mutation	SNP	ENST00000419743.2	37	CCDS45884.1	.	.	.	.	.	.	.	.	.	.	T	8.465	0.856251	0.17106	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.47528	0.84;0.84	4.93	2.54	0.30619	.	0.737265	0.13656	N	0.371884	T	0.48995	0.1531	M	0.68317	2.08	0.09310	N	1	D;P	0.54397	0.966;0.883	P;P	0.48030	0.564;0.467	T	0.41680	-0.9495	10	0.72032	D	0.01	-25.5126	5.933	0.19150	0.0:0.1488:0.1391:0.7121	.	397;321	B3KST3;Q8NCQ5	.;FBX15_HUMAN	Y	321;397	ENSP00000269500:N321Y;ENSP00000393154:N397Y	ENSP00000269500:N321Y	N	-	1	0	FBXO15	69900216	0.987000	0.35691	0.111000	0.21465	0.029000	0.11900	1.114000	0.31196	0.329000	0.23460	-0.256000	0.11100	AAC	.	.	none		0.333	FBXO15-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000444223.1	NM_152676	
LAMA5	3911	hgsc.bcm.edu	37	20	60885315	60885315	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr20:60885315G>A	ENST00000252999.3	-	77	10719	c.10653C>T	c.(10651-10653)ccC>ccT	p.P3551P	LAMA5_ENST00000492698.1_5'Flank	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3551	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TGACTGCCAGGGGCCGCACCT	0.652																																					p.P3551P		Atlas-SNP	.											.	LAMA5	268	.	0			c.C10653T						PASS	.						33.0	39.0	37.0					20																	60885315		2201	4294	6495	SO:0001819	synonymous_variant	3911	exon77			TGCCAGGGGCCGC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.10653C>T	20.37:g.60885315G>A		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	47	18	0.382979	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	CCDS33502.1																																																																																			.	.	none		0.652	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
SORCS3	22986	hgsc.bcm.edu	37	10	106907486	106907486	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:106907486A>C	ENST00000369701.3	+	9	1641	c.1414A>C	c.(1414-1416)Act>Cct	p.T472P		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	472					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GATTTACTTCACTCTGGCCAT	0.463																																					p.T472P	NSCLC(116;1497 1690 7108 13108 14106)	Atlas-SNP	.											.	SORCS3	282	.	0			c.A1414C						PASS	.						235.0	188.0	204.0					10																	106907486		2203	4299	6502	SO:0001583	missense	22986	exon9			TACTTCACTCTGG	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1414A>C	10.37:g.106907486A>C	ENSP00000358715:p.Thr472Pro	Somatic	232	0	0		WXS	Illumina HiSeq	Phase_I	196	86	0.438776	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.698172	0.88830	.	.	ENSG00000156395	ENST00000369701	T	0.26067	1.76	5.42	5.42	0.78866	VPS10 (1);	0.051975	0.85682	D	0.000000	T	0.52741	0.1753	M	0.77616	2.38	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.58205	-0.7677	10	0.87932	D	0	.	15.7709	0.78167	1.0:0.0:0.0:0.0	.	472	Q9UPU3	SORC3_HUMAN	P	472	ENSP00000358715:T472P	ENSP00000358715:T472P	T	+	1	0	SORCS3	106897476	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.287000	0.95975	2.194000	0.70268	0.528000	0.53228	ACT	.	.	none		0.463	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
RUNX2	860	hgsc.bcm.edu	37	6	45390482	45390482	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:45390482C>G	ENST00000371438.1	+	2	569	c.211C>G	c.(211-213)Cag>Gag	p.Q71E	RUNX2_ENST00000352853.5_Missense_Mutation_p.Q139E|RUNX2_ENST00000541979.1_Missense_Mutation_p.Q139E|RUNX2_ENST00000371436.6_Missense_Mutation_p.Q71E|RUNX2_ENST00000576263.1_Missense_Mutation_p.Q71E|RUNX2_ENST00000359524.5_Missense_Mutation_p.Q57E|RUNX2_ENST00000371432.3_Missense_Mutation_p.Q57E|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000465038.2_Missense_Mutation_p.Q71E	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	71	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						gcagcagcagcaggaggcggc	0.716																																					p.Q71E		Atlas-SNP	.											RUNX2_ENST00000352853,NS,carcinoma,0,2	RUNX2	128	2	0			c.C211G						scavenged	.						6.0	10.0	9.0					6																	45390482		1279	2789	4068	SO:0001583	missense	860	exon3			CAGCAGCAGGAGG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.211C>G	6.37:g.45390482C>G	ENSP00000360493:p.Gln71Glu	Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	25	2	0.08	NM_001024630	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985548	0.35036	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08	3.45	3.45	0.39498	.	1.972660	0.03402	N	0.203449	T	0.19248	0.0462	N	0.14661	0.345	0.27094	N	0.962779	B;B;B	0.23806	0.033;0.055;0.091	B;B;B	0.20384	0.029;0.013;0.029	T	0.13818	-1.0495	10	0.02654	T	1	.	14.8379	0.70197	0.0:1.0:0.0:0.0	.	139;71;57	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	E	71;139;139;71;71;57;57	ENSP00000420707:Q71E;ENSP00000319087:Q139E;ENSP00000446290:Q139E;ENSP00000360493:Q71E;ENSP00000360491:Q71E;ENSP00000352514:Q57E;ENSP00000360486:Q57E	ENSP00000319087:Q139E	Q	+	1	0	RUNX2	45498460	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.268000	0.33062	1.622000	0.50330	0.407000	0.27541	CAG	.	.	none		0.716	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
TFPI2	7980	hgsc.bcm.edu	37	7	93519470	93519470	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:93519470C>T	ENST00000222543.5	-	2	562	c.250G>A	c.(250-252)Gat>Aat	p.D84N	GNGT1_ENST00000455502.1_Intron|AC002076.10_ENST00000435257.1_RNA|TFPI2_ENST00000545378.1_Missense_Mutation_p.D84N	NM_001271003.1|NM_001271004.1|NM_006528.3	NP_001257932.1|NP_001257933.1|NP_006519.1	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2	84	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.				blood coagulation (GO:0007596)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(5)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			CAGCAAGCATCGTCGCAAGCC	0.617																																					p.D84N		Atlas-SNP	.											.	TFPI2	37	.	0			c.G250A						PASS	.						33.0	35.0	34.0					7																	93519470		2203	4300	6503	SO:0001583	missense	7980	exon2			AAGCATCGTCGCA	L27624	CCDS5632.1	7q	2008-07-18			ENSG00000105825	ENSG00000105825			11761	protein-coding gene	gene with protein product		600033				7896752, 8945635	Standard	NM_006528		Approved	PP5, TFPI-2, REF1	uc003umy.2	P48307	OTTHUMG00000022963	ENST00000222543.5:c.250G>A	7.37:g.93519470C>T	ENSP00000222543:p.Asp84Asn	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	83	4	0.0481928	NM_006528	Q66ME8|Q8NAK6|Q9UC86	Missense_Mutation	SNP	ENST00000222543.5	37	CCDS5632.1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.815932	0.32145	.	.	ENSG00000105825	ENST00000222543;ENST00000545378;ENST00000451238	T;T;T	0.56275	0.47;0.47;0.55	5.09	-1.78	0.07957	Proteinase inhibitor I2, Kunitz metazoa (5);	0.446267	0.26542	N	0.023783	T	0.18087	0.0434	N	0.02539	-0.55	0.09310	N	1	B;B;B;B	0.23540	0.087;0.0;0.011;0.0	B;B;B;B	0.11329	0.006;0.0;0.005;0.0	T	0.26224	-1.0109	10	0.13853	T	0.58	.	6.3313	0.21272	0.0:0.2858:0.2387:0.4755	.	55;73;84;84	A4ZVU7;Q8NAK6;F5H3J8;P48307	.;.;.;TFPI2_HUMAN	N	84;84;5	ENSP00000222543:D84N;ENSP00000438861:D84N;ENSP00000416370:D5N	ENSP00000222543:D84N	D	-	1	0	TFPI2	93357406	0.018000	0.18449	0.000000	0.03702	0.014000	0.08584	0.525000	0.22956	-0.223000	0.09943	-0.657000	0.03884	GAT	.	.	none		0.617	TFPI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254720.2	NM_006528	
VPS8	23355	hgsc.bcm.edu	37	3	184616396	184616396	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:184616396T>C	ENST00000437079.3	+	24	2219	c.2048T>C	c.(2047-2049)aTc>aCc	p.I683T	VPS8_ENST00000446204.2_Missense_Mutation_p.I591T|VPS8_ENST00000287546.4_Missense_Mutation_p.I683T|VPS8_ENST00000436792.2_Missense_Mutation_p.I681T	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	683							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GATGCTATGATCTATGTCTAC	0.338																																					p.I683T		Atlas-SNP	.											.	VPS8	109	.	0			c.T2048C						PASS	.						119.0	118.0	118.0					3																	184616396		1838	4084	5922	SO:0001583	missense	23355	exon23			CTATGATCTATGT	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.2048T>C	3.37:g.184616396T>C	ENSP00000397879:p.Ile683Thr	Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	241	64	0.26556	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.589816	0.86851	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.33865	1.47;1.47;1.47;1.39	5.75	5.75	0.90469	Quinonprotein alcohol dehydrogenase-like (1);	0.042417	0.85682	D	0.000000	T	0.62551	0.2437	M	0.80028	2.48	0.80722	D	1	P;D;P	0.65815	0.756;0.995;0.661	P;D;B	0.69307	0.644;0.963;0.43	T	0.67837	-0.5567	10	0.87932	D	0	-21.0896	16.0544	0.80788	0.0:0.0:0.0:1.0	.	683;591;681	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	T	683;683;681;591	ENSP00000287546:I683T;ENSP00000397879:I683T;ENSP00000404704:I681T;ENSP00000405483:I591T	ENSP00000287546:I683T	I	+	2	0	VPS8	186099090	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.495000	0.81514	2.188000	0.69820	0.477000	0.44152	ATC	.	.	none		0.338	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
SEMA3E	9723	hgsc.bcm.edu	37	7	82997329	82997329	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:82997329T>G	ENST00000307792.3	-	17	2368	c.1901A>C	c.(1900-1902)aAg>aCg	p.K634T	SEMA3E_ENST00000427262.1_Missense_Mutation_p.K574T	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	634	Ig-like C2-type.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				AAGGTCCATCTTAACCACTCT	0.418																																					p.K634T		Atlas-SNP	.											.	SEMA3E	125	.	0			c.A1901C						PASS	.						118.0	114.0	115.0					7																	82997329		2203	4300	6503	SO:0001583	missense	9723	exon17			TCCATCTTAACCA	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1901A>C	7.37:g.82997329T>G	ENSP00000303212:p.Lys634Thr	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	143	30	0.20979	NM_012431	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	37	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	T	17.43	3.386952	0.61956	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.01495	4.83;4.83	5.77	5.77	0.91146	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.173767	0.49916	D	0.000122	T	0.03959	0.0111	M	0.68593	2.085	0.39645	D	0.970385	P	0.37688	0.605	B	0.39771	0.309	T	0.56372	-0.7990	10	0.22109	T	0.4	.	16.0802	0.81001	0.0:0.0:0.0:1.0	.	634	O15041	SEM3E_HUMAN	T	634;574;634	ENSP00000303212:K634T;ENSP00000405052:K574T	ENSP00000303212:K634T	K	-	2	0	SEMA3E	82835265	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	3.679000	0.54634	2.201000	0.70794	0.477000	0.44152	AAG	.	.	none		0.418	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
MYO7B	4648	hgsc.bcm.edu	37	2	128379623	128379623	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:128379623C>T	ENST00000409816.2	+	26	3546	c.3514C>T	c.(3514-3516)Cgc>Tgc	p.R1172C	MYO7B_ENST00000409090.1_Missense_Mutation_p.R25C|MYO7B_ENST00000428314.1_Missense_Mutation_p.R1172C|MYO7B_ENST00000389524.4_Missense_Mutation_p.R1172C			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1172	MyTH4 1. {ECO:0000255|PROSITE- ProRule:PRU00359}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GCGCCTGAGACGCACCTATGC	0.667																																					p.R1172C		Atlas-SNP	.											MYO7B_ENST00000428314,caecum,carcinoma,-1,4	MYO7B	359	4	0			c.C3514T						scavenged	.						23.0	23.0	23.0					2																	128379623		1735	3680	5415	SO:0001583	missense	4648	exon27			CTGAGACGCACCT		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.3514C>T	2.37:g.128379623C>T	ENSP00000386461:p.Arg1172Cys	Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	99	2	0.020202	NM_001080527	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	.	31	5.070714	0.93950	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000272666;ENST00000409816;ENST00000437387;ENST00000409090	T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11	4.92	4.92	0.64577	MyTH4 domain (3);	0.000000	0.85682	D	0.000000	D	0.91566	0.7336	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94097	0.7358	10	0.87932	D	0	.	18.0998	0.89503	0.0:1.0:0.0:0.0	.	1172	Q6PIF6	MYO7B_HUMAN	C	1172;1172;25;1172;25;25	ENSP00000374175:R1172C;ENSP00000415090:R1172C;ENSP00000386461:R1172C;ENSP00000404927:R25C;ENSP00000386850:R25C	ENSP00000272666:R25C	R	+	1	0	MYO7B	128096093	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.764000	0.47613	2.250000	0.74265	0.561000	0.74099	CGC	.	.	none		0.667	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
KCNK18	338567	hgsc.bcm.edu	37	10	118969290	118969290	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:118969290C>T	ENST00000334549.1	+	3	635	c.635C>T	c.(634-636)cCc>cTc	p.P212L		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	212					cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		CTTCCAGGCCCCAAACTTGGC	0.527																																					p.P212L		Atlas-SNP	.											.	KCNK18	70	.	0			c.C635T						PASS	.						74.0	75.0	75.0					10																	118969290		2203	4300	6503	SO:0001583	missense	338567	exon3			CAGGCCCCAAACT	AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	ENST00000334549.1:c.635C>T	10.37:g.118969290C>T	ENSP00000334650:p.Pro212Leu	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	75	31	0.413333	NM_181840	Q5SQQ8	Missense_Mutation	SNP	ENST00000334549.1	37	CCDS7598.1	.	.	.	.	.	.	.	.	.	.	C	7.395	0.631626	0.14322	.	.	ENSG00000186795	ENST00000334549	T	0.14022	2.54	4.72	1.75	0.24633	.	0.572860	0.19090	N	0.122981	T	0.06781	0.0173	L	0.27053	0.805	0.09310	N	0.999999	B	0.26318	0.146	B	0.18871	0.023	T	0.31447	-0.9943	10	0.27082	T	0.32	.	1.6533	0.02776	0.2389:0.4293:0.1165:0.2153	.	212	Q7Z418	KCNKI_HUMAN	L	212	ENSP00000334650:P212L	ENSP00000334650:P212L	P	+	2	0	KCNK18	118959280	0.000000	0.05858	0.002000	0.10522	0.027000	0.11550	0.311000	0.19380	0.258000	0.21686	0.655000	0.94253	CCC	.	.	none		0.527	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050562.2	NM_181840	
FAM179A	165186	hgsc.bcm.edu	37	2	29225519	29225519	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:29225519C>T	ENST00000379558.4	+	5	896	c.545C>T	c.(544-546)cCt>cTt	p.P182L	FAM179A_ENST00000403861.2_Missense_Mutation_p.P182L	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	182										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CAGAGCATCCCTACCACCCCT	0.652																																					p.P182L		Atlas-SNP	.											.	FAM179A	106	.	0			c.C545T						PASS	.						31.0	38.0	36.0					2																	29225519		1994	4161	6155	SO:0001583	missense	165186	exon5			GCATCCCTACCAC	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.545C>T	2.37:g.29225519C>T	ENSP00000368876:p.Pro182Leu	Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	95	35	0.368421	NM_199280	Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	37	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291836	0.59976	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.52526	1.47;0.66	5.03	5.03	0.67393	.	.	.	.	.	T	0.57740	0.2074	L	0.32530	0.975	0.43632	D	0.996029	D;P	0.89917	1.0;0.779	D;B	0.91635	0.999;0.251	T	0.61357	-0.7079	9	0.87932	D	0	.	13.87	0.63612	0.0:1.0:0.0:0.0	.	182;182	F8W8E4;Q6ZUX3	.;F179A_HUMAN	L	182	ENSP00000368876:P182L;ENSP00000384699:P182L	ENSP00000368876:P182L	P	+	2	0	FAM179A	29079023	0.966000	0.33281	1.000000	0.80357	0.304000	0.27724	2.654000	0.46699	2.319000	0.78375	0.555000	0.69702	CCT	.	.	none		0.652	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
HERC2	8924	hgsc.bcm.edu	37	15	28483809	28483809	+	Silent	SNP	G	G	A	rs149204675	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:28483809G>A	ENST00000261609.7	-	24	3795	c.3687C>T	c.(3685-3687)gaC>gaT	p.D1229D		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACACCTTCCCGTCAATCACAG	0.373													G|||	26	0.00519169	0.0129	0.0	5008	,	,		17942	0.0		0.004	False		,,,				2504	0.0051				p.D1229D		Atlas-SNP	.											HERC2,NS,carcinoma,0,1	HERC2	501	1	0			c.C3687T						scavenged	.						73.0	68.0	70.0					15																	28483809		2203	4300	6503	SO:0001819	synonymous_variant	8924	exon24			CTTCCCGTCAATC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.3687C>T	15.37:g.28483809G>A		Somatic	475	2	0.00421053		WXS	Illumina HiSeq	Phase_I	393	6	0.0152672	NM_004667		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																			G|0.998;A|0.002	0.002	strong		0.373	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
MUC6	4588	hgsc.bcm.edu	37	11	1017575	1017575	+	Silent	SNP	C	C	T	rs76222533		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:1017575C>T	ENST00000421673.2	-	31	5276	c.5226G>A	c.(5224-5226)acG>acA	p.T1742T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1742	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGTTTTGGCCGTGCTAAATG	0.537													-|||	1	0.000199681	0.0	0.0014	5008	,	,		39036	0.0		0.0	False		,,,				2504	0.0				p.T1742T		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	0			c.G5226A						scavenged	.						697.0	677.0	684.0					11																	1017575		2190	4282	6472	SO:0001819	synonymous_variant	4588	exon31			TTTGGCCGTGCTA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5226G>A	11.37:g.1017575C>T		Somatic	907	109	0.120176		WXS	Illumina HiSeq	Phase_I	833	94	0.112845	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			C|0.500;T|0.500	0.500	strong		0.537	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
CARD11	84433	hgsc.bcm.edu	37	7	2983885	2983885	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:2983885C>G	ENST00000396946.4	-	5	1048	c.645G>C	c.(643-645)aaG>aaC	p.K215N	AC004906.3_ENST00000423194.1_RNA	NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	215					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.K208N(1)|p.K208del(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CCGCCATGTTCTTCTCCTCAC	0.577			Mis		DLBCL																																p.K215N		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	CARD11,colon,carcinoma,-2,6	CARD11	339	6	2	Substitution - Missense(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(2)	c.G645C						PASS	.						186.0	114.0	138.0					7																	2983885		2203	4300	6503	SO:0001583	missense	84433	exon5			CATGTTCTTCTCC	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.645G>C	7.37:g.2983885C>G	ENSP00000380150:p.Lys215Asn	Somatic	239	0	0		WXS	Illumina HiSeq	Phase_I	292	160	0.547945	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	C	16.06	3.015955	0.54468	.	.	ENSG00000198286	ENST00000396946	T	0.37915	1.17	4.16	-3.11	0.05299	.	0.000000	0.85682	D	0.000000	T	0.49012	0.1532	L	0.57536	1.79	0.46336	D	0.998996	D	0.65815	0.995	D	0.69479	0.964	T	0.40979	-0.9534	10	0.52906	T	0.07	-28.1579	13.3536	0.60615	0.0:0.8991:0.0:0.1009	.	215	Q9BXL7	CAR11_HUMAN	N	215	ENSP00000380150:K215N	ENSP00000380150:K215N	K	-	3	2	CARD11	2950411	1.000000	0.71417	0.961000	0.40146	0.982000	0.71751	1.434000	0.34958	-1.079000	0.03113	-0.367000	0.07326	AAG	.	.	none		0.577	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
SLC17A7	57030	hgsc.bcm.edu	37	19	49937049	49937049	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:49937049C>T	ENST00000221485.3	-	7	972	c.801G>A	c.(799-801)tcG>tcA	p.S267S	SLC17A7_ENST00000600601.1_Silent_p.S200S|SLC17A7_ENST00000543531.1_Silent_p.S255S	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	267					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		GCTCCTCCTCCGAGATGCTGG	0.647																																					p.S267S		Atlas-SNP	.											SLC17A7,caecum,carcinoma,-1,1	SLC17A7	57	1	0			c.G801A						scavenged	.						63.0	54.0	57.0					19																	49937049		2203	4300	6503	SO:0001819	synonymous_variant	57030	exon7			CTCCTCCGAGATG	AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.801G>A	19.37:g.49937049C>T		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	58	3	0.0517241	NM_020309	B4DFR9|B4DG46|Q6PCD0	Silent	SNP	ENST00000221485.3	37	CCDS12764.1																																																																																			.	.	none		0.647	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465367.2		
KRT12	3859	hgsc.bcm.edu	37	17	39019783	39019783	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:39019783C>T	ENST00000251643.4	-	5	1072	c.1049G>A	c.(1048-1050)cGc>cAc	p.R350H	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	350	Coil 2.|Rod.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	CTGAAAGGCGCGACGCAGGTC	0.562																																					p.R350H		Atlas-SNP	.											.	KRT12	53	.	0			c.G1049A						PASS	.						80.0	66.0	71.0					17																	39019783		2203	4300	6503	SO:0001583	missense	3859	exon5			AAGGCGCGACGCA		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.1049G>A	17.37:g.39019783C>T	ENSP00000251643:p.Arg350His	Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	99	36	0.363636	NM_000223	B2R9E0	Missense_Mutation	SNP	ENST00000251643.4	37	CCDS11378.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.178992	0.78564	.	.	ENSG00000187242	ENST00000251643	D	0.90504	-2.68	5.44	5.44	0.79542	Filament (1);	0.000000	0.49305	D	0.000145	D	0.93167	0.7824	M	0.84156	2.68	0.53688	D	0.999972	D	0.69078	0.997	P	0.51101	0.659	D	0.93791	0.7092	10	0.62326	D	0.03	.	14.4797	0.67573	0.0:0.9274:0.0:0.0726	.	350	Q99456	K1C12_HUMAN	H	350	ENSP00000251643:R350H	ENSP00000251643:R350H	R	-	2	0	KRT12	36273309	1.000000	0.71417	0.959000	0.39883	0.443000	0.32047	3.335000	0.52105	2.542000	0.85734	0.491000	0.48974	CGC	.	.	none		0.562	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223	
ZFX	7543	hgsc.bcm.edu	37	X	24229464	24229464	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:24229464C>T	ENST00000379177.1	+	11	2816	c.2389C>T	c.(2389-2391)Cga>Tga	p.R797*	ZFX_ENST00000338565.3_Nonsense_Mutation_p.R747*|ZFX_ENST00000379188.3_Nonsense_Mutation_p.R797*|ZFX_ENST00000539115.1_Nonsense_Mutation_p.R568*|ZFX_ENST00000304543.5_Nonsense_Mutation_p.R797*|ZFX_ENST00000540034.1_Nonsense_Mutation_p.R836*	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	797					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						GCACATAATGCGACATCATAA	0.423																																					p.R797X	Esophageal Squamous(20;306 562 7346 32868 37983)	Atlas-SNP	.											.	ZFX	61	.	0			c.C2389T						PASS	.						57.0	47.0	51.0					X																	24229464		2202	4300	6502	SO:0001587	stop_gained	7543	exon10			ATAATGCGACATC		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.2389C>T	X.37:g.24229464C>T	ENSP00000368475:p.Arg797*	Somatic	292	0	0		WXS	Illumina HiSeq	Phase_I	147	100	0.680272	NM_003410	B9EG97|O43668|Q8WYJ8	Nonsense_Mutation	SNP	ENST00000379177.1	37	CCDS14211.1	.	.	.	.	.	.	.	.	.	.	C	37	6.393586	0.97533	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	.	.	.	5.41	3.63	0.41609	.	0.120124	0.36519	N	0.002558	.	.	.	.	.	.	0.41696	D	0.989374	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-7.1264	15.3833	0.74676	0.3533:0.6467:0.0:0.0	.	.	.	.	X	568;797;519;797;797;836;747	.	ENSP00000304985:R797X	R	+	1	2	ZFX	24139385	0.999000	0.42202	0.992000	0.48379	0.962000	0.63368	0.752000	0.26362	0.203000	0.20529	-0.936000	0.02699	CGA	.	.	none		0.423	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410	
BRWD3	254065	hgsc.bcm.edu	37	X	80064532	80064532	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:80064532G>A	ENST00000373275.4	-	3	316	c.100C>T	c.(100-102)Cag>Tag	p.Q34*		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	34					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TCGAGCTCCTGCACTAGCACC	0.602																																					p.Q34X		Atlas-SNP	.											.	BRWD3	251	.	0			c.C100T						PASS	.						52.0	49.0	50.0					X																	80064532		2199	4298	6497	SO:0001587	stop_gained	254065	exon3			GCTCCTGCACTAG		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.100C>T	X.37:g.80064532G>A	ENSP00000362372:p.Gln34*	Somatic	253	1	0.00395257		WXS	Illumina HiSeq	Phase_I	123	83	0.674797	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Nonsense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	G	37	6.619038	0.97709	.	.	ENSG00000165288	ENST00000373275	.	.	.	4.6	3.66	0.41972	.	0.081539	0.47455	D	0.000229	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.9026	8.9154	0.35579	0.0:0.2224:0.7776:0.0	.	.	.	.	X	34	.	.	Q	-	1	0	BRWD3	79951188	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.261000	0.51530	2.273000	0.75805	0.529000	0.55759	CAG	.	.	none		0.602	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
GRIN2A	2903	hgsc.bcm.edu	37	16	10274133	10274133	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr16:10274133C>T	ENST00000396573.2	-	3	445	c.136G>A	c.(136-138)Gtg>Atg	p.V46M	GRIN2A_ENST00000404927.2_Missense_Mutation_p.V46M|GRIN2A_ENST00000396575.2_Missense_Mutation_p.V46M|GRIN2A_ENST00000330684.3_Missense_Mutation_p.V46M|GRIN2A_ENST00000562109.1_Missense_Mutation_p.V46M	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	46					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.V46L(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGCTCTGTCACGTCGTGGCTG	0.697																																					p.V46M		Atlas-SNP	.											GRIN2A,NS,carcinoma,0,1	GRIN2A	366	1	1	Substitution - Missense(1)	lung(1)	c.G136A						PASS	.						50.0	55.0	53.0					16																	10274133		2197	4300	6497	SO:0001583	missense	2903	exon3			CTGTCACGTCGTG		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.136G>A	16.37:g.10274133C>T	ENSP00000379818:p.Val46Met	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	40	16	0.4	NM_000833	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.334675	0.41297	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000330684;ENST00000396575	D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13	4.54	3.58	0.41010	.	0.264378	0.28977	N	0.013526	T	0.72700	0.3493	N	0.22421	0.69	0.80722	D	1	B;P;P	0.41041	0.002;0.736;0.609	B;B;B	0.30782	0.0;0.12;0.041	T	0.65561	-0.6138	9	.	.	.	.	8.8007	0.34907	0.0:0.7269:0.0:0.2731	.	46;46;46	Q547U9;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	M	46	ENSP00000379818:V46M;ENSP00000385872:V46M;ENSP00000332549:V46M;ENSP00000379820:V46M	.	V	-	1	0	GRIN2A	10181634	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	1.062000	0.30555	0.378000	0.24764	-1.134000	0.01955	GTG	.	.	none		0.697	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
DRP2	1821	hgsc.bcm.edu	37	X	100497418	100497418	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:100497418C>T	ENST00000395209.3	+	8	1460	c.933C>T	c.(931-933)tcC>tcT	p.S311S	DRP2_ENST00000541709.1_Silent_p.S233S|DRP2_ENST00000538510.1_Silent_p.S311S|DRP2_ENST00000402866.1_Silent_p.S311S	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	311					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						TGGAGAATTCCCAGGCCCTGG	0.488																																					p.S311S		Atlas-SNP	.											.	DRP2	98	.	0			c.C933T						PASS	.						141.0	128.0	132.0					X																	100497418		2203	4300	6503	SO:0001819	synonymous_variant	1821	exon8			GAATTCCCAGGCC	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.933C>T	X.37:g.100497418C>T		Somatic	190	0	0		WXS	Illumina HiSeq	Phase_I	70	53	0.757143	NM_001939	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Silent	SNP	ENST00000395209.3	37	CCDS14480.2																																																																																			.	.	none		0.488	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	
NPW	283869	hgsc.bcm.edu	37	16	2070164	2070164	+	Missense_Mutation	SNP	C	C	T	rs2286471	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr16:2070164C>T	ENST00000566435.1	+	1	619	c.106C>T	c.(106-108)Cct>Tct	p.P36S	NPW_ENST00000329610.4_Missense_Mutation_p.P88S			Q8N729	NPW_HUMAN	neuropeptide W	88					feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				kidney(1)	1						CCGCGAGGCTCCTCTCCTGCT	0.771													C|||	960	0.191693	0.295	0.0893	5008	,	,		10080	0.3304		0.1024	False		,,,				2504	0.0736				p.P88S		Atlas-SNP	.											.	NPW	4	.	0			c.C262T						PASS	.	C	SER/PRO	641,2329		67,507,911	8.0	8.0	8.0		262	2.1	0.0	16	dbSNP_100	8	559,6313		29,501,2906	yes	missense	NPW	NM_001099456.2	74	96,1008,3817	TT,TC,CC		8.1345,21.5825,12.1926	possibly-damaging	88/166	2070164	1200,8642	1485	3436	4921	SO:0001583	missense	283869	exon1			GAGGCTCCTCTCC	AB084276	CCDS42102.1	16p13.3	2013-02-26			ENSG00000183971	ENSG00000183971		"""Endogenous ligands"""	30509	protein-coding gene	gene with protein product	"""prepro-neuropeptide W"""	607997				12118011, 12401809	Standard	NM_001099456		Approved	PPL8	uc002coh.4	Q8N729	OTTHUMG00000176914	ENST00000566435.1:c.106C>T	16.37:g.2070164C>T	ENSP00000456974:p.Pro36Ser	Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	14	5	0.357143	NM_001099456		Missense_Mutation	SNP	ENST00000566435.1	37		425	0.1945970695970696	144	0.2926829268292683	35	0.09668508287292818	174	0.3041958041958042	72	0.09498680738786279	c	12.52	1.963210	0.34659	0.215825	0.081345	ENSG00000183971	ENST00000329610	T	0.44482	0.92	3.08	2.09	0.27110	.	0.933080	0.08816	U	0.889472	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P	0.46706	0.883	B	0.32928	0.155	T	0.34054	-0.9844	9	0.20046	T	0.44	.	8.0822	0.30752	0.0:0.7485:0.2515:0.0	rs2286471	88	Q8N729	NPW_HUMAN	S	88	ENSP00000330070:P88S	ENSP00000330070:P88S	P	+	1	0	NPW	2010165	0.002000	0.14202	0.003000	0.11579	0.021000	0.10359	0.455000	0.21843	0.617000	0.30160	0.400000	0.26472	CCT	C|0.821;T|0.179	0.179	strong		0.771	NPW-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000434312.1	NM_001099456	
ATP10D	57205	hgsc.bcm.edu	37	4	47593309	47593309	+	Missense_Mutation	SNP	T	T	G	rs536235043	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:47593309T>G	ENST00000273859.3	+	23	4461	c.4192T>G	c.(4192-4194)Tta>Gta	p.L1398V		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1398					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GCAAGGAAACTTATCTCTGTG	0.458																																					p.L1398V		Atlas-SNP	.											.	ATP10D	168	.	0			c.T4192G						PASS	.						144.0	143.0	143.0					4																	47593309		2203	4299	6502	SO:0001583	missense	57205	exon23			GGAAACTTATCTC	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.4192T>G	4.37:g.47593309T>G	ENSP00000273859:p.Leu1398Val	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	71	28	0.394366	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	T	10.03	1.239183	0.22711	.	.	ENSG00000145246	ENST00000273859	T	0.38722	1.12	4.33	-8.66	0.00866	.	4.506970	0.00166	N	0.000015	T	0.31040	0.0784	L	0.46157	1.445	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30736	-0.9968	10	0.10636	T	0.68	11.4644	9.5229	0.39147	0.4141:0.0:0.4591:0.1268	.	1398	Q9P241	AT10D_HUMAN	V	1398	ENSP00000273859:L1398V	ENSP00000273859:L1398V	L	+	1	2	ATP10D	47288066	0.000000	0.05858	0.000000	0.03702	0.435000	0.31806	-2.282000	0.01156	-3.824000	0.00102	-0.898000	0.02899	TTA	.	.	none		0.458	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
RANBP2	5903	hgsc.bcm.edu	37	2	109382170	109382170	+	Silent	SNP	A	A	G	rs535428027		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:109382170A>G	ENST00000283195.6	+	20	5301	c.5175A>G	c.(5173-5175)gaA>gaG	p.E1725E		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1725					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E1725E(9)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CTAAGAAGGAAGGACAGTGGG	0.418													A|||	1	0.000199681	0.0	0.0014	5008	,	,		23860	0.0		0.0	False		,,,				2504	0.0				p.E1725E		Atlas-SNP	.											RANBP2_ENST00000283195,NS,carcinoma,0,6	RANBP2	488	6	9	Substitution - coding silent(9)	prostate(9)	c.A5175G						scavenged	.						182.0	173.0	176.0					2																	109382170		2203	4300	6503	SO:0001819	synonymous_variant	5903	exon20			GAAGGAAGGACAG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.5175A>G	2.37:g.109382170A>G		Somatic	550	5	0.00909091		WXS	Illumina HiSeq	Phase_I	431	8	0.0185615	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	ENST00000283195.6	37	CCDS2079.1																																																																																			.	.	none		0.418	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
BARHL2	343472	hgsc.bcm.edu	37	1	91180266	91180266	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:91180266G>C	ENST00000370445.4	-	2	714	c.673C>G	c.(673-675)Ccc>Gcc	p.P225A		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	225					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		CTCACAGGGGGACTCTCACGG	0.542																																					p.P225A	GBM(199;3561 4100 22440)	Atlas-SNP	.											BARHL2,NS,carcinoma,+1,1	BARHL2	62	1	0			c.C673G						PASS	.						155.0	154.0	154.0					1																	91180266		2203	4300	6503	SO:0001583	missense	343472	exon2			CAGGGGGACTCTC	AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.673C>G	1.37:g.91180266G>C	ENSP00000359474:p.Pro225Ala	Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	133	48	0.360902	NM_020063	A0AVP2|Q7Z4N7	Missense_Mutation	SNP	ENST00000370445.4	37	CCDS730.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.592727	0.66219	.	.	ENSG00000143032	ENST00000370445	D	0.95656	-3.77	5.1	5.1	0.69264	Homeodomain-related (1);Homeodomain-like (1);	0.059845	0.64402	D	0.000002	D	0.94604	0.8261	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.92857	0.6302	10	0.18276	T	0.48	.	17.1014	0.86651	0.0:0.0:1.0:0.0	.	225	Q9NY43	BARH2_HUMAN	A	225	ENSP00000359474:P225A	ENSP00000359474:P225A	P	-	1	0	BARHL2	90952854	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.561000	0.98142	2.348000	0.79779	0.655000	0.94253	CCC	.	.	none		0.542	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027728.2		
TNK2	10188	hgsc.bcm.edu	37	3	195605200	195605200	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:195605200G>A	ENST00000333602.6	-	9	1797	c.1180C>T	c.(1180-1182)Cgg>Tgg	p.R394W	TNK2_ENST00000381916.2_Missense_Mutation_p.R457W|TNK2_ENST00000392400.1_Missense_Mutation_p.R394W|TNK2_ENST00000428187.1_Missense_Mutation_p.R426W|TNK2_ENST00000316664.3_Missense_Mutation_p.R394W|TNK2_ENST00000468819.1_5'Flank	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	394	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.			Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	TGAAGGGCCCGCATGTCTGTG	0.617																																					p.R457W		Atlas-SNP	.											.	TNK2	246	.	0			c.C1369T						PASS	.						117.0	112.0	114.0					3																	195605200		2203	4300	6503	SO:0001583	missense	10188	exon9			GGGCCCGCATGTC	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.1180C>T	3.37:g.195605200G>A	ENSP00000329425:p.Arg394Trp	Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	212	47	0.221698	NM_001010938	Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	ENST00000333602.6	37	CCDS33928.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655314	0.67586	.	.	ENSG00000061938	ENST00000333602;ENST00000381916;ENST00000428187;ENST00000392400;ENST00000316664	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01	4.47	1.45	0.22620	Src homology-3 domain (3);Protein kinase-like domain (1);	0.181464	0.44097	D	0.000500	T	0.79941	0.4533	M	0.93507	3.425	0.45867	D	0.998722	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.70935	0.918;0.958;0.971;0.952	T	0.79374	-0.1830	10	0.72032	D	0.01	.	7.4437	0.27198	0.0839:0.0:0.3517:0.5644	.	270;394;457;426	Q59FX1;Q07912;Q07912-3;C9J1X3	.;ACK1_HUMAN;.;.	W	394;457;426;394;394	ENSP00000329425:R394W;ENSP00000371341:R457W;ENSP00000392546:R426W;ENSP00000376201:R394W;ENSP00000323216:R394W	ENSP00000323216:R394W	R	-	1	2	TNK2	197089597	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.601000	0.24119	0.491000	0.27793	0.655000	0.94253	CGG	.	.	none		0.617	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
MYH6	4624	hgsc.bcm.edu	37	14	23851691	23851691	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:23851691G>A	ENST00000356287.3	-	37	5771	c.5742C>T	c.(5740-5742)atC>atT	p.I1914I	MYH6_ENST00000405093.3_Silent_p.I1914I			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1914					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.I1914I(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GGGACTCAGCGATGTCCGCCC	0.592																																					p.I1914I		Atlas-SNP	.											MYH6,rectum,carcinoma,0,1	MYH6	274	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C5742T						scavenged	.						180.0	158.0	165.0					14																	23851691		2203	4300	6503	SO:0001819	synonymous_variant	4624	exon38			CTCAGCGATGTCC	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.5742C>T	14.37:g.23851691G>A		Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	193	2	0.0103627	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	ENST00000356287.3	37	CCDS9600.1																																																																																			.	.	none		0.592	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
ZCCHC17	51538	hgsc.bcm.edu	37	1	31821801	31821801	+	Missense_Mutation	SNP	C	C	T	rs377290811		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:31821801C>T	ENST00000373714.1	+	7	805	c.544C>T	c.(544-546)Cct>Tct	p.P182S	ZCCHC17_ENST00000344147.5_Missense_Mutation_p.P182S|ZCCHC17_ENST00000546109.1_Missense_Mutation_p.P174S|ZCCHC17_ENST00000479629.1_3'UTR|ZCCHC17_ENST00000422613.2_Missense_Mutation_p.P184S|RP11-266K22.2_ENST00000430143.1_RNA	NM_001282568.1|NM_001282570.1	NP_001269497.1|NP_001269499.1	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17	182						cytosolic large ribosomal subunit (GO:0022625)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P182S(1)		breast(1)|kidney(1)|large_intestine(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		TACAAGGAATCCTTCTAGAAA	0.393																																					p.P182S		Atlas-SNP	.											ZCCHC17,face,carcinoma,0,1	ZCCHC17	30	1	1	Substitution - Missense(1)	skin(1)	c.C544T						scavenged	.						84.0	84.0	84.0					1																	31821801		2203	4300	6503	SO:0001583	missense	51538	exon7			AGGAATCCTTCTA	AF151085	CCDS341.1, CCDS60061.1, CCDS72741.1, CCDS72742.1, CCDS72743.1, CCDS72744.1	1p35.2	2008-05-02			ENSG00000121766	ENSG00000121766		"""Zinc fingers, CCHC domain containing"""	30246	protein-coding gene	gene with protein product						12202495, 12893261	Standard	NM_001282572		Approved	PS1D, HSPC251, pNO40	uc001bsp.1	Q9NP64	OTTHUMG00000003791	ENST00000373714.1:c.544C>T	1.37:g.31821801C>T	ENSP00000362819:p.Pro182Ser	Somatic	201	0	0		WXS	Illumina HiSeq	Phase_I	187	3	0.0160428	NM_016505	B4DY38|D3DPN4|Q6PKH4|Q9NYG4|Q9P0M8	Missense_Mutation	SNP	ENST00000373714.1	37	CCDS341.1	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.363215	0.01235	.	.	ENSG00000121766	ENST00000344147;ENST00000373714;ENST00000546109;ENST00000422613	.	.	.	4.84	3.62	0.41486	.	0.477745	0.22608	N	0.057875	T	0.07908	0.0198	N	0.01048	-1.04	0.23550	N	0.997436	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.36578	-0.9742	9	0.02654	T	1	.	7.3041	0.26436	0.0:0.1014:0.0:0.8986	.	184;174;182	E7EPF0;B4DY38;Q9NP64	.;.;NO40_HUMAN	S	182;182;174;184	.	ENSP00000343557:P182S	P	+	1	0	ZCCHC17	31594388	1.000000	0.71417	1.000000	0.80357	0.492000	0.33523	1.952000	0.40343	0.975000	0.38392	-0.474000	0.04947	CCT	.	.	none		0.393	ZCCHC17-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010665.1	NM_016505	
ZNF521	25925	hgsc.bcm.edu	37	18	22669489	22669489	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:22669489T>G	ENST00000361524.3	-	7	3994	c.3846A>C	c.(3844-3846)gaA>gaC	p.E1282D	ZNF521_ENST00000584787.1_Missense_Mutation_p.E1062D|ZNF521_ENST00000538137.2_Missense_Mutation_p.E1282D	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1282					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AGATCTTGTCTTCTTGTCCAT	0.403			T	PAX5	ALL																																p.E1282D		Atlas-SNP	.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521	269	.	0			c.A3846C						PASS	.						190.0	173.0	179.0					18																	22669489		2203	4300	6503	SO:0001583	missense	25925	exon7			CTTGTCTTCTTGT	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3846A>C	18.37:g.22669489T>G	ENSP00000354794:p.Glu1282Asp	Somatic	235	0	0		WXS	Illumina HiSeq	Phase_I	472	70	0.148305	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	T	11.99	1.804717	0.31961	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T	0.09445	2.98	5.79	4.62	0.57501	Zinc finger, C2H2 (1);	0.000000	0.64402	D	0.000001	T	0.17746	0.0426	N	0.24115	0.695	0.38064	D	0.93617	D	0.63046	0.992	D	0.77004	0.989	T	0.06144	-1.0843	10	0.48119	T	0.1	-20.6004	9.4859	0.38928	0.0:0.1539:0.0:0.8461	.	1282	Q96K83	ZN521_HUMAN	D	1282;1316;1282	ENSP00000354794:E1282D	ENSP00000354794:E1282D	E	-	3	2	ZNF521	20923487	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.711000	0.47177	0.998000	0.38996	0.528000	0.53228	GAA	.	.	none		0.403	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
MYF6	4618	hgsc.bcm.edu	37	12	81101689	81101689	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:81101689C>T	ENST00000228641.3	+	1	413	c.191C>T	c.(190-192)gCg>gTg	p.A64V		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	64					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A64V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						CATGTCCTGGCGCCCCCGGGC	0.632																																					p.A64V		Atlas-SNP	.											MYF6,NS,carcinoma,0,1	MYF6	74	1	1	Substitution - Missense(1)	endometrium(1)	c.C191T						PASS	.						36.0	42.0	40.0					12																	81101689		2203	4300	6503	SO:0001583	missense	4618	exon1			TCCTGGCGCCCCC		CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.191C>T	12.37:g.81101689C>T	ENSP00000228641:p.Ala64Val	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	58	25	0.431034	NM_002469	B2R898|Q53X80|Q6FHI9	Missense_Mutation	SNP	ENST00000228641.3	37	CCDS9019.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653792	0.88056	.	.	ENSG00000111046	ENST00000228641	T	0.80909	-1.43	5.62	5.62	0.85841	Myogenic basic muscle-specific protein (2);	0.000000	0.85682	D	0.000000	D	0.87904	0.6295	L	0.53671	1.685	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.86881	0.2042	10	0.46703	T	0.11	.	19.6517	0.95819	0.0:1.0:0.0:0.0	.	64	P23409	MYF6_HUMAN	V	64	ENSP00000228641:A64V	ENSP00000228641:A64V	A	+	2	0	MYF6	79625820	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.662000	0.90505	0.655000	0.94253	GCG	.	.	none		0.632	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407756.1	NM_002469	
DLX6	1750	hgsc.bcm.edu	37	7	96639340	96639340	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:96639340A>C	ENST00000518156.2	+	3	1293	c.863A>C	c.(862-864)cAg>cCg	p.Q288P	DLX6-AS1_ENST00000605417.1_RNA|DLX6_ENST00000555308.1_Missense_Mutation_p.Q160P|DLX6-AS1_ENST00000430404.2_RNA|DLX6_ENST00000493273.2_3'UTR|DLX6_ENST00000007660.5_Missense_Mutation_p.Q260P|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS1_ENST00000452769.2_RNA|DLX6-AS1_ENST00000437541.1_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	170					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					GACACGATGCAGAGACCACAG	0.547																																					p.Q288P		Atlas-SNP	.											.	DLX6	37	.	0			c.A863C						PASS	.						23.0	24.0	23.0					7																	96639340		2121	4253	6374	SO:0001583	missense	1750	exon3			CGATGCAGAGACC		CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.863A>C	7.37:g.96639340A>C	ENSP00000428480:p.Gln288Pro	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	190	39	0.205263	NM_005222	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Missense_Mutation	SNP	ENST00000518156.2	37	CCDS47647.2	.	.	.	.	.	.	.	.	.	.	A	19.33	3.807640	0.70797	.	.	ENSG00000006377	ENST00000518156;ENST00000007660;ENST00000555308	D;D;D	0.91686	-2.89;-2.83;-2.89	5.76	5.76	0.90799	.	1.660890	0.02777	N	0.120406	D	0.91061	0.7187	L	0.42245	1.32	0.80722	D	1	B	0.17852	0.024	B	0.20577	0.03	T	0.60999	-0.7151	10	0.20519	T	0.43	-15.5545	16.0796	0.80995	1.0:0.0:0.0:0.0	.	260	P56179-2	.	P	288;260;160	ENSP00000428480:Q288P;ENSP00000007660:Q260P;ENSP00000451635:Q160P	ENSP00000007660:Q260P	Q	+	2	0	DLX6	96477276	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.085000	0.76875	2.206000	0.71126	0.533000	0.62120	CAG	.	.	none		0.547	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334373.4	NM_005222	
KRT5	3852	hgsc.bcm.edu	37	12	52909593	52909593	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:52909593G>T	ENST00000252242.4	-	8	1853	c.1463C>A	c.(1462-1464)cCa>cAa	p.P488Q		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	488	Tail.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		GATGTTGACTGGTCCAACTCC	0.398																																					p.P488Q		Atlas-SNP	.											KRT5,NS,carcinoma,0,1	KRT5	88	1	0			c.C1463A						scavenged	.						162.0	145.0	151.0					12																	52909593		2203	4300	6503	SO:0001583	missense	3852	exon8			TTGACTGGTCCAA		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.1463C>A	12.37:g.52909593G>T	ENSP00000252242:p.Pro488Gln	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	121	2	0.0165289	NM_000424	Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	ENST00000252242.4	37	CCDS8830.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.406723	0.42715	.	.	ENSG00000186081	ENST00000252242;ENST00000456000	D	0.94650	-3.48	5.95	5.95	0.96441	.	0.000000	0.56097	D	0.000024	D	0.89536	0.6743	N	0.20845	0.615	0.32312	N	0.56356	B	0.20780	0.048	B	0.19946	0.027	D	0.87535	0.2455	10	0.40728	T	0.16	.	14.8167	0.70039	0.0:0.1431:0.8569:0.0	.	488	P13647	K2C5_HUMAN	Q	488;453	ENSP00000252242:P488Q	ENSP00000252242:P488Q	P	-	2	0	KRT5	51195860	0.007000	0.16637	1.000000	0.80357	0.999000	0.98932	1.544000	0.36158	2.824000	0.97209	0.655000	0.94253	CCA	.	.	none		0.398	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1		
FBN1	2200	hgsc.bcm.edu	37	15	48703210	48703210	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:48703210T>G	ENST00000316623.5	-	66	9048	c.8593A>C	c.(8593-8595)Aaa>Caa	p.K2865Q	FBN1_ENST00000561429.1_5'Flank	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2865					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ACCTGGATTTTCATCTTCAGA	0.328																																					p.K2865Q		Atlas-SNP	.											.	FBN1	310	.	0			c.A8593C						PASS	.						87.0	85.0	85.0					15																	48703210		2198	4297	6495	SO:0001583	missense	2200	exon66			GGATTTTCATCTT	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8593A>C	15.37:g.48703210T>G	ENSP00000325527:p.Lys2865Gln	Somatic	243	0	0		WXS	Illumina HiSeq	Phase_I	155	65	0.419355	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.384485	0.42308	.	.	ENSG00000166147	ENST00000316623	D	0.82711	-1.64	5.87	5.87	0.94306	.	0.088256	0.85682	D	0.000000	T	0.80071	0.4556	M	0.68317	2.08	0.80722	D	1	P	0.41313	0.745	B	0.31686	0.134	T	0.82808	-0.0274	10	0.62326	D	0.03	.	15.9277	0.79632	0.0:0.0:0.0:1.0	.	2865	P35555	FBN1_HUMAN	Q	2865	ENSP00000325527:K2865Q	ENSP00000325527:K2865Q	K	-	1	0	FBN1	46490502	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.087000	0.64480	2.247000	0.74100	0.528000	0.53228	AAA	.	.	none		0.328	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
SLC25A36	55186	hgsc.bcm.edu	37	3	140692754	140692754	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:140692754G>T	ENST00000324194.6	+	6	817	c.649G>T	c.(649-651)Gaa>Taa	p.E217*	SLC25A36_ENST00000453248.2_Nonsense_Mutation_p.E191*|RP11-231L11.3_ENST00000513802.1_RNA|SLC25A36_ENST00000446041.2_Nonsense_Mutation_p.E217*			Q96CQ1	S2536_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier ), member 36	217					response to estradiol (GO:0032355)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						GGAAAATGATGAAGAGTCTGT	0.353																																					p.E217X		Atlas-SNP	.											SLC25A36,NS,carcinoma,-2,1	SLC25A36	24	1	0			c.G649T						scavenged	.						68.0	69.0	69.0					3																	140692754		2203	4300	6503	SO:0001587	stop_gained	55186	exon6			AATGATGAAGAGT	AK001480	CCDS3114.1, CCDS46927.1	3q23	2013-05-22	2012-03-29		ENSG00000114120	ENSG00000114120		"""Solute carriers"""	25554	protein-coding gene	gene with protein product			"""solute carrier family 25, member 36"""				Standard	NM_001104647		Approved	FLJ10618, PNC2	uc003etr.2	Q96CQ1	OTTHUMG00000160260	ENST00000324194.6:c.649G>T	3.37:g.140692754G>T	ENSP00000320688:p.Glu217*	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	60	1	0.0166667	NM_018155	A8MYF7|Q05CY1|Q9H0G8|Q9NVN5	Nonsense_Mutation	SNP	ENST00000324194.6	37	CCDS46927.1	.	.	.	.	.	.	.	.	.	.	G	37	6.337806	0.97485	.	.	ENSG00000114120	ENST00000446041;ENST00000324194;ENST00000453248	.	.	.	6.16	6.16	0.99307	.	0.143577	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-9.3544	18.3537	0.90348	0.0:0.0:1.0:0.0	.	.	.	.	X	217;217;191	.	ENSP00000320688:E217X	E	+	1	0	SLC25A36	142175444	1.000000	0.71417	0.996000	0.52242	0.927000	0.56198	9.863000	0.99569	2.937000	0.99478	0.650000	0.86243	GAA	.	.	none		0.353	SLC25A36-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359929.1	NM_018155	
FLNC	2318	hgsc.bcm.edu	37	7	128489252	128489252	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:128489252G>A	ENST00000325888.8	+	29	5206	c.4945G>A	c.(4945-4947)Ggc>Agc	p.G1649S	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.G1649S	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1649					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TGGAGGCCATGGCCTGGGTGA	0.667																																					p.G1649S		Atlas-SNP	.											FLNC,NS,carcinoma,0,1	FLNC	339	1	0			c.G4945A						scavenged	.						64.0	65.0	65.0					7																	128489252		1930	4115	6045	SO:0001583	missense	2318	exon29			GGCCATGGCCTGG	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4945G>A	7.37:g.128489252G>A	ENSP00000327145:p.Gly1649Ser	Somatic	181	1	0.00552486		WXS	Illumina HiSeq	Phase_I	254	70	0.275591	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.991672	0.93106	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.92048	-2.96;-2.96	5.76	5.76	0.90799	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94981	0.8376	M	0.61703	1.905	0.58432	D	0.99999	P;D	0.56035	0.465;0.974	B;D	0.63381	0.411;0.914	D	0.95051	0.8187	10	0.72032	D	0.01	.	17.4698	0.87642	0.0:0.0:1.0:0.0	.	1649;1649	Q14315-2;Q14315	.;FLNC_HUMAN	S	1649	ENSP00000327145:G1649S;ENSP00000344002:G1649S	ENSP00000327145:G1649S	G	+	1	0	FLNC	128276488	1.000000	0.71417	0.978000	0.43139	0.951000	0.60555	5.950000	0.70265	2.713000	0.92767	0.655000	0.94253	GGC	.	.	none		0.667	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
LRFN5	145581	hgsc.bcm.edu	37	14	42356853	42356853	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:42356853T>G	ENST00000298119.4	+	3	2214	c.1025T>G	c.(1024-1026)cTt>cGt	p.L342R	LRFN5_ENST00000554171.1_Missense_Mutation_p.L342R|LRFN5_ENST00000554120.1_Missense_Mutation_p.L342R	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	342	Ig-like.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		AACGGAACACTTGACATTCTT	0.423										HNSCC(30;0.082)																											p.L342R		Atlas-SNP	.											LRFN5,NS,carcinoma,-1,2	LRFN5	269	2	0			c.T1025G						PASS	.						120.0	118.0	119.0					14																	42356853		2203	4300	6503	SO:0001583	missense	145581	exon3			GAACACTTGACAT	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1025T>G	14.37:g.42356853T>G	ENSP00000298119:p.Leu342Arg	Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	135	39	0.288889	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	T	16.41	3.116036	0.56505	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	D;D;D	0.90004	-2.6;-2.6;-2.6	5.4	5.4	0.78164	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.50627	D	0.000117	D	0.96552	0.8875	H	0.97918	4.105	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.97110	1.0;0.982	D	0.97779	1.0231	10	0.87932	D	0	.	13.6708	0.62424	0.0:0.0:0.0:1.0	.	342;342	G3V364;Q96NI6	.;LRFN5_HUMAN	R	342	ENSP00000298119:L342R;ENSP00000451897:L342R;ENSP00000451067:L342R	ENSP00000298119:L342R	L	+	2	0	LRFN5	41426603	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.997000	0.88414	2.165000	0.68154	0.460000	0.39030	CTT	.	.	none		0.423	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
SCYL2	55681	hgsc.bcm.edu	37	12	100729435	100729435	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:100729435C>T	ENST00000360820.2	+	15	2332	c.1895C>T	c.(1894-1896)tCt>tTt	p.S632F		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	632					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						ATGAATGTTTCTGAGGAGATG	0.313																																					p.S632F		Atlas-SNP	.											SCYL2,caecum,carcinoma,+1,1	SCYL2	99	1	0			c.C1895T						scavenged	.						76.0	82.0	80.0					12																	100729435		2202	4298	6500	SO:0001583	missense	55681	exon15			ATGTTTCTGAGGA	AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.1895C>T	12.37:g.100729435C>T	ENSP00000354061:p.Ser632Phe	Somatic	232	0	0		WXS	Illumina HiSeq	Phase_I	160	3	0.01875	NM_017988	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	37	CCDS9076.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.782040	0.70222	.	.	ENSG00000136021	ENST00000549687;ENST00000360820	T;T	0.35236	1.7;1.32	5.27	5.27	0.74061	.	0.117691	0.64402	D	0.000011	T	0.49201	0.1543	M	0.73598	2.24	0.58432	D	0.999997	P	0.43662	0.814	P	0.47015	0.534	T	0.49331	-0.8951	10	0.42905	T	0.14	.	17.4212	0.87515	0.0:1.0:0.0:0.0	.	632	Q6P3W7	SCYL2_HUMAN	F	632	ENSP00000448366:S632F;ENSP00000354061:S632F	ENSP00000354061:S632F	S	+	2	0	SCYL2	99253566	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	4.728000	0.62000	2.601000	0.87937	0.655000	0.94253	TCT	.	.	none		0.313	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988	
ITIH4	3700	hgsc.bcm.edu	37	3	52860923	52860923	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:52860923C>T	ENST00000266041.4	-	4	499	c.403G>A	c.(403-405)Gct>Act	p.A135T	RP5-966M1.6_ENST00000513520.1_5'Flank|ITIH4_ENST00000346281.5_Missense_Mutation_p.A135T|ITIH4_ENST00000485816.1_Missense_Mutation_p.A135T|ITIH4_ENST00000406595.1_Missense_Mutation_p.A135T|RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4-AS1_ENST00000478366.1_RNA|ITIH4_ENST00000434759.3_Missense_Mutation_p.A47T	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	135	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		GCATTGGGAGCCACACTGACC	0.617																																					p.A135T		Atlas-SNP	.											ITIH4,NS,carcinoma,+1,1	ITIH4	74	1	0			c.G403A						scavenged	.						88.0	87.0	87.0					3																	52860923		2203	4300	6503	SO:0001583	missense	3700	exon4			TGGGAGCCACACT	D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.403G>A	3.37:g.52860923C>T	ENSP00000266041:p.Ala135Thr	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	132	4	0.030303	NM_001166449	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Missense_Mutation	SNP	ENST00000266041.4	37	CCDS2865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.2|23.2	4.389964|4.389964	0.82902|0.82902	.|.	.|.	ENSG00000055955|ENSG00000055955	ENST00000266041;ENST00000346281;ENST00000485816;ENST00000406595;ENST00000538421;ENST00000434759|ENST00000441637	T;T;T;T;T|.	0.26373|.	1.74;1.74;1.74;1.74;1.74|.	5.4|5.4	5.4|5.4	0.78164|0.78164	Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);|.	0.000000|.	0.64402|.	D|.	0.000005|.	D|D	0.83635|0.83635	0.5297|0.5297	M|M	0.87682|0.87682	2.9|2.9	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.999|.	D;D;D;D|.	0.85130|.	0.997;0.997;0.997;0.99|.	D|D	0.85634|0.85634	0.1272|0.1272	10|5	0.72032|.	D|.	0.01|.	-21.2108|-21.2108	18.772|18.772	0.91896|0.91896	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	135;135;135;135|.	E9PGN5;B7ZKJ8;Q14624;Q14624-2|.	.;.;ITIH4_HUMAN;.|.	T|D	135;135;135;135;135;47|4	ENSP00000266041:A135T;ENSP00000340520:A135T;ENSP00000417824:A135T;ENSP00000384425:A135T;ENSP00000440036:A47T|.	ENSP00000266041:A135T|.	A|G	-|-	1|2	0|0	ITIH4|ITIH4	52835963|52835963	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.685000|0.685000	0.39939|0.39939	3.236000|3.236000	0.51336|0.51336	2.547000|2.547000	0.85894|0.85894	0.561000|0.561000	0.74099|0.74099	GCT|GGC	.	.	none		0.617	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1	NM_002218	
MUSK	4593	hgsc.bcm.edu	37	9	113562830	113562830	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:113562830A>G	ENST00000374448.4	+	15	2306	c.2172A>G	c.(2170-2172)cgA>cgG	p.R724R	MUSK_ENST00000416899.2_Silent_p.R716R|MUSK_ENST00000189978.5_Silent_p.R724R	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	724	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						TTGTTCACCGAGATTTAGCCA	0.557																																					p.R724R		Atlas-SNP	.											MUSK,right_upper_lobe,carcinoma,+2,1	MUSK	112	1	0			c.A2172G						scavenged	.						142.0	143.0	142.0					9																	113562830		1978	4157	6135	SO:0001819	synonymous_variant	4593	exon14			TCACCGAGATTTA	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.2172A>G	9.37:g.113562830A>G		Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	132	4	0.030303	NM_005592	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Silent	SNP	ENST00000374448.4	37	CCDS48005.1																																																																																			.	.	none		0.557	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
POTED	317754	hgsc.bcm.edu	37	21	15011839	15011839	+	Silent	SNP	T	T	C	rs182477426	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr21:15011839T>C	ENST00000299443.5	+	10	1465	c.1413T>C	c.(1411-1413)gaT>gaC	p.D471D		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	471						plasma membrane (GO:0005886)		p.D471D(1)		central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						CTTCTAGTGATGAACAAAATG	0.363													N|||	1402	0.279952	0.2632	0.1455	5008	,	,		3613	0.5258		0.2266	False		,,,				2504	0.1994				p.D471D		Atlas-SNP	.											POTED,NS,carcinoma,0,1	POTED	57	1	1	Substitution - coding silent(1)	stomach(1)	c.T1413C						scavenged	.						17.0	22.0	21.0					21																	15011839		824	3044	3868	SO:0001819	synonymous_variant	317754	exon10			TAGTGATGAACAA	AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.1413T>C	21.37:g.15011839T>C		Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	108	5	0.0462963	NM_174981	C9JCF7	Silent	SNP	ENST00000299443.5	37	CCDS13562.1																																																																																			T|0.500;C|0.500	0.500	weak		0.363	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1	NM_174981	
CDH20	28316	hgsc.bcm.edu	37	18	59166652	59166652	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:59166652C>A	ENST00000262717.4	+	3	878	c.480C>A	c.(478-480)gaC>gaA	p.D160E	CDH20_ENST00000538374.1_Missense_Mutation_p.D160E|CDH20_ENST00000536675.2_Missense_Mutation_p.D160E			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	160	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				ACATCAATGACAATGAGCCCA	0.522																																					p.D160E		Atlas-SNP	.											.	CDH20	117	.	0			c.C480A						PASS	.						73.0	74.0	73.0					18																	59166652		2203	4300	6503	SO:0001583	missense	28316	exon2			CAATGACAATGAG	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.480C>A	18.37:g.59166652C>A	ENSP00000262717:p.Asp160Glu	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	211	23	0.109005	NM_031891	Q495S3	Missense_Mutation	SNP	ENST00000262717.4	37	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141010	0.77775	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.74526	-0.85;-0.85;-0.85	6.06	2.93	0.34026	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.094194	0.64402	D	0.000001	D	0.91314	0.7261	H	0.99261	4.49	0.51233	D	0.999916	D	0.65815	0.995	D	0.81914	0.995	D	0.93533	0.6871	10	0.87932	D	0	.	12.9137	0.58195	0.0:0.7957:0.0:0.2043	.	160	Q9HBT6	CAD20_HUMAN	E	160	ENSP00000444767:D160E;ENSP00000442226:D160E;ENSP00000262717:D160E	ENSP00000262717:D160E	D	+	3	2	CDH20	57317632	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.309000	0.51903	0.903000	0.36546	-0.145000	0.13849	GAC	.	.	none		0.522	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
GABRG3	2567	hgsc.bcm.edu	37	15	27777873	27777873	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:27777873T>G	ENST00000333743.6	+	10	1504	c.1250T>G	c.(1249-1251)tTc>tGc	p.F417C	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	417					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGTCAGAGCTTCTTCTGCTGC	0.463																																					p.F417C	NSCLC(114;800 1656 7410 37729 45293)	Atlas-SNP	.											.	GABRG3	115	.	0			c.T1250G						PASS	.						105.0	107.0	106.0					15																	27777873		1973	4142	6115	SO:0001583	missense	2567	exon10			AGAGCTTCTTCTG		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1250T>G	15.37:g.27777873T>G	ENSP00000331912:p.Phe417Cys	Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	151	56	0.370861	NM_033223	G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.043813	0.75732	.	.	ENSG00000182256	ENST00000333743	D	0.84298	-1.83	5.85	4.7	0.59300	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.055639	0.64402	D	0.000001	D	0.87861	0.6284	L	0.39514	1.22	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	D	0.86989	0.2109	10	0.49607	T	0.09	.	11.4819	0.50331	0.1347:0.0:0.0:0.8653	.	417	Q99928	GBRG3_HUMAN	C	417	ENSP00000331912:F417C	ENSP00000331912:F417C	F	+	2	0	GABRG3	25451468	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.941000	0.70195	1.003000	0.39130	0.528000	0.53228	TTC	.	.	none		0.463	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
DPP10	57628	hgsc.bcm.edu	37	2	116257116	116257116	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:116257116G>T	ENST00000410059.1	+	4	782	c.302G>T	c.(301-303)gGa>gTa	p.G101V	DPP10_ENST00000409163.1_Missense_Mutation_p.G51V|DPP10_ENST00000393147.2_Missense_Mutation_p.G105V|DPP10_ENST00000310323.8_Missense_Mutation_p.G94V|DPP10_ENST00000488208.1_3'UTR	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	101						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						AGCGAGAATGGACATGTCATT	0.294																																					p.G105V		Atlas-SNP	.											.	DPP10	415	.	0			c.G314T						PASS	.						148.0	143.0	145.0					2																	116257116		2203	4300	6503	SO:0001583	missense	57628	exon4			AGAATGGACATGT	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.302G>T	2.37:g.116257116G>T	ENSP00000386565:p.Gly101Val	Somatic	204	0	0		WXS	Illumina HiSeq	Phase_I	134	51	0.380597	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.940675	0.73557	.	.	ENSG00000175497	ENST00000436732;ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000419287;ENST00000476155	T;T;T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.82939	0.5146	M	0.84082	2.675	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.85227	0.1030	10	0.87932	D	0	-32.1676	16.0293	0.80567	0.0:0.0:1.0:0.0	.	94;105;97;101	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	V	51;101;51;97;105;94;51;51	ENSP00000391092:G51V;ENSP00000386565:G101V;ENSP00000387038:G51V;ENSP00000376854:G97V;ENSP00000376855:G105V;ENSP00000309066:G94V;ENSP00000402499:G51V	ENSP00000309066:G94V	G	+	2	0	DPP10	115973586	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.323000	0.72891	2.705000	0.92388	0.561000	0.74099	GGA	.	.	none		0.294	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
AOX1	316	hgsc.bcm.edu	37	2	201499567	201499567	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:201499567C>T	ENST00000374700.2	+	21	2516	c.2275C>T	c.(2275-2277)Ctt>Ttt	p.L759F	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	759					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	CCAAAGCATGCTTGTCGTTCC	0.418																																					p.L759F		Atlas-SNP	.											AOX1,NS,carcinoma,0,1	AOX1	152	1	0			c.C2275T						scavenged	.						112.0	108.0	109.0					2																	201499567		2203	4300	6503	SO:0001583	missense	316	exon21			AGCATGCTTGTCG	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.2275C>T	2.37:g.201499567C>T	ENSP00000363832:p.Leu759Phe	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	132	2	0.0151515	NM_001159	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843804	0.91197	.	.	ENSG00000138356	ENST00000374700	T	0.47869	0.83	5.41	5.41	0.78517	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (2);	0.000000	0.85682	D	0.000000	T	0.61899	0.2384	M	0.81341	2.54	0.80722	D	1	B	0.29232	0.238	B	0.40009	0.316	T	0.62765	-0.6785	10	0.52906	T	0.07	-32.2832	19.3843	0.94550	0.0:1.0:0.0:0.0	.	759	Q06278	ADO_HUMAN	F	759	ENSP00000363832:L759F	ENSP00000363832:L759F	L	+	1	0	AOX1	201207812	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.545000	0.67237	2.814000	0.96858	0.591000	0.81541	CTT	.	.	none		0.418	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	
RBP3	5949	hgsc.bcm.edu	37	10	48389465	48389465	+	Silent	SNP	C	C	T	rs532562665		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:48389465C>T	ENST00000224600.4	-	1	1526	c.1413G>A	c.(1411-1413)acG>acA	p.T471T	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	471	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	TGAGGTGCTCCGTGTCCTGTA	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		17409	0.0		0.0	False		,,,				2504	0.001				p.T471T		Atlas-SNP	.											RBP3,NS,carcinoma,-1,2	RBP3	152	2	0			c.G1413A						scavenged	.						46.0	45.0	45.0					10																	48389465		2203	4300	6503	SO:0001819	synonymous_variant	5949	exon1			GTGCTCCGTGTCC	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1413G>A	10.37:g.48389465C>T		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	52	2	0.0384615	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Silent	SNP	ENST00000224600.4	37	CCDS7218.1																																																																																			.	.	none		0.647	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
AGBL1	123624	hgsc.bcm.edu	37	15	87089240	87089240	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:87089240G>T	ENST00000441037.2	+	19	2650	c.2555G>T	c.(2554-2556)tGt>tTt	p.C852F	AGBL1_ENST00000389298.3_Missense_Mutation_p.C583F|AGBL1_ENST00000421325.2_Missense_Mutation_p.C852F	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	852					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TAGGTTTTCTGTGACTTCCAT	0.433																																					p.C852F		Atlas-SNP	.											AGBL1,NS,carcinoma,+1,1	AGBL1	151	1	0			c.G2555T						PASS	.						130.0	120.0	123.0					15																	87089240		1902	4120	6022	SO:0001583	missense	123624	exon19			TTTTCTGTGACTT	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2555G>T	15.37:g.87089240G>T	ENSP00000413001:p.Cys852Phe	Somatic	244	0	0		WXS	Illumina HiSeq	Phase_I	201	55	0.273632	NM_152336	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.155644	0.78114	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.10477	2.87;2.87	5.53	5.53	0.82687	Peptidase M14, carboxypeptidase A (1);	0.965353	0.08432	U	0.946782	T	0.38772	0.1053	M	0.69823	2.125	0.50467	D	0.999876	D	0.89917	1.0	D	0.97110	1.0	T	0.01848	-1.1261	10	0.87932	D	0	-3.2391	18.6325	0.91364	0.0:0.0:1.0:0.0	.	852	Q96MI9	CBPC4_HUMAN	F	887;852;583	ENSP00000397173:C852F;ENSP00000373949:C583F	ENSP00000373949:C583F	C	+	2	0	AGBL1	84890244	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.072000	0.93986	2.882000	0.98803	0.655000	0.94253	TGT	.	.	none		0.433	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
GABRD	2563	hgsc.bcm.edu	37	1	1961467	1961467	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:1961467G>A	ENST00000378585.4	+	9	1188	c.1105G>A	c.(1105-1107)Ggc>Agc	p.G369S		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	369					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTCTGCTGCCGGCGTCACGCA	0.682																																					p.G369S		Atlas-SNP	.											GABRD,NS,malignant_melanoma,-1,1	GABRD	49	1	0			c.G1105A						scavenged	.						40.0	41.0	40.0					1																	1961467		2199	4289	6488	SO:0001583	missense	2563	exon9			GCTGCCGGCGTCA	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.1105G>A	1.37:g.1961467G>A	ENSP00000367848:p.Gly369Ser	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	112	2	0.0178571	NM_000815	Q8N4N9	Missense_Mutation	SNP	ENST00000378585.4	37	CCDS36.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105146	0.77096	.	.	ENSG00000187730	ENST00000378585	D	0.84298	-1.83	3.82	3.82	0.43975	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.128751	0.51477	D	0.000083	D	0.84097	0.5397	L	0.39085	1.19	0.58432	D	0.999999	D	0.69078	0.997	P	0.55222	0.771	T	0.81833	-0.0751	10	0.27082	T	0.32	-20.7859	13.3928	0.60832	0.0:0.0:1.0:0.0	.	369	O14764	GBRD_HUMAN	S	369	ENSP00000367848:G369S	ENSP00000367848:G369S	G	+	1	0	GABRD	1951327	1.000000	0.71417	0.672000	0.29872	0.911000	0.54048	5.775000	0.68915	2.145000	0.66743	0.491000	0.48974	GGC	.	.	none		0.682	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098493.1	NM_000815	
