#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATXN1	6310	hgsc.bcm.edu	37	6	16327915	16327916	+	In_Frame_Ins	INS	-	-	TGC	rs11969612|rs369629396	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:16327915_16327916insTGC	ENST00000244769.4	-	8	1562_1563	c.626_627insGCA	c.(625-627)cat>caGCAt	p.208_209insQ	ATXN1_ENST00000436367.1_In_Frame_Ins_p.208_209insQ	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	208	Poly-Gln.		H -> Q (in dbSNP:rs11969612).		adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.H209delH(2)|p.H209_H211delHQH(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgatgctgatgctgctgctg	0.668																																					p.H209delinsQH		Atlas-Indel	.											ATXN1,colon,carcinoma,0,1	ATXN1	117	1	3	Deletion - In frame(3)	upper_aerodigestive_tract(1)|large_intestine(1)|prostate(1)	c.627_628insGCA						PASS	.																																			SO:0001652	inframe_insertion	6310	exon8			.	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.624_626dupGCA	6.37:g.16327922_16327924dupTGC	ENSP00000244769:p.Gln209_Gln210dup	Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	51	17	0.333333	NM_000332	Q17S02|Q9UJG2|Q9Y4J1	In_Frame_Ins	INS	ENST00000244769.4	37	CCDS34342.1																																																																																			.	.	weak		0.668	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
SHKBP1	92799	hgsc.bcm.edu	37	19	41095087	41095112	+	Intron	DEL	GAGGACAGTCCTGTCCAACAGGGAGG	GAGGACAGTCCTGTCCAACAGGGAGG	-	rs528660073|rs547185289	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	GAGGACAGTCCTGTCCAACAGGGAGG	GAGGACAGTCCTGTCCAACAGGGAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:41095087_41095112delGAGGACAGTCCTGTCCAACAGGGAGG	ENST00000291842.5	+	15	1638				SHKBP1_ENST00000600733.1_Intron|SHKBP1_ENST00000597649.1_Intron	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1						protein homooligomerization (GO:0051260)					breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGGCAGCGGTGAGGACAGTCCTGTCCAACAGGGAGGGAGGACAGTC	0.606														1576	0.314696	0.3275	0.3242	5008	,	,		11236	0.3155		0.3231	False		,,,				2504	0.2812				.		Atlas-Indel	.											.	SHKBP1	68	.	0			.						PASS	.																																			SO:0001627	intron_variant	92799	.			.	AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1589+3GAGGACAGTCCTGTCCAACAGGGAGG>-	19.37:g.41095087_41095112delGAGGACAGTCCTGTCCAACAGGGAGG		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	84	12	0.142857	.	Q8N2I6|Q8WY93|Q96IB8	Splice_Site	DEL	ENST00000291842.5	37	CCDS12560.1																																																																																			.	.	none		0.606	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392	
TPRX1	284355	hgsc.bcm.edu	37	19	48305613	48305624	+	In_Frame_Del	DEL	TTGGGCCTGAGA	TTGGGCCTGAGA	-	rs201007421		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	TTGGGCCTGAGA	TTGGGCCTGAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:48305613_48305624delTTGGGCCTGAGA	ENST00000322175.3	-	2	799_810	c.644_655delTCTCAGGCCCAA	c.(643-657)atctcaggcccaaac>aac	p.ISGP215del	TPRX1_ENST00000535759.1_In_Frame_Del_p.ISGP312del|TPRX1_ENST00000543508.1_In_Frame_Del_p.ISGP205del	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	215	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gggcctgggtttgggcctgagattgggcctga	0.67																																					p.215_219del	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-Indel	.											TPRX1,NS,carcinoma,0,1	TPRX1	46	1	0			c.645_656del						PASS	.																																			SO:0001651	inframe_deletion	284355	exon2			.		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.644_655delTCTCAGGCCCAA	19.37:g.48305613_48305624delTTGGGCCTGAGA	ENSP00000323455:p.Ile215_Pro218del	Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	39	11	0.282051	NM_198479	A5D8Y3|B2RPL5	In_Frame_Del	DEL	ENST00000322175.3	37	CCDS33066.1																																																																																			.	.	none		0.670	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
DSPP	1834	hgsc.bcm.edu	37	4	88537205	88537213	+	In_Frame_Del	DEL	GACAGCAGT	GACAGCAGT	-	rs143067236|rs151217478|rs551655835	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	GACAGCAGT	GACAGCAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:88537205_88537213delGACAGCAGT	ENST00000282478.7	+	4	3424_3432	c.3391_3399delGACAGCAGT	c.(3391-3399)gacagcagtdel	p.DSS1137del	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_In_Frame_Del_p.DSS1137del			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1137	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcgacagcagtgatagcagtg	0.569																																					p.1130_1133del		Atlas-Indel	.											.	DSPP	174	.	0			c.3390_3398del						PASS	.			357,1999		74,209,895						-1.1	0.0			19	1005,3537		137,731,1403	no	coding	DSPP	NM_014208.3		211,940,2298	A1A1,A1R,RR		22.1268,15.1528,19.7449				1362,5536				SO:0001651	inframe_deletion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3391_3399delGACAGCAGT	4.37:g.88537205_88537213delGACAGCAGT	ENSP00000282478:p.Asp1137_Ser1139del	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	57	30	0.526316	NM_014208	A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	none		0.569	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
TBP	6908	hgsc.bcm.edu	37	6	170871013	170871014	+	In_Frame_Ins	INS	-	-	CAG	rs201732168|rs113202486|rs574714675|rs71010672	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:170871013_170871014insCAG	ENST00000392092.2	+	3	468_469	c.189_190insCAG	c.(190-192)cag>CAGcag	p.64_64Q>QQ	TBP_ENST00000230354.6_In_Frame_Ins_p.64_64Q>QQ|TBP_ENST00000540980.1_In_Frame_Ins_p.44_44Q>QQ	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q63_Q64insQ(1)|p.Q63Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagca	0.55																																					p.Q63delinsQQ		Atlas-Indel	.											TBP,NS,carcinoma,0,5	TBP	58	5	2	Insertion - In frame(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	c.189_190insCAG						PASS	.																																			SO:0001652	inframe_insertion	6908	exon3			.	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.211_213dupCAG	6.37:g.170871020_170871022dupCAG	ENSP00000375942:p.Gln95dup	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	67	41	0.61194	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Ins	INS	ENST00000392092.2	37	CCDS5315.1																																																																																			-|0.138;CAG|0.862	0.862	strong		0.550	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
DUSP27	92235	hgsc.bcm.edu	37	1	167095865	167095865	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:167095865delC	ENST00000361200.2	+	6	1663	c.1497delC	c.(1495-1497)agcfs	p.S499fs	DUSP27_ENST00000443333.1_Frame_Shift_Del_p.S499fs|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Frame_Shift_Del_p.S499fs			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	499					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ACGCCAAGAGCAAGAGAGAGG	0.617																																					p.S499fs		Pindel,Atlas-Indel	.											.	DUSP27	235	.	0			c.1496delG						PASS	.						48.0	46.0	47.0					1																	167095865		2203	4300	6503	SO:0001589	frameshift_variant	92235	exon5			.	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1497delC	1.37:g.167095865delC	ENSP00000354483:p.Ser499fs	Somatic	155	.	.		WXS	Illumina HiSeq	Phase_I	186	48	0.258	NM_001080426	A0AUM4|Q9C074	Frame_Shift_Del	DEL	ENST00000361200.2	37	CCDS30932.1																																																																																			.	.	none		0.617	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
LCE1F	353137	hgsc.bcm.edu	37	1	152749003	152749008	+	In_Frame_Del	DEL	TGGCTC	TGGCTC	-	rs544759833|rs200931119	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	TGGCTC	TGGCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:152749003_152749008delTGGCTC	ENST00000334371.2	+	1	156_161	c.156_161delTGGCTC	c.(154-162)tgtggctcc>tgc	p.GS53del		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	53					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGGCTGCTGTGGCTCCAGCTCTGGG	0.68														25	0.00499201	0.0008	0.0058	5008	,	,		15823	0.002		0.001	False		,,,				2504	0.0174				p.52_54del		Atlas-Indel	.											.	LCE1F	42	.	0			c.155_160del						PASS	.			13,4251		0,13,2119						2.4	0.8			40	164,8090		0,164,3963	no	coding	LCE1F	NM_178354.2		0,177,6082	A1A1,A1R,RR		1.9869,0.3049,1.414				177,12341				SO:0001651	inframe_deletion	353137	exon1			.		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.156_161delTGGCTC	1.37:g.152749003_152749008delTGGCTC	ENSP00000334187:p.Gly53_Ser54del	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	118	14	0.118644	NM_178354		In_Frame_Del	DEL	ENST00000334371.2	37	CCDS1023.1																																																																																			.	.	none		0.680	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
DGKB	1607	hgsc.bcm.edu	37	7	14775822	14775822	+	Intron	DEL	G	G	-	rs370443019|rs66786499|rs139628753	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:14775822delG	ENST00000403951.2	-	5	588				DGKB_ENST00000399322.3_Intron|DGKB_ENST00000407950.1_Intron|DGKB_ENST00000402815.1_Intron|DGKB_ENST00000406247.3_Intron|DGKB_ENST00000258767.5_Intron|DGKB_ENST00000403963.1_Intron|DGKB_ENST00000444700.2_Intron			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.?(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TCTATTGTCTGGAAAAAAAAA	0.328													?|GG|G|unsure	2796	0.558307	0.239	0.5432	5008	,	,		17163	0.5655		0.831	False		,,,				2504	0.7127				.		Atlas-Indel	.											.	DGKB	166	.	1	Unknown(1)	stomach(1)	c.169-2C>-						PASS	.		,	1129,2347		197,735,806	25.0	13.0	16.0		,	5.9	1.0	7	dbSNP_134	32	6344,1464		2573,1198,133	no	intron,intron	DGKB	NM_145695.2,NM_004080.2	,	2770,1933,939	A1A1,A1R,RR		18.75,32.4799,33.7735	,	,	14775822	7473,3811	1786	4015	5801	SO:0001627	intron_variant	1607	exon5			.	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.169-3C>-	7.37:g.14775822delG		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	69	28	0.405797	NM_004080	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Splice_Site	DEL	ENST00000403951.2	37	CCDS47547.1																																																																																			G|0.405;-|0.595	0.595	strong		0.328	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