ADCY2	108	hgsc.bcm.edu	37	5	7709382	7709382	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:7709382A>C	ENST00000338316.4	+	10	1549	c.1460A>C	c.(1459-1461)aAa>aCa	p.K487T	ADCY2_ENST00000537121.1_Missense_Mutation_p.K307T|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	487					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GATGGAGCCAAAATGAGGGCC	0.592																																					p.K487T		Atlas-SNP	.											.	ADCY2	337	.	0			c.A1460C						PASS	.						73.0	65.0	68.0					5																	7709382		2203	4300	6503	SO:0001583	missense	108	exon10			GAGCCAAAATGAG	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1460A>C	5.37:g.7709382A>C	ENSP00000342952:p.Lys487Thr	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	72	32	0.444444	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	a	19.22	3.785732	0.70337	.	.	ENSG00000078295	ENST00000338316;ENST00000537121	T;D	0.82526	-1.15;-1.62	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.84853	0.5564	M	0.81497	2.545	0.50313	D	0.999862	B;B	0.18461	0.015;0.028	B;B	0.25759	0.041;0.063	T	0.82548	-0.0402	10	0.52906	T	0.07	.	15.8247	0.78690	1.0:0.0:0.0:0.0	.	307;487	B7Z2C1;Q08462	.;ADCY2_HUMAN	T	487;307	ENSP00000342952:K487T;ENSP00000444803:K307T	ENSP00000342952:K487T	K	+	2	0	ADCY2	7762382	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	5.844000	0.69430	2.137000	0.66172	0.456000	0.33151	AAA	.	.	none		0.592	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
PCDHA7	56141	hgsc.bcm.edu	37	5	140215022	140215022	+	Missense_Mutation	SNP	C	C	A	rs150063888		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:140215022C>A	ENST00000525929.1	+	1	1054	c.1054C>A	c.(1054-1056)Ctc>Atc	p.L352I	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.L352I|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	352	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L352F(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGTTGACTCTCACTTCCCT	0.507																																					p.L352I	NSCLC(160;258 2013 5070 22440 28951)	Atlas-SNP	.											PCDHA7,shoulder,malignant_melanoma,0,1	PCDHA7	367	1	1	Substitution - Missense(1)	skin(1)	c.C1054A						scavenged	.						181.0	157.0	165.0					5																	140215022		2203	4299	6502	SO:0001583	missense	56141	exon1			TTGACTCTCACTT	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1054C>A	5.37:g.140215022C>A	ENSP00000436426:p.Leu352Ile	Somatic	328	6	0.0182927		WXS	Illumina HiSeq	Phase_I	457	7	0.0153173	NM_031852	O75282	Missense_Mutation	SNP	ENST00000525929.1	37	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	C	0.413	-0.912035	0.02415	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.61274	0.12;0.26	4.04	-1.41	0.08941	Cadherin (2);Cadherin-like (1);	0.343115	0.15286	N	0.270413	T	0.21347	0.0514	N	0.03268	-0.37	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.001	T	0.19877	-1.0292	10	0.05833	T	0.94	.	2.2003	0.03921	0.3512:0.1209:0.4122:0.1158	.	352;352	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	I	352	ENSP00000436426:L352I;ENSP00000367365:L352I	ENSP00000367365:L352I	L	+	1	0	PCDHA7	140195206	0.000000	0.05858	0.000000	0.03702	0.882000	0.50991	-3.197000	0.00562	-0.656000	0.05380	0.305000	0.20034	CTC	.	.	alt		0.507	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
ANK3	288	hgsc.bcm.edu	37	10	61845008	61845008	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:61845008C>T	ENST00000280772.2	-	31	3943	c.3752G>A	c.(3751-3753)gGc>gAc	p.G1251D	ANK3_ENST00000503366.1_Missense_Mutation_p.G1252D|ANK3_ENST00000373827.2_Missense_Mutation_p.G1245D|ANK3_ENST00000355288.2_Missense_Mutation_p.G385D	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1251	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						AGGCGAAGTGCCCCCTGAGAG	0.428																																					p.G1252D		Atlas-SNP	.											.	ANK3	703	.	0			c.G3755A						PASS	.						64.0	61.0	62.0					10																	61845008		2203	4300	6503	SO:0001583	missense	288	exon32			GAAGTGCCCCCTG	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.3752G>A	10.37:g.61845008C>T	ENSP00000280772:p.Gly1251Asp	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	90	4	0.0444444	NM_001204404	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	34	5.383214	0.95967	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000544789;ENST00000536348	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	6.17	6.17	0.99709	.	0.000000	0.42821	D	0.000647	T	0.66733	0.2819	M	0.89904	3.07	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0;0.996;1.0	D;D;D;D;D;D;D	0.97110	0.98;1.0;0.999;1.0;0.999;0.982;0.999	T	0.70949	-0.4733	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1252;385;784;1245;1251;486;385	E9PE32;A8KA62;Q59G01;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;.;ANK3_HUMAN;.;.	D	1251;1245;385;385;1252;1231;486;886;886;384;784	ENSP00000280772:G1251D;ENSP00000362933:G1245D;ENSP00000347436:G385D;ENSP00000425236:G1252D	ENSP00000280772:G1251D	G	-	2	0	ANK3	61515014	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.797000	0.85911	2.941000	0.99782	0.655000	0.94253	GGC	.	.	none		0.428	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
CHST11	50515	hgsc.bcm.edu	37	12	105150950	105150950	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:105150950A>C	ENST00000303694.5	+	3	867	c.428A>C	c.(427-429)aAg>aCg	p.K143T	CHST11_ENST00000549260.1_Missense_Mutation_p.K138T	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	143					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						GGGCGGGGGAAGTACAGCGAC	0.602																																					p.K143T		Atlas-SNP	.											.	CHST11	54	.	0			c.A428C						PASS	.						69.0	69.0	69.0					12																	105150950		2203	4300	6503	SO:0001583	missense	50515	exon3			GGGGGAAGTACAG	AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.428A>C	12.37:g.105150950A>C	ENSP00000305725:p.Lys143Thr	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	154	64	0.415584	NM_018413	A8K4F8|Q9NXY6|Q9NY36	Missense_Mutation	SNP	ENST00000303694.5	37	CCDS9099.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.623524	0.46840	.	.	ENSG00000171310	ENST00000549260;ENST00000303694;ENST00000549016	T;T;T	0.73363	-0.74;-0.74;-0.74	5.42	5.42	0.78866	.	0.089513	0.85682	D	0.000000	T	0.66645	0.2810	L	0.33485	1.01	0.80722	D	1	P;P	0.43169	0.762;0.8	B;B	0.41988	0.255;0.372	T	0.65529	-0.6146	10	0.27785	T	0.31	-8.0608	15.4614	0.75359	1.0:0.0:0.0:0.0	.	138;143	Q9NPF2-2;Q9NPF2	.;CHSTB_HUMAN	T	138;143;103	ENSP00000450004:K138T;ENSP00000305725:K143T;ENSP00000449095:K103T	ENSP00000305725:K143T	K	+	2	0	CHST11	103675080	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.355000	0.79434	2.065000	0.61736	0.533000	0.62120	AAG	.	.	none		0.602	CHST11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405960.2	NM_018413	
ITSN1	6453	hgsc.bcm.edu	37	21	35258754	35258754	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr21:35258754C>T	ENST00000381318.3	+	39	5295	c.5007C>T	c.(5005-5007)ttC>ttT	p.F1669F	AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000437442.2_Silent_p.F1608F|ITSN1_ENST00000399367.3_Silent_p.F1664F|ITSN1_ENST00000399326.3_3'UTR|ITSN1_ENST00000381285.4_Silent_p.F1669F	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1669	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						GGGACCAGTTCTCACCAGATG	0.542																																					p.F1669F		Atlas-SNP	.											ITSN1,colon,carcinoma,+2,1	ITSN1	166	1	0			c.C5007T						scavenged	.						96.0	77.0	83.0					21																	35258754		2203	4300	6503	SO:0001819	synonymous_variant	6453	exon39			CCAGTTCTCACCA	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.5007C>T	21.37:g.35258754C>T		Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	120	2	0.0166667	NM_003024	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Silent	SNP	ENST00000381318.3	37	CCDS33545.1																																																																																			.	.	none		0.542	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
TSPAN2	10100	hgsc.bcm.edu	37	1	115604799	115604799	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:115604799C>T	ENST00000369516.2	-	3	258	c.227G>A	c.(226-228)gGg>gAg	p.G76E	TSPAN2_ENST00000369515.2_Missense_Mutation_p.G76E|TSPAN2_ENST00000369514.2_Missense_Mutation_p.G76E	NM_005725.4	NP_005716.2	O60636	TSN2_HUMAN	tetraspanin 2	76					astrocyte development (GO:0014002)|axon development (GO:0061564)|brain development (GO:0007420)|inflammatory response (GO:0006954)|microglia development (GO:0014005)|myelination (GO:0042552)|oligodendrocyte differentiation (GO:0048709)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(4)|lung(3)|pancreas(1)|prostate(1)	10	Lung SC(450;0.211)	all_cancers(81;2.9e-07)|all_epithelial(167;1.42e-06)|all_lung(203;6.72e-06)|Lung NSC(69;1.13e-05)|Acute lymphoblastic leukemia(138;0.191)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)		TCCGCAGCACCCGAAGAACCC	0.632																																					p.G76E		Atlas-SNP	.											TSPAN2,NS,carcinoma,+1,1	TSPAN2	37	1	0			c.G227A						scavenged	.						54.0	47.0	49.0					1																	115604799		2203	4297	6500	SO:0001583	missense	10100	exon3			CAGCACCCGAAGA	AF054839	CCDS881.1	1p13.1	2013-02-14			ENSG00000134198	ENSG00000134198		"""Tetraspanins"""	20659	protein-coding gene	gene with protein product		613133				9714763, 11739647	Standard	NM_005725		Approved	TSPAN-2, TSN2, FLJ12082	uc001eft.3	O60636	OTTHUMG00000011878	ENST00000369516.2:c.227G>A	1.37:g.115604799C>T	ENSP00000358529:p.Gly76Glu	Somatic	308	0	0		WXS	Illumina HiSeq	Phase_I	275	4	0.0145455	NM_005725	D6PTH4|Q5TET2|Q8WU05	Missense_Mutation	SNP	ENST00000369516.2	37	CCDS881.1	.	.	.	.	.	.	.	.	.	.	C	32	5.119025	0.94385	.	.	ENSG00000134198	ENST00000369516;ENST00000369515;ENST00000433172;ENST00000369514	D;D;D;D	0.94897	-3.55;-3.55;-3.55;-3.55	5.56	5.56	0.83823	Tetraspanin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97823	0.9285	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98523	1.0624	10	0.87932	D	0	.	18.2921	0.90134	0.0:1.0:0.0:0.0	.	76	O60636	TSN2_HUMAN	E	76;76;70;76	ENSP00000358529:G76E;ENSP00000358528:G76E;ENSP00000415256:G70E;ENSP00000358527:G76E	ENSP00000358527:G76E	G	-	2	0	TSPAN2	115406322	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	6.961000	0.76042	2.619000	0.88677	0.462000	0.41574	GGG	.	.	none		0.632	TSPAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032828.1	NM_005725	
ANXA7	310	hgsc.bcm.edu	37	10	75139679	75139679	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:75139679G>A	ENST00000372921.5	-	11	1179	c.1123C>T	c.(1123-1125)Cgt>Tgt	p.R375C	RP11-537A6.9_ENST00000427492.1_RNA|ANXA7_ENST00000535178.1_Missense_Mutation_p.R245C	NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7	397					autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)	p.R397C(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					GAAAACTCACGGCTCACACTG	0.338																																					p.R397C		Atlas-SNP	.											ANXA7,colon,carcinoma,0,1	ANXA7	50	1	1	Substitution - Missense(1)	large_intestine(1)	c.C1189T						scavenged	.						164.0	175.0	171.0					10																	75139679		2203	4300	6503	SO:0001583	missense	310	exon12			ACTCACGGCTCAC	J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.1123C>T	10.37:g.75139679G>A	ENSP00000362012:p.Arg375Cys	Somatic	216	1	0.00462963		WXS	Illumina HiSeq	Phase_I	197	4	0.0203046	NM_004034	Q5F2H3|Q5T0M6|Q5T0M7	Missense_Mutation	SNP	ENST00000372921.5	37	CCDS7325.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.807160	0.70797	.	.	ENSG00000138279	ENST00000372921;ENST00000372919;ENST00000535178	T;T;T	0.03441	3.93;3.93;3.93	5.65	4.73	0.59995	Annexin repeat, conserved site (1);	0.159895	0.43416	D	0.000562	T	0.19886	0.0478	M	0.87328	2.875	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.74023	0.982;0.953;0.969;0.982	T	0.00899	-1.1522	10	0.87932	D	0	.	12.1681	0.54141	0.0:0.0:0.8292:0.1708	.	375;302;375;397	Q53HM8;B4DWU2;P20073-2;P20073	.;.;.;ANXA7_HUMAN	C	375;397;245	ENSP00000362012:R375C;ENSP00000362010:R397C;ENSP00000442864:R245C	ENSP00000362010:R397C	R	-	1	0	ANXA7	74809685	0.993000	0.37304	0.423000	0.26634	0.980000	0.70556	2.090000	0.41682	1.483000	0.48342	0.655000	0.94253	CGT	.	.	none		0.338	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048646.2	NM_001156	
TBC1D23	55773	hgsc.bcm.edu	37	3	100039768	100039768	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:100039768G>C	ENST00000394144.4	+	18	1978	c.1971G>C	c.(1969-1971)aaG>aaC	p.K657N	TBC1D23_ENST00000486274.1_3'UTR|TBC1D23_ENST00000344949.5_Missense_Mutation_p.K642N|TBC1D23_ENST00000475134.1_Missense_Mutation_p.K520N	NM_001199198.2	NP_001186127.1	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	657					positive regulation of interleukin-6 production (GO:0032755)|regulation of inflammatory response (GO:0050727)|regulation of tumor necrosis factor production (GO:0032680)		Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(10)|ovary(1)|prostate(2)|skin(2)	25						TTACCTTCAAGTATGGAAATA	0.328																																					p.K657N		Atlas-SNP	.											.	TBC1D23	133	.	0			c.G1971C						PASS	.						64.0	65.0	64.0					3																	100039768		2203	4300	6503	SO:0001583	missense	55773	exon18			CTTCAAGTATGGA	AK001908	CCDS2936.1, CCDS56265.1	3q12.2	2013-07-10			ENSG00000036054	ENSG00000036054			25622	protein-coding gene	gene with protein product						22312129	Standard	NM_001199198		Approved	FLJ11046	uc003dtt.4	Q9NUY8	OTTHUMG00000159067	ENST00000394144.4:c.1971G>C	3.37:g.100039768G>C	ENSP00000377700:p.Lys657Asn	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	85	28	0.329412	NM_001199198	B9A6M5|Q8TCN8|Q8WUB7|Q96D90|Q9NV75	Missense_Mutation	SNP	ENST00000394144.4	37	CCDS56265.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495039	0.64186	.	.	ENSG00000036054	ENST00000344949;ENST00000394144;ENST00000475134	T;T;T	0.43294	0.95;0.96;1.02	5.55	3.76	0.43208	.	0.000000	0.85682	D	0.000000	T	0.58764	0.2145	M	0.73962	2.25	0.80722	D	1	D;D	0.76494	0.994;0.999	P;D	0.69479	0.829;0.964	T	0.57177	-0.7856	9	.	.	.	.	8.4773	0.33021	0.3074:0.0:0.6926:0.0	.	657;642	Q9NUY8;Q9NUY8-2	TBC23_HUMAN;.	N	642;657;520	ENSP00000340693:K642N;ENSP00000377700:K657N;ENSP00000418059:K520N	.	K	+	3	2	TBC1D23	101522458	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.160000	0.31761	0.694000	0.31654	0.655000	0.94253	AAG	.	.	none		0.328	TBC1D23-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353150.1	NM_018309	
MUC4	4585	hgsc.bcm.edu	37	3	195515038	195515038	+	Missense_Mutation	SNP	G	G	A	rs201206859		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:195515038G>A	ENST00000463781.3	-	2	3872	c.3413C>T	c.(3412-3414)cCt>cTt	p.P1138L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P1138L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	605					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P1138L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGAGGT	0.567																																					p.P1138L		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - Missense(1)	endometrium(1)	c.C3413T						scavenged	.																																			SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3413C>T	3.37:g.195515038G>A	ENSP00000417498:p.Pro1138Leu	Somatic	76	2	0.0263158		WXS	Illumina HiSeq	Phase_I	106	5	0.0471698	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.066	0.197826	0.09652	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33865	1.39;1.39	0.814	0.814	0.18756	.	.	.	.	.	T	0.38108	0.1028	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	D	0.74674	0.984	T	0.21280	-1.0250	8	.	.	.	.	7.6132	0.28142	0.0:0.0:1.0:0.0	.	1138	E7ESK3	.	L	1138	ENSP00000417498:P1138L;ENSP00000420243:P1138L	.	P	-	2	0	MUC4	196999433	0.002000	0.14202	0.001000	0.08648	0.065000	0.16274	1.050000	0.30404	0.776000	0.33473	0.064000	0.15345	CCT	.	.	weak		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
RGS6	9628	hgsc.bcm.edu	37	14	72976974	72976974	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:72976974T>C	ENST00000553530.1	+	14	1285	c.1078T>C	c.(1078-1080)Tca>Cca	p.S360P	RGS6_ENST00000553525.1_Missense_Mutation_p.S360P|RGS6_ENST00000343854.6_Missense_Mutation_p.S323P|RGS6_ENST00000355512.6_Missense_Mutation_p.S360P|RGS6_ENST00000434263.2_Missense_Mutation_p.S291P|RGS6_ENST00000402788.2_Missense_Mutation_p.S360P|RGS6_ENST00000404301.2_Missense_Mutation_p.S360P|RGS6_ENST00000407322.4_Missense_Mutation_p.S360P|RGS6_ENST00000406236.4_Missense_Mutation_p.S360P|RGS6_ENST00000554782.1_Missense_Mutation_p.S221P|RGS6_ENST00000556437.1_Missense_Mutation_p.S360P|RGS6_ENST00000555571.1_Missense_Mutation_p.S360P	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	360	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CGAATTCAGTTCAGAAAACCT	0.458																																					p.S360P	Ovarian(143;1926 2468 21071 48641)	Atlas-SNP	.											.	RGS6	92	.	0			c.T1078C						PASS	.						89.0	100.0	96.0					14																	72976974		2203	4300	6503	SO:0001583	missense	9628	exon14			TTCAGTTCAGAAA	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.1078T>C	14.37:g.72976974T>C	ENSP00000452331:p.Ser360Pro	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	90	31	0.344444	NM_001204424	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	ENST00000553530.1	37	CCDS9808.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.188405	0.78789	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000343854;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T;T	0.02121	4.44;4.44;4.44;4.44;4.44;4.44;4.44;4.44;4.44;4.44;4.44;4.44	5.72	5.72	0.89469	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.13457	0.0326	M	0.78049	2.395	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.97110	0.999;0.973;1.0;0.971	T	0.00110	-1.2048	10	0.62326	D	0.03	-9.758	16.2988	0.82793	0.0:0.0:0.0:1.0	.	291;360;365;360	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	P	360;360;360;360;360;360;360;360;360;323;332;291;221;221	ENSP00000451030:S360P;ENSP00000450936:S360P;ENSP00000452331:S360P;ENSP00000451855:S360P;ENSP00000347699:S360P;ENSP00000385243:S360P;ENSP00000384218:S360P;ENSP00000384612:S360P;ENSP00000383953:S360P;ENSP00000341199:S323P;ENSP00000412144:S291P;ENSP00000451912:S221P	ENSP00000341199:S323P	S	+	1	0	RGS6	72046727	1.000000	0.71417	0.980000	0.43619	0.978000	0.69477	7.997000	0.88414	2.311000	0.77944	0.533000	0.62120	TCA	.	.	none		0.458	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2		
EEF1B2	1933	hgsc.bcm.edu	37	2	207024768	207024768	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:207024768A>G	ENST00000392222.2	+	1	440	c.65A>G	c.(64-66)aAg>aGg	p.K22R	NDUFS1_ENST00000432169.1_5'Flank|NDUFS1_ENST00000423725.1_5'Flank|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000449699.1_5'Flank|NDUFS1_ENST00000233190.6_5'Flank|EEF1B2_ENST00000236957.5_Missense_Mutation_p.K22R|SNORA41_ENST00000384675.1_RNA|EEF1B2_ENST00000392221.1_Missense_Mutation_p.K22R|NDUFS1_ENST00000457011.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	22	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)			breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						CTGGCGGACAAGAGCTACATC	0.682																																					p.K22R		Atlas-SNP	.											EEF1B2,colon,carcinoma,-1,1	EEF1B2	58	1	0			c.A65G						scavenged	.						40.0	46.0	44.0					2																	207024768		2203	4299	6502	SO:0001583	missense	1933	exon2			CGGACAAGAGCTA	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.65A>G	2.37:g.207024768A>G	ENSP00000376056:p.Lys22Arg	Somatic	163	2	0.0122699		WXS	Illumina HiSeq	Phase_I	110	5	0.0454545	NM_021121	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	A	6.084	0.383763	0.11524	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	4.8	1.01	0.19927	Glutathione S-transferase, C-terminal-like (2);	0.258042	0.38548	N	0.001652	T	0.12135	0.0295	N	0.05306	-0.075	0.39419	D	0.966889	B	0.06786	0.001	B	0.10450	0.005	T	0.31916	-0.9926	10	0.02654	T	1	-6.5504	5.1665	0.15088	0.7193:0.0:0.148:0.1327	.	22	P24534	EF1B_HUMAN	R	22	ENSP00000236957:K22R;ENSP00000376055:K22R;ENSP00000376056:K22R;ENSP00000407730:K22R	ENSP00000236957:K22R	K	+	2	0	EEF1B2	206733013	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.389000	0.44407	0.024000	0.15214	-0.290000	0.09829	AAG	.	.	weak		0.682	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
SPHKAP	80309	hgsc.bcm.edu	37	2	228882763	228882763	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:228882763G>A	ENST00000392056.3	-	7	2853	c.2807C>T	c.(2806-2808)aCg>aTg	p.T936M	SPHKAP_ENST00000344657.5_Missense_Mutation_p.T936M	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	936	PKA-RII subunit binding domain. {ECO:0000250}.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.T936R(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGAGACGACCGTGTCTGCTAA	0.473																																					p.T936M		Atlas-SNP	.											SPHKAP_ENST00000392056,NS,carcinoma,0,2	SPHKAP	750	2	2	Substitution - Missense(2)	lung(2)	c.C2807T						scavenged	.						177.0	159.0	165.0					2																	228882763		2203	4300	6503	SO:0001583	missense	80309	exon7			ACGACCGTGTCTG		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2807C>T	2.37:g.228882763G>A	ENSP00000375909:p.Thr936Met	Somatic	201	1	0.00497512		WXS	Illumina HiSeq	Phase_I	159	68	0.427673	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530106	0.45073	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.26067	1.78;1.76	6.08	5.18	0.71444	.	0.044191	0.85682	N	0.000000	T	0.30916	0.0780	L	0.32530	0.975	0.58432	D	0.999993	D;D	0.67145	0.996;0.996	P;P	0.52881	0.462;0.712	T	0.03453	-1.1035	10	0.52906	T	0.07	.	13.6707	0.62422	0.0763:0.0:0.9237:0.0	.	936;936	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	M	936	ENSP00000375909:T936M;ENSP00000339886:T936M	ENSP00000339886:T936M	T	-	2	0	SPHKAP	228591007	1.000000	0.71417	0.897000	0.35233	0.273000	0.26683	7.275000	0.78548	1.520000	0.48965	0.655000	0.94253	ACG	.	.	none		0.473	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
YIPF7	285525	hgsc.bcm.edu	37	4	44652108	44652108	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:44652108A>C	ENST00000332990.5	-	2	98	c.82T>G	c.(82-84)Ttg>Gtg	p.L28V	YIPF7_ENST00000415895.4_Missense_Mutation_p.L4V	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	28						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						AATTGTGCCAAGTTTGACATC	0.299																																					p.L28V		Atlas-SNP	.											.	YIPF7	33	.	0			c.T82G						PASS	.						39.0	36.0	37.0					4																	44652108		1809	4068	5877	SO:0001583	missense	285525	exon2			GTGCCAAGTTTGA	AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.82T>G	4.37:g.44652108A>C	ENSP00000332772:p.Leu28Val	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	101	45	0.445545	NM_182592	Q3SY21|Q3SY22	Missense_Mutation	SNP	ENST00000332990.5	37	CCDS54766.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.39|12.39	1.923362|1.923362	0.33908|0.33908	.|.	.|.	ENSG00000177752|ENSG00000177752	ENST00000415895|ENST00000332990	.|T	.|0.43294	.|0.95	5.45|5.45	0.453|0.453	0.16639|0.16639	.|.	.|.	.|.	.|.	.|.	T|T	0.19846|0.19846	0.0477|0.0477	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	0.999998|0.999998	.|B;B	.|0.23806	.|0.091;0.002	.|B;B	.|0.19946	.|0.027;0.009	T|T	0.19516|0.19516	-1.0303|-1.0303	5|9	.|0.16896	.|T	.|0.51	-0.5497|-0.5497	0.8365|0.8365	0.01141|0.01141	0.5011:0.1696:0.1654:0.1639|0.5011:0.1696:0.1654:0.1639	.|.	.|28;28	.|Q8N8F6-4;Q8N8F6	.|.;YIPF7_HUMAN	R|V	4|28	.|ENSP00000332772:L28V	.|ENSP00000332772:L28V	L|L	-|-	2|1	0|2	YIPF7|YIPF7	44346865|44346865	0.980000|0.980000	0.34600|0.34600	0.977000|0.977000	0.42913|0.42913	0.976000|0.976000	0.68499|0.68499	0.167000|0.167000	0.16602|0.16602	0.549000|0.549000	0.28973|0.28973	0.524000|0.524000	0.50904|0.50904	CTT|TTG	.	.	none		0.299	YIPF7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_182592	
MUC17	140453	hgsc.bcm.edu	37	7	100678405	100678405	+	Silent	SNP	T	T	C	rs4729648	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:100678405T>C	ENST00000306151.4	+	3	3772	c.3708T>C	c.(3706-3708)gcT>gcC	p.A1236A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1236	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTTCTGAGGCTAGCACCCTTT	0.522													T|||	989	0.197484	0.2663	0.0893	5008	,	,		30674	0.2212		0.1083	False		,,,				2504	0.2485				p.A1236A		Atlas-SNP	.											MUC17,caecum,carcinoma,0,1	MUC17	804	1	0			c.T3708C						scavenged	.	T		340,4066	144.2+/-179.2	0,340,1863	305.0	293.0	297.0		3708	-0.9	0.0	7	dbSNP_111	297	209,8391	66.0+/-128.3	0,209,4091	no	coding-synonymous	MUC17	NM_001040105.1		0,549,5954	CC,CT,TT		2.4302,7.7167,4.2211		1236/4494	100678405	549,12457	2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			TGAGGCTAGCACC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3708T>C	7.37:g.100678405T>C		Somatic	116	17	0.146552		WXS	Illumina HiSeq	Phase_I	151	44	0.291391	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																			T|0.936;C|0.064	0.064	strong		0.522	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MAP3K1	4214	hgsc.bcm.edu	37	5	56189428	56189428	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:56189428G>A	ENST00000399503.3	+	20	4460	c.4460G>A	c.(4459-4461)cGt>cAt	p.R1487H		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1487	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GTGGCTCTTCGTTGTTTAGAA	0.448																																					p.R1487H		Atlas-SNP	.											MAP3K1,colon,carcinoma,+1,1	MAP3K1	355	1	0			c.G4460A						scavenged	.						132.0	125.0	127.0					5																	56189428		1966	4168	6134	SO:0001583	missense	4214	exon20			CTCTTCGTTGTTT	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.4460G>A	5.37:g.56189428G>A	ENSP00000382423:p.Arg1487His	Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	169	2	0.0118343	NM_005921		Missense_Mutation	SNP	ENST00000399503.3	37	CCDS43318.1	.	.	.	.	.	.	.	.	.	.	G	33	5.199784	0.94997	.	.	ENSG00000095015	ENST00000399503	T	0.67345	-0.26	6.04	6.04	0.98038	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80654	0.4664	L	0.54863	1.705	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80313	-0.1435	10	0.87932	D	0	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	1487	Q13233	M3K1_HUMAN	H	1487	ENSP00000382423:R1487H	ENSP00000382423:R1487H	R	+	2	0	MAP3K1	56225185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.554000	0.90689	2.873000	0.98535	0.561000	0.74099	CGT	.	.	none		0.448	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
ZMYM4	9202	hgsc.bcm.edu	37	1	35847205	35847205	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:35847205T>G	ENST00000314607.6	+	9	1495	c.1415T>G	c.(1414-1416)tTc>tGc	p.F472C	ZMYM4_ENST00000373297.2_Missense_Mutation_p.F472C	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	472					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GATGCCTGCTTCTCTAAGTTT	0.418																																					p.F472C		Atlas-SNP	.											ZMYM4,NS,carcinoma,-1,1	ZMYM4	143	1	0			c.T1415G						scavenged	.						199.0	185.0	190.0					1																	35847205		2203	4300	6503	SO:0001583	missense	9202	exon9			CCTGCTTCTCTAA	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1415T>G	1.37:g.35847205T>G	ENSP00000322915:p.Phe472Cys	Somatic	122	1	0.00819672		WXS	Illumina HiSeq	Phase_I	128	33	0.257812	NM_005095	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.090933	0.76756	.	.	ENSG00000146463	ENST00000314607;ENST00000373297	T;T	0.49720	0.77;1.11	5.01	5.01	0.66863	TRASH (1);	0.000000	0.85682	D	0.000000	T	0.69214	0.3086	M	0.77313	2.365	0.24658	N	0.993483	D	0.89917	1.0	D	0.91635	0.999	T	0.65051	-0.6262	10	0.72032	D	0.01	-2.4899	15.0118	0.71555	0.0:0.0:0.0:1.0	.	472	Q5VZL5	ZMYM4_HUMAN	C	472	ENSP00000322915:F472C;ENSP00000362394:F472C	ENSP00000322915:F472C	F	+	2	0	ZMYM4	35619792	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.608000	0.82898	2.012000	0.59069	0.482000	0.46254	TTC	.	.	none		0.418	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
DSCAM	1826	hgsc.bcm.edu	37	21	41446993	41446993	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr21:41446993C>T	ENST00000400454.1	-	27	5336	c.4859G>A	c.(4858-4860)cGg>cAg	p.R1620Q		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1620					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CTGCTCCCGCCGCCTCCTCCG	0.627																																					p.R1620Q	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											DSCAM,NS,carcinoma,-1,1	DSCAM	347	1	0			c.G4859A						PASS	.						63.0	79.0	73.0					21																	41446993		2109	4217	6326	SO:0001583	missense	1826	exon27			TCCCGCCGCCTCC	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.4859G>A	21.37:g.41446993C>T	ENSP00000383303:p.Arg1620Gln	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	128	52	0.40625	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	34	5.302381	0.95601	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.59638	0.25;0.37	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.64227	0.2579	L	0.36672	1.1	0.44388	D	0.99729	D	0.89917	1.0	P	0.55965	0.788	T	0.61879	-0.6972	10	0.41790	T	0.15	.	19.812	0.96551	0.0:1.0:0.0:0.0	.	1620	O60469	DSCAM_HUMAN	Q	1620;1372	ENSP00000383303:R1620Q;ENSP00000385342:R1372Q	ENSP00000383303:R1620Q	R	-	2	0	DSCAM	40368863	1.000000	0.71417	0.509000	0.27700	0.879000	0.50718	7.395000	0.79876	2.685000	0.91497	0.655000	0.94253	CGG	.	.	none		0.627	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
LEPREL1	55214	hgsc.bcm.edu	37	3	189675751	189675751	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:189675751C>T	ENST00000319332.5	-	15	2274	c.2077G>A	c.(2077-2079)Gaa>Aaa	p.E693K	LEPREL1_ENST00000427335.2_Missense_Mutation_p.E512K	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	693					collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CCTTGCTGTTCTTGATCCAGA	0.323											OREG0015985	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E693K		Atlas-SNP	.											LEPREL1,NS,carcinoma,0,1	LEPREL1	95	1	0			c.G2077A						scavenged	.						214.0	199.0	204.0					3																	189675751		2203	4300	6503	SO:0001583	missense	55214	exon15			GCTGTTCTTGATC		CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.2077G>A	3.37:g.189675751C>T	ENSP00000316881:p.Glu693Lys	Somatic	185	0	0	2032	WXS	Illumina HiSeq	Phase_I	205	4	0.0195122	NM_018192	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Missense_Mutation	SNP	ENST00000319332.5	37	CCDS3294.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393038	0.62066	.	.	ENSG00000090530	ENST00000319332;ENST00000427335	T;T	0.35973	1.28;1.61	4.89	4.89	0.63831	.	0.160826	0.56097	D	0.000031	T	0.22244	0.0536	N	0.14661	0.345	0.44289	D	0.997159	B	0.25667	0.131	B	0.18561	0.022	T	0.05683	-1.0870	9	.	.	.	-14.9178	16.1215	0.81361	0.0:1.0:0.0:0.0	.	693	Q8IVL5	P3H2_HUMAN	K	693;512	ENSP00000316881:E693K;ENSP00000408947:E512K	.	E	-	1	0	LEPREL1	191158445	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	2.632000	0.46511	2.648000	0.89879	0.650000	0.86243	GAA	.	.	none		0.323	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343855.1	NM_018192	
PCDHGB2	56103	hgsc.bcm.edu	37	5	140741034	140741034	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:140741034C>T	ENST00000522605.1	+	1	1332	c.1332C>T	c.(1330-1332)gaC>gaT	p.D444D	PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	444	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACATCTCCGACGTCAACGATA	0.552																																					p.D444D		Atlas-SNP	.											.	PCDHGB2	196	.	0			c.C1332T						PASS	.						105.0	109.0	108.0					5																	140741034		2069	4208	6277	SO:0001819	synonymous_variant	56103	exon1			CTCCGACGTCAAC	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1332C>T	5.37:g.140741034C>T		Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	145	92	0.634483	NM_018923	Q3MIJ3|Q9UN65	Silent	SNP	ENST00000522605.1	37	CCDS54924.1																																																																																			.	.	none		0.552	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
CHKA	1119	hgsc.bcm.edu	37	11	67833918	67833918	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:67833918C>T	ENST00000265689.4	-	8	1020	c.994G>A	c.(994-996)Gaa>Aaa	p.E332K	CHKA_ENST00000356135.5_Missense_Mutation_p.E314K	NM_001277.2	NP_001268.2	P35790	CHKA_HUMAN	choline kinase alpha	332					CDP-choline pathway (GO:0006657)|choline metabolic process (GO:0019695)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline binding (GO:0033265)|choline kinase activity (GO:0004103)|cholinesterase activity (GO:0004104)|drug binding (GO:0008144)|ethanolamine kinase activity (GO:0004305)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13					Choline(DB00122)	CTGCTGTATTCGAAATCAATG	0.338																																					p.E332K		Atlas-SNP	.											.	CHKA	41	.	0			c.G994A						PASS	.						200.0	186.0	191.0					11																	67833918		2200	4294	6494	SO:0001583	missense	1119	exon8			TGTATTCGAAATC	D10704	CCDS8178.1, CCDS8179.1	11q13.1	2008-02-05	2004-04-19	2004-04-21	ENSG00000110721	ENSG00000110721	2.7.1.32		1937	protein-coding gene	gene with protein product		118491	"""choline kinase"""	CHK		1618328, 15003397	Standard	NM_001277		Approved	CKI	uc001onj.3	P35790	OTTHUMG00000167424	ENST00000265689.4:c.994G>A	11.37:g.67833918C>T	ENSP00000265689:p.Glu332Lys	Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	164	57	0.347561	NM_001277	Q8NE29	Missense_Mutation	SNP	ENST00000265689.4	37	CCDS8178.1	.	.	.	.	.	.	.	.	.	.	C	36	5.789905	0.96945	.	.	ENSG00000110721	ENST00000265689;ENST00000356135	D;D	0.86366	-2.11;-2.11	5.63	5.63	0.86233	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.106946	0.64402	D	0.000008	D	0.96134	0.8740	H	0.96633	3.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.97;0.993	D	0.97172	0.9845	10	0.87932	D	0	-21.1536	19.6499	0.95796	0.0:1.0:0.0:0.0	.	314;332	P35790-2;P35790	.;CHKA_HUMAN	K	332;314	ENSP00000265689:E332K;ENSP00000348454:E314K	ENSP00000265689:E332K	E	-	1	0	CHKA	67590494	1.000000	0.71417	0.891000	0.34965	0.990000	0.78478	7.730000	0.84881	2.647000	0.89833	0.491000	0.48974	GAA	.	.	none		0.338	CHKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394570.1	NM_001277	
CSDE1	7812	hgsc.bcm.edu	37	1	115276720	115276720	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:115276720C>A	ENST00000358528.4	-	8	1027	c.601G>T	c.(601-603)Gaa>Taa	p.E201*	CSDE1_ENST00000339438.6_Nonsense_Mutation_p.E170*|CSDE1_ENST00000534699.1_Nonsense_Mutation_p.E201*|CSDE1_ENST00000438362.2_Nonsense_Mutation_p.E247*|CSDE1_ENST00000261443.5_Nonsense_Mutation_p.E170*|CSDE1_ENST00000530886.1_Nonsense_Mutation_p.E71*|CSDE1_ENST00000369530.1_Nonsense_Mutation_p.E216*	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	201	CSD 3.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCACCTCTTTCAATAAAGCCA	0.323																																					p.E247X		Atlas-SNP	.											.	CSDE1	145	.	0			c.G739T						PASS	.						44.0	44.0	44.0					1																	115276720		2203	4300	6503	SO:0001587	stop_gained	7812	exon9			CTCTTTCAATAAA		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.601G>T	1.37:g.115276720C>A	ENSP00000351329:p.Glu201*	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	34	16	0.470588	NM_001242891	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Nonsense_Mutation	SNP	ENST00000358528.4	37	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	C	40	8.400554	0.98794	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699;ENST00000529046	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-7.445	20.6593	0.99626	0.0:1.0:0.0:0.0	.	.	.	.	X	170;247;201;170;71;216;201;71	.	ENSP00000261443:E170X	E	-	1	0	CSDE1	115078243	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.885000	0.99019	0.655000	0.94253	GAA	.	.	none		0.323	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158	
OTOP1	133060	hgsc.bcm.edu	37	4	4199791	4199791	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:4199791G>A	ENST00000296358.4	-	5	794	c.770C>T	c.(769-771)cCa>cTa	p.P257L		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	257					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GCACAGAGTTGGGGGCGTGCA	0.532																																					p.P257L		Atlas-SNP	.											.	OTOP1	118	.	0			c.C770T						PASS	.						64.0	52.0	56.0					4																	4199791		2203	4300	6503	SO:0001583	missense	133060	exon5			AGAGTTGGGGGCG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.770C>T	4.37:g.4199791G>A	ENSP00000296358:p.Pro257Leu	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	150	64	0.426667	NM_177998	A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	G	5.616	0.298361	0.10622	.	.	ENSG00000163982	ENST00000296358	T	0.08807	3.05	4.56	2.75	0.32379	.	0.653632	0.15845	N	0.241839	T	0.08088	0.0202	L	0.44542	1.39	0.09310	N	1	B	0.31351	0.32	B	0.30716	0.119	T	0.24905	-1.0147	10	0.59425	D	0.04	.	7.7448	0.28862	0.0786:0.0:0.6134:0.3079	.	257	Q7RTM1	OTOP1_HUMAN	L	257	ENSP00000296358:P257L	ENSP00000296358:P257L	P	-	2	0	OTOP1	4250692	0.283000	0.24277	0.001000	0.08648	0.003000	0.03518	1.794000	0.38774	0.426000	0.26116	0.404000	0.27445	CCA	.	.	none		0.532	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
GPC6	10082	hgsc.bcm.edu	37	13	93879793	93879793	+	Silent	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr13:93879793G>T	ENST00000377047.4	+	1	699	c.84G>T	c.(82-84)cgG>cgT	p.R28R		NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	28					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				TGAAGGCTCGGAGCTGCGGAG	0.652											OREG0022460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R28R		Atlas-SNP	.											.	GPC6	102	.	0			c.G84T						PASS	.						75.0	74.0	74.0					13																	93879793		2203	4300	6503	SO:0001819	synonymous_variant	10082	exon1			GGCTCGGAGCTGC	AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.84G>T	13.37:g.93879793G>T		Somatic	86	0	0	1301	WXS	Illumina HiSeq	Phase_I	66	26	0.393939	NM_005708	A8K279|Q96SG5|Q96SG8|Q9H1P4	Silent	SNP	ENST00000377047.4	37	CCDS9469.1																																																																																			.	.	none		0.652	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	
SLC35G6	643664	hgsc.bcm.edu	37	17	7386301	7386301	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:7386301A>C	ENST00000412468.2	+	2	1113	c.998A>C	c.(997-999)gAa>gCa	p.E333A	POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	333						integral component of membrane (GO:0016021)		p.E333A(1)									TGTGAGAGGGAAGGGAAGGTG	0.557																																					p.E333A		Atlas-SNP	.											POLR2A_ENST00000412468,NS,carcinoma,0,1	.	.	1	1	Substitution - Missense(1)	prostate(1)	c.A998C						scavenged	.						60.0	58.0	59.0					17																	7386301		2203	4300	6503	SO:0001583	missense	643664	exon2			AGAGGGAAGGGAA		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.998A>C	17.37:g.7386301A>C	ENSP00000396523:p.Glu333Ala	Somatic	141	2	0.0141844		WXS	Illumina HiSeq	Phase_I	132	11	0.0833333	NM_001102614		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	A	2.913	-0.225018	0.06022	.	.	ENSG00000181222	ENST00000412468	T	0.26067	1.76	4.69	1.0	0.19881	.	.	.	.	.	T	0.15609	0.0376	N	0.25647	0.755	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.22626	-1.0211	9	0.36615	T	0.2	-0.2286	5.7938	0.18375	0.4278:0.471:0.1012:0.0	.	333	P0C7Q6	S35G6_HUMAN	A	333	ENSP00000396523:E333A	ENSP00000396523:E333A	E	+	2	0	SLC35G6	7327025	0.886000	0.30341	0.428000	0.26697	0.484000	0.33280	1.649000	0.37281	0.732000	0.32470	0.477000	0.44152	GAA	.	.	none		0.557	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
BMP5	653	hgsc.bcm.edu	37	6	55739470	55739470	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:55739470G>T	ENST00000370830.3	-	1	892	c.194C>A	c.(193-195)cCc>cAc	p.P65H	BMP5_ENST00000446683.2_Missense_Mutation_p.P65H	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	65					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			AAATGGTCTGGGTCTGTGAGG	0.433																																					p.P65H		Atlas-SNP	.											.	BMP5	94	.	0			c.C194A						PASS	.						197.0	177.0	184.0					6																	55739470		2203	4300	6503	SO:0001583	missense	653	exon1			GGTCTGGGTCTGT		CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.194C>A	6.37:g.55739470G>T	ENSP00000359866:p.Pro65His	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	146	31	0.212329	NM_021073	B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	37	CCDS4958.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874739	0.72180	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	D;D	0.91068	-2.78;-2.78	5.71	5.71	0.89125	Transforming growth factor-beta, N-terminal (1);	0.157746	0.64402	D	0.000019	D	0.95937	0.8677	M	0.87381	2.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.95966	0.8966	10	0.87932	D	0	.	19.8478	0.96722	0.0:0.0:1.0:0.0	.	65;65	B4E0Y4;P22003	.;BMP5_HUMAN	H	65	ENSP00000359866:P65H;ENSP00000391818:P65H	ENSP00000359866:P65H	P	-	2	0	BMP5	55847429	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.685000	0.91497	0.650000	0.86243	CCC	.	.	none		0.433	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1		
SLC44A2	57153	hgsc.bcm.edu	37	19	10748564	10748564	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:10748564G>A	ENST00000335757.5	+	18	2104	c.1728G>A	c.(1726-1728)tcG>tcA	p.S576S	SLC44A2_ENST00000586078.1_Silent_p.S576S|SLC44A2_ENST00000588214.1_3'UTR|SLC44A2_ENST00000407327.4_Silent_p.S574S			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	576					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	TCTGCACCTCGGCCAGGAATG	0.577																																					p.S576S		Atlas-SNP	.											.	SLC44A2	56	.	0			c.G1728A						PASS	.						152.0	139.0	144.0					19																	10748564		2203	4300	6503	SO:0001819	synonymous_variant	57153	exon18			CACCTCGGCCAGG	AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.1728G>A	19.37:g.10748564G>A		Somatic	274	0	0		WXS	Illumina HiSeq	Phase_I	237	114	0.481013	NM_020428	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Silent	SNP	ENST00000335757.5	37	CCDS12245.1																																																																																			.	.	none		0.577	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		
FBLN1	2192	hgsc.bcm.edu	37	22	45970519	45970519	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr22:45970519T>C	ENST00000327858.6	+	15	1921	c.1826T>C	c.(1825-1827)tTc>tCc	p.F609S	FBLN1_ENST00000348697.2_Splice_Site_p.F609S	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	609					embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TTCCGCGAGTTCACCCGCCCT	0.642																																					p.F609S		Atlas-SNP	.											.	FBLN1	143	.	0			c.T1826C						PASS	.						131.0	77.0	96.0					22																	45970519		2203	4300	6503	SO:0001583	missense	2192	exon15			GCGAGTTCACCCG		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1826T>C	22.37:g.45970519T>C	ENSP00000331544:p.Phe609Ser	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	46	4	0.0869565	NM_006486	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	T	18.77	3.695144	0.68386	.	.	ENSG00000077942	ENST00000348697;ENST00000327858	D;D	0.83250	-1.59;-1.7	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.85626	0.5740	L	0.32530	0.975	0.52501	D	0.999959	D	0.76494	0.999	D	0.80764	0.994	D	0.85636	0.1273	10	0.44086	T	0.13	.	13.1527	0.59498	0.0:0.0:0.0:1.0	.	609	P23142	FBLN1_HUMAN	S	609	ENSP00000262723:F609S;ENSP00000331544:F609S	ENSP00000331544:F609S	F	+	2	0	FBLN1	44349183	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.632000	0.74281	1.921000	0.55644	0.460000	0.39030	TTC	.	.	none		0.642	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
APC	324	hgsc.bcm.edu	37	5	112173494	112173494	+	Missense_Mutation	SNP	G	G	A	rs559313229	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:112173494G>A	ENST00000457016.1	+	16	2583	c.2203G>A	c.(2203-2205)Gcg>Acg	p.A735T	APC_ENST00000508376.2_Missense_Mutation_p.A735T|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.A735T			P25054	APC_HUMAN	adenomatous polyposis coli	735	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAATAGGCCTGCGAAGTACAA	0.443		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.A735T	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	Atlas-SNP	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,NS,carcinoma,-2,1	APC	4158	1	1	Unknown(1)	skin(1)	c.G2203A						PASS	.						77.0	67.0	71.0					5																	112173494		2202	4300	6502	SO:0001583	missense	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	AGGCCTGCGAAGT	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2203G>A	5.37:g.112173494G>A	ENSP00000413133:p.Ala735Thr	Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	76	23	0.302632	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833345	0.50951	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	T;T;T;T;T	0.64618	-0.11;0.97;-0.11;-0.11;0.97	6.17	5.29	0.74685	Armadillo-like helical (1);Armadillo-type fold (1);	0.046835	0.85682	D	0.000000	T	0.64538	0.2607	M	0.71581	2.175	0.80722	D	1	B;B	0.19935	0.04;0.04	B;B	0.21546	0.023;0.035	T	0.61535	-0.7043	10	0.39692	T	0.17	-18.6539	17.5212	0.87787	0.0:0.1239:0.8761:0.0	.	737;735	Q4LE70;P25054	.;APC_HUMAN	T	735;717;735;735;735	ENSP00000413133:A735T;ENSP00000423224:A717T;ENSP00000257430:A735T;ENSP00000427089:A735T;ENSP00000423828:A735T	ENSP00000257430:A735T	A	+	1	0	APC	112201393	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.663000	0.83820	1.593000	0.50029	0.655000	0.94253	GCG	.	.	none		0.443	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PGPEP1L	145814	hgsc.bcm.edu	37	15	99511839	99511839	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:99511839C>T	ENST00000378919.6	-	5	664	c.459G>A	c.(457-459)ggG>ggA	p.G153G	PGPEP1L_ENST00000535714.1_Silent_p.G99G|RP11-654A16.3_ENST00000559468.1_RNA	NM_001102612.2	NP_001096082.2	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase I-like	153							cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|stomach(1)	14						TGGCCGGGAGCCCGCGCGATA	0.552																																					p.G153G		Atlas-SNP	.											PGPEP1L,NS,carcinoma,-1,1	PGPEP1L	26	1	0			c.G459A						PASS	.						32.0	32.0	32.0					15																	99511839		1964	4147	6111	SO:0001819	synonymous_variant	145814	exon5			CGGGAGCCCGCGC		CCDS53977.1, CCDS58400.1	15q26.3	2010-02-16			ENSG00000183571	ENSG00000183571			27080	protein-coding gene	gene with protein product							Standard	NM_001102612		Approved		uc002bum.3	A6NFU8		ENST00000378919.6:c.459G>A	15.37:g.99511839C>T		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	178	47	0.264045	NM_001102612	H0YF86	Silent	SNP	ENST00000378919.6	37	CCDS53977.1																																																																																			.	.	none		0.552	PGPEP1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415703.1	NM_001102612.2	
OR4C46	119749	hgsc.bcm.edu	37	11	51516008	51516008	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:51516008A>G	ENST00000328188.1	+	1	727	c.727A>G	c.(727-729)Acg>Gcg	p.T243A		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						CTCCCACATCACGGTTGTCAT	0.468																																					p.T243A		Atlas-SNP	.											.	OR4C46	96	.	0			c.A727G						PASS	.						134.0	113.0	120.0					11																	51516008		2201	4296	6497	SO:0001583	missense	119749	exon1			CACATCACGGTTG		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.727A>G	11.37:g.51516008A>G	ENSP00000329056:p.Thr243Ala	Somatic	238	0	0		WXS	Illumina HiSeq	Phase_I	199	77	0.386935	NM_001004703		Missense_Mutation	SNP	ENST00000328188.1	37	CCDS31498.1	.	.	.	.	.	.	.	.	.	.	.	4.480	0.089001	0.08583	.	.	ENSG00000185926	ENST00000328188	T	0.37235	1.21	2.33	1.08	0.20341	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000249	T	0.26919	0.0659	L	0.41824	1.3	0.09310	N	1	B	0.33826	0.427	B	0.40940	0.344	T	0.12319	-1.0552	10	0.39692	T	0.17	.	1.9961	0.03457	0.5748:0.0:0.1596:0.2656	.	243	A6NHA9	O4C46_HUMAN	A	243	ENSP00000329056:T243A	ENSP00000329056:T243A	T	+	1	0	OR4C46	51372584	0.000000	0.05858	0.375000	0.26029	0.060000	0.15804	0.118000	0.15605	0.145000	0.18977	0.102000	0.15555	ACG	.	.	none		0.468	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703	
SDK2	54549	hgsc.bcm.edu	37	17	71346425	71346425	+	Missense_Mutation	SNP	G	G	A	rs369870973	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:71346425G>A	ENST00000392650.3	-	43	5989	c.5989C>T	c.(5989-5991)Cgg>Tgg	p.R1997W	SDK2_ENST00000410094.1_5'UTR|SDK2_ENST00000388726.3_Missense_Mutation_p.R1978W	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1997					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						ACGGAGAGCCGCCTGTTGTTG	0.607													G|||	3	0.000599042	0.0	0.0	5008	,	,		17175	0.0		0.0	False		,,,				2504	0.0031				p.R1997W		Atlas-SNP	.											SDK2,acral,malignant_melanoma,+1,1	SDK2	219	1	0			c.C5989T						scavenged	.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	88.0	69.0	76.0		5989	1.0	0.1	17		76	0,8600		0,0,4300	no	missense	SDK2	NM_001144952.1	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1997/2173	71346425	1,13005	2203	4300	6503	SO:0001583	missense	54549	exon43			AGAGCCGCCTGTT	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.5989C>T	17.37:g.71346425G>A	ENSP00000376421:p.Arg1997Trp	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	69	2	0.0289855	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765051	0.69878	2.27E-4	0.0	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893;ENST00000410094	T;T;T	0.61980	0.06;0.08;1.39	5.53	1.0	0.19881	.	0.064516	0.64402	D	0.000007	T	0.73837	0.3638	L	0.59436	1.845	0.45490	D	0.998451	D;D	0.89917	0.999;1.0	D;D	0.75484	0.929;0.986	T	0.75141	-0.3422	10	0.87932	D	0	.	14.9281	0.70896	0.0:0.0:0.4935:0.5065	.	1997;1978	Q58EX2;Q58EX2-3	SDK2_HUMAN;.	W	1621;1997;1978;1154;1997;338	ENSP00000376421:R1997W;ENSP00000373378:R1978W;ENSP00000407098:R1154W	ENSP00000324967:R1997W	R	-	1	2	SDK2	68858020	0.999000	0.42202	0.133000	0.22050	0.984000	0.73092	2.872000	0.48467	-0.025000	0.13918	0.650000	0.86243	CGG	.	.	weak		0.607	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
ZNF587	84914	hgsc.bcm.edu	37	19	58371258	58371258	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:58371258A>G	ENST00000339656.5	+	3	1660	c.1478A>G	c.(1477-1479)gAa>gGa	p.E493G	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597652.1_5'Flank|ZNF587_ENST00000423137.1_Missense_Mutation_p.E492G|ZNF587_ENST00000419854.1_Missense_Mutation_p.E450G|ZNF814_ENST00000597832.1_Intron	NM_001204817.1|NM_032828.3	NP_001191746.1|NP_116217.1	Q96SQ5	ZN587_HUMAN	zinc finger protein 587	493					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		AGGCCGTATGAATGCAGTGAA	0.428																																					p.E493G	Pancreas(59;641 1233 1885 20055 50741)	Atlas-SNP	.											ZNF587,NS,carcinoma,-1,1	ZNF587	53	1	0			c.A1478G						scavenged	.						144.0	148.0	147.0					19																	58371258		2203	4300	6503	SO:0001583	missense	84914	exon3			CGTATGAATGCAG	AF294842	CCDS12964.1, CCDS56110.1	19q13.43	2013-01-08				ENSG00000198466		"""Zinc fingers, C2H2-type"", ""-"""	30955	protein-coding gene	gene with protein product						10520746	Standard	NM_032828		Approved	ZF6, FLJ14710, UBF-fl, FLJ20813	uc002qql.3	Q96SQ5	OTTHUMG00000154901	ENST00000339656.5:c.1478A>G	19.37:g.58371258A>G	ENSP00000345479:p.Glu493Gly	Somatic	375	0	0		WXS	Illumina HiSeq	Phase_I	310	4	0.0129032	NM_032828	A0AV72|G3V0H5|Q6ZMK8	Missense_Mutation	SNP	ENST00000339656.5	37	CCDS12964.1	.	.	.	.	.	.	.	.	.	.	.	12.98	2.100394	0.37048	.	.	ENSG00000198466	ENST00000376209;ENST00000423137;ENST00000339656;ENST00000540851;ENST00000419854	T;T;T	0.22743	1.94;1.94;1.94	1.44	1.44	0.22558	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19287	0.0463	L	0.28054	0.825	0.25005	N	0.991448	P;P	0.45594	0.836;0.862	P;P	0.48704	0.532;0.587	T	0.22661	-1.0210	8	0.62326	D	0.03	.	7.7065	0.28653	1.0:0.0:0.0:0.0	.	492;493	G3V0H5;Q96SQ5	.;ZN587_HUMAN	G	450;492;493;493;450	ENSP00000393865:E492G;ENSP00000345479:E493G;ENSP00000406999:E450G	ENSP00000345479:E493G	E	+	2	0	ZNF587	63063070	0.000000	0.05858	0.020000	0.16555	0.325000	0.28411	-0.131000	0.10482	0.624000	0.30286	0.164000	0.16699	GAA	.	.	none		0.428	ZNF587-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337594.2	NM_032828	
CDC6	990	hgsc.bcm.edu	37	17	38457274	38457274	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:38457274C>T	ENST00000209728.4	+	10	1915	c.1444C>T	c.(1444-1446)Ctg>Ttg	p.L482L	CTD-2267D19.6_ENST00000602403.1_lincRNA	NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	482					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						AGAGGTCACTCTGGGGAAGGT	0.463																																					p.L482L		Atlas-SNP	.											CDC6,NS,carcinoma,-2,1	CDC6	53	1	0			c.C1444T						scavenged	.						116.0	103.0	107.0					17																	38457274		2203	4300	6503	SO:0001819	synonymous_variant	990	exon10			GTCACTCTGGGGA	U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.1444C>T	17.37:g.38457274C>T		Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	168	2	0.0119048	NM_001254	Q8TB30	Silent	SNP	ENST00000209728.4	37	CCDS11365.1																																																																																			.	.	none		0.463	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257129.1		
ZNF436	80818	hgsc.bcm.edu	37	1	23689381	23689381	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:23689381G>T	ENST00000314011.4	-	4	630	c.494C>A	c.(493-495)cCc>cAc	p.P165H	ZNF436_ENST00000374608.3_Missense_Mutation_p.P165H	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		ACATTTATAGGGTCTGTCTCC	0.453																																					p.P165H		Atlas-SNP	.											.	ZNF436	49	.	0			c.C494A						PASS	.						94.0	88.0	90.0					1																	23689381		2203	4300	6503	SO:0001583	missense	80818	exon4			TTATAGGGTCTGT	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.494C>A	1.37:g.23689381G>T	ENSP00000313582:p.Pro165His	Somatic	249	1	0.00401606		WXS	Illumina HiSeq	Phase_I	222	91	0.40991	NM_001077195	Q658I9	Missense_Mutation	SNP	ENST00000314011.4	37	CCDS233.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.103046	0.76983	.	.	ENSG00000125945	ENST00000314011;ENST00000374609;ENST00000374608	T;T;T	0.29397	1.57;1.57;1.57	6.03	6.03	0.97812	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000018	T	0.61464	0.2349	M	0.82716	2.605	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.64262	-0.6449	10	0.87932	D	0	-22.7732	18.0604	0.89375	0.0:0.0:1.0:0.0	.	165	Q9C0F3	ZN436_HUMAN	H	165	ENSP00000313582:P165H;ENSP00000363737:P165H;ENSP00000363736:P165H	ENSP00000313582:P165H	P	-	2	0	ZNF436	23561968	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.871000	0.87180	2.854000	0.98071	0.655000	0.94253	CCC	.	.	none		0.453	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
HN1	51155	hgsc.bcm.edu	37	17	73132201	73132201	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:73132201C>T	ENST00000409753.3	-	5	746	c.461G>A	c.(460-462)gGt>gAt	p.G154D	HN1_ENST00000392566.2_Missense_Mutation_p.G108D|HN1_ENST00000482348.1_Missense_Mutation_p.G108D|RP11-649A18.5_ENST00000584339.1_RNA|HN1_ENST00000481647.1_Missense_Mutation_p.G108D|HN1_ENST00000356033.4_Missense_Mutation_p.V148I|HN1_ENST00000476258.1_Missense_Mutation_p.G108D|HN1_ENST00000470924.1_Missense_Mutation_p.G108D|HN1_ENST00000405458.3_Missense_Mutation_p.G108D	NM_016185.2	NP_057269.1	Q9UK76	HN1_HUMAN	hematological and neurological expressed 1	154					developmental process (GO:0032502)	nucleus (GO:0005634)			HN1/USH1G(2)	breast(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)					TCAGAGCTAACCCAAGACGAG	0.582																																					p.G154D		Atlas-SNP	.											.	HN1	17	.	0			c.G461A						PASS	.						81.0	78.0	79.0					17																	73132201		2203	4300	6503	SO:0001583	missense	51155	exon5			AGCTAACCCAAGA	AF086910	CCDS32729.1, CCDS45771.1, CCDS45772.1	17q25.1	2013-09-20			ENSG00000189159	ENSG00000189159			14569	protein-coding gene	gene with protein product	"""androgen-regulated protein 2"""					15094197	Standard	NM_001002032		Approved	ARM2, HN1A	uc002jnb.1	Q9UK76	OTTHUMG00000154521	ENST00000409753.3:c.461G>A	17.37:g.73132201C>T	ENSP00000387059:p.Gly154Asp	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	128	49	0.382812	NM_016185	B2R6K3|Q53FG7|Q7Z2D2|Q7Z2F0	Missense_Mutation	SNP	ENST00000409753.3	37	CCDS45771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.6|25.6	4.658406|4.658406	0.88154|0.88154	.|.	.|.	ENSG00000189159|ENSG00000189159	ENST00000405458;ENST00000409753;ENST00000392566|ENST00000356033	.|.	.|.	.|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	.|0.921149	.|0.09115	.|N	.|0.846595	T|T	0.57227|0.57227	0.2039|0.2039	.|.	.|.	.|.	0.48040|0.48040	D|D	0.999573|0.999573	D|P	0.89917|0.39480	1.0|0.675	D|B	0.91635|0.36134	0.999|0.218	T|T	0.59915|0.59915	-0.7364|-0.7364	7|8	0.87932|0.87932	D|D	0|0	-20.073|-20.073	18.3821|18.3821	0.90454|0.90454	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	154|148	Q9UK76|Q9UK76-2	HN1_HUMAN|.	D|I	108;154;108|148	.|.	ENSP00000440912:G108D|ENSP00000348316:V148I	G|V	-|-	2|1	0|0	HN1|HN1	70643796|70643796	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.822000|0.822000	0.46500|0.46500	4.949000|4.949000	0.63596|0.63596	2.773000|2.773000	0.95371|0.95371	0.643000|0.643000	0.83706|0.83706	GGT|GTT	.	.	none		0.582	HN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000335692.1	NM_001002032	
MT-CO2	4513	hgsc.bcm.edu	37	M	7818	7818	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrM:7818T>C	ENST00000361739.1	+	1	233	c.233T>C	c.(232-234)cTc>cCc	p.L78P	MT-TD_ENST00000387419.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND3_ENST00000361227.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	78					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						CCTCATCGCCCTCCCATCCCT	0.468																																					p.L78P		Atlas-SNP	.											.	.	.	.	0			c.T233C						PASS	.																																			SO:0001583	missense	5743	exon1			TCGCCCTCCCATC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.233T>C	M.37:g.7818T>C	ENSP00000354876:p.Leu78Pro	Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	15	14	0.933333	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	37																																																																																				.	.	none		0.468	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
KRTAP5-3	387266	hgsc.bcm.edu	37	11	1629156	1629156	+	Missense_Mutation	SNP	T	T	A	rs75371407		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:1629156T>A	ENST00000399685.1	-	1	537	c.460A>T	c.(460-462)Agc>Tgc	p.S154C		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	154	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		TGGGAGCAGCTGGGCTTGCAG	0.627																																					p.S154C		Atlas-SNP	.											KRTAP5-3,NS,carcinoma,+2,1	KRTAP5-3	33	1	0			c.A460T						scavenged	.						127.0	139.0	135.0					11																	1629156		2202	4299	6501	SO:0001583	missense	387266	exon1			AGCAGCTGGGCTT	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.460A>T	11.37:g.1629156T>A	ENSP00000382592:p.Ser154Cys	Somatic	198	2	0.010101		WXS	Illumina HiSeq	Phase_I	184	3	0.0163043	NM_001012708	Q6PL44|Q701N3	Missense_Mutation	SNP	ENST00000399685.1	37	CCDS41591.1	.	.	.	.	.	.	.	.	.	.	T	2.139	-0.397181	0.04899	.	.	ENSG00000196224	ENST00000399685	T	0.01084	5.36	3.75	-3.61	0.04556	.	.	.	.	.	T	0.00468	0.0015	N	0.00742	-1.23	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.46331	-0.9199	9	0.51188	T	0.08	.	5.3378	0.15967	0.4233:0.1302:0.0:0.4465	.	154	Q6L8H2	KRA53_HUMAN	C	154	ENSP00000382592:S154C	ENSP00000382592:S154C	S	-	1	0	KRTAP5-3	1585732	.	.	0.594000	0.28785	0.041000	0.13682	.	.	-0.339000	0.08401	-1.270000	0.01421	AGC	T|0.500;A|0.500	0.500	weak		0.627	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1		
TREML2	79865	hgsc.bcm.edu	37	6	41166098	41166098	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:41166098G>A	ENST00000483722.1	-	2	310	c.125C>T	c.(124-126)tCc>tTc	p.S42F		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	42	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCCCTTATAGGAGCACTGCAC	0.512																																					p.S42F		Atlas-SNP	.											TREML2,colon,carcinoma,0,1	TREML2	41	1	0			c.C125T						scavenged	.						155.0	164.0	161.0					6																	41166098		2203	4300	6503	SO:0001583	missense	79865	exon2			TTATAGGAGCACT	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.125C>T	6.37:g.41166098G>A	ENSP00000418767:p.Ser42Phe	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	111	5	0.045045	NM_024807	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	37	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	.	13.82	2.351464	0.41700	.	.	ENSG00000112195	ENST00000483722	T	0.64803	-0.12	4.75	3.85	0.44370	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.487586	0.17816	N	0.161037	T	0.59224	0.2178	L	0.43757	1.38	0.32993	D	0.525191	D	0.76494	0.999	D	0.72982	0.979	T	0.60682	-0.7215	10	0.48119	T	0.1	-10.0883	10.3616	0.43998	0.0:0.0:0.8036:0.1964	.	42	Q5T2D2	TRML2_HUMAN	F	42	ENSP00000418767:S42F	ENSP00000418767:S42F	S	-	2	0	TREML2	41274076	1.000000	0.71417	1.000000	0.80357	0.316000	0.28119	0.753000	0.26376	1.079000	0.41038	0.563000	0.77884	TCC	.	.	none		0.512	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
C11orf86	254439	hgsc.bcm.edu	37	11	66743072	66743072	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:66743072G>C	ENST00000308963.4	+	1	325	c.239G>C	c.(238-240)cGa>cCa	p.R80P		NM_001136485.1	NP_001129957.1	A6NJI1	CK086_HUMAN	chromosome 11 open reading frame 86	80										NS(1)|skin(1)	2						CAAGCCCAGCGAAGAGGCAGC	0.662																																					p.R80P		Atlas-SNP	.											.	C11orf86	7	.	0			c.G239C						PASS	.						26.0	36.0	33.0					11																	66743072		692	1591	2283	SO:0001583	missense	254439	exon1			CCCAGCGAAGAGG	AK026328, AP003176	CCDS44656.1	11q13.1	2012-08-10			ENSG00000173237	ENSG00000173237			34442	protein-coding gene	gene with protein product							Standard	NM_001136485		Approved	FLJ22675	uc010rpm.2	A6NJI1	OTTHUMG00000153671	ENST00000308963.4:c.239G>C	11.37:g.66743072G>C	ENSP00000311479:p.Arg80Pro	Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	63	33	0.52381	NM_001136485		Missense_Mutation	SNP	ENST00000308963.4	37	CCDS44656.1	.	.	.	.	.	.	.	.	.	.	.	11.40	1.628127	0.28978	.	.	ENSG00000173237	ENST00000308963	.	.	.	4.95	-1.63	0.08345	.	1.309580	0.05152	N	0.496276	T	0.27063	0.0663	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.15484	0.013	T	0.33904	-0.9850	9	0.66056	D	0.02	-0.1866	5.2921	0.15733	0.6278:0.1765:0.1957:0.0	.	80	A6NJI1	CK086_HUMAN	P	80	.	ENSP00000311479:R80P	R	+	2	0	C11orf86	66499648	0.000000	0.05858	0.002000	0.10522	0.038000	0.13279	-0.631000	0.05496	-0.101000	0.12219	-0.266000	0.10368	CGA	.	.	none		0.662	C11orf86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332022.2	NM_001136485	
MEX3A	92312	hgsc.bcm.edu	37	1	156047300	156047300	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:156047300A>G	ENST00000532414.2	-	2	627	c.628T>C	c.(628-630)Tca>Cca	p.S210P	AL355388.1_ENST00000410679.1_RNA|MEX3A_ENST00000442784.1_5'UTR	NM_001093725.1	NP_001087194.1	A1L020	MEX3A_HUMAN	mex-3 RNA binding family member A	210						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9	Hepatocellular(266;0.158)|all_neural(408;0.195)					GCGGCGCCTGACTTGTTGCGG	0.672																																					p.S210P		Atlas-SNP	.											.	MEX3A	33	.	0			c.T628C						PASS	.						40.0	48.0	45.0					1																	156047300		2159	4272	6431	SO:0001583	missense	92312	exon2			CGCCTGACTTGTT	AK024097	CCDS53377.1	1q22	2013-09-24	2013-08-21	2007-07-18	ENSG00000254726	ENSG00000254726		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	33482	protein-coding gene	gene with protein product		611007	"""ring finger and KH domain containing 4"", ""mex-3 homolog A (C. elegans)"""	RKHD4		17267406	Standard	NM_001093725		Approved		uc001fnd.4	A1L020	OTTHUMG00000017465	ENST00000532414.2:c.628T>C	1.37:g.156047300A>G	ENSP00000432845:p.Ser210Pro	Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	108	7	0.0648148	NM_001093725		Missense_Mutation	SNP	ENST00000532414.2	37	CCDS53377.1	.	.	.	.	.	.	.	.	.	.	A	12.75	2.032059	0.35893	.	.	ENSG00000254726	ENST00000532414	T	0.47869	0.83	5.15	3.95	0.45737	.	0.280783	0.30293	N	0.009946	T	0.14270	0.0345	N	0.19112	0.55	0.31477	N	0.667688	P	0.44195	0.828	B	0.36289	0.221	T	0.05273	-1.0895	10	0.38643	T	0.18	.	9.7334	0.40374	0.6547:0.3453:0.0:0.0	.	210	A1L020	MEX3A_HUMAN	P	210	ENSP00000432845:S210P	ENSP00000432845:S210P	S	-	1	0	MEX3A	154313924	0.999000	0.42202	0.995000	0.50966	0.944000	0.59088	2.028000	0.41088	1.950000	0.56595	0.379000	0.24179	TCA	.	.	none		0.672	MEX3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046218.3	NM_001093725	
EPS8L2	64787	hgsc.bcm.edu	37	11	726366	726366	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:726366G>A	ENST00000533256.1	+	20	2191	c.1816G>A	c.(1816-1818)Gcg>Acg	p.A606T	EPS8L2_ENST00000526198.1_Missense_Mutation_p.A622T|EPS8L2_ENST00000318562.8_Missense_Mutation_p.A606T|AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000530636.1_Missense_Mutation_p.A606T			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	606					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAACATCAGGGCGCAGCCACA	0.677																																					p.A606T		Atlas-SNP	.											.	EPS8L2	42	.	0			c.G1816A						PASS	.						22.0	24.0	23.0					11																	726366		2191	4288	6479	SO:0001583	missense	64787	exon19			ATCAGGGCGCAGC	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.1816G>A	11.37:g.726366G>A	ENSP00000435585:p.Ala606Thr	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	154	67	0.435065	NM_022772	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Missense_Mutation	SNP	ENST00000533256.1	37	CCDS31328.1	.	.	.	.	.	.	.	.	.	.	G	8.791	0.930546	0.18131	.	.	ENSG00000177106	ENST00000318562;ENST00000533256;ENST00000530636;ENST00000526198	T;T;T;T	0.15834	2.39;2.39;2.39;2.39	3.11	-1.15	0.09709	.	0.791425	0.10418	N	0.677052	T	0.05456	0.0144	N	0.04746	-0.17	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.40887	-0.9539	10	0.12766	T	0.61	-3.7233	1.0949	0.01671	0.267:0.1586:0.4134:0.161	.	622;606	B7ZKL3;Q9H6S3	.;ES8L2_HUMAN	T	606;606;606;622	ENSP00000320828:A606T;ENSP00000435585:A606T;ENSP00000436035:A606T;ENSP00000436230:A622T	ENSP00000320828:A606T	A	+	1	0	EPS8L2	716366	0.001000	0.12720	0.003000	0.11579	0.497000	0.33675	0.551000	0.23361	-0.375000	0.07955	0.298000	0.19748	GCG	.	.	none		0.677	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	
GOLGA6L1	283767	hgsc.bcm.edu	37	15	22743249	22743249	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:22743249T>A	ENST00000560659.2	+	8	1484	c.1484T>A	c.(1483-1485)aTg>aAg	p.M495K	GOLGA6L1_ENST00000316397.3_Missense_Mutation_p.M545K			Q8N7Z2	GG6L1_HUMAN	golgin A6 family-like 1	538										NS(1)|breast(2)|endometrium(5)|large_intestine(1)|lung(1)|skin(1)	11						caggaggagatgatgcaggaa	0.552																																					p.M545K		Atlas-SNP	.											GOLGA6L1,caecum,carcinoma,0,1	GOLGA6L1	20	1	0			c.T1634A						scavenged	.																																			SO:0001583	missense	283767	exon8			AGGAGATGATGCA	AK097517	CCDS73699.1	15q11.2	2012-10-05	2010-02-12		ENSG00000197414	ENSG00000277865			37444	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 1"""				Standard	NM_001001413		Approved		uc010tzx.1	Q8N7Z2	OTTHUMG00000171883	ENST00000560659.2:c.1484T>A	15.37:g.22743249T>A	ENSP00000452626:p.Met495Lys	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	25	4	0.16	NM_001001413		Missense_Mutation	SNP	ENST00000560659.2	37		.	.	.	.	.	.	.	.	.	.	.	0.004	-2.347201	0.00219	.	.	ENSG00000197414	ENST00000316397	T	0.07688	3.17	.	.	.	.	.	.	.	.	T	0.01976	0.0062	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37197	-0.9716	5	0.02654	T	1	.	1.3913	0.02251	0.3258:0.0:0.3254:0.3488	.	.	.	.	K	545	ENSP00000320207:M545K	ENSP00000320207:M545K	M	+	2	0	GOLGA6L1	20294613	0.232000	0.23762	0.009000	0.14445	0.009000	0.06853	-1.148000	0.03185	-1.878000	0.01128	-2.010000	0.00438	ATG	.	.	none		0.552	GOLGA6L1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000415616.2	NM_001001413	
SLC35E3	55508	hgsc.bcm.edu	37	12	69140524	69140524	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:69140524C>T	ENST00000398004.2	+	1	639	c.367C>T	c.(367-369)Cag>Tag	p.Q123*		NM_018656.2	NP_061126.2	Q7Z769	S35E3_HUMAN	solute carrier family 35, member E3	123						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Breast(13;2.31e-06)|Renal(347;0.0684)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00372)			CTTCTGCTACCAGAAAACCTT	0.572																																					p.Q123X		Atlas-SNP	.											.	SLC35E3	23	.	0			c.C367T						PASS	.						109.0	115.0	114.0					12																	69140524		1955	4154	6109	SO:0001587	stop_gained	55508	exon1			TGCTACCAGAAAA	AF148713, AY358943	CCDS41808.1	12q15	2014-09-04			ENSG00000175782	ENSG00000175782		"""Solute carriers"""	20864	protein-coding gene	gene with protein product						12975309	Standard	XM_005269006		Approved	BLOV1	uc001suh.3	Q7Z769	OTTHUMG00000169282	ENST00000398004.2:c.367C>T	12.37:g.69140524C>T	ENSP00000381089:p.Gln123*	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	86	4	0.0465116	NM_018656	A8K0T0|Q0P5Y5|Q9P0V1	Nonsense_Mutation	SNP	ENST00000398004.2	37	CCDS41808.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615301	0.87359	.	.	ENSG00000175782	ENST00000398004	.	.	.	4.84	-4.92	0.03075	.	0.978663	0.08427	N	0.947515	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-19.4926	11.8581	0.52451	0.1162:0.3976:0.4862:0.0	.	.	.	.	X	123	.	.	Q	+	1	0	SLC35E3	67426791	1.000000	0.71417	0.374000	0.26016	0.191000	0.23601	1.223000	0.32527	-0.906000	0.03866	-0.274000	0.10170	CAG	.	.	none		0.572	SLC35E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403241.1	NM_018656	
TOX2	84969	hgsc.bcm.edu	37	20	42679965	42679965	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr20:42679965C>T	ENST00000358131.5	+	4	666	c.458C>T	c.(457-459)tCg>tTg	p.S153L	TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000372999.1_Missense_Mutation_p.S102L|TOX2_ENST00000341197.4_Missense_Mutation_p.S144L|TOX2_ENST00000423191.2_Missense_Mutation_p.S102L	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	153					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			ATGGTCCACTCGGAAGTGGCT	0.617																																					p.S153L		Atlas-SNP	.											TOX2_ENST00000348077,NS,carcinoma,-1,4	TOX2	158	4	0			c.C458T						scavenged	.																																			SO:0001583	missense	84969	exon4			TCCACTCGGAAGT	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.458C>T	20.37:g.42679965C>T	ENSP00000350849:p.Ser153Leu	Somatic	254	0	0		WXS	Illumina HiSeq	Phase_I	170	3	0.0176471	NM_001098798	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	ENST00000358131.5	37	CCDS42875.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804330	0.50315	.	.	ENSG00000124191	ENST00000341197;ENST00000442881;ENST00000423191;ENST00000372999;ENST00000358131;ENST00000435864	T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;2.45	5.58	5.58	0.84498	.	0.827554	0.11141	N	0.595264	T	0.45478	0.1344	L	0.35854	1.095	0.50313	D	0.999864	D;D;P;P;P	0.56287	0.957;0.975;0.672;0.913;0.918	B;B;B;B;B	0.41946	0.204;0.371;0.086;0.17;0.204	T	0.52162	-0.8612	10	0.62326	D	0.03	.	18.5722	0.91140	0.0:1.0:0.0:0.0	.	22;144;102;153;102	B4DQV8;G3XAC7;A8K1J1;Q96NM4;E1P5X0	.;.;.;TOX2_HUMAN;.	L	144;102;102;102;153;22	ENSP00000344724:S144L;ENSP00000396584:S102L;ENSP00000390278:S102L;ENSP00000362090:S102L;ENSP00000350849:S153L;ENSP00000396777:S22L	ENSP00000344724:S144L	S	+	2	0	TOX2	42113379	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	5.298000	0.65710	2.604000	0.88044	0.655000	0.94253	TCG	.	.	none		0.617	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2		
PPIP5K2	23262	hgsc.bcm.edu	37	5	102465357	102465357	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:102465357C>T	ENST00000358359.3	+	2	573	c.64C>T	c.(64-66)Cga>Tga	p.R22*	PPIP5K2_ENST00000414217.1_Nonsense_Mutation_p.R22*|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Nonsense_Mutation_p.R22*	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	22					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TGGAAATTATCGACATTTCTT	0.363																																					p.R22X		Atlas-SNP	.											.	PPIP5K2	98	.	0			c.C64T						PASS	.						110.0	105.0	106.0					5																	102465357		2203	4300	6503	SO:0001587	stop_gained	23262	exon1			AATTATCGACATT	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.64C>T	5.37:g.102465357C>T	ENSP00000351126:p.Arg22*	Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	40	4	0.1	NM_015216	A1NI53|A6NGS8|Q8TB50	Nonsense_Mutation	SNP	ENST00000358359.3	37		.	.	.	.	.	.	.	.	.	.	C	29.5	5.011757	0.93346	.	.	ENSG00000145725	ENST00000515845;ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217	.	.	.	5.75	2.74	0.32292	.	0.167313	0.39615	N	0.001314	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.0712	0.06231	0.2478:0.4349:0.2312:0.0861	.	.	.	.	X	22	.	ENSP00000313070:R22X	R	+	1	2	PPIP5K2	102493256	0.615000	0.27026	0.907000	0.35723	0.977000	0.68977	0.906000	0.28517	0.880000	0.35969	0.650000	0.86243	CGA	.	.	none		0.363	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
THOC7	80145	hgsc.bcm.edu	37	3	63824125	63824125	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:63824125G>A	ENST00000295899.5	-	3	300	c.188C>T	c.(187-189)tCa>tTa	p.S63L	THOC7_ENST00000498422.1_5'UTR|C3orf49_ENST00000295896.8_Intron	NM_025075.2	NP_079351.2	Q6I9Y2	THOC7_HUMAN	THO complex 7 homolog (Drosophila)	63	Interaction with THOC5.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			central_nervous_system(1)|large_intestine(1)|ovary(1)|pancreas(1)	4				BRCA - Breast invasive adenocarcinoma(55;0.000439)|Kidney(15;0.00194)|KIRC - Kidney renal clear cell carcinoma(15;0.00218)		TTTGCCCATTGAAAATTCACA	0.299																																					p.S63L	Colon(48;665 1127 6720 18651)	Atlas-SNP	.											.	THOC7	24	.	0			c.C188T						PASS	.						62.0	64.0	63.0					3																	63824125		2202	4299	6501	SO:0001583	missense	80145	exon3			CCCATTGAAAATT	BC020599	CCDS2900.1, CCDS74957.1	3p14.1	2013-02-11			ENSG00000163634	ENSG00000163634		"""THO complex subunits"""	29874	protein-coding gene	gene with protein product	"""Ngg1 interacting factor 3 like 1 binding protein 1"", ""functional spliceosome-associated protein 24"""	611965				12951069	Standard	NM_001285404		Approved	NIF3L1BP1, FLJ23445, fSAP24	uc003dlt.4	Q6I9Y2	OTTHUMG00000158767	ENST00000295899.5:c.188C>T	3.37:g.63824125G>A	ENSP00000295899:p.Ser63Leu	Somatic	264	0	0		WXS	Illumina HiSeq	Phase_I	263	74	0.281369	NM_025075	Q6P1L3|Q8WUF2|Q9H5H0	Missense_Mutation	SNP	ENST00000295899.5	37	CCDS2900.1	.	.	.	.	.	.	.	.	.	.	G	36	5.795790	0.96952	.	.	ENSG00000163634	ENST00000295899	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.74772	0.3760	L	0.59436	1.845	0.80722	D	1	D	0.57571	0.98	P	0.57846	0.828	T	0.74054	-0.3788	9	0.56958	D	0.05	-34.2799	20.4324	0.99085	0.0:0.0:1.0:0.0	.	63	Q6I9Y2	THOC7_HUMAN	L	63	.	ENSP00000295899:S63L	S	-	2	0	THOC7	63799165	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.823000	0.99369	2.833000	0.97629	0.585000	0.79938	TCA	.	.	none		0.299	THOC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352096.1	NM_025075	
UGT1A9	54600	hgsc.bcm.edu	37	2	234581002	234581002	+	Missense_Mutation	SNP	C	C	G	rs76167146	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:234581002C>G	ENST00000354728.4	+	1	504	c.422C>G	c.(421-423)tCt>tGt	p.S141C	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Missense_Mutation_p.S141C			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	141					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	AAGGAGAGTTCTTTTGATGCA	0.358																																					p.S141C		Atlas-SNP	.											UGT1A9,NS,carcinoma,0,1	UGT1A9	79	1	0			c.C422G						scavenged	.						125.0	125.0	125.0					2																	234581002		2203	4300	6503	SO:0001583	missense	54600	exon1			AGAGTTCTTTTGA	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.422C>G	2.37:g.234581002C>G	ENSP00000346768:p.Ser141Cys	Somatic	117	3	0.025641		WXS	Illumina HiSeq	Phase_I	115	10	0.0869565	NM_021027	B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	ENST00000354728.4	37	CCDS2505.1	.	.	.	.	.	.	.	.	.	.	C	5.531	0.282927	0.10458	.	.	ENSG00000241119	ENST00000354728	T	0.62639	0.01	3.41	3.41	0.39046	.	.	.	.	.	T	0.61375	0.2342	M	0.81942	2.565	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.12837	0.008;0.008	T	0.58036	-0.7707	9	0.66056	D	0.02	.	6.3779	0.21517	0.334:0.5079:0.1581:0.0	.	141;141	Q5DSZ5;O60656	.;UD19_HUMAN	C	141	ENSP00000346768:S141C	ENSP00000346768:S141C	S	+	2	0	UGT1A9	234245741	0.000000	0.05858	0.866000	0.34008	0.471000	0.32888	0.356000	0.20181	1.907000	0.55213	0.440000	0.28878	TCT	C|0.943;G|0.057	0.057	strong		0.358	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
ADAMTS2	9509	hgsc.bcm.edu	37	5	178552090	178552090	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:178552090C>T	ENST00000251582.7	-	19	2943	c.2842G>A	c.(2842-2844)Gac>Aac	p.D948N		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	948	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GTGGTGTTGTCGTGTAGCGGC	0.692																																					p.D948N		Atlas-SNP	.											ADAMTS2,caecum,carcinoma,0,2	ADAMTS2	190	2	0			c.G2842A						scavenged	.						112.0	113.0	113.0					5																	178552090		2203	4300	6503	SO:0001583	missense	9509	exon19			TGTTGTCGTGTAG	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2842G>A	5.37:g.178552090C>T	ENSP00000251582:p.Asp948Asn	Somatic	163	1	0.00613497		WXS	Illumina HiSeq	Phase_I	128	3	0.0234375	NM_014244		Missense_Mutation	SNP	ENST00000251582.7	37	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	C	0.743	-0.775731	0.02951	.	.	ENSG00000087116	ENST00000251582	T	0.53857	0.6	5.31	2.0	0.26442	.	0.301971	0.27792	N	0.017833	T	0.26774	0.0655	N	0.12422	0.21	0.80722	D	1	B	0.24317	0.101	B	0.22601	0.04	T	0.10730	-1.0617	10	0.06757	T	0.87	.	8.4694	0.32975	0.0:0.7177:0.0:0.2823	.	948	O95450	ATS2_HUMAN	N	948	ENSP00000251582:D948N	ENSP00000251582:D948N	D	-	1	0	ADAMTS2	178484696	0.966000	0.33281	0.957000	0.39632	0.030000	0.12068	1.550000	0.36223	0.026000	0.15269	-1.140000	0.01884	GAC	.	.	none		0.692	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
SH2B1	25970	hgsc.bcm.edu	37	16	28856096	28856096	+	5'Flank	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr16:28856096G>A	ENST00000322610.8	+	0	0				TUFM_ENST00000313511.3_Missense_Mutation_p.R203W|MIR4721_ENST00000577590.1_RNA			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1						blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						AGCAGCTCCCGGATCTCCAGT	0.582																																					p.R203W		Atlas-SNP	.											TUFM,NS,carcinoma,+1,1	TUFM	33	1	0			c.C607T						scavenged	.						118.0	110.0	112.0					16																	28856096		2197	4300	6497	SO:0001631	upstream_gene_variant	7284	exon5			GCTCCCGGATCTC	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2			16.37:g.28856096G>A	Exception_encountered	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	114	2	0.0175439	NM_003321	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	37	CCDS53996.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646820	0.67358	.	.	ENSG00000178952	ENST00000313511	T	0.71934	-0.61	5.63	2.41	0.29592	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	D	0.90113	0.6911	H	0.99299	4.505	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93073	0.6484	10	0.87932	D	0	-0.5418	13.8343	0.63400	0.0:0.0:0.5789:0.4211	.	200	P49411	EFTU_HUMAN	W	203	ENSP00000322439:R203W	ENSP00000322439:R203W	R	-	1	2	TUFM	28763597	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.405000	0.52630	0.685000	0.31468	0.561000	0.74099	CGG	.	.	none		0.582	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503	
DAGLA	747	hgsc.bcm.edu	37	11	61495668	61495668	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:61495668G>A	ENST00000257215.5	+	7	796	c.680G>A	c.(679-681)cGg>cAg	p.R227Q		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	227					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		GAGTTCTTCCGGGACCTTGAC	0.627																																					p.R227Q		Atlas-SNP	.											.	DAGLA	109	.	0			c.G680A						PASS	.						203.0	182.0	189.0					11																	61495668		2202	4299	6501	SO:0001583	missense	747	exon7			TCTTCCGGGACCT	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.680G>A	11.37:g.61495668G>A	ENSP00000257215:p.Arg227Gln	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	94	37	0.393617	NM_006133	A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	37	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225249	0.79576	.	.	ENSG00000134780	ENST00000257215	T	0.25414	1.8	4.78	4.78	0.61160	.	0.133125	0.49916	D	0.000137	T	0.43809	0.1264	L	0.42245	1.32	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	T	0.25467	-1.0131	10	0.44086	T	0.13	-22.5485	18.2062	0.89855	0.0:0.0:1.0:0.0	.	227	Q9Y4D2	DGLA_HUMAN	Q	227	ENSP00000257215:R227Q	ENSP00000257215:R227Q	R	+	2	0	DAGLA	61252244	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.753000	0.85153	2.373000	0.80994	0.555000	0.69702	CGG	.	.	none		0.627	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
ZMYM4	9202	hgsc.bcm.edu	37	1	35847247	35847247	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:35847247G>T	ENST00000314607.6	+	9	1537	c.1457G>T	c.(1456-1458)tGt>tTt	p.C486F	ZMYM4_ENST00000373297.2_Missense_Mutation_p.C486F	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	486					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ATGAACTGTTGTGAGAACTGT	0.438																																					p.C486F		Atlas-SNP	.											.	ZMYM4	143	.	0			c.G1457T						PASS	.						205.0	187.0	193.0					1																	35847247		2203	4300	6503	SO:0001583	missense	9202	exon9			ACTGTTGTGAGAA	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1457G>T	1.37:g.35847247G>T	ENSP00000322915:p.Cys486Phe	Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	163	33	0.202454	NM_005095	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.5|21.5	4.156265|4.156265	0.78114|0.78114	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000314607;ENST00000373297|ENST00000457946	T;T|.	0.80653|.	-1.4;1.15|.	5.01|5.01	5.01|5.01	0.66863|0.66863	TRASH (1);Zinc finger, MYM-type (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75273|0.75273	0.3827|0.3827	M|M	0.72894|0.72894	2.215|2.215	0.36207|0.36207	D|D	0.851107|0.851107	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.79725|0.79725	-0.1683|-0.1683	10|5	0.87932|.	D|.	0|.	-1.461|-1.461	18.6737|18.6737	0.91521|0.91521	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	486|.	Q5VZL5|.	ZMYM4_HUMAN|.	F|F	486|234	ENSP00000322915:C486F;ENSP00000362394:C486F|.	ENSP00000322915:C486F|.	C|L	+|+	2|3	0|2	ZMYM4|ZMYM4	35619834|35619834	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.361000|9.361000	0.97122|0.97122	2.487000|2.487000	0.83934|0.83934	0.591000|0.591000	0.81541|0.81541	TGT|TTG	.	.	none		0.438	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
MPRIP	23164	hgsc.bcm.edu	37	17	17078669	17078669	+	Silent	SNP	C	C	T	rs369573954		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:17078669C>T	ENST00000341712.4	+	19	2652	c.2652C>T	c.(2650-2652)ggC>ggT	p.G884G	MPRIP_ENST00000395811.5_Silent_p.G884G|MPRIP_ENST00000444976.1_Silent_p.G846G|RP11-45M22.3_ENST00000584203.1_RNA|MPRIP_ENST00000395804.3_Silent_p.G884G			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	884						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.G884G(1)		biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						CTGGGGACGGCGGTGGGGAGG	0.627																																					p.G884G		Atlas-SNP	.											MPRIP,NS,carcinoma,0,1	MPRIP	87	1	1	Substitution - coding silent(1)	kidney(1)	c.C2652T						scavenged	.	C	,	0,4406		0,0,2203	42.0	37.0	39.0		2652,2652	-8.3	0.0	17		39	1,8591		0,1,4295	no	coding-synonymous,coding-synonymous	MPRIP	NM_015134.3,NM_201274.3	,	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	,	884/1039,884/1026	17078669	1,12997	2203	4296	6499	SO:0001819	synonymous_variant	23164	exon19			GGACGGCGGTGGG	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.2652C>T	17.37:g.17078669C>T		Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	194	3	0.0154639	NM_015134	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Silent	SNP	ENST00000341712.4	37	CCDS32578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.598|6.598	0.478629|0.478629	0.12521|0.12521	0.0|0.0	1.16E-4|1.16E-4	ENSG00000133030|ENSG00000133030	ENST00000414263|ENST00000313485	.|.	.|.	.|.	5.77|5.77	-8.33|-8.33	0.00992|0.00992	.|.	.|.	.|.	.|.	.|.	T|T	0.17280|0.17280	0.0415|0.0415	.|.	.|.	.|.	0.19775|0.19775	N|N	0.999959|0.999959	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.22661|0.22661	-1.0210|-1.0210	4|4	.|.	.|.	.|.	-11.5729|-11.5729	3.7501|3.7501	0.08563|0.08563	0.0776:0.285:0.2322:0.4052|0.0776:0.285:0.2322:0.4052	.|.	.|.	.|.	.|.	V|W	950|1249	.|.	.|.	A|R	+|+	2|1	0|2	MPRIP|MPRIP	17019394|17019394	0.012000|0.012000	0.17670|0.17670	0.000000|0.000000	0.03702|0.03702	0.736000|0.736000	0.42039|0.42039	-0.923000|-0.923000	0.04000|0.04000	-1.411000|-1.411000	0.02032|0.02032	-0.136000|-0.136000	0.14681|0.14681	GCG|CGG	.	.	weak		0.627	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
CCDC138	165055	hgsc.bcm.edu	37	2	109463198	109463198	+	Missense_Mutation	SNP	C	C	T	rs367747465		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:109463198C>T	ENST00000295124.4	+	12	1388	c.1328C>T	c.(1327-1329)tCg>tTg	p.S443L	CCDC138_ENST00000412964.2_Missense_Mutation_p.S443L	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	443								p.S443L(1)		endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						TAACAGCACTCGACTATGACA	0.348																																					p.S443L		Atlas-SNP	.											CCDC138,rectum,carcinoma,0,1	CCDC138	49	1	1	Substitution - Missense(1)	large_intestine(1)	c.C1328T						scavenged	.						79.0	82.0	81.0					2																	109463198		2203	4300	6503	SO:0001583	missense	165055	exon12			AGCACTCGACTAT	AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.1328C>T	2.37:g.109463198C>T	ENSP00000295124:p.Ser443Leu	Somatic	191	0	0		WXS	Illumina HiSeq	Phase_I	191	3	0.0157068	NM_144978	Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	ENST00000295124.4	37	CCDS2080.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.35|15.35	2.808471|2.808471	0.50421|0.50421	.|.	.|.	ENSG00000163006|ENSG00000163006	ENST00000456512|ENST00000412964;ENST00000295124	.|T;T	.|0.34072	.|1.38;1.39	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.434355	.|0.23549	.|N	.|0.046989	.|T	.|0.38295	.|0.1035	L|L	0.48362|0.48362	1.52|1.52	0.43287|0.43287	D|D	0.995261|0.995261	.|P;B	.|0.45240	.|0.854;0.007	.|B;B	.|0.41466	.|0.358;0.004	.|T	.|0.05053	.|-1.0909	.|10	.|0.33141	.|T	.|0.24	-2.6465|-2.6465	20.1575|20.1575	0.98120|0.98120	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|443;443	.|Q96M89-2;Q96M89	.|.;CC138_HUMAN	X|L	340|443	.|ENSP00000411800:S443L;ENSP00000295124:S443L	.|ENSP00000295124:S443L	R|S	+|+	1|2	2|0	CCDC138|CCDC138	108829630|108829630	0.777000|0.777000	0.28628|0.28628	0.997000|0.997000	0.53966|0.53966	0.989000|0.989000	0.77384|0.77384	3.852000|3.852000	0.55934|0.55934	2.850000|2.850000	0.98022|0.98022	0.650000|0.650000	0.86243|0.86243	CGA|TCG	.	.	alt		0.348	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253593.1	NM_144978	
FAM120B	84498	hgsc.bcm.edu	37	6	170627775	170627775	+	Missense_Mutation	SNP	C	C	G	rs6934830	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:170627775C>G	ENST00000476287.1	+	2	1405	c.1297C>G	c.(1297-1299)Ccc>Gcc	p.P433A	FAM120B_ENST00000540480.1_Missense_Mutation_p.P445A|FAM120B_ENST00000537664.1_Missense_Mutation_p.P456A|FAM120B_ENST00000252510.9_Intron	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	433			P -> A (in dbSNP:rs6934830).		cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		AGACTCTGAACCCAGGCAAGA	0.498																																					p.P433A		Atlas-SNP	.											FAM120B,colon,carcinoma,0,1	FAM120B	108	1	0			c.C1297G						scavenged	.						182.0	201.0	194.0					6																	170627775		2203	4299	6502	SO:0001583	missense	84498	exon2			TCTGAACCCAGGC	AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.1297C>G	6.37:g.170627775C>G	ENSP00000417970:p.Pro433Ala	Somatic	93	2	0.0215054		WXS	Illumina HiSeq	Phase_I	127	4	0.0314961	NM_032448	B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	ENST00000476287.1	37	CCDS5314.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.794388	0.00077	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287	T;T;T	0.08720	3.06;3.09;3.1	3.07	-6.14	0.02111	.	2.097720	0.01397	N	0.013442	T	0.01353	0.0044	L	0.29908	0.895	0.09310	N	1	B;B	0.15930	0.015;0.015	B;B	0.12156	0.007;0.007	T	0.35251	-0.9796	10	0.24483	T	0.36	1.0923	4.696	0.12804	0.3085:0.3177:0.0:0.3738	rs6934830	433;433	Q96EK7;F2Z2E1	F120B_HUMAN;.	A	445;456;433	ENSP00000444125:P445A;ENSP00000440125:P456A;ENSP00000417970:P433A	ENSP00000436640:P433A	P	+	1	0	FAM120B	170469700	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.335000	0.00508	-2.968000	0.00287	-2.448000	0.00209	CCC	C|0.712;G|0.288	0.288	strong		0.498	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
CCDC7	79741	hgsc.bcm.edu	37	10	33135314	33135314	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:33135314A>G	ENST00000375030.2	+	18	1839	c.1221A>G	c.(1219-1221)aaA>aaG	p.K407K	C10orf68_ENST00000375025.4_Silent_p.K512K|C10orf68_ENST00000375028.3_Silent_p.K452K			Q9H943	CJ068_HUMAN		448										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						AGACTGATAAAGAACTCTTAA	0.289																																					p.K448K		Atlas-SNP	.											C10orf68,NS,carcinoma,0,1	C10orf68	75	1	0			c.A1344G						scavenged	.						40.0	45.0	43.0					10																	33135314		2197	4274	6471	SO:0001819	synonymous_variant	79741	exon17			TGATAAAGAACTC																												ENST00000375030.2:c.1221A>G	10.37:g.33135314A>G		Somatic	196	0	0		WXS	Illumina HiSeq	Phase_I	179	2	0.0111732	NM_024688	B0QZ71|Q08AN7|Q8N7T7	Silent	SNP	ENST00000375030.2	37																																																																																				.	.	none		0.289	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000313999.2		
OR2M2	391194	hgsc.bcm.edu	37	1	248344182	248344182	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:248344182A>G	ENST00000359682.2	+	1	895	c.895A>G	c.(895-897)Aga>Gga	p.R299G		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGAGGTGACTAGAGCATTCAT	0.438																																					p.R299G		Atlas-SNP	.											.	OR2M2	149	.	0			c.A895G						PASS	.						206.0	199.0	201.0					1																	248344182		2203	4300	6503	SO:0001583	missense	391194	exon1			GTGACTAGAGCAT	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.895A>G	1.37:g.248344182A>G	ENSP00000352710:p.Arg299Gly	Somatic	295	0	0		WXS	Illumina HiSeq	Phase_I	137	93	0.678832	NM_001004688	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	a	0.003	-2.433136	0.00182	.	.	ENSG00000198601	ENST00000359682	T	0.39056	1.1	2.03	-4.06	0.03986	.	.	.	.	.	T	0.15392	0.0371	N	0.12471	0.22	0.09310	N	1	B	0.17268	0.021	B	0.15484	0.013	T	0.28870	-1.0030	9	0.02654	T	1	.	3.493	0.07645	0.1485:0.1352:0.5811:0.1351	.	299	Q96R28	OR2M2_HUMAN	G	299	ENSP00000352710:R299G	ENSP00000352710:R299G	R	+	1	2	OR2M2	246410805	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.567000	0.05916	-1.524000	0.01764	-0.478000	0.04885	AGA	.	.	none		0.438	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
FOXB2	442425	hgsc.bcm.edu	37	9	79634683	79634683	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:79634683A>G	ENST00000376708.1	+	1	113	c.113A>G	c.(112-114)gAc>gGc	p.D38G		NM_001013735.1	NP_001013757.1	Q5VYV0	FOXB2_HUMAN	forkhead box B2	38					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(8)|ovary(1)	10						CCGCTGAGCGACATCTACAAG	0.582																																					p.D38G		Atlas-SNP	.											LOC442425,colon,carcinoma,+1,3	FOXB2	71	3	0			c.A113G						scavenged	.						74.0	65.0	68.0					9																	79634683		2203	4300	6503	SO:0001583	missense	442425	exon1			TGAGCGACATCTA		CCDS35045.1	9q21.2	2008-02-05			ENSG00000204612	ENSG00000204612		"""Forkhead boxes"""	23315	protein-coding gene	gene with protein product							Standard	NM_001013735		Approved	bA159H20.4	uc004ako.1	Q5VYV0	OTTHUMG00000020051	ENST00000376708.1:c.113A>G	9.37:g.79634683A>G	ENSP00000365898:p.Asp38Gly	Somatic	186	1	0.00537634		WXS	Illumina HiSeq	Phase_I	126	3	0.0238095	NM_001013735		Missense_Mutation	SNP	ENST00000376708.1	37	CCDS35045.1	.	.	.	.	.	.	.	.	.	.	A	17.32	3.358978	0.61403	.	.	ENSG00000204612	ENST00000376708	D	0.95622	-3.76	4.3	4.3	0.51218	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	D	0.000000	D	0.94574	0.8252	N	0.17800	0.525	0.80722	D	1	D	0.65815	0.995	D	0.67231	0.95	D	0.93882	0.7172	10	0.35671	T	0.21	.	13.4114	0.60944	1.0:0.0:0.0:0.0	.	38	Q5VYV0	FOXB2_HUMAN	G	38	ENSP00000365898:D38G	ENSP00000365898:D38G	D	+	2	0	FOXB2	78824503	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.099000	0.64554	1.710000	0.51325	0.459000	0.35465	GAC	.	.	none		0.582	FOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052745.1	NM_001013735	
TAAR2	9287	hgsc.bcm.edu	37	6	132938981	132938981	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:132938981A>C	ENST00000367931.1	-	2	363	c.364T>G	c.(364-366)Ttt>Gtt	p.F122V	TAAR2_ENST00000275191.2_Missense_Mutation_p.F77V|TAAR2_ENST00000537809.1_Missense_Mutation_p.F77V			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	122					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		ATCAGGTCAAAACTATAATAA	0.363																																					p.F122V		Atlas-SNP	.											.	TAAR2	45	.	0			c.T364G						PASS	.						77.0	74.0	75.0					6																	132938981		2203	4300	6503	SO:0001583	missense	9287	exon2			GGTCAAAACTATA	AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.364T>G	6.37:g.132938981A>C	ENSP00000356908:p.Phe122Val	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	98	25	0.255102	NM_001033080	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Missense_Mutation	SNP	ENST00000367931.1	37	CCDS34541.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.480293	0.44044	.	.	ENSG00000146378	ENST00000275191;ENST00000367931;ENST00000537809	T;T;T	0.39056	1.1;1.1;1.1	6.0	6.0	0.97389	GPCR, rhodopsin-like superfamily (1);	0.060936	0.64402	D	0.000003	T	0.44767	0.1309	L	0.40543	1.245	0.40300	D	0.978594	D	0.89917	1.0	D	0.91635	0.999	T	0.43750	-0.9372	10	0.42905	T	0.14	-34.3902	12.6876	0.56956	0.8767:0.0:0.0:0.1233	.	122	Q9P1P5	TAAR2_HUMAN	V	77;122;77	ENSP00000275191:F77V;ENSP00000356908:F122V;ENSP00000441263:F77V	ENSP00000275191:F77V	F	-	1	0	TAAR2	132980674	0.998000	0.40836	1.000000	0.80357	0.746000	0.42486	2.252000	0.43196	2.295000	0.77249	0.528000	0.53228	TTT	.	.	none		0.363	TAAR2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390735.1	NM_014626	
GRIN2B	2904	hgsc.bcm.edu	37	12	13716441	13716441	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:13716441G>A	ENST00000609686.1	-	13	3940	c.3731C>T	c.(3730-3732)gCt>gTt	p.A1244V		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1244					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TTTCTTGCAAGCCTCACACCG	0.622																																					p.A1244V		Atlas-SNP	.											.	GRIN2B	303	.	0			c.C3731T						PASS	.						81.0	83.0	82.0					12																	13716441		2203	4300	6503	SO:0001583	missense	2904	exon13			TTGCAAGCCTCAC		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3731C>T	12.37:g.13716441G>A	ENSP00000477455:p.Ala1244Val	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	64	20	0.3125	NM_000834	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.746037	0.30955	.	.	ENSG00000150086	ENST00000279593	T	0.15952	2.38	4.97	4.97	0.65823	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.116103	0.56097	D	0.000021	T	0.14270	0.0345	L	0.27053	0.805	0.44168	D	0.996978	B	0.18461	0.028	B	0.27076	0.076	T	0.04178	-1.0971	10	0.51188	T	0.08	.	12.1704	0.54155	0.078:0.0:0.922:0.0	.	1244	Q13224	NMDE2_HUMAN	V	1244	ENSP00000279593:A1244V	ENSP00000279593:A1244V	A	-	2	0	GRIN2B	13607708	1.000000	0.71417	0.969000	0.41365	0.903000	0.53119	4.723000	0.61965	2.735000	0.93741	0.655000	0.94253	GCT	.	.	none		0.622	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
SYCP1	6847	hgsc.bcm.edu	37	1	115487569	115487569	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:115487569T>G	ENST00000369522.3	+	25	2360	c.2120T>G	c.(2119-2121)aTa>aGa	p.I707R	SYCP1_ENST00000369518.1_Missense_Mutation_p.I707R	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	707					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAACATAAAATAGCTGAAATG	0.264																																					p.I707R		Atlas-SNP	.											.	SYCP1	149	.	0			c.T2120G						PASS	.						39.0	40.0	40.0					1																	115487569		2200	4280	6480	SO:0001583	missense	6847	exon25			ATAAAATAGCTGA	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2120T>G	1.37:g.115487569T>G	ENSP00000358535:p.Ile707Arg	Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	120	42	0.35	NM_003176	O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	37	CCDS879.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.043678	0.75732	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.56611	0.45;0.45;0.45	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.65439	0.2691	M	0.74258	2.255	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.71477	-0.4581	10	0.72032	D	0.01	-13.3514	14.2117	0.65769	0.0:0.0:0.0:1.0	.	707;707	B7ZLS9;Q15431	.;SYCP1_HUMAN	R	707	ENSP00000358535:I707R;ENSP00000410011:I707R;ENSP00000358531:I707R	ENSP00000358531:I707R	I	+	2	0	SYCP1	115289092	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.517000	0.67061	1.840000	0.53500	0.528000	0.53228	ATA	.	.	none		0.264	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
HTT	3064	hgsc.bcm.edu	37	4	3129287	3129287	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:3129287G>A	ENST00000355072.5	+	12	1844	c.1699G>A	c.(1699-1701)Gaa>Aaa	p.E567K		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	567					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GACCACCACCGAAGGGCCTGA	0.537																																					p.E567K		Atlas-SNP	.											.	HTT	221	.	0			c.G1699A						PASS	.						50.0	54.0	53.0					4																	3129287		1997	4158	6155	SO:0001583	missense	3064	exon12			ACCACCGAAGGGC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.1699G>A	4.37:g.3129287G>A	ENSP00000347184:p.Glu567Lys	Somatic	238	0	0		WXS	Illumina HiSeq	Phase_I	226	92	0.40708	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	G	32	5.190556	0.94923	.	.	ENSG00000197386	ENST00000355072	T	0.06768	3.26	4.84	4.84	0.62591	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.20414	0.0491	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.01084	-1.1457	10	0.36615	T	0.2	.	17.722	0.88355	0.0:0.0:1.0:0.0	.	567	P42858	HD_HUMAN	K	567	ENSP00000347184:E567K	ENSP00000347184:E567K	E	+	1	0	HTT	3099085	1.000000	0.71417	0.958000	0.39756	0.941000	0.58515	9.017000	0.93651	2.533000	0.85409	0.655000	0.94253	GAA	.	.	none		0.537	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
KMT2D	8085	hgsc.bcm.edu	37	12	49415920	49415920	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:49415920G>T	ENST00000301067.7	-	53	16426	c.16427C>A	c.(16426-16428)tCc>tAc	p.S5476Y	RP11-386G11.5_ENST00000547866.1_RNA|PRKAG1_ENST00000548065.1_5'Flank|RP11-386G11.5_ENST00000552933.1_RNA	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5476	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGGGGCACAGGAATGGTTAAT	0.507																																					p.S5476Y		Atlas-SNP	.											.	MLL2	1173	.	0			c.C16427A						PASS	.						159.0	154.0	156.0					12																	49415920		2066	4208	6274	SO:0001583	missense	8085	exon53			GCACAGGAATGGT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.16427C>A	12.37:g.49415920G>T	ENSP00000301067:p.Ser5476Tyr	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	49	16	0.326531	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	g	15.78	2.935624	0.52972	.	.	ENSG00000167548	ENST00000301067;ENST00000526209	D;D	0.94184	-3.37;-3.37	4.97	4.97	0.65823	SET domain (3);	0.000000	0.35207	N	0.003365	D	0.98400	0.9468	H	0.99535	4.615	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99782	1.1028	10	0.87932	D	0	.	17.4382	0.87558	0.0:0.0:1.0:0.0	.	5476	O14686	MLL2_HUMAN	Y	5476;157	ENSP00000301067:S5476Y;ENSP00000435714:S157Y	ENSP00000301067:S5476Y	S	-	2	0	MLL2	47702187	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.753000	0.98904	2.492000	0.84095	0.550000	0.68814	TCC	.	.	none		0.507	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
IKZF2	22807	hgsc.bcm.edu	37	2	213872764	213872764	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:213872764T>C	ENST00000434687.1	-	9	1210	c.901A>G	c.(901-903)Atg>Gtg	p.M301V	IKZF2_ENST00000342002.2_Missense_Mutation_p.M307V|IKZF2_ENST00000451136.2_Missense_Mutation_p.M229V|IKZF2_ENST00000457361.1_Missense_Mutation_p.M301V|IKZF2_ENST00000374327.4_Missense_Mutation_p.M156V|IKZF2_ENST00000413091.3_3'UTR|IKZF2_ENST00000421754.2_Missense_Mutation_p.M227V|IKZF2_ENST00000374319.4_Missense_Mutation_p.M275V|AC079610.1_ENST00000415387.1_RNA			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	301					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		GTTAAGTTCATATCAAAGTGA	0.418																																					p.M301V		Atlas-SNP	.											IKZF2,NS,carcinoma,+2,1	IKZF2	71	1	0			c.A901G						PASS	.						63.0	60.0	61.0					2																	213872764		2203	4300	6503	SO:0001583	missense	22807	exon8			AGTTCATATCAAA	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.901A>G	2.37:g.213872764T>C	ENSP00000412869:p.Met301Val	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	110	41	0.372727	NM_016260	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	ENST00000434687.1	37	CCDS2395.1	.	.	.	.	.	.	.	.	.	.	T	6.998	0.554240	0.13374	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327	T;T;T;T;T;T;T	0.13538	3.33;3.3;3.33;3.36;3.31;3.35;2.58	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.10680	0.0261	L	0.41027	1.25	0.80722	D	1	B;B;B;B;B;B	0.14438	0.0;0.0;0.01;0.0;0.0;0.0	B;B;B;B;B;B	0.10450	0.001;0.0;0.005;0.003;0.0;0.001	T	0.21759	-1.0236	10	0.19147	T	0.46	-8.1552	7.3309	0.26582	0.0:0.0723:0.1458:0.7819	.	229;227;156;275;301;79	C9JCG7;C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7;Q96LD7	.;.;.;.;IKZF2_HUMAN;.	V	301;307;301;275;229;227;156	ENSP00000410447:M301V;ENSP00000342876:M307V;ENSP00000412869:M301V;ENSP00000363439:M275V;ENSP00000395203:M229V;ENSP00000399574:M227V;ENSP00000363447:M156V	ENSP00000342876:M307V	M	-	1	0	IKZF2	213581009	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.783000	0.55409	2.220000	0.72140	0.533000	0.62120	ATG	.	.	none		0.418	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	NM_016260	
OR5H1	26341	hgsc.bcm.edu	37	3	97852211	97852211	+	Missense_Mutation	SNP	G	G	A	rs72926074	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:97852211G>A	ENST00000354565.2	+	1	670	c.670G>A	c.(670-672)Gca>Aca	p.A224T	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TGTTCTCTTCGCAATCTTAAA	0.343													A|||	126	0.0251597	0.0908	0.0043	5008	,	,		19300	0.0		0.003	False		,,,				2504	0.0				p.A224T		Atlas-SNP	.											.	OR5H1	71	.	0			c.G670A						PASS	.	A	THR/ALA	262,4142	791.4+/-415.1	10,242,1950	71.0	78.0	76.0		670	-0.4	0.0	3	dbSNP_130	76	9,8589	815.9+/-406.9	0,9,4290	yes	missense	OR5H1	NM_001005338.1	58	10,251,6240	AA,AG,GG		0.1047,5.9491,2.0843	benign	224/314	97852211	271,12731	2202	4299	6501	SO:0001583	missense	26341	exon1			CTCTTCGCAATCT	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.670G>A	3.37:g.97852211G>A	ENSP00000346575:p.Ala224Thr	Somatic	268	0	0		WXS	Illumina HiSeq	Phase_I	204	11	0.0539216	NM_001005338		Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	43	0.019688644688644688	40	0.08130081300813008	0	0.0	0	0.0	3	0.00395778364116095	A	0	-2.610351	0.00121	0.059491	0.001047	ENSG00000231192	ENST00000354565	T	0.00188	8.59	3.57	-0.435	0.12279	GPCR, rhodopsin-like superfamily (1);	0.627824	0.14082	N	0.342661	T	0.00012	0.0000	N	0.03930	-0.32	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08722	-1.0708	10	0.07325	T	0.83	.	3.9726	0.09460	0.3411:0.0:0.4652:0.1937	.	224	A6NKK0	OR5H1_HUMAN	T	224	ENSP00000346575:A224T	ENSP00000346575:A224T	A	+	1	0	OR5H1	99334901	0.000000	0.05858	0.003000	0.11579	0.002000	0.02628	-0.171000	0.09883	-0.302000	0.08869	-1.298000	0.01336	GCA	G|0.981;A|0.019	0.019	strong		0.343	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
DPYSL5	56896	hgsc.bcm.edu	37	2	27163001	27163001	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:27163001C>T	ENST00000288699.6	+	9	1208	c.1050C>T	c.(1048-1050)ggC>ggT	p.G350G	DPYSL5_ENST00000401478.1_Silent_p.G350G	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	350					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGTGAGTGGCGTGCAGGACC	0.552																																					p.G350G		Atlas-SNP	.											.	DPYSL5	69	.	0			c.C1050T						PASS	.						165.0	140.0	148.0					2																	27163001		2203	4300	6503	SO:0001819	synonymous_variant	56896	exon9			GAGTGGCGTGCAG	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.1050C>T	2.37:g.27163001C>T		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	65	20	0.307692	NM_001253724	Q8TCL6|Q9NQC4|Q9NRY9	Silent	SNP	ENST00000288699.6	37	CCDS1730.1																																																																																			.	.	none		0.552	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	
MST1L	11223	hgsc.bcm.edu	37	1	17085373	17085373	+	RNA	SNP	C	C	T	rs2092130		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:17085373C>T	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.G440R(1)|p.G397R(1)									TGGCTATCCCCATCTGGGTCT	0.602																																					p.G440R		Atlas-SNP	.											Q13209_HUMAN,NS,carcinoma,0,6	.	.	6	2	Substitution - Missense(2)	kidney(2)	c.G1318A						scavenged	.																																					11223	exon10			TATCCCCATCTGG	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085373C>T		Somatic	507	17	0.0335306		WXS	Illumina HiSeq	Phase_I	509	17	0.0333988	NM_001271733	B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37		.	.	.	.	.	.	.	.	.	.	.	3.164	-0.171433	0.06421	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.699669	0.12362	N	0.475555	T	0.21761	0.0524	.	.	.	.	.	.	B	0.16166	0.016	B	0.17979	0.02	T	0.23940	-1.0174	5	.	.	.	.	3.5811	0.07954	2.0E-4:0.4998:0.4998:2.0E-4	rs2092130;rs2095110;rs4567270;rs9701105	440	Q2TV78-2	.	R	397;440;440	.	.	G	-	1	0	MST1P9	16957960	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	1.482000	0.35486	-0.000000	0.14550	0.000000	0.15137	GGG	C|1.000;|0.000	.	weak		0.602	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733	
APEH	327	hgsc.bcm.edu	37	3	49723296	49723296	+	IGR	SNP	G	G	A	rs2087733	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:49723296G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000494828.2_5'Flank|MST1_ENST00000383728.3_3'UTR|MST1_ENST00000449682.2_Missense_Mutation_p.P416L|AC099668.5_ENST00000563780.1_RNA	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.P402L(4)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GACTCACTGCGGCTTGTGCGG	0.677													G|||	3	0.000599042	0.0	0.0	5008	,	,		23747	0.0		0.003	False		,,,				2504	0.0				p.P416L		Atlas-SNP	.											MST1,trunk,malignant_melanoma,0,3	MST1	84	3	4	Substitution - Missense(4)	NS(2)|lung(1)|skin(1)	c.C1247T						scavenged	.						67.0	64.0	65.0					3																	49723296		2197	4282	6479	SO:0001628	intergenic_variant	4485	exon10			CACTGCGGCTTGT	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723296G>A		Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	112	10	0.0892857	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117796	0.37339	.	.	ENSG00000173531	ENST00000449682	T	0.66280	-0.2	5.1	5.1	0.69264	.	0.000000	0.42053	D	0.000772	T	0.52980	0.1768	L	0.33137	0.985	0.80722	D	1	B	0.18013	0.025	B	0.17979	0.02	T	0.48969	-0.8987	10	0.38643	T	0.18	.	16.2918	0.82756	0.0:0.0:1.0:0.0	rs2087733	416	G3XAK1	.	L	416	ENSP00000414287:P416L	ENSP00000414287:P416L	P	-	2	0	MST1	49698300	1.000000	0.71417	0.996000	0.52242	0.047000	0.14425	8.980000	0.93460	2.373000	0.80994	0.561000	0.74099	CCG	G|0.375;A|0.625	0.625	strong		0.677	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
FREM2	341640	hgsc.bcm.edu	37	13	39263849	39263849	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr13:39263849G>A	ENST00000280481.7	+	1	2584	c.2368G>A	c.(2368-2370)Ggt>Agt	p.G790S		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	790					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G790S(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CAGACCCCCGGGTCAAGAACT	0.542																																					p.G790S		Atlas-SNP	.											FREM2,arm,malignant_melanoma,0,1	FREM2	385	1	1	Substitution - Missense(1)	skin(1)	c.G2368A						scavenged	.						60.0	64.0	63.0					13																	39263849		2203	4300	6503	SO:0001583	missense	341640	exon1			CCCCCGGGTCAAG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2368G>A	13.37:g.39263849G>A	ENSP00000280481:p.Gly790Ser	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	76	2	0.0263158	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	1.132	-0.652246	0.03480	.	.	ENSG00000150893	ENST00000280481	T	0.16324	2.35	5.8	4.01	0.46588	.	0.256592	0.42964	N	0.000636	T	0.08802	0.0218	N	0.19112	0.55	0.35280	D	0.781262	B	0.02656	0.0	B	0.01281	0.0	T	0.22277	-1.0221	10	0.07175	T	0.84	.	8.0322	0.30472	0.1543:0.1388:0.7069:0.0	.	790	Q5SZK8	FREM2_HUMAN	S	790	ENSP00000280481:G790S	ENSP00000280481:G790S	G	+	1	0	FREM2	38161849	1.000000	0.71417	0.962000	0.40283	0.158000	0.22134	4.522000	0.60539	0.747000	0.32809	0.655000	0.94253	GGT	.	.	none		0.542	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
PROSER1	80209	hgsc.bcm.edu	37	13	39587314	39587314	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr13:39587314G>A	ENST00000352251.3	-	11	2908	c.2075C>T	c.(2074-2076)cCa>cTa	p.P692L	PROSER1_ENST00000350125.3_Missense_Mutation_p.P670L|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	692	Ser-rich.							p.P692L(1)									AGTGAATACTGGTGCAATGGG	0.438																																					p.P692L		Atlas-SNP	.											C13orf23,NS,carcinoma,0,1	.	.	1	1	Substitution - Missense(1)	kidney(1)	c.C2075T						scavenged	.						129.0	129.0	129.0					13																	39587314		2203	4300	6503	SO:0001583	missense	80209	exon11			AATACTGGTGCAA	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.2075C>T	13.37:g.39587314G>A	ENSP00000332034:p.Pro692Leu	Somatic	100	1	0.01		WXS	Illumina HiSeq	Phase_I	107	2	0.0186916	NM_025138	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	ENST00000352251.3	37	CCDS9368.2	.	.	.	.	.	.	.	.	.	.	G	14.11	2.436928	0.43224	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.34667	1.36;1.35	5.27	4.42	0.53409	.	.	.	.	.	T	0.47930	0.1472	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.38542	-0.9656	8	.	.	.	-13.7911	14.7268	0.69351	0.0:0.0:0.8541:0.1459	.	670;692	A6NJ97;Q86XN7	.;PRSR1_HUMAN	L	692;670	ENSP00000332034:P692L;ENSP00000339123:P670L	.	P	-	2	0	PROSER1	38485314	0.998000	0.40836	0.045000	0.18777	0.188000	0.23474	4.754000	0.62191	1.340000	0.45581	-0.310000	0.09108	CCA	.	.	none		0.438	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
PEG3	5178	hgsc.bcm.edu	37	19	57325440	57325440	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:57325440C>T	ENST00000326441.9	-	10	4733	c.4370G>A	c.(4369-4371)gGt>gAt	p.G1457D	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.G1457D|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.G1333D|PEG3_ENST00000593695.1_Missense_Mutation_p.G1331D|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1457	Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G1457D(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GTCTTCAATACCTGCACCATC	0.572																																					p.G1457D		Atlas-SNP	.											ZIM2_ENST00000326441,rectum,carcinoma,0,2	PEG3	414	2	2	Substitution - Missense(2)	large_intestine(2)	c.G4370A						scavenged	.						107.0	97.0	100.0					19																	57325440		2203	4300	6503	SO:0001583	missense	5178	exon9			TCAATACCTGCAC	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4370G>A	19.37:g.57325440C>T	ENSP00000326581:p.Gly1457Asp	Somatic	291	0	0		WXS	Illumina HiSeq	Phase_I	284	3	0.0105634	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576445	0.65878	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02345	4.33;4.33	4.25	4.25	0.50352	.	0.000000	0.46145	D	0.000317	T	0.06325	0.0163	L	0.27053	0.805	.	.	.	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.50693	-0.8798	9	0.12103	T	0.63	-39.6188	12.4664	0.55762	0.0:1.0:0.0:0.0	.	1333;1457;1392	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	D	1457	ENSP00000326581:G1457D;ENSP00000403051:G1457D	ENSP00000326581:G1457D	G	-	2	0	ZIM2	62017252	0.000000	0.05858	0.514000	0.27761	0.779000	0.44077	0.246000	0.18160	2.657000	0.90304	0.650000	0.86243	GGT	.	.	none		0.572	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
PROM2	150696	hgsc.bcm.edu	37	2	95953995	95953995	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:95953995G>A	ENST00000317620.9	+	21	2414	c.2281G>A	c.(2281-2283)Gga>Aga	p.G761R	PROM2_ENST00000317668.4_Missense_Mutation_p.G761R|PROM2_ENST00000403131.2_Missense_Mutation_p.G761R|PROM2_ENST00000542147.1_Missense_Mutation_p.G712R	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	761					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						GCCCCTCTCCGGAGCCCTGGA	0.622																																					p.G761R		Atlas-SNP	.											PROM2,NS,carcinoma,-1,1	PROM2	78	1	0			c.G2281A						scavenged	.						110.0	109.0	109.0					2																	95953995		2203	4300	6503	SO:0001583	missense	150696	exon21			CTCTCCGGAGCCC	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.2281G>A	2.37:g.95953995G>A	ENSP00000318270:p.Gly761Arg	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	68	3	0.0441176	NM_001165977	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	37	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	G	0.091	-1.167753	0.01660	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.58	0.453	0.16639	.	1.356780	0.04605	N	0.399145	T	0.27765	0.0683	L	0.38175	1.15	0.09310	N	1	B	0.16396	0.017	B	0.14023	0.01	T	0.11060	-1.0603	10	0.13853	T	0.58	3.5562	1.1033	0.01688	0.2652:0.1535:0.4234:0.1579	.	761	Q8N271	PROM2_HUMAN	R	761;761;761;712	ENSP00000385716:G761R;ENSP00000318520:G761R;ENSP00000318270:G761R;ENSP00000442542:G712R	ENSP00000318270:G761R	G	+	1	0	PROM2	95317722	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	0.021000	0.13489	0.014000	0.14944	0.655000	0.94253	GGA	.	.	none		0.622	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
RETSAT	54884	hgsc.bcm.edu	37	2	85577909	85577909	+	Silent	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:85577909C>A	ENST00000295802.4	-	3	703	c.591G>T	c.(589-591)ctG>ctT	p.L197L	RETSAT_ENST00000263854.6_Silent_p.L197L|RETSAT_ENST00000457495.2_Silent_p.L136L	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	197					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	TTACCTTAACCAGCTTTATAT	0.473																																					p.L197L		Atlas-SNP	.											.	RETSAT	56	.	0			c.G591T						PASS	.						161.0	158.0	159.0					2																	85577909		2203	4300	6503	SO:0001819	synonymous_variant	54884	exon3			CTTAACCAGCTTT	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.591G>T	2.37:g.85577909C>A		Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	124	46	0.370968	NM_017750	A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Silent	SNP	ENST00000295802.4	37	CCDS1972.1	.	.	.	.	.	.	.	.	.	.	C	8.785	0.929119	0.18131	.	.	ENSG00000042445	ENST00000409984	.	.	.	5.92	5.03	0.67393	.	.	.	.	.	T	0.70675	0.3251	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70029	-0.4984	4	.	.	.	-9.9361	14.7022	0.69164	0.0:0.854:0.146:0.0	.	.	.	.	L	136	.	.	W	-	2	0	RETSAT	85431420	0.089000	0.21612	0.998000	0.56505	0.939000	0.58152	0.046000	0.14035	1.478000	0.48253	0.655000	0.94253	TGG	.	.	none		0.473	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750	
MARCH7	64844	hgsc.bcm.edu	37	2	160599591	160599591	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:160599591C>G	ENST00000259050.4	+	3	295	c.173C>G	c.(172-174)tCt>tGt	p.S58C	MARCH7_ENST00000539065.1_Missense_Mutation_p.S58C|MARCH7_ENST00000409175.1_Missense_Mutation_p.S58C|MARCH7_ENST00000473749.1_3'UTR|MARCH7_ENST00000409591.1_Missense_Mutation_p.S20C	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	58	Ser-rich.				protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						GCATCAGCATCTGCGTCACCA	0.393																																					p.S58C		Atlas-SNP	.											.	MARCH7	48	.	0			c.C173G						PASS	.						99.0	97.0	98.0					2																	160599591		2203	4300	6503	SO:0001583	missense	64844	exon3			CAGCATCTGCGTC	AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.173C>G	2.37:g.160599591C>G	ENSP00000259050:p.Ser58Cys	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	143	62	0.433566	NM_022826	A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	ENST00000259050.4	37	CCDS2210.1	.	.	.	.	.	.	.	.	.	.	C	7.695	0.691842	0.15039	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000421037;ENST00000409591	T;T;T;T;T	0.50813	2.57;2.52;2.57;0.73;2.44	5.54	2.29	0.28610	.	0.329624	0.29964	N	0.010759	T	0.29749	0.0743	N	0.19112	0.55	0.23589	N	0.99735	B;B;B	0.10296	0.003;0.002;0.002	B;B;B	0.08055	0.003;0.001;0.002	T	0.20907	-1.0261	10	0.49607	T	0.09	-37.7217	8.7404	0.34554	0.0:0.7161:0.1278:0.1561	.	58;20;58	F5H6W4;B7Z7P5;Q9H992	.;.;MARH7_HUMAN	C	58;58;58;58;20	ENSP00000386830:S58C;ENSP00000442992:S58C;ENSP00000259050:S58C;ENSP00000392862:S58C;ENSP00000387238:S20C	ENSP00000259050:S58C	S	+	2	0	MARCH7	160307837	1.000000	0.71417	0.998000	0.56505	0.826000	0.46750	2.550000	0.45811	0.693000	0.31634	-0.142000	0.14014	TCT	.	.	none		0.393	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255040.3	NM_022826	
SAMHD1	25939	hgsc.bcm.edu	37	20	35559188	35559188	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr20:35559188C>A	ENST00000262878.4	-	5	799	c.600G>T	c.(598-600)caG>caT	p.Q200H	SAMHD1_ENST00000373694.5_5'UTR	NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	200	HD.				dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				GTCCAGCAATCTGAACACAGA	0.413																																					p.Q200H		Atlas-SNP	.											.	SAMHD1	62	.	0			c.G600T						PASS	.						194.0	177.0	183.0					20																	35559188		2203	4300	6503	SO:0001583	missense	25939	exon5			AGCAATCTGAACA	AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.600G>T	20.37:g.35559188C>A	ENSP00000262878:p.Gln200His	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	91	44	0.483516	NM_015474	B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	ENST00000262878.4	37	CCDS13288.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.529296	0.85706	.	.	ENSG00000101347	ENST00000262878	D	0.90385	-2.66	6.02	6.02	0.97574	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.106561	0.64402	D	0.000003	D	0.94042	0.8091	M	0.75150	2.29	0.80722	D	1	D	0.60160	0.987	P	0.62014	0.897	D	0.93147	0.6546	10	0.44086	T	0.13	-16.5248	14.1219	0.65192	0.0:0.9234:0.0:0.0766	.	200	Q9Y3Z3	SAMH1_HUMAN	H	200	ENSP00000262878:Q200H	ENSP00000262878:Q200H	Q	-	3	2	SAMHD1	34992602	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.216000	0.51176	2.850000	0.98022	0.650000	0.86243	CAG	.	.	none		0.413	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079062.2	NM_015474	
MUC4	4585	hgsc.bcm.edu	37	3	195515065	195515065	+	Missense_Mutation	SNP	G	G	T	rs74695299		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:195515065G>T	ENST00000463781.3	-	2	3845	c.3386C>A	c.(3385-3387)gCa>gAa	p.A1129E	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A1129E	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	568					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A1129V(4)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.562																																					p.A1129E		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,5	MUC4	1505	5	4	Substitution - Missense(4)	endometrium(2)|skin(2)	c.C3386A						scavenged	.						7.0	6.0	6.0					3																	195515065		628	1402	2030	SO:0001583	missense	4585	exon2			GTGGATGCTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3386C>A	3.37:g.195515065G>T	ENSP00000417498:p.Ala1129Glu	Somatic	72	8	0.111111		WXS	Illumina HiSeq	Phase_I	119	7	0.0588235	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.390	0.071964	0.08436	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32515	1.45;1.45	0.814	-1.63	0.08345	.	.	.	.	.	T	0.30262	0.0759	N	0.19112	0.55	0.09310	N	1	D	0.62365	0.991	D	0.70716	0.97	T	0.36456	-0.9747	8	.	.	.	.	3.2261	0.06732	0.3884:0.0:0.3874:0.2242	.	1129	E7ESK3	.	E	1129	ENSP00000417498:A1129E;ENSP00000420243:A1129E	.	A	-	2	0	MUC4	196999460	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	0.076000	0.14712	-3.103000	0.00244	-2.092000	0.00371	GCA	G|0.500;A|0.500	.	alt		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SERPINB2	5055	hgsc.bcm.edu	37	18	61562516	61562516	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:61562516G>T	ENST00000299502.4	+	3	267	c.187G>T	c.(187-189)Gtg>Ttg	p.V63L	SERPINB2_ENST00000482254.1_3'UTR|SERPINB2_ENST00000457692.1_Missense_Mutation_p.V63L	NM_002575.2	NP_002566.1	P05120	PAI2_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 2	63					blood coagulation (GO:0007596)|fibrinolysis (GO:0042730)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|liver(1)|lung(12)|prostate(2)|skin(2)|stomach(1)	32		Esophageal squamous(42;0.131)			Tenecteplase(DB00031)|Urokinase(DB00013)	GTTTAATGAAGTGGGAGCCAA	0.453																																					p.V63L		Atlas-SNP	.											.	SERPINB2	63	.	0			c.G187T						PASS	.						149.0	150.0	150.0					18																	61562516		2203	4300	6503	SO:0001583	missense	5055	exon3			AATGAAGTGGGAG	Y00630	CCDS11989.1	18q21.3	2014-02-18	2005-08-18		ENSG00000197632	ENSG00000197632		"""Serine (or cysteine) peptidase inhibitors"""	8584	protein-coding gene	gene with protein product		173390	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2"""	PLANH2, PAI2		24172014	Standard	NM_002575		Approved	HsT1201	uc002ljo.3	P05120	OTTHUMG00000060592	ENST00000299502.4:c.187G>T	18.37:g.61562516G>T	ENSP00000299502:p.Val63Leu	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	182	35	0.192308	NM_002575	Q96E96	Missense_Mutation	SNP	ENST00000299502.4	37	CCDS11989.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.778022	0.31502	.	.	ENSG00000197632	ENST00000404622;ENST00000299502;ENST00000457692;ENST00000413956;ENST00000443281	D;T;T;D;T	0.82711	-1.64;2.83;2.83;-1.55;-1.17	5.93	0.531	0.17108	Serpin domain (3);	4.311900	0.00508	N	0.000179	T	0.75925	0.3916	L	0.33668	1.02	0.09310	N	1	B	0.21520	0.057	B	0.21360	0.034	T	0.56727	-0.7931	10	0.25751	T	0.34	.	8.6478	0.34016	0.4471:0.0:0.5529:0.0	.	63	P05120	PAI2_HUMAN	L	63	ENSP00000385397:V63L;ENSP00000299502:V63L;ENSP00000401645:V63L;ENSP00000402386:V63L;ENSP00000397096:V63L	ENSP00000299502:V63L	V	+	1	0	SERPINB2	59713496	0.001000	0.12720	0.001000	0.08648	0.013000	0.08279	-0.105000	0.10907	0.019000	0.15079	0.655000	0.94253	GTG	.	.	none		0.453	SERPINB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134009.1	NM_002575	
DCHS1	8642	hgsc.bcm.edu	37	11	6646497	6646497	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:6646497C>T	ENST00000299441.3	-	19	7489	c.7078G>A	c.(7078-7080)Gcc>Acc	p.A2360T	RP11-732A19.5_ENST00000526456.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2360	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGAGGTTGGCACGGCCCTCA	0.587																																					p.A2360T		Atlas-SNP	.											.	DCHS1	277	.	0			c.G7078A						PASS	.						89.0	82.0	85.0					11																	6646497		2201	4296	6497	SO:0001583	missense	8642	exon19			GGTTGGCACGGCC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.7078G>A	11.37:g.6646497C>T	ENSP00000299441:p.Ala2360Thr	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	52	25	0.480769	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735641	0.69189	.	.	ENSG00000166341	ENST00000299441	T	0.50548	0.74	4.95	4.95	0.65309	Cadherin (4);Cadherin-like (1);	0.000000	0.42548	D	0.000684	T	0.53834	0.1821	L	0.35414	1.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.40850	-0.9541	10	0.05959	T	0.93	.	16.9484	0.86236	0.0:1.0:0.0:0.0	.	2360	Q96JQ0	PCD16_HUMAN	T	2360	ENSP00000299441:A2360T	ENSP00000299441:A2360T	A	-	1	0	DCHS1	6603073	1.000000	0.71417	0.963000	0.40424	0.860000	0.49131	5.826000	0.69293	2.563000	0.86464	0.655000	0.94253	GCC	.	.	none		0.587	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
TDRD6	221400	hgsc.bcm.edu	37	6	46658993	46658993	+	Missense_Mutation	SNP	A	A	C	rs138212613		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:46658993A>C	ENST00000316081.6	+	1	3128	c.3128A>C	c.(3127-3129)aAg>aCg	p.K1043T	TDRD6_ENST00000544460.1_Missense_Mutation_p.K1043T	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1043	Tudor 5. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			TGCCTTGCCAAGTATACTGAT	0.338																																					p.K1043T		Atlas-SNP	.											TDRD6,NS,carcinoma,0,1	TDRD6	205	1	0			c.A3128C						scavenged	.						71.0	76.0	74.0					6																	46658993		2203	4300	6503	SO:0001583	missense	221400	exon1			TTGCCAAGTATAC	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.3128A>C	6.37:g.46658993A>C	ENSP00000346065:p.Lys1043Thr	Somatic	95	1	0.0105263		WXS	Illumina HiSeq	Phase_I	127	38	0.299213	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	A	10.72	1.428736	0.25726	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.09723	2.95;2.95	5.45	-1.74	0.08056	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.515089	0.21750	N	0.069696	T	0.17619	0.0423	M	0.86420	2.815	0.25095	N	0.99083	D;D	0.67145	0.995;0.996	D;D	0.70935	0.951;0.971	T	0.04579	-1.0941	10	0.39692	T	0.17	-3.58	11.919	0.52781	0.5826:0.0:0.4174:0.0	.	1043;1043	F5H5M3;O60522	.;TDRD6_HUMAN	T	1043	ENSP00000443299:K1043T;ENSP00000346065:K1043T	ENSP00000346065:K1043T	K	+	2	0	TDRD6	46766952	0.041000	0.20044	0.545000	0.28153	0.307000	0.27823	-0.057000	0.11768	-0.545000	0.06224	-0.977000	0.02584	AAG	A|1.000;G|0.000	.	alt		0.338	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
SYNJ2	8871	hgsc.bcm.edu	37	6	158504550	158504550	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:158504550G>A	ENST00000355585.4	+	21	3030	c.2955G>A	c.(2953-2955)atG>atA	p.M985I	SYNJ2_ENST00000367122.2_Missense_Mutation_p.M985I|SYNJ2_ENST00000367112.1_Missense_Mutation_p.M70I|SYNJ2_ENST00000367121.3_Missense_Mutation_p.M985I	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	985					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		GAGACAGCATGGCCCCCGTGT	0.527																																					p.M985I		Atlas-SNP	.											.	SYNJ2	111	.	0			c.G2955A						PASS	.						106.0	99.0	102.0					6																	158504550		2203	4300	6503	SO:0001583	missense	8871	exon21			CAGCATGGCCCCC	AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.2955G>A	6.37:g.158504550G>A	ENSP00000347792:p.Met985Ile	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	92	29	0.315217	NM_003898	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Missense_Mutation	SNP	ENST00000355585.4	37	CCDS5254.1	.	.	.	.	.	.	.	.	.	.	G	1.051	-0.675929	0.03378	.	.	ENSG00000078269	ENST00000367122;ENST00000367121;ENST00000355585;ENST00000367112	D;D;D;T	0.92699	-2.84;-3.09;-2.83;1.21	5.43	3.59	0.41128	Domain of unknown function DUF1866 (1);	0.963904	0.08620	N	0.918599	T	0.52273	0.1724	N	0.01109	-1.01	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.59815	-0.7383	10	0.05525	T	0.97	.	3.6538	0.08213	0.1642:0.151:0.5613:0.1235	.	985;985	O15056;O15056-3	SYNJ2_HUMAN;.	I	985;985;985;70	ENSP00000356089:M985I;ENSP00000356088:M985I;ENSP00000347792:M985I;ENSP00000356079:M70I	ENSP00000347792:M985I	M	+	3	0	SYNJ2	158424538	0.989000	0.36119	0.069000	0.20011	0.935000	0.57460	0.611000	0.24268	1.271000	0.44313	0.591000	0.81541	ATG	.	.	none		0.527	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
FAM157A	728262	hgsc.bcm.edu	37	3	197894668	197894668	+	lincRNA	SNP	G	G	A	rs200450190		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:197894668G>A	ENST00000437428.2	+	0	829							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A									p.R337K(1)		NS(1)|skin(1)	2						TTCCCGCTGAGGTGCCAGAAG	0.607											OREG0016022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R337K		Atlas-SNP	.											FAM157A,NS,malignant_melanoma,0,1	FAM157A	4	1	1	Substitution - Missense(1)	NS(1)	c.G1010A						scavenged	.						33.0	31.0	31.0					3																	197894668		689	1588	2277			728262	exon5			CGCTGAGGTGCCA			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197894668G>A		Somatic	935	6	0.00641711	2094	WXS	Illumina HiSeq	Phase_I	1020	11	0.0107843	NM_001145248		Missense_Mutation	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	4.173	0.030697	0.08101	.	.	ENSG00000236438	ENST00000431569	.	.	.	0.467	0.467	0.16721	.	.	.	.	.	T	0.17365	0.0417	N	0.08118	0	0.09310	N	1	B	0.28667	0.219	B	0.32090	0.14	T	0.31888	-0.9927	6	.	.	.	.	.	.	.	.	337	C9JC47	F157A_HUMAN	K	337	.	.	R	+	2	0	FAM157A	199379065	0.074000	0.21230	0.015000	0.15790	0.049000	0.14656	0.293000	0.19029	0.539000	0.28788	0.388000	0.25769	AGG	.	.	weak		0.607	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
ZSWIM4	65249	hgsc.bcm.edu	37	19	13915887	13915887	+	Missense_Mutation	SNP	A	A	C	rs199644245		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:13915887A>C	ENST00000254323.2	+	3	826	c.637A>C	c.(637-639)Act>Cct	p.T213P	ZSWIM4_ENST00000440752.2_5'UTR	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	213							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CGCCCATCACACTGAGGTGCT	0.627											OREG0025298	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	a|||	1	0.000199681	0.0	0.0014	5008	,	,		19520	0.0		0.0	False		,,,				2504	0.0				p.T213P		Atlas-SNP	.											.	ZSWIM4	69	.	0			c.A637C						PASS	.						47.0	41.0	43.0					19																	13915887		2203	4300	6503	SO:0001583	missense	65249	exon3			CATCACACTGAGG	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.637A>C	19.37:g.13915887A>C	ENSP00000254323:p.Thr213Pro	Somatic	24	0	0	691	WXS	Illumina HiSeq	Phase_I	39	16	0.410256	NM_023072		Missense_Mutation	SNP	ENST00000254323.2	37	CCDS32924.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	18.12	3.552511	0.65425	.	.	ENSG00000132003	ENST00000254323	T	0.43294	0.95	4.58	4.58	0.56647	.	0.000000	0.64402	D	0.000015	T	0.64103	0.2568	M	0.84082	2.675	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.65475	-0.6159	10	0.34782	T	0.22	-10.3035	11.9253	0.52817	1.0:0.0:0.0:0.0	.	213	Q9H7M6	ZSWM4_HUMAN	P	213	ENSP00000254323:T213P	ENSP00000254323:T213P	T	+	1	0	ZSWIM4	13776887	1.000000	0.71417	0.995000	0.50966	0.436000	0.31835	8.974000	0.93433	1.714000	0.51371	0.459000	0.35465	ACT	A|1.000;C|0.000	0.000	strong		0.627	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342	
ALG10	84920	hgsc.bcm.edu	37	12	34179242	34179242	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:34179242G>A	ENST00000266483.2	+	3	1133	c.814G>A	c.(814-816)Ggt>Agt	p.G272S	AC046130.1_ENST00000401300.2_RNA|ALG10_ENST00000538927.1_Intron|RP11-847H18.2_ENST00000501954.2_RNA	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	272					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				AGTAGTTAATGGTGGAATTGT	0.373																																					p.G272S		Atlas-SNP	.											.	ALG10	53	.	0			c.G814A						PASS	.						174.0	180.0	178.0					12																	34179242		2203	4297	6500	SO:0001583	missense	84920	exon3			GTTAATGGTGGAA	AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.814G>A	12.37:g.34179242G>A	ENSP00000266483:p.Gly272Ser	Somatic	343	0	0		WXS	Illumina HiSeq	Phase_I	292	111	0.380137	NM_032834	Q6NS98|Q96DU0|Q96SM6	Missense_Mutation	SNP	ENST00000266483.2	37	CCDS41769.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.288670	0.59976	.	.	ENSG00000139133	ENST00000266483	T	0.56611	0.45	3.37	2.46	0.29980	.	0.194989	0.53938	N	0.000042	T	0.66218	0.2767	M	0.91038	3.17	0.80722	D	1	D	0.54964	0.969	P	0.51487	0.671	T	0.69647	-0.5089	10	0.66056	D	0.02	.	8.4466	0.32845	0.1241:0.0:0.8759:0.0	.	272	Q5BKT4	AG10A_HUMAN	S	272	ENSP00000266483:G272S	ENSP00000266483:G272S	G	+	1	0	ALG10	34070509	1.000000	0.71417	0.030000	0.17652	0.829000	0.46940	4.077000	0.57598	0.537000	0.28751	0.184000	0.17185	GGT	.	.	none		0.373	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403309.1	NM_032834	
FAM186A	121006	hgsc.bcm.edu	37	12	50746166	50746166	+	Silent	SNP	G	G	C	rs368983791		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:50746166G>C	ENST00000327337.5	-	4	4448	c.4449C>G	c.(4447-4449)ctC>ctG	p.L1483L	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Silent_p.L1483L	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1483								p.L1483L(2)									GCGGAGGGATGAGAGGGATCC	0.647																																					p.L1483L	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											FAM186A_ENST00000327337,NS,carcinoma,0,3	FAM186A	181	3	2	Substitution - coding silent(2)	endometrium(2)	c.C4449G						scavenged	.						22.0	21.0	21.0					12																	50746166		692	1591	2283	SO:0001819	synonymous_variant	121006	exon4			AGGGATGAGAGGG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4449C>G	12.37:g.50746166G>C		Somatic	301	2	0.00664452		WXS	Illumina HiSeq	Phase_I	253	5	0.0197628	NM_001145475		Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																			.	.	weak		0.647	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
ZMPSTE24	10269	hgsc.bcm.edu	37	1	40751632	40751632	+	Silent	SNP	C	C	T	rs116284141	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:40751632C>T	ENST00000372759.3	+	8	1155	c.990C>T	c.(988-990)ctC>ctT	p.L330L		NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	330					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			AGGAGGTACTCGCTGTACTAG	0.328													C|||	29	0.00579073	0.0204	0.0029	5008	,	,		19667	0.0		0.0	False		,,,				2504	0.0				p.L330L		Atlas-SNP	.											ZMPSTE24,NS,carcinoma,+2,1	ZMPSTE24	50	1	0			c.C990T						scavenged	.	C		71,4335	65.3+/-102.7	0,71,2132	106.0	104.0	105.0		990	-2.1	1.0	1	dbSNP_132	105	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZMPSTE24	NM_005857.3		0,72,6431	TT,TC,CC		0.0116,1.6114,0.5536		330/476	40751632	72,12934	2203	4300	6503	SO:0001819	synonymous_variant	10269	exon8			GGTACTCGCTGTA	Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.990C>T	1.37:g.40751632C>T		Somatic	204	0	0		WXS	Illumina HiSeq	Phase_I	163	4	0.0245399	NM_005857	B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Silent	SNP	ENST00000372759.3	37	CCDS449.1																																																																																			C|0.995;T|0.005	0.005	strong		0.328	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015766.1		
PTPN21	11099	hgsc.bcm.edu	37	14	88951488	88951488	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:88951488T>C	ENST00000556564.1	-	12	1294	c.1010A>G	c.(1009-1011)tAc>tGc	p.Y337C	PTPN21_ENST00000328736.3_Missense_Mutation_p.Y337C	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	337					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AGGCATCACGTAGGGCTGGGG	0.428																																					p.Y337C		Atlas-SNP	.											.	PTPN21	113	.	0			c.A1010G						PASS	.						125.0	117.0	120.0					14																	88951488		2203	4300	6503	SO:0001583	missense	11099	exon12			ATCACGTAGGGCT	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.1010A>G	14.37:g.88951488T>C	ENSP00000452414:p.Tyr337Cys	Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	89	34	0.382022	NM_007039		Missense_Mutation	SNP	ENST00000556564.1	37	CCDS9884.1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.365736	0.61513	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	D;D	0.82255	-1.59;-1.59	5.49	4.27	0.50696	.	0.073893	0.56097	D	0.000025	D	0.88994	0.6589	M	0.71581	2.175	0.43724	D	0.996202	D	0.89917	1.0	D	0.80764	0.994	D	0.88828	0.3303	10	0.49607	T	0.09	.	11.6649	0.51368	0.1326:0.0:0.0:0.8674	.	337	Q16825	PTN21_HUMAN	C	337	ENSP00000330276:Y337C;ENSP00000452414:Y337C	ENSP00000330276:Y337C	Y	-	2	0	PTPN21	88021241	1.000000	0.71417	0.996000	0.52242	0.925000	0.55904	3.230000	0.51286	2.212000	0.71576	0.533000	0.62120	TAC	.	.	none		0.428	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
BMP10	27302	hgsc.bcm.edu	37	2	69093241	69093241	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:69093241C>T	ENST00000295379.1	-	2	955	c.797G>A	c.(796-798)aGg>aAg	p.R266K		NM_014482.1	NP_055297.1	O95393	BMP10_HUMAN	bone morphogenetic protein 10	266					activin receptor signaling pathway (GO:0032924)|adult heart development (GO:0007512)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heart trabecula formation (GO:0060347)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction (GO:0055117)|sarcomere organization (GO:0045214)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Z disc (GO:0030018)	hormone activity (GO:0005179)|receptor serine/threonine kinase binding (GO:0033612)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(15)|ovary(2)	27						TTCCTCCTTCCTCTCCTTGTC	0.488																																					p.R266K		Atlas-SNP	.											BMP10,NS,carcinoma,+1,1	BMP10	70	1	0			c.G797A						scavenged	.						117.0	100.0	106.0					2																	69093241		2203	4300	6503	SO:0001583	missense	27302	exon2			TCCTTCCTCTCCT	AF101441	CCDS1890.1	2p13.2	2014-09-17			ENSG00000163217	ENSG00000163217		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	20869	protein-coding gene	gene with protein product		608748				10072785	Standard	NM_014482		Approved		uc002sez.1	O95393	OTTHUMG00000129573	ENST00000295379.1:c.797G>A	2.37:g.69093241C>T	ENSP00000295379:p.Arg266Lys	Somatic	257	0	0		WXS	Illumina HiSeq	Phase_I	226	3	0.0132743	NM_014482	Q53R17|Q6NTE0	Missense_Mutation	SNP	ENST00000295379.1	37	CCDS1890.1	.	.	.	.	.	.	.	.	.	.	C	0.023	-1.403837	0.01165	.	.	ENSG00000163217	ENST00000295379	T	0.73897	-0.79	6.07	-2.92	0.05615	.	0.563905	0.20427	N	0.092545	T	0.49218	0.1544	N	0.14661	0.345	0.09310	N	1	B	0.15719	0.014	B	0.10450	0.005	T	0.41179	-0.9523	10	0.06365	T	0.9	.	13.0709	0.59061	0.0:0.1996:0.0:0.8004	.	266	O95393	BMP10_HUMAN	K	266	ENSP00000295379:R266K	ENSP00000295379:R266K	R	-	2	0	BMP10	68946745	0.128000	0.22383	0.004000	0.12327	0.212000	0.24457	0.336000	0.19823	-0.415000	0.07484	-0.136000	0.14681	AGG	.	.	none		0.488	BMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251768.1	NM_014482	