BTG1	694	hgsc.bcm.edu	37	12	92539174	92539180	+	Frame_Shift_Del	DEL	CTCCTGC	CTCCTGC	-	rs377174658|rs199587257|rs200623021|rs549978043		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	CTCCTGC	CTCCTGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:92539174_92539180delCTCCTGC	ENST00000256015.3	-	1	493_499	c.132_138delGCAGGAG	c.(130-138)ctgcaggagfs	p.LQE44fs	RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000551563.2_5'Flank|C12orf79_ENST00000546975.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|C12orf79_ENST00000549802.1_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	44					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)	p.E46D(1)		haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CTGCCAGCAGCTCCTGCAGGCTCTGGC	0.691			T	MYC	BCLL																																p.45_47del		Pindel,Atlas-Indel	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	.	BTG1	30	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.133_139del						PASS	.																																			SO:0001589	frameshift_variant	694	exon1			.		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.132_138delGCAGGAG	12.37:g.92539174_92539180delCTCCTGC	ENSP00000256015:p.Leu44fs	Somatic	110	.	.		WXS	Illumina HiSeq	Phase_I	110	25	0.227	NM_001731	P31607	Frame_Shift_Del	DEL	ENST00000256015.3	37	CCDS9043.1																																																																																			.	.	none		0.691	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
KMT2D	8085	hgsc.bcm.edu	37	12	49445046	49445047	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:49445046_49445047insA	ENST00000301067.7	-	10	2418_2419	c.2419_2420insT	c.(2419-2421)tccfs	p.S807fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	807	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGTCTGGGGGGACAGGTGCAAT	0.634																																					p.S807fs		Atlas-Indel	.											.	MLL2	1173	.	0			c.2420_2421insT						PASS	.																																			SO:0001589	frameshift_variant	8085	exon10			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2420dupT	12.37:g.49445047_49445047dupA	ENSP00000301067:p.Ser807fs	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	286	172	0.601399	NM_003482	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	37	CCDS44873.1																																																																																			.	.	none		0.634	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KIAA0125	9834	hgsc.bcm.edu	37	14	106388019	106388094	+	Splice_Site	DEL	CCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	CCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	-			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	CCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	CCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:106388019_106388094delCCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	ENST00000449410.1	+	3	265_298	c.156_189delCCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	c.(154-189)acccagaccatcagatggcctcctcacctacccctc>ac	p.TQTIRWPPHLPL52fs	IGHD1-1_ENST00000454908.1_RNA|KIAA0125_ENST00000482999.1_3'UTR|KIAA0125_ENST00000429431.1_Splice_Site_p.PDHQMASSPTPLQ56fs			Q9NZY2	K0125_HUMAN	KIAA0125	52																	CTGTCTTGGCCCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATGCCAGACCTCC	0.58																																					.		Pindel	.											.	.	.	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	9834	.			.	AB019441		14q32.33	2014-04-01			ENSG00000226777	ENSG00000226777			19955	other	unknown			"""family with sequence similarity 30, member A"", ""chromosome 14 open reading frame 110"""	FAM30A, C14orf110		8590280	Standard	NR_026800		Approved	HSPC053	uc001ysq.3	Q9NZY2	OTTHUMG00000152318	ENST00000449410.1:c.157-1CCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG>-	14.37:g.106388019_106388094delCCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG		Somatic	109	.	.		WXS	Illumina HiSeq	Phase_I	28	17	0.607	.	C9J8W9	RNA	DEL	ENST00000449410.1	37																																																																																				.	.	none		0.580	KIAA0125-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000325876.1	NM_014792	Frame_Shift_Del
KMT2D	8085	hgsc.bcm.edu	37	12	49445040	49445041	+	Frame_Shift_Ins	INS	-	-	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:49445040_49445041insG	ENST00000301067.7	-	10	2424_2425	c.2425_2426insC	c.(2425-2427)cagfs	p.Q809fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	809	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTCCTCAGTCTGGGGGGACAGG	0.634																																					p.Q809fs		Pindel	.											.	MLL2	1173	.	0			c.2426_2427insC						PASS	.																																			SO:0001589	frameshift_variant	8085	exon10			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2426dupC	12.37:g.49445046_49445046dupG	ENSP00000301067:p.Gln809fs	Somatic	126	.	.		WXS	Illumina HiSeq	Phase_I	286	80	0.280	NM_003482	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	37	CCDS44873.1																																																																																			.	.	none		0.634	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
RIMBP3B	440804	hgsc.bcm.edu	37	22	21739333	21739335	+	In_Frame_Del	DEL	GAG	GAG	-	rs201364657		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr22:21739333_21739335delGAG	ENST00000434111.1	+	1	1671_1673	c.1186_1188delGAG	c.(1186-1188)gagdel	p.E397del		NM_001128635.1	NP_001122107.1	A6NNM3	RIM3B_HUMAN	RIMS binding protein 3B	397																	TACCCTGCAAGAGGAGAACAAGC	0.665																																					p.395_396del		Pindel	.											.	RIMBP3C	6	.	0			c.1185_1187del						PASS	.																																			SO:0001651	inframe_deletion	150221	exon1			.		CCDS46668.1	22q11.21	2008-10-23			ENSG00000196934	ENSG00000274600			33891	protein-coding gene	gene with protein product		612700				17855024	Standard	NM_001128635		Approved			A6NNM3	OTTHUMG00000150819	ENST00000434111.1:c.1186_1188delGAG	22.37:g.21739336_21739338delGAG	ENSP00000407925:p.Glu397del	Somatic	206	.	.		WXS	Illumina HiSeq	Phase_I	114	24	0.211	NM_001128633		In_Frame_Del	DEL	ENST00000434111.1	37	CCDS46668.1																																																																																			GAG|0.990;-|0.010	0.010	strong		0.665	RIMBP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320196.2	XM_036936	
RIMBP3	85376	hgsc.bcm.edu	37	22	20460113	20460115	+	In_Frame_Del	DEL	CCG	CCG	-	rs201820173		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	CCG	CCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr22:20460113_20460115delCCG	ENST00000426804.1	-	1	1671_1673	c.1187_1189delCGG	c.(1186-1191)gcggag>gag	p.A396del		NM_015672.1	NP_056487.1	Q9UFD9	RIM3A_HUMAN	RIMS binding protein 3	396				A -> E (in Ref. 2; BAB33336). {ECO:0000305}.						breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	13	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			TGCTTGTTCTCCGCTTGCAGGGT	0.675																																					p.396_397del		Pindel	.											.	RIMBP3	42	.	0			c.1188_1190del						PASS	.																																			SO:0001651	inframe_deletion	85376	exon1			.	AB051453	CCDS46665.1	22q11.21	2014-05-06			ENSG00000196622	ENSG00000275793			29344	protein-coding gene	gene with protein product		612699				11258795, 17855024	Standard	NM_015672		Approved	KIAA1666, RIMBP3.1, RIMBP3A	uc002zsd.4	Q9UFD9	OTTHUMG00000188355	ENST00000426804.1:c.1187_1189delCGG	22.37:g.20460113_20460115delCCG	ENSP00000391564:p.Ala396del	Somatic	24	.	.		WXS	Illumina HiSeq	Phase_I	35	27	0.771	NM_015672	Q8IYP7|Q9BY94|Q9UFQ5	In_Frame_Del	DEL	ENST00000426804.1	37	CCDS46665.1																																																																																			.	.	alt		0.675	RIMBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318945.2	NM_015672	
RIMBP3C	150221	hgsc.bcm.edu	37	22	21904075	21904077	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr22:21904075_21904077delCTC	ENST00000433039.1	-	1	1673_1675	c.1189_1191delGAG	c.(1189-1191)gagdel	p.E397del	UBE2L3_ENST00000458578.2_Intron|RIMBP3C_ENST00000331505.5_In_Frame_Del_p.E303del	NM_001128633.1	NP_001122105.1	A6NJZ7	RIM3C_HUMAN	RIMS binding protein 3C	397										large_intestine(1)	1						GCTGCTTGTTCTCCTCTTGCAGG	0.67																																					p.397_398del		Pindel	.											.	RIMBP3C	6	.	0			c.1190_1192del						PASS	.																																			SO:0001651	inframe_deletion	150221	exon1			.		CCDS46669.1	22q11.21	2008-10-21			ENSG00000183246	ENSG00000183246			33892	protein-coding gene	gene with protein product		612701				17855024	Standard	NM_001128633		Approved		uc002zuq.4	A6NJZ7	OTTHUMG00000150825	ENST00000433039.1:c.1189_1191delGAG	22.37:g.21904078_21904080delCTC	ENSP00000390630:p.Glu397del	Somatic	210	.	.		WXS	Illumina HiSeq	Phase_I	130	41	0.315	NM_001128633		In_Frame_Del	DEL	ENST00000433039.1	37	CCDS46669.1																																																																																			.	.	none		0.670	RIMBP3C-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		XM_036942	
ELFN1	392617	hgsc.bcm.edu	37	7	1785563	1785563	+	Missense_Mutation	SNP	G	G	A	rs563858883		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:1785563G>A	ENST00000424383.2	+	3	1818	c.1331G>A	c.(1330-1332)cGg>cAg	p.R444Q	ELFN1_ENST00000561626.1_Missense_Mutation_p.R444Q|ELFN1_ENST00000541472.1_Missense_Mutation_p.R444Q			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	444					negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						CGCAGGCGGCGGCGCCAGGAG	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		13689	0.001		0.0	False		,,,				2504	0.0				p.R444Q		Atlas-SNP	.											.	ELFN1	22	.	0			c.G1331A						PASS	.						15.0	15.0	15.0					7																	1785563		692	1590	2282	SO:0001583	missense	392617	exon2			GGCGGCGGCGCCA		CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.1331G>A	7.37:g.1785563G>A	ENSP00000456548:p.Arg444Gln	Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	48	19	0.395833	NM_001128636	H3BS57	Missense_Mutation	SNP	ENST00000424383.2	37	CCDS59046.1																																																																																			.	.	none		0.662	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322893.2	NM_001128636	