OCRL	4952	hgsc.bcm.edu	37	X	128709154	128709154	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:128709154T>G	ENST00000371113.4	+	16	1805	c.1640T>G	c.(1639-1641)tTt>tGt	p.F547C	OCRL_ENST00000357121.5_Missense_Mutation_p.F547C	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	547	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						CGGAAAGTCTTTGAAGATAGT	0.423																																					p.F547C		Atlas-SNP	.											.	OCRL	117	.	0			c.T1640G						PASS	.						217.0	176.0	190.0					X																	128709154		2203	4300	6503	SO:0001583	missense	4952	exon16			AAGTCTTTGAAGA	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.1640T>G	X.37:g.128709154T>G	ENSP00000360154:p.Phe547Cys	Somatic	136	1	0.00735294		WXS	Illumina HiSeq	Phase_I	105	86	0.819048	NM_000276	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	37	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.059371	0.76074	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	D;D	0.95412	-3.7;-3.7	5.68	5.68	0.88126	Endonuclease/exonuclease/phosphatase (1);	0.047623	0.85682	D	0.000000	D	0.97084	0.9047	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.69824	0.966;0.9	D	0.97274	0.9913	10	0.56958	D	0.05	.	13.6193	0.62128	0.0:0.0:0.0:1.0	.	547;547	Q01968-2;Q01968	.;OCRL_HUMAN	C	547	ENSP00000360154:F547C;ENSP00000349635:F547C	ENSP00000349635:F547C	F	+	2	0	OCRL	128536835	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.698000	0.84413	1.896000	0.54893	0.441000	0.28932	TTT	.	.	none		0.423	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
THSD7A	221981	hgsc.bcm.edu	37	7	11509616	11509616	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:11509616G>T	ENST00000423059.4	-	9	2509	c.2258C>A	c.(2257-2259)cCt>cAt	p.P753H	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	753	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		AAGGCTTTCAGGACATCTAGA	0.393										HNSCC(18;0.044)																											p.P753H		Atlas-SNP	.											THSD7A,mouth,carcinoma,+1,1	THSD7A	219	1	0			c.C2258A						PASS	.						47.0	40.0	43.0					7																	11509616		1858	4094	5952	SO:0001583	missense	221981	exon9			CTTTCAGGACATC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2258C>A	7.37:g.11509616G>T	ENSP00000406482:p.Pro753His	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	85	28	0.329412	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716373	0.89205	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.61742	0.08	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.76407	0.3983	M	0.73372	2.23	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.77008	-0.2747	10	0.56958	D	0.05	.	19.5548	0.95338	0.0:0.0:1.0:0.0	.	753	Q9UPZ6	THS7A_HUMAN	H	753	ENSP00000406482:P753H	ENSP00000262042:P753H	P	-	2	0	THSD7A	11476141	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.813000	0.99286	2.686000	0.91538	0.650000	0.86243	CCT	.	.	none		0.393	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
CCDC185	164127	hgsc.bcm.edu	37	1	223567883	223567883	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:223567883C>T	ENST00000366875.3	+	1	1169	c.1066C>T	c.(1066-1068)Ccg>Tcg	p.P356S		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		356										breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		CCAGGAGAGCCCGCGCCAGGA	0.687																																					p.P356S		Atlas-SNP	.											C1orf65,rectum,carcinoma,-1,1	C1orf65	71	1	0			c.C1066T						scavenged	.						12.0	17.0	15.0					1																	223567883		2192	4288	6480	SO:0001583	missense	164127	exon1			GAGAGCCCGCGCC																												ENST00000366875.3:c.1066C>T	1.37:g.223567883C>T	ENSP00000355840:p.Pro356Ser	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	60	2	0.0333333	NM_152610	Q8N746|Q8NA93	Missense_Mutation	SNP	ENST00000366875.3	37	CCDS1537.1	.	.	.	.	.	.	.	.	.	.	C	0.022	-1.416426	0.01136	.	.	ENSG00000178395	ENST00000366875	T	0.20069	2.1	4.27	3.28	0.37604	.	.	.	.	.	T	0.12518	0.0304	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.24584	-1.0156	9	0.09843	T	0.71	.	9.9791	0.41802	0.0:0.6389:0.3611:0.0	.	356	Q8N715	CA065_HUMAN	S	356	ENSP00000355840:P356S	ENSP00000355840:P356S	P	+	1	0	C1orf65	221634506	0.000000	0.05858	0.005000	0.12908	0.257000	0.26127	0.469000	0.22067	1.911000	0.55334	0.650000	0.86243	CCG	.	.	none		0.687	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1		
PCMTD1	115294	hgsc.bcm.edu	37	8	52733101	52733101	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr8:52733101A>G	ENST00000360540.5	-	7	1290	c.884T>C	c.(883-885)cTt>cCt	p.L295P	PCMTD1_ENST00000544451.1_Missense_Mutation_p.L219P|PCMTD1_ENST00000522514.1_Missense_Mutation_p.L295P|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	295						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CTGAGGAATAAGCTGATTACC	0.423																																					p.L295P		Atlas-SNP	.											PCMTD1,extremity,malignant_melanoma,-1,3	PCMTD1	73	3	0			c.T884C						scavenged	.						176.0	171.0	172.0					8																	52733101		2203	4300	6503	SO:0001583	missense	115294	exon6			GGAATAAGCTGAT		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.884T>C	8.37:g.52733101A>G	ENSP00000353739:p.Leu295Pro	Somatic	327	0	0		WXS	Illumina HiSeq	Phase_I	265	4	0.0150943	NM_052937	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.944992	0.73672	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.50548	0.74;0.74;0.74	5.97	5.97	0.96955	.	0.063724	0.64402	D	0.000004	T	0.66406	0.2786	L	0.57536	1.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.984	D;D;P	0.87578	0.998;0.977;0.851	T	0.68131	-0.5490	10	0.66056	D	0.02	-65.0248	16.4473	0.83942	1.0:0.0:0.0:0.0	.	165;219;295	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	P	295;219;295	ENSP00000353739:L295P;ENSP00000444026:L219P;ENSP00000428099:L295P	ENSP00000353739:L295P	L	-	2	0	PCMTD1	52895654	1.000000	0.71417	0.981000	0.43875	0.987000	0.75469	8.424000	0.90267	2.281000	0.76405	0.533000	0.62120	CTT	.	.	none		0.423	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
SEPT6	23157	hgsc.bcm.edu	37	X	118797638	118797638	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:118797638C>A	ENST00000343984.5	-	3	412	c.148G>T	c.(148-150)Gag>Tag	p.E50*	SEPT6_ENST00000394616.4_5'UTR|SEPT6_ENST00000394617.2_Nonsense_Mutation_p.E80*|SEPT6_ENST00000360156.7_Nonsense_Mutation_p.E50*|SEPT6_ENST00000394610.1_Nonsense_Mutation_p.E50*|SEPT6_ENST00000354228.4_Nonsense_Mutation_p.E50*|SEPT6_ENST00000354416.3_Nonsense_Mutation_p.E50*|SEPT6_ENST00000489216.1_Nonsense_Mutation_p.E50*	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6	50	Septin-type G.				cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						AAACCTGTCTCTCCTGAAAAG	0.478			T	MLL	AML																																p.E50X		Atlas-SNP	.		Dom	yes		X	Xq24	23157	septin 6		L	.	SEPT6	53	.	0			c.G148T						PASS	.						140.0	131.0	134.0					X																	118797638		2203	4300	6503	SO:0001587	stop_gained	23157	exon3			CTGTCTCTCCTGA	D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.148G>T	X.37:g.118797638C>A	ENSP00000341524:p.Glu50*	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	50	32	0.64	NM_145802	Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	Nonsense_Mutation	SNP	ENST00000343984.5	37	CCDS14584.1	.	.	.	.	.	.	.	.	.	.	c	38	7.016911	0.98006	.	.	ENSG00000125354	ENST00000360156;ENST00000354228;ENST00000489216;ENST00000354416;ENST00000394610;ENST00000343984;ENST00000394617;ENST00000520510	.	.	.	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	15.6198	0.76796	0.0:1.0:0.0:0.0	.	.	.	.	X	50;50;50;50;50;50;80;50	.	ENSP00000341524:E50X	E	-	1	0	SEPT6	118681666	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.439000	0.80444	2.073000	0.62155	0.597000	0.82753	GAG	.	.	none		0.478	SEPT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058059.1	NM_145802	
OR5H15	403274	hgsc.bcm.edu	37	3	97888289	97888289	+	Missense_Mutation	SNP	G	G	C	rs140807945		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:97888289G>C	ENST00000356526.2	+	1	746	c.746G>C	c.(745-747)tGt>tCt	p.C249S		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						TTCTCTGTCTGTTTATACTAT	0.428													g|||	1	0.000199681	0.0	0.0	5008	,	,		16343	0.001		0.0	False		,,,				2504	0.0				p.C249S		Atlas-SNP	.											OR5H15,colon,carcinoma,0,2	OR5H15	70	2	0			c.G746C						PASS	.						101.0	103.0	102.0					3																	97888289		2203	4300	6503	SO:0001583	missense	403274	exon1			CTGTCTGTTTATA		CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.746G>C	3.37:g.97888289G>C	ENSP00000373195:p.Cys249Ser	Somatic	209	0	0		WXS	Illumina HiSeq	Phase_I	292	23	0.0787671	NM_001005515		Missense_Mutation	SNP	ENST00000356526.2	37	CCDS33799.1	.	.	.	.	.	.	.	.	.	.	-	0	-2.618780	0.00118	.	.	ENSG00000233412	ENST00000356526;ENST00000454529	T	0.35789	1.29	2.48	0.465	0.16711	GPCR, rhodopsin-like superfamily (1);	0.476318	0.17871	N	0.159188	T	0.07638	0.0192	N	0.00630	-1.315	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36089	-0.9762	10	0.02654	T	1	.	4.8111	0.13344	0.0:0.4161:0.4463:0.1376	.	249	A6NDH6	O5H15_HUMAN	S	249	ENSP00000373195:C249S	ENSP00000373195:C249S	C	+	2	0	OR5H15	99370979	0.000000	0.05858	0.136000	0.22124	0.013000	0.08279	-0.279000	0.08479	-0.036000	0.13669	-1.406000	0.01132	TGT	G|0.999;C|0.001	0.001	weak		0.428	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359109.1		
BNC2	54796	hgsc.bcm.edu	37	9	16436244	16436244	+	Missense_Mutation	SNP	C	C	T	rs138108118	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:16436244C>T	ENST00000380672.4	-	6	2005	c.1948G>A	c.(1948-1950)Gcc>Acc	p.A650T	BNC2_ENST00000380667.2_Missense_Mutation_p.A583T|BNC2_ENST00000380666.2_Missense_Mutation_p.A650T|BNC2_ENST00000545497.1_Missense_Mutation_p.A555T	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		AACTCATCGGCGGTATCAATA	0.488													C|||	10	0.00199681	0.0	0.0	5008	,	,		20005	0.0		0.0	False		,,,				2504	0.0102				p.A650T		Atlas-SNP	.											BNC2,NS,carcinoma,+1,1	BNC2	166	1	0			c.G1948A						scavenged	.	C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	134.0	122.0	126.0		1948	6.2	0.9	9	dbSNP_134	126	0,8600		0,0,4300	yes	missense	BNC2	NM_017637.5	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	650/1100	16436244	1,13005	2203	4300	6503	SO:0001583	missense	54796	exon6			CATCGGCGGTATC	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.1948G>A	9.37:g.16436244C>T	ENSP00000370047:p.Ala650Thr	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	125	2	0.016	NM_017637		Missense_Mutation	SNP	ENST00000380672.4	37	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960890	0.53400	2.27E-4	0.0	ENSG00000173068	ENST00000380672;ENST00000411752;ENST00000418777;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	T;T;T;T;T;T	0.51817	1.39;0.69;1.38;1.41;1.4;1.38	6.17	6.17	0.99709	.	0.046884	0.85682	N	0.000000	T	0.60932	0.2307	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.71674	0.991;0.992;0.998;0.998;0.998;0.996;0.996;0.996;0.996	P;P;P;P;P;P;P;P;P	0.54706	0.628;0.477;0.759;0.759;0.676;0.477;0.578;0.578;0.578	T	0.51911	-0.8645	10	0.32370	T	0.25	-12.2506	20.8794	0.99867	0.0:1.0:0.0:0.0	.	555;583;650;476;650;607;650;555;415	F5H586;B1APH0;Q6ZN30-2;B4E3J2;F5H8G9;Q5H9S4;Q6ZN30;B4DR27;D3DRJ1	.;.;.;.;.;.;BNC2_HUMAN;.;.	T	650;43;607;583;555;476;650;650	ENSP00000370047:A650T;ENSP00000392212:A43T;ENSP00000408370:A607T;ENSP00000370042:A583T;ENSP00000444640:A555T;ENSP00000370041:A650T	ENSP00000370041:A650T	A	-	1	0	BNC2	16426244	0.999000	0.42202	0.920000	0.36463	0.415000	0.31203	3.947000	0.56652	2.941000	0.99782	0.655000	0.94253	GCC	C|1.000;T|0.000	0.000	weak		0.488	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
COL8A1	1295	hgsc.bcm.edu	37	3	99514003	99514003	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:99514003G>A	ENST00000261037.3	+	5	1638	c.1258G>A	c.(1258-1260)Ggg>Agg	p.G420R	COL8A1_ENST00000273342.4_Missense_Mutation_p.G420R	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	420	Triple-helical region (COL1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						TGGGATTGTAGGGCCACAGGG	0.617																																					p.G420R		Atlas-SNP	.											.	COL8A1	68	.	0			c.G1258A						PASS	.						38.0	38.0	38.0					3																	99514003		2203	4299	6502	SO:0001583	missense	1295	exon5			ATTGTAGGGCCAC	AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.1258G>A	3.37:g.99514003G>A	ENSP00000261037:p.Gly420Arg	Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	77	31	0.402597	NM_001850	D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	ENST00000261037.3	37	CCDS2934.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159714	0.57368	.	.	ENSG00000144810	ENST00000261037;ENST00000273342	D;D	0.99353	-5.77;-5.77	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.99582	0.9849	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98206	1.0470	10	0.87932	D	0	.	17.6174	0.88071	0.0:0.0:1.0:0.0	.	421;420	E7EPK9;P27658	.;CO8A1_HUMAN	R	420	ENSP00000261037:G420R;ENSP00000273342:G420R	ENSP00000261037:G420R	G	+	1	0	COL8A1	100996693	1.000000	0.71417	0.972000	0.41901	0.930000	0.56654	9.819000	0.99357	2.746000	0.94184	0.563000	0.77884	GGG	.	.	none		0.617	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309001.1	NM_001850	
SUPT5H	6829	hgsc.bcm.edu	37	19	39948337	39948337	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:39948337C>T	ENST00000599117.1	+	5	631	c.264C>T	c.(262-264)gaC>gaT	p.D88D	SUPT5H_ENST00000598725.1_Silent_p.D88D|SUPT5H_ENST00000359191.6_Silent_p.D88D|SUPT5H_ENST00000402194.2_Silent_p.D88D|SUPT5H_ENST00000432763.2_Silent_p.D88D			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	88	Glu-rich.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AGTATGAGGACGAGGACCAGT	0.537																																					p.D88D		Atlas-SNP	.											.	SUPT5H	119	.	0			c.C264T						PASS	.						242.0	197.0	212.0					19																	39948337		2203	4300	6503	SO:0001819	synonymous_variant	6829	exon4			TGAGGACGAGGAC	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.264C>T	19.37:g.39948337C>T		Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	179	72	0.402235	NM_001130825	O43279|Q59G52|Q99639	Silent	SNP	ENST00000599117.1	37	CCDS12536.1																																																																																			.	.	none		0.537	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
MX1	4599	hgsc.bcm.edu	37	21	42817373	42817373	+	Splice_Site	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr21:42817373A>G	ENST00000398600.2	+	14	2033		c.e14-1		AP001610.5_ENST00000411427.1_RNA|MX1_ENST00000455164.2_Splice_Site|MX1_ENST00000398598.3_Splice_Site|MX1_ENST00000288383.6_Splice_Site	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1						apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				CATTTTCCTCAGAAATCTCTG	0.438																																					.		Atlas-SNP	.											.	MX1	58	.	0			c.1009-2A>G						PASS	.						79.0	85.0	83.0					21																	42817373		2203	4300	6503	SO:0001630	splice_region_variant	4599	exon14			TTCCTCAGAAATC		CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.1009-1A>G	21.37:g.42817373A>G		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	60	21	0.35	NM_001144925	B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Splice_Site	SNP	ENST00000398600.2	37	CCDS13673.1	.	.	.	.	.	.	.	.	.	.	A	12.18	1.859458	0.32884	.	.	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000288383	.	.	.	4.89	3.72	0.42706	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.317	0.49399	0.8471:0.1529:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MX1	41739243	1.000000	0.71417	0.943000	0.38184	0.530000	0.34684	7.482000	0.81143	0.937000	0.37394	0.528000	0.53228	.	.	.	none		0.438	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195161.2		Intron
VPS13B	157680	hgsc.bcm.edu	37	8	100866137	100866137	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr8:100866137A>G	ENST00000358544.2	+	56	10706	c.10595A>G	c.(10594-10596)tAc>tGc	p.Y3532C	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.Y3507C	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3532					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GCTCGGTTATACGTGGAAGAC	0.408																																					p.Y3532C	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											VPS13B_ENST00000357162,NS,carcinoma,-1,4	VPS13B	811	4	0			c.A10595G						scavenged	.						115.0	118.0	117.0					8																	100866137		2203	4300	6503	SO:0001583	missense	157680	exon56			GGTTATACGTGGA	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10595A>G	8.37:g.100866137A>G	ENSP00000351346:p.Tyr3532Cys	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	106	2	0.0188679	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.164745	0.78339	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.73363	-0.73;-0.74	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.84566	0.5500	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.983;0.997	D	0.86055	0.1528	10	0.72032	D	0.01	.	15.9135	0.79491	1.0:0.0:0.0:0.0	.	3507;3532	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	C	3507;3532	ENSP00000349685:Y3507C;ENSP00000351346:Y3532C	ENSP00000349685:Y3507C	Y	+	2	0	VPS13B	100935313	1.000000	0.71417	0.270000	0.24601	0.965000	0.64279	8.283000	0.89909	2.153000	0.67306	0.528000	0.53228	TAC	.	.	none		0.408	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
KCNA1	3736	hgsc.bcm.edu	37	12	5020724	5020724	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:5020724C>T	ENST00000382545.3	+	2	1287	c.180C>T	c.(178-180)aaC>aaT	p.N60N	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	60					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	AGTTCCCCAACACGCTGCTGG	0.627																																					p.N60N		Atlas-SNP	.											KCNA1,right_lower_lobe,carcinoma,+1,1	KCNA1	112	1	0			c.C180T						scavenged	.						56.0	57.0	56.0					12																	5020724		2203	4300	6503	SO:0001819	synonymous_variant	3736	exon2			CCCCAACACGCTG	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.180C>T	12.37:g.5020724C>T		Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	142	3	0.0211268	NM_000217	A6NM83|Q3MIQ9	Silent	SNP	ENST00000382545.3	37	CCDS8535.1																																																																																			.	.	none		0.627	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
HERC1	8925	hgsc.bcm.edu	37	15	63935174	63935174	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:63935174A>G	ENST00000443617.2	-	59	11502	c.11415T>C	c.(11413-11415)gcT>gcC	p.A3805A		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3805					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TATTTgagcaagcagctactc	0.378																																					p.A3805A		Atlas-SNP	.											HERC1_ENST00000443617,colon,carcinoma,-1,2	HERC1	624	2	0			c.T11415C						scavenged	.						67.0	62.0	64.0					15																	63935174		1879	4111	5990	SO:0001819	synonymous_variant	8925	exon59			TGAGCAAGCAGCT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.11415T>C	15.37:g.63935174A>G		Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	199	3	0.0150754	NM_003922	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1																																																																																			.	.	none		0.378	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
ANKRD29	147463	hgsc.bcm.edu	37	18	21197729	21197729	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:21197729C>T	ENST00000592179.1	-	8	844	c.690G>A	c.(688-690)ttG>ttA	p.L230L	ANKRD29_ENST00000284207.7_Silent_p.L230L|ANKRD29_ENST00000322980.9_Silent_p.L230L|ANKRD29_ENST00000586511.1_5'Flank	NM_173505.2	NP_775776.2	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29	230										breast(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)	13	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AGAATTTAAGCAACTCTTTTA	0.343																																					p.L230L		Atlas-SNP	.											.	ANKRD29	24	.	0			c.G690A						PASS	.						145.0	133.0	137.0					18																	21197729		2202	4300	6502	SO:0001819	synonymous_variant	147463	exon8			TTTAAGCAACTCT	AK057782	CCDS11879.1	18q11.2	2013-01-10			ENSG00000154065	ENSG00000154065		"""Ankyrin repeat domain containing"""	27110	protein-coding gene	gene with protein product							Standard	NM_173505		Approved	FLJ25053	uc002kun.3	Q8N6D5	OTTHUMG00000131875	ENST00000592179.1:c.690G>A	18.37:g.21197729C>T		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	177	28	0.158192	NM_173505	B2R972|Q6ZWE8|Q96LU9	Silent	SNP	ENST00000592179.1	37	CCDS11879.1																																																																																			.	.	none		0.343	ANKRD29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254825.1	NM_173505	
ATP13A5	344905	hgsc.bcm.edu	37	3	193051546	193051546	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:193051546T>C	ENST00000342358.4	-	11	1382	c.1265A>G	c.(1264-1266)tAc>tGc	p.Y422C		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	422						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TACTCCATGGTACATATATAC	0.438																																					p.Y422C		Atlas-SNP	.											.	ATP13A5	171	.	0			c.A1265G						PASS	.						73.0	74.0	74.0					3																	193051546		2203	4300	6503	SO:0001583	missense	344905	exon11			CCATGGTACATAT	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1265A>G	3.37:g.193051546T>C	ENSP00000341942:p.Tyr422Cys	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	112	29	0.258929	NM_198505	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.904221	0.33628	.	.	ENSG00000187527	ENST00000342358	D	0.90620	-2.7	5.53	5.53	0.82687	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.64402	D	0.000010	D	0.92557	0.7636	L	0.55743	1.74	0.27566	N	0.950029	D	0.76494	0.999	D	0.68353	0.957	D	0.86778	0.1977	10	0.38643	T	0.18	-5.2622	9.8364	0.40971	0.153:0.0:0.0:0.847	.	422	Q4VNC0	AT135_HUMAN	C	422	ENSP00000341942:Y422C	ENSP00000341942:Y422C	Y	-	2	0	ATP13A5	194534240	0.000000	0.05858	0.943000	0.38184	0.061000	0.15899	0.525000	0.22956	2.111000	0.64477	0.528000	0.53228	TAC	.	.	none		0.438	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
NFIB	4781	hgsc.bcm.edu	37	9	14307015	14307015	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:14307015A>C	ENST00000380959.3	-	2	1008	c.535T>G	c.(535-537)Ttt>Gtt	p.F179V	NFIB_ENST00000380934.4_Missense_Mutation_p.F205V|NFIB_ENST00000397581.2_Missense_Mutation_p.F179V|NFIB_ENST00000380921.3_Missense_Mutation_p.F179V|NFIB_ENST00000380953.1_Missense_Mutation_p.F179V|NFIB_ENST00000397579.2_Missense_Mutation_p.F179V|NFIB_ENST00000397575.3_Missense_Mutation_p.F179V	NM_005596.3	NP_005587.2	O00712	NFIB_HUMAN	nuclear factor I/B	179					anterior commissure morphogenesis (GO:0021960)|chondrocyte differentiation (GO:0002062)|Clara cell differentiation (GO:0060486)|commissural neuron axon guidance (GO:0071679)|DNA replication (GO:0006260)|glial cell differentiation (GO:0010001)|hindbrain development (GO:0030902)|lung ciliated cell differentiation (GO:0061141)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000795)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|principal sensory nucleus of trigeminal nerve development (GO:0021740)|transcription from RNA polymerase II promoter (GO:0006366)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)	cerebellar mossy fiber (GO:0044300)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		TATGCCAAAAACAAATCAAGC	0.468			T	"""MYB, HGMA2"""	"""adenoid cystic carcinoma, lipoma"""																																p.F205V	Esophageal Squamous(132;921 1730 14828 40753 46471)	Atlas-SNP	.		Dom	yes		9	9p24.1	4781	nuclear factor I/B		E	.	NFIB	91	.	0			c.T613G						PASS	.						144.0	131.0	135.0					9																	14307015		2203	4300	6503	SO:0001583	missense	4781	exon2			CCAAAAACAAATC	U07810	CCDS6474.1, CCDS55291.1, CCDS55292.1, CCDS65007.1	9p24.1	2008-02-05			ENSG00000147862	ENSG00000147862			7785	protein-coding gene	gene with protein product		600728				7590749	Standard	NM_001190737		Approved	NFI-RED, NFIB2, NFIB3	uc003zlf.3	O00712	OTTHUMG00000021027	ENST00000380959.3:c.535T>G	9.37:g.14307015A>C	ENSP00000370346:p.Phe179Val	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	140	44	0.314286	NM_001190738	G3V1P1|H7BYE8|O00166|Q12858|Q5VW29|Q63HM5|Q6ZNF9|Q96J45	Missense_Mutation	SNP	ENST00000380959.3	37	CCDS6474.1	.	.	.	.	.	.	.	.	.	.	A	16.39	3.108877	0.56398	.	.	ENSG00000147862	ENST00000380934;ENST00000380959;ENST00000380953;ENST00000397575;ENST00000397581;ENST00000397579;ENST00000380921	T;T;T;T;T;T	0.51325	0.71;0.74;0.76;0.72;0.71;0.74	5.53	5.53	0.82687	CTF transcription factor/nuclear factor 1, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.34454	0.0898	N	0.22421	0.69	0.80722	D	1	P;P;P	0.42409	0.779;0.779;0.779	B;B;B	0.35510	0.191;0.204;0.191	T	0.35475	-0.9787	10	0.87932	D	0	.	15.6677	0.77242	1.0:0.0:0.0:0.0	.	179;179;179	Q5VW27;Q5VW29;O00712	.;.;NFIB_HUMAN	V	205;179;179;179;179;179;179	ENSP00000370321:F205V;ENSP00000370346:F179V;ENSP00000370340:F179V;ENSP00000380705:F179V;ENSP00000380711:F179V;ENSP00000380709:F179V	ENSP00000370308:F179V	F	-	1	0	NFIB	14297015	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.092000	0.63282	0.482000	0.46254	TTT	.	.	none		0.468	NFIB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055468.1	NM_005596	
ACOX1	51	hgsc.bcm.edu	37	17	73944495	73944495	+	Missense_Mutation	SNP	C	C	T	rs369561903		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:73944495C>T	ENST00000301608.4	-	13	1832	c.1772G>A	c.(1771-1773)cGt>cAt	p.R591H	ACOX1_ENST00000293217.5_Missense_Mutation_p.R591H|ACOX1_ENST00000537812.1_Missense_Mutation_p.R553H	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	591					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)			large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	CTCCTTTACACGCTGGTTTAC	0.388																																					p.R591H		Atlas-SNP	.											ACOX1_ENST00000301608,caecum,carcinoma,-1,2	ACOX1	85	2	0			c.G1772A						scavenged	.	T	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	157.0	135.0	143.0		1658,1772,1772	2.2	0.1	17		143	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ACOX1	NM_001185039.1,NM_004035.6,NM_007292.5	29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	553/623,591/661,591/661	73944495	1,13005	2203	4300	6503	SO:0001583	missense	51	exon13			TTTACACGCTGGT	U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.1772G>A	17.37:g.73944495C>T	ENSP00000301608:p.Arg591His	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	58	3	0.0517241	NM_007292	A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	ENST00000301608.4	37	CCDS11735.1	.	.	.	.	.	.	.	.	.	.	c	10.48	1.360962	0.24684	0.0	1.16E-4	ENSG00000161533	ENST00000301608;ENST00000293217;ENST00000537812;ENST00000539791;ENST00000538781	T;T;T	0.44881	0.91;0.91;0.91	5.25	2.23	0.28157	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.099482	0.64402	N	0.000003	T	0.36413	0.0966	L	0.58669	1.825	0.27295	N	0.957734	B;B;B;B	0.16166	0.006;0.003;0.016;0.007	B;B;B;B	0.12156	0.005;0.005;0.007;0.003	T	0.27938	-1.0059	10	0.33940	T	0.23	-11.4201	10.7402	0.46149	0.0:0.7301:0.0:0.2699	.	523;553;591;591	F5H0M0;F5GYQ8;Q15067;Q15067-2	.;.;ACOX1_HUMAN;.	H	591;591;553;591;523	ENSP00000301608:R591H;ENSP00000293217:R591H;ENSP00000441257:R553H	ENSP00000293217:R591H	R	-	2	0	ACOX1	71456090	0.882000	0.30256	0.075000	0.20258	0.408000	0.30992	1.744000	0.38268	0.891000	0.36235	-0.726000	0.03593	CGT	.	.	weak		0.388	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439503.1		
SF3B1	23451	hgsc.bcm.edu	37	2	198270084	198270084	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:198270084C>T	ENST00000335508.6	-	10	1443	c.1352G>A	c.(1351-1353)cGa>cAa	p.R451Q	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	451	Interaction with PPP1R8.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTTCATAGTTCGATCTTCAGT	0.398			Mis		myelodysplastic syndrome																																p.R451Q		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	SF3B1,NS,carcinoma,0,1	SF3B1	1038	1	0			c.G1352A						scavenged	.						62.0	62.0	62.0					2																	198270084		2203	4300	6503	SO:0001583	missense	23451	exon10			ATAGTTCGATCTT	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1352G>A	2.37:g.198270084C>T	ENSP00000335321:p.Arg451Gln	Somatic	157	1	0.00636943		WXS	Illumina HiSeq	Phase_I	125	2	0.016	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.924141	0.73213	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.66	5.66	0.87406	Splicing factor 3B subunit 1 (1);	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	L	0.38175	1.15	0.80722	D	1	B	0.26975	0.165	B	0.20184	0.028	T	0.48399	-0.9039	9	0.33940	T	0.23	.	20.115	0.97926	0.0:1.0:0.0:0.0	.	451	O75533	SF3B1_HUMAN	Q	451	.	ENSP00000335321:R451Q	R	-	2	0	SF3B1	197978329	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.665000	0.83852	2.827000	0.97445	0.655000	0.94253	CGA	.	.	none		0.398	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
PLCH2	9651	hgsc.bcm.edu	37	1	2419084	2419084	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:2419084T>C	ENST00000419816.2	+	8	1436	c.1162T>C	c.(1162-1164)Tac>Cac	p.Y388H	PLCH2_ENST00000378488.3_Missense_Mutation_p.Y388H|PLCH2_ENST00000449969.1_Missense_Mutation_p.Y361H|PLCH2_ENST00000378486.3_Missense_Mutation_p.Y388H|PLCH2_ENST00000288766.5_Intron			O75038	PLCH2_HUMAN	phospholipase C, eta 2	388	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		GCACCATGGCTACACTCTGAC	0.587																																					p.Y388H		Atlas-SNP	.											PLCH2_ENST00000378486,NS,carcinoma,-2,2	PLCH2	131	2	0			c.T1162C						scavenged	.						45.0	50.0	48.0					1																	2419084		2049	4188	6237	SO:0001583	missense	9651	exon8			CATGGCTACACTC	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.1162T>C	1.37:g.2419084T>C	ENSP00000389803:p.Tyr388His	Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	173	5	0.0289017	NM_014638	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37		.	.	.	.	.	.	.	.	.	.	T	18.12	3.552236	0.65311	.	.	ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000343889;ENST00000278878	T;T;T	0.52754	0.65;0.65;0.65	4.77	4.77	0.60923	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.85682	D	0.000000	T	0.52869	0.1761	N	0.17838	0.53	0.80722	D	1	D;D;D;D	0.89917	1.0;0.986;1.0;0.972	D;D;D;D	0.97110	1.0;0.972;0.999;0.972	T	0.56408	-0.7984	10	0.49607	T	0.09	.	13.4515	0.61174	0.0:0.0:0.0:1.0	.	235;176;361;388	B9DI81;B9DI82;O75038-2;O75038	.;.;.;PLCH2_HUMAN	H	361;388;388;235;176	ENSP00000397289:Y361H;ENSP00000367747:Y388H;ENSP00000367749:Y388H	ENSP00000278878:Y176H	Y	+	1	0	PLCH2	2408944	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.967000	0.70403	1.784000	0.52394	0.459000	0.35465	TAC	.	.	none		0.587	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
GULP1	51454	hgsc.bcm.edu	37	2	189405948	189405948	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:189405948G>A	ENST00000409580.1	+	8	1016	c.302G>A	c.(301-303)tGt>tAt	p.C101Y	GULP1_ENST00000409805.1_Intron|GULP1_ENST00000359135.3_Missense_Mutation_p.C101Y|GULP1_ENST00000479019.1_3'UTR|GULP1_ENST00000409637.3_Missense_Mutation_p.C101Y|GULP1_ENST00000409609.1_Missense_Mutation_p.C101Y|GULP1_ENST00000409843.1_Missense_Mutation_p.C101Y|GULP1_ENST00000409830.1_Missense_Mutation_p.C101Y|GULP1_ENST00000410051.1_Missense_Mutation_p.C101Y			Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing 1	101	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|lipid transport (GO:0006869)|phagocytosis, engulfment (GO:0006911)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)			endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			ATATCTTTTTGTGCAGATGAT	0.323																																					p.C101Y	Pancreas(178;563 2065 20199 42378 52815)	Atlas-SNP	.											.	GULP1	35	.	0			c.G302A						PASS	.						110.0	109.0	109.0					2																	189405948		2203	4300	6503	SO:0001583	missense	51454	exon7			CTTTTTGTGCAGA	AF191771	CCDS2295.1, CCDS58742.1, CCDS58743.1	2q32.3-q33	2008-02-05			ENSG00000144366	ENSG00000144366			18649	protein-coding gene	gene with protein product		608165				11729193	Standard	NM_001252668		Approved	CED6, CED-6, GULP	uc010fru.3	Q9UBP9	OTTHUMG00000132647	ENST00000409580.1:c.302G>A	2.37:g.189405948G>A	ENSP00000386289:p.Cys101Tyr	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	96	39	0.40625	NM_016315	B2RB51|B4DQ40|B8ZZ72|D3DPH1|E9PB86|Q53PC1|Q53RF3|Q9BVL3	Missense_Mutation	SNP	ENST00000409580.1	37	CCDS2295.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482106	0.84747	.	.	ENSG00000144366	ENST00000409843;ENST00000409830;ENST00000410051;ENST00000359135;ENST00000409580;ENST00000409637;ENST00000409609	T;T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07;2.07	5.36	5.36	0.76844	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.56396	0.1982	M	0.90705	3.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.999;1.0;0.996	T	0.65274	-0.6208	10	0.87932	D	0	-5.6024	18.4419	0.90669	0.0:0.0:1.0:0.0	.	101;101;101	Q9UBP9;B8ZZ72;Q9UBP9-2	GULP1_HUMAN;.;.	Y	101	ENSP00000387144:C101Y;ENSP00000386732:C101Y;ENSP00000387013:C101Y;ENSP00000352047:C101Y;ENSP00000386289:C101Y;ENSP00000386402:C101Y;ENSP00000386867:C101Y	ENSP00000352047:C101Y	C	+	2	0	GULP1	189114193	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.813000	0.99286	2.671000	0.90904	0.555000	0.69702	TGT	.	.	none		0.323	GULP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335722.1	NM_016315	
FBXW10	10517	hgsc.bcm.edu	37	17	18653098	18653098	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:18653098G>C	ENST00000395665.4	+	3	955	c.734G>C	c.(733-735)gGa>gCa	p.G245A	FBXW10_ENST00000395667.1_Missense_Mutation_p.G245A|FBXW10_ENST00000308799.4_Missense_Mutation_p.G245A|FBXW10_ENST00000301938.4_Missense_Mutation_p.G245A			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	245								p.G245A(6)		NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						TCTGGAAAAGGAGACATAACC	0.468																																					p.G245A		Atlas-SNP	.											FBXW10,NS,carcinoma,0,6	FBXW10	82	6	6	Substitution - Missense(6)	endometrium(6)	c.G734C						scavenged	.						231.0	173.0	193.0					17																	18653098		2203	4300	6503	SO:0001583	missense	10517	exon3			GAAAAGGAGACAT	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.734G>C	17.37:g.18653098G>C	ENSP00000379025:p.Gly245Ala	Somatic	341	0	0		WXS	Illumina HiSeq	Phase_I	295	5	0.0169492	NM_001267585	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	ENST00000395665.4	37	CCDS11199.3	.	.	.	.	.	.	.	.	.	.	G	0.030	-1.343101	0.01277	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	2.49	-4.98	0.03019	.	1.434070	0.05440	N	0.547512	T	0.12987	0.0315	N	0.16307	0.4	0.09310	N	1	B;B;B;B	0.09022	0.001;0.001;0.002;0.001	B;B;B;B	0.08055	0.003;0.003;0.001;0.003	T	0.28522	-1.0041	10	0.06236	T	0.91	.	4.4282	0.11515	0.0:0.2164:0.3696:0.414	.	245;245;245;245	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	A	245	ENSP00000379026:G245A;ENSP00000310382:G245A;ENSP00000306937:G245A;ENSP00000379025:G245A	ENSP00000306937:G245A	G	+	2	0	FBXW10	18593823	0.000000	0.05858	0.000000	0.03702	0.372000	0.29890	-0.502000	0.06390	-0.939000	0.03709	-0.750000	0.03501	GGA	G|0.750;C|0.250	0.250	weak		0.468	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313531.2	NM_031456	
PABPC1	26986	hgsc.bcm.edu	37	8	101727716	101727716	+	Missense_Mutation	SNP	C	C	T	rs201157005		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr8:101727716C>T	ENST00000318607.5	-	4	1745	c.617G>A	c.(616-618)cGc>cAc	p.R206H	PABPC1_ENST00000519004.1_Missense_Mutation_p.R161H|PABPC1_ENST00000522387.1_Missense_Mutation_p.R174H|PABPC1_ENST00000519596.1_5'UTR	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	206	CSDE1-binding.|RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ATCCTTAAGGCGCTCATCATC	0.353																																					p.R206H		Atlas-SNP	.											PABPC1,NS,carcinoma,-1,1	PABPC1	76	1	0			c.G617A						scavenged	.																																			SO:0001583	missense	26986	exon4			TTAAGGCGCTCAT	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.617G>A	8.37:g.101727716C>T	ENSP00000313007:p.Arg206His	Somatic	102	2	0.0196078		WXS	Illumina HiSeq	Phase_I	88	3	0.0340909	NM_002568	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	130|130	0.05952380952380952|0.05952380952380952	45|45	0.09146341463414634|0.09146341463414634	8|8	0.022099447513812154|0.022099447513812154	29|29	0.050699300699300696|0.050699300699300696	48|48	0.0633245382585752|0.0633245382585752	C|C	15.89|15.89	2.967520|2.967520	0.53507|0.53507	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000519100|ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387	.|D;D;T	.|0.84370	.|-1.84;-1.84;2.38	5.03|5.03	5.03|5.03	0.67393|0.67393	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.56097	.|D	.|0.000024	T|T	0.14184|0.14184	0.0343|0.0343	N|N	0.25647|0.25647	0.755|0.755	0.44736|0.44736	D|D	0.997731|0.997731	.|B;B;B	.|0.24920	.|0.005;0.053;0.114	.|B;B;B	.|0.20384	.|0.008;0.029;0.026	T|T	0.56890|0.56890	-0.7904|-0.7904	5|10	.|0.49607	.|T	.|0.09	.|.	18.734|18.734	0.91748|0.91748	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|174;206;206	.|E7ERJ7;B3KT93;P11940	.|.;.;PABP1_HUMAN	T|H	78|206;206;161;174	.|ENSP00000313007:R206H;ENSP00000429594:R161H;ENSP00000429395:R174H	.|ENSP00000313007:R206H	A|R	-|-	1|2	0|0	PABPC1|PABPC1	101796892|101796892	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.004000|6.004000	0.70709|0.70709	2.482000|2.482000	0.83794|0.83794	0.585000|0.585000	0.79938|0.79938	GCC|CGC	C|0.940;T|0.060	0.060	strong		0.353	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
ZNF407	55628	hgsc.bcm.edu	37	18	72343485	72343485	+	Silent	SNP	G	G	A	rs368077796		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:72343485G>A	ENST00000299687.5	+	1	510	c.510G>A	c.(508-510)ccG>ccA	p.P170P	ZNF407_ENST00000582337.1_Silent_p.P170P|ZNF407_ENST00000577538.1_Silent_p.P170P|ZNF407_ENST00000309902.6_Silent_p.P170P	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CTTTCCCCCCGAAAGAAATTA	0.393																																					p.P170P		Atlas-SNP	.											ZNF407_ENST00000582337,NS,carcinoma,0,2	ZNF407	231	2	0			c.G510A						scavenged	.	G	,,	0,3722		0,0,1861	86.0	86.0	86.0		510,510,510	2.3	0.0	18		86	2,8210		0,2,4104	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF407	NM_001146189.1,NM_001146190.1,NM_017757.2	,,	0,2,5965	AA,AG,GG		0.0244,0.0,0.0168	,,	170/1816,170/1661,170/2249	72343485	2,11932	1861	4106	5967	SO:0001819	synonymous_variant	55628	exon1			CCCCCCGAAAGAA	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.510G>A	18.37:g.72343485G>A		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	117	2	0.017094	NM_001146190	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Silent	SNP	ENST00000299687.5	37	CCDS45885.1																																																																																			.	.	weak		0.393	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
ARPP21	10777	hgsc.bcm.edu	37	3	35758809	35758809	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:35758809A>T	ENST00000187397.4	+	13	1411	c.955A>T	c.(955-957)Aac>Tac	p.N319Y	ARPP21_ENST00000417925.1_Missense_Mutation_p.N285Y|ARPP21_ENST00000337271.5_Intron|ARPP21_ENST00000458225.1_Missense_Mutation_p.N285Y|ARPP21_ENST00000444190.1_Intron	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	319					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						GGAAGACAGTAACATATGCAA	0.333																																					p.N319Y		Atlas-SNP	.											.	ARPP21	153	.	0			c.A955T						PASS	.						170.0	172.0	171.0					3																	35758809		2203	4299	6502	SO:0001583	missense	10777	exon13			GACAGTAACATAT	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.955A>T	3.37:g.35758809A>T	ENSP00000187397:p.Asn319Tyr	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	120	37	0.308333	NM_016300	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	A	14.89	2.670639	0.47781	.	.	ENSG00000172995	ENST00000458225;ENST00000187397;ENST00000417925;ENST00000425289	T;T;T	0.24723	1.89;1.84;1.89	5.45	4.27	0.50696	.	0.343723	0.33110	N	0.005261	T	0.15262	0.0368	N	0.08118	0	0.80722	D	1	P;P	0.44090	0.826;0.558	B;B	0.42653	0.394;0.107	T	0.06041	-1.0849	10	0.72032	D	0.01	-10.8417	10.3625	0.44003	0.8283:0.1717:0.0:0.0	.	285;319	Q9UBL0-3;Q9UBL0	.;ARP21_HUMAN	Y	285;319;285;90	ENSP00000414351:N285Y;ENSP00000187397:N319Y;ENSP00000412326:N285Y	ENSP00000187397:N319Y	N	+	1	0	ARPP21	35733813	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.073000	0.50057	0.882000	0.36016	0.528000	0.53228	AAC	.	.	none		0.333	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399	
LRP1B	53353	hgsc.bcm.edu	37	2	141079638	141079638	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:141079638A>G	ENST00000389484.3	-	82	13505	c.12534T>C	c.(12532-12534)gaT>gaC	p.D4178D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4178	EGF-like 16. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CGCATGCTAAATCCAAGCATG	0.373										TSP Lung(27;0.18)																											p.D4178D	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.T12534C						PASS	.						50.0	53.0	52.0					2																	141079638		2203	4300	6503	SO:0001819	synonymous_variant	53353	exon82			TGCTAAATCCAAG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12534T>C	2.37:g.141079638A>G		Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	127	54	0.425197	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	a	9.034	0.988116	0.18966	.	.	ENSG00000168702	ENST00000437977	.	.	.	5.19	1.6	0.23607	.	.	.	.	.	T	0.51517	0.1679	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38628	-0.9652	4	.	.	.	.	5.0496	0.14501	0.5306:0.1535:0.3159:0.0	.	.	.	.	T	410	.	.	I	-	2	0	LRP1B	140796108	0.112000	0.22096	1.000000	0.80357	0.989000	0.77384	-0.485000	0.06520	0.401000	0.25424	0.528000	0.53228	ATT	.	.	none		0.373	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
SKIV2L2	23517	hgsc.bcm.edu	37	5	54641000	54641000	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:54641000A>G	ENST00000230640.5	+	10	1338	c.1084A>G	c.(1084-1086)Aaa>Gaa	p.K362E	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.K261E	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	362					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				AGGAGACCAGAAAGGGCGGAA	0.358																																					p.K362E	Melanoma(2;92 134 23744 29976 33782)	Atlas-SNP	.											SKIV2L2,NS,carcinoma,-2,1	SKIV2L2	104	1	0			c.A1084G						scavenged	.						57.0	61.0	60.0					5																	54641000		2203	4300	6503	SO:0001583	missense	23517	exon10			GACCAGAAAGGGC	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.1084A>G	5.37:g.54641000A>G	ENSP00000230640:p.Lys362Glu	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	143	4	0.027972	NM_015360	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	37	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	A	19.06	3.754859	0.69648	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.44881	0.91;0.91	5.38	5.38	0.77491	.	0.203730	0.53938	D	0.000060	T	0.46464	0.1394	M	0.75615	2.305	0.80722	D	1	B;B	0.33940	0.433;0.047	B;B	0.36244	0.22;0.04	T	0.41502	-0.9505	10	0.23302	T	0.38	-22.2468	15.6677	0.77242	1.0:0.0:0.0:0.0	.	261;362	F5H7E2;P42285	.;SK2L2_HUMAN	E	362;261	ENSP00000230640:K362E;ENSP00000442583:K261E	ENSP00000230640:K362E	K	+	1	0	SKIV2L2	54676757	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.735000	0.91549	2.164000	0.68074	0.477000	0.44152	AAA	.	.	none		0.358	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
SH3TC1	54436	hgsc.bcm.edu	37	4	8224646	8224646	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:8224646C>T	ENST00000245105.3	+	10	1259	c.1192C>T	c.(1192-1194)Cag>Tag	p.Q398*	SH3TC1_ENST00000539824.1_Nonsense_Mutation_p.Q322*	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	398										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GGATGCCAGGCAGTTGCTGAG	0.547																																					p.Q398X	NSCLC(145;2298 2623 35616 37297)	Atlas-SNP	.											.	SH3TC1	105	.	0			c.C1192T						PASS	.						87.0	79.0	81.0					4																	8224646		2203	4300	6503	SO:0001587	stop_gained	54436	exon10			GCCAGGCAGTTGC	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.1192C>T	4.37:g.8224646C>T	ENSP00000245105:p.Gln398*	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	95	45	0.473684	NM_018986	Q4W5G5	Nonsense_Mutation	SNP	ENST00000245105.3	37	CCDS3399.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366069	0.41902	.	.	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265;ENST00000508641	.	.	.	4.31	1.4	0.22301	.	1.151220	0.06322	N	0.704583	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-11.1481	8.0625	0.30642	0.2675:0.4488:0.2837:0.0	.	.	.	.	X	136;398;322;227;180	.	ENSP00000245105:Q398X	Q	+	1	0	SH3TC1	8275546	0.425000	0.25498	0.001000	0.08648	0.170000	0.22686	0.931000	0.28871	-0.047000	0.13423	0.561000	0.74099	CAG	.	.	none		0.547	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	
SRBD1	55133	hgsc.bcm.edu	37	2	45620107	45620107	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:45620107G>A	ENST00000263736.4	-	20	2737	c.2675C>T	c.(2674-2676)cCt>cTt	p.P892L	SRBD1_ENST00000490133.1_5'UTR|SRBD1_ENST00000535761.1_Missense_Mutation_p.P411L	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	892					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)	p.P892H(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			AAAGCTTTCAGGCTGGCTGAG	0.398																																					p.P892L		Atlas-SNP	.											SRBD1,NS,carcinoma,0,1	SRBD1	107	1	1	Substitution - Missense(1)	kidney(1)	c.C2675T						scavenged	.						336.0	273.0	294.0					2																	45620107		2203	4300	6503	SO:0001583	missense	55133	exon20			CTTTCAGGCTGGC	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.2675C>T	2.37:g.45620107G>A	ENSP00000263736:p.Pro892Leu	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	125	2	0.016	NM_018079	Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	ENST00000263736.4	37	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914795	0.92178	.	.	ENSG00000068784	ENST00000263736;ENST00000535761	T;T	0.40756	1.36;1.02	5.55	5.55	0.83447	Tex RuvX-like domain (1);	0.000000	0.85682	D	0.000000	T	0.72581	0.3478	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.77950	-0.2395	10	0.87932	D	0	.	19.8575	0.96767	0.0:0.0:1.0:0.0	.	892	Q8N5C6	SRBD1_HUMAN	L	892;411	ENSP00000263736:P892L;ENSP00000441272:P411L	ENSP00000263736:P892L	P	-	2	0	SRBD1	45473611	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.306000	0.89962	2.767000	0.95098	0.563000	0.77884	CCT	.	.	none		0.398	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079	
DUSP27	92235	hgsc.bcm.edu	37	1	167097477	167097477	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:167097477C>T	ENST00000361200.2	+	6	3275	c.3109C>T	c.(3109-3111)Cca>Tca	p.P1037S	DUSP27_ENST00000271385.5_Missense_Mutation_p.P1037S|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000443333.1_Missense_Mutation_p.P1037S			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1037					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AGAGGAGAGCCCAGAGCCCTA	0.587																																					p.P1037S		Atlas-SNP	.											.	DUSP27	235	.	0			c.C3109T						PASS	.						36.0	40.0	39.0					1																	167097477		2203	4300	6503	SO:0001583	missense	92235	exon5			GAGAGCCCAGAGC	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3109C>T	1.37:g.167097477C>T	ENSP00000354483:p.Pro1037Ser	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	88	41	0.465909	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766633	0.69878	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03663	3.85;3.85;3.85	5.42	5.42	0.78866	.	0.000000	0.50627	D	0.000120	T	0.12433	0.0302	M	0.65975	2.015	0.44956	D	0.997975	D	0.89917	1.0	D	0.83275	0.996	T	0.01152	-1.1435	10	0.87932	D	0	-14.3953	19.2273	0.93822	0.0:1.0:0.0:0.0	.	1037	Q5VZP5	DUS27_HUMAN	S	1037	ENSP00000354483:P1037S;ENSP00000271385:P1037S;ENSP00000404874:P1037S	ENSP00000271385:P1037S	P	+	1	0	DUSP27	165364101	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	3.548000	0.53670	2.530000	0.85305	0.643000	0.83706	CCA	.	.	none		0.587	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
SERPINB10	5273	hgsc.bcm.edu	37	18	61584747	61584747	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:61584747A>G	ENST00000238508.3	+	3	285	c.226A>G	c.(226-228)Agg>Ggg	p.R76G		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	76					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				TGAAAAAAAAAGGAAAATGGT	0.299																																					p.R76G		Atlas-SNP	.											SERPINB10,colon,carcinoma,0,1	SERPINB10	53	1	0			c.A226G						scavenged	.						23.0	23.0	23.0					18																	61584747		2168	4251	6419	SO:0001583	missense	5273	exon2			AAAAAAAGGAAAA	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.226A>G	18.37:g.61584747A>G	ENSP00000238508:p.Arg76Gly	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	113	3	0.0265487	NM_005024	Q4VAX4|Q4VAX7	Missense_Mutation	SNP	ENST00000238508.3	37	CCDS11990.1	.	.	.	.	.	.	.	.	.	.	A	11.93	1.786427	0.31593	.	.	ENSG00000242550	ENST00000238508	D	0.85088	-1.94	5.51	5.51	0.81932	Serpin domain (3);	0.157487	0.42821	D	0.000652	D	0.82747	0.5104	N	0.26042	0.785	0.31412	N	0.675345	D;D	0.58970	0.984;0.973	P;P	0.54210	0.745;0.745	T	0.82448	-0.0452	9	.	.	.	.	11.9508	0.52954	1.0:0.0:0.0:0.0	.	76;76	P48595;B2RC45	SPB10_HUMAN;.	G	76	ENSP00000238508:R76G	.	R	+	1	2	SERPINB10	59735727	1.000000	0.71417	1.000000	0.80357	0.438000	0.31896	3.903000	0.56318	2.319000	0.78375	0.528000	0.53228	AGG	.	.	none		0.299	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	NM_005024	
PCDHGA9	56107	hgsc.bcm.edu	37	5	140784896	140784896	+	Missense_Mutation	SNP	G	G	A	rs371490086	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:140784896G>A	ENST00000573521.1	+	1	2377	c.2377G>A	c.(2377-2379)Gtc>Atc	p.V793I	PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	793					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTTTGTGCGTCTCTGTTGA	0.428													.|||	2	0.000399361	0.0015	0.0	5008	,	,		20921	0.0		0.0	False		,,,				2504	0.0				p.V793I		Atlas-SNP	.											PCDHGA9_ENST00000573521,NS,carcinoma,0,2	PCDHGA9	110	2	0			c.G2377A						scavenged	.	G	,,,,,,,,ILE/VAL,,,,,,ILE/VAL	3,4379		0,3,2188	71.0	78.0	76.0		,,,,,,,,2377,,,,,,2377	-3.4	0.0	5		76	0,8596		0,0,4298	no	intron,intron,intron,intron,intron,intron,intron,intron,missense,intron,intron,intron,intron,intron,missense	PCDHGB4,PCDHGA8,PCDHGB5,PCDHGB3,PCDHGB2,PCDHGB1,PCDHGA9,PCDHGA7,PCDHGA6,PCDHGA5,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_003736.2,NM_018912.2,NM_018915.2,NM_018916.3,NM_018917.2,NM_018918.2,NM_018919.2,NM_018920.2,NM_018921.2,NM_018922.2,NM_018923.2,NM_018924.2,NM_018925.2,NM_032088.1,NM_032089.1	,,,,,,,,29,,,,,,29	0,3,6486	AA,AG,GG		0.0,0.0685,0.0231	,,,,,,,,,,,,,,	,,,,,,,,793/933,,,,,,793/829	140784896	3,12975	2191	4298	6489	SO:0001583	missense	56107	exon1			TTGTGCGTCTCTG	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.2377G>A	5.37:g.140784896G>A	ENSP00000460274:p.Val793Ile	Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	207	3	0.0144928	NM_032089	A2RU65|Q9Y5C9	Missense_Mutation	SNP	ENST00000573521.1	37	CCDS58981.1																																																																																			.	.	weak		0.428	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921	
MIPEP	4285	hgsc.bcm.edu	37	13	24436455	24436455	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr13:24436455T>C	ENST00000382172.3	-	9	1137	c.1039A>G	c.(1039-1041)Aat>Gat	p.N347D		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	347					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		TTTTGAGGATTCAGTTTCATT	0.279																																					p.N347D		Atlas-SNP	.											.	MIPEP	53	.	0			c.A1039G						PASS	.						47.0	43.0	44.0					13																	24436455		2196	4289	6485	SO:0001583	missense	4285	exon9			GAGGATTCAGTTT		CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.1039A>G	13.37:g.24436455T>C	ENSP00000371607:p.Asn347Asp	Somatic	212	0	0		WXS	Illumina HiSeq	Phase_I	133	48	0.360902	NM_005932	Q5JV15|Q5T9Q9|Q96G65	Missense_Mutation	SNP	ENST00000382172.3	37	CCDS9303.1	.	.	.	.	.	.	.	.	.	.	T	19.34	3.808264	0.70797	.	.	ENSG00000027001	ENST00000382172	T	0.07908	3.15	4.79	4.79	0.61399	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.18002	0.0432	M	0.67953	2.075	0.45747	D	0.998648	P	0.42296	0.775	P	0.48873	0.593	T	0.00670	-1.1617	10	0.42905	T	0.14	.	14.4368	0.67287	0.0:0.0:0.0:1.0	.	347	Q99797	MIPEP_HUMAN	D	347	ENSP00000371607:N347D	ENSP00000371607:N347D	N	-	1	0	MIPEP	23334455	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	6.106000	0.71511	2.132000	0.65825	0.533000	0.62120	AAT	.	.	none		0.279	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044169.1		
ZNF691	51058	hgsc.bcm.edu	37	1	43317125	43317125	+	Missense_Mutation	SNP	C	C	T	rs201360083		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:43317125C>T	ENST00000372506.1	+	4	836	c.496C>T	c.(496-498)Cgg>Tgg	p.R166W	ZNF691_ENST00000372504.1_Missense_Mutation_p.R188W|ZNF691_ENST00000372507.1_Missense_Mutation_p.R166W|ZNF691_ENST00000397044.3_Missense_Mutation_p.R197W|ZNF691_ENST00000372502.1_Missense_Mutation_p.R188W|ZNF691_ENST00000372508.3_Missense_Mutation_p.R166W	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	197						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CCTAGGCAAGCGGCCATACCG	0.592													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18616	0.0		0.0	False		,,,				2504	0.0				p.R197W		Atlas-SNP	.											.	ZNF691	30	.	0			c.C589T						PASS	.						65.0	58.0	60.0					1																	43317125		2203	4300	6503	SO:0001583	missense	51058	exon4			GGCAAGCGGCCAT		CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.496C>T	1.37:g.43317125C>T	ENSP00000361584:p.Arg166Trp	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	66	4	0.0606061	NM_001242739	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	ENST00000372506.1	37	CCDS476.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	18.52	3.641667	0.67244	.	.	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000372503;ENST00000372502	T;T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08;2.08	5.31	2.19	0.27852	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	D	0.000110	T	0.26955	0.0660	M	0.90252	3.1	0.35155	D	0.770112	B;B	0.30973	0.195;0.302	B;B	0.25759	0.039;0.063	T	0.37361	-0.9709	10	0.87932	D	0	-11.7827	6.4447	0.21869	0.423:0.4921:0.0:0.0849	.	197;197	B4DJR7;Q5VV52	.;ZN691_HUMAN	W	166;166;166;197;188;197;188	ENSP00000361586:R166W;ENSP00000361585:R166W;ENSP00000361584:R166W;ENSP00000380237:R197W;ENSP00000361582:R188W;ENSP00000361580:R188W	ENSP00000361580:R188W	R	+	1	2	ZNF691	43089712	0.991000	0.36638	1.000000	0.80357	0.976000	0.68499	2.198000	0.42705	0.887000	0.36136	0.561000	0.74099	CGG	C|1.000;T|0.000	0.000	strong		0.592	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020192.1	NM_015911	
EYA4	2070	hgsc.bcm.edu	37	6	133836535	133836535	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:133836535A>G	ENST00000367895.5	+	17	2042	c.1578A>G	c.(1576-1578)ctA>ctG	p.L526L	EYA4_ENST00000355286.6_Silent_p.L503L|EYA4_ENST00000525849.1_Silent_p.L503L|EYA4_ENST00000531901.1_Silent_p.L532L|RP3-323P13.2_ENST00000607033.1_RNA|EYA4_ENST00000431403.2_Silent_p.L526L|EYA4_ENST00000430974.2_Silent_p.L478L|EYA4_ENST00000452339.2_Silent_p.L472L|EYA4_ENST00000355167.3_Silent_p.L526L	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	526					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		ATTCCTGGCTAACAAATGCAC	0.413																																					p.L526L	Melanoma(57;398 1237 3528 4702 7415)	Atlas-SNP	.											EYA4_ENST00000355167,NS,carcinoma,+2,2	EYA4	196	2	0			c.A1578G						PASS	.						192.0	183.0	186.0					6																	133836535		2203	4300	6503	SO:0001819	synonymous_variant	2070	exon17			CTGGCTAACAAAT	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1578A>G	6.37:g.133836535A>G		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	94	20	0.212766	NM_172105	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Silent	SNP	ENST00000367895.5	37	CCDS5165.1																																																																																			.	.	none		0.413	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100	
LURAP1L	286343	hgsc.bcm.edu	37	9	12775880	12775880	+	Missense_Mutation	SNP	T	T	G	rs201963967		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:12775880T>G	ENST00000319264.3	+	1	861	c.166T>G	c.(166-168)Tgc>Ggc	p.C56G	RP11-3L8.3_ENST00000417638.1_RNA|LURAP1L_ENST00000489107.1_3'UTR	NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	59	Gly-rich.							p.C56G(1)									cggcggcggctgcagtagcag	0.687																																					p.C56G		Atlas-SNP	.											C9orf150,caecum,carcinoma,0,3	.	.	3	1	Substitution - Missense(1)	ovary(1)	c.T166G						scavenged	.						4.0	4.0	4.0					9																	12775880		1740	3236	4976	SO:0001583	missense	286343	exon1			GGCGGCTGCAGTA	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.166T>G	9.37:g.12775880T>G	ENSP00000321026:p.Cys56Gly	Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	5	3	0.6	NM_203403	Q5VZX7|Q8N923|Q8NCG2	Missense_Mutation	SNP	ENST00000319264.3	37	CCDS6473.1	.	.	.	.	.	.	.	.	.	.	T	6.415	0.444604	0.12164	.	.	ENSG00000153714	ENST00000319264	T	0.42900	0.96	4.66	0.578	0.17391	.	1.586600	0.03312	N	0.190713	T	0.18087	0.0434	.	.	.	0.51482	P	7.500000000004725E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.20009	-1.0288	8	0.08837	T	0.75	.	1.2788	0.02036	0.1736:0.1011:0.2715:0.4538	.	59	Q8IV03	CI150_HUMAN	G	56	ENSP00000321026:C56G	ENSP00000321026:C56G	C	+	1	0	C9orf150	12765880	0.074000	0.21230	0.846000	0.33378	0.825000	0.46686	-0.127000	0.10547	0.663000	0.31027	0.454000	0.30748	TGC	.	.	weak		0.687	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403	
KIF14	9928	hgsc.bcm.edu	37	1	200550342	200550342	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:200550342A>G	ENST00000367350.4	-	20	3760	c.3322T>C	c.(3322-3324)Tat>Cat	p.Y1108H		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	1108	Required for CIT-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						CCAAAAACATAGTATGTTTTC	0.308																																					p.Y1108H		Atlas-SNP	.											KIF14,NS,carcinoma,+1,1	KIF14	156	1	0			c.T3322C						scavenged	.						90.0	93.0	92.0					1																	200550342		2202	4300	6502	SO:0001583	missense	9928	exon20			AAACATAGTATGT	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.3322T>C	1.37:g.200550342A>G	ENSP00000356319:p.Tyr1108His	Somatic	295	0	0		WXS	Illumina HiSeq	Phase_I	275	3	0.0109091	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	ENST00000367350.4	37	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	A	17.20	3.327760	0.60743	.	.	ENSG00000118193	ENST00000367350	T	0.16597	2.33	5.44	4.24	0.50183	.	0.153645	0.40818	N	0.001009	T	0.28797	0.0714	M	0.63428	1.95	0.33949	D	0.644234	D	0.69078	0.997	P	0.62089	0.898	T	0.29640	-1.0005	10	0.15499	T	0.54	.	8.3451	0.32268	0.6775:0.0:0.0:0.3225	.	1108	Q15058	KIF14_HUMAN	H	1108	ENSP00000356319:Y1108H	ENSP00000356319:Y1108H	Y	-	1	0	KIF14	198816965	1.000000	0.71417	0.891000	0.34965	0.669000	0.39330	4.981000	0.63819	2.058000	0.61347	0.383000	0.25322	TAT	.	.	none		0.308	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
CCDC37	348807	hgsc.bcm.edu	37	3	126142198	126142198	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:126142198G>A	ENST00000352312.1	+	12	1212	c.1113G>A	c.(1111-1113)gaG>gaA	p.E371E	CCDC37_ENST00000505024.1_Silent_p.E372E|CCDC37_ENST00000393425.1_Silent_p.E372E	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	371										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		CCACGCAGGAGGACACCGACA	0.667																																					p.E371E		Atlas-SNP	.											.	CCDC37	69	.	0			c.G1113A						PASS	.						41.0	37.0	38.0					3																	126142198		2203	4300	6503	SO:0001819	synonymous_variant	348807	exon12			GCAGGAGGACACC	AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.1113G>A	3.37:g.126142198G>A		Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	145	42	0.289655	NM_182628	D3DNA8|Q494V1|Q494V4|Q8N838	Silent	SNP	ENST00000352312.1	37	CCDS3037.1																																																																																			.	.	none		0.667	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000370099.4	NM_182628	
SP5	389058	hgsc.bcm.edu	37	2	171572940	171572940	+	Missense_Mutation	SNP	G	G	A	rs3749036	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:171572940G>A	ENST00000375281.3	+	2	385	c.223G>A	c.(223-225)Gcc>Acc	p.A75T	SP5_ENST00000487037.1_3'UTR|AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	75			A -> T (in dbSNP:rs3749036).		bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(2)|lung(1)|prostate(1)	5						CCCGTGGACCGCCGACATGCC	0.756													G|||	2195	0.438299	0.5113	0.4553	5008	,	,		7969	0.5962		0.3012	False		,,,				2504	0.3057				p.A75T		Atlas-SNP	.											.	SP5	14	.	0			c.G223A						PASS	.	G	THR/ALA	1960,2092		529,902,595	9.0	11.0	10.0		223	0.9	0.6	2	dbSNP_107	10	2697,5473		538,1621,1926	no	missense	SP5	NM_001003845.2	58	1067,2523,2521	AA,AG,GG		33.011,48.3712,38.1034	benign	75/399	171572940	4657,7565	2026	4085	6111	SO:0001583	missense	389058	exon2			TGGACCGCCGACA		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.223G>A	2.37:g.171572940G>A	ENSP00000364430:p.Ala75Thr	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_001003845		Missense_Mutation	SNP	ENST00000375281.3	37	CCDS33322.1	943	0.4317765567765568	243	0.49390243902439024	143	0.39502762430939226	321	0.5611888111888111	236	0.3113456464379947	G	6.686	0.495106	0.12762	0.483712	0.33011	ENSG00000204335	ENST00000375281	T	0.09073	3.02	4.42	0.867	0.19085	.	0.177050	0.45867	D	0.000334	T	0.00012	0.0000	N	0.01352	-0.895	0.40457	P	0.019797999999999982	B	0.02656	0.0	B	0.01281	0.0	T	0.30621	-0.9972	9	0.11485	T	0.65	.	3.3493	0.07146	0.3555:0.0:0.4543:0.1902	rs3749036	75	Q6BEB4	SP5_HUMAN	T	75	ENSP00000364430:A75T	ENSP00000364430:A75T	A	+	1	0	SP5	171281186	0.158000	0.22850	0.577000	0.28562	0.966000	0.64601	1.032000	0.30178	0.292000	0.22492	0.455000	0.32223	GCC	G|0.572;A|0.428	0.428	strong		0.756	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333670.1	XM_371581	
P2RY8	286530	hgsc.bcm.edu	37	X	1584851	1584851	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:1584851G>C	ENST00000381297.4	-	2	811	c.601C>G	c.(601-603)Ctg>Gtg	p.L201V	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ATGAGGAACAGCAGGATGAAG	0.632			T	CRLF2	"""B-ALL, Downs associated ALL"""																																p.L201V		Atlas-SNP	.		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	.	P2RY8	53	.	0			c.C601G						PASS	.						134.0	71.0	93.0					X																	1584851		2203	4296	6499	SO:0001583	missense	286530	exon2			GGAACAGCAGGAT	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.601C>G	X.37:g.1584851G>C	ENSP00000370697:p.Leu201Val	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	48	35	0.729167	NM_178129		Missense_Mutation	SNP	ENST00000381297.4	37	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	g	3.766	-0.048645	0.07407	.	.	ENSG00000182162	ENST00000381297	T	0.71461	-0.57	2.41	2.41	0.29592	GPCR, rhodopsin-like superfamily (1);	0.085770	0.48286	U	0.000193	T	0.68531	0.3011	L	0.41632	1.29	0.09310	N	1	D	0.61080	0.989	P	0.62298	0.9	T	0.56523	-0.7965	10	0.17369	T	0.5	.	5.7904	0.18357	0.269:0.0:0.731:0.0	.	201	Q86VZ1	P2RY8_HUMAN	V	201	ENSP00000370697:L201V	ENSP00000370697:L201V	L	-	1	2	P2RY8	1544851	0.994000	0.37717	0.486000	0.27416	0.409000	0.31022	2.274000	0.43390	0.838000	0.34948	0.279000	0.19357	CTG	.	.	none		0.632	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	NM_178129	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79080663	79080663	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:79080663C>T	ENST00000388820.4	-	8	1442	c.1232G>A	c.(1231-1233)cGa>cAa	p.R411Q	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	411	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GATGAAAGGTCGTTTCCCAAC	0.612																																					p.R411Q		Atlas-SNP	.											ADAMTS7,NS,carcinoma,0,1	ADAMTS7	142	1	0			c.G1232A						scavenged	.						159.0	136.0	143.0					15																	79080663		2196	4293	6489	SO:0001583	missense	11173	exon8			AAAGGTCGTTTCC	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1232G>A	15.37:g.79080663C>T	ENSP00000373472:p.Arg411Gln	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	153	2	0.0130719	NM_014272	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.040431	0.55003	.	.	ENSG00000136378	ENST00000388820	T	0.03441	3.93	5.37	0.0853	0.14441	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.068763	0.56097	D	0.000031	T	0.02380	0.0073	L	0.37630	1.12	0.35551	D	0.80384	B;P	0.35844	0.334;0.524	B;B	0.28916	0.059;0.096	T	0.55309	-0.8161	10	0.25106	T	0.35	.	5.4694	0.16662	0.1278:0.5715:0.0:0.3007	.	411;411	A8MQ00;Q9UKP4	.;ATS7_HUMAN	Q	411	ENSP00000373472:R411Q	ENSP00000373472:R411Q	R	-	2	0	ADAMTS7	76867718	0.945000	0.32115	0.997000	0.53966	0.835000	0.47333	0.308000	0.19314	0.011000	0.14865	-0.320000	0.08662	CGA	.	.	none		0.612	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
PITPNM3	83394	hgsc.bcm.edu	37	17	6367558	6367558	+	Silent	SNP	G	G	C	rs561217506		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:6367558G>C	ENST00000262483.8	-	16	2175	c.2088C>G	c.(2086-2088)cgC>cgG	p.R696R	PITPNM3_ENST00000576664.1_5'UTR|PITPNM3_ENST00000421306.3_Silent_p.R660R	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	696					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		TGTATGTGATGCGACCACTGC	0.597																																					p.R696R		Atlas-SNP	.											PITPNM3,colon,carcinoma,-1,1	PITPNM3	91	1	0			c.C2088G						PASS	.						83.0	81.0	81.0					17																	6367558		2203	4300	6503	SO:0001819	synonymous_variant	83394	exon16			TGTGATGCGACCA	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.2088C>G	17.37:g.6367558G>C		Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	77	25	0.324675	NM_031220	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	37	CCDS11076.1																																																																																			.	.	none		0.597	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220	
MUC17	140453	hgsc.bcm.edu	37	7	100678407	100678407	+	Missense_Mutation	SNP	G	G	A	rs4729649	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:100678407G>A	ENST00000306151.4	+	3	3774	c.3710G>A	c.(3709-3711)aGc>aAc	p.S1237N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1237	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCTGAGGCTAGCACCCTTTCA	0.527													G|||	989	0.197484	0.2663	0.0893	5008	,	,		29474	0.2212		0.1083	False		,,,				2504	0.2485				p.S1237N		Atlas-SNP	.											MUC17,caecum,carcinoma,0,1	MUC17	804	1	0			c.G3710A						scavenged	.	G	ASN/SER	354,4052	149.2+/-183.4	0,354,1849	303.0	291.0	295.0		3710	-1.7	0.0	7	dbSNP_111	295	220,8380	66.0+/-128.3	0,220,4080	no	missense	MUC17	NM_001040105.1	46	0,574,5929	AA,AG,GG		2.5581,8.0345,4.4133	benign	1237/4494	100678407	574,12432	2203	4300	6503	SO:0001583	missense	140453	exon3			AGGCTAGCACCCT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3710G>A	7.37:g.100678407G>A	ENSP00000302716:p.Ser1237Asn	Somatic	114	17	0.149123		WXS	Illumina HiSeq	Phase_I	146	41	0.280822	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	0.984	-0.696233	0.03279	0.080345	0.025581	ENSG00000169876	ENST00000306151	T	0.02606	4.23	0.838	-1.68	0.08212	.	.	.	.	.	T	0.00144	0.0004	L	0.29908	0.895	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.47235	-0.9133	9	0.26408	T	0.33	.	2.9027	0.05711	0.0:0.3166:0.4155:0.2679	rs4729649	1237	Q685J3	MUC17_HUMAN	N	1237	ENSP00000302716:S1237N	ENSP00000302716:S1237N	S	+	2	0	MUC17	100465127	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-2.728000	0.00807	-1.139000	0.02881	0.134000	0.15878	AGC	G|0.948;A|0.052	0.052	strong		0.527	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
GRK4	2868	hgsc.bcm.edu	37	4	2986265	2986265	+	Silent	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:2986265T>C	ENST00000398052.4	+	2	421	c.78T>C	c.(76-78)cgT>cgC	p.R26R	GRK4_ENST00000398051.4_Intron|GRK4_ENST00000504933.1_Silent_p.R26R|GRK4_ENST00000345167.6_Intron	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4	26	N-terminal.				G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AAAGTGGTCGTAGTAAAAAAT	0.393																																					p.R26R		Atlas-SNP	.											GRK4_ENST00000398052,NS,carcinoma,+2,3	GRK4	72	3	0			c.T78C						scavenged	.						88.0	83.0	85.0					4																	2986265		2203	4300	6503	SO:0001819	synonymous_variant	2868	exon2			TGGTCGTAGTAAA		CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.78T>C	4.37:g.2986265T>C		Somatic	269	1	0.00371747		WXS	Illumina HiSeq	Phase_I	244	4	0.0163934	NM_182982	O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Silent	SNP	ENST00000398052.4	37	CCDS33946.1																																																																																			.	.	none		0.393	GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358176.2	NM_005307	
TREML2	79865	hgsc.bcm.edu	37	6	41166119	41166119	+	Missense_Mutation	SNP	T	T	C	rs76984414		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:41166119T>C	ENST00000483722.1	-	2	289	c.104A>G	c.(103-105)gAg>gGg	p.E35G		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	35	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGACAGAGTCTCCCCTTCAAG	0.498																																					p.E35G		Atlas-SNP	.											TREML2,colon,carcinoma,0,2	TREML2	41	2	0			c.A104G						scavenged	.						132.0	135.0	134.0					6																	41166119		2203	4300	6503	SO:0001583	missense	79865	exon2			AGAGTCTCCCCTT	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.104A>G	6.37:g.41166119T>C	ENSP00000418767:p.Glu35Gly	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	104	5	0.0480769	NM_024807	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	37	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	.	7.815	0.716447	0.15306	.	.	ENSG00000112195	ENST00000483722	T	0.20598	2.06	4.75	3.58	0.41010	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.462226	0.19397	N	0.115265	T	0.05410	0.0143	L	0.33245	0.995	0.26220	N	0.979173	B	0.14438	0.01	B	0.12156	0.007	T	0.37596	-0.9699	10	0.29301	T	0.29	-14.8097	9.5481	0.39293	0.0:0.0923:0.0:0.9077	.	35	Q5T2D2	TRML2_HUMAN	G	35	ENSP00000418767:E35G	ENSP00000418767:E35G	E	-	2	0	TREML2	41274097	1.000000	0.71417	0.999000	0.59377	0.017000	0.09413	1.360000	0.34125	0.283000	0.22279	-1.195000	0.01675	GAG	.	.	weak		0.498	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
RYR2	6262	hgsc.bcm.edu	37	1	237580416	237580416	+	Silent	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:237580416A>C	ENST00000366574.2	+	11	1158	c.841A>C	c.(841-843)Aga>Cga	p.R281R	RYR2_ENST00000542537.1_Silent_p.R265R|RYR2_ENST00000360064.6_Silent_p.R279R	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	281					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGAGACGCTAAGAGTTGCGTA	0.443																																					p.R281R		Atlas-SNP	.											RYR2,NS,carcinoma,-1,2	RYR2	1273	2	0			c.A841C						PASS	.						120.0	117.0	118.0					1																	237580416		2050	4217	6267	SO:0001819	synonymous_variant	6262	exon11			ACGCTAAGAGTTG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.841A>C	1.37:g.237580416A>C		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	63	22	0.349206	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																			.	.	none		0.443	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
OTOF	9381	hgsc.bcm.edu	37	2	26696112	26696112	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:26696112C>T	ENST00000272371.2	-	29	3747	c.3621G>A	c.(3619-3621)gtG>gtA	p.V1207V	OTOF_ENST00000402415.3_Silent_p.V517V|OTOF_ENST00000338581.6_Silent_p.V460V|OTOF_ENST00000403946.3_Silent_p.V1207V|OTOF_ENST00000339598.3_Silent_p.V460V	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1207					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCGGCAGTCCACCACACGGA	0.667																																					p.V1207V	GBM(102;732 1451 20652 24062 31372)	Atlas-SNP	.											OTOF_ENST00000361394,NS,carcinoma,-2,2	OTOF	524	2	0			c.G3621A						scavenged	.						59.0	58.0	58.0					2																	26696112		2203	4300	6503	SO:0001819	synonymous_variant	9381	exon29			GCAGTCCACCACA	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3621G>A	2.37:g.26696112C>T		Somatic	217	0	0		WXS	Illumina HiSeq	Phase_I	214	3	0.0140187	NM_194248	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	ENST00000272371.2	37	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.270436	0.23221	.	.	ENSG00000115155	ENST00000426958	.	.	.	4.68	-0.675	0.11364	.	.	.	.	.	T	0.50086	0.1595	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36578	-0.9742	4	.	.	.	-18.2206	4.9019	0.13779	0.1335:0.4692:0.0:0.3973	.	.	.	.	R	63	.	.	G	-	1	0	OTOF	26549616	0.857000	0.29778	0.995000	0.50966	0.926000	0.56050	0.016000	0.13377	-0.184000	0.10567	0.305000	0.20034	GGA	.	.	none		0.667	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
PRRT4	401399	hgsc.bcm.edu	37	7	127992592	127992592	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:127992592G>C	ENST00000446477.2	-	6	1331	c.1018C>G	c.(1018-1020)Ccg>Gcg	p.P340A	PRRT4_ENST00000435512.1_Missense_Mutation_p.P340A|PRRT4_ENST00000535159.1_Missense_Mutation_p.P340A|PRRT4_ENST00000489835.2_Missense_Mutation_p.P340A	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	340						integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						AGGGGCCTCGGCGCCTCGGGA	0.716																																					p.P340A		Atlas-SNP	.											.	PRRT4	31	.	0			c.C1018G						PASS	.						41.0	51.0	48.0					7																	127992592		692	1591	2283	SO:0001583	missense	401399	exon6			GCCTCGGCGCCTC	BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.1018C>G	7.37:g.127992592G>C	ENSP00000415026:p.Pro340Ala	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	87	23	0.264368	NM_001174164	A4D0Z9|C9JVW7	Missense_Mutation	SNP	ENST00000446477.2	37	CCDS55160.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.254999	0.22965	.	.	ENSG00000224940	ENST00000489835;ENST00000446477;ENST00000535159;ENST00000435512;ENST00000489517	.	.	.	4.1	0.903	0.19296	.	.	.	.	.	T	0.26159	0.0638	L	0.29908	0.895	0.24037	N	0.9961	B	0.02656	0.0	B	0.06405	0.002	T	0.26018	-1.0115	8	0.62326	D	0.03	-14.736	2.2696	0.04087	0.1191:0.185:0.5058:0.1901	.	340	C9JH25	PRRT4_HUMAN	A	340	.	ENSP00000410779:P340A	P	-	1	0	PRRT4	127779828	0.003000	0.15002	0.054000	0.19295	0.051000	0.14879	0.941000	0.29005	0.064000	0.16427	-0.438000	0.05819	CCG	.	.	none		0.716	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001114726	
ETS2	2114	hgsc.bcm.edu	37	21	40194761	40194761	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr21:40194761C>T	ENST00000360214.3	+	11	1818	c.1358C>T	c.(1357-1359)aCg>aTg	p.T453M	ETS2_ENST00000360938.3_Missense_Mutation_p.T453M	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	453					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				CTGGGGTTCACGCCCGAGGAA	0.632																																					p.T593M		Atlas-SNP	.											ETS2_ENST00000360214,caecum,carcinoma,-1,2	ETS2	87	2	0			c.C1778T						PASS	.						77.0	60.0	66.0					21																	40194761		2203	4300	6503	SO:0001583	missense	2114	exon11			GGTTCACGCCCGA		CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.1358C>T	21.37:g.40194761C>T	ENSP00000353344:p.Thr453Met	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	40	23	0.575	NM_001256295	A6NM68|D3DSH6|Q53Y89	Missense_Mutation	SNP	ENST00000360214.3	37	CCDS13659.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414164	0.83449	.	.	ENSG00000157557	ENST00000360214;ENST00000360938	T;T	0.14640	2.49;2.49	5.62	5.62	0.85841	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.155857	0.56097	D	0.000028	T	0.33585	0.0868	M	0.68952	2.095	0.58432	D	0.999998	D	0.89917	1.0	P	0.57620	0.824	T	0.02498	-1.1150	10	0.87932	D	0	.	19.2718	0.94013	0.0:1.0:0.0:0.0	.	453	P15036	ETS2_HUMAN	M	453	ENSP00000353344:T453M;ENSP00000354194:T453M	ENSP00000353344:T453M	T	+	2	0	ETS2	39116631	1.000000	0.71417	0.979000	0.43373	0.927000	0.56198	5.598000	0.67585	2.634000	0.89283	0.655000	0.94253	ACG	.	.	none		0.632	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207544.1		
MTCL1	23255	hgsc.bcm.edu	37	18	8825287	8825287	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:8825287C>T	ENST00000306329.11	+	13	4736	c.4736C>T	c.(4735-4737)cCc>cTc	p.P1579L	SOGA2_ENST00000306285.7_Missense_Mutation_p.P585L|SOGA2_ENST00000400050.3_Missense_Mutation_p.P1219L|SOGA2_ENST00000518815.1_Missense_Mutation_p.P585L|SOGA2_ENST00000517570.1_Missense_Mutation_p.P1219L|SOGA2_ENST00000359865.3_Missense_Mutation_p.P1260L														p.P1260L(1)									CTTGATAGTCCCCTCTGTACC	0.612																																					p.P1260L		Atlas-SNP	.											CCDC165,scalp,carcinoma,0,1	.	.	1	1	Substitution - Missense(1)	skin(1)	c.C3779T						scavenged	.						41.0	40.0	40.0					18																	8825287		2203	4300	6503	SO:0001583	missense	23255	exon15			ATAGTCCCCTCTG																												ENST00000306329.11:c.4736C>T	18.37:g.8825287C>T	ENSP00000305027:p.Pro1579Leu	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	91	2	0.021978	NM_015210		Missense_Mutation	SNP	ENST00000306329.11	37		.	.	.	.	.	.	.	.	.	.	C	6.308	0.424917	0.11987	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.33216	2.46;2.43;2.46;1.42	5.24	5.24	0.73138	.	0.845097	0.10140	N	0.710976	T	0.47266	0.1436	L	0.49126	1.545	0.43583	D	0.995922	P;P	0.51791	0.717;0.948	B;P	0.53861	0.211;0.736	T	0.31916	-0.9926	10	0.42905	T	0.14	-6.1189	18.8187	0.92088	0.0:1.0:0.0:0.0	.	1570;1260	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	L	1281;1219;1260;1219;585	ENSP00000429556:P1219L;ENSP00000352927:P1260L;ENSP00000382924:P1219L;ENSP00000303670:P585L	ENSP00000303670:P585L	P	+	2	0	CCDC165	8815287	0.836000	0.29430	0.379000	0.26080	0.055000	0.15305	7.463000	0.80869	2.448000	0.82819	0.655000	0.94253	CCC	.	.	none		0.612	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
HERC5	51191	hgsc.bcm.edu	37	4	89427002	89427002	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:89427002C>T	ENST00000264350.3	+	23	3201	c.3048C>T	c.(3046-3048)gcC>gcT	p.A1016A	HERC5_ENST00000508159.1_Silent_p.A654A	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	1016	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		TTCAAGAAGCCATCAACAACA	0.408																																					p.A1016A	Esophageal Squamous(39;887 1012 34045 50514)	Atlas-SNP	.											.	HERC5	114	.	0			c.C3048T						PASS	.						59.0	59.0	59.0					4																	89427002		2203	4300	6503	SO:0001819	synonymous_variant	51191	exon23			AGAAGCCATCAAC	AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.3048C>T	4.37:g.89427002C>T		Somatic	207	0	0		WXS	Illumina HiSeq	Phase_I	173	68	0.393064	NM_016323	B2RTQ1|Q69G20	Silent	SNP	ENST00000264350.3	37	CCDS3630.1																																																																																			.	.	none		0.408	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323	
ADORA1	134	hgsc.bcm.edu	37	1	203134499	203134499	+	Missense_Mutation	SNP	C	C	T	rs145647777	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:203134499C>T	ENST00000367236.4	+	3	1373	c.452C>T	c.(451-453)gCg>gTg	p.A151V	ADORA1_ENST00000367235.1_3'UTR|ADORA1_ENST00000309502.3_Missense_Mutation_p.A151V|ADORA1_ENST00000472535.1_3'UTR|ADORA1_ENST00000337894.4_Missense_Mutation_p.A151V	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor	151					activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	AATCTGAGTGCGGTGGAGCGG	0.622																																					p.A151V		Atlas-SNP	.											.	ADORA1	62	.	0			c.C452T						PASS	.	C	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	96.0	98.0	97.0		452,452	-2.5	0.0	1	dbSNP_134	97	3,8597	3.0+/-9.4	0,3,4297	no	missense,missense	ADORA1	NM_000674.2,NM_001048230.1	64,64	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	benign,benign	151/327,151/327	203134499	4,13002	2203	4300	6503	SO:0001583	missense	134	exon3			TGAGTGCGGTGGA	BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.452C>T	1.37:g.203134499C>T	ENSP00000356205:p.Ala151Val	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	128	60	0.46875	NM_001048230	A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	Missense_Mutation	SNP	ENST00000367236.4	37	CCDS1434.1	.	.	.	.	.	.	.	.	.	.	C	9.043	0.990226	0.18966	2.27E-4	3.49E-4	ENSG00000163485	ENST00000309502;ENST00000367236;ENST00000337894	T;T;T	0.36699	1.24;1.24;1.24	5.04	-2.45	0.06481	GPCR, rhodopsin-like superfamily (1);	1.079960	0.06915	N	0.808370	T	0.19005	0.0456	N	0.12471	0.22	0.09310	N	1	B;B;B	0.14438	0.007;0.01;0.0	B;B;B	0.12156	0.005;0.007;0.002	T	0.27400	-1.0075	10	0.30854	T	0.27	-2.041	7.6008	0.28075	0.4019:0.3808:0.0:0.2173	.	184;83;151	B7Z379;B7Z1L9;P30542	.;.;AA1R_HUMAN	V	151	ENSP00000308549:A151V;ENSP00000356205:A151V;ENSP00000338435:A151V	ENSP00000308549:A151V	A	+	2	0	ADORA1	201401122	0.001000	0.12720	0.029000	0.17559	0.521000	0.34408	0.081000	0.14823	-0.240000	0.09696	-0.538000	0.04264	GCG	C|1.000;T|0.000	0.000	strong		0.622	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100273.1	NM_000674	
CNTNAP4	85445	hgsc.bcm.edu	37	16	76350339	76350339	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr16:76350339T>G	ENST00000476707.1	+	1	263	c.124T>G	c.(124-126)Ttg>Gtg	p.L42V	CNTNAP4_ENST00000307431.8_Missense_Mutation_p.L38V|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.L14V|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.L38V			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	39	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TGTGTCTGCCTTGCCTCAGGC	0.483																																					p.L14V		Atlas-SNP	.											.	CNTNAP4	600	.	0			c.T40G						PASS	.						128.0	92.0	104.0					16																	76350339		2198	4300	6498	SO:0001583	missense	85445	exon2			TCTGCCTTGCCTC	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.124T>G	16.37:g.76350339T>G	ENSP00000417628:p.Leu42Val	Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	126	54	0.428571	NM_138994	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	T	17.04	3.287086	0.59867	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.97328	-4.34;-4.34;-4.34;-4.34	4.39	0.937	0.19494	Coagulation factor 5/8 C-terminal type domain (2);Galactose-binding domain-like (1);	0.000000	0.31554	N	0.007446	D	0.97704	0.9247	.	.	.	0.34919	D	0.748277	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.83275	0.983;0.983;0.982;0.996	D	0.97326	0.9947	9	0.87932	D	0	.	7.0566	0.25104	0.0:0.402:0.0:0.598	.	14;42;14;39	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	V	38;38;14;42	ENSP00000306893:L38V;ENSP00000439733:L38V;ENSP00000418741:L14V;ENSP00000417628:L42V	ENSP00000306893:L38V	L	+	1	2	CNTNAP4	74907840	0.986000	0.35501	0.932000	0.37286	0.951000	0.60555	2.133000	0.42093	0.040000	0.15660	0.533000	0.62120	TTG	.	.	none		0.483	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
ARMCX5	64860	hgsc.bcm.edu	37	X	101858511	101858511	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:101858511C>T	ENST00000604957.1	+	1	4064	c.1442C>T	c.(1441-1443)cCc>cTc	p.P481L	ARMCX5_ENST00000246174.2_Missense_Mutation_p.P481L|ARMCX5_ENST00000537008.1_Missense_Mutation_p.P481L|ARMCX5_ENST00000541409.1_Missense_Mutation_p.P481L|ARMCX5_ENST00000372742.1_Missense_Mutation_p.P481L|RP4-769N13.7_ENST00000602441.1_RNA|ARMCX5_ENST00000536530.1_Missense_Mutation_p.P481L|RP4-769N13.6_ENST00000476910.2_RNA	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	481										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						TTGGTTGCACCCTTTAACAAG	0.308																																					p.P481L		Atlas-SNP	.											.	ARMCX5	55	.	0			c.C1442T						PASS	.						55.0	52.0	53.0					X																	101858511		2203	4298	6501	SO:0001583	missense	64860	exon3			TTGCACCCTTTAA		CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.1442C>T	X.37:g.101858511C>T	ENSP00000474720:p.Pro481Leu	Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	78	4	0.0512821	NM_022838	B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Missense_Mutation	SNP	ENST00000604957.1	37	CCDS14500.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.497123	0.00159	.	.	ENSG00000125962	ENST00000246174;ENST00000537008;ENST00000541409;ENST00000536530;ENST00000372742	T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19	4.1	-1.49	0.08718	Armadillo-like helical (1);Armadillo-type fold (1);	0.671371	0.12373	N	0.474583	T	0.04634	0.0126	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37009	-0.9724	10	0.02654	T	1	1.1091	3.7361	0.08511	0.1792:0.3098:0.0:0.511	.	481	Q6P1M9	ARMX5_HUMAN	L	481	ENSP00000246174:P481L;ENSP00000439001:P481L;ENSP00000446385:P481L;ENSP00000445851:P481L;ENSP00000361827:P481L	ENSP00000246174:P481L	P	+	2	0	ARMCX5	101745167	0.000000	0.05858	0.000000	0.03702	0.173000	0.22820	-0.653000	0.05360	-0.442000	0.07190	-0.192000	0.12808	CCC	.	.	none		0.308	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469659.1	NM_022838	
ISOC2	79763	hgsc.bcm.edu	37	19	55966409	55966409	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:55966409C>T	ENST00000425675.2	-	5	544	c.484G>A	c.(484-486)Gaa>Aaa	p.E162K	ISOC2_ENST00000438389.2_Missense_Mutation_p.E92K|ISOC2_ENST00000085068.3_Missense_Mutation_p.E178K			Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2	162					protein destabilization (GO:0031648)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.E178K(1)		endometrium(1)|lung(4)|ovary(1)|stomach(1)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		ATGAGCCCTTCGCTGGTGGAG	0.647											OREG0025682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E178K		Atlas-SNP	.											ISOC2,colon,carcinoma,0,4	ISOC2	16	4	1	Substitution - Missense(1)	ovary(1)	c.G532A						scavenged	.						46.0	44.0	44.0					19																	55966409		2203	4300	6503	SO:0001583	missense	79763	exon5			GCCCTTCGCTGGT	AK027122	CCDS12925.1, CCDS46194.1, CCDS46195.1	19q13.42	2011-07-14			ENSG00000063241	ENSG00000063241			26278	protein-coding gene	gene with protein product		612928				17658461	Standard	NM_024710		Approved	FLJ23469	uc002qla.3	Q96AB3		ENST00000425675.2:c.484G>A	19.37:g.55966409C>T	ENSP00000401726:p.Glu162Lys	Somatic	276	0	0	1011	WXS	Illumina HiSeq	Phase_I	249	3	0.0120482	NM_024710	Q6ZN91|Q9H5G0	Missense_Mutation	SNP	ENST00000425675.2	37	CCDS46195.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314927	0.81358	.	.	ENSG00000063241	ENST00000085068;ENST00000425675;ENST00000438389	.	.	.	4.03	4.03	0.46877	Isochorismatase-like (3);	0.000000	0.85682	D	0.000000	D	0.84727	0.5536	H	0.95004	3.61	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.997	D;P;P	0.64237	0.923;0.891;0.778	D	0.89396	0.3692	9	0.87932	D	0	-16.8549	14.0504	0.64732	0.0:1.0:0.0:0.0	.	92;162;178	Q96AB3-3;Q96AB3;Q96AB3-2	.;ISOC2_HUMAN;.	K	178;162;92	.	ENSP00000085068:E178K	E	-	1	0	ISOC2	60658221	1.000000	0.71417	0.350000	0.25708	0.595000	0.36748	6.657000	0.74402	1.981000	0.57761	0.491000	0.48974	GAA	.	.	none		0.647	ISOC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453179.1	NM_024710	
DRD5	1816	hgsc.bcm.edu	37	4	9784550	9784550	+	Silent	SNP	G	G	A	rs2227844	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:9784550G>A	ENST00000304374.2	+	1	1293	c.897G>A	c.(895-897)tcG>tcA	p.S299S		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	299					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	AGACCCTGTCGGTGATCATGG	0.632																																					p.S299S		Atlas-SNP	.											DRD5,colon,carcinoma,0,2	DRD5	119	2	0			c.G897A						scavenged	.						55.0	52.0	53.0					4																	9784550		2203	4297	6500	SO:0001819	synonymous_variant	1816	exon1			CCTGTCGGTGATC	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.897G>A	4.37:g.9784550G>A		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	25	5	0.2	NM_000798	B2R9S3|Q8NEQ8	Silent	SNP	ENST00000304374.2	37	CCDS3405.1																																																																																			G|0.885;A|0.115	0.115	strong		0.632	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
TRPM6	140803	hgsc.bcm.edu	37	9	77473596	77473596	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:77473596T>G	ENST00000360774.1	-	2	339	c.102A>C	c.(100-102)aaA>aaC	p.K34N	RNU6-445P_ENST00000516949.1_RNA|TRPM6_ENST00000449912.2_Missense_Mutation_p.K29N|TRPM6_ENST00000361255.3_Missense_Mutation_p.K29N|TRPM6_ENST00000451710.3_Missense_Mutation_p.K34N|TRPM6_ENST00000376871.3_Missense_Mutation_p.K34N|TRPM6_ENST00000376864.4_Missense_Mutation_p.K34N|TRPM6_ENST00000359047.2_Missense_Mutation_p.K34N|TRPM6_ENST00000376872.3_Missense_Mutation_p.K34N	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	34					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TGTGAGGATTTTTTGAGCTGG	0.313																																					p.K34N		Atlas-SNP	.											.	TRPM6	377	.	0			c.A102C						PASS	.						96.0	95.0	95.0					9																	77473596		2201	4299	6500	SO:0001583	missense	140803	exon2			AGGATTTTTTGAG	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.102A>C	9.37:g.77473596T>G	ENSP00000354006:p.Lys34Asn	Somatic	199	0	0		WXS	Illumina HiSeq	Phase_I	73	46	0.630137	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.714639	0.68730	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870;ENST00000376864;ENST00000359047	T;T;T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	5.29	-0.0403	0.13872	.	0.107996	0.64402	D	0.000007	T	0.73442	0.3587	M	0.74546	2.27	0.40657	D	0.982093	D;D;D;P;D;P	0.76494	0.999;0.999;0.999;0.599;0.978;0.809	D;D;D;P;P;P	0.83275	0.994;0.994;0.996;0.802;0.71;0.535	T	0.71919	-0.4447	10	0.87932	D	0	.	8.3884	0.32514	0.0:0.3417:0.0:0.6583	.	34;34;34;34;34;29	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q96LV9;Q9BX84;Q9BX84-3	.;.;.;.;TRPM6_HUMAN;.	N	34;34;34;34;29;29;33;34;34	ENSP00000354006:K34N;ENSP00000407341:K34N;ENSP00000366068:K34N;ENSP00000366067:K34N;ENSP00000396672:K29N;ENSP00000354962:K29N;ENSP00000366060:K34N;ENSP00000351942:K34N	ENSP00000351942:K34N	K	-	3	2	TRPM6	76663416	1.000000	0.71417	0.992000	0.48379	0.853000	0.48598	1.298000	0.33412	-0.168000	0.10853	0.454000	0.30748	AAA	.	.	none		0.313	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
C8A	731	hgsc.bcm.edu	37	1	57378134	57378134	+	Missense_Mutation	SNP	G	G	T	rs373473282		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:57378134G>T	ENST00000361249.3	+	10	1535	c.1439G>T	c.(1438-1440)cGc>cTc	p.R480L		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	480	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)		p.R480L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						GAGGCCAAGCGCCAGAACCTG	0.622																																					p.R480L		Atlas-SNP	.											C8A,NS,carcinoma,0,1	C8A	103	1	1	Substitution - Missense(1)	lung(1)	c.G1439T						scavenged	.						59.0	62.0	61.0					1																	57378134		2203	4300	6503	SO:0001583	missense	731	exon10			CCAAGCGCCAGAA	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1439G>T	1.37:g.57378134G>T	ENSP00000354458:p.Arg480Leu	Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	140	3	0.0214286	NM_000562	A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	ENST00000361249.3	37	CCDS606.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595302	0.28445	.	.	ENSG00000157131	ENST00000361249	D	0.85258	-1.96	5.73	3.86	0.44501	Membrane attack complex component/perforin (MACPF) domain (3);	0.156847	0.53938	D	0.000057	D	0.82398	0.5028	M	0.73598	2.24	0.22226	N	0.999271	B	0.22276	0.067	B	0.26416	0.069	T	0.71866	-0.4463	10	0.39692	T	0.17	-1.8718	6.362	0.21433	0.0707:0.1315:0.6612:0.1366	.	480	P07357	CO8A_HUMAN	L	480	ENSP00000354458:R480L	ENSP00000354458:R480L	R	+	2	0	C8A	57150722	0.003000	0.15002	0.957000	0.39632	0.921000	0.55340	0.941000	0.29005	0.776000	0.33473	0.655000	0.94253	CGC	.	.	none		0.622	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562	
CRTC3	64784	hgsc.bcm.edu	37	15	91172567	91172567	+	Missense_Mutation	SNP	G	G	A	rs140158187	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:91172567G>A	ENST00000268184.6	+	11	1073	c.1069G>A	c.(1069-1071)Gca>Aca	p.A357T	RP11-387D10.2_ENST00000559531.1_RNA|CRTC3_ENST00000420329.2_Missense_Mutation_p.A357T			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	357					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			TGTTCCCAACGCATCTGCTCT	0.547			T	MAML2	salivary gland mucoepidermoid								G|||	11	0.00219649	0.0076	0.0	5008	,	,		20116	0.001		0.0	False		,,,				2504	0.0				p.A357T		Atlas-SNP	.		Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	.	CRTC3	47	.	0			c.G1069A						PASS	.	G	THR/ALA,THR/ALA	45,4351	47.5+/-82.1	0,45,2153	261.0	253.0	255.0		1069,1069	3.3	0.0	15	dbSNP_134	255	0,8596		0,0,4298	yes	missense,missense	CRTC3	NM_001042574.1,NM_022769.3	58,58	0,45,6451	AA,AG,GG		0.0,1.0237,0.3464	possibly-damaging,possibly-damaging	357/619,357/620	91172567	45,12947	2198	4298	6496	SO:0001583	missense	64784	exon11			CCCAACGCATCTG		CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.1069G>A	15.37:g.91172567G>A	ENSP00000268184:p.Ala357Thr	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	250	70	0.28	NM_022769	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	ENST00000268184.6	37	CCDS32331.1	5	0.0022893772893772895	4	0.008130081300813009	0	0.0	1	0.0017482517482517483	0	0.0	G	0.759	-0.770132	0.02974	0.010237	0.0	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.11495	2.77;2.77	5.18	3.32	0.38043	.	0.686881	0.14923	N	0.290567	T	0.05960	0.0155	L	0.54323	1.7	0.09310	N	1	B;B	0.16396	0.01;0.017	B;B	0.10450	0.002;0.005	T	0.45220	-0.9276	10	0.02654	T	1	-6.7224	6.7728	0.23602	0.2749:0.0:0.7251:0.0	.	357;357	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	T	321;357;357	ENSP00000268184:A357T;ENSP00000416573:A357T	ENSP00000268184:A357T	A	+	1	0	CRTC3	88973571	0.479000	0.25925	0.002000	0.10522	0.001000	0.01503	0.892000	0.28322	0.771000	0.33359	0.655000	0.94253	GCA	G|0.996;A|0.004	0.004	strong		0.547	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417716.2	NM_022769	
CLIP2	7461	hgsc.bcm.edu	37	7	73731906	73731906	+	Silent	SNP	C	C	T	rs148561130	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:73731906C>T	ENST00000395060.1	+	1	30	c.30C>T	c.(28-30)ccC>ccT	p.P10P	CLIP2_ENST00000223398.6_Silent_p.P10P|CLIP2_ENST00000361545.5_Silent_p.P10P			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	10						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						TGAAGCCCCCCGGCCGTGGGG	0.667													C|||	123	0.0245607	0.0	0.0432	5008	,	,		18799	0.0427		0.0298	False		,,,				2504	0.0204				p.P10P		Atlas-SNP	.											.	CLIP2	134	.	0			c.C30T						PASS	.	C	,	43,4361		0,43,2159	43.0	49.0	47.0		30,30	0.5	1.0	7	dbSNP_134	47	357,8239		6,345,3947	no	coding-synonymous,coding-synonymous	CLIP2	NM_003388.4,NM_032421.2	,	6,388,6106	TT,TC,CC		4.1531,0.9764,3.0769	,	10/1047,10/1012	73731906	400,12600	2202	4298	6500	SO:0001819	synonymous_variant	7461	exon2			GCCCCCCGGCCGT	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.30C>T	7.37:g.73731906C>T		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	163	35	0.214724	NM_032421	O14527|O43611	Silent	SNP	ENST00000395060.1	37	CCDS5569.1																																																																																			C|0.968;T|0.032	0.032	strong		0.667	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
DNAH1	25981	hgsc.bcm.edu	37	3	52398997	52398997	+	Missense_Mutation	SNP	G	G	A	rs377201322		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:52398997G>A	ENST00000420323.2	+	34	5741	c.5480G>A	c.(5479-5481)cGc>cAc	p.R1827H		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1827	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GAGGCCATCCGCGAGGCCTGC	0.622																																					p.R1827H		Atlas-SNP	.											DNAH1_ENST00000420323,NS,carcinoma,0,4	DNAH1	534	4	0			c.G5480A						PASS	.	G	HIS/ARG	0,4214		0,0,2107	67.0	71.0	70.0		5480	4.6	1.0	3		70	1,8439		0,1,4219	no	missense	DNAH1	NM_015512.4	29	0,1,6326	AA,AG,GG		0.0118,0.0,0.0079	possibly-damaging	1827/4266	52398997	1,12653	2107	4220	6327	SO:0001583	missense	25981	exon34			CCATCCGCGAGGC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5480G>A	3.37:g.52398997G>A	ENSP00000401514:p.Arg1827His	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	103	35	0.339806	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.926969	0.34002	0.0	1.18E-4	ENSG00000114841	ENST00000420323	T	0.44881	0.91	4.6	4.6	0.57074	.	0.000000	0.46758	D	0.000261	T	0.38134	0.1029	L	0.59912	1.85	0.50467	D	0.999871	B	0.29037	0.231	B	0.23852	0.049	T	0.31081	-0.9956	10	0.45353	T	0.12	.	11.9735	0.53078	0.0841:0.0:0.9159:0.0	.	1827	C9JXH6	.	H	1827	ENSP00000401514:R1827H	ENSP00000401514:R1827H	R	+	2	0	DNAH1	52374037	0.855000	0.29742	0.988000	0.46212	0.252000	0.25951	2.447000	0.44917	2.128000	0.65567	0.467000	0.42956	CGC	.	.	weak		0.622	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
OVGP1	5016	hgsc.bcm.edu	37	1	111957202	111957202	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:111957202G>T	ENST00000369732.3	-	11	1976	c.1921C>A	c.(1921-1923)Cgc>Agc	p.R641S		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	641					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GGAACAAAGCGGTTGTCAAAA	0.468																																					p.R641S		Atlas-SNP	.											OVGP1_ENST00000369728,NS,adenocarcinoma,0,2	OVGP1	177	2	0			c.C1921A						scavenged	.						81.0	81.0	81.0					1																	111957202		2203	4300	6503	SO:0001583	missense	5016	exon11			CAAAGCGGTTGTC	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1921C>A	1.37:g.111957202G>T	ENSP00000358747:p.Arg641Ser	Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	124	2	0.016129	NM_002557	A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	ENST00000369732.3	37	CCDS834.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.582714	0.28180	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000434331	T	0.05319	3.46	4.55	-3.31	0.04988	.	20.891500	0.00166	U	0.000006	T	0.01320	0.0043	N	0.22421	0.69	0.09310	N	0.999999	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.47774	-0.9091	10	0.66056	D	0.02	.	2.5271	0.04694	0.1822:0.418:0.2582:0.1416	.	641;705	Q12889;Q59HH5	OVGP1_HUMAN;.	S	641;705;449	ENSP00000358747:R641S	ENSP00000358743:R705S	R	-	1	0	OVGP1	111758725	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.065000	0.14466	-0.334000	0.08463	-0.283000	0.09986	CGC	.	.	none		0.468	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557	
FSHR	2492	hgsc.bcm.edu	37	2	49247297	49247297	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:49247297T>C	ENST00000406846.2	-	3	346	c.227A>G	c.(226-228)gAg>gGg	p.E76G	FSHR_ENST00000304421.4_Missense_Mutation_p.E76G|FSHR_ENST00000346173.3_Missense_Mutation_p.E76G	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	76					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	CTGAGAGATCTCTCTGTGGAG	0.413									Gonadal Dysgenesis, 46 XX																												p.E76G		Atlas-SNP	.											FSHR,NS,carcinoma,-1,1	FSHR	164	1	0			c.A227G						scavenged	.						199.0	206.0	204.0					2																	49247297		2203	4300	6503	SO:0001583	missense	2492	exon3	Familial Cancer Database		GAGATCTCTCTGT		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.227A>G	2.37:g.49247297T>C	ENSP00000384708:p.Glu76Gly	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	152	3	0.0197368	NM_181446	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	T	17.43	3.387418	0.61956	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000454032	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	5.3	5.3	0.74995	.	0.403945	0.24717	N	0.036163	D	0.92922	0.7748	M	0.82716	2.605	0.80722	D	1	P;D;D	0.76494	0.847;0.997;0.999	P;D;D	0.72338	0.56;0.954;0.977	D	0.93076	0.6487	9	.	.	.	.	11.5563	0.50750	0.0:0.0:0.0:1.0	.	76;76;76	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	G	76	ENSP00000384708:E76G;ENSP00000333908:E76G;ENSP00000306780:E76G;ENSP00000415504:E76G	.	E	-	2	0	FSHR	49100801	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	4.321000	0.59209	2.217000	0.71921	0.528000	0.53228	GAG	.	.	none		0.413	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2		
FKBP9	11328	hgsc.bcm.edu	37	7	33014908	33014908	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:33014908G>A	ENST00000242209.4	+	3	651	c.482G>A	c.(481-483)cGg>cAg	p.R161Q	FKBP9_ENST00000538336.1_Missense_Mutation_p.R214Q|AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000538443.1_Missense_Mutation_p.R23Q	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	161					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			AGTTGCCCTCGGACCATCCAG	0.473																																					p.R161Q		Atlas-SNP	.											FKBP9,brain,glioma,0,9	FKBP9	335	9	0			c.G482A						scavenged	.						99.0	87.0	91.0					7																	33014908		2203	4300	6503	SO:0001583	missense	11328	exon3			GCCCTCGGACCAT	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.482G>A	7.37:g.33014908G>A	ENSP00000242209:p.Arg161Gln	Somatic	130	2	0.0153846		WXS	Illumina HiSeq	Phase_I	159	2	0.0125786	NM_007270	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Missense_Mutation	SNP	ENST00000242209.4	37	CCDS5439.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720086	0.89205	.	.	ENSG00000122642	ENST00000242209;ENST00000538336;ENST00000538443	D;D;D	0.86164	-2.08;-2.08;-2.08	5.36	5.36	0.76844	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (1);	0.000000	0.85682	D	0.000000	D	0.92714	0.7684	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.92752	0.6217	10	0.56958	D	0.05	-4.2611	19.0957	0.93249	0.0:0.0:1.0:0.0	.	214;161;161	B7Z6H3;O95302;B3KQQ0	.;FKBP9_HUMAN;.	Q	161;214;23	ENSP00000242209:R161Q;ENSP00000439250:R214Q;ENSP00000437504:R23Q	ENSP00000242209:R161Q	R	+	2	0	FKBP9	32981433	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	9.809000	0.99208	2.524000	0.85096	0.650000	0.86243	CGG	.	.	none		0.473	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
RGL3	57139	hgsc.bcm.edu	37	19	11510960	11510960	+	Silent	SNP	G	G	T	rs201767762		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:11510960G>T	ENST00000380456.3	-	14	1561	c.1498C>A	c.(1498-1500)Cgg>Agg	p.R500R	RGL3_ENST00000393423.3_Silent_p.R500R|RGL3_ENST00000568628.1_5'Flank	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	500	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						TCAATGACCCGGGAGAGCCGG	0.607																																					p.R500R	GBM(174;751 2067 17998 27979 33959)	Atlas-SNP	.											RGL3_ENST00000380456,colon,carcinoma,0,2	RGL3	100	2	0			c.C1498A						scavenged	.						67.0	64.0	65.0					19																	11510960		2203	4300	6503	SO:0001819	synonymous_variant	57139	exon14			TGACCCGGGAGAG	BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.1498C>A	19.37:g.11510960G>T		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	145	2	0.0137931	NM_001035223	B5ME84|B7ZL22|Q0P6G0	Silent	SNP	ENST00000380456.3	37	CCDS32910.1																																																																																			.	.	alt		0.607	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421208.3	XM_290867	
BIRC2	329	hgsc.bcm.edu	37	11	102248352	102248352	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:102248352C>G	ENST00000227758.2	+	7	2891	c.1492C>G	c.(1492-1494)Caa>Gaa	p.Q498E	BIRC2_ENST00000527910.1_3'UTR|BIRC2_ENST00000530675.1_Missense_Mutation_p.Q449E|BIRC2_ENST00000532672.1_Missense_Mutation_p.Q477E	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	498	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		TATTATTAAACAAAAAACACA	0.338																																					p.Q498E		Atlas-SNP	.											.	BIRC2	51	.	0			c.C1492G						PASS	.						67.0	76.0	73.0					11																	102248352		2203	4296	6499	SO:0001583	missense	329	exon7			ATTAAACAAAAAA	L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.1492C>G	11.37:g.102248352C>G	ENSP00000227758:p.Gln498Glu	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	75	25	0.333333	NM_001256163	B4E026|Q16516|Q4TTG0	Missense_Mutation	SNP	ENST00000227758.2	37	CCDS8316.1	.	.	.	.	.	.	.	.	.	.	C	17.33	3.361246	0.61403	.	.	ENSG00000110330	ENST00000530675;ENST00000533742;ENST00000227758;ENST00000541741;ENST00000532672;ENST00000531259	T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8	5.83	5.83	0.93111	DEATH-like (2);Caspase Recruitment (3);	0.259553	0.46145	D	0.000306	T	0.33933	0.0880	L	0.46819	1.47	0.42351	D	0.992372	B	0.31931	0.347	B	0.40864	0.342	T	0.02829	-1.1105	10	0.30854	T	0.27	-21.752	20.1316	0.98000	0.0:1.0:0.0:0.0	.	498	Q13490	BIRC2_HUMAN	E	449;160;498;498;477;33	ENSP00000431723:Q449E;ENSP00000433851:Q160E;ENSP00000227758:Q498E;ENSP00000434979:Q477E;ENSP00000436741:Q33E	ENSP00000227758:Q498E	Q	+	1	0	BIRC2	101753562	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.898000	0.56281	2.766000	0.95052	0.650000	0.86243	CAA	.	.	none		0.338	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1	NM_001166	
VAV3	10451	hgsc.bcm.edu	37	1	108299925	108299925	+	Silent	SNP	C	C	T	rs17541972	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:108299925C>T	ENST00000370056.4	-	11	1318	c.1044G>A	c.(1042-1044)ccG>ccA	p.P348P	VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Silent_p.P348P|VAV3_ENST00000371846.4_Silent_p.P283P	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	348	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		CCTTCTCAGTCGGATCAGTGG	0.343													c|||	9	0.00179712	0.0015	0.0029	5008	,	,		16113	0.0		0.005	False		,,,				2504	0.0				p.P348P		Atlas-SNP	.											VAV3,NS,carcinoma,0,1	VAV3	176	1	0			c.G1044A						scavenged	.			2,4404	4.2+/-10.8	0,2,2201	155.0	147.0	149.0		1044	-9.7	0.0	1	dbSNP_123	149	63,8537	39.3+/-95.6	0,63,4237	no	coding-synonymous	VAV3	NM_006113.4		0,65,6438	TT,TC,CC		0.7326,0.0454,0.4998		348/848	108299925	65,12941	2203	4300	6503	SO:0001819	synonymous_variant	10451	exon11			CTCAGTCGGATCA	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1044G>A	1.37:g.108299925C>T		Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	158	4	0.0253165	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Silent	SNP	ENST00000370056.4	37	CCDS785.1	5	0.0022893772893772895	0	0.0	1	0.0027624309392265192	0	0.0	4	0.005277044854881266	c	0.068	-1.208785	0.01568	4.54E-4	0.007326	ENSG00000134215	ENST00000490388	.	.	.	5.83	-9.66	0.00534	.	.	.	.	.	T	0.14830	0.0358	.	.	.	0.32619	N	0.523584	.	.	.	.	.	.	T	0.06215	-1.0839	4	.	.	.	.	7.6701	0.28453	0.5888:0.0779:0.258:0.0752	rs17541972;rs17541972	.	.	.	Q	343	.	.	R	-	2	0	VAV3	108101448	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.548000	0.02184	-1.828000	0.01202	-1.119000	0.02030	CGA	C|0.996;T|0.004	0.004	strong		0.343	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
NAALADL2	254827	hgsc.bcm.edu	37	3	174814738	174814738	+	Missense_Mutation	SNP	G	G	A	rs9823911	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:174814738G>A	ENST00000454872.1	+	2	330	c.202G>A	c.(202-204)Ggt>Agt	p.G68S	NAALADL2_ENST00000473253.1_3'UTR|NAALADL2-AS3_ENST00000453180.1_RNA	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	68			G -> S (in dbSNP:rs9823911). {ECO:0000269|PubMed:15168106, ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		CCAGCTAGACGGTGCTGAGAA	0.463													A|||	1893	0.377995	0.2852	0.4179	5008	,	,		14330	0.4375		0.3926	False		,,,				2504	0.3988				p.G68S		Atlas-SNP	.											.	NAALADL2	86	.	0			c.G202A						PASS	.	A	SER/GLY	1024,2766		148,728,1019	77.0	73.0	74.0		202	1.0	0.0	3	dbSNP_119	74	3188,5052		627,1934,1559	yes	missense	NAALADL2	NM_207015.2	56	775,2662,2578	AA,AG,GG		38.6893,27.0185,35.0125	benign	68/796	174814738	4212,7818	1895	4120	6015	SO:0001583	missense	254827	exon2			CTAGACGGTGCTG		CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.202G>A	3.37:g.174814738G>A	ENSP00000404705:p.Gly68Ser	Somatic	209	0	0		WXS	Illumina HiSeq	Phase_I	196	38	0.193878	NM_207015	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	ENST00000454872.1	37	CCDS46960.1	828	0.3791208791208791	145	0.29471544715447157	161	0.4447513812154696	236	0.4125874125874126	286	0.37730870712401055	A	7.764	0.706087	0.15172	0.270185	0.386893	ENSG00000177694	ENST00000434257;ENST00000454872	T;T	0.30182	1.62;1.54	5.72	0.957	0.19613	.	0.757199	0.12476	N	0.465639	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46541	-0.9184	9	0.02654	T	1	-0.2147	5.8982	0.18951	0.4966:0.2423:0.2611:0.0	rs9823911;rs52835565;rs58142944;rs9823911	51;68	Q58DX5-2;Q58DX5	.;NADL2_HUMAN	S	51;68	ENSP00000409858:G51S;ENSP00000404705:G68S	ENSP00000409858:G51S	G	+	1	0	NAALADL2	176297432	0.007000	0.16637	0.018000	0.16275	0.704000	0.40688	0.523000	0.22925	-0.042000	0.13535	-0.269000	0.10298	GGT	G|0.642;A|0.358	0.358	strong		0.463	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015	
DMKN	93099	hgsc.bcm.edu	37	19	36002369	36002369	+	Missense_Mutation	SNP	C	C	T	rs56743379		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:36002369C>T	ENST00000339686.3	-	5	1038	c.862G>A	c.(862-864)Ggc>Agc	p.G288S	DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000424570.2_Missense_Mutation_p.G288S|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000451297.2_Missense_Mutation_p.G288S|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000440396.1_Missense_Mutation_p.G288S|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.G288S|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.G288S|DMKN_ENST00000414866.2_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	288	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			ccactgctgccaccactgctg	0.632																																					p.G288S		Atlas-SNP	.											DMKN_ENST00000424570,NS,carcinoma,0,3	DMKN	116	3	1	Deletion - In frame(1)	ovary(1)	c.G862A						scavenged	.						29.0	23.0	25.0					19																	36002369		2194	4290	6484	SO:0001583	missense	93099	exon5			TGCTGCCACCACT	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.862G>A	19.37:g.36002369C>T	ENSP00000342012:p.Gly288Ser	Somatic	55	2	0.0363636		WXS	Illumina HiSeq	Phase_I	55	5	0.0909091	NM_001126058	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	C	0.218	-1.030758	0.02045	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	2.68	-4.69	0.03299	.	1.453220	0.04292	N	0.345661	T	0.23210	0.0561	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.17465	0.0;0.0;0.0;0.0;0.022	B;B;B;B;B	0.15484	0.001;0.001;0.001;0.001;0.013	T	0.24799	-1.0150	10	0.09590	T	0.72	-0.9644	8.7065	0.34358	0.0:0.4947:0.0:0.5053	.	288;288;288;288;288	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;Q6E0U4	.;.;.;.;DMKN_HUMAN	S	288	ENSP00000342012:G288S;ENSP00000394908:G288S;ENSP00000415277:G288S;ENSP00000414743:G288S;ENSP00000388404:G288S;ENSP00000409513:G288S	ENSP00000342012:G288S	G	-	1	0	DMKN	40694209	.	.	0.000000	0.03702	0.022000	0.10575	.	.	-1.118000	0.02961	-0.959000	0.02639	GGC	.	.	none		0.632	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
C11orf68	83638	hgsc.bcm.edu	37	11	65685335	65685335	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:65685335C>T	ENST00000530188.1	-	1	496	c.351G>A	c.(349-351)caG>caA	p.Q117Q	DRAP1_ENST00000532933.1_5'Flank|DRAP1_ENST00000376991.2_5'Flank|DRAP1_ENST00000527119.1_5'Flank|C11orf68_ENST00000438576.2_Silent_p.Q159Q|DRAP1_ENST00000312515.2_5'Flank|C11orf68_ENST00000449692.3_Silent_p.Q158Q			Q9H3H3	CK068_HUMAN	chromosome 11 open reading frame 68	117							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(3)	4				READ - Rectum adenocarcinoma(159;0.166)		TGATGGCGAGCTGGCGCAGGG	0.687																																					p.Q159Q		Atlas-SNP	.											C11orf68_ENST00000438576,colon,carcinoma,-1,2	C11orf68	15	2	0			c.G477A						scavenged	.						45.0	42.0	43.0					11																	65685335		2201	4296	6497	SO:0001819	synonymous_variant	83638	exon2			GGCGAGCTGGCGC	AF073483	CCDS8122.2, CCDS44652.1	11q13.1	2012-08-09			ENSG00000175573	ENSG00000175573			28801	protein-coding gene	gene with protein product	"""basophilic leukemia-expressed protein"""					16511166	Standard	NM_031450		Approved	P5326, BLES03	uc001ogi.3	Q9H3H3	OTTHUMG00000157153	ENST00000530188.1:c.351G>A	11.37:g.65685335C>T		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	95	2	0.0210526	NM_001135635	J3KQG9|Q9BT13	Silent	SNP	ENST00000530188.1	37																																																																																				.	.	none		0.687	C11orf68-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000391173.1	NM_031450	
ZNF519	162655	hgsc.bcm.edu	37	18	14105585	14105585	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:14105585C>T	ENST00000590202.1	-	3	1106	c.954G>A	c.(952-954)aaG>aaA	p.K318K	ZNF519_ENST00000589498.1_Intron|RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	318					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						ACTTGAAAGGCTTCTCTCCAG	0.393																																					p.K318K		Atlas-SNP	.											ZNF519,NS,carcinoma,0,1	ZNF519	53	1	0			c.G954A						PASS	.						82.0	84.0	83.0					18																	14105585		2203	4300	6503	SO:0001819	synonymous_variant	162655	exon3			GAAAGGCTTCTCT	BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.954G>A	18.37:g.14105585C>T		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	86	4	0.0465116	NM_145287		Silent	SNP	ENST00000590202.1	37	CCDS32797.1																																																																																			.	.	none		0.393	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459037.1	NM_145287	
G2E3	55632	hgsc.bcm.edu	37	14	31066658	31066658	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:31066658T>G	ENST00000206595.6	+	7	715	c.561T>G	c.(559-561)ttT>ttG	p.F187L	G2E3_ENST00000544007.1_3'UTR|G2E3_ENST00000438909.2_Missense_Mutation_p.F141L|G2E3_ENST00000553504.1_Missense_Mutation_p.F217L	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	187					apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						TGTTTTTCTTTAGGTGTACAA	0.308																																					p.F187L		Atlas-SNP	.											.	G2E3	82	.	0			c.T561G						PASS	.						150.0	167.0	161.0					14																	31066658		2203	4299	6502	SO:0001583	missense	55632	exon7			TTTCTTTAGGTGT	AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.561T>G	14.37:g.31066658T>G	ENSP00000206595:p.Phe187Leu	Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	206	59	0.286408	NM_017769	Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Missense_Mutation	SNP	ENST00000206595.6	37	CCDS9638.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.396616	0.83011	.	.	ENSG00000092140	ENST00000206595;ENST00000438909;ENST00000553504	T;T;T	0.69040	-0.37;-0.37;-0.37	5.67	0.657	0.17850	Zinc finger, RING-type (1);Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.73345	0.3575	L	0.55834	1.745	0.48341	D	0.999638	D;D	0.69078	0.973;0.997	P;D	0.75020	0.786;0.985	T	0.70513	-0.4851	10	0.48119	T	0.1	-22.4009	10.3259	0.43793	0.0:0.2489:0.0:0.7511	.	141;187	B4DIF9;Q7L622	.;G2E3_HUMAN	L	187;141;217	ENSP00000206595:F187L;ENSP00000391068:F141L;ENSP00000451653:F217L	ENSP00000206595:F187L	F	+	3	2	G2E3	30136409	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.630000	0.24553	0.170000	0.19704	0.482000	0.46254	TTT	.	.	none		0.308	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276613.2	NM_017769	
OR5H1	26341	hgsc.bcm.edu	37	3	97851661	97851661	+	Missense_Mutation	SNP	G	G	T	rs200721525	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:97851661G>T	ENST00000354565.2	+	1	120	c.120G>T	c.(118-120)atG>atT	p.M40I	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M40I(4)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TCACCATCATGGGGAATCTTG	0.413																																					p.M40I		Atlas-SNP	.											OR5H1,NS,carcinoma,0,7	OR5H1	71	7	4	Substitution - Missense(4)	endometrium(2)|kidney(2)	c.G120T						scavenged	.						46.0	50.0	48.0					3																	97851661		2173	4250	6423	SO:0001583	missense	26341	exon1			CATCATGGGGAAT	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.120G>T	3.37:g.97851661G>T	ENSP00000346575:p.Met40Ile	Somatic	676	4	0.00591716		WXS	Illumina HiSeq	Phase_I	823	10	0.0121507	NM_001005338		Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	G	3.467	-0.108676	0.06924	.	.	ENSG00000231192	ENST00000354565	T	0.00433	7.43	3.63	2.75	0.32379	.	0.578292	0.14348	N	0.325303	T	0.00178	0.0005	N	0.02842	-0.48	0.20764	N	0.999858	B	0.06786	0.001	B	0.04013	0.001	T	0.29882	-0.9997	10	0.33940	T	0.23	.	8.5896	0.33679	0.1182:0.0:0.8818:0.0	.	40	A6NKK0	OR5H1_HUMAN	I	40	ENSP00000346575:M40I	ENSP00000346575:M40I	M	+	3	0	OR5H1	99334351	0.002000	0.14202	0.678000	0.29963	0.118000	0.20060	-0.111000	0.10807	0.729000	0.32403	0.195000	0.17529	ATG	G|0.982;T|0.018	0.018	strong		0.413	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
CIB1	10519	hgsc.bcm.edu	37	15	90770838	90770838	+	IGR	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:90770838G>A	ENST00000328649.6	-	0	1247				SEMA4B_ENST00000379122.3_Missense_Mutation_p.A575T|SEMA4B_ENST00000332496.6_Missense_Mutation_p.A580T|SEMA4B_ENST00000411539.2_Missense_Mutation_p.A580T	NM_006384.3	NP_006375.2	Q99828	CIB1_HUMAN	calcium and integrin binding 1 (calmyrin)						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to growth factor stimulus (GO:0071363)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to tumor necrosis factor (GO:0071356)|cytoplasmic microtubule organization (GO:0031122)|double-strand break repair (GO:0006302)|endomitotic cell cycle (GO:0007113)|extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|platelet formation (GO:0030220)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of male germ cell proliferation (GO:2000256)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell division (GO:0051302)|regulation of cell proliferation (GO:0042127)|response to ischemia (GO:0002931)|spermatid development (GO:0007286)|thrombopoietin-mediated signaling pathway (GO:0038163)	cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|protein anchor (GO:0043495)|Ras GTPase binding (GO:0017016)			lung(1)|prostate(1)	2	Melanoma(11;0.00551)|Lung NSC(78;0.0141)|all_lung(78;0.0303)		BRCA - Breast invasive adenocarcinoma(143;0.00269)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			CCTTTGCAGCGCGTCTTCGGT	0.607																																					p.A580T		Atlas-SNP	.											.	SEMA4B	51	.	0			c.G1738A						PASS	.						68.0	73.0	71.0					15																	90770838		2021	4190	6211	SO:0001628	intergenic_variant	10509	exon14			TGCAGCGCGTCTT	U82226	CCDS10360.1, CCDS73781.1	15q25.3-q26	2013-01-10			ENSG00000185043	ENSG00000185043		"""EF-hand domain containing"""	16920	protein-coding gene	gene with protein product		602293				9030514, 10826701	Standard	NM_006384		Approved	SIP2-28, CALMYRIN, CIB, KIP	uc031qtq.1	Q99828	OTTHUMG00000149808		15.37:g.90770838G>A		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	77	17	0.220779	NM_020210	B5BU40|H6WJF3|O00693|O00735|Q6IB49|Q96J54|Q99971	Missense_Mutation	SNP	ENST00000328649.6	37	CCDS10360.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.682933	0.47991	.	.	ENSG00000185033	ENST00000332496;ENST00000379122;ENST00000411539	T;T;T	0.21361	2.01;2.21;2.01	5.38	-1.92	0.07618	.	1.464410	0.03864	N	0.274414	T	0.06280	0.0162	N	0.00538	-1.39	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.29731	-1.0002	10	0.29301	T	0.29	.	7.3344	0.26601	0.4842:0.1203:0.3956:0.0	.	575;580;575	Q9NPR2-2;Q2NL81;Q9NPR2	.;.;SEM4B_HUMAN	T	580;575;580	ENSP00000332204:A580T;ENSP00000368417:A575T;ENSP00000394720:A580T	ENSP00000332204:A580T	A	+	1	0	SEMA4B	88571842	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.873000	0.04214	-0.596000	0.05821	-0.416000	0.06073	GCG	.	.	none		0.607	CIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313419.1		
CBX6	23466	hgsc.bcm.edu	37	22	39263079	39263079	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr22:39263079C>T	ENST00000407418.3	-	5	497	c.374G>A	c.(373-375)cGc>cAc	p.R125H	CBX6_ENST00000216083.6_Missense_Mutation_p.R107H			O95503	CBX6_HUMAN	chromobox homolog 6	125					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)	single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(58;0.04)					ACGGTGGCAGCGGCGGATGTC	0.697																																					p.R125H		Atlas-SNP	.											.	CBX6	26	.	0			c.G374A						PASS	.						10.0	9.0	9.0					22																	39263079		1978	3955	5933	SO:0001583	missense	23466	exon5			TGGCAGCGGCGGA		CCDS13980.1	22q13.1	2013-04-23			ENSG00000183741	ENSG00000183741			1556	protein-coding gene	gene with protein product							Standard	NM_014292		Approved		uc003awl.3	O95503	OTTHUMG00000150456	ENST00000407418.3:c.374G>A	22.37:g.39263079C>T	ENSP00000384490:p.Arg125His	Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	30	10	0.333333	NM_014292	A8KAH0|Q96EM5	Missense_Mutation	SNP	ENST00000407418.3	37	CCDS13980.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.044789	0.93685	.	.	ENSG00000183741	ENST00000407418;ENST00000216083	.	.	.	4.13	4.13	0.48395	.	0.317552	0.20986	U	0.082124	T	0.67249	0.2873	L	0.34521	1.04	0.58432	D	0.999992	D	0.89917	1.0	D	0.83275	0.996	T	0.71820	-0.4477	9	0.72032	D	0.01	.	16.5945	0.84792	0.0:1.0:0.0:0.0	.	125	O95503	CBX6_HUMAN	H	125;107	.	ENSP00000216083:R107H	R	-	2	0	CBX6	37593025	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.822000	0.75277	2.138000	0.66242	0.407000	0.27541	CGC	.	.	none		0.697	CBX6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318190.1	NM_014292	
FAM60A	58516	hgsc.bcm.edu	37	12	31448253	31448253	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:31448253C>G	ENST00000337682.4	-	3	511	c.143G>C	c.(142-144)cGt>cCt	p.R48P	FAM60A_ENST00000395766.1_5'UTR|FAM60A_ENST00000542983.1_5'UTR|FAM60A_ENST00000539409.1_Intron|FAM60A_ENST00000454658.2_Missense_Mutation_p.R48P	NM_001135812.1	NP_001129284.1	Q9NP50	FA60A_HUMAN	family with sequence similarity 60, member A	48					negative regulation of cell migration (GO:0030336)	Sin3 complex (GO:0016580)				large_intestine(1)|lung(2)	3	all_cancers(9;5.22e-13)|all_epithelial(9;4e-13)|all_lung(12;1.2e-11)|Lung NSC(12;2.17e-09)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0207)|Lung SC(12;0.0592)|Esophageal squamous(101;0.162)					GTCTCCTGAACGAGTCTCATG	0.388																																					p.R48P		Atlas-SNP	.											FAM60A,NS,carcinoma,-1,1	FAM60A	16	1	0			c.G143C						scavenged	.						73.0	69.0	71.0					12																	31448253		2203	4300	6503	SO:0001583	missense	58516	exon4			CCTGAACGAGTCT	AF212220	CCDS8723.1	12p11.21	2012-11-30	2005-04-07	2005-04-07	ENSG00000139146	ENSG00000139146			30702	protein-coding gene	gene with protein product		615027	"""chromosome 12 open reading frame 14"""	C12orf14		11042152, 22984288, 22865885	Standard	NM_021238		Approved	TERA	uc001rke.3	Q9NP50	OTTHUMG00000168586	ENST00000337682.4:c.143G>C	12.37:g.31448253C>G	ENSP00000337477:p.Arg48Pro	Somatic	332	3	0.00903614		WXS	Illumina HiSeq	Phase_I	279	5	0.0179211	NM_021238	D3DUV8|Q9BSZ8	Missense_Mutation	SNP	ENST00000337682.4	37	CCDS8723.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748018	0.69533	.	.	ENSG00000139146	ENST00000337682;ENST00000454658;ENST00000398170;ENST00000539004;ENST00000543615	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.79782	0.4505	M	0.81112	2.525	0.80722	D	1	P;D	0.76494	0.903;0.999	B;D	0.68039	0.307;0.955	D	0.83646	0.0153	10	0.87932	D	0	.	17.8807	0.88840	0.0:1.0:0.0:0.0	.	48;89	Q9NP50;B7Z287	FA60A_HUMAN;.	P	48;48;89;48;48	ENSP00000337477:R48P;ENSP00000393279:R48P;ENSP00000443881:R48P;ENSP00000437363:R48P	ENSP00000337477:R48P	R	-	2	0	FAM60A	31339520	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.639000	0.83342	2.285000	0.76669	0.561000	0.74099	CGT	.	.	none		0.388	FAM60A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400347.1	NM_021238	
RFX4	5992	hgsc.bcm.edu	37	12	107103190	107103190	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:107103190C>T	ENST00000392842.1	+	9	1330	c.916C>T	c.(916-918)Cga>Tga	p.R306*	RFX4_ENST00000357881.4_Nonsense_Mutation_p.R315*|RFX4_ENST00000229387.5_Nonsense_Mutation_p.R212*|RP11-144F15.1_ENST00000551505.1_Intron	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	306					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R306*(1)|p.R315*(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						AGAAAACTTGCGAAACATCAA	0.398																																					p.R315X		Atlas-SNP	.											RFX4_ENST00000357881,NS,carcinoma,0,5	RFX4	218	5	2	Substitution - Nonsense(2)	large_intestine(2)	c.C943T						scavenged	.						86.0	75.0	79.0					12																	107103190		2203	4300	6503	SO:0001587	stop_gained	5992	exon9			AACTTGCGAAACA	AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.916C>T	12.37:g.107103190C>T	ENSP00000376585:p.Arg306*	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	56	2	0.0357143	NM_001206691	A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Nonsense_Mutation	SNP	ENST00000392842.1	37	CCDS9106.1	.	.	.	.	.	.	.	.	.	.	C	39	7.428677	0.98279	.	.	ENSG00000111783	ENST00000392842;ENST00000357881;ENST00000266774;ENST00000551640;ENST00000229387	.	.	.	5.59	4.68	0.58851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-8.515	15.4125	0.74937	0.1443:0.8557:0.0:0.0	.	.	.	.	X	306;315;315;251;212	.	ENSP00000229387:R212X	R	+	1	2	RFX4	105627320	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	2.987000	0.49378	1.294000	0.44707	0.650000	0.86243	CGA	.	.	none		0.398	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402707.1	NM_032491	
GGNBP2	79893	hgsc.bcm.edu	37	17	34912947	34912947	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:34912947G>T	ENST00000304718.4	+	4	515	c.199G>T	c.(199-201)Gat>Tat	p.D67Y		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	67					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TAAGCAACAGGATCTAAGTAT	0.443																																					p.D67Y		Atlas-SNP	.											.	GGNBP2	72	.	0			c.G199T						PASS	.						193.0	178.0	183.0					17																	34912947		2203	4300	6503	SO:0001583	missense	79893	exon4			CAACAGGATCTAA	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.199G>T	17.37:g.34912947G>T	ENSP00000307617:p.Asp67Tyr	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	90	30	0.333333	NM_024835	B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	37	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274508	0.80580	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.58119	0.2100	L	0.36672	1.1	0.80722	D	1	P;P	0.52692	0.955;0.891	P;P	0.48141	0.549;0.568	T	0.64166	-0.6471	9	0.87932	D	0	-6.3477	18.5109	0.90916	0.0:0.0:1.0:0.0	.	67;67	Q9H3C7;Q9H3C7-3	GGNB2_HUMAN;.	Y	67	.	ENSP00000307617:D67Y	D	+	1	0	GGNBP2	31987060	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.991000	0.93514	2.376000	0.81061	0.579000	0.79373	GAT	.	.	none		0.443	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	
THBS2	7058	hgsc.bcm.edu	37	6	169632988	169632988	+	Silent	SNP	G	G	A	rs148676859		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:169632988G>A	ENST00000366787.3	-	12	2025	c.1776C>T	c.(1774-1776)gaC>gaT	p.D592D	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	592					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CACCCACCTCGTCCAGGTCCT	0.687													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15698	0.0		0.0	False		,,,				2504	0.0				p.D592D	Esophageal Squamous(91;219 1934 18562 44706)	Atlas-SNP	.											.	THBS2	230	.	0			c.C1776T						PASS	.	G		1,4399		0,1,2199	39.0	41.0	41.0		1776	-6.7	0.8	6	dbSNP_134	41	0,8600		0,0,4300	no	coding-synonymous	THBS2	NM_003247.2		0,1,6499	AA,AG,GG		0.0,0.0227,0.0077		592/1173	169632988	1,12999	2200	4300	6500	SO:0001819	synonymous_variant	7058	exon12			CACCTCGTCCAGG		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1776C>T	6.37:g.169632988G>A		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	82	20	0.243902	NM_003247	A6H8N1|A7E232|Q5RI52	Silent	SNP	ENST00000366787.3	37	CCDS34574.1																																																																																			G|1.000;A|0.000	0.000	weak		0.687	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
SACS	26278	hgsc.bcm.edu	37	13	23908805	23908805	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr13:23908805A>G	ENST00000382292.3	-	9	9483	c.9210T>C	c.(9208-9210)gtT>gtC	p.V3070V	SACS_ENST00000402364.1_Silent_p.V2320V|SACS_ENST00000382298.3_Silent_p.V3070V			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3070					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CACAGTTATAAACCAAGTTGA	0.343																																					p.V3070V		Atlas-SNP	.											.	SACS	871	.	0			c.T9210C						PASS	.						97.0	91.0	93.0					13																	23908805		2203	4300	6503	SO:0001819	synonymous_variant	26278	exon10			GTTATAAACCAAG	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.9210T>C	13.37:g.23908805A>G		Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	117	46	0.393162	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	CCDS9300.2																																																																																			.	.	none		0.343	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
OR5H1	26341	hgsc.bcm.edu	37	3	97852220	97852220	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:97852220A>G	ENST00000354565.2	+	1	679	c.679A>G	c.(679-681)Aaa>Gaa	p.K227E	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						CGCAATCTTAAAAAAGAAATC	0.338																																					p.K227E		Atlas-SNP	.											.	OR5H1	71	.	0			c.A679G						PASS	.						73.0	81.0	78.0					3																	97852220		2202	4299	6501	SO:0001583	missense	26341	exon1			ATCTTAAAAAAGA	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.679A>G	3.37:g.97852220A>G	ENSP00000346575:p.Lys227Glu	Somatic	255	0	0		WXS	Illumina HiSeq	Phase_I	211	19	0.0900474	NM_001005338		Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	A	3.686	-0.064561	0.07273	.	.	ENSG00000231192	ENST00000354565	T	0.00169	8.63	3.57	3.57	0.40892	GPCR, rhodopsin-like superfamily (1);	0.264153	0.26915	N	0.021841	T	0.00356	0.0011	M	0.92784	3.345	0.09310	N	1	B	0.10296	0.003	B	0.23574	0.047	T	0.28870	-1.0030	10	0.87932	D	0	.	10.1009	0.42504	1.0:0.0:0.0:0.0	.	227	A6NKK0	OR5H1_HUMAN	E	227	ENSP00000346575:K227E	ENSP00000346575:K227E	K	+	1	0	OR5H1	99334910	0.000000	0.05858	0.030000	0.17652	0.006000	0.05464	0.423000	0.21313	1.481000	0.48307	0.164000	0.16699	AAA	.	.	none		0.338	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
ANKRD33	341405	hgsc.bcm.edu	37	12	52284881	52284881	+	Intron	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:52284881T>C	ENST00000340970.4	+	6	1035				ANKRD33_ENST00000547119.1_3'UTR|ANKRD33_ENST00000301190.6_Missense_Mutation_p.L384P|ANKRD33_ENST00000538991.1_Intron			Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.0969)		AGCAAGTGCCTTCAGTGGCTA	0.647																																					p.L384P		Atlas-SNP	.											.	ANKRD33	33	.	0			c.T1151C						PASS	.						62.0	54.0	57.0					12																	52284881		2203	4300	6503	SO:0001627	intron_variant	341405	exon5			AGTGCCTTCAGTG		CCDS8815.1, CCDS44892.1	12q13.13	2013-01-10	2005-01-07	2005-01-07		ENSG00000167612		"""Ankyrin repeat domain containing"""	13788	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 7"""	C12orf7		20026326	Standard	NM_182608		Approved	DKFZp686O1689, PANKY	uc001rzd.3	Q7Z3H0	OTTHUMG00000169506	ENST00000340970.4:c.665-89T>C	12.37:g.52284881T>C		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	118	6	0.0508475	NM_182608	Q0VAA7|Q5K619|Q5K621|Q5K622|Q5K623|Q5K624|Q6ZUN0	Missense_Mutation	SNP	ENST00000340970.4	37	CCDS44892.1	.	.	.	.	.	.	.	.	.	.	T	2.706	-0.269834	0.05716	.	.	ENSG00000167612	ENST00000301190	T	0.24908	1.83	4.48	2.53	0.30540	.	0.645195	0.15887	N	0.239728	T	0.13756	0.0333	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22521	-1.0214	9	0.26408	T	0.33	.	4.1627	0.10291	0.184:0.6209:0.0:0.1951	.	384	Q7Z3H0-2	.	P	384	ENSP00000301190:L384P	ENSP00000301190:L384P	L	+	2	0	ANKRD33	50571148	0.246000	0.23909	0.912000	0.35992	0.589000	0.36550	1.831000	0.39141	0.606000	0.29965	-0.337000	0.08149	CTT	.	.	none		0.647	ANKRD33-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404515.1	NM_182608	
ZBTB24	9841	hgsc.bcm.edu	37	6	109787112	109787112	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:109787112G>T	ENST00000230122.3	-	7	2203	c.2036C>A	c.(2035-2037)cCg>cAg	p.P679Q	MICAL1_ENST00000368952.4_5'UTR	NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	679					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		GGGTGGTGGCGGACCAGGCTC	0.537																																					p.P679Q		Atlas-SNP	.											ZBTB24,colon,adenoma,+1,1	ZBTB24	64	1	0			c.C2036A						scavenged	.						100.0	97.0	98.0					6																	109787112		2203	4300	6503	SO:0001583	missense	9841	exon7			GGTGGCGGACCAG	AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.2036C>A	6.37:g.109787112G>T	ENSP00000230122:p.Pro679Gln	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	89	2	0.0224719	NM_014797	Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	ENST00000230122.3	37	CCDS34509.1	.	.	.	.	.	.	.	.	.	.	G	6.784	0.513573	0.12944	.	.	ENSG00000112365	ENST00000230122	T	0.09817	2.94	5.42	2.58	0.30949	.	1.240340	0.05807	N	0.613348	T	0.01800	0.0057	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.44997	-0.9291	10	0.72032	D	0.01	-0.0725	4.1508	0.10237	0.0781:0.1199:0.4652:0.3368	.	679	O43167	ZBT24_HUMAN	Q	679	ENSP00000230122:P679Q	ENSP00000230122:P679Q	P	-	2	0	ZBTB24	109893805	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.187000	0.09656	0.858000	0.35431	-0.158000	0.13435	CCG	.	.	none		0.537	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041758.1	NM_014797	
NCL	4691	hgsc.bcm.edu	37	2	232326352	232326352	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:232326352T>C	ENST00000322723.4	-	3	752	c.512A>G	c.(511-513)gAa>gGa	p.E171G	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	171	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CGCTGCTGGTTCAATTtcatc	0.502																																					p.E171G		Atlas-SNP	.											NCL,NS,carcinoma,-1,1	NCL	80	1	0			c.A512G						scavenged	.						402.0	257.0	306.0					2																	232326352		2203	4300	6503	SO:0001583	missense	4691	exon3			GCTGGTTCAATTT		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.512A>G	2.37:g.232326352T>C	ENSP00000318195:p.Glu171Gly	Somatic	225	0	0		WXS	Illumina HiSeq	Phase_I	220	4	0.0181818	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	ENST00000322723.4	37	CCDS33397.1	.	.	.	.	.	.	.	.	.	.	T	15.56	2.869085	0.51588	.	.	ENSG00000115053	ENST00000322723;ENST00000392033;ENST00000322732;ENST00000454824;ENST00000417652	T;T;T	0.68025	2.05;-0.3;-0.3	5.34	5.34	0.76211	.	0.484707	0.24730	N	0.036062	T	0.62588	0.2440	L	0.54323	1.7	0.25572	N	0.986886	B	0.26635	0.155	B	0.25405	0.06	T	0.60136	-0.7322	10	0.59425	D	0.04	-18.3082	13.3181	0.60419	0.0:0.0:0.0:1.0	.	171	P19338	NUCL_HUMAN	G	171;113;171;155;155	ENSP00000318195:E171G;ENSP00000401620:E155G;ENSP00000392747:E155G	ENSP00000318195:E171G	E	-	2	0	NCL	232034596	1.000000	0.71417	0.754000	0.31244	0.589000	0.36550	3.207000	0.51106	2.035000	0.60131	0.454000	0.30748	GAA	.	.	none		0.502	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
ZBTB20	26137	hgsc.bcm.edu	37	3	114069130	114069130	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:114069130C>T	ENST00000474710.1	-	4	1973	c.1795G>A	c.(1795-1797)Gta>Ata	p.V599I	ZBTB20_ENST00000481632.1_Missense_Mutation_p.V526I|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20_ENST00000471418.1_Missense_Mutation_p.V526I|ZBTB20_ENST00000464560.1_Missense_Mutation_p.V526I|ZBTB20_ENST00000462705.1_Missense_Mutation_p.V526I|ZBTB20_ENST00000393785.2_Missense_Mutation_p.V526I|ZBTB20_ENST00000357258.3_Missense_Mutation_p.V526I|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20-AS1_ENST00000496219.1_RNA	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	599						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CCTGTGTGTACGAACATGTGC	0.557																																					p.V599I	NSCLC(69;748 1344 9802 11203 30933)	Atlas-SNP	.											.	ZBTB20	157	.	0			c.G1795A						PASS	.						156.0	154.0	155.0					3																	114069130		2203	4300	6503	SO:0001583	missense	26137	exon4			TGTGTACGAACAT	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1795G>A	3.37:g.114069130C>T	ENSP00000419153:p.Val599Ile	Somatic	252	0	0		WXS	Illumina HiSeq	Phase_I	323	87	0.26935	NM_001164342	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121532	0.37436	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.19105	3.17;3.17;3.17;3.17;2.17;3.17;3.17	6.03	6.03	0.97812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.26955	0.0660	N	0.11000	0.08	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.06356	-1.0831	10	0.07644	T	0.81	.	20.5753	0.99366	0.0:1.0:0.0:0.0	.	599	Q9HC78	ZBT20_HUMAN	I	526;526;526;526;599;526;526	ENSP00000420324:V526I;ENSP00000377375:V526I;ENSP00000418092:V526I;ENSP00000419902:V526I;ENSP00000419153:V599I;ENSP00000349803:V526I;ENSP00000417307:V526I	ENSP00000349803:V526I	V	-	1	0	ZBTB20	115551820	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	7.482000	0.81143	2.868000	0.98415	0.557000	0.71058	GTA	.	.	none		0.557	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642	
CST11	140880	hgsc.bcm.edu	37	20	23433317	23433317	+	Silent	SNP	C	C	T	rs34604301	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr20:23433317C>T	ENST00000377009.3	-	1	165	c.132G>A	c.(130-132)gcG>gcA	p.A44A	CST11_ENST00000377007.3_Silent_p.A44A	NM_130794.1	NP_570612.1	Q9H112	CST11_HUMAN	cystatin 11	44					defense response to bacterium (GO:0042742)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			kidney(2)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	14	Colorectal(13;0.0431)|Lung NSC(19;0.235)					AGCTGTCCTTCGCATAGTTTT	0.478													C|||	22	0.00439297	0.0	0.0072	5008	,	,		21958	0.0		0.0159	False		,,,				2504	0.001				p.A44A		Atlas-SNP	.											CST11,colon,carcinoma,0,1	CST11	27	1	0			c.G132A						scavenged	.	C	,	14,4392	21.2+/-45.6	0,14,2189	202.0	177.0	185.0		132,132	-1.6	0.0	20	dbSNP_126	185	120,8480	61.7+/-123.6	0,120,4180	no	coding-synonymous,coding-synonymous	CST11	NM_080830.2,NM_130794.1	,	0,134,6369	TT,TC,CC		1.3953,0.3177,1.0303	,	44/104,44/139	23433317	134,12872	2203	4300	6503	SO:0001819	synonymous_variant	140880	exon1			GTCCTTCGCATAG	AL096677	CCDS13154.1, CCDS13155.1	20p11.21	2012-08-14			ENSG00000125831	ENSG00000125831			15959	protein-coding gene	gene with protein product		609731		CST8L		20565543	Standard	NM_080830		Approved	dJ322G13.6, CTES2	uc002wtf.1	Q9H112	OTTHUMG00000032060	ENST00000377009.3:c.132G>A	20.37:g.23433317C>T		Somatic	236	0	0		WXS	Illumina HiSeq	Phase_I	186	3	0.016129	NM_130794	Q0VAF2|Q0VAF3|Q8WXU5|Q8WXU6|Q9H113	Silent	SNP	ENST00000377009.3	37	CCDS13155.1																																																																																			C|0.991;T|0.009	0.009	strong		0.478	CST11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078314.1	NM_130794	