DPH6	89978	hgsc.bcm.edu	37	15	35830516	35830516	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr15:35830516C>T	ENST00000256538.4	-	3	297	c.271G>A	c.(271-273)Gat>Aat	p.D91N	DPH6_ENST00000440392.2_Missense_Mutation_p.D91N	NM_080650.3	NP_542381.1	Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6	91					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										TCAACCTCATCACCTTCACAT	0.378																																					p.D91N		Atlas-SNP	.											.	ATPBD4	30	.	0			c.G271A						PASS	.						238.0	207.0	218.0					15																	35830516		2201	4298	6499	SO:0001583	missense	89978	exon3			CCTCATCACCTTC		CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000256538.4:c.271G>A	15.37:g.35830516C>T	ENSP00000256538:p.Asp91Asn	Somatic	283	0	0		WXS	Illumina HiSeq	Phase_I	163	127	0.779141	NM_001141972	B3KWG1|Q96HJ6	Missense_Mutation	SNP	ENST00000256538.4	37	CCDS10043.1	.	.	.	.	.	.	.	.	.	.	C	32	5.175413	0.94807	.	.	ENSG00000134146	ENST00000256538;ENST00000440392	T;T	0.68181	0.91;-0.31	5.75	5.75	0.90469	Domain of unknown function DUF71, ATP-binding domain (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.87378	0.6162	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.999	D	0.89087	0.3480	10	0.62326	D	0.03	-29.0226	20.312	0.98644	0.0:1.0:0.0:0.0	.	91;91	B3KWG1;Q7L8W6	.;ATBD4_HUMAN	N	91	ENSP00000256538:D91N;ENSP00000406976:D91N	ENSP00000256538:D91N	D	-	1	0	ATPBD4	33617808	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.887000	0.69751	2.880000	0.98712	0.655000	0.94253	GAT	.	.	none		0.378	DPH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251973.1	NM_080650	
CCP110	9738	hgsc.bcm.edu	37	16	19556216	19556216	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:19556216C>T	ENST00000381396.5	+	9	2829	c.2582C>T	c.(2581-2583)gCt>gTt	p.A861V	CCP110_ENST00000396208.2_Missense_Mutation_p.A861V|CCP110_ENST00000396212.2_Missense_Mutation_p.A861V	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	861					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						AGAGTGTTAGCTCAGGTAAAT	0.338																																					p.A861V		Atlas-SNP	.											.	CCP110	57	.	0			c.C2582T						PASS	.						106.0	105.0	105.0					16																	19556216		2197	4300	6497	SO:0001583	missense	9738	exon9			TGTTAGCTCAGGT	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.2582C>T	16.37:g.19556216C>T	ENSP00000370803:p.Ala861Val	Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	405	159	0.392593	NM_001199022	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	37	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795586	0.90453	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.17370	2.28;2.29;2.28	5.48	5.48	0.80851	.	0.057778	0.64402	D	0.000002	T	0.38161	0.1030	L	0.53249	1.67	0.58432	D	0.999999	D;D	0.59767	0.986;0.986	D;D	0.67103	0.949;0.949	T	0.01757	-1.1280	10	0.39692	T	0.17	-16.6553	19.364	0.94454	0.0:1.0:0.0:0.0	.	861;861	O43303;O43303-2	CP110_HUMAN;.	V	861	ENSP00000379515:A861V;ENSP00000370803:A861V;ENSP00000379511:A861V	ENSP00000370803:A861V	A	+	2	0	CCP110	19463717	1.000000	0.71417	0.991000	0.47740	0.992000	0.81027	4.349000	0.59385	2.547000	0.85894	0.655000	0.94253	GCT	.	.	none		0.338	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
TMEM119	338773	hgsc.bcm.edu	37	12	108986031	108986031	+	Silent	SNP	C	C	T	rs74504010	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:108986031C>T	ENST00000392806.3	-	2	297	c.129G>A	c.(127-129)gaG>gaA	p.E43E		NM_181724.2	NP_859075.2	Q4V9L6	TM119_HUMAN	transmembrane protein 119	43					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(3)|ovary(1)|skin(1)	7						AGCCCTCGGCCTCCCCACTAC	0.706													C|||	832	0.166134	0.0053	0.1297	5008	,	,		11135	0.3145		0.164	False		,,,				2504	0.2587				p.E43E		Atlas-SNP	.											TMEM119,NS,carcinoma,0,1	TMEM119	31	1	0			c.G129A						scavenged	.	C		156,4214		6,144,2035	8.0	11.0	10.0		129	0.4	1.0	12	dbSNP_131	10	1399,7135		129,1141,2997	no	coding-synonymous	TMEM119	NM_181724.2		135,1285,5032	TT,TC,CC		16.3933,3.5698,12.0505		43/284	108986031	1555,11349	2185	4267	6452	SO:0001819	synonymous_variant	338773	exon2			CTCGGCCTCCCCA	AK075501	CCDS9119.1	12q23.3	2014-02-12				ENSG00000183160			27884	protein-coding gene	gene with protein product						12975309	Standard	NM_181724		Approved		uc001tng.3	Q4V9L6		ENST00000392806.3:c.129G>A	12.37:g.108986031C>T		Somatic	4	2	0.5		WXS	Illumina HiSeq	Phase_I	15	8	0.533333	NM_181724	Q6UXE5|Q8N2F5	Silent	SNP	ENST00000392806.3	37	CCDS9119.1																																																																																			C|0.827;T|0.173	0.173	strong		0.706	TMEM119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403900.1	NM_181724	
DTX1	1840	hgsc.bcm.edu	37	12	113496135	113496135	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:113496135C>T	ENST00000257600.3	+	1	641	c.138C>T	c.(136-138)caC>caT	p.H46H		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	46	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CCGTGTGCCACCACATTGAGA	0.652																																					p.H46H		Atlas-SNP	.											.	DTX1	83	.	0			c.C138T						PASS	.						106.0	92.0	97.0					12																	113496135		2203	4300	6503	SO:0001819	synonymous_variant	1840	exon1			GTGCCACCACATT	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.138C>T	12.37:g.113496135C>T		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	93	38	0.408602	NM_004416	O60630|Q9BS04	Silent	SNP	ENST00000257600.3	37	CCDS9164.1																																																																																			.	.	none		0.652	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
MLXIP	22877	hgsc.bcm.edu	37	12	122516989	122516989	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:122516989T>C	ENST00000319080.7	+	1	362	c.230T>C	c.(229-231)aTc>aCc	p.I77T						MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		CAGCAGATCATCCACAGCGGC	0.726																																					p.I77T	Esophageal Squamous(105;787 1493 16200 18566 52466)	Atlas-SNP	.											.	MLXIP	46	.	0			c.T230C						PASS	.						35.0	35.0	35.0					12																	122516989		692	1591	2283	SO:0001583	missense	22877	exon1			AGATCATCCACAG	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.230T>C	12.37:g.122516989T>C	ENSP00000312834:p.Ile77Thr	Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	38	17	0.447368	NM_014938		Missense_Mutation	SNP	ENST00000319080.7	37		.	.	.	.	.	.	.	.	.	.	T	27.7	4.857990	0.91433	.	.	ENSG00000175727	ENST00000319080	T	0.22539	1.95	4.1	4.1	0.47936	.	0.000000	0.85682	D	0.000000	T	0.46014	0.1371	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.50575	-0.8812	9	0.87932	D	0	-21.7018	12.1646	0.54123	0.0:0.0:0.0:1.0	.	77	Q9HAP2	MLXIP_HUMAN	T	77	ENSP00000312834:I77T	ENSP00000312834:I77T	I	+	2	0	MLXIP	121001372	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.191000	0.77763	1.611000	0.50210	0.379000	0.24179	ATC	.	.	none		0.726	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938	
ZNF234	10780	hgsc.bcm.edu	37	19	44660855	44660855	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:44660855A>T	ENST00000426739.2	+	6	944	c.686A>T	c.(685-687)gAg>gTg	p.E229V	ZNF234_ENST00000592437.1_Missense_Mutation_p.E229V	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	229					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				CACACTGTAGAGAAACCATTC	0.413																																					p.E229V		Atlas-SNP	.											ZNF234,colon,carcinoma,-1,1	ZNF234	132	1	0			c.A686T						scavenged	.						135.0	138.0	137.0					19																	44660855		2203	4300	6503	SO:0001583	missense	10780	exon6			CTGTAGAGAAACC	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.686A>T	19.37:g.44660855A>T	ENSP00000400878:p.Glu229Val	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	138	2	0.0144928	NM_006630	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	ENST00000426739.2	37	CCDS46101.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.635806	0.47049	.	.	ENSG00000167380	ENST00000426739;ENST00000542402	T	0.26810	1.71	4.19	3.17	0.36434	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22399	0.0540	L	0.39898	1.24	0.27832	N	0.941419	B	0.19817	0.039	B	0.24006	0.05	T	0.19516	-1.0303	9	0.66056	D	0.02	.	9.0313	0.36260	0.9084:0.0:0.0916:0.0	.	229	Q14588	ZN234_HUMAN	V	229;58	ENSP00000400878:E229V	ENSP00000400878:E229V	E	+	2	0	ZNF226	49352695	0.996000	0.38824	0.788000	0.31933	0.996000	0.88848	1.579000	0.36536	0.752000	0.32923	0.477000	0.44152	GAG	.	.	none		0.413	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2		
NLRP6	171389	hgsc.bcm.edu	37	11	279844	279844	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:279844C>T	ENST00000312165.5	+	3	321	c.321C>T	c.(319-321)ctC>ctT	p.L107L	NLRP6_ENST00000534750.1_Silent_p.L107L	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	107					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGCTCGGGCTCGGCTCCGGGA	0.726																																					p.L107L		Atlas-SNP	.											.	NLRP6	4	.	0			c.C321T						PASS	.						13.0	16.0	15.0					11																	279844		2190	4294	6484	SO:0001819	synonymous_variant	171389	exon3			CGGGCTCGGCTCC	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.321C>T	11.37:g.279844C>T		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	42	7	0.166667	NM_138329	A8K9F3|E9PJZ8	Silent	SNP	ENST00000312165.5	37	CCDS7693.1																																																																																			.	.	none		0.726	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329	