MDGA2	161357	hgsc.bcm.edu	37	14	47530650	47530650	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:47530650A>C	ENST00000399232.2	-	7	1484	c.1120T>G	c.(1120-1122)Ttt>Gtt	p.F374V	MDGA2_ENST00000357362.3_Missense_Mutation_p.F145V|MDGA2_ENST00000426342.1_Missense_Mutation_p.F145V|MDGA2_ENST00000439988.3_Missense_Mutation_p.F443V	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	374	Ig-like 4.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CCATTTTTAAACCAACTAAAT	0.413																																					p.F443V		Atlas-SNP	.											.	MDGA2	470	.	0			c.T1327G						PASS	.						128.0	115.0	119.0					14																	47530650		1882	4103	5985	SO:0001583	missense	161357	exon7			TTTTAAACCAACT	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1120T>G	14.37:g.47530650A>C	ENSP00000382178:p.Phe374Val	Somatic	203	0	0		WXS	Illumina HiSeq	Phase_I	228	53	0.232456	NM_001113498	F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.91|13.91	2.376692|2.376692	0.42105|0.42105	.|.	.|.	ENSG00000139915|ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362|ENST00000554762	T;T;T;T|.	0.46063|.	0.88;0.88;0.88;0.88|.	5.96|5.96	4.81|4.81	0.61882|0.61882	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.000000|.	0.53938|.	U|.	0.000054|.	T|T	0.59662|0.59662	0.2210|0.2210	L|L	0.46670|0.46670	1.46|1.46	0.80722|0.80722	D|D	1|1	P|.	0.41848|.	0.763|.	P|.	0.49421|.	0.61|.	T|T	0.55490|0.55490	-0.8133|-0.8133	10|5	0.42905|.	T|.	0.14|.	.|.	12.4319|12.4319	0.55578|0.55578	0.8597:0.1403:0.0:0.0|0.8597:0.1403:0.0:0.0	.|.	374|.	Q7Z553|.	MDGA2_HUMAN|.	V|G	374;145;443;145|148	ENSP00000400011:F374V;ENSP00000405456:F145V;ENSP00000382178:F443V;ENSP00000349925:F145V|.	ENSP00000349925:F145V|.	F|V	-|-	1|2	0|0	MDGA2|MDGA2	46600400|46600400	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.511000|5.511000	0.67024|0.67024	1.061000|1.061000	0.40601|0.40601	0.533000|0.533000	0.62120|0.62120	TTT|GTT	.	.	none		0.413	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830	
ADAMTS9	56999	hgsc.bcm.edu	37	3	64536662	64536662	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:64536662C>A	ENST00000498707.1	-	31	5117	c.4775G>T	c.(4774-4776)gGg>gTg	p.G1592V	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.G1564V	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1592	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		ACAGCGTGCCCCATGCACCTC	0.542																																					p.G1592V		Atlas-SNP	.											.	ADAMTS9	206	.	0			c.G4775T						PASS	.						209.0	173.0	185.0					3																	64536662		2203	4300	6503	SO:0001583	missense	56999	exon31			CGTGCCCCATGCA	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4775G>T	3.37:g.64536662C>A	ENSP00000418735:p.Gly1592Val	Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	208	52	0.25	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.705|7.705	0.693825|0.693825	0.15039|0.15039	.|.	.|.	ENSG00000163638|ENSG00000163638	ENST00000295903;ENST00000498707|ENST00000481060	T;T|T	0.65178|0.65549	-0.14;-0.14|-0.16	5.83|5.83	3.0|3.0	0.34707|0.34707	.|.	0.407807|0.407807	0.28203|0.28203	N|N	0.016217|0.016217	T|T	0.55737|0.55737	0.1939|0.1939	L|L	0.41415|0.41415	1.275|1.275	0.09310|0.09310	N|N	0.999994|0.999994	B;B;B|.	0.26258|.	0.003;0.145;0.001|.	B;B;B|.	0.27380|.	0.016;0.079;0.016|.	T|T	0.51236|0.51236	-0.8731|-0.8731	10|8	0.62326|0.72032	D|D	0.03|0.01	.|.	7.4549|7.4549	0.27261|0.27261	0.0:0.6035:0.2603:0.1362|0.0:0.6035:0.2603:0.1362	.|.	1564;1592;1592|.	B7ZVX9;Q9P2N4-1;Q9P2N4|.	.;.;ATS9_HUMAN|.	V|W	1564;1592|648	ENSP00000295903:G1564V;ENSP00000418735:G1592V|ENSP00000417521:G648W	ENSP00000295903:G1564V|ENSP00000417521:G648W	G|G	-|-	2|1	0|0	ADAMTS9|ADAMTS9	64511702|64511702	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.011000|0.011000	0.07611|0.07611	1.480000|1.480000	0.35464|0.35464	0.345000|0.345000	0.23873|0.23873	0.585000|0.585000	0.79938|0.79938	GGG|GGG	.	.	none		0.542	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
OR51A4	401666	hgsc.bcm.edu	37	11	4967768	4967768	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:4967768T>G	ENST00000380373.2	-	1	588	c.563A>C	c.(562-564)aAg>aCg	p.K188T	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	188						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACAGGCCAACTTCATGACATC	0.413																																					p.K188T		Atlas-SNP	.											.	OR51A4	73	.	0			c.A563C						PASS	.						72.0	70.0	70.0					11																	4967768		2196	4284	6480	SO:0001583	missense	401666	exon1			GCCAACTTCATGA	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.563A>C	11.37:g.4967768T>G	ENSP00000369731:p.Lys188Thr	Somatic	905	0	0		WXS	Illumina HiSeq	Phase_I	805	200	0.248447	NM_001005329		Missense_Mutation	SNP	ENST00000380373.2	37	CCDS31367.1	.	.	.	.	.	.	.	.	.	.	T	11.76	1.734892	0.30774	.	.	ENSG00000205497	ENST00000380373	T	0.39997	1.05	3.44	1.13	0.20643	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.64583	0.2611	M	0.89163	3.01	0.09310	N	1	D	0.67145	0.996	D	0.72625	0.978	T	0.51356	-0.8716	9	0.87932	D	0	.	7.4109	0.27017	0.0:0.2083:0.0:0.7917	.	188	Q8NGJ6	O51A4_HUMAN	T	188	ENSP00000369731:K188T	ENSP00000369731:K188T	K	-	2	0	OR51A4	4924344	0.000000	0.05858	0.695000	0.30226	0.651000	0.38670	0.338000	0.19858	0.509000	0.28195	-0.627000	0.03993	AAG	.	.	none		0.413	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329	
TRDMT1	1787	hgsc.bcm.edu	37	10	17201224	17201224	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:17201224C>T	ENST00000377799.3	-	7	511	c.464G>A	c.(463-465)gGc>gAc	p.G155D	TRDMT1_ENST00000377766.5_Nonsense_Mutation_p.W83*|TRDMT1_ENST00000457442.2_Missense_Mutation_p.G74D|TRDMT1_ENST00000351358.4_Missense_Mutation_p.G109D|TRDMT1_ENST00000452380.2_5'UTR|TRDMT1_ENST00000488990.1_Intron|TRDMT1_ENST00000358282.7_3'UTR|TRDMT1_ENST00000412821.3_Missense_Mutation_p.G131D	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1	155	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)	p.G155V(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	ATTTGGAATGCCAAGCTGTAA	0.363																																					p.G155D		Atlas-SNP	.											TRDMT1,colon,carcinoma,-1,4	TRDMT1	46	4	1	Substitution - Missense(1)	ovary(1)	c.G464A						scavenged	.						59.0	62.0	61.0					10																	17201224		2203	4300	6503	SO:0001583	missense	1787	exon7			GGAATGCCAAGCT	AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.464G>A	10.37:g.17201224C>T	ENSP00000367030:p.Gly155Asp	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	135	4	0.0296296	NM_004412	B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	Missense_Mutation	SNP	ENST00000377799.3	37	CCDS7114.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	18.80|18.80|18.80	3.701076|3.701076|3.701076	0.68501|0.68501|0.68501	.|.|.	.|.|.	ENSG00000107614|ENSG00000107614|ENSG00000107614	ENST00000436968|ENST00000377799;ENST00000412821;ENST00000351358;ENST00000457442;ENST00000525762|ENST00000377766;ENST00000313936	.|T;T;T;T;T|.	.|0.75260|.	.|-0.92;-0.92;-0.92;-0.92;-0.92|.	5.64|5.64|5.64	4.74|4.74|4.74	0.60224|0.60224|0.60224	.|.|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|.	0.80633|0.80633|.	0.4660|0.4660|.	M|M|M	0.89601|0.89601|0.89601	3.045|3.045|3.045	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D;D;D;D;D|.	.|0.89917|.	.|1.0;1.0;0.999;1.0;0.999;0.999|.	.|D;D;D;D;D;D|.	.|0.97110|.	.|1.0;0.999;0.999;0.998;0.999;0.999|.	D|D|.	0.84294|0.84294|.	0.0501|0.0501|.	5|10|.	.|0.66056|.	.|D|.	.|0.02|.	-12.4056|-12.4056|-12.4056	14.5118|14.5118|14.5118	0.67791|0.67791|0.67791	0.0:0.9283:0.0:0.0717|0.0:0.9283:0.0:0.0717|0.0:0.9283:0.0:0.0717	.|.|.	.|84;74;155;109;131;155|.	.|B7Z1Y7;E7EMI8;Q6ICS7;O14717-3;O14717-2;O14717|.	.|.;.;.;.;.;TRDMT_HUMAN|.	T|D|X	63|155;131;109;74;113|83;88	.|ENSP00000367030:G155D;ENSP00000409354:G131D;ENSP00000324328:G109D;ENSP00000412256:G74D;ENSP00000431476:G113D|.	.|ENSP00000324328:G109D|.	A|G|W	-|-|-	1|2|3	0|0|0	TRDMT1|TRDMT1|TRDMT1	17241230|17241230|17241230	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.982000|0.982000|0.982000	0.71751|0.71751|0.71751	7.058000|7.058000|7.058000	0.76676|0.76676|0.76676	1.373000|1.373000|1.373000	0.46208|0.46208|0.46208	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GCA|GGC|TGG	.	.	none		0.363	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047024.3	NM_004412	
PMS2	5395	hgsc.bcm.edu	37	7	6022454	6022454	+	Splice_Site	SNP	C	C	T	rs267608172		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:6022454C>T	ENST00000265849.7	-	12	2280		c.e12+1		PMS2_ENST00000406569.3_Intron|PMS2_ENST00000382321.4_Splice_Site|PMS2_ENST00000441476.2_Splice_Site|PMS2_ENST00000469652.1_5'Flank	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)						ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)	p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		AACACACTCACGCTATGAGCC	0.517			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												.		Atlas-SNP	.	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	PMS2,NS,lymphoid_neoplasm,0,1	PMS2	88	1	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.2174+1G>A	GRCh37	CS083966	PMS2	S		scavenged	.						20.0	21.0	21.0					7																	6022454		2200	4295	6495	SO:0001630	splice_region_variant	5395	exon13	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CACTCACGCTATG		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.2174+1G>A	7.37:g.6022454C>T		Somatic	513	0	0		WXS	Illumina HiSeq	Phase_I	650	5	0.00769231	NM_000535	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Splice_Site	SNP	ENST00000265849.7	37	CCDS5343.1	.	.	.	.	.	.	.	.	.	.	-	16.11	3.030109	0.54790	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000382321;ENST00000441476	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.058	0.89368	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PMS2	5988980	1.000000	0.71417	0.015000	0.15790	0.005000	0.04900	7.772000	0.85439	2.347000	0.79759	0.555000	0.69702	.	.	.	weak		0.517	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	Intron
HMGCR	3156	hgsc.bcm.edu	37	5	74655105	74655105	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:74655105T>G	ENST00000287936.4	+	17	2424	c.2268T>G	c.(2266-2268)atT>atG	p.I756M	HMGCR_ENST00000343975.5_Missense_Mutation_p.I703M|HMGCR_ENST00000511206.1_Missense_Mutation_p.I756M	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	756	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	CAGCAAACATTGTCACCGCCA	0.458																																					p.I756M		Atlas-SNP	.											.	HMGCR	53	.	0			c.T2268G						PASS	.						102.0	95.0	97.0					5																	74655105		2203	4300	6503	SO:0001583	missense	3156	exon17			AAACATTGTCACC		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.2268T>G	5.37:g.74655105T>G	ENSP00000287936:p.Ile756Met	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	64	30	0.46875	NM_000859	B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	37	CCDS4027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.10|13.10	2.136618|2.136618	0.37728|0.37728	.|.	.|.	ENSG00000113161|ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975;ENST00000429286|ENST00000509085	T;T;T|.	0.48836|.	0.8;0.8;0.8|.	5.11|5.11	-5.61|-5.61	0.02489|0.02489	Hydroxymethylglutaryl-CoA reductase, class I/II, catalytic domain (1);Hydroxymethylglutaryl-CoA reductase, class I/II, substrate-binding (1);|.	0.054543|.	0.64402|.	D|.	0.000001|.	T|T	0.64681|0.64681	0.2620|0.2620	L|L	0.61218|0.61218	1.895|1.895	0.51482|0.51482	D|D	0.999929|0.999929	P;B;P;P|.	0.48089|.	0.642;0.261;0.905;0.793|.	B;B;P;P|.	0.48552|.	0.405;0.183;0.581;0.486|.	T|T	0.67162|0.67162	-0.5740|-0.5740	10|5	0.38643|.	T|.	0.18|.	-9.0541|-9.0541	14.1509|14.1509	0.65384|0.65384	0.0:0.5119:0.0:0.4881|0.0:0.5119:0.0:0.4881	.|.	756;133;703;756|.	B2R649;B4DSB1;P04035-2;P04035|.	.;.;.;HMDH_HUMAN|.	M|W	756;687;756;703;133|86	ENSP00000426745:I756M;ENSP00000287936:I756M;ENSP00000340816:I703M|.	ENSP00000287936:I756M|.	I|L	+|+	3|2	3|0	HMGCR|HMGCR	74690861|74690861	0.000000|0.000000	0.05858|0.05858	0.675000|0.675000	0.29917|0.29917	0.895000|0.895000	0.52256|0.52256	-3.976000|-3.976000	0.00321|0.00321	-0.947000|-0.947000	0.03673|0.03673	-0.250000|-0.250000	0.11733|0.11733	ATT|TTG	.	.	none		0.458	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
TLDC1	57707	hgsc.bcm.edu	37	16	84516214	84516214	+	Missense_Mutation	SNP	G	G	A	rs140439420	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr16:84516214G>A	ENST00000343629.6	-	6	1243	c.1061C>T	c.(1060-1062)aCg>aTg	p.T354M	TLDC1_ENST00000535580.1_Missense_Mutation_p.T327M	NM_020947.3	NP_065998.3	Q6P9B6	TLDC1_HUMAN	TBC/LysM-associated domain containing 1	354	TLD.					lysosomal membrane (GO:0005765)											GTTCGGGATCGTCTGCTGTCC	0.577													G|||	10	0.00199681	0.0	0.0058	5008	,	,		19898	0.0		0.003	False		,,,				2504	0.0031				p.T354M		Atlas-SNP	.											KIAA1609,NS,carcinoma,0,1	KIAA1609	39	1	0			c.C1061T						scavenged	.	G	MET/THR	7,4393	12.9+/-30.5	0,7,2193	187.0	151.0	163.0		1061	5.4	1.0	16	dbSNP_134	163	37,8563	25.7+/-73.6	0,37,4263	yes	missense	KIAA1609	NM_020947.3	81	0,44,6456	AA,AG,GG		0.4302,0.1591,0.3385	probably-damaging	354/457	84516214	44,12956	2200	4300	6500	SO:0001583	missense	57707	exon6			GGGATCGTCTGCT	AB046829	CCDS32498.1	16q24.1	2013-03-14	2013-03-14	2013-03-14	ENSG00000140950	ENSG00000140950			29325	protein-coding gene	gene with protein product	"""TLD domain containing 1"""		"""KIAA1609"""	KIAA1609		10997877	Standard	NM_020947		Approved		uc002fib.3	Q6P9B6	OTTHUMG00000176739	ENST00000343629.6:c.1061C>T	16.37:g.84516214G>A	ENSP00000343635:p.Thr354Met	Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	171	3	0.0175439	NM_020947	Q8IZ64|Q9HCG3|Q9NTE8	Missense_Mutation	SNP	ENST00000343629.6	37	CCDS32498.1	4	0.0018315018315018315	0	0.0	2	0.0055248618784530384	0	0.0	2	0.002638522427440633	G	18.60	3.658288	0.67586	0.001591	0.004302	ENSG00000140950	ENST00000343629;ENST00000545792;ENST00000535580	T;T	0.11930	2.9;2.73	5.37	5.37	0.77165	TLDc (2);	0.050042	0.85682	D	0.000000	T	0.38134	0.1029	M	0.88775	2.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	T	0.52019	-0.8631	10	0.87932	D	0	-45.4035	18.1009	0.89505	0.0:0.0:1.0:0.0	.	327;354	F5GWS3;Q6P9B6	.;K1609_HUMAN	M	354;22;327	ENSP00000343635:T354M;ENSP00000441997:T327M	ENSP00000343635:T354M	T	-	2	0	KIAA1609	83073715	1.000000	0.71417	1.000000	0.80357	0.256000	0.26092	7.338000	0.79269	2.516000	0.84829	0.655000	0.94253	ACG	G|0.996;A|0.004	0.004	strong		0.577	TLDC1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433421.1	NM_020947	
MICB	4277	hgsc.bcm.edu	37	6	31473513	31473513	+	Missense_Mutation	SNP	C	C	T	rs2240858	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:31473513C>T	ENST00000252229.6	+	2	269	c.190C>T	c.(190-192)Cgc>Tgc	p.R64C	MICB_ENST00000399150.3_Missense_Mutation_p.R64C|MICB_ENST00000538442.1_Missense_Mutation_p.R32C	NM_005931.3	NP_005922.2			MHC class I polypeptide-related sequence B											NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	13						CAGGCAGAAACGCAGGGCAAA	0.572													c|||	4	0.000798722	0.0	0.0014	5008	,	,		19845	0.0		0.0	False		,,,				2504	0.0031				p.R64C		Atlas-SNP	.											MICB,rectum,carcinoma,0,1	MICB	26	1	0			c.C190T						scavenged	.						72.0	76.0	75.0					6																	31473513		1286	2551	3837	SO:0001583	missense	4277	exon2			CAGAAACGCAGGG		CCDS43449.1, CCDS75422.1, CCDS75423.1	6p21.3	2013-01-11			ENSG00000204516	ENSG00000204516		"""Immunoglobulin superfamily / C1-set domain containing"""	7091	protein-coding gene	gene with protein product		602436				8022771	Standard	NM_005931		Approved	PERB11.2	uc003ntn.4	Q29980	OTTHUMG00000031074	ENST00000252229.6:c.190C>T	6.37:g.31473513C>T	ENSP00000252229:p.Arg64Cys	Somatic	133	1	0.0075188		WXS	Illumina HiSeq	Phase_I	137	3	0.0218978	NM_005931		Missense_Mutation	SNP	ENST00000252229.6	37	CCDS43449.1	.	.	.	.	.	.	.	.	.	.	N	3.472	-0.107702	0.06924	.	.	ENSG00000204516	ENST00000538442;ENST00000399150;ENST00000252229	T;T;T	0.01887	4.58;4.58;4.58	2.35	-4.71	0.03279	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.688810	0.03892	U	0.278939	T	0.00440	0.0014	N	0.12422	0.21	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.10450	0.002;0.004;0.005	T	0.47548	-0.9109	10	0.42905	T	0.14	.	2.3151	0.04197	0.1242:0.3189:0.378:0.1788	rs2240858	32;64;64	F5H7Q8;A2AC57;Q29980	.;.;MICB_HUMAN	C	32;64;64	ENSP00000442345:R32C;ENSP00000382103:R64C;ENSP00000252229:R64C	ENSP00000252229:R64C	R	+	1	0	MICB	31581492	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.334000	0.02665	-1.193000	0.02688	-3.051000	0.00069	CGC	C|0.500;T|0.500	0.500	weak		0.572	MICB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076102.3	NM_005931	
LILRB3	11025	hgsc.bcm.edu	37	19	54725980	54725980	+	Silent	SNP	G	G	A	rs150024950	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:54725980G>A	ENST00000391750.1	-	5	514	c.378C>T	c.(376-378)ctC>ctT	p.L126L	LILRA6_ENST00000391735.3_Intron|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRB3_ENST00000469273.1_5'Flank|LILRB3_ENST00000245620.9_Silent_p.L126L|LILRA6_ENST00000270464.5_Intron|LILRB3_ENST00000407860.2_Silent_p.L126L|LILRB3_ENST00000346401.6_Silent_p.L126L|LILRB3_ENST00000424807.1_Silent_p.L126L|LILRA6_ENST00000419410.2_Intron|LILRA6_ENST00000440558.2_Intron			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	126	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.L126L(1)		endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCAGGGCTGAGAGGGTGGGTT	0.582													.|||	570	0.113818	0.0507	0.1037	5008	,	,		13484	0.0486		0.1471	False		,,,				2504	0.2393				p.L126L		Atlas-SNP	.											LILRB3,NS,carcinoma,0,1	LILRB3	67	1	1	Substitution - coding silent(1)	kidney(1)	c.C378T						scavenged	.						55.0	36.0	42.0					19																	54725980		2117	3871	5988	SO:0001819	synonymous_variant	11025	exon4			GGCTGAGAGGGTG	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.378C>T	19.37:g.54725980G>A		Somatic	141	2	0.0141844		WXS	Illumina HiSeq	Phase_I	115	2	0.0173913	NM_006864	C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	ENST00000391750.1	37	CCDS33105.1																																																																																			G|0.947;A|0.053	0.053	strong		0.582	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
FAM149B1	317662	hgsc.bcm.edu	37	10	74953319	74953319	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:74953319A>G	ENST00000242505.6	+	5	684	c.510A>G	c.(508-510)gaA>gaG	p.E170E	Y_RNA_ENST00000362331.1_RNA	NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	170										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						CTTCATATGAAACAACCTTGT	0.368																																					p.E170E		Atlas-SNP	.											FAM149B1,NS,carcinoma,+2,1	FAM149B1	26	1	0			c.A510G						scavenged	.						165.0	125.0	137.0					10																	74953319		692	1591	2283	SO:0001819	synonymous_variant	317662	exon5			ATATGAAACAACC	AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.510A>G	10.37:g.74953319A>G		Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	120	2	0.0166667	NM_173348	Q9Y2I0	Silent	SNP	ENST00000242505.6	37	CCDS44435.1	.	.	.	.	.	.	.	.	.	.	A	2.807	-0.247867	0.05867	.	.	ENSG00000138286	ENST00000372955	.	.	.	4.76	0.0834	0.14433	.	.	.	.	.	T	0.53753	0.1816	.	.	.	0.38223	D	0.940807	.	.	.	.	.	.	T	0.49735	-0.8908	4	.	.	.	-6.3937	7.562	0.27857	0.4754:0.0:0.5246:0.0	.	.	.	.	R	111	.	.	K	+	2	0	FAM149B1	74623325	0.092000	0.21681	0.559000	0.28332	0.468000	0.32798	0.151000	0.16283	-0.029000	0.13827	0.482000	0.46254	AAA	.	.	none		0.368	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145438.1	NM_173348	
NMUR1	10316	hgsc.bcm.edu	37	2	232389989	232389989	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:232389989G>A	ENST00000305141.4	-	3	1179	c.1046C>T	c.(1045-1047)tCg>tTg	p.S349L		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	349					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GTTGGCCGCCGAGCCCAGGTA	0.647																																					p.S349L		Atlas-SNP	.											NMUR1,right_lower_lobe,carcinoma,+1,1	NMUR1	46	1	0			c.C1046T						scavenged	.						71.0	67.0	68.0					2																	232389989		2203	4300	6503	SO:0001583	missense	10316	exon3			GCCGCCGAGCCCA	AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.1046C>T	2.37:g.232389989G>A	ENSP00000305877:p.Ser349Leu	Somatic	225	0	0		WXS	Illumina HiSeq	Phase_I	196	2	0.0102041	NM_006056	O43664|Q7LDP6|Q8NE20	Missense_Mutation	SNP	ENST00000305141.4	37	CCDS2486.1	.	.	.	.	.	.	.	.	.	.	G	17.84	3.487791	0.64074	.	.	ENSG00000171596	ENST00000305141	T	0.79554	-1.28	4.79	2.98	0.34508	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.92766	0.7700	H	0.98965	4.385	0.53688	D	0.999972	D	0.89917	1.0	D	0.85130	0.997	D	0.91805	0.5455	10	0.72032	D	0.01	-9.2674	8.6406	0.33974	0.0793:0.0:0.7692:0.1515	.	349	Q9HB89	NMUR1_HUMAN	L	349	ENSP00000305877:S349L	ENSP00000305877:S349L	S	-	2	0	NMUR1	232098233	1.000000	0.71417	0.370000	0.25965	0.333000	0.28666	4.733000	0.62036	0.641000	0.30601	0.555000	0.69702	TCG	.	.	none		0.647	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
TMC1	117531	hgsc.bcm.edu	37	9	75355045	75355045	+	Missense_Mutation	SNP	A	A	C	rs377607548		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:75355045A>C	ENST00000297784.5	+	9	913	c.373A>C	c.(373-375)Aaa>Caa	p.K125Q	TMC1_ENST00000396237.3_Missense_Mutation_p.K125Q|TMC1_ENST00000340019.3_Missense_Mutation_p.K125Q	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	125	Arg/Asp/Glu/Lys-rich (highly charged).				auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						GGAGGCAAAAAAATTTGTGAG	0.368																																					p.K125Q	Pancreas(75;173 1345 14232 34245 43413)	Atlas-SNP	.											.	TMC1	87	.	0			c.A373C						PASS	.						72.0	74.0	73.0					9																	75355045		2203	4300	6503	SO:0001583	missense	117531	exon9			GCAAAAAAATTTG	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.373A>C	9.37:g.75355045A>C	ENSP00000297784:p.Lys125Gln	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	60	20	0.333333	NM_138691	A8MVZ2|B1AM91	Missense_Mutation	SNP	ENST00000297784.5	37	CCDS6643.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.218045	0.39201	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000538054;ENST00000542143;ENST00000396237	T;T;T	0.17528	2.27;2.27;2.27	5.62	4.5	0.54988	.	0.378995	0.26079	N	0.026471	T	0.07908	0.0198	N	0.11560	0.145	0.28108	N	0.931139	B;B	0.15930	0.001;0.015	B;B	0.12156	0.001;0.007	T	0.13335	-1.0513	10	0.31617	T	0.26	-29.0715	5.1393	0.14950	0.8494:0.0:0.1506:0.0	.	92;125	A4FUA6;Q8TDI8	.;TMC1_HUMAN	Q	125;125;92;92;92;119;125	ENSP00000297784:K125Q;ENSP00000341433:K125Q;ENSP00000379538:K125Q	ENSP00000297784:K125Q	K	+	1	0	TMC1	74544865	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.709000	0.25734	2.133000	0.65898	0.533000	0.62120	AAA	.	.	weak		0.368	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1		
KLHL14	57565	hgsc.bcm.edu	37	18	30257201	30257201	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:30257201T>G	ENST00000359358.4	-	8	2119	c.1681A>C	c.(1681-1683)Agt>Cgt	p.S561R		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	561						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						CCAGGGCCACTTCGACCCTCC	0.468																																					p.S561R		Atlas-SNP	.											.	KLHL14	92	.	0			c.A1681C						PASS	.						168.0	140.0	150.0					18																	30257201		2203	4300	6503	SO:0001583	missense	57565	exon8			GGCCACTTCGACC	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1681A>C	18.37:g.30257201T>G	ENSP00000352314:p.Ser561Arg	Somatic	188	0	0		WXS	Illumina HiSeq	Phase_I	273	56	0.205128	NM_020805	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	37	CCDS32813.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.720055	0.89205	.	.	ENSG00000197705	ENST00000359358	T	0.80994	-1.44	5.73	5.73	0.89815	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.84379	0.5459	L	0.35288	1.05	0.80722	D	1	D	0.67145	0.996	D	0.77557	0.99	D	0.83414	0.0029	10	0.34782	T	0.22	.	16.3197	0.82945	0.0:0.0:0.0:1.0	.	561	Q9P2G3	KLH14_HUMAN	R	561	ENSP00000352314:S561R	ENSP00000352314:S561R	S	-	1	0	KLHL14	28511199	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.648000	0.83479	2.302000	0.77476	0.533000	0.62120	AGT	.	.	none		0.468	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1		
MAGEB16	139604	hgsc.bcm.edu	37	X	35821008	35821008	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:35821008C>T	ENST00000399989.1	+	2	974	c.695C>T	c.(694-696)aCg>aTg	p.T232M	MAGEB16_ENST00000399992.1_Missense_Mutation_p.T264M|MAGEB16_ENST00000399988.1_Missense_Mutation_p.T232M|MAGEB16_ENST00000399987.1_Missense_Mutation_p.T232M|MAGEB16_ENST00000399985.1_Missense_Mutation_p.T232M	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	232	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						CTGAATTTGACGGGAGTATAT	0.498																																					p.T232M		Atlas-SNP	.											.	MAGEB16	64	.	0			c.C695T						PASS	.						66.0	63.0	64.0					X																	35821008		2174	4283	6457	SO:0001583	missense	139604	exon2			ATTTGACGGGAGT		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.695C>T	X.37:g.35821008C>T	ENSP00000382871:p.Thr232Met	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	83	52	0.626506	NM_001099921	A8MU30	Missense_Mutation	SNP	ENST00000399989.1	37	CCDS43927.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.023161	0.00414	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.04156	3.69;3.69;3.69;3.69;3.69	3.13	-2.0	0.07433	.	0.556178	0.18983	N	0.125826	T	0.00875	0.0029	N	0.00275	-1.725	0.09310	N	1	B	0.25441	0.126	B	0.15484	0.013	T	0.41928	-0.9481	10	0.02654	T	1	.	7.8393	0.29389	0.0:0.3154:0.0:0.6846	.	232	A2A368	MAGBG_HUMAN	M	232;264;232;232;232	ENSP00000382870:T232M;ENSP00000382874:T264M;ENSP00000382869:T232M;ENSP00000382871:T232M;ENSP00000382867:T232M	ENSP00000382867:T232M	T	+	2	0	MAGEB16	35730929	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.451000	0.00466	-0.690000	0.05142	0.521000	0.50471	ACG	.	.	none		0.498	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1		
NPTX2	4885	hgsc.bcm.edu	37	7	98257799	98257799	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:98257799C>T	ENST00000265634.3	+	5	1319	c.1154C>T	c.(1153-1155)gCa>gTa	p.A385V		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	385	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GTCCTTCGCGCACAAGAAATT	0.567																																					p.A385V		Atlas-SNP	.											NPTX2,NS,carcinoma,+1,1	NPTX2	45	1	0			c.C1154T						scavenged	.						99.0	78.0	85.0					7																	98257799		2203	4300	6503	SO:0001583	missense	4885	exon5			TTCGCGCACAAGA		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.1154C>T	7.37:g.98257799C>T	ENSP00000265634:p.Ala385Val	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	154	3	0.0194805	NM_002523	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	37	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331804	0.60853	.	.	ENSG00000106236	ENST00000265634	T	0.06608	3.28	5.94	5.94	0.96194	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.094221	0.85682	D	0.000000	T	0.05731	0.0150	N	0.14661	0.345	0.52099	D	0.999947	B	0.32653	0.379	B	0.28385	0.089	T	0.45205	-0.9277	10	0.56958	D	0.05	-15.4807	19.3514	0.94389	0.0:1.0:0.0:0.0	.	385	P47972	NPTX2_HUMAN	V	385	ENSP00000265634:A385V	ENSP00000265634:A385V	A	+	2	0	NPTX2	98095735	0.643000	0.27269	0.048000	0.18961	0.741000	0.42261	3.303000	0.51858	2.826000	0.97356	0.561000	0.74099	GCA	.	.	none		0.567	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
KIF1B	23095	hgsc.bcm.edu	37	1	10363223	10363223	+	Intron	SNP	C	C	T	rs151053483		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:10363223C>T	ENST00000377086.1	+	22	2317				KIF1B_ENST00000377093.4_Silent_p.D660D|KIF1B_ENST00000377081.1_Intron|KIF1B_ENST00000377083.1_Silent_p.D660D|KIF1B_ENST00000263934.6_Intron			O60333	KIF1B_HUMAN	kinesin family member 1B						anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		ttCCAAAGGACGCGGATTCTG	0.388													C|||	1	0.000199681	0.0	0.0	5008	,	,		16904	0.0		0.001	False		,,,				2504	0.0				p.D660D		Atlas-SNP	.											.	KIF1B	242	.	0			c.C1980T						PASS	.	C	,	0,4402		0,0,2201	48.0	50.0	49.0		,1980	2.4	1.0	1	dbSNP_134	49	13,8587	9.1+/-34.3	0,13,4287	no	intron,coding-synonymous	KIF1B	NM_015074.3,NM_183416.3	,	0,13,6488	TT,TC,CC		0.1512,0.0,0.1	,	,660/1154	10363223	13,12989	2201	4300	6501	SO:0001627	intron_variant	23095	exon21			AAAGGACGCGGAT	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2115+5919C>T	1.37:g.10363223C>T		Somatic	286	0	0		WXS	Illumina HiSeq	Phase_I	242	12	0.0495868	NM_183416	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Silent	SNP	ENST00000377086.1	37																																																																																				C|0.999;T|0.001	0.001	strong		0.388	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
DSPP	1834	hgsc.bcm.edu	37	4	88537700	88537700	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:88537700C>A	ENST00000282478.7	+	4	3919	c.3886C>A	c.(3886-3888)Cac>Aac	p.H1296N	DSPP_ENST00000399271.1_Missense_Mutation_p.H1296N|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1296	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagtAACCACTCAACCAG	0.398																																					p.H1296N		Atlas-SNP	.											DSPP,NS,carcinoma,0,1	DSPP	174	1	0			c.C3886A						scavenged	.						90.0	98.0	95.0					4																	88537700		1528	2824	4352	SO:0001583	missense	1834	exon5			AGTAACCACTCAA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3886C>A	4.37:g.88537700C>A	ENSP00000282478:p.His1296Asn	Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	191	3	0.0157068	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	C	9.776	1.174135	0.21704	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.87809	-2.3;-2.3	3.94	3.94	0.45596	.	0.485875	0.15384	N	0.265146	T	0.74966	0.3786	N	0.19112	0.55	0.20703	N	0.999866	B	0.32573	0.376	B	0.33339	0.162	T	0.61023	-0.7146	10	0.06236	T	0.91	-10.4375	11.649	0.51277	0.0:1.0:0.0:0.0	.	1296	Q9NZW4	DSPP_HUMAN	N	1296	ENSP00000382213:H1296N;ENSP00000282478:H1296N	ENSP00000282478:H1296N	H	+	1	0	DSPP	88756724	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.964000	0.40462	2.200000	0.70718	0.460000	0.39030	CAC	.	.	none		0.398	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FAT4	79633	hgsc.bcm.edu	37	4	126239318	126239318	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:126239318G>A	ENST00000394329.3	+	1	1765	c.1752G>A	c.(1750-1752)caG>caA	p.Q584Q		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	584	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TATTTAGCCAGCCAGAAGGGT	0.517																																					p.Q584Q		Atlas-SNP	.											.	FAT4	1752	.	0			c.G1752A						PASS	.						68.0	71.0	70.0					4																	126239318		2007	4176	6183	SO:0001819	synonymous_variant	79633	exon1			TAGCCAGCCAGAA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.1752G>A	4.37:g.126239318G>A		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	78	33	0.423077	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																			.	.	none		0.517	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
TTC7A	57217	hgsc.bcm.edu	37	2	47249048	47249048	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:47249048G>A	ENST00000319190.5	+	12	1808	c.1440G>A	c.(1438-1440)gaG>gaA	p.E480E	TTC7A_ENST00000394850.2_Silent_p.E480E|TTC7A_ENST00000409245.1_Silent_p.E446E|TTC7A_ENST00000461601.1_3'UTR|TTC7A_ENST00000263737.6_Silent_p.E126E	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	480					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)					breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			GCCTCGGAGAGGAAGCCGGGG	0.602																																					p.E480E		Atlas-SNP	.											.	TTC7A	80	.	0			c.G1440A						PASS	.						107.0	104.0	105.0					2																	47249048		2203	4300	6503	SO:0001819	synonymous_variant	57217	exon12			CGGAGAGGAAGCC	AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.1440G>A	2.37:g.47249048G>A		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	81	4	0.0493827	NM_020458	Q6PIX4|Q8ND67|Q9BUS3	Silent	SNP	ENST00000319190.5	37	CCDS33193.1																																																																																			.	.	none		0.602	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329667.2	XM_372927	
PSMC2	5701	hgsc.bcm.edu	37	7	103004631	103004631	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:103004631C>T	ENST00000435765.1	+	9	1044	c.633C>T	c.(631-633)ggC>ggT	p.G211G	SLC26A5_ENST00000339444.6_Intron|SLC26A5_ENST00000356767.4_Intron|PSMC2_ENST00000292644.3_Silent_p.G211G|PSMC2_ENST00000544811.1_Silent_p.G74G|SLC26A5_ENST00000393735.2_Intron	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2	211					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						CTCCCAAGGGCGTGCTGCTCT	0.493																																					p.G211G		Atlas-SNP	.											PSMC2,rectum,carcinoma,0,1	PSMC2	38	1	0			c.C633T						scavenged	.						107.0	93.0	98.0					7																	103004631		2203	4300	6503	SO:0001819	synonymous_variant	5701	exon8			CAAGGGCGTGCTG	D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	ENST00000435765.1:c.633C>T	7.37:g.103004631C>T		Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	161	2	0.0124224	NM_002803	A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Silent	SNP	ENST00000435765.1	37	CCDS5731.1																																																																																			.	.	none		0.493	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347922.1	NM_002803	
MUT	4594	hgsc.bcm.edu	37	6	49423828	49423828	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:49423828G>A	ENST00000274813.3	-	4	1003	c.876C>T	c.(874-876)ctC>ctT	p.L292L		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	292					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGCCAGCCTGGAGTCCAGTTC	0.403																																					p.L292L		Atlas-SNP	.											.	MUT	70	.	0			c.C876T						PASS	.						80.0	74.0	76.0					6																	49423828		2203	4300	6503	SO:0001819	synonymous_variant	4594	exon4			AGCCTGGAGTCCA		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.876C>T	6.37:g.49423828G>A		Somatic	193	0	0		WXS	Illumina HiSeq	Phase_I	208	10	0.0480769	NM_000255	A8K953|Q5SYZ3|Q96B11|Q9UD64	Silent	SNP	ENST00000274813.3	37	CCDS4924.1																																																																																			.	.	none		0.403	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1		
POTEE	445582	hgsc.bcm.edu	37	2	132021684	132021684	+	Missense_Mutation	SNP	C	C	A	rs2672150		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:132021684C>A	ENST00000356920.5	+	15	2750	c.2656C>A	c.(2656-2658)Cct>Act	p.P886T	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	886	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GCGGGAACTGCCTGACTACCT	0.592																																					p.P886T		Atlas-SNP	.											ENSG00000188219,NS,carcinoma,-1,1	.	.	1	0			c.C2656A						scavenged	.						46.0	47.0	47.0					2																	132021684		2203	4281	6484	SO:0001583	missense	445582	exon15			GAACTGCCTGACT	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2656C>A	2.37:g.132021684C>A	ENSP00000439189:p.Pro886Thr	Somatic	420	3	0.00714286		WXS	Illumina HiSeq	Phase_I	380	7	0.0184211	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	3.880	-0.026136	0.07589	.	.	ENSG00000188219	ENST00000356920	T	0.04360	3.64	.	.	.	.	.	.	.	.	T	0.00241	0.0007	N	0.00000	-5.39	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.59606	-0.7423	8	0.02654	T	1	.	4.0636	0.09849	0.6406:0.3593:1.0E-4:0.0	.	886	Q6S8J3	POTEE_HUMAN	T	886	ENSP00000439189:P886T	ENSP00000439189:P886T	P	+	1	0	AC131180.1	131738154	1.000000	0.71417	0.081000	0.20488	0.082000	0.17680	4.531000	0.60602	-2.143000	0.00803	-2.210000	0.00300	CCT	.	.	weak		0.592	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
CYSLTR1	10800	hgsc.bcm.edu	37	X	77529241	77529241	+	Start_Codon_SNP	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:77529241C>T	ENST00000373304.3	-	3	295	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	1					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	CTGTTTCATCCATGTTTCTCT	0.343																																					p.M1I		Atlas-SNP	.											.	CYSLTR1	59	.	0			c.G3A						PASS	.						152.0	115.0	128.0					X																	77529241		2203	4300	6503	SO:0001582	initiator_codon_variant	10800	exon3			TTCATCCATGTTT	AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.3G>A	X.37:g.77529241C>T	ENSP00000362401:p.Met1Ile	Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	89	63	0.707865	NM_006639	B2R954|D3DTE4|Q5JS94|Q8IV19	Missense_Mutation	SNP	ENST00000373304.3	37	CCDS14439.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.292661	0.23564	.	.	ENSG00000173198	ENST00000373304	T	0.67523	-0.27	4.54	4.54	0.55810	.	2.367420	0.01786	N	0.032058	T	0.63438	0.2511	.	.	.	0.80722	D	1	B	0.26809	0.16	B	0.19666	0.026	T	0.28808	-1.0032	9	0.48119	T	0.1	.	13.8144	0.63283	0.0:1.0:0.0:0.0	.	1	Q9Y271	CLTR1_HUMAN	I	1	ENSP00000362401:M1I	ENSP00000362401:M1I	M	-	3	0	CYSLTR1	77415897	1.000000	0.71417	0.995000	0.50966	0.280000	0.26924	4.875000	0.63072	1.826000	0.53198	0.456000	0.33151	ATG	.	.	none		0.343	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057315.1		Missense_Mutation
SPTBN4	57731	hgsc.bcm.edu	37	19	41066402	41066402	+	Intron	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:41066402G>A	ENST00000352632.3	+	27	6001				SPTBN4_ENST00000595535.1_Silent_p.*2003*|SPTBN4_ENST00000598249.1_Intron|SPTBN4_ENST00000392023.1_Silent_p.*679*|SPTBN4_ENST00000338932.3_Intron|SPTBN4_ENST00000392025.1_Intron			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4						actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCAATGGAATGacaacagcca	0.582																																					p.X679X		Atlas-SNP	.											.	SPTBN4	213	.	0			c.G2036A						PASS	.						11.0	14.0	13.0					19																	41066402		2126	4185	6311	SO:0001627	intron_variant	57731	exon10			TGGAATGACAACA	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5915+93G>A	19.37:g.41066402G>A		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	94	40	0.425532	NM_025213	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	CCDS12559.1																																																																																			.	.	none		0.582	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
NYNRIN	57523	hgsc.bcm.edu	37	14	24879175	24879175	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:24879175C>T	ENST00000382554.3	+	4	2493	c.2175C>T	c.(2173-2175)ccC>ccT	p.P725P		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	725					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GGCAGGGTCCCCAGTCCAGTG	0.627																																					p.P725P		Atlas-SNP	.											NYNRIN,colon,carcinoma,0,1	NYNRIN	120	1	0			c.C2175T						scavenged	.						25.0	29.0	28.0					14																	24879175		1967	4144	6111	SO:0001819	synonymous_variant	57523	exon4			GGGTCCCCAGTCC	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.2175C>T	14.37:g.24879175C>T		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	181	2	0.0110497	NM_025081	Q6P153|Q86TR3|Q9HAC4	Silent	SNP	ENST00000382554.3	37	CCDS45090.1																																																																																			.	.	none		0.627	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
TAX1BP1	8887	hgsc.bcm.edu	37	7	27831747	27831747	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:27831747G>A	ENST00000396319.2	+	9	1249	c.1161G>A	c.(1159-1161)acG>acA	p.T387T	TAX1BP1_ENST00000265393.6_Silent_p.T387T|TAX1BP1_ENST00000409980.1_Silent_p.T387T|TAX1BP1_ENST00000433216.2_Silent_p.T230T|TAX1BP1_ENST00000543117.1_Silent_p.T387T	NM_006024.6	NP_006015.4	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I) binding protein 1	387	Oligomerization.				apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	kinase binding (GO:0019900)	p.T387T(2)		breast(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(8)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31			GBM - Glioblastoma multiforme(3;0.0823)			GAGACAGAACGATGGCAGACC	0.443																																					p.T387T		Atlas-SNP	.											TAX1BP1,rectum,carcinoma,0,2	TAX1BP1	71	2	2	Substitution - coding silent(2)	large_intestine(2)	c.G1161A						scavenged	.						106.0	96.0	99.0					7																	27831747		2203	4300	6503	SO:0001819	synonymous_variant	8887	exon9			CAGAACGATGGCA	U33821	CCDS5415.1, CCDS43561.1, CCDS56471.1	7p15	2010-08-05			ENSG00000106052	ENSG00000106052			11575	protein-coding gene	gene with protein product		605326				10435631	Standard	NM_006024		Approved	TXBP151, CALCOCO3	uc003szl.3	Q86VP1	OTTHUMG00000023377	ENST00000396319.2:c.1161G>A	7.37:g.27831747G>A		Somatic	144	2	0.0138889		WXS	Illumina HiSeq	Phase_I	196	4	0.0204082	NM_006024	B4DKU7|E7ENV2|O60398|O95770|Q13311|Q9BQG5|Q9UI88	Silent	SNP	ENST00000396319.2	37	CCDS5415.1																																																																																			.	.	none		0.443	TAX1BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214142.1	NM_006024	
INPP4B	8821	hgsc.bcm.edu	37	4	143003328	143003328	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:143003328T>G	ENST00000513000.1	-	26	2931	c.2498A>C	c.(2497-2499)aAa>aCa	p.K833T	INPP4B_ENST00000509777.1_Missense_Mutation_p.K833T|INPP4B_ENST00000508116.1_Missense_Mutation_p.K833T|INPP4B_ENST00000308502.4_Missense_Mutation_p.K833T|INPP4B_ENST00000262992.4_Missense_Mutation_p.K833T	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	833					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					ACCATTCAGTTTGCGGCAAAT	0.413																																					p.K833T		Atlas-SNP	.											.	INPP4B	132	.	0			c.A2498C						PASS	.						141.0	125.0	130.0					4																	143003328		2203	4300	6503	SO:0001583	missense	8821	exon26			TTCAGTTTGCGGC	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.2498A>C	4.37:g.143003328T>G	ENSP00000425487:p.Lys833Thr	Somatic	219	0	0		WXS	Illumina HiSeq	Phase_I	227	97	0.427313	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	37	CCDS3757.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.99|19.99	3.928315|3.928315	0.73327|0.73327	.|.	.|.	ENSG00000109452|ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000508116;ENST00000509777;ENST00000511838|ENST00000542702	T;T;T;T;T;T|.	0.23754|.	1.89;1.89;1.89;1.89;1.89;1.89|.	5.7|5.7	4.52|4.52	0.55395|0.55395	.|.	0.050528|.	0.85682|.	D|.	0.000000|.	T|T	0.65739|0.65739	0.2720|0.2720	M|M	0.61703|0.61703	1.905|1.905	0.47037|0.47037	D|D	0.999293|0.999293	D|.	0.62365|.	0.991|.	P|.	0.59703|.	0.862|.	T|T	0.67745|0.67745	-0.5591|-0.5591	10|6	0.56958|0.87932	D|D	0.05|0	.|.	11.4577|11.4577	0.50191|0.50191	0.0:0.0702:0.0:0.9298|0.0:0.0702:0.0:0.9298	.|.	833|.	O15327|.	INP4B_HUMAN|.	T|H	833;833;833;833;833;648|647	ENSP00000425487:K833T;ENSP00000262992:K833T;ENSP00000308441:K833T;ENSP00000423954:K833T;ENSP00000422793:K833T;ENSP00000426207:K648T|.	ENSP00000262992:K833T|ENSP00000446046:Q647H	K|Q	-|-	2|3	0|2	INPP4B|INPP4B	143222778|143222778	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	4.389000|4.389000	0.59639|0.59639	1.001000|1.001000	0.39076|0.39076	0.455000|0.455000	0.32223|0.32223	AAA|CAA	.	.	none		0.413	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
CNDP2	55748	hgsc.bcm.edu	37	18	72167213	72167213	+	Missense_Mutation	SNP	C	C	T	rs140583961		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:72167213C>T	ENST00000324262.4	+	2	321	c.5C>T	c.(4-6)gCg>gTg	p.A2V	CNDP2_ENST00000324301.8_Missense_Mutation_p.A2V|CNDP2_ENST00000579847.1_Missense_Mutation_p.A2V	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	2					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.A2V(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		TGAAAGATGGCGGCCCTCACT	0.458													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17676	0.0		0.0	False		,,,				2504	0.0				p.A2V		Atlas-SNP	.											CNDP2,NS,carcinoma,0,1	CNDP2	55	1	1	Substitution - Missense(1)	lung(1)	c.C5T						scavenged	.	C	VAL/ALA,VAL/ALA	4,4402	8.1+/-20.4	0,4,2199	104.0	91.0	96.0		5,5	4.6	0.5	18	dbSNP_134	96	0,8600		0,0,4300	no	missense,missense	CNDP2	NM_001168499.1,NM_018235.2	64,64	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	benign,benign	2/392,2/476	72167213	4,13002	2203	4300	6503	SO:0001583	missense	55748	exon1			AGATGGCGGCCCT	AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.5C>T	18.37:g.72167213C>T	ENSP00000325548:p.Ala2Val	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	215	3	0.0139535	NM_001168499	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	ENST00000324262.4	37	CCDS12006.1	.	.	.	.	.	.	.	.	.	.	C	9.693	1.152475	0.21371	9.08E-4	0.0	ENSG00000133313	ENST00000324262;ENST00000324301	T	0.18960	2.18	5.43	4.56	0.56223	.	0.332021	0.31772	N	0.007090	T	0.13200	0.0320	N	0.14661	0.345	0.21416	N	0.999694	P;B;P	0.35411	0.5;0.324;0.5	B;B;B	0.28232	0.087;0.035;0.087	T	0.10474	-1.0628	10	0.62326	D	0.03	0.7047	15.9342	0.79688	0.0:0.8645:0.1355:0.0	.	2;2;2	B4DV28;Q96KP4-2;Q96KP4	.;.;CNDP2_HUMAN	V	2	ENSP00000325548:A2V	ENSP00000325548:A2V	A	+	2	0	CNDP2	70318193	0.997000	0.39634	0.533000	0.28001	0.012000	0.07955	4.525000	0.60559	1.280000	0.44463	-0.304000	0.09214	GCG	C|1.000;T|0.000	0.000	weak		0.458	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
POTEF	728378	hgsc.bcm.edu	37	2	130877892	130877892	+	Missense_Mutation	SNP	C	C	T	rs11889701	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:130877892C>T	ENST00000409914.2	-	3	596	c.197G>A	c.(196-198)cGc>cAc	p.R66H	POTEF_ENST00000357462.5_Missense_Mutation_p.R66H|POTEF_ENST00000360967.5_Missense_Mutation_p.R66H|POTEF_ENST00000361163.4_Missense_Mutation_p.R66H	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	66					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GAAGCAGTGGCGGCACCACTT	0.602													.|||	37	0.00738818	0.0272	0.0	5008	,	,		15114	0.0		0.0	False		,,,				2504	0.001				p.R66H		Atlas-SNP	.											POTEF,NS,carcinoma,-1,12	POTEF	140	12	0			c.G197A						scavenged	.						91.0	126.0	114.0					2																	130877892		2167	4294	6461	SO:0001583	missense	728378	exon3			CAGTGGCGGCACC	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.197G>A	2.37:g.130877892C>T	ENSP00000386786:p.Arg66His	Somatic	339	29	0.0855457		WXS	Illumina HiSeq	Phase_I	287	11	0.0383275	NM_001099771	A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	0.014	-1.587100	0.00872	.	.	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.77358	-1.09;-1.09;1.74;1.76	.	.	.	.	.	.	.	.	T	0.47469	0.1447	N	0.01109	-1.01	0.09310	N	1	D	0.56521	0.976	P	0.46629	0.522	T	0.47509	-0.9112	7	0.12766	T	0.61	.	.	.	.	.	66	A5A3E0	POTEF_HUMAN	H	66	ENSP00000350052:R66H;ENSP00000386786:R66H;ENSP00000354232:R66H;ENSP00000355012:R66H	ENSP00000350052:R66H	R	-	2	0	POTEF	130594362	0.005000	0.15991	0.077000	0.20336	0.096000	0.18686	-1.080000	0.03407	0.149000	0.19098	0.152000	0.16155	CGC	C|0.500;T|0.500	0.500	weak		0.602	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
SCFD2	152579	hgsc.bcm.edu	37	4	54231638	54231638	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:54231638C>T	ENST00000401642.3	-	1	604	c.471G>A	c.(469-471)ccG>ccA	p.P157P	SCFD2_ENST00000388940.4_Silent_p.P157P	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	157					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CAAGCAATAACGGGACATGGA	0.572																																					p.P157P		Atlas-SNP	.											SCFD2,NS,carcinoma,-1,1	SCFD2	78	1	0			c.G471A						scavenged	.						87.0	74.0	78.0					4																	54231638		2203	4300	6503	SO:0001819	synonymous_variant	152579	exon1			CAATAACGGGACA	AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.471G>A	4.37:g.54231638C>T		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	90	2	0.0222222	NM_152540	Q8N5F3|Q8N8H0|Q96ED3	Silent	SNP	ENST00000401642.3	37	CCDS33984.1																																																																																			.	.	none		0.572	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540	
SNRK	54861	hgsc.bcm.edu	37	3	43345043	43345043	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:43345043C>T	ENST00000296088.7	+	3	652	c.348C>T	c.(346-348)gcC>gcT	p.A116A	SNRK_ENST00000437827.1_Intron|SNRK_ENST00000454177.1_Silent_p.A116A|SNRK_ENST00000462810.1_3'UTR|SNRK_ENST00000429705.2_Silent_p.A116A	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		AAGACTTGGCCAAGAAGTATT	0.363																																					p.A116A		Atlas-SNP	.											.	SNRK	118	.	0			c.C348T						PASS	.						76.0	73.0	73.0					3																	43345043		1849	4090	5939	SO:0001819	synonymous_variant	54861	exon3			CTTGGCCAAGAAG	D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.348C>T	3.37:g.43345043C>T		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	58	22	0.37931	NM_017719		Silent	SNP	ENST00000296088.7	37	CCDS43075.1																																																																																			.	.	none		0.363	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1	NM_017719	
NEFL	4747	hgsc.bcm.edu	37	8	24813297	24813297	+	RNA	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr8:24813297C>T	ENST00000221169.5	-	0	1327				CTD-2168K21.2_ENST00000607735.1_RNA			P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		TCCATCTCCACGGAGATCTGC	0.582																																					p.V245M		Atlas-SNP	.											.	NEFL	47	.	0			c.G733A						PASS	.						47.0	52.0	50.0					8																	24813297		2139	4250	6389			4747	exon1			TCTCCACGGAGAT		CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24813297C>T		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	80	30	0.375	NM_006158	B9ZVN2|Q16154|Q8IU72	Missense_Mutation	SNP	ENST00000221169.5	37																																																																																				.	.	none		0.582	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000258943.4	NM_006158	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110451186	110451186	+	Missense_Mutation	SNP	C	C	T	rs202179223		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr8:110451186C>T	ENST00000378402.5	+	32	3925	c.3821C>T	c.(3820-3822)gCg>gTg	p.A1274V		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1274	IPT/TIG 6.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CAAAACATGGCGGTGTATGTT	0.333										HNSCC(38;0.096)			C|||	1	0.000199681	0.0	0.0	5008	,	,		17296	0.001		0.0	False		,,,				2504	0.0				p.A1274V		Atlas-SNP	.											PKHD1L1,NS,carcinoma,-1,1	PKHD1L1	522	1	0			c.C3821T						scavenged	.						70.0	68.0	69.0					8																	110451186		1814	4074	5888	SO:0001583	missense	93035	exon32			ACATGGCGGTGTA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3821C>T	8.37:g.110451186C>T	ENSP00000367655:p.Ala1274Val	Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	135	2	0.0148148	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	1.256	-0.617125	0.03663	.	.	ENSG00000205038	ENST00000378402	T	0.76578	-1.03	3.78	-3.16	0.05217	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	1.760370	0.03248	N	0.181446	T	0.56963	0.2021	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.37430	-0.9706	10	0.26408	T	0.33	.	4.2987	0.10915	0.3385:0.3215:0.0:0.34	.	1274	Q86WI1	PKHL1_HUMAN	V	1274	ENSP00000367655:A1274V	ENSP00000367655:A1274V	A	+	2	0	PKHD1L1	110520362	0.001000	0.12720	0.083000	0.20561	0.259000	0.26198	-1.072000	0.03434	-0.567000	0.06046	-1.162000	0.01777	GCG	C|1.000;T|0.000	0.000	strong		0.333	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
OR2M3	127062	hgsc.bcm.edu	37	1	248366819	248366819	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:248366819C>T	ENST00000456743.1	+	1	488	c.450C>T	c.(448-450)atC>atT	p.I150I		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TTTCCTGGATCCTGGGCTCTA	0.468																																					p.I150I		Atlas-SNP	.											.	OR2M3	116	.	0			c.C450T						PASS	.						202.0	196.0	198.0					1																	248366819		2203	4300	6503	SO:0001819	synonymous_variant	127062	exon1			CTGGATCCTGGGC		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.450C>T	1.37:g.248366819C>T		Somatic	384	1	0.00260417		WXS	Illumina HiSeq	Phase_I	180	116	0.644444	NM_001004689	B9EH06|Q6IEY0	Silent	SNP	ENST00000456743.1	37	CCDS31107.1																																																																																			.	.	none		0.468	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689	
PPARG	5468	hgsc.bcm.edu	37	3	12475443	12475443	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:12475443C>A	ENST00000287820.6	+	7	1438	c.1317C>A	c.(1315-1317)gaC>gaA	p.D439E	PPARG_ENST00000397000.1_3'UTR|PPARG_ENST00000397015.2_Missense_Mutation_p.D411E|PPARG_ENST00000397026.2_Missense_Mutation_p.D417E|PPARG_ENST00000539812.1_3'UTR|PPARG_ENST00000397010.2_Missense_Mutation_p.D411E|PPARG_ENST00000397012.2_Missense_Mutation_p.D411E|PPARG_ENST00000309576.6_Missense_Mutation_p.D411E	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	439	Ligand-binding.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	ACATTCAAGACAACCTGCTAC	0.507			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																														p.D439E		Atlas-SNP	.		Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	.	PPARG	49	.	0			c.C1317A						PASS	.						104.0	100.0	102.0					3																	12475443		2203	4300	6503	SO:0001583	missense	5468	exon7			TCAAGACAACCTG	X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.1317C>A	3.37:g.12475443C>A	ENSP00000287820:p.Asp439Glu	Somatic	217	0	0		WXS	Illumina HiSeq	Phase_I	287	61	0.212544	NM_015869	A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	ENST00000287820.6	37	CCDS2609.1	.	.	.	.	.	.	.	.	.	.	C	2.364	-0.345921	0.05208	.	.	ENSG00000132170	ENST00000397010;ENST00000309576;ENST00000397015;ENST00000397012;ENST00000397026;ENST00000287820	D;D;D;D;D;D	0.96168	-3.93;-3.93;-3.93;-3.93;-3.93;-3.93	5.61	2.41	0.29592	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.154798	0.56097	D	0.000021	T	0.79747	0.4499	N	0.01188	-0.97	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.72513	-0.4270	10	0.02654	T	1	.	4.3276	0.11048	0.1297:0.4992:0.2553:0.1158	.	439	P37231	PPARG_HUMAN	E	411;411;411;411;417;439	ENSP00000380205:D411E;ENSP00000312472:D411E;ENSP00000380210:D411E;ENSP00000380207:D411E;ENSP00000380221:D417E;ENSP00000287820:D439E	ENSP00000287820:D439E	D	+	3	2	PPARG	12450443	0.988000	0.35896	1.000000	0.80357	0.933000	0.57130	0.263000	0.18478	0.724000	0.32296	0.650000	0.86243	GAC	.	.	none		0.507	PPARG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251979.2	NM_005037	
BSN	8927	hgsc.bcm.edu	37	3	49701983	49701983	+	Silent	SNP	G	G	A	rs9858542	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:49701983G>A	ENST00000296452.4	+	9	11850	c.11736G>A	c.(11734-11736)acG>acA	p.T3912T		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3912					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GCAAACTGACGGAAGGTATGC	0.637													G|||	978	0.195288	0.2171	0.17	5008	,	,		17930	0.0516		0.3241	False		,,,				2504	0.1994				p.T3912T		Atlas-SNP	.											BSN,NS,carcinoma,+1,1	BSN	272	1	0			c.G11736A						scavenged	.	G		1044,3362	379.7+/-323.4	120,804,1279	48.0	54.0	52.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	11736	-10.1	0.6	3	dbSNP_119	52	2577,6023	416.5+/-352.1	402,1773,2125	yes	coding-synonymous	BSN	NM_003458.3		522,2577,3404	AA,AG,GG	http://www.ncbi.nlm.nih.gov/pubmed?term	29.9651,23.695,27.841		3912/3927	49701983	3621,9385	2203	4300	6503	SO:0001819	synonymous_variant	8927	exon9			ACTGACGGAAGGT	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.11736G>A	3.37:g.49701983G>A		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	48	2	0.0416667	NM_003458	O43161|Q7LGH3	Silent	SNP	ENST00000296452.4	37	CCDS2800.1																																																																																			G|0.749;A|0.251	0.251	strong		0.637	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
SLC35G6	643664	hgsc.bcm.edu	37	17	7386300	7386300	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:7386300G>A	ENST00000412468.2	+	2	1112	c.997G>A	c.(997-999)Gaa>Aaa	p.E333K	POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	333						integral component of membrane (GO:0016021)											CTGTGAGAGGGAAGGGAAGGT	0.557																																					p.E333K		Atlas-SNP	.											POLR2A_ENST00000412468,NS,carcinoma,-1,1	.	.	1	0			c.G997A						scavenged	.						60.0	59.0	59.0					17																	7386300		2203	4300	6503	SO:0001583	missense	643664	exon2			GAGAGGGAAGGGA		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.997G>A	17.37:g.7386300G>A	ENSP00000396523:p.Glu333Lys	Somatic	142	2	0.0140845		WXS	Illumina HiSeq	Phase_I	134	12	0.0895522	NM_001102614		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.322479	0.01320	.	.	ENSG00000181222	ENST00000412468	T	0.26518	1.73	4.69	1.44	0.22558	.	.	.	.	.	T	0.14056	0.0340	L	0.36672	1.1	0.09310	N	1	B	0.18013	0.025	B	0.15870	0.014	T	0.37526	-0.9702	9	0.02654	T	1	-0.2286	4.7772	0.13185	0.2637:0.1728:0.5636:0.0	.	333	P0C7Q6	S35G6_HUMAN	K	333	ENSP00000396523:E333K	ENSP00000396523:E333K	E	+	1	0	SLC35G6	7327024	1.000000	0.71417	0.321000	0.25320	0.451000	0.32288	4.403000	0.59729	0.499000	0.27970	-0.225000	0.12378	GAA	.	.	none		0.557	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
LINGO1	84894	hgsc.bcm.edu	37	15	77906709	77906709	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:77906709C>G	ENST00000355300.6	-	2	1714	c.1540G>C	c.(1540-1542)Gtg>Ctg	p.V514L	LINGO1_ENST00000561030.1_Missense_Mutation_p.V508L	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	514					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						TAGCTGCGCACATGCAGGTGG	0.672																																					p.V514L		Atlas-SNP	.											.	LINGO1	76	.	0			c.G1540C						PASS	.						55.0	60.0	58.0					15																	77906709		2130	4227	6357	SO:0001583	missense	84894	exon2			TGCGCACATGCAG	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1540G>C	15.37:g.77906709C>G	ENSP00000347451:p.Val514Leu	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	84	24	0.285714	NM_032808	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	ENST00000355300.6	37	CCDS45313.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.762626	0.49574	.	.	ENSG00000169783	ENST00000355300	T	0.60299	0.2	5.08	5.08	0.68730	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.055741	0.64402	D	0.000001	T	0.70219	0.3199	M	0.93283	3.4	0.80722	D	1	P	0.49253	0.921	B	0.41135	0.348	T	0.81540	-0.0886	10	0.66056	D	0.02	.	18.482	0.90815	0.0:1.0:0.0:0.0	.	514	Q96FE5	LIGO1_HUMAN	L	514	ENSP00000347451:V514L	ENSP00000347451:V514L	V	-	1	0	LINGO1	75693764	1.000000	0.71417	0.990000	0.47175	0.965000	0.64279	5.938000	0.70170	2.359000	0.80004	0.462000	0.41574	GTG	.	.	none		0.672	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419546.1	NM_032808	
AGAP1	116987	hgsc.bcm.edu	37	2	236653407	236653407	+	Silent	SNP	C	C	T	rs553037277		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:236653407C>T	ENST00000304032.8	+	5	1042	c.462C>T	c.(460-462)acC>acT	p.T154T	AGAP1_ENST00000428334.2_5'Flank|AGAP1_ENST00000409538.1_Silent_p.T419T|AGAP1_ENST00000336665.5_Silent_p.T154T|AGAP1_ENST00000409457.1_Silent_p.T154T	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	154	Small GTPase-like.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						GTTTCCAGACCGTTTACCACT	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		18907	0.001		0.0	False		,,,				2504	0.0				p.T154T		Atlas-SNP	.											AGAP1,NS,carcinoma,0,1	AGAP1	95	1	0			c.C462T						scavenged	.						143.0	128.0	133.0					2																	236653407		2203	4300	6503	SO:0001819	synonymous_variant	116987	exon5			CCAGACCGTTTAC	AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.462C>T	2.37:g.236653407C>T		Somatic	304	1	0.00328947		WXS	Illumina HiSeq	Phase_I	274	3	0.0109489	NM_014914	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Silent	SNP	ENST00000304032.8	37	CCDS33408.1																																																																																			.	.	none		0.502	AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914	
GARNL3	84253	hgsc.bcm.edu	37	9	130155397	130155397	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:130155397C>T	ENST00000373387.4	+	28	3258	c.2906C>T	c.(2905-2907)tCc>tTc	p.S969F	GARNL3_ENST00000435213.2_Missense_Mutation_p.S947F|GARNL3_ENST00000314904.5_3'UTR|GARNL3_ENST00000496711.1_3'UTR	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	969					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						GCTTCTACTTCCGAAGCCAAC	0.562																																					p.S969F		Atlas-SNP	.											GARNL3,NS,carcinoma,-1,1	GARNL3	83	1	0			c.C2906T						scavenged	.						71.0	76.0	74.0					9																	130155397		2203	4300	6503	SO:0001583	missense	84253	exon28			CTACTTCCGAAGC	BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.2906C>T	9.37:g.130155397C>T	ENSP00000362485:p.Ser969Phe	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	151	2	0.013245	NM_032293	B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Missense_Mutation	SNP	ENST00000373387.4	37	CCDS6869.2	.	.	.	.	.	.	.	.	.	.	C	6.398	0.441485	0.12164	.	.	ENSG00000136895	ENST00000435213;ENST00000373387	D;D	0.87650	-2.28;-2.28	5.73	2.83	0.33086	.	0.378978	0.27917	N	0.017328	T	0.71290	0.3322	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.54497	-0.8285	9	.	.	.	.	5.312	0.15835	0.0:0.5767:0.1552:0.2681	.	969;947	Q5VVW2;B7Z3Q6	GARL3_HUMAN;.	F	947;969	ENSP00000396205:S947F;ENSP00000362485:S969F	.	S	+	2	0	GARNL3	129195218	0.000000	0.05858	0.002000	0.10522	0.264000	0.26372	0.738000	0.26158	0.859000	0.35456	0.655000	0.94253	TCC	.	.	none		0.562	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054151.3	NM_032293	
HELZ	9931	hgsc.bcm.edu	37	17	65186460	65186460	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:65186460T>C	ENST00000358691.5	-	10	735	c.569A>G	c.(568-570)cAa>cGa	p.Q190R	HELZ_ENST00000580662.1_5'UTR|HELZ_ENST00000580168.1_Missense_Mutation_p.Q190R	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	190						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ACAGATTCCTTGTTCTAAAAA	0.363																																					p.Q190R		Atlas-SNP	.											.	HELZ	160	.	0			c.A569G						PASS	.						108.0	98.0	101.0					17																	65186460		1841	4088	5929	SO:0001583	missense	9931	exon10			ATTCCTTGTTCTA	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.569A>G	17.37:g.65186460T>C	ENSP00000351524:p.Gln190Arg	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	144	57	0.395833	NM_014877	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	T	11.57	1.678552	0.29783	.	.	ENSG00000198265	ENST00000358691;ENST00000417253	T;T	0.40476	1.03;1.03	5.38	4.3	0.51218	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.49218	0.1544	L	0.56769	1.78	0.58432	D	0.999997	P;P	0.49961	0.93;0.529	P;B	0.52189	0.692;0.198	T	0.44097	-0.9350	10	0.44086	T	0.13	-11.9044	11.1502	0.48453	0.0:0.0722:0.0:0.9278	.	190;190	B7ZLW2;P42694	.;HELZ_HUMAN	R	190	ENSP00000351524:Q190R;ENSP00000411144:Q190R	ENSP00000351524:Q190R	Q	-	2	0	HELZ	62616922	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.003000	0.57061	0.894000	0.36317	0.533000	0.62120	CAA	.	.	none		0.363	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
PRB2	653247	hgsc.bcm.edu	37	12	11546598	11546598	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:11546598C>T	ENST00000389362.4	-	3	449	c.414G>A	c.(412-414)aaG>aaA	p.K138K	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	138	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GTCCTTGTGGCTTTCCTGGAG	0.597																																					p.K138K		Atlas-SNP	.											PRB2_ENST00000389362,NS,carcinoma,0,2	PRB2	168	2	0			c.G414A						scavenged	.						241.0	220.0	227.0					12																	11546598		2201	4296	6497	SO:0001819	synonymous_variant	653247	exon3			TTGTGGCTTTCCT	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.414G>A	12.37:g.11546598C>T		Somatic	260	1	0.00384615		WXS	Illumina HiSeq	Phase_I	214	4	0.0186916	NM_006248	O00599|P02811|P04281	Silent	SNP	ENST00000389362.4	37	CCDS41757.2																																																																																			.	.	none		0.597	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
TRAK1	22906	hgsc.bcm.edu	37	3	42264607	42264607	+	Missense_Mutation	SNP	G	G	A	rs537037086		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:42264607G>A	ENST00000327628.5	+	16	2640	c.2240G>A	c.(2239-2241)cGg>cAg	p.R747Q	TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000396175.1_Missense_Mutation_p.R689Q|RNU4-78P_ENST00000410940.1_RNA	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	747					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						TTGAAGGAGCGGGGCATTTCT	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		15086	0.001		0.0	False		,,,				2504	0.0				p.R747Q	GBM(44;195 884 22595 31865 41850)	Atlas-SNP	.											.	TRAK1	188	.	0			c.G2240A						PASS	.						46.0	56.0	53.0					3																	42264607		2038	4177	6215	SO:0001583	missense	22906	exon16			AGGAGCGGGGCAT		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.2240G>A	3.37:g.42264607G>A	ENSP00000328998:p.Arg747Gln	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	118	28	0.237288	NM_001042646	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Missense_Mutation	SNP	ENST00000327628.5	37	CCDS43072.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125799	0.77436	.	.	ENSG00000182606	ENST00000327628;ENST00000543338;ENST00000396175	T;T	0.53206	0.63;0.63	5.32	4.45	0.53987	Trafficking kinesin-binding protein domain (1);	0.067564	0.56097	D	0.000026	T	0.44117	0.1278	L	0.41492	1.28	0.80722	D	1	D;P	0.53462	0.96;0.904	P;P	0.46629	0.522;0.522	T	0.34004	-0.9846	10	0.40728	T	0.16	.	12.8284	0.57733	0.0787:0.0:0.9213:0.0	.	689;747	C9JC32;Q9UPV9	.;TRAK1_HUMAN	Q	747;726;689	ENSP00000328998:R747Q;ENSP00000379478:R689Q	ENSP00000328998:R747Q	R	+	2	0	TRAK1	42239611	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.267000	0.51577	1.267000	0.44247	0.591000	0.81541	CGG	.	.	none		0.637	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
SCRIB	23513	hgsc.bcm.edu	37	8	144887138	144887138	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr8:144887138G>A	ENST00000320476.3	-	20	2723	c.2717C>T	c.(2716-2718)gCg>gTg	p.A906V	SCRIB_ENST00000377533.3_Missense_Mutation_p.A825V|SCRIB_ENST00000356994.2_Missense_Mutation_p.A906V	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	906	Interaction with ARHGEF7.|PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CAGTGTGCCCGCGCGGTGAGC	0.736																																					p.A906V	Pancreas(51;966 1133 10533 14576 29674)	Atlas-SNP	.											SCRIB_ENST00000356994,lower_third,carcinoma,+1,2	SCRIB	192	2	0			c.C2717T						PASS	.						8.0	9.0	9.0					8																	144887138		2159	4250	6409	SO:0001583	missense	23513	exon20			GTGCCCGCGCGGT	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.2717C>T	8.37:g.144887138G>A	ENSP00000322938:p.Ala906Val	Somatic	14	0	0		WXS	Illumina HiSeq	Phase_I	32	6	0.1875	NM_015356	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	37	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.806868	0.50421	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533;ENST00000377539	T;T;T	0.29655	1.56;1.56;1.56	4.58	4.58	0.56647	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.43964	0.1271	L	0.46670	1.46	0.29848	N	0.828673	D;D	0.89917	1.0;1.0	P;D	0.64506	0.891;0.926	T	0.36163	-0.9759	9	0.59425	D	0.04	.	9.2305	0.37434	0.0:0.1566:0.6819:0.1615	.	906;906	Q14160;Q14160-3	SCRIB_HUMAN;.	V	906;906;825;275	ENSP00000349486:A906V;ENSP00000322938:A906V;ENSP00000366756:A825V	ENSP00000322938:A906V	A	-	2	0	SCRIB	144959126	0.111000	0.22076	0.841000	0.33234	0.040000	0.13550	0.937000	0.28951	2.090000	0.63153	0.442000	0.29010	GCG	.	.	none		0.736	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
ZMYM3	9203	hgsc.bcm.edu	37	X	70462020	70462020	+	Splice_Site	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:70462020C>T	ENST00000353904.2	-	23	3989	c.3802G>A	c.(3802-3804)Gac>Aac	p.D1268N	ZMYM3_ENST00000373998.1_Splice_Site_p.D1256N|ZMYM3_ENST00000373984.3_Intron|ZMYM3_ENST00000373988.1_Splice_Site_p.D1270N|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000314425.5_Splice_Site_p.D1268N	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	1268					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					AGCCTCGTACCTCGCCCTTTC	0.637																																					p.D1268N		Atlas-SNP	.											.	ZMYM3	137	.	0			c.G3802A						PASS	.						38.0	26.0	30.0					X																	70462020		2188	4286	6474	SO:0001630	splice_region_variant	9203	exon23			TCGTACCTCGCCC	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.3802+1G>A	X.37:g.70462020C>T		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	35	27	0.771429	NM_005096	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	ENST00000353904.2	37	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	c	17.31	3.356776	0.61293	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373988	T;T;T;T	0.45668	1.48;0.89;1.48;1.48	4.66	4.66	0.58398	.	0.175419	0.39544	N	0.001325	T	0.27697	0.0681	N	0.14661	0.345	0.50313	D	0.999865	B;B	0.09022	0.002;0.002	B;B	0.10450	0.003;0.005	T	0.06463	-1.0825	9	.	.	.	-13.7907	16.8803	0.86061	0.0:1.0:0.0:0.0	.	1256;1268	Q14202-2;Q14202	.;ZMYM3_HUMAN	N	1268;1256;1268;1270	ENSP00000322845:D1268N;ENSP00000363110:D1256N;ENSP00000343909:D1268N;ENSP00000363100:D1270N	.	D	-	1	0	ZMYM3	70378745	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	6.625000	0.74248	2.161000	0.67846	0.519000	0.50382	GAC	.	.	none		0.637	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599	Missense_Mutation