PMEPA1	56937	hgsc.bcm.edu	37	20	56227142	56227142	+	Silent	SNP	T	T	C	rs138355480		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:56227142T>C	ENST00000341744.3	-	4	1150	c.831A>G	c.(829-831)aaA>aaG	p.K277K	PMEPA1_ENST00000347215.4_Silent_p.K242K|PMEPA1_ENST00000265626.4_Silent_p.K227K|PMEPA1_ENST00000395816.3_Silent_p.K227K|PMEPA1_ENST00000395814.1_Silent_p.K227K	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	277					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						TATCCTTCTCTTTGCTCCAGA	0.627																																					p.K277K		Atlas-SNP	.											.	PMEPA1	29	.	0			c.A831G						PASS	.	T	,,,	0,4390		0,0,2195	27.0	30.0	29.0		831,726,681,681	-6.6	0.5	20	dbSNP_134	29	1,8579		0,1,4289	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PMEPA1	NM_020182.3,NM_199169.1,NM_199170.1,NM_199171.1	,,,	0,1,6484	CC,CT,TT		0.0117,0.0,0.0077	,,,	277/288,242/253,227/238,227/238	56227142	1,12969	2195	4290	6485	SO:0001819	synonymous_variant	56937	exon4			CTTCTCTTTGCTC	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.831A>G	20.37:g.56227142T>C		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	115	6	0.0521739	NM_020182	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Silent	SNP	ENST00000341744.3	37	CCDS13463.1																																																																																			T|1.000;C|0.000	0.000	weak		0.627	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
RTP1	132112	hgsc.bcm.edu	37	3	186915368	186915368	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:186915368T>C	ENST00000312295.4	+	1	95	c.65T>C	c.(64-66)tTc>tCc	p.F22S	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	22					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)			breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		CTCTCCGTGTTCTCACTAAGG	0.527																																					p.F22S		Atlas-SNP	.											RTP1,NS,carcinoma,-1,1	RTP1	51	1	0			c.T65C						scavenged	.						142.0	144.0	143.0					3																	186915368		2203	4300	6503	SO:0001583	missense	132112	exon1			CCGTGTTCTCACT	BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.65T>C	3.37:g.186915368T>C	ENSP00000311712:p.Phe22Ser	Somatic	202	0	0		WXS	Illumina HiSeq	Phase_I	235	4	0.0170213	NM_153708		Missense_Mutation	SNP	ENST00000312295.4	37	CCDS3287.2	.	.	.	.	.	.	.	.	.	.	T	14.27	2.486637	0.44249	.	.	ENSG00000175077	ENST00000312295	T	0.15834	2.39	5.84	4.68	0.58851	.	0.301827	0.29198	N	0.012842	T	0.11879	0.0289	N	0.22421	0.69	0.26932	N	0.966439	B	0.23650	0.089	B	0.21546	0.035	T	0.17077	-1.0381	10	0.72032	D	0.01	.	8.5802	0.33623	0.0:0.0865:0.0:0.9135	.	22	P59025	RTP1_HUMAN	S	22	ENSP00000311712:F22S	ENSP00000311712:F22S	F	+	2	0	RTP1	188398062	0.972000	0.33761	0.938000	0.37757	0.672000	0.39443	1.611000	0.36879	1.046000	0.40249	0.533000	0.62120	TTC	.	.	none		0.527	RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708	
ZNF419	79744	hgsc.bcm.edu	37	19	58005146	58005146	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:58005146C>G	ENST00000221735.7	+	5	1407	c.1221C>G	c.(1219-1221)ttC>ttG	p.F407L	ZNF419_ENST00000415379.2_Missense_Mutation_p.F361L|ZNF419_ENST00000354197.4_Missense_Mutation_p.F395L|ZNF419_ENST00000347466.6_Missense_Mutation_p.F375L|ZNF419_ENST00000442920.2_Missense_Mutation_p.F394L|AC003005.4_ENST00000601674.1_Intron|ZNF419_ENST00000426954.2_Missense_Mutation_p.F395L|ZNF419_ENST00000424930.2_Missense_Mutation_p.F408L			Q96HQ0	ZN419_HUMAN	zinc finger protein 419	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		GTGGGAGATTCTTTAGAGAGA	0.423																																					p.F408L		Atlas-SNP	.											ZNF419_ENST00000424930,NS,carcinoma,0,3	ZNF419	134	3	0			c.C1224G						scavenged	.						91.0	96.0	95.0					19																	58005146		2202	4299	6501	SO:0001583	missense	79744	exon5			GAGATTCTTTAGA	AK026886	CCDS42637.1, CCDS46211.1, CCDS54325.1, CCDS54326.1, CCDS54327.1, CCDS54328.1	19q13.43	2013-01-08	2006-12-15	2006-12-15	ENSG00000105136	ENSG00000105136		"""Zinc fingers, C2H2-type"", ""-"""	20648	protein-coding gene	gene with protein product			"""zinc finger protein 419A"""	ZNF419A			Standard	NM_001098492		Approved		uc010ety.1	Q96HQ0	OTTHUMG00000037073	ENST00000221735.7:c.1221C>G	19.37:g.58005146C>G	ENSP00000221735:p.Phe407Leu	Somatic	86	4	0.0465116		WXS	Illumina HiSeq	Phase_I	121	3	0.0247934	NM_001098491	B4DXU7|B4E348|B7ZA41|E9PCP4|E9PED0|E9PET3|E9PFX9|Q9H5P0	Missense_Mutation	SNP	ENST00000221735.7	37	CCDS54326.1	.	.	.	.	.	.	.	.	.	.	C	7.041	0.562596	0.13498	.	.	ENSG00000105136	ENST00000284020;ENST00000424930;ENST00000426954;ENST00000354197;ENST00000442920;ENST00000517598;ENST00000347466;ENST00000415379;ENST00000221735	T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26	2.19	-4.38	0.03622	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04907	0.0132	N	0.01679	-0.765	0.80722	D	1	B;B;B;B;B;B;B	0.19445	0.001;0.002;0.003;0.0;0.036;0.004;0.036	B;B;B;B;B;B;B	0.19666	0.001;0.005;0.011;0.002;0.026;0.006;0.026	T	0.27191	-1.0081	9	0.45353	T	0.12	.	6.1318	0.20209	0.0:0.3241:0.1371:0.5388	.	361;361;394;395;408;375;407	E9PFX9;B4DXU7;E9PCP4;E9PET3;E9PED0;Q96HQ0-2;Q96HQ0	.;.;.;.;.;.;ZN419_HUMAN	L	382;408;395;395;394;408;375;361;407	ENSP00000388864:F408L;ENSP00000390916:F395L;ENSP00000346136:F395L;ENSP00000414709:F394L;ENSP00000299860:F375L;ENSP00000392129:F361L;ENSP00000221735:F407L	ENSP00000221735:F407L	F	+	3	2	ZNF419	62696958	0.000000	0.05858	0.000000	0.03702	0.396000	0.30629	-4.624000	0.00207	-1.133000	0.02903	-1.021000	0.02439	TTC	.	.	none		0.423	ZNF419-006	KNOWN	NAGNAG_splice_site|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378506.1	NM_024691	
FNDC7	163479	hgsc.bcm.edu	37	1	109280146	109280146	+	Splice_Site	SNP	G	G	A	rs572093742		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:109280146G>A	ENST00000370017.3	+	11	2447	c.2170G>A	c.(2170-2172)Gtg>Atg	p.V724M	RP11-293A10.3_ENST00000437400.2_RNA|FNDC7_ENST00000271311.2_Splice_Site_p.V725M	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	724						extracellular region (GO:0005576)		p.V491M(1)|p.V724M(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		ACTTGGAATGGGTAAGTCATT	0.299																																					p.V724M		Atlas-SNP	.											FNDC7_ENST00000370017,NS,carcinoma,0,2	FNDC7	113	2	2	Substitution - Missense(2)	kidney(2)	c.G2170A						scavenged	.						112.0	119.0	117.0					1																	109280146		2202	4300	6502	SO:0001630	splice_region_variant	163479	exon11			GGAATGGGTAAGT		CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.2170+1G>A	1.37:g.109280146G>A		Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	125	3	0.024	NM_001144937	A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	ENST00000370017.3	37	CCDS44185.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392765	0.62066	.	.	ENSG00000143107	ENST00000370017;ENST00000271311	D;D	0.97959	-4.63;-4.63	5.34	5.34	0.76211	.	0.147571	0.45126	D	0.000384	D	0.94745	0.8304	L	0.47716	1.5	0.58432	D	0.999998	B	0.23058	0.079	B	0.20577	0.03	D	0.92620	0.6107	10	0.72032	D	0.01	-2.228	17.5941	0.88006	0.0:0.0:1.0:0.0	.	724	E9PAZ5	.	M	724;725	ENSP00000359034:V724M;ENSP00000271311:V725M	ENSP00000271311:V725M	V	+	1	0	FNDC7	109081669	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.563000	0.67352	2.665000	0.90641	0.655000	0.94253	GTG	.	.	none		0.299	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030589.4	NM_173532	Missense_Mutation
CDC27	996	hgsc.bcm.edu	37	17	45234327	45234327	+	Missense_Mutation	SNP	C	C	T	rs7350889		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:45234327C>T	ENST00000066544.3	-	7	887	c.794G>A	c.(793-795)gGt>gAt	p.G265D	CDC27_ENST00000531206.1_Missense_Mutation_p.G265D|CDC27_ENST00000527547.1_Missense_Mutation_p.G265D|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Missense_Mutation_p.G204D	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	265					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.G265D(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TAAACTTCGACCAGTTTTTGG	0.368																																					p.G265D		Atlas-SNP	.											CDC27_ENST00000531206,NS,adenoma,0,4	CDC27	337	4	2	Substitution - Missense(2)	skin(2)	c.G794A						scavenged	.						60.0	65.0	63.0					17																	45234327		2201	4295	6496	SO:0001583	missense	996	exon7			CTTCGACCAGTTT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.794G>A	17.37:g.45234327C>T	ENSP00000066544:p.Gly265Asp	Somatic	58	1	0.0172414		WXS	Illumina HiSeq	Phase_I	52	4	0.0769231	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725453	0.48833	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68181	-0.31;-0.3;-0.11;-0.31;0.86	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.52853	0.1760	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.32350	0.251;0.366;0.247;0.251	B;B;B;B	0.27076	0.045;0.056;0.076;0.055	T	0.51694	-0.8673	10	0.33141	T	0.24	1.6987	17.2083	0.86924	0.0:1.0:0.0:0.0	rs7350889;rs7350889	204;265;265;265	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	D	265;265;204;265;265	ENSP00000066544:G265D;ENSP00000434614:G265D;ENSP00000392802:G204D;ENSP00000437339:G265D;ENSP00000432105:G265D	ENSP00000066544:G265D	G	-	2	0	CDC27	42589326	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.618000	0.67722	2.665000	0.90641	0.460000	0.39030	GGT	C|1.000;|0.000	.	weak		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
MRGPRX3	117195	hgsc.bcm.edu	37	11	18159093	18159093	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:18159093C>T	ENST00000396275.2	+	3	705	c.344C>T	c.(343-345)gCc>gTc	p.A115V		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						ATGCTGAGCGCCATCAGCACC	0.567																																					p.A115V		Atlas-SNP	.											MRGPRX3,colon,carcinoma,+1,1	MRGPRX3	59	1	0			c.C344T						scavenged	.						125.0	117.0	120.0					11																	18159093		2200	4293	6493	SO:0001583	missense	117195	exon3			TGAGCGCCATCAG		CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.344C>T	11.37:g.18159093C>T	ENSP00000379571:p.Ala115Val	Somatic	159	1	0.00628931		WXS	Illumina HiSeq	Phase_I	187	2	0.0106952	NM_054031	B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	ENST00000396275.2	37	CCDS7830.1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.112648	0.37242	.	.	ENSG00000179826	ENST00000396275;ENST00000531264	T;T	0.38401	1.14;1.14	1.46	-0.729	0.11158	GPCR, rhodopsin-like superfamily (1);	0.179558	0.39407	N	0.001380	T	0.51244	0.1663	M	0.86097	2.795	0.19300	N	0.99997	D	0.65815	0.995	D	0.63283	0.913	T	0.41395	-0.9511	10	0.34782	T	0.22	.	5.8511	0.18694	0.0:0.6573:0.0:0.3427	.	115	Q96LB0	MRGX3_HUMAN	V	115	ENSP00000379571:A115V;ENSP00000436242:A115V	ENSP00000379571:A115V	A	+	2	0	MRGPRX3	18115669	0.051000	0.20477	0.002000	0.10522	0.004000	0.04260	0.651000	0.24873	-0.214000	0.10078	-0.573000	0.04149	GCC	.	.	none		0.567	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389767.1	NM_054031	