DPYS	1807	hgsc.bcm.edu	37	8	105405212	105405212	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr8:105405212A>C	ENST00000351513.2	-	8	1375	c.1243T>G	c.(1243-1245)Tca>Gca	p.S415A	DPYS_ENST00000521601.1_Intron	NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	415					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GTTTTTGCTGAGATAGTCCTA	0.368																																					p.S415A		Atlas-SNP	.											.	DPYS	107	.	0			c.T1243G						PASS	.						67.0	71.0	70.0					8																	105405212		2203	4300	6503	SO:0001583	missense	1807	exon8			TTGCTGAGATAGT	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.1243T>G	8.37:g.105405212A>C	ENSP00000276651:p.Ser415Ala	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	42	20	0.47619	NM_001385		Missense_Mutation	SNP	ENST00000351513.2	37	CCDS6302.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.670756	0.88348	.	.	ENSG00000147647	ENST00000351513	T	0.76578	-1.03	6.02	6.02	0.97574	Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.88005	0.6321	M	0.75884	2.315	0.80722	D	1	D	0.69078	0.997	D	0.85130	0.997	D	0.89012	0.3429	10	0.72032	D	0.01	-14.0938	16.5494	0.84464	1.0:0.0:0.0:0.0	.	415	Q14117	DPYS_HUMAN	A	415	ENSP00000276651:S415A	ENSP00000276651:S415A	S	-	1	0	DPYS	105474388	1.000000	0.71417	0.996000	0.52242	0.936000	0.57629	8.962000	0.93254	2.299000	0.77371	0.528000	0.53228	TCA	.	.	none		0.368	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385	
KLHL40	131377	hgsc.bcm.edu	37	3	42728044	42728044	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:42728044T>C	ENST00000287777.4	+	1	1034	c.934T>C	c.(934-936)Ttc>Ctc	p.F312L		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	312					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											CACCCTGCGCTTCGGCATGTT	0.572																																					p.F312L		Atlas-SNP	.											KBTBD5,NS,carcinoma,-2,1	.	.	1	0			c.T934C						scavenged	.						158.0	154.0	155.0					3																	42728044		2203	4300	6503	SO:0001583	missense	131377	exon1			CTGCGCTTCGGCA	AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.934T>C	3.37:g.42728044T>C	ENSP00000287777:p.Phe312Leu	Somatic	192	0	0		WXS	Illumina HiSeq	Phase_I	240	3	0.0125	NM_152393	Q86SI1|Q96MR2	Missense_Mutation	SNP	ENST00000287777.4	37	CCDS2703.1	.	.	.	.	.	.	.	.	.	.	T	17.17	3.321161	0.60634	.	.	ENSG00000157119	ENST00000287777;ENST00000452129	T	0.70749	-0.51	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.64316	0.2587	L	0.52126	1.63	0.80722	D	1	B	0.20052	0.041	B	0.15484	0.013	T	0.60026	-0.7343	10	0.22706	T	0.39	.	14.8619	0.70387	0.0:0.0:0.0:1.0	.	312	Q2TBA0	KBTB5_HUMAN	L	312;57	ENSP00000287777:F312L	ENSP00000287777:F312L	F	+	1	0	KBTBD5	42703048	1.000000	0.71417	0.998000	0.56505	0.809000	0.45718	6.289000	0.72696	1.937000	0.56155	0.533000	0.62120	TTC	.	.	none		0.572	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256651.1	NM_152393	
BSN	8927	hgsc.bcm.edu	37	3	49692749	49692749	+	Silent	SNP	C	C	T	rs185582385	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:49692749C>T	ENST00000296452.4	+	5	5874	c.5760C>T	c.(5758-5760)gcC>gcT	p.A1920A		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	1920					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TCCACCCGGCCCCCAGTGTGC	0.637													C|||	2	0.000399361	0.0	0.0014	5008	,	,		19178	0.0		0.001	False		,,,				2504	0.0				p.A1920A		Atlas-SNP	.											.	BSN	272	.	0			c.C5760T						PASS	.						40.0	40.0	40.0					3																	49692749		2203	4299	6502	SO:0001819	synonymous_variant	8927	exon5			CCCGGCCCCCAGT	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.5760C>T	3.37:g.49692749C>T		Somatic	192	0	0		WXS	Illumina HiSeq	Phase_I	254	68	0.267717	NM_003458	O43161|Q7LGH3	Silent	SNP	ENST00000296452.4	37	CCDS2800.1																																																																																			C|0.999;T|0.001	0.001	strong		0.637	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
MUC4	4585	hgsc.bcm.edu	37	3	195509606	195509606	+	Missense_Mutation	SNP	C	C	T	rs200244334		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:195509606C>T	ENST00000463781.3	-	2	9304	c.8845G>A	c.(8845-8847)Gac>Aac	p.D2949N	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2949N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.592																																					p.D2949N		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.G8845A						scavenged	.						10.0	8.0	9.0					3																	195509606		648	1501	2149	SO:0001583	missense	4585	exon2			AAGTGTCGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8845G>A	3.37:g.195509606C>T	ENSP00000417498:p.Asp2949Asn	Somatic	200	5	0.025		WXS	Illumina HiSeq	Phase_I	244	5	0.0204918	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	7.799	0.713161	0.15306	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30182	1.54;1.54	.	.	.	.	.	.	.	.	T	0.11281	0.0275	N	0.19112	0.55	0.09310	N	1	P	0.50710	0.938	B	0.29663	0.105	T	0.19484	-1.0304	7	.	.	.	.	3.2503	0.06812	0.0:0.638:0.0:0.362	.	2821	E7ESK3	.	N	2949	ENSP00000417498:D2949N;ENSP00000420243:D2949N	.	D	-	1	0	MUC4	196994385	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.907000	0.04067	-0.000000	0.14550	0.000000	0.15137	GAC	C|0.625;T|0.375	0.375	strong		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PRPF40A	55660	hgsc.bcm.edu	37	2	153547487	153547487	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:153547487C>T	ENST00000410080.1	-	5	875	c.334G>A	c.(334-336)Gca>Aca	p.A112T		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	139					cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						GCACCAGATGCTGTACCTAAA	0.254																																					p.A112T		Atlas-SNP	.											.	PRPF40A	149	.	0			c.G334A						PASS	.						15.0	15.0	15.0					2																	153547487		1762	4001	5763	SO:0001583	missense	55660	exon5			CAGATGCTGTACC	AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.334G>A	2.37:g.153547487C>T	ENSP00000386458:p.Ala112Thr	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	85	5	0.0588235	NM_017892	O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Missense_Mutation	SNP	ENST00000410080.1	37	CCDS46430.1	.	.	.	.	.	.	.	.	.	.	C	4.111	0.018714	0.07959	.	.	ENSG00000196504	ENST00000410080;ENST00000440252;ENST00000545856;ENST00000493468	T	0.35236	1.32	4.59	-2.47	0.06442	.	.	.	.	.	T	0.13415	0.0325	N	0.08118	0	0.24969	N	0.991671	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.33033	-0.9884	9	0.10111	T	0.7	16.2594	4.8208	0.13390	0.1543:0.3167:0.0:0.5289	.	139;112	O75400-3;E9PFS0	.;.	T	112;8;139;132	ENSP00000386458:A112T	ENSP00000386458:A112T	A	-	1	0	PRPF40A	153255733	0.088000	0.21588	0.976000	0.42696	0.886000	0.51366	-1.734000	0.01848	-0.351000	0.08249	-0.237000	0.12165	GCA	.	.	none		0.254	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333559.2	XM_371575	
TRPV6	55503	hgsc.bcm.edu	37	7	142572885	142572885	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:142572885C>T	ENST00000359396.3	-	9	1400	c.1155G>A	c.(1153-1155)cgG>cgA	p.R385R	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	385					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					CCCCGACCAGCCGGATATCGT	0.562																																					p.R385R		Atlas-SNP	.											TRPV6,colon,carcinoma,-1,1	TRPV6	108	1	0			c.G1155A						scavenged	.						119.0	108.0	112.0					7																	142572885		2203	4300	6503	SO:0001819	synonymous_variant	55503	exon9			GACCAGCCGGATA	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1155G>A	7.37:g.142572885C>T		Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	137	2	0.0145985	NM_018646	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Silent	SNP	ENST00000359396.3	37	CCDS5874.1																																																																																			.	.	none		0.562	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274	
PYGL	5836	hgsc.bcm.edu	37	14	51378473	51378473	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:51378473G>A	ENST00000216392.7	-	16	2276	c.1944C>T	c.(1942-1944)aaC>aaT	p.N648N	RP11-218E20.5_ENST00000557343.1_RNA|PYGL_ENST00000544180.2_Silent_p.N614N|PYGL_ENST00000532462.1_Silent_p.N648N	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	648					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|necroptotic process (GO:0070266)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	AMP binding (GO:0016208)|ATP binding (GO:0005524)|bile acid binding (GO:0032052)|drug binding (GO:0008144)|glucose binding (GO:0005536)|glycogen phosphorylase activity (GO:0008184)|protein homodimerization activity (GO:0042803)|purine nucleobase binding (GO:0002060)|pyridoxal phosphate binding (GO:0030170)|vitamin binding (GO:0019842)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)	ATACTCTGTAGTTCTCCAAGA	0.438																																					p.N648N		Atlas-SNP	.											.	PYGL	77	.	0			c.C1944T						PASS	.						86.0	78.0	81.0					14																	51378473		2203	4300	6503	SO:0001819	synonymous_variant	5836	exon16			TCTGTAGTTCTCC		CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	2.4.1.1	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""			2877458	Standard	NM_002863		Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.1944C>T	14.37:g.51378473G>A		Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	212	56	0.264151	NM_002863	A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	Silent	SNP	ENST00000216392.7	37	CCDS32080.1																																																																																			.	.	none		0.438	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390654.3	NM_002863	
PSPH	5723	hgsc.bcm.edu	37	7	56085002	56085002	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:56085002C>T	ENST00000395471.3	-	6	1151	c.346G>A	c.(346-348)Gta>Ata	p.V116I	PSPH_ENST00000459834.1_Intron|PSPH_ENST00000275605.3_Missense_Mutation_p.V116I			P78330	SERB_HUMAN	phosphoserine phosphatase	116					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)	p.V116I(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACATGCTCTACAATACTCCTA	0.393																																					p.V116I		Atlas-SNP	.											PSPH,NS,carcinoma,0,2	PSPH	23	2	1	Substitution - Missense(1)	lung(1)	c.G346A						scavenged	.						87.0	75.0	79.0					7																	56085002		2203	4300	6503	SO:0001583	missense	5723	exon6			GCTCTACAATACT	Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.346G>A	7.37:g.56085002C>T	ENSP00000378854:p.Val116Ile	Somatic	519	7	0.0134875		WXS	Illumina HiSeq	Phase_I	578	9	0.0155709	NM_004577	B2RCR5|Q7Z3S5	Missense_Mutation	SNP	ENST00000395471.3	37	CCDS5522.1	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432510	0.25813	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626	D;D;D	0.81908	-1.55;-1.55;-1.55	4.85	4.85	0.62838	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.65228	0.2671	N	0.05124	-0.11	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.18263	0.021;0.021	T	0.62992	-0.6736	10	0.02654	T	1	-16.2549	17.1115	0.86676	0.0:1.0:0.0:0.0	.	116;116	Q53EY1;P78330	.;SERB_HUMAN	I	116	ENSP00000275605:V116I;ENSP00000378854:V116I;ENSP00000398653:V116I	ENSP00000275605:V116I	V	-	1	0	PSPH	56052496	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.551000	0.82182	2.297000	0.77311	0.579000	0.79373	GTA	.	.	none		0.393	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343304.1	NM_004577	
LARP1	23367	hgsc.bcm.edu	37	5	154179585	154179585	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:154179585T>C	ENST00000336314.4	+	10	1492	c.1468T>C	c.(1468-1470)Tcc>Ccc	p.S490P		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	567					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCCTCGGCCATCCCCAGCACG	0.577																																					p.S490P		Atlas-SNP	.											.	LARP1	187	.	0			c.T1468C						PASS	.						50.0	49.0	49.0					5																	154179585		2203	4300	6503	SO:0001583	missense	23367	exon10			CGGCCATCCCCAG	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.1468T>C	5.37:g.154179585T>C	ENSP00000336721:p.Ser490Pro	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	56	46	0.821429	NM_015315	O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	ENST00000336314.4	37	CCDS4328.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.300724	0.81136	.	.	ENSG00000155506	ENST00000336314;ENST00000518297;ENST00000524248;ENST00000523163;ENST00000518742	T;T;T;T;T	0.52983	1.83;1.39;1.42;0.73;0.64	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.51483	0.1677	M	0.76574	2.34	0.80722	D	1	B;B	0.27068	0.167;0.084	B;B	0.25614	0.048;0.062	T	0.50767	-0.8789	10	0.48119	T	0.1	-22.2417	16.4484	0.83959	0.0:0.0:0.0:1.0	.	567;490	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	P	490;567;362;275;165	ENSP00000336721:S490P;ENSP00000428589:S567P;ENSP00000429904:S362P;ENSP00000430438:S275P;ENSP00000431072:S165P	ENSP00000336721:S490P	S	+	1	0	LARP1	154159778	1.000000	0.71417	0.999000	0.59377	0.618000	0.37518	5.893000	0.69798	2.285000	0.76669	0.533000	0.62120	TCC	.	.	none		0.577	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	
MUC5B	727897	hgsc.bcm.edu	37	11	1253691	1253691	+	Missense_Mutation	SNP	C	C	T	rs56411917	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:1253691C>T	ENST00000529681.1	+	16	1913	c.1855C>T	c.(1855-1857)Cgg>Tgg	p.R619W	MUC5B_ENST00000447027.1_Missense_Mutation_p.R622W	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	619	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GAACTACGCCCGGCACTGGTG	0.662													c|||	4	0.000798722	0.0	0.0	5008	,	,		16017	0.001		0.002	False		,,,				2504	0.001				p.R619W		Atlas-SNP	.											.	MUC5B	473	.	0			c.C1855T						PASS	.	C	TRP/ARG	3,4183		0,3,2090	38.0	43.0	42.0		1855	4.3	0.9	11	dbSNP_129	42	32,8388		0,32,4178	yes	missense	MUC5B	NM_002458.2	101	0,35,6268	TT,TC,CC		0.38,0.0717,0.2776	probably-damaging	619/5763	1253691	35,12571	2093	4210	6303	SO:0001583	missense	727897	exon16			TACGCCCGGCACT	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1855C>T	11.37:g.1253691C>T	ENSP00000436812:p.Arg619Trp	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	96	42	0.4375	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	6.454	0.451926	0.12283	7.17E-4	0.0038	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.77229	-1.08;-1.08	4.32	4.32	0.51571	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	.	.	.	.	D	0.85557	0.5724	M	0.79475	2.455	0.09310	N	1	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.70935	0.761;0.971;0.971	T	0.75451	-0.3313	9	0.87932	D	0	.	6.7306	0.23381	0.1774:0.732:0.0:0.0907	rs56411917	619;1278;622	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	W	619;622;620;655	ENSP00000436812:R619W;ENSP00000415793:R622W	ENSP00000343037:R620W	R	+	1	2	MUC5B	1210267	0.000000	0.05858	0.905000	0.35620	0.385000	0.30292	-0.600000	0.05693	1.946000	0.56461	0.462000	0.41574	CGG	C|0.997;T|0.003	0.003	strong		0.662	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
DNAH8	1769	hgsc.bcm.edu	37	6	38942190	38942190	+	Missense_Mutation	SNP	G	G	A	rs201939427		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:38942190G>A	ENST00000359357.3	+	83	12322	c.12068G>A	c.(12067-12069)cGc>cAc	p.R4023H	DNAH8_ENST00000441566.1_Missense_Mutation_p.R3987H			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4023	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CAAGGTGTACGCGCAGGTTTG	0.363													G|||	1	0.000199681	0.0	0.0	5008	,	,		17765	0.001		0.0	False		,,,				2504	0.0				p.R4240H		Atlas-SNP	.											DNAH8_ENST00000359357,caecum,carcinoma,+1,4	DNAH8	1239	4	0			c.G12719A						scavenged	.						78.0	71.0	73.0					6																	38942190		2203	4300	6503	SO:0001583	missense	1769	exon85			GTGTACGCGCAGG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12068G>A	6.37:g.38942190G>A	ENSP00000352312:p.Arg4023His	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	116	2	0.0172414	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	22.4	4.291594	0.80914	.	.	ENSG00000124721	ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.08807	3.05;3.05;3.05	5.84	5.84	0.93424	Dynein heavy chain (1);	0.065044	0.56097	D	0.000021	T	0.22781	0.0550	M	0.84433	2.695	0.48040	D	0.999574	D;D	0.89917	1.0;1.0	D;D	0.74023	0.969;0.982	T	0.00653	-1.1625	10	0.45353	T	0.12	.	13.3475	0.60582	0.0717:0.0:0.9283:0.0	.	3987;4023	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	H	4228;4023;3987	ENSP00000333363:R4228H;ENSP00000352312:R4023H;ENSP00000402294:R3987H	ENSP00000333363:R4228H	R	+	2	0	DNAH8	39050168	0.940000	0.31905	0.745000	0.31077	0.953000	0.61014	3.628000	0.54259	2.764000	0.94973	0.655000	0.94253	CGC	G|1.000;A|0.000	0.000	strong		0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
RAI1	10743	hgsc.bcm.edu	37	17	17701758	17701758	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:17701758C>T	ENST00000353383.1	+	3	5965	c.5496C>T	c.(5494-5496)acC>acT	p.T1832T	RAI1_ENST00000261641.6_Intron	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1832					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CCGTGTGGACCGGCGGCGTCT	0.677																																					p.T1832T		Atlas-SNP	.											.	RAI1	121	.	0			c.C5496T						PASS	.						21.0	21.0	21.0					17																	17701758		2200	4298	6498	SO:0001819	synonymous_variant	10743	exon3			GTGGACCGGCGGC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.5496C>T	17.37:g.17701758C>T		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	24	11	0.458333	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	ENST00000353383.1	37	CCDS11188.1																																																																																			.	.	none		0.677	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
TRPM3	80036	hgsc.bcm.edu	37	9	73477843	73477843	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:73477843C>T	ENST00000377111.2	-	3	686	c.443G>A	c.(442-444)gGc>gAc	p.G148D	TRPM3_ENST00000396285.1_5'Flank|TRPM3_ENST00000377097.3_5'UTR|TRPM3_ENST00000360823.2_5'UTR|TRPM3_ENST00000437699.3_5'UTR|TRPM3_ENST00000377110.3_Missense_Mutation_p.G148D|TRPM3_ENST00000358082.3_5'Flank|TRPM3_ENST00000377101.1_5'UTR|TRPM3_ENST00000357533.2_Missense_Mutation_p.G150D|TRPM3_ENST00000396280.5_5'Flank|TRPM3_ENST00000396292.4_5'Flank|TRPM3_ENST00000408909.2_5'Flank|TRPM3_ENST00000377105.1_5'UTR|TRPM3_ENST00000423814.3_Missense_Mutation_p.G150D|TRPM3_ENST00000361823.5_5'UTR|TRPM3_ENST00000377106.1_5'UTR|TRPM3_ENST00000396283.1_5'UTR	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	148					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GTTGGAATGGCCACCTCCTTG	0.473																																					p.G148D		Atlas-SNP	.											.	TRPM3	700	.	0			c.G443A						PASS	.						217.0	202.0	207.0					9																	73477843		2203	4300	6503	SO:0001583	missense	80036	exon3			GAATGGCCACCTC	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.443G>A	9.37:g.73477843C>T	ENSP00000366315:p.Gly148Asp	Somatic	299	0	0		WXS	Illumina HiSeq	Phase_I	212	82	0.386792	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.82|14.82	2.649070|2.649070	0.47362|0.47362	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000377097|ENST00000377111;ENST00000377110;ENST00000357533;ENST00000423814	.|T;T;T;T	.|0.04360	.|3.64;3.64;3.64;3.64	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.24470|0.24470	0.0593|0.0593	M|M	0.75615|0.75615	2.305|2.305	0.80722|0.80722	D|D	1|1	.|D;D;B;B	.|0.89917	.|0.991;1.0;0.078;0.065	.|P;D;B;B	.|0.97110	.|0.874;1.0;0.108;0.071	T|T	0.00025|0.00025	-1.2321|-1.2321	5|10	.|0.59425	.|D	.|0.04	-15.6026|-15.6026	20.3854|20.3854	0.98941|0.98941	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|148;150;148;148	.|Q9HCF6;Q4VXD2;Q9HCF6-2;Q9HCF6-10	.|TRPM3_HUMAN;.;.;.	T|D	38|148;148;150;150	.|ENSP00000366315:G148D;ENSP00000366314:G148D;ENSP00000350140:G150D;ENSP00000389542:G150D	.|ENSP00000350140:G150D	A|G	-|-	1|2	0|0	TRPM3|TRPM3	72667663|72667663	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.986000|0.986000	0.74619|0.74619	4.564000|4.564000	0.60830|0.60830	2.825000|2.825000	0.97269|0.97269	0.655000|0.655000	0.94253|0.94253	GCC|GGC	.	.	none		0.473	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
PKD1L1	168507	hgsc.bcm.edu	37	7	47876625	47876625	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:47876625G>A	ENST00000289672.2	-	37	5887	c.5837C>T	c.(5836-5838)cCc>cTc	p.P1946L		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1946					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GCTGGAGGAGGGCCTGCTGTA	0.582																																					p.P1946L		Atlas-SNP	.											.	PKD1L1	328	.	0			c.C5837T						PASS	.						60.0	53.0	55.0					7																	47876625		2203	4300	6503	SO:0001583	missense	168507	exon37			GAGGAGGGCCTGC	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.5837C>T	7.37:g.47876625G>A	ENSP00000289672:p.Pro1946Leu	Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	169	42	0.248521	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354085	0.82243	.	.	ENSG00000158683	ENST00000289672	T	0.28895	1.59	5.1	4.22	0.49857	.	0.000000	0.64402	D	0.000005	T	0.58481	0.2125	M	0.87381	2.88	0.49687	D	0.999811	D	0.89917	1.0	D	0.87578	0.998	T	0.64360	-0.6426	10	0.72032	D	0.01	-33.0327	11.2105	0.48795	0.0904:0.0:0.9096:0.0	.	1946	Q8TDX9	PK1L1_HUMAN	L	1946	ENSP00000289672:P1946L	ENSP00000289672:P1946L	P	-	2	0	PKD1L1	47843150	1.000000	0.71417	0.890000	0.34922	0.996000	0.88848	6.472000	0.73567	1.134000	0.42165	0.655000	0.94253	CCC	.	.	none		0.582	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
NEBL	10529	hgsc.bcm.edu	37	10	21120221	21120221	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:21120221C>T	ENST00000377122.4	-	16	1971	c.1575G>A	c.(1573-1575)aaG>aaA	p.K525K	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	525					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTTCTAAGTCCTTCTTGTATT	0.363																																					p.K525K		Atlas-SNP	.											NEBL,NS,carcinoma,0,1	NEBL	199	1	0			c.G1575A						scavenged	.						130.0	118.0	122.0					10																	21120221		2203	4300	6503	SO:0001819	synonymous_variant	10529	exon16			TAAGTCCTTCTTG	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.1575G>A	10.37:g.21120221C>T		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	59	2	0.0338983	NM_006393	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	ENST00000377122.4	37	CCDS7134.1																																																																																			.	.	none		0.363	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393	
OR52M1	119772	hgsc.bcm.edu	37	11	4567169	4567169	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:4567169C>T	ENST00000360213.1	+	1	749	c.749C>T	c.(748-750)gCc>gTc	p.A250V		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACCTCTGTGCCATCCTGATC	0.507																																					p.A250V		Atlas-SNP	.											OR52M1,NS,carcinoma,0,1	OR52M1	53	1	0			c.C749T						scavenged	.						306.0	263.0	277.0					11																	4567169		2201	4298	6499	SO:0001583	missense	119772	exon1			TCTGTGCCATCCT	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.749C>T	11.37:g.4567169C>T	ENSP00000353343:p.Ala250Val	Somatic	258	1	0.00387597		WXS	Illumina HiSeq	Phase_I	186	4	0.0215054	NM_001004137		Missense_Mutation	SNP	ENST00000360213.1	37	CCDS31353.1	.	.	.	.	.	.	.	.	.	.	C	4.084	0.013444	0.07959	.	.	ENSG00000197790	ENST00000360213	T	0.00021	9.03	4.91	1.97	0.26223	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000248	T	0.00178	0.0005	L	0.35487	1.065	0.25267	N	0.989546	D	0.89917	1.0	D	0.91635	0.999	T	0.43750	-0.9372	10	0.02654	T	1	.	8.4867	0.33076	0.2761:0.6468:0.0:0.0771	.	250	Q8NGK5	O52M1_HUMAN	V	250	ENSP00000353343:A250V	ENSP00000353343:A250V	A	+	2	0	OR52M1	4523745	0.676000	0.27567	0.968000	0.41197	0.478000	0.33099	0.835000	0.27531	0.747000	0.32809	-0.127000	0.14921	GCC	.	.	none		0.507	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385847.1	NM_001004137	
CD96	10225	hgsc.bcm.edu	37	3	111319650	111319650	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:111319650A>T	ENST00000283285.5	+	8	1155	c.1024A>T	c.(1024-1026)Agt>Tgt	p.S342C	CD96_ENST00000438817.2_Missense_Mutation_p.S326C|CD96_ENST00000352690.4_Missense_Mutation_p.S326C	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	342	Ig-like C2-type.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						AAGGGTACATAGTAATAAACC	0.393									Opitz Trigonocephaly syndrome																												p.S342C		Atlas-SNP	.											CD96,NS,carcinoma,-1,1	CD96	75	1	0			c.A1024T						scavenged	.						113.0	113.0	113.0					3																	111319650		2203	4300	6503	SO:0001583	missense	10225	exon8	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	GTACATAGTAATA	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.1024A>T	3.37:g.111319650A>T	ENSP00000283285:p.Ser342Cys	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	194	2	0.0103093	NM_198196	Q5JPB3	Missense_Mutation	SNP	ENST00000283285.5	37	CCDS2959.1	.	.	.	.	.	.	.	.	.	.	A	14.31	2.496064	0.44352	.	.	ENSG00000153283	ENST00000352690;ENST00000283285;ENST00000438817	T;T;T	0.00630	6.1;6.1;6.1	5.04	-1.91	0.07641	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.663960	0.03159	N	0.169078	T	0.00784	0.0026	N	0.14661	0.345	0.09310	N	1	P;P;P;P	0.47604	0.805;0.768;0.805;0.898	P;B;P;P	0.48488	0.579;0.443;0.579;0.579	T	0.44697	-0.9311	10	0.59425	D	0.04	0.8561	5.6216	0.17459	0.2829:0.3766:0.3405:0.0	.	326;326;342;326	E9PEJ1;P40200-2;P40200;Q8WUE2	.;.;TACT_HUMAN;.	C	326;342;326	ENSP00000342040:S326C;ENSP00000283285:S342C;ENSP00000389801:S326C	ENSP00000283285:S342C	S	+	1	0	CD96	112802340	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.091000	0.11146	-0.136000	0.11475	-0.417000	0.06048	AGT	.	.	none		0.393	CD96-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354312.2		
TCHH	7062	hgsc.bcm.edu	37	1	152082269	152082269	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:152082269C>T	ENST00000368804.1	-	2	3423	c.3424G>A	c.(3424-3426)Gag>Aag	p.E1142K		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1142	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			tcctcttcctcccgatattgc	0.602																																					p.E1142K		Atlas-SNP	.											TCHH,NS,malignant_melanoma,0,1	TCHH	275	1	0			c.G3424A						scavenged	.						88.0	86.0	87.0					1																	152082269		1995	4159	6154	SO:0001583	missense	7062	exon3			CTTCCTCCCGATA	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3424G>A	1.37:g.152082269C>T	ENSP00000357794:p.Glu1142Lys	Somatic	145	1	0.00689655		WXS	Illumina HiSeq	Phase_I	141	5	0.035461	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.334416	0.24253	.	.	ENSG00000159450	ENST00000368804	T	0.05786	3.39	2.89	1.94	0.25998	.	.	.	.	.	T	0.01489	0.0048	N	0.24115	0.695	0.09310	N	1	P	0.47762	0.9	B	0.37989	0.262	T	0.48445	-0.9035	9	0.46703	T	0.11	.	9.5203	0.39131	0.0:0.7829:0.2171:0.0	.	1142	Q07283	TRHY_HUMAN	K	1142	ENSP00000357794:E1142K	ENSP00000357794:E1142K	E	-	1	0	TCHH	150348893	0.001000	0.12720	0.001000	0.08648	0.229000	0.25112	0.771000	0.26633	0.375000	0.24679	0.455000	0.32223	GAG	.	.	none		0.602	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
OVCH1	341350	hgsc.bcm.edu	37	12	29604411	29604411	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:29604411A>G	ENST00000318184.5	-	22	2621	c.2622T>C	c.(2620-2622)tcT>tcC	p.S874S	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	874	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TGAGCACCCAAGAACATTCCA	0.438																																					p.S874S		Atlas-SNP	.											.	OVCH1	195	.	0			c.T2622C						PASS	.						85.0	80.0	81.0					12																	29604411		1880	4105	5985	SO:0001819	synonymous_variant	341350	exon22			CACCCAAGAACAT	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.2622T>C	12.37:g.29604411A>G		Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	121	33	0.272727	NM_183378		Silent	SNP	ENST00000318184.5	37																																																																																				.	.	none		0.438	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
MUC4	4585	hgsc.bcm.edu	37	3	195508975	195508975	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:195508975G>T	ENST00000463781.3	-	2	9935	c.9476C>A	c.(9475-9477)tCc>tAc	p.S3159Y	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S3159Y	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S3159Y(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATGCTGAGGAAGTGTCGGT	0.582																																					p.S3159Y		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - Missense(1)	endometrium(1)	c.C9476A						scavenged	.						5.0	4.0	4.0					3																	195508975		554	1286	1840	SO:0001583	missense	4585	exon2			GCTGAGGAAGTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9476C>A	3.37:g.195508975G>T	ENSP00000417498:p.Ser3159Tyr	Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	155	4	0.0258065	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	3.452	-0.111711	0.06881	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30714	1.52;1.53	.	.	.	.	.	.	.	.	T	0.15219	0.0367	N	0.19112	0.55	0.09310	N	1	P	0.50156	0.932	B	0.40782	0.34	T	0.10870	-1.0611	7	.	.	.	.	2.6645	0.05037	0.495:0.0:0.505:0.0	.	3031	E7ESK3	.	Y	3159	ENSP00000417498:S3159Y;ENSP00000420243:S3159Y	.	S	-	2	0	MUC4	196993754	0.058000	0.20735	0.017000	0.16124	0.017000	0.09413	0.351000	0.20096	0.073000	0.16731	0.074000	0.15403	TCC	G|0.500;T|0.500	0.500	strong		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CLP1	10978	hgsc.bcm.edu	37	11	57427378	57427378	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:57427378C>T	ENST00000533682.1	+	2	1155	c.430C>T	c.(430-432)Cgt>Tgt	p.R144C	CLP1_ENST00000529430.1_Missense_Mutation_p.R155C|CLP1_ENST00000525602.1_Missense_Mutation_p.R144C|CLP1_ENST00000302731.4_Intron			Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						TTTGGGCCGCCGTCCCACTTA	0.607																																					p.R144C		Atlas-SNP	.											CLP1,NS,carcinoma,-1,1	CLP1	40	1	0			c.C430T						scavenged	.						94.0	76.0	82.0					11																	57427378		2201	4296	6497	SO:0001583	missense	10978	exon2			GGCCGCCGTCCCA	BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000533682.1:c.430C>T	11.37:g.57427378C>T	ENSP00000434995:p.Arg144Cys	Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	133	3	0.0225564	NM_006831	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000533682.1	37	CCDS7964.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.363806	0.61513	.	.	ENSG00000172409	ENST00000529430;ENST00000533682;ENST00000525602	T;T;T	0.26223	1.75;1.75;1.75	5.79	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.36303	0.0962	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.02064	-1.1220	10	0.37606	T	0.19	-19.1296	13.6726	0.62434	0.2765:0.7235:0.0:0.0	.	144	Q92989	CLP1_HUMAN	C	155;144;144	ENSP00000433406:R155C;ENSP00000434995:R144C;ENSP00000436066:R144C	ENSP00000436066:R144C	R	+	1	0	CLP1	57183954	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.514000	0.45503	2.737000	0.93849	0.643000	0.83706	CGT	.	.	none		0.607	CLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393462.3	NM_006831	
SLC4A7	9497	hgsc.bcm.edu	37	3	27424644	27424644	+	Splice_Site	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:27424644C>A	ENST00000295736.5	-	24	3633	c.3563G>T	c.(3562-3564)aGt>aTt	p.S1188I	SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000440156.1_Splice_Site_p.S1184I|SLC4A7_ENST00000455077.1_Splice_Site_p.S1069I|SLC4A7_ENST00000446700.1_Splice_Site_p.S1180I|SLC4A7_ENST00000454389.1_Splice_Site_p.S1197I|SLC4A7_ENST00000428386.1_Splice_Site_p.S1064I|SLC4A7_ENST00000435667.2_Splice_Site_p.S1073I|SLC4A7_ENST00000437179.1_Splice_Site_p.S1069I|SLC4A7_ENST00000445684.1_Splice_Site_p.S1184I|SLC4A7_ENST00000388777.4_Splice_Site_p.S738I	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	1188					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	CATATCTCACCTATATTTTAG	0.333																																					p.S1188I		Atlas-SNP	.											.	SLC4A7	119	.	0			c.G3563T						PASS	.						100.0	97.0	98.0					3																	27424644		2203	4300	6503	SO:0001630	splice_region_variant	9497	exon24			TCTCACCTATATT	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.3563+1G>T	3.37:g.27424644C>A		Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	109	22	0.201835	NM_003615	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	37	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446651	0.63178	.	.	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777	T;T;T;T;T;T;T;T;T;T;T	0.80994	-1.44;-1.24;-1.25;-1.13;-1.21;-1.25;-1.32;-1.16;-1.32;-1.16;-1.44	5.41	5.41	0.78517	.	0.254953	0.42964	D	0.000621	D	0.85737	0.5766	L	0.39898	1.24	0.80722	D	1	D;D;D;P;B;B;D;D;B	0.67145	0.996;0.99;0.996;0.543;0.048;0.001;0.994;0.996;0.002	D;D;D;B;B;B;D;D;B	0.74348	0.974;0.962;0.974;0.059;0.017;0.009;0.983;0.974;0.006	D	0.84259	0.0482	9	.	.	.	.	18.784	0.91946	0.0:1.0:0.0:0.0	.	1184;1069;1180;1184;1197;738;1064;1188;1069	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	I	739;1188;1064;1197;1184;1069;1180;1069;1184;1073;738	ENSP00000411031:S739I;ENSP00000295736:S1188I;ENSP00000416368:S1064I;ENSP00000390394:S1197I;ENSP00000414797:S1184I;ENSP00000394252:S1069I;ENSP00000406605:S1180I;ENSP00000407382:S1069I;ENSP00000406804:S1184I;ENSP00000395336:S1073I;ENSP00000373429:S738I	.	S	-	2	0	SLC4A7	27399648	1.000000	0.71417	1.000000	0.80357	0.440000	0.31957	5.587000	0.67510	2.509000	0.84616	0.650000	0.86243	AGT	.	.	none		0.333	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615	Missense_Mutation
SEMA5A	9037	hgsc.bcm.edu	37	5	9066712	9066712	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:9066712G>T	ENST00000382496.5	-	17	2785	c.2120C>A	c.(2119-2121)aCc>aAc	p.T707N		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	707	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CCAGGGCGTGGTCTTCTTCAG	0.557																																					p.T707N		Atlas-SNP	.											.	SEMA5A	236	.	0			c.C2120A						PASS	.						167.0	154.0	158.0					5																	9066712		2203	4300	6503	SO:0001583	missense	9037	exon17			GGCGTGGTCTTCT	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2120C>A	5.37:g.9066712G>T	ENSP00000371936:p.Thr707Asn	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	129	51	0.395349	NM_003966	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	G	8.800	0.932750	0.18131	.	.	ENSG00000112902	ENST00000382496	T	0.36520	1.25	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.19644	0.0472	N	0.14661	0.345	0.54753	D	0.999989	B	0.20550	0.046	B	0.16722	0.016	T	0.07849	-1.0751	10	0.07325	T	0.83	.	12.2699	0.54700	0.0:0.0:0.8304:0.1696	.	707	Q13591	SEM5A_HUMAN	N	707	ENSP00000371936:T707N	ENSP00000371936:T707N	T	-	2	0	SEMA5A	9119712	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.149000	0.71795	2.761000	0.94854	0.591000	0.81541	ACC	.	.	none		0.557	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
PAX4	5078	hgsc.bcm.edu	37	7	127253851	127253851	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:127253851C>T	ENST00000341640.2	-	4	702	c.497G>A	c.(496-498)cGg>cAg	p.R166Q	PAX4_ENST00000463946.1_Missense_Mutation_p.R164Q|PAX4_ENST00000338516.3_Missense_Mutation_p.R174Q|PAX4_ENST00000378740.2_Missense_Mutation_p.R166Q	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	174					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GAAGATAGTCCGATTCCGGTG	0.587																																					p.R166Q	Ovarian(113;737 1605 7858 27720 34092)	Atlas-SNP	.											PAX4,NS,carcinoma,0,1	PAX4	66	1	0			c.G497A						scavenged	.						85.0	83.0	84.0					7																	127253851		2203	4300	6503	SO:0001583	missense	5078	exon4			ATAGTCCGATTCC		CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.497G>A	7.37:g.127253851C>T	ENSP00000339906:p.Arg166Gln	Somatic	133	1	0.0075188		WXS	Illumina HiSeq	Phase_I	147	36	0.244898	NM_006193	O95161|Q6B0H0	Missense_Mutation	SNP	ENST00000341640.2	37	CCDS5797.1	.	.	.	.	.	.	.	.	.	.	C	36	5.598306	0.96614	.	.	ENSG00000106331	ENST00000341640;ENST00000338516;ENST00000378740;ENST00000463946	D;D;D	0.99150	-5.49;-5.49;-5.49	5.32	5.32	0.75619	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.070525	0.64402	D	0.000019	D	0.99423	0.9796	M	0.91249	3.19	0.53688	D	0.999971	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.994	D	0.98683	1.0693	10	0.87932	D	0	.	16.8665	0.86030	0.0:1.0:0.0:0.0	.	166;164;174;164	O43316-4;Q1W386;O43316;G3V4Q1	.;.;PAX4_HUMAN;.	Q	166;174;174;164	ENSP00000339906:R166Q;ENSP00000344297:R174Q;ENSP00000451923:R164Q	ENSP00000344297:R174Q	R	-	2	0	PAX4	127041087	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.543000	0.73874	2.661000	0.90470	0.650000	0.86243	CGG	.	.	none		0.587	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349165.1		
DSEL	92126	hgsc.bcm.edu	37	18	65180354	65180354	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:65180354T>G	ENST00000310045.7	-	2	2995	c.1522A>C	c.(1522-1524)Aac>Cac	p.N508H	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	498					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				AATACATTGTTAAGGTGGCTC	0.483																																					p.N508H		Atlas-SNP	.											.	DSEL	196	.	0			c.A1522C						PASS	.						92.0	83.0	86.0					18																	65180354		2203	4300	6503	SO:0001583	missense	92126	exon2			CATTGTTAAGGTG	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1522A>C	18.37:g.65180354T>G	ENSP00000310565:p.Asn508His	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	206	29	0.140777	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	T	17.58	3.425856	0.62733	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.29917	1.55	5.46	5.46	0.80206	.	0.000000	0.85682	U	0.000000	T	0.57519	0.2059	M	0.80746	2.51	0.53688	D	0.999975	D	0.89917	1.0	D	0.87578	0.998	T	0.59064	-0.7524	10	0.38643	T	0.18	-16.4224	15.2042	0.73165	0.0:0.0:0.0:1.0	.	498	Q8IZU8	DSEL_HUMAN	H	508;498	ENSP00000310565:N508H	ENSP00000310565:N508H	N	-	1	0	DSEL	63331334	1.000000	0.71417	0.988000	0.46212	0.958000	0.62258	7.849000	0.86908	2.083000	0.62718	0.460000	0.39030	AAC	.	.	none		0.483	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
AATF	26574	hgsc.bcm.edu	37	17	35307529	35307529	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:35307529T>C	ENST00000225402.5	+	2	358	c.107T>C	c.(106-108)gTg>gCg	p.V36A		NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor	36					apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				GCTGCCAGGGTGATTGACAGG	0.493																																					p.V36A	NSCLC(49;901 1159 19183 41572 46244)	Atlas-SNP	.											.	AATF	36	.	0			c.T107C						PASS	.						128.0	131.0	130.0					17																	35307529		2203	4300	6503	SO:0001583	missense	26574	exon2			CCAGGGTGATTGA	AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.107T>C	17.37:g.35307529T>C	ENSP00000225402:p.Val36Ala	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	127	50	0.393701	NM_012138	A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	Missense_Mutation	SNP	ENST00000225402.5	37	CCDS32632.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.607702	0.87157	.	.	ENSG00000108270	ENST00000225402	T	0.38887	1.11	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.61337	0.2339	M	0.76574	2.34	0.58432	D	0.999997	D	0.76494	0.999	D	0.78314	0.991	T	0.59440	-0.7454	10	0.10902	T	0.67	-15.8584	15.3994	0.74827	0.0:0.0:0.0:1.0	.	36	Q9NY61	AATF_HUMAN	A	36	ENSP00000225402:V36A	ENSP00000225402:V36A	V	+	2	0	AATF	32381642	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.762000	0.74950	2.117000	0.64856	0.402000	0.26972	GTG	.	.	none		0.493	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451543.1	NM_012138	
FMNL2	114793	hgsc.bcm.edu	37	2	153463872	153463872	+	Missense_Mutation	SNP	G	G	A	rs377497365		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:153463872G>A	ENST00000288670.9	+	10	1263	c.896G>A	c.(895-897)cGc>cAc	p.R299H		NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	299	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						GAAAAACAGCGCTTTGAGAAG	0.313													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18174	0.0		0.0	False		,,,				2504	0.0				p.R299H		Atlas-SNP	.											.	FMNL2	75	.	0			c.G896A						PASS	.	G	HIS/ARG	1,3705		0,1,1852	92.0	88.0	89.0		896	5.9	1.0	2		89	0,8204		0,0,4102	no	missense	FMNL2	NM_052905.3	29	0,1,5954	AA,AG,GG		0.0,0.027,0.0084	probably-damaging	299/1093	153463872	1,11909	1853	4102	5955	SO:0001583	missense	114793	exon10			AACAGCGCTTTGA	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.896G>A	2.37:g.153463872G>A	ENSP00000288670:p.Arg299His	Somatic	369	0	0		WXS	Illumina HiSeq	Phase_I	278	81	0.291367	NM_052905	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000288670.9	37	CCDS46429.1	.	.	.	.	.	.	.	.	.	.	G	35	5.436354	0.96168	2.7E-4	0.0	ENSG00000157827	ENST00000288670	D	0.89875	-2.58	5.92	5.92	0.95590	.	0.092942	0.85682	D	0.000000	D	0.96386	0.8821	H	0.94771	3.58	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.96788	0.9580	10	0.87932	D	0	.	19.9118	0.97027	0.0:0.0:1.0:0.0	.	299	Q96PY5-3	.	H	299	ENSP00000288670:R299H	ENSP00000288670:R299H	R	+	2	0	FMNL2	153172118	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.809000	0.96659	0.557000	0.71058	CGC	.	.	weak		0.313	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905	
MUC4	4585	hgsc.bcm.edu	37	3	195515100	195515100	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:195515100G>A	ENST00000463781.3	-	2	3810	c.3351C>T	c.(3349-3351)caC>caT	p.H1117H	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.H1117H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	556					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGTGTGACCTGTGG	0.567																																					p.H1117H		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-2,1	MUC4	1505	1	0			c.C3351T						scavenged	.						14.0	8.0	9.0					3																	195515100		671	1543	2214	SO:0001819	synonymous_variant	4585	exon2			GGTGGTGTGACCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3351C>T	3.37:g.195515100G>A		Somatic	79	5	0.0632911		WXS	Illumina HiSeq	Phase_I	126	14	0.111111	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	none		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CYP11B2	1585	hgsc.bcm.edu	37	8	143994724	143994724	+	Silent	SNP	C	C	A	rs61757297	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr8:143994724C>A	ENST00000323110.2	-	6	1100	c.1098G>T	c.(1096-1098)cgG>cgT	p.R366R		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	366					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TGAGGGCCGCCCGCAGCAAGG	0.692									Familial Hyperaldosteronism type I				.|||	5	0.000998403	0.0015	0.0029	5008	,	,		16828	0.001		0.0	False		,,,				2504	0.0				p.R366R		Atlas-SNP	.											CYP11B2,mouth,carcinoma,-2,1	CYP11B2	107	1	0			c.G1098T						scavenged	.						43.0	46.0	45.0					8																	143994724		2203	4300	6503	SO:0001819	synonymous_variant	1585	exon6	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	GGCCGCCCGCAGC	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1098G>T	8.37:g.143994724C>A		Somatic	164	3	0.0182927		WXS	Illumina HiSeq	Phase_I	293	11	0.0375427	NM_000498	B0ZBE4|Q16726	Silent	SNP	ENST00000323110.2	37	CCDS6393.1																																																																																			C|0.474;A|0.526	0.526	strong		0.692	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
ZNF521	25925	hgsc.bcm.edu	37	18	22804688	22804688	+	Missense_Mutation	SNP	T	T	G	rs576191621		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:22804688T>G	ENST00000361524.3	-	4	3342	c.3194A>C	c.(3193-3195)tAt>tCt	p.Y1065S	ZNF521_ENST00000584787.1_Missense_Mutation_p.Y845S|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000538137.2_Missense_Mutation_p.Y1065S	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1065					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.Y1065F(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGCGCACTTATACAGTTTTTG	0.502			T	PAX5	ALL																																p.Y1065S		Atlas-SNP	.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	ZNF521,lymph_node,lymphoid_neoplasm,0,1	ZNF521	269	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.A3194C						PASS	.						73.0	62.0	66.0					18																	22804688		2203	4300	6503	SO:0001583	missense	25925	exon4			CACTTATACAGTT	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3194A>C	18.37:g.22804688T>G	ENSP00000354794:p.Tyr1065Ser	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	162	28	0.17284	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	T	9.873	1.199473	0.22121	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.10005	3.0;2.92	5.86	5.86	0.93980	.	0.120227	0.64402	D	0.000019	T	0.18635	0.0447	L	0.27053	0.805	0.34858	D	0.742331	P	0.49862	0.929	P	0.56398	0.797	T	0.10086	-1.0645	10	0.87932	D	0	-45.4225	16.2652	0.82574	0.0:0.0:0.0:1.0	.	1065	Q96K83	ZN521_HUMAN	S	1065;1099;1065	ENSP00000354794:Y1065S;ENSP00000382352:Y1065S	ENSP00000354794:Y1065S	Y	-	2	0	ZNF521	21058686	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.773000	0.55333	2.241000	0.73720	0.528000	0.53228	TAT	.	.	none		0.502	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
FLG2	388698	hgsc.bcm.edu	37	1	152327955	152327955	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:152327955G>A	ENST00000388718.5	-	3	2379	c.2307C>T	c.(2305-2307)agC>agT	p.S769S	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	769	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S769S(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTGGCCATAGCTAGACTGAC	0.517																																					p.S769S		Atlas-SNP	.											FLG2,NS,carcinoma,0,1	FLG2	431	1	1	Substitution - coding silent(1)	kidney(1)	c.C2307T						scavenged	.						412.0	337.0	362.0					1																	152327955		2203	4300	6503	SO:0001819	synonymous_variant	388698	exon3			GCCATAGCTAGAC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2307C>T	1.37:g.152327955G>A		Somatic	151	1	0.00662252		WXS	Illumina HiSeq	Phase_I	134	3	0.0223881	NM_001014342	Q9H4U1	Silent	SNP	ENST00000388718.5	37	CCDS30861.1																																																																																			.	.	none		0.517	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
NXF1	10482	hgsc.bcm.edu	37	11	62564687	62564687	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:62564687G>C	ENST00000532297.1	-	14	1775	c.1146C>G	c.(1144-1146)aaC>aaG	p.N382K	NXF1_ENST00000533048.1_5'Flank|NXF1_ENST00000531709.2_3'UTR|NXF1_ENST00000294172.2_Missense_Mutation_p.N382K			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	382					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GACTCTTCAAGTTTTCTGTTC	0.502																																					p.N382K		Atlas-SNP	.											.	NXF1	67	.	0			c.C1146G						PASS	.						66.0	60.0	62.0					11																	62564687		2201	4299	6500	SO:0001583	missense	10482	exon13			CTTCAAGTTTTCT	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.1146C>G	11.37:g.62564687G>C	ENSP00000436679:p.Asn382Lys	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	168	53	0.315476	NM_006362	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	37	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.674708	0.29693	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875	T;T;T	0.62788	-0.0;-0.0;-0.0	5.42	2.51	0.30379	.	0.279688	0.40818	N	0.001013	T	0.34048	0.0884	N	0.05280	-0.08	0.80722	D	1	B;B	0.13145	0.007;0.005	B;B	0.09377	0.002;0.004	T	0.06075	-1.0847	10	0.11485	T	0.65	-12.4081	9.1261	0.36816	0.2447:0.0:0.7553:0.0	.	425;382	E9PIN3;Q9UBU9	.;NXF1_HUMAN	K	382;382;425	ENSP00000294172:N382K;ENSP00000436679:N382K;ENSP00000435742:N425K	ENSP00000294172:N382K	N	-	3	2	NXF1	62321263	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	1.659000	0.37387	0.267000	0.21916	0.555000	0.69702	AAC	.	.	none		0.502	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
FAM46C	54855	hgsc.bcm.edu	37	1	118165588	118165588	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:118165588T>C	ENST00000369448.3	+	2	345	c.98T>C	c.(97-99)gTa>gCa	p.V33A		NM_017709.3	NP_060179.2	Q5VWP2	FA46C_HUMAN	family with sequence similarity 46, member C	33										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	15	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		ACTGAAGTTGTACCTATCCAC	0.552			"""Mis, F, O"""		MM					Multiple Myeloma(3;1.13e-06)																											p.V33A		Atlas-SNP	.		Rec	yes		1	1p12	54855	"""family with sequence similarity 46, member C"""		L	FAM46C,pharynx,carcinoma,-1,1	FAM46C	25	1	0			c.T98C						scavenged	.						101.0	87.0	92.0					1																	118165588		2203	4300	6503	SO:0001583	missense	54855	exon2			AAGTTGTACCTAT	BC036516	CCDS896.1	1p12	2008-02-05			ENSG00000183508	ENSG00000183508			24712	protein-coding gene	gene with protein product		613952				12477932	Standard	NM_017709		Approved	FLJ20202	uc001ehe.3	Q5VWP2	OTTHUMG00000013703	ENST00000369448.3:c.98T>C	1.37:g.118165588T>C	ENSP00000358458:p.Val33Ala	Somatic	164	0	0		WXS	Illumina HiSeq	Phase_I	152	2	0.0131579	NM_017709	A3KMG2|Q8NE25|Q9NXK0	Missense_Mutation	SNP	ENST00000369448.3	37	CCDS896.1	.	.	.	.	.	.	.	.	.	.	T	17.46	3.394398	0.62066	.	.	ENSG00000183508	ENST00000369448	T	0.27557	1.66	5.97	5.97	0.96955	Domain of unknown function DUF1693 (1);	0.000000	0.64402	D	0.000010	T	0.32941	0.0846	M	0.84326	2.69	0.80722	D	1	P	0.40282	0.711	B	0.42062	0.374	T	0.34825	-0.9813	10	0.66056	D	0.02	-9.4992	15.6284	0.76882	0.0:0.0:0.0:1.0	.	33	Q5VWP2	FA46C_HUMAN	A	33	ENSP00000358458:V33A	ENSP00000358458:V33A	V	+	2	0	FAM46C	117967111	1.000000	0.71417	0.174000	0.22961	0.612000	0.37316	7.698000	0.84413	2.281000	0.76405	0.533000	0.62120	GTA	.	.	none		0.552	FAM46C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038424.1	NM_017709	
MCTP2	55784	hgsc.bcm.edu	37	15	94858849	94858849	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:94858849T>C	ENST00000357742.4	+	3	620	c.620T>C	c.(619-621)gTt>gCt	p.V207A	MCTP2_ENST00000451018.3_Missense_Mutation_p.V207A|MCTP2_ENST00000331706.4_5'UTR|MCTP2_ENST00000543482.1_Missense_Mutation_p.V207A	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	207	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CGGAACCTGGTTGTCCGAGAT	0.527																																					p.V207A		Atlas-SNP	.											MCTP2,NS,carcinoma,+1,1	MCTP2	122	1	0			c.T620C						scavenged	.						165.0	138.0	147.0					15																	94858849		2197	4298	6495	SO:0001583	missense	55784	exon3			ACCTGGTTGTCCG	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.620T>C	15.37:g.94858849T>C	ENSP00000350377:p.Val207Ala	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	255	3	0.0117647	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	37	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	T	14.48	2.548454	0.45383	.	.	ENSG00000140563	ENST00000543482;ENST00000556363;ENST00000451018;ENST00000357742	T;T;T	0.68025	-0.3;-0.3;-0.3	6.07	6.07	0.98685	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.58323	0.2114	N	0.02802	-0.49	0.80722	D	1	D;B;D;D;D	0.58970	0.965;0.178;0.984;0.972;0.98	D;B;P;P;P	0.64776	0.929;0.076;0.841;0.906;0.885	T	0.60949	-0.7161	10	0.14656	T	0.56	.	14.1521	0.65392	0.0:0.0:0.0:1.0	.	207;207;207;207;207	F5H415;Q6DN12-2;Q6DN12;B7Z6H2;G3V2J2	.;.;MCTP2_HUMAN;.;.	A	207	ENSP00000438521:V207A;ENSP00000395109:V207A;ENSP00000350377:V207A	ENSP00000350377:V207A	V	+	2	0	MCTP2	92659853	1.000000	0.71417	0.998000	0.56505	0.485000	0.33311	4.463000	0.60128	2.326000	0.78906	0.533000	0.62120	GTT	.	.	none		0.527	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
MSN	4478	hgsc.bcm.edu	37	X	64955264	64955264	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:64955264G>T	ENST00000360270.5	+	8	1103	c.931G>T	c.(931-933)Gag>Tag	p.E311*		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	311					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						ACAGGCCCGGGAGGAGAAGCA	0.587			T	ALK	ALCL																																p.E311X		Atlas-SNP	.		Dom	yes		X	Xq11.2-q12	4478	moesin		L	.	MSN	89	.	0			c.G931T						PASS	.						51.0	33.0	39.0					X																	64955264		2203	4300	6503	SO:0001587	stop_gained	4478	exon8			GCCCGGGAGGAGA	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.931G>T	X.37:g.64955264G>T	ENSP00000353408:p.Glu311*	Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	77	55	0.714286	NM_002444		Nonsense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	G	39	7.666558	0.98422	.	.	ENSG00000147065	ENST00000360270	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	16.7763	0.85551	0.0:0.0:1.0:0.0	.	.	.	.	X	311	.	ENSP00000353408:E311X	E	+	1	0	MSN	64871989	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.756000	0.98918	2.278000	0.76064	0.594000	0.82650	GAG	.	.	none		0.587	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
PDE10A	10846	hgsc.bcm.edu	37	6	165848819	165848819	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:165848819C>T	ENST00000366882.1	-	7	567	c.413G>A	c.(412-414)cGc>cAc	p.R138H	PDE10A_ENST00000354448.4_Missense_Mutation_p.R138H|PDE10A_ENST00000539869.2_Missense_Mutation_p.R148H			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	138	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.R138H(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	AGGGATGAGGCGGGGTTTTCC	0.488																																					p.R148H	Esophageal Squamous(22;308 615 5753 12038 40624)	Atlas-SNP	.											PDE10A,NS,carcinoma,-1,3	PDE10A	154	3	1	Substitution - Missense(1)	large_intestine(1)	c.G443A						PASS	.						146.0	125.0	132.0					6																	165848819		2203	4300	6503	SO:0001583	missense	10846	exon6			ATGAGGCGGGGTT	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.413G>A	6.37:g.165848819C>T	ENSP00000355847:p.Arg138His	Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	139	40	0.28777	NM_001130690	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37		.	.	.	.	.	.	.	.	.	.	C	16.42	3.118205	0.56505	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.69306	-0.39;-0.39	5.32	2.57	0.30868	GAF (1);	0.473990	0.25535	N	0.030018	T	0.36441	0.0967	L	0.38175	1.15	0.21527	N	0.999651	P;P	0.52842	0.66;0.956	B;P	0.47102	0.149;0.537	T	0.28713	-1.0035	10	0.45353	T	0.12	.	2.4185	0.04442	0.1336:0.5251:0.1293:0.212	.	148;138	Q9ULW9;Q9Y233	.;PDE10_HUMAN	H	138;166;148;138;137	ENSP00000355847:R138H;ENSP00000346435:R138H	ENSP00000341187:R148H	R	-	2	0	PDE10A	165768809	0.001000	0.12720	0.070000	0.20053	0.702000	0.40608	0.827000	0.27421	0.321000	0.23259	0.460000	0.39030	CGC	.	.	none		0.488	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
NOL4	8715	hgsc.bcm.edu	37	18	31599400	31599400	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:31599400G>A	ENST00000261592.5	-	6	1235	c.938C>T	c.(937-939)gCg>gTg	p.A313V	NOL4_ENST00000269185.4_Missense_Mutation_p.A199V|NOL4_ENST00000538587.1_Missense_Mutation_p.A239V|NOL4_ENST00000535475.1_Missense_Mutation_p.A158V|NOL4_ENST00000535384.1_Missense_Mutation_p.A28V|NOL4_ENST00000589544.1_Missense_Mutation_p.A313V	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	313						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						AGTTAGCTGCGCAGAGAGGGG	0.473																																					p.A313V		Atlas-SNP	.											NOL4,NS,NS,+1,1	NOL4	139	1	0			c.C938T						scavenged	.						177.0	152.0	160.0					18																	31599400		2203	4300	6503	SO:0001583	missense	8715	exon6			AGCTGCGCAGAGA	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.938C>T	18.37:g.31599400G>A	ENSP00000261592:p.Ala313Val	Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	378	4	0.010582	NM_003787	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	G	16.21	3.060129	0.55432	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	5.75	5.75	0.90469	.	0.313238	0.31450	N	0.007623	D	0.88058	0.6335	L	0.39898	1.24	0.36284	D	0.855959	D;P;P;P;P;P;P;P	0.71674	0.998;0.901;0.854;0.733;0.519;0.854;0.938;0.733	P;B;B;B;B;B;B;B	0.62184	0.899;0.187;0.162;0.084;0.123;0.162;0.164;0.084	D	0.90593	0.4538	10	0.62326	D	0.03	-12.5903	15.4215	0.75015	0.0:0.1384:0.8616:0.0	.	199;62;28;239;313;28;313;158	B4DLW2;F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;O94818-2;B3KRF4	.;.;.;.;NOL4_HUMAN;.;.;.	V	313;199;62;28;158;239	ENSP00000261592:A313V;ENSP00000269185:A199V;ENSP00000445733:A28V;ENSP00000438190:A158V;ENSP00000443472:A239V	ENSP00000261592:A313V	A	-	2	0	NOL4	29853398	1.000000	0.71417	0.999000	0.59377	0.934000	0.57294	3.877000	0.56123	2.730000	0.93505	0.542000	0.68232	GCG	.	.	none		0.473	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
STRN	6801	hgsc.bcm.edu	37	2	37082372	37082372	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr2:37082372T>A	ENST00000263918.4	-	15	1969	c.1961A>T	c.(1960-1962)gAa>gTa	p.E654V	STRN_ENST00000379213.2_Missense_Mutation_p.E605V	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	654					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				TACATTGGATTCTAAAGTGAG	0.343																																					p.E654V		Atlas-SNP	.											STRN,NS,carcinoma,-1,1	STRN	71	1	0			c.A1961T						scavenged	.						182.0	155.0	164.0					2																	37082372		2203	4300	6503	SO:0001583	missense	6801	exon15			TTGGATTCTAAAG	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.1961A>T	2.37:g.37082372T>A	ENSP00000263918:p.Glu654Val	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	123	2	0.0162602	NM_003162	Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	ENST00000263918.4	37	CCDS1784.1	.	.	.	.	.	.	.	.	.	.	T	18.15	3.559629	0.65538	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	T;T	0.30182	1.54;1.54	5.16	5.16	0.70880	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.048179	0.85682	D	0.000000	T	0.43478	0.1249	M	0.66939	2.045	0.80722	D	1	P;P	0.51791	0.948;0.715	P;B	0.51135	0.66;0.374	T	0.42799	-0.9430	10	0.56958	D	0.05	-17.5894	13.5497	0.61726	0.0:0.0:0.0:1.0	.	605;654	O43815-2;O43815	.;STRN_HUMAN	V	654;629;605	ENSP00000263918:E654V;ENSP00000368513:E605V	ENSP00000263918:E654V	E	-	2	0	STRN	36935876	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.041000	0.76558	1.944000	0.56390	0.482000	0.46254	GAA	.	.	none		0.343	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218568.1		
TSHZ3	57616	hgsc.bcm.edu	37	19	31770237	31770237	+	Silent	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:31770237A>G	ENST00000240587.4	-	2	789	c.462T>C	c.(460-462)agT>agC	p.S154S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	154	Ser-rich.				in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					tgctgctgctactgctgctgc	0.607																																					p.S154S		Atlas-SNP	.											TSHZ3_ENST00000240587,bladder,carcinoma,0,1	TSHZ3	549	1	0			c.T462C						scavenged	.						39.0	44.0	42.0					19																	31770237		2184	4294	6478	SO:0001819	synonymous_variant	57616	exon2			GCTGCTACTGCTG	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.462T>C	19.37:g.31770237A>G		Somatic	300	2	0.00666667		WXS	Illumina HiSeq	Phase_I	254	4	0.015748	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																			.	.	none		0.607	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
SENP1	29843	hgsc.bcm.edu	37	12	48477432	48477432	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:48477432C>T	ENST00000004980.5	-	6	972	c.494G>A	c.(493-495)cGt>cAt	p.R165H	SENP1_ENST00000448372.1_Missense_Mutation_p.R165H|SENP1_ENST00000551330.1_Missense_Mutation_p.R165H|SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000547886.1_5'UTR|SENP1_ENST00000549518.1_Missense_Mutation_p.R165H|SENP1_ENST00000549595.1_Missense_Mutation_p.R165H|RNU6-1203P_ENST00000410703.1_RNA			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	165	Ser-rich.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				AAGACTTCGACGACATGAACC	0.413																																					p.R165H		Atlas-SNP	.											SENP1_ENST00000448372,colon,carcinoma,0,2	SENP1	44	2	0			c.G494A						scavenged	.						118.0	110.0	112.0					12																	48477432		1856	4088	5944	SO:0001583	missense	29843	exon6			CTTCGACGACATG	AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.494G>A	12.37:g.48477432C>T	ENSP00000004980:p.Arg165His	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	110	2	0.0181818	NM_001267594	A8K7P5|Q86XC8	Missense_Mutation	SNP	ENST00000004980.5	37	CCDS44868.2	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262787	0.80358	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518	T;T;T;T;T	0.16457	2.34;2.34;2.34;2.34;2.34	4.2	3.28	0.37604	.	0.275088	0.35525	N	0.003141	T	0.25717	0.0626	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.63113	0.818;0.911	T	0.05115	-1.0905	10	0.59425	D	0.04	-9.9251	14.3694	0.66828	0.0:0.8501:0.1499:0.0	.	165;165	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	H	165	ENSP00000004980:R165H;ENSP00000394791:R165H;ENSP00000446681:R165H;ENSP00000450076:R165H;ENSP00000447328:R165H	ENSP00000004980:R165H	R	-	2	0	SENP1	46763699	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.577000	0.60922	1.316000	0.45131	0.655000	0.94253	CGT	.	.	none		0.413	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406471.1	NM_014554	
PCDH7	5099	hgsc.bcm.edu	37	4	30725116	30725116	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:30725116C>T	ENST00000361762.2	+	1	3080	c.2072C>T	c.(2071-2073)aCg>aTg	p.T691M	PCDH7_ENST00000543491.1_Missense_Mutation_p.T691M	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	691	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GAAAATGACACGGGGACCATT	0.488																																					p.T691M		Atlas-SNP	.											.	PCDH7	215	.	0			c.C2072T						PASS	.						118.0	118.0	118.0					4																	30725116		2203	4300	6503	SO:0001583	missense	5099	exon1			ATGACACGGGGAC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2072C>T	4.37:g.30725116C>T	ENSP00000355243:p.Thr691Met	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	66	4	0.0606061	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.431137	0.62844	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.58060	0.36;0.36	5.25	5.25	0.73442	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.80706	0.4674	M	0.93808	3.46	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85549	0.1220	9	0.87932	D	0	.	19.0454	0.93018	0.0:1.0:0.0:0.0	.	691;644;691	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	M	691;691;644	ENSP00000355243:T691M;ENSP00000441802:T691M	ENSP00000330302:T644M	T	+	2	0	PCDH7	30334214	1.000000	0.71417	0.969000	0.41365	0.982000	0.71751	7.647000	0.83462	2.722000	0.93159	0.655000	0.94253	ACG	.	.	none		0.488	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
IPO7	10527	hgsc.bcm.edu	37	11	9444655	9444655	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:9444655C>T	ENST00000379719.3	+	9	1151	c.1009C>T	c.(1009-1011)Ctc>Ttc	p.L337F		NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	337					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		TTCTCATGCTCTCACCTGGAA	0.303																																					p.L337F		Atlas-SNP	.											IPO7,NS,carcinoma,-1,1	IPO7	72	1	0			c.C1009T						scavenged	.						40.0	43.0	42.0					11																	9444655		2201	4287	6488	SO:0001583	missense	10527	exon9			CATGCTCTCACCT	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.1009C>T	11.37:g.9444655C>T	ENSP00000369042:p.Leu337Phe	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	54	2	0.037037	NM_006391	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	37	CCDS31425.1	.	.	.	.	.	.	.	.	.	.	C	8.349	0.830479	0.16749	.	.	ENSG00000205339	ENST00000379719	T	0.67345	-0.26	5.34	4.41	0.53225	Armadillo-like helical (1);Armadillo-type fold (1);Exportin/Importin, Cse1-like (1);	0.196752	0.43260	D	0.000589	T	0.49029	0.1533	N	0.11560	0.145	0.42909	D	0.994255	B	0.30542	0.284	B	0.39617	0.305	T	0.48445	-0.9035	10	0.32370	T	0.25	.	8.0733	0.30701	0.1268:0.5685:0.3046:0.0	.	337	O95373	IPO7_HUMAN	F	337	ENSP00000369042:L337F	ENSP00000369042:L337F	L	+	1	0	IPO7	9401231	0.998000	0.40836	0.989000	0.46669	0.995000	0.86356	2.950000	0.49081	2.484000	0.83849	0.591000	0.81541	CTC	.	.	none		0.303	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
HIST1H1E	3008	hgsc.bcm.edu	37	6	26156929	26156929	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:26156929C>G	ENST00000304218.3	+	1	371	c.311C>G	c.(310-312)tCc>tGc	p.S104C	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	104	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GCGTCGGGTTCCTTCAAACTC	0.602																																					p.S104C		Atlas-SNP	.											.	HIST1H1E	69	.	0			c.C311G						PASS	.						39.0	45.0	43.0					6																	26156929		2203	4300	6503	SO:0001583	missense	3008	exon1			CGGGTTCCTTCAA	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.311C>G	6.37:g.26156929C>G	ENSP00000307705:p.Ser104Cys	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	222	50	0.225225	NM_005321	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	.	.	.	.	.	.	.	.	.	.	.	19.18	3.777704	0.70107	.	.	ENSG00000168298	ENST00000304218	T	0.10960	2.82	5.35	5.35	0.76521	Histone H1/H5 (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.40522	0.1120	H	0.95850	3.73	0.80722	D	1	D	0.56287	0.975	D	0.64410	0.925	T	0.58725	-0.7586	10	0.87932	D	0	-5.7108	18.4042	0.90528	0.0:1.0:0.0:0.0	.	104	P10412	H14_HUMAN	C	104	ENSP00000307705:S104C	ENSP00000307705:S104C	S	+	2	0	HIST1H1E	26264908	1.000000	0.71417	0.711000	0.30485	0.551000	0.35334	7.751000	0.85126	2.658000	0.90341	0.561000	0.74099	TCC	.	.	none		0.602	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
ARMC8	25852	hgsc.bcm.edu	37	3	137942263	137942263	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:137942263G>A	ENST00000469044.1	+	4	498	c.227G>A	c.(226-228)aGc>aAc	p.S76N	ARMC8_ENST00000471453.1_Missense_Mutation_p.S62N|ARMC8_ENST00000461822.1_Missense_Mutation_p.S76N|ARMC8_ENST00000491704.1_Missense_Mutation_p.S34N|ARMC8_ENST00000481646.1_Missense_Mutation_p.S62N|ARMC8_ENST00000393058.3_Missense_Mutation_p.S66N|ARMC8_ENST00000538260.1_Missense_Mutation_p.S76N|ARMC8_ENST00000489213.1_Missense_Mutation_p.S34N|ARMC8_ENST00000470821.1_Missense_Mutation_p.S76N|ARMC8_ENST00000358441.2_Missense_Mutation_p.S62N|ARMC8_ENST00000485396.1_Missense_Mutation_p.S34N	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	76										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						GAAACCTCAAGCACAGAGCTG	0.383																																					p.S76N		Atlas-SNP	.											ARMC8_ENST00000481646,colon,carcinoma,0,2	ARMC8	79	2	0			c.G227A						scavenged	.						84.0	82.0	83.0					3																	137942263		2203	4300	6503	SO:0001583	missense	25852	exon4			CCTCAAGCACAGA		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.227G>A	3.37:g.137942263G>A	ENSP00000419413:p.Ser76Asn	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	193	3	0.015544	NM_001267041	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Missense_Mutation	SNP	ENST00000469044.1	37		.	.	.	.	.	.	.	.	.	.	G	12.13	1.846453	0.32606	.	.	ENSG00000114098	ENST00000481646;ENST00000469044;ENST00000491704;ENST00000461600;ENST00000466749;ENST00000358441;ENST00000489213;ENST00000461822;ENST00000485396;ENST00000471453;ENST00000470821;ENST00000471709;ENST00000538260;ENST00000393058	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44	5.9	5.02	0.67125	Armadillo-like helical (1);Armadillo-type fold (1);	0.038615	0.85682	D	0.000000	T	0.53867	0.1823	N	0.22421	0.69	0.58432	D	0.99999	B;B;B;B;B;B;B	0.31413	0.001;0.0;0.0;0.322;0.0;0.004;0.002	B;B;B;B;B;B;B	0.34093	0.002;0.003;0.003;0.175;0.003;0.005;0.003	T	0.50224	-0.8853	10	0.22706	T	0.39	-19.3172	14.9985	0.71451	0.0:0.1432:0.8568:0.0	.	34;76;76;76;62;76;62	B7Z637;B7Z441;F5GWK4;Q8IUR7;Q8IUR7-2;G5E9V6;Q8IUR7-6	.;.;.;ARMC8_HUMAN;.;.;.	N	62;76;34;76;34;62;34;76;34;62;76;76;76;66	ENSP00000420333:S62N;ENSP00000419413:S76N;ENSP00000417304:S34N;ENSP00000418074:S76N;ENSP00000417699:S34N;ENSP00000351221:S62N;ENSP00000418412:S34N;ENSP00000420706:S76N;ENSP00000417049:S34N;ENSP00000420440:S62N;ENSP00000418405:S76N;ENSP00000420719:S76N;ENSP00000441592:S76N;ENSP00000376778:S66N	ENSP00000351221:S62N	S	+	2	0	ARMC8	139424953	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.617000	0.74210	1.504000	0.48704	-0.156000	0.13503	AGC	.	.	none		0.383	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396	