MUC4	4585	hgsc.bcm.edu	37	3	195505858	195505858	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195505858G>A	ENST00000463781.3	-	2	13052	c.12593C>T	c.(12592-12594)aCt>aTt	p.T4198I	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T4198I	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGTGTCGGTGAC	0.602																																					p.T4198I		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,3	MUC4	1505	3	0			c.C12593T						scavenged	.						19.0	15.0	16.0					3																	195505858		689	1576	2265	SO:0001583	missense	4585	exon2			GAGGAAGTGTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12593C>T	3.37:g.195505858G>A	ENSP00000417498:p.Thr4198Ile	Somatic	104	2	0.0192308		WXS	Illumina HiSeq	Phase_I	160	6	0.0375	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.623	0.115726	0.08831	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.38;1.3	.	.	.	.	.	.	.	.	T	0.19485	0.0468	N	0.14661	0.345	0.21105	N	0.999787	P	0.44090	0.826	B	0.40782	0.34	T	0.09975	-1.0650	7	.	.	.	.	6.6097	0.22745	2.0E-4:0.0:0.9998:0.0	.	4070	E7ESK3	.	I	4198	ENSP00000417498:T4198I;ENSP00000420243:T4198I	.	T	-	2	0	MUC4	196990637	0.000000	0.05858	0.017000	0.16124	0.032000	0.12392	0.289000	0.18957	0.452000	0.26830	0.074000	0.15403	ACT	.	.	none		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SEPT4	5414	hgsc.bcm.edu	37	17	56599152	56599152	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:56599152A>G	ENST00000317268.3	-	7	1036	c.860T>C	c.(859-861)aTc>aCc	p.I287T	RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000579371.1_Missense_Mutation_p.I188T|SEPT4_ENST00000412945.3_Missense_Mutation_p.I279T|SEPT4_ENST00000580809.1_3'UTR|SEPT4_ENST00000583114.1_Missense_Mutation_p.I140T|SEPT4_ENST00000580844.1_Missense_Mutation_p.I188T|SEPT4_ENST00000393086.1_Missense_Mutation_p.I268T|SEPT4_ENST00000457347.2_Missense_Mutation_p.I302T|SEPT4_ENST00000317256.6_Missense_Mutation_p.I268T|SEPT4_ENST00000426861.1_3'UTR	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	287	Septin-type G.				apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTTAGCCAGGATAGGCACGAT	0.567																																					p.I302T		Atlas-SNP	.											SEPT4,NS,carcinoma,-1,1	SEPT4	48	1	0			c.T905C						scavenged	.						109.0	90.0	96.0					17																	56599152		2203	4300	6503	SO:0001583	missense	5414	exon8			GCCAGGATAGGCA	AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.860T>C	17.37:g.56599152A>G	ENSP00000321674:p.Ile287Thr	Somatic	276	0	0		WXS	Illumina HiSeq	Phase_I	375	4	0.0106667	NM_001256782	B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Missense_Mutation	SNP	ENST00000317268.3	37	CCDS11610.1	.	.	.	.	.	.	.	.	.	.	A	11.69	1.712395	0.30322	.	.	ENSG00000108387	ENST00000412945;ENST00000457347;ENST00000317256;ENST00000317268;ENST00000393086	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.9	5.9	0.94986	.	0.121540	0.56097	D	0.000029	T	0.53417	0.1795	M	0.85099	2.735	0.80722	D	1	P;P;P;B;P	0.47545	0.837;0.897;0.837;0.115;0.866	P;P;P;B;P	0.48873	0.457;0.521;0.457;0.138;0.593	T	0.62291	-0.6885	10	0.87932	D	0	.	14.2838	0.66232	1.0:0.0:0.0:0.0	.	279;302;268;140;287	O43236-3;O43236-4;O43236-2;O43236-5;O43236	.;.;.;.;SEPT4_HUMAN	T	279;301;268;287;268	ENSP00000414779:I279T;ENSP00000321071:I268T;ENSP00000321674:I287T;ENSP00000376801:I268T	ENSP00000321071:I268T	I	-	2	0	SEPT4	53954151	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.477000	0.81069	2.248000	0.74166	0.460000	0.39030	ATC	.	.	none		0.567	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445420.1	NM_080417	
IGSF22	283284	hgsc.bcm.edu	37	11	18735652	18735652	+	Silent	SNP	C	C	T	rs377071364		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:18735652C>T	ENST00000513874.1	-	14	1981	c.1842G>A	c.(1840-1842)gcG>gcA	p.A614A	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	614	Ig-like 4.							p.A614A(2)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TGATGGCGTGCGCAGCCAGTG	0.617																																					p.A614A		Atlas-SNP	.											IGSF22_ENST00000513874,NS,carcinoma,0,2	IGSF22	211	2	2	Substitution - coding silent(2)	breast(2)	c.G1842A						scavenged	.						59.0	64.0	62.0					11																	18735652		2131	4231	6362	SO:0001819	synonymous_variant	283284	exon14			GGCGTGCGCAGCC	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1842G>A	11.37:g.18735652C>T		Somatic	196	1	0.00510204		WXS	Illumina HiSeq	Phase_I	202	3	0.0148515	NM_173588	A6NNA0|D6RGV7	Silent	SNP	ENST00000513874.1	37	CCDS41625.2																																																																																			.	.	weak		0.617	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	
HRC	3270	hgsc.bcm.edu	37	19	49657713	49657713	+	Missense_Mutation	SNP	T	T	A	rs547456261|rs61355957|rs61198077|rs66501117|rs531655952|rs534731199|rs569932130	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:49657713T>A	ENST00000252825.4	-	1	968	c.782A>T	c.(781-783)gAt>gTt	p.D261V	HRC_ENST00000595625.1_Missense_Mutation_p.D261V	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	261	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Asp-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		AATGGAGAcatcatcatcatc	0.498																																					p.D261V	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											HRC,NS,carcinoma,0,1	HRC	85	1	0			c.A782T						scavenged	.						143.0	105.0	118.0					19																	49657713		2203	4300	6503	SO:0001583	missense	3270	exon1			GAGACATCATCAT		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.782A>T	19.37:g.49657713T>A	ENSP00000252825:p.Asp261Val	Somatic	63	1	0.015873		WXS	Illumina HiSeq	Phase_I	61	2	0.0327869	NM_002152	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.093755	0.36952	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.33438	1.41	3.29	1.02	0.19986	.	.	.	.	.	T	0.26738	0.0654	M	0.69823	2.125	0.09310	N	0.999995	B	0.24618	0.107	B	0.19666	0.026	T	0.29671	-1.0004	9	0.36615	T	0.2	2.7396	2.2712	0.04091	0.249:0.1435:0.0:0.6075	.	261	P23327	SRCH_HUMAN	V	261;231	ENSP00000252825:D261V	ENSP00000252825:D261V	D	-	2	0	HRC	54349525	0.000000	0.05858	0.174000	0.22961	0.528000	0.34623	-1.362000	0.02595	0.283000	0.22279	0.374000	0.22700	GAT	.	.	none		0.498	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
C17orf82	388407	hgsc.bcm.edu	37	17	59489893	59489893	+	Missense_Mutation	SNP	T	T	C	rs200497494|rs9907379	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:59489893T>C	ENST00000335108.2	+	1	782	c.557T>C	c.(556-558)cTc>cCc	p.L186P	RP11-332H18.4_ENST00000592009.1_RNA	NM_203425.1	NP_982249	Q86X59	CQ082_HUMAN	chromosome 17 open reading frame 82	186			L -> P (in dbSNP:rs9907379). {ECO:0000269|PubMed:15489334}.							cervix(1)|lung(1)	2						CGGCAACTCCTCACAGGTCCA	0.731													C|||	3623	0.723442	0.7769	0.6571	5008	,	,		12512	0.7004		0.8002	False		,,,				2504	0.6431				p.L186P		Atlas-SNP	.											C17orf82_ENST00000335108,NS,carcinoma,0,2	C17orf82	16	2	0			c.T557C						PASS	.	C	PRO/LEU	3143,775		1281,581,97	4.0	6.0	5.0		557	0.9	0.1	17	dbSNP_119	5	6355,1647		2560,1235,206	no	missense	C17orf82	NM_203425.1	98	3841,1816,303	CC,CT,TT		20.5824,19.7805,20.3188	benign	186/252	59489893	9498,2422	1959	4001	5960	SO:0001583	missense	388407	exon1			AACTCCTCACAGG	BC046200	CCDS11628.1	17q23.2	2012-10-23			ENSG00000187013	ENSG00000187013			32699	protein-coding gene	gene with protein product							Standard	NM_203425		Approved		uc002izh.1	Q86X59	OTTHUMG00000180077	ENST00000335108.2:c.557T>C	17.37:g.59489893T>C	ENSP00000335229:p.Leu186Pro	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	7	6	0.857143	NM_203425		Missense_Mutation	SNP	ENST00000335108.2	37	CCDS11628.1	1628	0.7454212454212454	382	0.7764227642276422	236	0.6519337016574586	399	0.6975524475524476	611	0.8060686015831134	C	8.991	0.977736	0.18812	0.802195	0.794176	ENSG00000187013	ENST00000335108	T	0.58210	0.35	4.29	0.931	0.19460	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.40031	P	0.024463000000000013	B	0.02656	0.0	B	0.01281	0.0	T	0.21109	-1.0255	8	0.39692	T	0.17	.	1.8756	0.03217	0.1483:0.381:0.2903:0.1804	rs9907379;rs17846388;rs17859430;rs57634035;rs9907379	186	Q86X59	CQ082_HUMAN	P	186	ENSP00000335229:L186P	ENSP00000335229:L186P	L	+	2	0	C17orf82	56844675	0.009000	0.17119	0.119000	0.21687	0.106000	0.19336	0.032000	0.13732	-0.103000	0.12175	-0.380000	0.06706	CTC	T|0.261;C|0.739	0.739	strong		0.731	C17orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449646.1	NM_203425	
NRXN2	9379	hgsc.bcm.edu	37	11	64434761	64434761	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:64434761C>T	ENST00000377551.1	-	8	1970	c.1759G>A	c.(1759-1761)Gag>Aag	p.E587K	NRXN2_ENST00000409571.1_Missense_Mutation_p.E580K|NRXN2_ENST00000377559.3_Missense_Mutation_p.E556K|NRXN2_ENST00000265459.6_Missense_Mutation_p.E587K			Q9P2S2	NRX2A_HUMAN	neurexin 2	587	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.E587K(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TGACACCACTCGCCATCATTG	0.592																																					p.E587K		Atlas-SNP	.											NRXN2,caecum,carcinoma,0,2	NRXN2	247	2	1	Substitution - Missense(1)	large_intestine(1)	c.G1759A						scavenged	.						92.0	75.0	81.0					11																	64434761		2201	4297	6498	SO:0001583	missense	9379	exon9			ACCACTCGCCATC		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.1759G>A	11.37:g.64434761C>T	ENSP00000366774:p.Glu587Lys	Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	199	4	0.0201005	NM_015080	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	C	31	5.087169	0.94100	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	4.61	4.61	0.57282	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.42821	U	0.000657	T	0.80491	0.4633	L	0.28115	0.83	0.58432	D	0.999999	D;D;D	0.76494	0.998;0.995;0.999	D;D;D	0.69479	0.964;0.936;0.909	T	0.83054	-0.0151	10	0.72032	D	0.01	.	14.9631	0.71171	0.0:1.0:0.0:0.0	.	556;587;333	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	K	587;556;587;556;580	ENSP00000366774:E587K;ENSP00000366782:E556K;ENSP00000265459:E587K;ENSP00000386416:E580K	ENSP00000265459:E587K	E	-	1	0	NRXN2	64191337	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.637000	0.83313	2.383000	0.81215	0.448000	0.29417	GAG	.	.	none		0.592	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