AMY2B	280	hgsc.bcm.edu	37	1	104116508	104116508	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:104116508A>T	ENST00000361355.4	+	6	1308	c.692A>T	c.(691-693)aAt>aTt	p.N231I	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	231					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)	p.N231T(1)		breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		AAACTGCATAATCTAAACAGT	0.373																																					p.N231I		Atlas-SNP	.											AMY2B,rectum,carcinoma,0,1	AMY2B	80	1	1	Substitution - Missense(1)	large_intestine(1)	c.A692T						PASS	.						173.0	172.0	172.0					1																	104116508		2203	4297	6500	SO:0001583	missense	280	exon6			TGCATAATCTAAA	M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.692A>T	1.37:g.104116508A>T	ENSP00000354610:p.Asn231Ile	Somatic	380	0	0		WXS	Illumina HiSeq	Phase_I	321	115	0.358255	NM_020978	B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	ENST00000361355.4	37	CCDS782.1	.	.	.	.	.	.	.	.	.	.	A	17.88	3.497641	0.64186	.	.	ENSG00000240038	ENST00000361355	D	0.98400	-4.91	4.47	4.47	0.54385	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.109676	0.64402	D	0.000011	D	0.98548	0.9515	H	0.96604	3.85	0.80722	D	1	P	0.41131	0.739	P	0.45577	0.486	D	0.99891	1.1134	10	0.87932	D	0	.	13.7962	0.63173	1.0:0.0:0.0:0.0	.	231	P19961	AMY2B_HUMAN	I	231	ENSP00000354610:N231I	ENSP00000354610:N231I	N	+	2	0	AMY2B	103918031	1.000000	0.71417	0.996000	0.52242	0.337000	0.28794	6.148000	0.71788	1.662000	0.50781	0.451000	0.29950	AAT	.	.	none		0.373	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030318.1	NM_020978	
UPK1A	11045	hgsc.bcm.edu	37	19	36157719	36157719	+	Missense_Mutation	SNP	C	C	T	rs367904056		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:36157719C>T	ENST00000222275.2	+	1	5	c.5C>T	c.(4-6)gCg>gTg	p.A2V	UPK1A_ENST00000379013.2_Missense_Mutation_p.A2V|RN7SL765P_ENST00000580260.1_RNA|UPK1A-AS1_ENST00000443196.1_RNA	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A	2					epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGGATGATGGCGTCTGCGGCA	0.617																																					p.A2V		Atlas-SNP	.											UPK1A,colon,carcinoma,-1,1	UPK1A	23	1	0			c.C5T						scavenged	.	C	VAL/ALA	0,4406		0,0,2203	117.0	109.0	112.0		5	2.5	1.0	19		112	2,8598	2.2+/-6.3	0,2,4298	no	missense	UPK1A	NM_007000.2	64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	2/259	36157719	2,13004	2203	4300	6503	SO:0001583	missense	11045	exon1			TGATGGCGTCTGC	AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.5C>T	19.37:g.36157719C>T	ENSP00000222275:p.Ala2Val	Somatic	157	1	0.00636943		WXS	Illumina HiSeq	Phase_I	142	3	0.0211268	NM_007000	Q3KNU5|Q3KNU6	Missense_Mutation	SNP	ENST00000222275.2	37	CCDS12470.1	.	.	.	.	.	.	.	.	.	.	C	7.391	0.630872	0.14322	0.0	2.33E-4	ENSG00000105668	ENST00000222275;ENST00000379013	T;T	0.08546	3.34;3.08	4.79	2.52	0.30459	.	1.918880	0.02481	N	0.088492	T	0.04003	0.0112	N	0.03608	-0.345	0.25659	N	0.986022	B;P	0.44734	0.003;0.842	B;B	0.33960	0.002;0.173	T	0.20472	-1.0274	10	0.87932	D	0	.	6.252	0.20852	0.0:0.7135:0.1869:0.0996	.	2;2	O00322-2;O00322	.;UPK1A_HUMAN	V	2	ENSP00000222275:A2V;ENSP00000368298:A2V	ENSP00000222275:A2V	A	+	2	0	UPK1A	40849559	0.985000	0.35326	0.989000	0.46669	0.003000	0.03518	1.211000	0.32382	1.381000	0.46364	-0.137000	0.14449	GCG	.	.	weak		0.617	UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109486.3		
ACOT4	122970	hgsc.bcm.edu	37	14	74058832	74058832	+	Missense_Mutation	SNP	C	C	T	rs3742819	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:74058832C>T	ENST00000326303.4	+	1	423	c.169C>T	c.(169-171)Cgc>Tgc	p.R57C		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	57			R -> C (in dbSNP:rs3742819). {ECO:0000269|PubMed:15489334}.		acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		CGCCGACGCCCGCGGCGAGCT	0.761													C|||	1988	0.396965	0.1059	0.513	5008	,	,		12914	0.629		0.3926	False		,,,				2504	0.4734				p.R57C		Atlas-SNP	.											.	ACOT4	25	.	0			c.C169T						PASS	.	C	CYS/ARG	496,3446		38,420,1513	6.0	7.0	6.0		169	-9.9	0.0	14	dbSNP_107	6	2402,5202		412,1578,1812	no	missense	ACOT4	NM_152331.3	180	450,1998,3325	TT,TC,CC		31.5886,12.5824,25.0996	possibly-damaging	57/422	74058832	2898,8648	1971	3802	5773	SO:0001583	missense	122970	exon1			GACGCCCGCGGCG	BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.169C>T	14.37:g.74058832C>T	ENSP00000323071:p.Arg57Cys	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_152331	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Missense_Mutation	SNP	ENST00000326303.4	37	CCDS9817.1	873	0.39972527472527475	60	0.12195121951219512	175	0.48342541436464087	366	0.6398601398601399	272	0.35883905013192613	C	13.86	2.362653	0.41902	0.125824	0.315886	ENSG00000177465	ENST00000326303	T	0.70516	-0.49	4.93	-9.85	0.00476	Acyl-CoA thioester hydrolase/bile acid-CoA amino acid N-acetyltransferase (1);	2.024500	0.02238	N	0.065442	T	0.00012	0.0000	L	0.53249	1.67	0.80722	P	0.0	P	0.51351	0.944	P	0.53954	0.738	T	0.48536	-0.9027	9	0.56958	D	0.05	-7.9166	15.5626	0.76262	0.2094:0.6193:0.1713:0.0	rs3742819	57	Q8N9L9	ACOT4_HUMAN	C	57	ENSP00000323071:R57C	ENSP00000323071:R57C	R	+	1	0	ACOT4	73128585	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.196000	0.03041	-2.884000	0.00318	-0.502000	0.04539	CGC	C|0.599;T|0.401	0.401	strong		0.761	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404298.2	NM_152331	
LRRC37A2	474170	hgsc.bcm.edu	37	17	44630768	44630768	+	Missense_Mutation	SNP	A	A	G	rs200445221		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:44630768A>G	ENST00000576629.1	+	12	5307	c.4812A>G	c.(4810-4812)atA>atG	p.I1604M	ARL17A_ENST00000445552.2_Intron|ARL17A_ENST00000329240.4_Intron|ARL17A_ENST00000570550.1_Intron|LRRC37A2_ENST00000333412.3_Missense_Mutation_p.I1604M|ARL17A_ENST00000573185.1_Intron|ARL17A_ENST00000337845.7_Intron			A6NM11	L37A2_HUMAN	leucine rich repeat containing 37, member A2	1604						integral component of membrane (GO:0016021)		p.I1604M(2)		endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|pancreas(4)|prostate(2)	15		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TAAAACAGATATGTTGTCACC	0.338																																					p.I1604M		Atlas-SNP	.											LRRC37A2,NS,carcinoma,0,2	LRRC37A2	37	2	2	Substitution - Missense(2)	prostate(2)	c.A4812G						scavenged	.						66.0	120.0	102.0					17																	44630768		2198	4293	6491	SO:0001583	missense	474170	exon11			ACAGATATGTTGT	AY386262	CCDS42353.1	17q21.31	2013-05-14			ENSG00000238083	ENSG00000238083			32404	protein-coding gene	gene with protein product	"""c114 SLIT-like testicular protein"""						Standard	NM_001006607		Approved	FLJ45049	uc002ikn.1	A6NM11	OTTHUMG00000178032	ENST00000576629.1:c.4812A>G	17.37:g.44630768A>G	ENSP00000459551:p.Ile1604Met	Somatic	1216	6	0.00493421		WXS	Illumina HiSeq	Phase_I	1073	18	0.0167754	NM_001006607	B7ZMC3	Missense_Mutation	SNP	ENST00000576629.1	37	CCDS42353.1	.	.	.	.	.	.	.	.	.	.	a	11.80	1.747925	0.30955	.	.	ENSG00000238083	ENST00000333412	T	0.53857	0.6	2.45	1.28	0.21552	.	.	.	.	.	T	0.60792	0.2296	L	0.53249	1.67	0.20307	N	0.999911	D;D	0.89917	1.0;0.997	D;D	0.80764	0.994;0.916	T	0.48958	-0.8988	9	0.87932	D	0	.	3.1223	0.06395	0.2434:0.0:0.2508:0.5058	.	565;1604	B3KRJ4;A6NM11	.;L37A2_HUMAN	M	1604	ENSP00000333071:I1604M	ENSP00000333071:I1604M	I	+	3	3	LRRC37A2	41986084	0.009000	0.17119	0.240000	0.24138	0.009000	0.06853	-0.890000	0.04140	-0.033000	0.13736	-1.974000	0.00461	ATA	.	.	alt		0.338	LRRC37A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440299.2	NM_001006607	
LRIT2	340745	hgsc.bcm.edu	37	10	85981799	85981799	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:85981799G>A	ENST00000372113.4	-	3	1535	c.1530C>T	c.(1528-1530)acC>acT	p.T510T	LRIT2_ENST00000538192.1_Silent_p.T520T	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	510			T -> P (in dbSNP:rs6585847).			integral component of membrane (GO:0016021)		p.T510T(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						GGGCTGCAGGGGTGCAGCTGG	0.627																																					p.T510T		Atlas-SNP	.											LRIT2,colon,carcinoma,-2,3	LRIT2	81	3	1	Substitution - coding silent(1)	ovary(1)	c.C1530T						scavenged	.						56.0	63.0	61.0					10																	85981799		2201	4299	6500	SO:0001819	synonymous_variant	340745	exon3			TGCAGGGGTGCAG		CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.1530C>T	10.37:g.85981799G>A		Somatic	123	1	0.00813008		WXS	Illumina HiSeq	Phase_I	94	2	0.0212766	NM_001017924	B7ZME6	Silent	SNP	ENST00000372113.4	37	CCDS31234.1																																																																																			.	.	none		0.627	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049110.4	XM_291697	
SLC47A1	55244	hgsc.bcm.edu	37	17	19470152	19470152	+	Missense_Mutation	SNP	C	C	T	rs547527862		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:19470152C>T	ENST00000270570.4	+	13	1242	c.1156C>T	c.(1156-1158)Cac>Tac	p.H386Y	SLC47A1_ENST00000436810.2_Missense_Mutation_p.H363Y|SLC47A1_ENST00000571335.1_Missense_Mutation_p.H191Y|SLC47A1_ENST00000395585.1_Missense_Mutation_p.H386Y|RP11-1113L8.1_ENST00000574267.1_RNA|SLC47A1_ENST00000457293.1_Missense_Mutation_p.H386Y|SLC47A1_ENST00000575023.1_Intron	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	386					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	TGCTGTTTCCCACCTCTTTGA	0.433																																					p.H386Y		Atlas-SNP	.											.	SLC47A1	55	.	0			c.C1156T						PASS	.						229.0	200.0	210.0					17																	19470152		2203	4300	6503	SO:0001583	missense	55244	exon13			GTTTCCCACCTCT		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.1156C>T	17.37:g.19470152C>T	ENSP00000270570:p.His386Tyr	Somatic	291	0	0		WXS	Illumina HiSeq	Phase_I	194	76	0.391753	NM_018242	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	ENST00000270570.4	37	CCDS11209.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.051596	0.55218	.	.	ENSG00000142494	ENST00000436810;ENST00000270570;ENST00000457293;ENST00000395585;ENST00000455670;ENST00000424755	T;T;T;T	0.26957	1.7;1.7;1.7;1.7	5.37	4.41	0.53225	.	0.213703	0.47852	D	0.000204	T	0.52517	0.1739	M	0.92026	3.265	0.80722	D	1	P;D;B;D;D	0.76494	0.951;0.999;0.295;0.994;0.978	P;D;B;D;P	0.72982	0.837;0.968;0.356;0.979;0.888	T	0.63967	-0.6517	10	0.07482	T	0.82	-3.635	12.7652	0.57388	0.0:0.9198:0.0:0.0802	.	120;363;120;386;386	E7ENC3;E7EX57;B4DDH5;Q96FL8;Q96FL8-3	.;.;.;S47A1_HUMAN;.	Y	363;386;386;386;120;98	ENSP00000407155:H363Y;ENSP00000270570:H386Y;ENSP00000415586:H386Y;ENSP00000378951:H386Y	ENSP00000270570:H386Y	H	+	1	0	SLC47A1	19410744	0.998000	0.40836	0.995000	0.50966	0.563000	0.35712	4.492000	0.60334	1.277000	0.44412	-0.136000	0.14681	CAC	.	.	none		0.433	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	NM_018242	
ABCA9	10350	hgsc.bcm.edu	37	17	67020435	67020435	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:67020435A>G	ENST00000340001.4	-	17	2412	c.2201T>C	c.(2200-2202)aTc>aCc	p.I734T	ABCA9_ENST00000453985.2_Missense_Mutation_p.I734T|ABCA9_ENST00000370732.2_Missense_Mutation_p.I734T	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	734					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GGCATCAGAGATGTGCTGCTT	0.323																																					p.I734T		Atlas-SNP	.											ABCA9,NS,carcinoma,0,1	ABCA9	192	1	0			c.T2201C						scavenged	.						70.0	62.0	65.0					17																	67020435		2203	4300	6503	SO:0001583	missense	10350	exon17			TCAGAGATGTGCT	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.2201T>C	17.37:g.67020435A>G	ENSP00000342216:p.Ile734Thr	Somatic	351	1	0.002849		WXS	Illumina HiSeq	Phase_I	303	4	0.0132013	NM_080283	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	A	18.04	3.535215	0.64972	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.86297	-2.1;-2.1	4.68	4.68	0.58851	.	0.136342	0.32473	N	0.006055	D	0.95506	0.8540	H	0.97340	3.985	0.46725	D	0.999179	D;D	0.76494	0.999;0.981	D;P	0.70487	0.969;0.852	D	0.96771	0.9568	10	0.87932	D	0	.	13.2291	0.59931	1.0:0.0:0.0:0.0	.	734;734	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	T	734;717;734;729	ENSP00000342216:I734T;ENSP00000359767:I734T	ENSP00000342216:I734T	I	-	2	0	ABCA9	64532030	1.000000	0.71417	0.997000	0.53966	0.865000	0.49528	8.196000	0.89725	1.875000	0.54330	0.443000	0.29094	ATC	.	.	none		0.323	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
A2ML1	144568	hgsc.bcm.edu	37	12	9006740	9006740	+	Silent	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:9006740T>C	ENST00000299698.7	+	21	2787	c.2607T>C	c.(2605-2607)acT>acC	p.T869T	A2ML1_ENST00000539547.1_Silent_p.T378T	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TTAACTTTACTATTAGTACAA	0.478																																					p.T869T		Atlas-SNP	.											.	A2ML1	199	.	0			c.T2607C						PASS	.						56.0	57.0	57.0					12																	9006740		1862	4096	5958	SO:0001819	synonymous_variant	144568	exon21			CTTTACTATTAGT	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.2607T>C	12.37:g.9006740T>C		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	61	21	0.344262	NM_144670		Silent	SNP	ENST00000299698.7	37	CCDS8596.2																																																																																			.	.	none		0.478	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
CPAMD8	27151	hgsc.bcm.edu	37	19	17039035	17039035	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:17039035C>T	ENST00000443236.1	-	25	3326	c.3295G>A	c.(3295-3297)Ggt>Agt	p.G1099S		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1052						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GGCTCTGGACCATGGCCAACC	0.597																																					p.G1099S		Atlas-SNP	.											.	CPAMD8	192	.	0			c.G3295A						PASS	.						28.0	31.0	30.0					19																	17039035		2007	4168	6175	SO:0001583	missense	27151	exon25			CTGGACCATGGCC	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3295G>A	19.37:g.17039035C>T	ENSP00000402505:p.Gly1099Ser	Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	62	27	0.435484	NM_015692	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.70|16.70	3.195939|3.195939	0.58126|0.58126	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440|ENST00000443236	.|.	.|.	.|.	3.13|3.13	3.13|3.13	0.36017|0.36017	Farnesoic acid O-methyl transferase (1);|.	0.205858|.	0.29631|.	U|.	0.011619|.	T|T	0.76126|0.76126	0.3944|0.3944	M|M	0.83774|0.83774	2.66|2.66	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.79369|0.79369	-0.1832|-0.1832	9|5	0.62326|.	D|.	0.03|.	.|.	14.2237|14.2237	0.65845|0.65845	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1052|.	Q8IZJ3|.	CPMD8_HUMAN|.	S|I	1099|1109	.|.	ENSP00000291440:G1099S|.	G|M	-|-	1|3	0|0	CPAMD8|CPAMD8	16900035|16900035	0.999000|0.999000	0.42202|0.42202	0.969000|0.969000	0.41365|0.41365	0.129000|0.129000	0.20672|0.20672	4.687000|4.687000	0.61708|0.61708	1.300000|1.300000	0.44818|0.44818	0.655000|0.655000	0.94253|0.94253	GGT|ATG	.	.	none		0.597	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
OR2S2	56656	hgsc.bcm.edu	37	9	35957229	35957229	+	Silent	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:35957229G>T	ENST00000341959.2	-	1	922	c.867C>A	c.(865-867)acC>acA	p.T289T		NM_019897.2	NP_063950.2	Q9NQN1	OR2S1_HUMAN	olfactory receptor, family 2, subfamily S, member 2	289					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(32;0.00613)|STAD - Stomach adenocarcinoma(86;0.194)			TGAGCATCGGGGTCACCACCC	0.493																																					p.T289T	Pancreas(172;293 2036 17878 24427 30946)	Atlas-SNP	.											.	OR2S2	46	.	0			c.C867A						PASS	.						98.0	95.0	96.0					9																	35957229		2203	4300	6503	SO:0001819	synonymous_variant	56656	exon1			CATCGGGGTCACC	AL135841	CCDS6596.2	9p13.3	2012-08-09			ENSG00000122718	ENSG00000122718		"""GPCR / Class A : Olfactory receptors"""	8276	protein-coding gene	gene with protein product							Standard	NM_019897		Approved		uc011lpi.2	Q9NQN1	OTTHUMG00000019891	ENST00000341959.2:c.867C>A	9.37:g.35957229G>T		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	87	37	0.425287	NM_019897	Q2M3L0|Q6IF19|Q96R42	Silent	SNP	ENST00000341959.2	37	CCDS6596.2																																																																																			.	.	none		0.493	OR2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052400.2	NM_019897	
TBC1D12	23232	hgsc.bcm.edu	37	10	96163177	96163177	+	Silent	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:96163177T>C	ENST00000225235.4	+	1	917	c.807T>C	c.(805-807)atT>atC	p.I269I		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	269							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				TTTCTGACATTCACTTCAACT	0.736																																					p.I269I		Atlas-SNP	.											.	TBC1D12	51	.	0			c.T807C						PASS	.						8.0	11.0	10.0					10																	96163177		1757	3890	5647	SO:0001819	synonymous_variant	23232	exon1			TGACATTCACTTC	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.807T>C	10.37:g.96163177T>C		Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	119	6	0.0504202	NM_015188	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	37	CCDS41553.1																																																																																			.	.	none		0.736	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
ARSF	416	hgsc.bcm.edu	37	X	3021805	3021805	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:3021805G>A	ENST00000381127.1	+	9	1326	c.1105G>A	c.(1105-1107)Gga>Aga	p.G369R	ARSF_ENST00000359361.2_Missense_Mutation_p.G369R|ARSF_ENST00000537104.1_Missense_Mutation_p.G369R	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	369					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCTTATAGGTGGAAAAGGCAT	0.428																																					p.G369R		Atlas-SNP	.											.	ARSF	97	.	0			c.G1105A						PASS	.						70.0	65.0	67.0					X																	3021805		2203	4300	6503	SO:0001583	missense	416	exon9			ATAGGTGGAAAAG	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.1105G>A	X.37:g.3021805G>A	ENSP00000370519:p.Gly369Arg	Somatic	226	1	0.00442478		WXS	Illumina HiSeq	Phase_I	109	72	0.66055	NM_004042	Q8TCC5	Missense_Mutation	SNP	ENST00000381127.1	37	CCDS14123.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471316	0.43942	.	.	ENSG00000062096	ENST00000381127;ENST00000537104;ENST00000359361	D;D;D	0.94576	-3.46;-3.46;-3.46	3.43	3.43	0.39272	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	U	0.000000	D	0.97028	0.9029	M	0.82323	2.585	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.97468	1.0039	10	0.66056	D	0.02	.	14.2451	0.65983	0.0:0.0:1.0:0.0	.	369	P54793	ARSF_HUMAN	R	369	ENSP00000370519:G369R;ENSP00000445594:G369R;ENSP00000352319:G369R	ENSP00000352319:G369R	G	+	1	0	ARSF	3031805	1.000000	0.71417	0.066000	0.19879	0.007000	0.05969	6.109000	0.71528	1.316000	0.45131	0.411000	0.27672	GGA	.	.	none		0.428	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1		
MED16	10025	hgsc.bcm.edu	37	19	879943	879943	+	Missense_Mutation	SNP	G	G	C	rs201392672|rs76403059	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:879943G>C	ENST00000589119.1	-	7	1346	c.1347C>G	c.(1345-1347)caC>caG	p.H449Q	MED16_ENST00000269814.4_Missense_Mutation_p.H449Q|MED16_ENST00000395808.3_Missense_Mutation_p.H449Q|MED16_ENST00000325464.1_Missense_Mutation_p.H449Q|MED16_ENST00000606828.1_Intron|MED16_ENST00000312090.6_Missense_Mutation_p.H449Q			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	449					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCACCTTCCCGTGGCTGTCAA	0.672																																					p.H449Q		Atlas-SNP	.											MED16,colon,carcinoma,0,1	MED16	61	1	0			c.C1347G						scavenged	.						13.0	11.0	12.0					19																	879943		2152	4247	6399	SO:0001583	missense	10025	exon8			CTTCCCGTGGCTG	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1347C>G	19.37:g.879943G>C	ENSP00000464810:p.His449Gln	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	100	4	0.04	NM_005481	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	ENST00000589119.1	37	CCDS12047.1	.	.	.	.	.	.	.	.	.	.	C	3.376	-0.127462	0.06753	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808;ENST00000269814;ENST00000534906;ENST00000537596;ENST00000540679;ENST00000538572;ENST00000424039	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.21	-7.89	0.01174	WD40 repeat-like-containing domain (1);	0.323237	0.32357	N	0.006220	T	0.21307	0.0513	L	0.37850	1.14	0.37741	D	0.925623	B;B;B;B;B	0.13145	0.006;0.007;0.002;0.001;0.001	B;B;B;B;B	0.14023	0.006;0.006;0.003;0.006;0.01	T	0.20009	-1.0288	10	0.15066	T	0.55	-14.2411	8.1092	0.30905	0.4704:0.1904:0.3392:0.0	.	449;449;449;449;449	Q9Y2X0-2;E7ETV0;Q9Y2X0-4;Q9Y2X0-3;Q9Y2X0	.;.;.;.;MED16_HUMAN	Q	449;449;449;449;449;305;210;208;449	ENSP00000325612:H449Q;ENSP00000308528:H449Q;ENSP00000379153:H449Q;ENSP00000269814:H449Q	ENSP00000269814:H449Q	H	-	3	2	MED16	830943	0.000000	0.05858	0.886000	0.34754	0.057000	0.15508	-3.404000	0.00482	-1.779000	0.01280	-2.326000	0.00250	CAC	.	.	weak		0.672	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457902.3	NM_005481	
RYR2	6262	hgsc.bcm.edu	37	1	237791370	237791370	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:237791370C>T	ENST00000366574.2	+	41	6747	c.6430C>T	c.(6430-6432)Cgt>Tgt	p.R2144C	RYR2_ENST00000542537.1_Missense_Mutation_p.R2128C|RYR2_ENST00000360064.6_Missense_Mutation_p.R2142C	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2144	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCTCATGATTCGTGGATTAGG	0.408																																					p.R2144C		Atlas-SNP	.											RYR2,colon,carcinoma,0,2	RYR2	1273	2	0			c.C6430T						scavenged	.						113.0	122.0	119.0					1																	237791370		1963	4140	6103	SO:0001583	missense	6262	exon41			ATGATTCGTGGAT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6430C>T	1.37:g.237791370C>T	ENSP00000355533:p.Arg2144Cys	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	144	3	0.0208333	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	17.86	3.493041	0.64186	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96856	-4.15;-4.12;-4.15	5.53	5.53	0.82687	Intracellular calcium-release channel (1);	0.083612	0.44483	D	0.000450	D	0.96944	0.9002	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.97707	1.0188	10	0.87932	D	0	-7.0119	19.8167	0.96571	0.0:1.0:0.0:0.0	.	2144	Q92736	RYR2_HUMAN	C	2144;2142;2128	ENSP00000355533:R2144C;ENSP00000353174:R2142C;ENSP00000443798:R2128C	ENSP00000353174:R2142C	R	+	1	0	RYR2	235857993	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	2.485000	0.45250	2.762000	0.94881	0.591000	0.81541	CGT	.	.	none		0.408	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
MAML3	55534	hgsc.bcm.edu	37	4	140811108	140811108	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:140811108C>T	ENST00000509479.2	-	2	2338	c.1482G>A	c.(1480-1482)caG>caA	p.Q494Q	MAML3_ENST00000398940.1_Silent_p.Q33Q|MAML3_ENST00000327122.5_Silent_p.Q338Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.537																																					p.Q494Q		Atlas-SNP	.											MAML3_ENST00000509479,NS,malignant_melanoma,0,2	MAML3	192	2	0			c.G1482A						scavenged	.						14.0	19.0	17.0					4																	140811108		2165	4272	6437	SO:0001819	synonymous_variant	55534	exon2			CTGCTGCTGCTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1482G>A	4.37:g.140811108C>T		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	66	2	0.030303	NM_018717		Silent	SNP	ENST00000509479.2	37	CCDS54805.1																																																																																			.	.	none		0.537	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
PKD1L1	168507	hgsc.bcm.edu	37	7	47968840	47968840	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:47968840C>T	ENST00000289672.2	-	7	1071	c.1021G>A	c.(1021-1023)Gag>Aag	p.E341K		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	341					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.E341K(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GCCATTGCCTCAGACATGTTG	0.527																																					p.E341K		Atlas-SNP	.											PKD1L1,NS,carcinoma,0,1	PKD1L1	328	1	1	Substitution - Missense(1)	breast(1)	c.G1021A						scavenged	.						144.0	137.0	139.0					7																	47968840		2203	4300	6503	SO:0001583	missense	168507	exon7			TTGCCTCAGACAT	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1021G>A	7.37:g.47968840C>T	ENSP00000289672:p.Glu341Lys	Somatic	206	0	0		WXS	Illumina HiSeq	Phase_I	211	3	0.014218	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	C	4.847	0.157484	0.09236	.	.	ENSG00000158683	ENST00000289672	T	0.19806	2.12	4.11	1.18	0.20946	.	29.947800	0.00166	N	0.000000	T	0.13329	0.0323	N	0.14661	0.345	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.20806	-1.0264	10	0.20046	T	0.44	-3.1752	6.1542	0.20328	0.0:0.5268:0.3683:0.1049	.	341	Q8TDX9	PK1L1_HUMAN	K	341	ENSP00000289672:E341K	ENSP00000289672:E341K	E	-	1	0	PKD1L1	47935365	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	0.107000	0.15375	0.126000	0.18424	0.579000	0.79373	GAG	.	.	none		0.527	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
ACOX1	51	hgsc.bcm.edu	37	17	73945827	73945827	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:73945827T>G	ENST00000301608.4	-	10	1510	c.1450A>C	c.(1450-1452)Acc>Ccc	p.T484P	ACOX1_ENST00000293217.5_Missense_Mutation_p.T484P|ACOX1_ENST00000537812.1_Missense_Mutation_p.T446P	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	484					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)			large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	TATGCTTCGGTTAGGCTTTCG	0.562																																					p.T484P		Atlas-SNP	.											.	ACOX1	85	.	0			c.A1450C						PASS	.						117.0	93.0	101.0					17																	73945827		2203	4300	6503	SO:0001583	missense	51	exon10			CTTCGGTTAGGCT	U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.1450A>C	17.37:g.73945827T>G	ENSP00000301608:p.Thr484Pro	Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	147	58	0.394558	NM_007292	A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	ENST00000301608.4	37	CCDS11735.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.066538	0.36470	.	.	ENSG00000161533	ENST00000301608;ENST00000293217;ENST00000537812;ENST00000539791;ENST00000538781	T;T;T	0.46819	0.86;0.86;0.86	5.62	1.07	0.20283	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.418244	0.27060	N	0.021135	T	0.51770	0.1694	M	0.73962	2.25	0.09310	N	0.999999	P;P;P;P	0.50369	0.688;0.838;0.536;0.934	B;P;P;P	0.50082	0.43;0.63;0.566;0.513	T	0.45323	-0.9269	10	0.56958	D	0.05	-4.3019	7.6917	0.28571	0.0:0.5105:0.0:0.4895	.	416;446;484;484	F5H0M0;F5GYQ8;Q15067;Q15067-2	.;.;ACOX1_HUMAN;.	P	484;484;446;484;416	ENSP00000301608:T484P;ENSP00000293217:T484P;ENSP00000441257:T446P	ENSP00000293217:T484P	T	-	1	0	ACOX1	71457422	0.350000	0.24878	0.002000	0.10522	0.230000	0.25150	1.643000	0.37217	0.428000	0.26173	0.528000	0.53228	ACC	.	.	none		0.562	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439503.1		
MAGEC3	139081	hgsc.bcm.edu	37	X	140985325	140985325	+	Intron	SNP	C	C	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chrX:140985325C>A	ENST00000298296.1	+	7	1728				MAGEC3_ENST00000544766.1_Missense_Mutation_p.T296N|MAGEC3_ENST00000536088.1_Missense_Mutation_p.T296N|MAGEC3_ENST00000443323.2_Missense_Mutation_p.T216N|MAGEC3_ENST00000409007.1_Missense_Mutation_p.T296N	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3											NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					AAGCTGCTCACTATACATTGG	0.527																																					p.T296N		Atlas-SNP	.											.	MAGEC3	228	.	0			c.C887A						PASS	.						73.0	73.0	73.0					X																	140985325		2203	4300	6503	SO:0001627	intron_variant	139081	exon5			TGCTCACTATACA	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1728+53C>A	X.37:g.140985325C>A		Somatic	211	0	0		WXS	Illumina HiSeq	Phase_I	169	141	0.83432	NM_177456	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	c	8.239	0.806342	0.16467	.	.	ENSG00000165509	ENST00000536088;ENST00000443323;ENST00000544766;ENST00000409007	T;T;T;T	0.05996	3.36;3.36;3.36;3.36	1.25	0.292	0.15737	.	.	.	.	.	T	0.30916	0.0780	H	0.96048	3.76	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.08249	-1.0731	8	.	.	.	.	6.1961	0.20550	0.0:0.7821:0.0:0.2179	.	296	Q3SYA7	.	N	296;216;296;296	ENSP00000441107:T296N;ENSP00000438254:T216N;ENSP00000440444:T296N;ENSP00000386566:T296N	.	T	+	2	0	MAGEC3	140812991	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.207000	0.09384	-0.423000	0.07394	-1.954000	0.00483	ACT	.	.	none		0.527	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
TRIOBP	11078	hgsc.bcm.edu	37	22	38119859	38119859	+	Silent	SNP	C	C	T	rs66505048	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr22:38119859C>T	ENST00000406386.3	+	7	1551	c.1296C>T	c.(1294-1296)tgC>tgT	p.C432C		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	432					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.C432C(6)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GAACATCCTGCGCCCAGCGGG	0.582																																					p.C432C		Atlas-SNP	.											TRIOBP_ENST00000344404,NS,carcinoma,0,8	TRIOBP	262	8	6	Substitution - coding silent(6)	kidney(3)|cervix(1)|lung(1)|endometrium(1)	c.C1296T						scavenged	.																																			SO:0001819	synonymous_variant	11078	exon7			ATCCTGCGCCCAG	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1296C>T	22.37:g.38119859C>T		Somatic	242	2	0.00826446		WXS	Illumina HiSeq	Phase_I	248	3	0.0120968	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	CCDS43015.1																																																																																			C|0.500;T|0.500	0.500	strong		0.582	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
IRAK2	3656	hgsc.bcm.edu	37	3	10251272	10251272	+	Splice_Site	SNP	G	G	A	rs140330791		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:10251272G>A	ENST00000256458.4	+	4	514		c.e4-1			NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2						activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						CTCCTTTCCAGGGTCCTCTCC	0.592																																					.		Atlas-SNP	.											IRAK2_ENST00000256458,caecum,carcinoma,-1,2	IRAK2	113	2	0			c.425-1G>A						PASS	.						125.0	134.0	131.0					3																	10251272		2203	4300	6503	SO:0001630	splice_region_variant	3656	exon4			TTTCCAGGGTCCT	AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.425-1G>A	3.37:g.10251272G>A		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	68	14	0.205882	NM_001570	B4DQZ6|Q08AG6|Q5K546	Splice_Site	SNP	ENST00000256458.4	37	CCDS33697.1	.	.	.	.	.	.	.	.	.	.	G	9.512	1.106048	0.20632	.	.	ENSG00000134070	ENST00000256458	.	.	.	4.44	4.44	0.53790	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9411	0.58345	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IRAK2	10226272	0.977000	0.34250	0.969000	0.41365	0.014000	0.08584	3.911000	0.56378	2.181000	0.69327	0.563000	0.77884	.	G|1.000;C|0.000	.	alt		0.592	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339623.1		Intron
SALL3	27164	hgsc.bcm.edu	37	18	76755256	76755256	+	Missense_Mutation	SNP	G	G	A	rs200983101	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:76755256G>A	ENST00000537592.2	+	2	3265	c.3265G>A	c.(3265-3267)Ggg>Agg	p.G1089R	SALL3_ENST00000575389.2_Missense_Mutation_p.G1017R|SALL3_ENST00000536229.3_Missense_Mutation_p.G884R	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1089					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GGTCCCCGCCGGGCCTCAGAC	0.716													G|||	16	0.00319489	0.0	0.0	5008	,	,		11981	0.0149		0.0	False		,,,				2504	0.001				p.G1089R		Atlas-SNP	.											.	SALL3	162	.	0			c.G3265A						PASS	.						9.0	12.0	11.0					18																	76755256		2171	4226	6397	SO:0001583	missense	27164	exon2			CCCGCCGGGCCTC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3265G>A	18.37:g.76755256G>A	ENSP00000441823:p.Gly1089Arg	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	8	8	1	NM_171999	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	9	0.004120879120879121	0	0.0	0	0.0	9	0.015734265734265736	0	0.0	G	15.42	2.829352	0.50845	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T;T	0.67171	2.81;-0.25	5.23	4.34	0.51931	.	0.104089	0.40064	N	0.001187	T	0.36193	0.0958	N	0.19112	0.55	0.33084	D	0.53701	B;D	0.60575	0.044;0.988	B;P	0.45506	0.02;0.483	T	0.54463	-0.8290	10	0.12430	T	0.62	-33.686	14.6441	0.68748	0.0:0.0:0.8532:0.1468	.	749;1089	F5GXY4;Q9BXA9	.;SALL3_HUMAN	R	1089;1017;749	ENSP00000441823:G1089R;ENSP00000439975:G1017R	ENSP00000299466:G1089R	G	+	1	0	SALL3	74856244	1.000000	0.71417	0.433000	0.26760	0.042000	0.13812	6.028000	0.70889	1.154000	0.42482	0.655000	0.94253	GGG	G|0.996;A|0.004	0.004	strong		0.716	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
TRDN	10345	hgsc.bcm.edu	37	6	123759264	123759264	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:123759264T>C	ENST00000398178.3	-	12	1016	c.995A>G	c.(994-996)aAa>aGa	p.K332R	RP11-532N4.2_ENST00000418467.2_RNA|RP11-532N4.2_ENST00000427828.1_RNA|RP11-532N4.2_ENST00000434768.1_RNA|RP11-532N4.2_ENST00000589182.1_RNA|TRDN_ENST00000334268.4_Missense_Mutation_p.K332R|RP11-532N4.2_ENST00000587106.2_RNA|RP11-532N4.2_ENST00000587049.1_RNA	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	332					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		GATATCTTCTTTTTCTGCTGG	0.343																																					p.K333R		Atlas-SNP	.											.	TRDN	88	.	0			c.A998G						PASS	.						108.0	100.0	102.0					6																	123759264		1815	4058	5873	SO:0001583	missense	10345	exon12			TCTTCTTTTTCTG	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.995A>G	6.37:g.123759264T>C	ENSP00000381240:p.Lys332Arg	Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	79	26	0.329114	NM_001251987	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	37	CCDS55053.1	.	.	.	.	.	.	.	.	.	.	T	18.29	3.592330	0.66219	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014	T;T	0.64260	-0.09;-0.09	5.64	5.64	0.86602	.	0.152578	0.41938	D	0.000781	T	0.56834	0.2012	N	0.24115	0.695	0.80722	D	1	D;D;D	0.76494	0.993;0.993;0.999	D;D;D	0.78314	0.978;0.978;0.991	T	0.61043	-0.7142	10	0.38643	T	0.18	-6.8293	12.5428	0.56182	0.0:0.0:0.0:1.0	.	332;333;332	Q5SWK9;Q8IVK2;Q13061	.;.;TRDN_HUMAN	R	332	ENSP00000381240:K332R;ENSP00000333984:K332R	ENSP00000333984:K332R	K	-	2	0	TRDN	123800963	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	2.046000	0.41260	2.275000	0.75901	0.528000	0.53228	AAA	.	.	none		0.343	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TCP1	6950	hgsc.bcm.edu	37	6	160208813	160208813	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:160208813G>A	ENST00000321394.7	-	3	521	c.241C>T	c.(241-243)Ctg>Ttg	p.L81L	SNORA29_ENST00000384183.1_RNA|TCP1_ENST00000544255.1_5'UTR|TCP1_ENST00000392168.2_5'UTR|MRPL18_ENST00000367034.4_5'Flank|TCP1_ENST00000420894.2_Silent_p.L81L|TCP1_ENST00000546023.1_5'Flank	NM_030752.2	NP_110379.2	P17987	TCPA_HUMAN	t-complex 1	81					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|tubulin complex assembly (GO:0007021)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|nuclear heterochromatin (GO:0005720)|pericentriolar material (GO:0000242)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(2)	10		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(65;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		TTGTCTTGCAGATCAGCCAGC	0.403																																					p.L81L		Atlas-SNP	.											.	TCP1	37	.	0			c.C241T						PASS	.						100.0	99.0	99.0					6																	160208813		2203	4300	6503	SO:0001819	synonymous_variant	6950	exon3			CTTGCAGATCAGC	X52882	CCDS5269.1, CCDS43522.1	6q25-q27	2012-10-02			ENSG00000120438	ENSG00000120438		"""Heat Shock Proteins / Chaperonins"""	11655	protein-coding gene	gene with protein product		186980				3476253, 3653076	Standard	NM_030752		Approved	D6S230E, CCT1, Ccta	uc003qsr.3	P17987	OTTHUMG00000015937	ENST00000321394.7:c.241C>T	6.37:g.160208813G>A		Somatic	380	0	0		WXS	Illumina HiSeq	Phase_I	455	124	0.272527	NM_030752	E1P5B2|Q15556|Q5TCM3	Silent	SNP	ENST00000321394.7	37	CCDS5269.1																																																																																			.	.	none		0.403	TCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042917.2	NM_030752	
GOLGA6L10	647042	hgsc.bcm.edu	37	15	82637061	82637061	+	Missense_Mutation	SNP	C	C	T	rs201670904	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr15:82637061C>T	ENST00000439287.4	-	6	1124	c.1025G>A	c.(1024-1026)cGg>cAg	p.R342Q		NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10	342										endometrium(1)|kidney(4)	5						ctccagctcccgcagcctctc	0.682													.|||	4106	0.819888	0.6135	0.8775	5008	,	,		8802	0.8631		0.8946	False		,,,				2504	0.9366				p.R342Q		Atlas-SNP	.											.	GOLGA6L10	16	.	0			c.G1025A						PASS	.																																			SO:0001583	missense	647042	exon6			AGCTCCCGCAGCC		CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580	ENST00000439287.4:c.1025G>A	15.37:g.82637061C>T	ENSP00000388606:p.Arg342Gln	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_001164465		Missense_Mutation	SNP	ENST00000439287.4	37	CCDS45325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.027|0.027	-1.363797|-1.363797	0.01235|0.01235	.|.	.|.	ENSG00000205281|ENSG00000205281	ENST00000430944|ENST00000439287	.|T	.|0.26660	.|1.72	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.18800|0.18800	0.0451|0.0451	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	P|P	0.0|0.0	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.30416|0.30416	-0.9979|-0.9979	4|5	0.87932|0.10111	D|T	0|0.7	.|.	2.8676|2.8676	0.05607|0.05607	0.4957:0.5038:2.0E-4:3.0E-4|0.4957:0.5038:2.0E-4:3.0E-4	.|.	.|.	.|.	.|.	R|Q	342|342	.|ENSP00000388606:R342Q	ENSP00000390083:G342R|ENSP00000388606:R342Q	G|R	-|-	1|2	0|0	GOLGA6L10|GOLGA6L10	80424116|80424116	0.000000|0.000000	0.05858|0.05858	0.312000|0.312000	0.25196|0.25196	0.315000|0.315000	0.28087|0.28087	-0.441000|-0.441000	0.06879|0.06879	0.107000|0.107000	0.17824|0.17824	0.109000|0.109000	0.15622|0.15622	GGG|CGG	.	.	weak		0.682	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419403.2	NM_001164465	
ROBO3	64221	hgsc.bcm.edu	37	11	124740064	124740064	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:124740064G>T	ENST00000397801.1	+	5	962	c.770G>T	c.(769-771)cGt>cTt	p.R257L	ROBO3_ENST00000538940.1_Missense_Mutation_p.R235L	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	257					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TCCATAGAGCGTCCCTCATTC	0.552																																					p.R257L		Atlas-SNP	.											ROBO3_ENST00000397801,NS,carcinoma,0,6	ROBO3	199	6	0			c.G770T						PASS	.						132.0	139.0	137.0					11																	124740064		2074	4209	6283	SO:0001583	missense	64221	exon5			TAGAGCGTCCCTC	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.770G>T	11.37:g.124740064G>T	ENSP00000380903:p.Arg257Leu	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	138	67	0.485507	NM_022370		Missense_Mutation	SNP	ENST00000397801.1	37	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323040	0.81580	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.29655	1.56;1.56	4.96	4.02	0.46733	Immunoglobulin-like fold (1);	0.000000	0.33753	U	0.004590	T	0.49474	0.1559	L	0.49699	1.58	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.51076	-0.8751	10	0.59425	D	0.04	.	15.0	0.71464	0.0:0.1438:0.8562:0.0	.	257	Q96MS0	ROBO3_HUMAN	L	257;235	ENSP00000380903:R257L;ENSP00000441797:R235L	ENSP00000380903:R257L	R	+	2	0	ROBO3	124245274	1.000000	0.71417	0.990000	0.47175	0.935000	0.57460	9.608000	0.98331	1.173000	0.42796	0.462000	0.41574	CGT	.	.	none		0.552	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663	
MYH1	4619	hgsc.bcm.edu	37	17	10399327	10399327	+	Silent	SNP	C	C	T	rs149731873	byFrequency	TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:10399327C>T	ENST00000226207.5	-	35	5203	c.5109G>A	c.(5107-5109)agG>agA	p.R1703R	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1703					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R1703R(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTGCGATTTTCCTGCTCCTCT	0.542													C|||	5	0.000998403	0.0008	0.0	5008	,	,		16305	0.002		0.002	False		,,,				2504	0.0				p.R1703R		Atlas-SNP	.											MYH1,NS,carcinoma,0,1	MYH1	403	1	1	Substitution - coding silent(1)	kidney(1)	c.G5109A						scavenged	.						102.0	92.0	96.0					17																	10399327		2203	4300	6503	SO:0001819	synonymous_variant	4619	exon35			GATTTTCCTGCTC		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5109G>A	17.37:g.10399327C>T		Somatic	132	1	0.00757576		WXS	Illumina HiSeq	Phase_I	143	8	0.0559441	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	37	CCDS11155.1																																																																																			C|0.999;T|0.001	0.001	strong		0.542	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
FRG1	2483	hgsc.bcm.edu	37	4	190873379	190873379	+	Missense_Mutation	SNP	A	A	G	rs112612436		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr4:190873379A>G	ENST00000226798.4	+	3	418	c.196A>G	c.(196-198)Aag>Gag	p.K66E	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	66			K -> E (in dbSNP:rs17406826).		mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K66E(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGAAATGGATAAGGGAACCTA	0.383																																					p.K66E		Atlas-SNP	.											FRG1,arm,malignant_melanoma,0,1	FRG1	76	1	1	Substitution - Missense(1)	skin(1)	c.A196G						scavenged	.						101.0	115.0	110.0					4																	190873379		2203	4298	6501	SO:0001583	missense	2483	exon3			ATGGATAAGGGAA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.196A>G	4.37:g.190873379A>G	ENSP00000226798:p.Lys66Glu	Somatic	132	22	0.166667		WXS	Illumina HiSeq	Phase_I	73	9	0.123288	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	11.33	1.608104	0.28623	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.44083	2.07;0.93	3.47	2.23	0.28157	Actin cross-linking (1);	0.148940	0.64402	D	0.000013	T	0.29288	0.0729	L	0.52011	1.625	0.42341	D	0.992332	B	0.02656	0.0	B	0.04013	0.001	T	0.10314	-1.0635	10	0.06757	T	0.87	-8.6418	8.2577	0.31766	0.7983:0.2017:0.0:0.0	rs17406826	66	Q14331	FRG1_HUMAN	E	66;3	ENSP00000226798:K66E;ENSP00000435943:K3E	ENSP00000226798:K66E	K	+	1	0	FRG1	191110373	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.931000	0.48932	0.668000	0.31126	0.441000	0.28932	AAG	.	.	weak		0.383	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
GPC6	10082	hgsc.bcm.edu	37	13	93879792	93879792	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr13:93879792G>T	ENST00000377047.4	+	1	698	c.83G>T	c.(82-84)cGg>cTg	p.R28L		NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	28					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GTGAAGGCTCGGAGCTGCGGA	0.652											OREG0022460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R28L		Atlas-SNP	.											.	GPC6	102	.	0			c.G83T						PASS	.						76.0	75.0	75.0					13																	93879792		2203	4300	6503	SO:0001583	missense	10082	exon1			AGGCTCGGAGCTG	AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.83G>T	13.37:g.93879792G>T	ENSP00000366246:p.Arg28Leu	Somatic	87	0	0	1301	WXS	Illumina HiSeq	Phase_I	66	26	0.393939	NM_005708	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	CCDS9469.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.074921	0.76415	.	.	ENSG00000183098	ENST00000377047	T	0.53206	0.63	5.52	5.52	0.82312	.	0.000000	0.51477	D	0.000084	T	0.54581	0.1867	M	0.74467	2.265	0.42422	D	0.992645	B;B	0.22080	0.021;0.064	B;B	0.31686	0.019;0.134	T	0.51733	-0.8668	10	0.25751	T	0.34	.	19.0471	0.93025	0.0:0.0:1.0:0.0	.	28;28	B4E2M1;Q9Y625	.;GPC6_HUMAN	L	28	ENSP00000366246:R28L	ENSP00000366246:R28L	R	+	2	0	GPC6	92677793	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.124000	0.77185	2.604000	0.88044	0.655000	0.94253	CGG	.	.	none		0.652	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	
IER2	9592	hgsc.bcm.edu	37	19	13264330	13264330	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:13264330C>T	ENST00000588173.1	+	1	1542	c.330C>T	c.(328-330)tgC>tgT	p.C110C	CTC-250I14.6_ENST00000592882.1_RNA|IER2_ENST00000292433.3_Silent_p.C110C|IER2_ENST00000587885.1_Silent_p.C110C|CTC-250I14.6_ENST00000586483.1_RNA			Q9BTL4	IER2_HUMAN	immediate early response 2	110						cytoplasm (GO:0005737)				kidney(1)|lung(1)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			CCTCCGCCTGCTGTGCCCCGC	0.706											OREG0025291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C110C		Atlas-SNP	.											.	IER2	14	.	0			c.C330T						PASS	.						8.0	9.0	9.0					19																	13264330		2152	4205	6357	SO:0001819	synonymous_variant	9592	exon2			CGCCTGCTGTGCC	M62831	CCDS12295.1	19p13.13	2008-02-05				ENSG00000160888			28871	protein-coding gene	gene with protein product						2061303	Standard	NM_004907		Approved	ETR101	uc002mwr.3	Q9BTL4		ENST00000588173.1:c.330C>T	19.37:g.13264330C>T		Somatic	17	0	0	686	WXS	Illumina HiSeq	Phase_I	12	7	0.583333	NM_004907	Q03827|Q2TAZ2	Silent	SNP	ENST00000588173.1	37	CCDS12295.1																																																																																			.	.	none		0.706	IER2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453033.1	NM_004907	
HIST1H2BJ	8970	hgsc.bcm.edu	37	6	27100241	27100241	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr6:27100241T>C	ENST00000607124.1	-	1	288	c.289A>G	c.(289-291)Acg>Gcg	p.T97A	HIST1H2BJ_ENST00000541790.1_Missense_Mutation_p.T97A|HIST1H2AG_ENST00000359193.2_5'Flank|HIST1H2BJ_ENST00000339812.2_Missense_Mutation_p.T97A			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	97					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						CGCACGGCCGTCTGGATCTCC	0.592																																					p.T97A		Atlas-SNP	.											.	HIST1H2BJ	21	.	0			c.A289G						PASS	.						82.0	85.0	84.0					6																	27100241		2203	4300	6503	SO:0001583	missense	8970	exon1			CGGCCGTCTGGAT	X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.289A>G	6.37:g.27100241T>C	ENSP00000476136:p.Thr97Ala	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	99	4	0.040404	NM_021058	B2R4J4|O60816	Missense_Mutation	SNP	ENST00000607124.1	37	CCDS4618.1	.	.	.	.	.	.	.	.	.	.	T	19.82	3.897676	0.72639	.	.	ENSG00000124635	ENST00000541790;ENST00000339812	T;T	0.41758	0.99;0.99	4.16	4.16	0.48862	Histone-fold (2);Histone core (1);	0.000000	0.44097	U	0.000498	T	0.53786	0.1818	M	0.81802	2.56	0.58432	D	0.999996	D	0.57899	0.981	D	0.64042	0.921	T	0.61973	-0.6952	10	0.87932	D	0	.	11.8112	0.52183	0.0:0.0:0.0:1.0	.	97	P06899	H2B1J_HUMAN	A	97	ENSP00000445633:T97A;ENSP00000342886:T97A	ENSP00000342886:T97A	T	-	1	0	HIST1H2BJ	27208220	1.000000	0.71417	1.000000	0.80357	0.362000	0.29581	3.651000	0.54431	1.841000	0.53522	0.477000	0.44152	ACG	.	.	none		0.592	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040138.2	NM_021058	
KALRN	8997	hgsc.bcm.edu	37	3	124385389	124385389	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr3:124385389C>T	ENST00000291478.5	+	13	1508	c.1345C>T	c.(1345-1347)Cgc>Tgc	p.R449C	KALRN_ENST00000393496.1_Missense_Mutation_p.R487C|KALRN_ENST00000360013.3_Missense_Mutation_p.R2146C|KALRN_ENST00000428018.2_Missense_Mutation_p.R417C|KALRN_ENST00000459915.1_Missense_Mutation_p.R238C	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2145					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CAAAGAGAGGCGCGTGTTCCT	0.547																																					p.R2146C		Atlas-SNP	.											.	KALRN	556	.	0			c.C6436T						PASS	.						96.0	85.0	89.0					3																	124385389		2203	4300	6503	SO:0001583	missense	8997	exon46			GAGAGGCGCGTGT	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.1345C>T	3.37:g.124385389C>T	ENSP00000291478:p.Arg449Cys	Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	184	50	0.271739	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000291478.5	37	CCDS3028.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.923372	0.73213	.	.	ENSG00000160145	ENST00000360013;ENST00000393496;ENST00000291478;ENST00000428018;ENST00000459915	T;T;T;T;T	0.12984	2.63;2.63;2.63;2.63;2.63	5.15	5.15	0.70609	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.44393	0.1291	M	0.90650	3.135	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.999;1.0;0.996	T	0.51084	-0.8750	10	0.87932	D	0	.	13.566	0.61819	0.193:0.807:0.0:0.0	.	238;449;487;2145	E7EUZ8;C9JQ37;O60229-5;O60229	.;.;.;KALRN_HUMAN	C	2146;487;449;417;238	ENSP00000353109:R2146C;ENSP00000377134:R487C;ENSP00000291478:R449C;ENSP00000402419:R417C;ENSP00000420318:R238C	ENSP00000291478:R449C	R	+	1	0	KALRN	125868079	0.883000	0.30277	0.999000	0.59377	0.993000	0.82548	1.698000	0.37794	2.687000	0.91594	0.563000	0.77884	CGC	.	.	none		0.547	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
PHRF1	57661	hgsc.bcm.edu	37	11	608546	608546	+	Silent	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:608546G>A	ENST00000264555.5	+	14	3218	c.3090G>A	c.(3088-3090)tcG>tcA	p.S1030S	PHRF1_ENST00000416188.2_Silent_p.S1029S|PHRF1_ENST00000533464.1_Silent_p.S1026S|PHRF1_ENST00000413872.2_Silent_p.S1028S	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1030	Arg-rich.				mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						ACAGGAGCTCGAGGTCAGCGT	0.677																																					p.S1029S		Atlas-SNP	.											PHRF1_ENST00000264555,NS,lymphoid_neoplasm,+1,2	PHRF1	188	2	0			c.G3087A						PASS	.						26.0	31.0	29.0					11																	608546		2189	4293	6482	SO:0001819	synonymous_variant	57661	exon14			GAGCTCGAGGTCA	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.3090G>A	11.37:g.608546G>A		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	97	39	0.402062	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	ENST00000264555.5	37																																																																																				.	.	none		0.677	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
RNF133	168433	hgsc.bcm.edu	37	7	122338257	122338257	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr7:122338257A>C	ENST00000340112.2	-	1	953	c.716T>G	c.(715-717)cTt>cGt	p.L239R	CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000313070.7_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	239					protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						TACTACTCGAAGTTGGAGTTG	0.388																																					p.L239R	Colon(198;1778 2057 7449 19869 45985)	Atlas-SNP	.											.	RNF133	41	.	0			c.T716G						PASS	.						157.0	151.0	153.0					7																	122338257		2203	4300	6503	SO:0001583	missense	168433	exon1			ACTCGAAGTTGGA	AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.716T>G	7.37:g.122338257A>C	ENSP00000344489:p.Leu239Arg	Somatic	326	0	0		WXS	Illumina HiSeq	Phase_I	455	87	0.191209	NM_139175	A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	37	CCDS5784.1	.	.	.	.	.	.	.	.	.	.	A	12.76	2.035419	0.35893	.	.	ENSG00000188050	ENST00000340112	T	0.16597	2.33	5.53	5.53	0.82687	.	0.435749	0.19868	U	0.104271	T	0.38348	0.1037	M	0.62723	1.935	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.06516	-1.0822	10	0.49607	T	0.09	.	13.8971	0.63778	1.0:0.0:0.0:0.0	.	239	Q8WVZ7	RN133_HUMAN	R	239	ENSP00000344489:L239R	ENSP00000344489:L239R	L	-	2	0	RNF133	122125493	0.933000	0.31639	0.140000	0.22221	0.021000	0.10359	5.341000	0.65964	2.099000	0.63709	0.402000	0.26972	CTT	.	.	none		0.388	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175	
WBP11	51729	hgsc.bcm.edu	37	12	14952649	14952649	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr12:14952649C>T	ENST00000261167.2	-	4	343	c.110G>A	c.(109-111)cGc>cAc	p.R37H		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	37	Required for nuclear import. {ECO:0000250}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						AACCATCATGCGCTGTTTTTT	0.368																																					p.R37H		Atlas-SNP	.											WBP11,NS,carcinoma,-1,1	WBP11	66	1	0			c.G110A						scavenged	.						103.0	85.0	91.0					12																	14952649		2201	4298	6499	SO:0001583	missense	51729	exon4			ATCATGCGCTGTT	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.110G>A	12.37:g.14952649C>T	ENSP00000261167:p.Arg37His	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	63	2	0.031746	NM_016312	Q96AY8	Missense_Mutation	SNP	ENST00000261167.2	37	CCDS8666.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.985656	0.74589	.	.	ENSG00000084463	ENST00000261167;ENST00000537574;ENST00000535328	.	.	.	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.77498	0.4139	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.78807	-0.2059	9	0.66056	D	0.02	-1.017	16.3982	0.83630	0.0:1.0:0.0:0.0	.	37	Q9Y2W2	WBP11_HUMAN	H	37	.	ENSP00000261167:R37H	R	-	2	0	WBP11	14843916	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.152000	0.77419	2.738000	0.93877	0.609000	0.83330	CGC	.	.	none		0.368	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400850.1	NM_016312	
NHLRC3	387921	hgsc.bcm.edu	37	13	39621247	39621247	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr13:39621247C>T	ENST00000379600.3	+	6	1071	c.749C>T	c.(748-750)gCa>gTa	p.A250V	NHLRC3_ENST00000379599.2_Missense_Mutation_p.A183V|NHLRC3_ENST00000470258.1_Missense_Mutation_p.A53V	NM_001012754.3	NP_001012772.1	Q5JS37	NHLC3_HUMAN	NHL repeat containing 3	250						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(3)|lung(4)|skin(2)	11		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;2.37e-08)|Epithelial(112;3.14e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00101)|BRCA - Breast invasive adenocarcinoma(63;0.00335)|GBM - Glioblastoma multiforme(144;0.0128)		TGGTTAGGAGCATGGAATAAT	0.373																																					p.A250V		Atlas-SNP	.											NHLRC3,NS,carcinoma,+1,1	NHLRC3	35	1	0			c.C749T						scavenged	.						147.0	149.0	148.0					13																	39621247		2203	4300	6503	SO:0001583	missense	387921	exon6			TAGGAGCATGGAA		CCDS31961.1, CCDS31962.1	13q13.3	2007-12-18			ENSG00000188811	ENSG00000188811			33751	protein-coding gene	gene with protein product							Standard	NM_001017370		Approved		uc001uxc.4	Q5JS37	OTTHUMG00000016765	ENST00000379600.3:c.749C>T	13.37:g.39621247C>T	ENSP00000368920:p.Ala250Val	Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	99	2	0.020202	NM_001012754	B2RTZ2|B4DTL0|Q69YI9	Missense_Mutation	SNP	ENST00000379600.3	37	CCDS31961.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075685	0.36662	.	.	ENSG00000188811	ENST00000470258;ENST00000379600;ENST00000379599	D;D;D	0.89552	-2.53;-2.53;-2.53	5.68	-0.538	0.11868	Six-bladed beta-propeller, TolB-like (1);	0.834567	0.11281	N	0.580320	D	0.83087	0.5178	L	0.50333	1.59	0.09310	N	1	B;B	0.23442	0.085;0.062	B;B	0.25140	0.039;0.058	T	0.67883	-0.5555	9	.	.	.	-0.6607	7.3706	0.26800	0.5786:0.2893:0.0:0.1321	.	183;250	B4DTL0;Q5JS37	.;NHLC3_HUMAN	V	53;250;183	ENSP00000418127:A53V;ENSP00000368920:A250V;ENSP00000368919:A183V	.	A	+	2	0	NHLRC3	38519247	0.003000	0.15002	0.079000	0.20413	0.985000	0.73830	0.919000	0.28692	-0.121000	0.11787	0.563000	0.77884	GCA	.	.	none		0.373	NHLRC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044616.2	NM_001012754	
DMKN	93099	hgsc.bcm.edu	37	19	36002404	36002404	+	Missense_Mutation	SNP	C	C	T	rs56743379|rs138902616		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr19:36002404C>T	ENST00000339686.3	-	5	1003	c.827G>A	c.(826-828)aGc>aAc	p.S276N	DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000424570.2_Missense_Mutation_p.S276N|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000451297.2_Missense_Mutation_p.S276N|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000440396.1_Missense_Mutation_p.S276N|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.S276N|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.S276N|DMKN_ENST00000414866.2_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	276	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			gccactgctgctgccactgct	0.647																																					p.S276N		Atlas-SNP	.											DMKN,NS,carcinoma,0,2	DMKN	116	2	1	Deletion - In frame(1)	ovary(1)	c.G827A						scavenged	.						28.0	21.0	23.0					19																	36002404		2176	4255	6431	SO:0001583	missense	93099	exon5			CTGCTGCTGCCAC	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.827G>A	19.37:g.36002404C>T	ENSP00000342012:p.Ser276Asn	Somatic	52	1	0.0192308		WXS	Illumina HiSeq	Phase_I	45	9	0.2	NM_001126058	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	C	7.414	0.635437	0.14322	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1	3.2	-1.74	0.08056	.	0.904855	0.09337	N	0.815985	T	0.30696	0.0773	L	0.48642	1.525	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.08055	0.001;0.001;0.001;0.001;0.003	T	0.32241	-0.9914	10	0.16896	T	0.51	5.0393	8.4003	0.32581	0.0:0.7659:0.0:0.2341	.	276;276;276;276;276	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;Q6E0U4	.;.;.;.;DMKN_HUMAN	N	276	ENSP00000342012:S276N;ENSP00000394908:S276N;ENSP00000415277:S276N;ENSP00000414743:S276N;ENSP00000388404:S276N;ENSP00000409513:S276N	ENSP00000342012:S276N	S	-	2	0	DMKN	40694244	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.213000	0.09305	-0.013000	0.14199	-1.984000	0.00453	AGC	.	.	weak		0.647	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
DCC	1630	hgsc.bcm.edu	37	18	50432601	50432601	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr18:50432601C>T	ENST00000442544.2	+	3	1216	c.600C>T	c.(598-600)agC>agT	p.S200S	DCC_ENST00000412726.1_Silent_p.S48S	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	200	Ig-like C2-type 2.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGCAGATCAGCCGACTCCAAC	0.512																																					p.S200S		Atlas-SNP	.											DCC,NS,carcinoma,+1,1	DCC	360	1	0			c.C600T						PASS	.						81.0	75.0	77.0					18																	50432601		2203	4300	6503	SO:0001819	synonymous_variant	1630	exon3			GATCAGCCGACTC	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.600C>T	18.37:g.50432601C>T		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	203	34	0.167488	NM_005215		Silent	SNP	ENST00000442544.2	37	CCDS11952.1																																																																																			.	.	none		0.512	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
CASC3	22794	hgsc.bcm.edu	37	17	38325589	38325589	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr17:38325589G>A	ENST00000264645.7	+	12	2204	c.1978G>A	c.(1978-1980)Gta>Ata	p.V660I		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	660	Necessary for localization in cytoplasmic stress granules.				gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						CCCATCACAGGTATATGGAGG	0.537																																					p.V660I		Atlas-SNP	.											.	CASC3	39	.	0			c.G1978A						PASS	.						80.0	90.0	87.0					17																	38325589		2203	4300	6503	SO:0001583	missense	22794	exon12			TCACAGGTATATG	X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.1978G>A	17.37:g.38325589G>A	ENSP00000264645:p.Val660Ile	Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	206	68	0.330097	NM_007359	A8K8R0	Missense_Mutation	SNP	ENST00000264645.7	37	CCDS11362.1	.	.	.	.	.	.	.	.	.	.	G	32	5.120484	0.94385	.	.	ENSG00000108349	ENST00000264645;ENST00000394114	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.65883	0.2734	L	0.27053	0.805	0.80722	D	1	D	0.64830	0.994	D	0.72625	0.978	T	0.66748	-0.5845	9	0.49607	T	0.09	-11.1308	18.5194	0.90947	0.0:0.0:1.0:0.0	.	660	O15234	CASC3_HUMAN	I	660	.	ENSP00000264645:V660I	V	+	1	0	CASC3	35579115	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.121000	0.94375	2.778000	0.95560	0.655000	0.94253	GTA	.	.	none		0.537	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257127.3	NM_007359	
TRIO	7204	hgsc.bcm.edu	37	5	14359502	14359502	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr5:14359502C>G	ENST00000344204.4	+	13	2277	c.2253C>G	c.(2251-2253)aaC>aaG	p.N751K	TRIO_ENST00000509967.2_Missense_Mutation_p.N702K|TRIO_ENST00000537187.1_Missense_Mutation_p.N751K	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	751					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CCCCCCACAACAGCTCCATCA	0.542																																					p.N751K		Atlas-SNP	.											.	TRIO	305	.	0			c.C2253G						PASS	.						89.0	86.0	87.0					5																	14359502		2203	4300	6503	SO:0001583	missense	7204	exon13			CCACAACAGCTCC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.2253C>G	5.37:g.14359502C>G	ENSP00000339299:p.Asn751Lys	Somatic	456	0	0		WXS	Illumina HiSeq	Phase_I	376	155	0.412234	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940315	0.52972	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.56444	1.01;1.01;0.46	5.31	3.53	0.40419	.	0.000000	0.85682	D	0.000000	T	0.45296	0.1335	N	0.08118	0	0.53688	D	0.999978	P;D;B	0.58970	0.486;0.984;0.295	B;P;B	0.58454	0.205;0.839;0.091	T	0.38200	-0.9672	10	0.33141	T	0.24	.	11.5233	0.50565	0.0:0.855:0.0:0.145	.	702;751;751	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	K	751;751;702;438	ENSP00000339299:N751K;ENSP00000446348:N751K;ENSP00000445592:N702K	ENSP00000339299:N751K	N	+	3	2	TRIO	14412502	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.089000	0.71384	0.631000	0.30412	0.650000	0.86243	AAC	.	.	none		0.542	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
RBMXL1	494115	hgsc.bcm.edu	37	1	89448539	89448539	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:89448539C>G	ENST00000321792.5	-	2	1398	c.971G>C	c.(970-972)cGa>cCa	p.R324P	RBMXL1_ENST00000399794.2_Missense_Mutation_p.R324P|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000413769.1_5'Flank	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	324	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										GTAACTGTCTCGACTTCCACC	0.517																																					p.R324P		Atlas-SNP	.											CCBL2,NS,carcinoma,-1,1	.	.	1	0			c.G971C						scavenged	.						185.0	184.0	184.0					1																	89448539		2203	4300	6503	SO:0001583	missense	494115	exon3			CTGTCTCGACTTC	BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.971G>C	1.37:g.89448539C>G	ENSP00000318415:p.Arg324Pro	Somatic	373	8	0.0214477		WXS	Illumina HiSeq	Phase_I	232	6	0.0258621	NM_001162536		Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.844738	0.51164	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.77358	-1.09;-1.09	1.89	0.895	0.19247	.	0.070349	0.64402	D	0.000016	T	0.62925	0.2468	M	0.65498	2.005	0.33162	D	0.547093	D	0.55172	0.97	P	0.46796	0.527	T	0.60667	-0.7218	10	0.52906	T	0.07	-3.2327	6.12	0.20148	0.0:0.8158:0.0:0.1842	.	324	Q96E39	RBMXL_HUMAN	P	324	ENSP00000318415:R324P;ENSP00000446099:R324P	ENSP00000318415:R324P	R	-	2	0	RBMXL1	89221127	1.000000	0.71417	0.995000	0.50966	0.753000	0.42808	4.995000	0.63908	0.128000	0.18479	0.306000	0.20318	CGA	.	.	none		0.517	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
OR6K6	128371	hgsc.bcm.edu	37	1	158725103	158725103	+	Silent	SNP	C	C	T			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr1:158725103C>T	ENST00000368144.2	+	1	594	c.498C>T	c.(496-498)ccC>ccT	p.P166P		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					TCATGATTCCCAAACTTTGTA	0.478																																					p.P166P		Atlas-SNP	.											OR6K6,right_upper_lobe,carcinoma,+2,1	OR6K6	81	1	0			c.C498T						scavenged	.						146.0	121.0	129.0					1																	158725103		2203	4300	6503	SO:0001819	synonymous_variant	128371	exon1			GATTCCCAAACTT	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.498C>T	1.37:g.158725103C>T		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	128	2	0.015625	NM_001005184	B9EIM8|Q5VUU9|Q6IFR4	Silent	SNP	ENST00000368144.2	37	CCDS30904.1																																																																																			.	.	none		0.478	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184	
UBTD1	80019	hgsc.bcm.edu	37	10	99327781	99327781	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr10:99327781T>C	ENST00000370664.3	+	2	517	c.181T>C	c.(181-183)Ttc>Ctc	p.F61L		NM_024954.3	NP_079230.1	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1	61										central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		AGCGCCTGCCTTCGAGGGCCG	0.627																																					p.F61L	Pancreas(100;169 2668 32720)	Atlas-SNP	.											UBTD1,colon,carcinoma,-2,1	UBTD1	19	1	0			c.T181C						scavenged	.						95.0	89.0	91.0					10																	99327781		2203	4300	6503	SO:0001583	missense	80019	exon2			CCTGCCTTCGAGG	BC007331	CCDS7465.1	10q24.2	2005-09-22			ENSG00000165886	ENSG00000165886			25683	protein-coding gene	gene with protein product						12477932	Standard	NM_024954		Approved	FLJ11807	uc001knv.1	Q9HAC8	OTTHUMG00000018856	ENST00000370664.3:c.181T>C	10.37:g.99327781T>C	ENSP00000359698:p.Phe61Leu	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	157	3	0.0191083	NM_024954	D3DR57|Q53HI3	Missense_Mutation	SNP	ENST00000370664.3	37	CCDS7465.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.314173	0.81358	.	.	ENSG00000165886	ENST00000370664	T	0.46451	0.87	5.7	5.7	0.88788	.	0.139837	0.64402	D	0.000003	T	0.62756	0.2454	M	0.79123	2.44	0.80722	D	1	D	0.54207	0.965	P	0.59171	0.853	T	0.66945	-0.5795	10	0.66056	D	0.02	-12.3524	15.9583	0.79906	0.0:0.0:0.0:1.0	.	61	Q9HAC8	UBTD1_HUMAN	L	61	ENSP00000359698:F61L	ENSP00000359698:F61L	F	+	1	0	UBTD1	99317771	1.000000	0.71417	0.825000	0.32803	0.019000	0.09904	8.040000	0.89188	2.313000	0.78055	0.519000	0.50382	TTC	.	.	none		0.627	UBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049701.1	NM_024954	
DCHS1	8642	hgsc.bcm.edu	37	11	6643761	6643761	+	Missense_Mutation	SNP	T	T	A	rs368872716		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr11:6643761T>A	ENST00000299441.3	-	21	9557	c.9146A>T	c.(9145-9147)gAg>gTg	p.E3049V	RP11-732A19.5_ENST00000526456.1_RNA|RP11-732A19.9_ENST00000545572.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	3049					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACGGGGGAACTCATTGATCAT	0.602																																					p.E3049V		Atlas-SNP	.											.	DCHS1	277	.	0			c.A9146T						PASS	.	T	VAL/GLU	0,4386		0,0,2193	31.0	23.0	26.0		9146	4.6	1.0	11		26	1,8573		0,1,4286	no	missense	DCHS1	NM_003737.2	121	0,1,6479	AA,AT,TT		0.0117,0.0,0.0077	probably-damaging	3049/3299	6643761	1,12959	2193	4287	6480	SO:0001583	missense	8642	exon21			GGGAACTCATTGA	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.9146A>T	11.37:g.6643761T>A	ENSP00000299441:p.Glu3049Val	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	60	25	0.416667	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	T	18.05	3.535958	0.64972	0.0	1.17E-4	ENSG00000166341	ENST00000299441	T	0.64991	-0.13	4.62	4.62	0.57501	.	0.000000	0.37857	N	0.001901	T	0.78323	0.4265	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81252	-0.1017	10	0.66056	D	0.02	.	13.346	0.60573	0.0:0.0:0.0:1.0	.	3049	Q96JQ0	PCD16_HUMAN	V	3049	ENSP00000299441:E3049V	ENSP00000299441:E3049V	E	-	2	0	DCHS1	6600337	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.811000	0.86092	1.939000	0.56221	0.379000	0.24179	GAG	.	.	weak		0.602	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
AHNAK2	113146	hgsc.bcm.edu	37	14	105418968	105418968	+	Silent	SNP	G	G	C			TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr14:105418968G>C	ENST00000333244.5	-	7	2939	c.2820C>G	c.(2818-2820)ggC>ggG	p.G940G	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	940						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCAGCTTGGGGCCCTTAACAT	0.622																																					p.G940G		Atlas-SNP	.											.	AHNAK2	719	.	0			c.C2820G						PASS	.						138.0	159.0	152.0					14																	105418968		1861	4088	5949	SO:0001819	synonymous_variant	113146	exon7			CTTGGGGCCCTTA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2820C>G	14.37:g.105418968G>C		Somatic	236	0	0		WXS	Illumina HiSeq	Phase_I	183	67	0.36612	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.	.	none		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
DOCK8	81704	hgsc.bcm.edu	37	9	289578	289578	+	Missense_Mutation	SNP	G	G	A	rs573137471		TCGA-FF-8042-01A-11D-2210-10	TCGA-FF-8042-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	897a4500-6fb8-4e81-aa07-021a26d632fb	92bd05d0-5cb1-4e14-9c66-c3b020b1d9c2	g.chr9:289578G>A	ENST00000453981.1	+	4	513	c.401G>A	c.(400-402)cGg>cAg	p.R134Q	DOCK8_ENST00000432829.2_Missense_Mutation_p.R66Q|DOCK8_ENST00000469391.1_Missense_Mutation_p.R66Q			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	134					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ATCGTGAACCGGAAGTAAGTT	0.328																																					p.R134Q		Atlas-SNP	.											DOCK8_ENST00000453981,NS,carcinoma,0,2	DOCK8	401	2	0			c.G401A						scavenged	.						157.0	151.0	153.0					9																	289578		2203	4300	6503	SO:0001583	missense	81704	exon4			TGAACCGGAAGTA	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.401G>A	9.37:g.289578G>A	ENSP00000408464:p.Arg134Gln	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	69	2	0.0289855	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	37	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431547	0.43122	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000479404;ENST00000487230;ENST00000469391	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	5.87	0.19	0.15125	.	0.480653	0.22214	N	0.063054	T	0.40932	0.1137	M	0.76574	2.34	0.42144	D	0.99152	B;B;B	0.33000	0.02;0.393;0.009	B;B;B	0.25884	0.064;0.04;0.064	T	0.22591	-1.0212	10	0.32370	T	0.25	.	10.0607	0.42273	0.3174:0.0:0.6826:0.0	.	66;134;134	E9PH09;A2A349;Q8NF50	.;.;DOCK8_HUMAN	Q	134;134;66;66;66;66	ENSP00000408464:R134Q;ENSP00000394888:R66Q;ENSP00000417082:R66Q;ENSP00000418318:R66Q;ENSP00000419438:R66Q	ENSP00000287364:R134Q	R	+	2	0	DOCK8	279578	1.000000	0.71417	0.971000	0.41717	0.329000	0.28539	2.496000	0.45346	-0.139000	0.11414	-0.783000	0.03347	CGG	.	.	none		0.328	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