SPATA3	130560	hgsc.bcm.edu	37	2	231861057	231861057	+	Missense_Mutation	SNP	C	C	T	rs72362780		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:231861057C>T	ENST00000452881.1	+	1	217	c.109C>T	c.(109-111)Cca>Tca	p.P37S	AC105344.2_ENST00000414876.1_lincRNA|SPATA3_ENST00000433428.2_Missense_Mutation_p.P37S|SPATA3_ENST00000424440.1_Missense_Mutation_p.P37S|SPATA3_ENST00000455816.1_Missense_Mutation_p.P37S			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	37										endometrium(2)|lung(1)	3						TGAATCCACACCACAGCAGCC	0.577																																					p.P37S		Atlas-SNP	.											SPATA3,NS,carcinoma,-2,4	SPATA3	52	4	0			c.C109T						scavenged	.						132.0	138.0	137.0					2																	231861057		692	1590	2282	SO:0001583	missense	130560	exon1			TCCACACCACAGC	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.109C>T	2.37:g.231861057C>T	ENSP00000388895:p.Pro37Ser	Somatic	66	9	0.136364		WXS	Illumina HiSeq	Phase_I	100	19	0.19	NM_139073	Q86WX5|Q8N9Y6	Missense_Mutation	SNP	ENST00000452881.1	37	CCDS2481.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829371	0.32329	.	.	ENSG00000173699	ENST00000424440;ENST00000452881;ENST00000433428;ENST00000455816;ENST00000355662;ENST00000440792	.	.	.	3.0	-0.25	0.13007	.	0.940554	0.08697	N	0.907107	T	0.19248	0.0462	N	0.12746	0.255	0.09310	N	1	.	.	.	.	.	.	T	0.27673	-1.0067	7	0.72032	D	0.01	0.139	2.334	0.04242	0.2359:0.4502:0.0:0.3139	.	.	.	.	S	37;37;37;37;37;3	.	ENSP00000347884:P37S	P	+	1	0	SPATA3	231569301	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.302000	0.08221	-0.061000	0.13110	-0.367000	0.07326	CCA	.	.	none		0.577	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
OVOL1	5017	hgsc.bcm.edu	37	11	65562092	65562092	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:65562092C>T	ENST00000335987.3	+	3	754	c.402C>T	c.(400-402)aaC>aaT	p.N134N	OVOL1_ENST00000532448.1_Silent_p.N72N|RP11-770G2.5_ENST00000531155.1_RNA	NM_004561.3	NP_004552.2	O14753	OVOL1_HUMAN	ovo-like zinc finger 1	134					cytoskeleton organization (GO:0007010)|epidermal cell differentiation (GO:0009913)|germline cell cycle switching, mitotic to meiotic cell cycle (GO:0051729)|kidney development (GO:0001822)|mesoderm development (GO:0007498)|negative regulation of meiotic cell cycle phase transition (GO:1901994)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.N134N(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6				READ - Rectum adenocarcinoma(159;0.17)		GCATGCTGAACCGCCACATGA	0.592																																					p.N134N		Atlas-SNP	.											OVOL1,brain,glioma,0,1	OVOL1	15	1	1	Substitution - coding silent(1)	central_nervous_system(1)	c.C402T						scavenged	.						125.0	92.0	103.0					11																	65562092		2201	4297	6498	SO:0001819	synonymous_variant	5017	exon3			GCTGAACCGCCAC	BC059408	CCDS8112.1	11q13	2013-10-17	2013-10-17		ENSG00000172818	ENSG00000172818		"""Zinc fingers, C2H2-type"""	8525	protein-coding gene	gene with protein product		602313	"""ovo (Drosophila) homolog-like 1"", ""ovo-like 1(Drosophila)"""			9383297	Standard	NM_004561		Approved	HOVO1	uc001ofp.3	O14753	OTTHUMG00000166600	ENST00000335987.3:c.402C>T	11.37:g.65562092C>T		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	179	3	0.0167598	NM_004561	Q6PCB1	Silent	SNP	ENST00000335987.3	37	CCDS8112.1																																																																																			.	.	none		0.592	OVOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390690.1	NM_004561	
OR10G7	390265	hgsc.bcm.edu	37	11	123909644	123909644	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:123909644T>C	ENST00000330487.5	-	1	73	c.65A>G	c.(64-66)gAc>gGc	p.D22G		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GAGGGGGGCGTCCAGCCCTGG	0.562																																					p.D22G		Atlas-SNP	.											OR10G7,NS,carcinoma,+1,1	OR10G7	103	1	0			c.A65G						PASS	.						97.0	93.0	94.0					11																	123909644		2200	4299	6499	SO:0001583	missense	390265	exon1			GGGGCGTCCAGCC	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.65A>G	11.37:g.123909644T>C	ENSP00000329689:p.Asp22Gly	Somatic	236	0	0		WXS	Illumina HiSeq	Phase_I	341	68	0.199413	NM_001004463	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	T	10.29	1.309984	0.23821	.	.	ENSG00000182634	ENST00000330487	T	0.00438	7.42	3.38	2.25	0.28309	.	0.495982	0.18008	N	0.154666	T	0.00178	0.0005	N	0.02697	-0.525	0.27635	N	0.947893	B	0.06786	0.001	B	0.12837	0.008	T	0.30238	-0.9985	10	0.46703	T	0.11	.	6.8806	0.24170	0.0:0.1112:0.0:0.8888	.	22	Q8NGN6	O10G7_HUMAN	G	22	ENSP00000329689:D22G	ENSP00000329689:D22G	D	-	2	0	OR10G7	123414854	0.000000	0.05858	0.681000	0.30009	0.009000	0.06853	-0.093000	0.11111	0.503000	0.28060	0.455000	0.32223	GAC	.	.	none		0.562	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463	
RTBDN	83546	hgsc.bcm.edu	37	19	12936596	12936596	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:12936596C>T	ENST00000458671.2	-	6	766	c.614G>A	c.(613-615)cGt>cAt	p.R205H	RTBDN_ENST00000589272.1_3'UTR|RTBDN_ENST00000322912.5_Missense_Mutation_p.R237H|RTBDN_ENST00000393233.2_3'UTR|CTD-2265O21.3_ENST00000588469.1_RNA|RTBDN_ENST00000592204.1_Missense_Mutation_p.R215H	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	205						extracellular region (GO:0005576)				kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						GCTGCGGGAACGCCGGGAGGG	0.711											OREG0025275	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R237H		Atlas-SNP	.											.	RTBDN	26	.	0			c.G710A						PASS	.						17.0	17.0	17.0					19																	12936596		2199	4289	6488	SO:0001583	missense	83546	exon7			CGGGAACGCCGGG	AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.614G>A	19.37:g.12936596C>T	ENSP00000416375:p.Arg205His	Somatic	123	0	0	683	WXS	Illumina HiSeq	Phase_I	131	53	0.40458	NM_031429	F1T0I8|Q9BWT5	Missense_Mutation	SNP	ENST00000458671.2	37	CCDS45994.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399729	0.42512	.	.	ENSG00000132026	ENST00000322912;ENST00000458671	T;T	0.58358	0.34;0.44	3.32	1.17	0.20885	.	0.665039	0.12535	N	0.460449	T	0.54515	0.1863	L	0.32530	0.975	0.09310	N	0.999993	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.939	T	0.37709	-0.9694	10	0.87932	D	0	-27.7491	4.204	0.10480	0.0:0.621:0.2441:0.1349	.	237;205	Q9BSG5-2;Q9BSG5	.;RTBDN_HUMAN	H	237;205	ENSP00000326253:R237H;ENSP00000416375:R205H	ENSP00000326253:R237H	R	-	2	0	RTBDN	12797596	0.000000	0.05858	0.012000	0.15200	0.141000	0.21300	-0.190000	0.09615	0.760000	0.33108	-0.195000	0.12781	CGT	.	.	none		0.711	RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451513.1	NM_031429	
SMG1	23049	hgsc.bcm.edu	37	16	18887501	18887501	+	Missense_Mutation	SNP	A	A	T	rs17842615	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:18887501A>T	ENST00000446231.2	-	13	2247	c.1835T>A	c.(1834-1836)aTa>aAa	p.I612K	SMG1_ENST00000565224.1_Missense_Mutation_p.I586K|SMG1_ENST00000389467.3_Missense_Mutation_p.I612K			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	612	Interaction with SMG8 and SMG9.		I -> K. {ECO:0000269|PubMed:15175154, ECO:0000269|PubMed:17344846}.		DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						GAGGTCAAATATAACTACAAA	0.368																																					p.I612K		Atlas-SNP	.											SMG1_ENST00000446231,NS,carcinoma,0,1	SMG1	401	1	0			c.T1835A						scavenged	.						83.0	80.0	81.0					16																	18887501		1818	4073	5891	SO:0001583	missense	23049	exon13			TCAAATATAACTA	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.1835T>A	16.37:g.18887501A>T	ENSP00000402515:p.Ile612Lys	Somatic	256	0	0		WXS	Illumina HiSeq	Phase_I	443	5	0.0112867	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	A	14.17	2.456191	0.43634	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.40756	1.02;1.02	5.34	4.23	0.50019	Armadillo-type fold (1);	0.070231	0.51477	N	0.000081	T	0.33760	0.0874	L	0.36672	1.1	0.50632	D	0.999885	B	0.02656	0.0	B	0.01281	0.0	T	0.10847	-1.0612	10	0.72032	D	0.01	.	11.5067	0.50471	0.8653:0.0:0.0:0.1347	rs17842615	612	Q96Q15	SMG1_HUMAN	K	612	ENSP00000402515:I612K;ENSP00000374118:I612K	ENSP00000374118:I612K	I	-	2	0	SMG1	18795002	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	7.473000	0.81007	0.827000	0.34685	-0.669000	0.03829	ATA	A|0.660;T|0.340	0.340	strong		0.368	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
TFG	10342	hgsc.bcm.edu	37	3	100467168	100467168	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:100467168A>T	ENST00000240851.4	+	8	1336	c.996A>T	c.(994-996)caA>caT	p.Q332H	TFG_ENST00000481203.1_3'UTR|TFG_ENST00000418917.2_Missense_Mutation_p.Q328H|TFG_ENST00000476228.1_Missense_Mutation_p.Q328H|TFG_ENST00000490574.1_Missense_Mutation_p.Q332H	NM_001195478.1|NM_001195479.1|NM_006070.5	NP_001182407.1|NP_001182408.1|NP_006061.2	Q92734	TFG_HUMAN	TRK-fused gene	332					cell death (GO:0008219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	signal transducer activity (GO:0004871)		TFG/NR4A3(2)|TFG/NTRK1_ENST00000392302(5)|TFG/ALK(9)	large_intestine(4)|lung(2)|prostate(1)|stomach(1)	8						ACACTGCCCAAACTTCTCAGC	0.527			T	"""NTRK1, ALK"""	"""papillary thyroid, ALCL, NSCLC"""																																p.Q332H		Atlas-SNP	.		Dom	yes		3	3q11-q12	10342	TRK-fused gene		"""E, L"""	.	TFG	42	.	0			c.A996T						PASS	.						84.0	86.0	85.0					3																	100467168		2203	4300	6503	SO:0001583	missense	10342	exon8			TGCCCAAACTTCT	BC009241	CCDS2939.1, CCDS56266.1	3q12.2	2013-03-13	2001-12-04		ENSG00000114354	ENSG00000114354			11758	protein-coding gene	gene with protein product		602498				9169129, 23479643	Standard	NM_001007565		Approved	TF6, FLJ36137, SPG57	uc003dui.3	Q92734	OTTHUMG00000159085	ENST00000240851.4:c.996A>T	3.37:g.100467168A>T	ENSP00000240851:p.Gln332His	Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	165	62	0.375758	NM_006070	D3DN49|G5E9V1|Q15656|Q969I2	Missense_Mutation	SNP	ENST00000240851.4	37	CCDS2939.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.92|15.92	2.976031|2.976031	0.53720|0.53720	.|.	.|.	ENSG00000114354|ENSG00000114354	ENST00000443578|ENST00000418917;ENST00000490574;ENST00000240851;ENST00000476228	.|T;T;T;T	.|0.54479	.|0.62;0.57;0.57;0.62	6.16|6.16	-2.35|-2.35	0.06684|0.06684	.|.	.|0.117044	.|0.64402	.|D	.|0.000009	T|T	0.55657|0.55657	0.1934|0.1934	L|L	0.29908|0.29908	0.895|0.895	0.53688|0.53688	D|D	0.999979|0.999979	.|D;D	.|0.64830	.|0.994;0.99	.|D;D	.|0.78314	.|0.991;0.979	T|T	0.55075|0.55075	-0.8197|-0.8197	6|10	0.87932|0.56958	D|D	0|0.05	-3.1538|-3.1538	13.2698|13.2698	0.60153|0.60153	0.5279:0.0:0.4721:0.0|0.5279:0.0:0.4721:0.0	.|.	.|328;332	.|G5E9V1;Q92734	.|.;TFG_HUMAN	I|H	328|328;332;332;328	.|ENSP00000397182:Q328H;ENSP00000419960:Q332H;ENSP00000240851:Q332H;ENSP00000417952:Q328H	ENSP00000409727:K328I|ENSP00000240851:Q332H	K|Q	+|+	2|3	0|2	TFG|TFG	101949858|101949858	0.992000|0.992000	0.36948|0.36948	0.582000|0.582000	0.28627|0.28627	0.885000|0.885000	0.51271|0.51271	0.363000|0.363000	0.20301|0.20301	-0.351000|-0.351000	0.08249|0.08249	-0.297000|-0.297000	0.09499|0.09499	AAA|CAA	.	.	none		0.527	TFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353242.1	NM_006070	
CUBN	8029	hgsc.bcm.edu	37	10	17157519	17157519	+	Missense_Mutation	SNP	C	C	T	rs139891639		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:17157519C>T	ENST00000377833.4	-	7	736	c.671G>A	c.(670-672)cGc>cAc	p.R224H		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	224					cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATGGACACAGCGTGCCACAGA	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18639	0.0		0.0	False		,,,				2504	0.0				p.R224H		Atlas-SNP	.											CUBN,NS,NS,-1,1	CUBN	515	1	0			c.G671A						scavenged	.	C	HIS/ARG	6,4400	11.4+/-27.6	0,6,2197	142.0	119.0	127.0		671	-11.5	0.0	10	dbSNP_134	127	0,8600		0,0,4300	yes	missense	CUBN	NM_001081.3	29	0,6,6497	TT,TC,CC		0.0,0.1362,0.0461	possibly-damaging	224/3624	17157519	6,13000	2203	4300	6503	SO:0001583	missense	8029	exon7			ACACAGCGTGCCA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.671G>A	10.37:g.17157519C>T	ENSP00000367064:p.Arg224His	Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	135	4	0.0296296	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608903	0.46527	0.001362	0.0	ENSG00000107611	ENST00000377833	T	0.75938	-0.98	5.75	-11.5	0.00074	Growth factor, receptor (1);Epidermal growth factor-like (1);	1.001730	0.08054	N	0.997097	T	0.53433	0.1796	N	0.22421	0.69	0.37548	D	0.918576	D	0.56521	0.976	B	0.40782	0.34	T	0.72465	-0.4285	10	0.72032	D	0.01	.	12.661	0.56813	0.7128:0.1589:0.0:0.1283	.	224	O60494	CUBN_HUMAN	H	224	ENSP00000367064:R224H	ENSP00000367064:R224H	R	-	2	0	CUBN	17197525	0.981000	0.34729	0.003000	0.11579	0.184000	0.23303	0.423000	0.21313	-1.630000	0.01545	-0.274000	0.10170	CGC	C|0.999;T|0.001	0.001	strong		0.537	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
SDHA	6389	hgsc.bcm.edu	37	5	236617	236617	+	Silent	SNP	G	G	T	rs200223188	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:236617G>T	ENST00000264932.6	+	10	1450	c.1335G>T	c.(1333-1335)tcG>tcT	p.S445S	SDHA_ENST00000504309.1_Silent_p.S445S|SDHA_ENST00000510361.1_Silent_p.S397S	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	445					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)	p.S445S(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CCTGTGCCTCGGTACATGGTG	0.597									Familial Paragangliomas				G|||	2	0.000399361	0.0015	0.0	5008	,	,		17972	0.0		0.0	False		,,,				2504	0.0				p.S445S		Atlas-SNP	.											SDHA,NS,carcinoma,0,1	SDHA	80	1	1	Substitution - coding silent(1)	breast(1)	c.G1335T						scavenged	.						73.0	67.0	69.0					5																	236617		2203	4300	6503	SO:0001819	synonymous_variant	6389	exon10	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	TGCCTCGGTACAT	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1335G>T	5.37:g.236617G>T		Somatic	331	1	0.00302115		WXS	Illumina HiSeq	Phase_I	372	4	0.0107527	NM_004168	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Silent	SNP	ENST00000264932.6	37	CCDS3853.1																																																																																			A|0.002;G|0.988;T|0.011	0.011	strong		0.597	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
ABCC1	4363	hgsc.bcm.edu	37	16	16162160	16162160	+	Splice_Site	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:16162160G>A	ENST00000399410.3	+	13	1999		c.e13+1		ABCC1_ENST00000346370.5_Splice_Site|ABCC1_ENST00000349029.5_Splice_Site|ABCC1_ENST00000399408.2_Splice_Site|ABCC1_ENST00000351154.5_Splice_Site|ABCC1_ENST00000345148.5_Splice_Site	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1						arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	CATCGTGCAGGTACAGGGGGA	0.597																																					.		Atlas-SNP	.											.	ABCC1	156	.	0			c.1824+1G>A						PASS	.						142.0	131.0	134.0					16																	16162160		2003	4168	6171	SO:0001630	splice_region_variant	4363	exon13			GTGCAGGTACAGG	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.1824+1G>A	16.37:g.16162160G>A		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	159	102	0.641509	NM_004996	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Splice_Site	SNP	ENST00000399410.3	37	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967961	0.74131	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0161	0.80441	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCC1	16069661	1.000000	0.71417	0.998000	0.56505	0.738000	0.42128	9.413000	0.97351	2.108000	0.64289	0.462000	0.41574	.	.	.	none		0.597	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996	Intron
SLC44A5	204962	hgsc.bcm.edu	37	1	75684254	75684254	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:75684254C>T	ENST00000370855.5	-	17	1563	c.1450G>A	c.(1450-1452)Gct>Act	p.A484T	SLC44A5_ENST00000370859.3_Missense_Mutation_p.A484T|SLC44A5_ENST00000535611.1_Missense_Mutation_p.A354T	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	484					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						TAATAAGTAGCGAATGCACCA	0.428																																					p.A484T		Atlas-SNP	.											SLC44A5_ENST00000370859,NS,carcinoma,0,2	SLC44A5	231	2	0			c.G1450A						scavenged	.						161.0	150.0	154.0					1																	75684254		2203	4300	6503	SO:0001583	missense	204962	exon17			AAGTAGCGAATGC	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1450G>A	1.37:g.75684254C>T	ENSP00000359892:p.Ala484Thr	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	127	3	0.023622	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.841395	0.91197	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.26810	1.71;1.71;1.71	5.6	5.6	0.85130	.	0.099447	0.64402	D	0.000002	T	0.53077	0.1774	M	0.86420	2.815	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.987;0.987;0.987;0.997;0.977	T	0.55927	-0.8063	10	0.51188	T	0.08	-15.4931	19.9938	0.97376	0.0:1.0:0.0:0.0	.	478;523;484;484;523	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	T	484;523;484;354;477	ENSP00000359896:A484T;ENSP00000359892:A484T;ENSP00000443090:A354T	ENSP00000359892:A484T	A	-	1	0	SLC44A5	75456842	1.000000	0.71417	0.997000	0.53966	0.428000	0.31595	7.792000	0.85828	2.814000	0.96858	0.655000	0.94253	GCT	.	.	none		0.428	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
COL14A1	7373	hgsc.bcm.edu	37	8	121174763	121174763	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:121174763T>C	ENST00000297848.3	+	4	574	c.304T>C	c.(304-306)Tac>Cac	p.Y102H	COL14A1_ENST00000247781.3_Missense_Mutation_p.Y102H|COL14A1_ENST00000537875.1_Missense_Mutation_p.Y102H|COL14A1_ENST00000309791.4_Missense_Mutation_p.Y102H|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AATTATTGCATACAATAAAGA	0.418																																					p.Y102H		Atlas-SNP	.											COL14A1,right_upper_lobe,carcinoma,-2,1	COL14A1	292	1	0			c.T304C						scavenged	.						90.0	90.0	90.0					8																	121174763		2203	4300	6503	SO:0001583	missense	7373	exon4			ATTGCATACAATA		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.304T>C	8.37:g.121174763T>C	ENSP00000297848:p.Tyr102His	Somatic	239	0	0		WXS	Illumina HiSeq	Phase_I	335	4	0.0119403	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	T	14.60	2.582601	0.46006	.	.	ENSG00000187955	ENST00000537875;ENST00000309791;ENST00000297848;ENST00000247781	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.71	4.56	0.56223	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.268999	0.36374	N	0.002635	T	0.41994	0.1183	L	0.34521	1.04	0.29077	N	0.882936	B	0.06786	0.001	B	0.08055	0.003	T	0.41787	-0.9489	10	0.62326	D	0.03	.	11.6072	0.51039	0.0:0.0696:0.0:0.9304	.	102	Q05707	COEA1_HUMAN	H	102	ENSP00000443974:Y102H;ENSP00000311809:Y102H;ENSP00000297848:Y102H;ENSP00000247781:Y102H	ENSP00000247781:Y102H	Y	+	1	0	COL14A1	121243944	0.988000	0.35896	0.954000	0.39281	0.990000	0.78478	3.879000	0.56138	0.997000	0.38969	0.533000	0.62120	TAC	.	.	none		0.418	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
SALL3	27164	hgsc.bcm.edu	37	18	76753588	76753588	+	Missense_Mutation	SNP	A	A	G	rs7240860	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr18:76753588A>G	ENST00000537592.2	+	2	1597	c.1597A>G	c.(1597-1599)Act>Gct	p.T533A	SALL3_ENST00000575389.2_Missense_Mutation_p.T533A|SALL3_ENST00000536229.3_Missense_Mutation_p.T400A	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	533			T -> A (in dbSNP:rs7240860).		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		ACTGCCGCCCACTGTCCCTGG	0.741													A|||	3600	0.71885	0.3374	0.8242	5008	,	,		11859	0.9127		0.8459	False		,,,				2504	0.8292				p.T533A		Atlas-SNP	.											SALL3,NS,carcinoma,0,1	SALL3	162	1	0			c.A1597G						scavenged	.	A	ALA/THR	1821,2527		397,1027,750	12.0	11.0	11.0		1597	2.7	0.2	18	dbSNP_116	11	7027,1441		2953,1121,160	no	missense	SALL3	NM_171999.2	58	3350,2148,910	GG,GA,AA		17.017,41.8813,30.9613	possibly-damaging	533/1301	76753588	8848,3968	2174	4234	6408	SO:0001583	missense	27164	exon2			CCGCCCACTGTCC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1597A>G	18.37:g.76753588A>G	ENSP00000441823:p.Thr533Ala	Somatic	3	1	0.333333		WXS	Illumina HiSeq	Phase_I	7	3	0.428571	NM_171999	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1629	0.7458791208791209	158	0.32113821138211385	307	0.8480662983425414	532	0.9300699300699301	632	0.8337730870712401	A	3.488	-0.104379	0.06967	0.418813	0.82983	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.10288	2.89	5.2	2.73	0.32206	.	0.000000	0.64402	D	0.000017	T	0.00012	0.0000	M	0.70842	2.15	0.09310	P	0.999999037973	P;P	0.52577	0.712;0.954	B;B	0.43950	0.396;0.437	T	0.11155	-1.0599	9	0.42905	T	0.14	-37.6074	8.1421	0.31089	0.7253:0.1343:0.0:0.1405	rs7240860	265;533	F5GXY4;Q9BXA9	.;SALL3_HUMAN	A	533;533;265	ENSP00000441823:T533A	ENSP00000299466:T533A	T	+	1	0	SALL3	74854576	1.000000	0.71417	0.204000	0.23530	0.006000	0.05464	4.407000	0.59754	0.267000	0.21916	-0.460000	0.05396	ACT	A|0.251;G|0.749	0.749	strong		0.741	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
INADL	10207	hgsc.bcm.edu	37	1	62545164	62545164	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:62545164T>C	ENST00000371158.2	+	32	4282	c.4168T>C	c.(4168-4170)Tcc>Ccc	p.S1390P	MIR3116-1_ENST00000584654.1_RNA|INADL_ENST00000545929.1_Missense_Mutation_p.S63P|INADL_ENST00000543708.1_Missense_Mutation_p.S174P|INADL_ENST00000316485.6_Missense_Mutation_p.S1390P	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1390					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						AACAAAAGTCTCCTTCAGTTC	0.373																																					p.S1390P		Atlas-SNP	.											INADL_ENST00000543708,NS,carcinoma,-1,2	INADL	179	2	0			c.T4168C						scavenged	.						153.0	144.0	147.0					1																	62545164		2203	4300	6503	SO:0001583	missense	10207	exon32			AAAGTCTCCTTCA	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.4168T>C	1.37:g.62545164T>C	ENSP00000360200:p.Ser1390Pro	Somatic	405	1	0.00246914		WXS	Illumina HiSeq	Phase_I	414	7	0.0169082	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	T	10.97	1.502825	0.26949	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000307297;ENST00000543708;ENST00000545929	T;T;T;T;T	0.30981	2.74;2.68;3.53;2.31;1.51	5.4	1.56	0.23342	.	0.166361	0.37136	N	0.002224	T	0.14787	0.0357	N	0.17474	0.49	0.09310	N	1	B;B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0;0.001	B;B;B;B;B;B	0.10450	0.001;0.005;0.001;0.002;0.001;0.005	T	0.10894	-1.0610	10	0.46703	T	0.11	.	3.2147	0.06695	0.0:0.2628:0.215:0.5222	.	63;174;849;1390;1390;1390	F5GY89;B4DE90;Q8NI35-5;F8W8T2;Q8NI35;Q8NI35-4	.;.;.;.;INADL_HUMAN;.	P	1390;1390;1390;1390;174;174;63	ENSP00000360200:S1390P;ENSP00000326199:S1390P;ENSP00000307496:S174P;ENSP00000445790:S174P;ENSP00000440094:S63P	ENSP00000307496:S174P	S	+	1	0	INADL	62317752	0.000000	0.05858	0.309000	0.25155	0.456000	0.32438	-0.148000	0.10219	0.897000	0.36392	0.533000	0.62120	TCC	.	.	none		0.373	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
HOXC13	3229	hgsc.bcm.edu	37	12	54333307	54333307	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:54333307A>G	ENST00000243056.3	+	1	773	c.617A>G	c.(616-618)gAc>gGc	p.D206G	HOXC-AS5_ENST00000512916.2_RNA	NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	206					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						CCGCGTCACGACGCCCTCATC	0.672			T	NUP98	AML																																p.D206G		Atlas-SNP	.		Dom	yes		12	12q13.3	3229	homeo box C13		L	.	HOXC13	24	.	0			c.A617G						PASS	.						18.0	20.0	19.0					12																	54333307		2199	4291	6490	SO:0001583	missense	3229	exon1			GTCACGACGCCCT		CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.617A>G	12.37:g.54333307A>G	ENSP00000243056:p.Asp206Gly	Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	57	11	0.192982	NM_017410	Q5BL02|Q96J32|Q9NR24|Q9NYD5	Missense_Mutation	SNP	ENST00000243056.3	37	CCDS8865.1	.	.	.	.	.	.	.	.	.	.	A	18.36	3.606534	0.66445	.	.	ENSG00000123364	ENST00000243056	D	0.93604	-3.25	3.16	3.16	0.36331	.	0.058843	0.64402	D	0.000003	D	0.93158	0.7821	M	0.76574	2.34	0.54753	D	0.999983	P	0.45569	0.861	P	0.46389	0.515	D	0.93361	0.6727	10	0.66056	D	0.02	.	11.3352	0.49500	1.0:0.0:0.0:0.0	.	206	P31276	HXC13_HUMAN	G	206	ENSP00000243056:D206G	ENSP00000243056:D206G	D	+	2	0	HOXC13	52619574	1.000000	0.71417	1.000000	0.80357	0.602000	0.36980	8.443000	0.90320	1.709000	0.51313	0.260000	0.18958	GAC	.	.	none		0.672	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358865.2		
MEPCE	56257	hgsc.bcm.edu	37	7	100028914	100028914	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:100028914C>T	ENST00000310512.2	+	1	1661	c.1273C>T	c.(1273-1275)Cgc>Tgc	p.R425C	ZCWPW1_ENST00000324725.6_5'Flank|MEPCE_ENST00000414441.1_5'UTR|ZCWPW1_ENST00000398027.2_5'Flank|ZCWPW1_ENST00000360951.4_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	425					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTATGGGTACCGCAATCCTTC	0.577																																					p.R425C		Atlas-SNP	.											MEPCE,NS,carcinoma,-1,1	MEPCE	52	1	0			c.C1273T						scavenged	.						70.0	67.0	68.0					7																	100028914		2203	4300	6503	SO:0001583	missense	56257	exon1			GGGTACCGCAATC	AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.1273C>T	7.37:g.100028914C>T	ENSP00000308546:p.Arg425Cys	Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	214	3	0.0140187	NM_019606	B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	ENST00000310512.2	37	CCDS5693.1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.888094	0.72524	.	.	ENSG00000146834	ENST00000310512	T	0.49720	0.77	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.66567	0.2802	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	P	0.61722	0.893	T	0.71810	-0.4480	10	0.87932	D	0	-4.6562	15.4512	0.75274	0.0:1.0:0.0:0.0	.	425	Q7L2J0	MEPCE_HUMAN	C	425	ENSP00000308546:R425C	ENSP00000308546:R425C	R	+	1	0	MEPCE	99866850	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.363000	0.66104	2.508000	0.84585	0.462000	0.41574	CGC	.	.	none		0.577	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339135.1		
WNT5A	7474	hgsc.bcm.edu	37	3	55508445	55508445	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:55508445G>A	ENST00000474267.1	-	5	1125	c.604C>T	c.(604-606)Cgg>Tgg	p.R202W	WNT5A_ENST00000497027.1_Missense_Mutation_p.R187W|WNT5A_ENST00000264634.4_Missense_Mutation_p.R202W			P41221	WNT5A_HUMAN	wingless-type MMTV integration site family, member 5A	202					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|ameboidal cell migration (GO:0001667)|anterior/posterior axis specification, embryo (GO:0008595)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular protein localization (GO:0034613)|cellular response to calcium ion (GO:0071277)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cervix development (GO:0060067)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|dopaminergic neuron differentiation (GO:0071542)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system development (GO:0048706)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity (GO:0001736)|face development (GO:0060324)|genitalia development (GO:0048806)|heart looping (GO:0001947)|hematopoietic stem cell proliferation (GO:0071425)|hindgut morphogenesis (GO:0007442)|hypophysis morphogenesis (GO:0048850)|keratinocyte differentiation (GO:0030216)|lateral sprouting involved in mammary gland duct morphogenesis (GO:0060599)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|male gonad development (GO:0008584)|mammary gland branching involved in thelarche (GO:0060744)|mesenchymal-epithelial cell signaling (GO:0060638)|midgut development (GO:0007494)|negative chemotaxis (GO:0050919)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of synapse assembly (GO:0051964)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|olfactory bulb interneuron development (GO:0021891)|optic cup formation involved in camera-type eye development (GO:0003408)|palate development (GO:0060021)|planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:0061350)|planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:0061349)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar cell polarity pathway involved in outflow tract morphogenesis (GO:0061347)|planar cell polarity pathway involved in pericardium morphogenesis (GO:0061354)|planar cell polarity pathway involved in ventricular septum morphogenesis (GO:0061348)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of meiosis (GO:0045836)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ossification (GO:0045778)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|protein phosphorylation (GO:0006468)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|response to organic substance (GO:0010033)|somitogenesis (GO:0001756)|type B pancreatic cell development (GO:0003323)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|wound healing (GO:0042060)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor tyrosine kinase-like orphan receptor binding (GO:0005115)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(1)|large_intestine(4)|lung(3)|prostate(2)|urinary_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		ATGCGCTCCCGCTCGCGGGCG	0.682																																					p.R202W		Atlas-SNP	.											WNT5A,NS,carcinoma,+1,1	WNT5A	43	1	0			c.C604T						scavenged	.						16.0	22.0	20.0					3																	55508445		2142	4269	6411	SO:0001583	missense	7474	exon4			GCTCCCGCTCGCG	L20861	CCDS46850.1, CCDS58835.1	3p21-p14	2013-02-28			ENSG00000114251	ENSG00000114251		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12784	protein-coding gene	gene with protein product	"""WNT-5A protein"""	164975				8288227	Standard	NM_001256105		Approved	hWNT5A	uc010hmw.4	P41221	OTTHUMG00000158361	ENST00000474267.1:c.604C>T	3.37:g.55508445G>A	ENSP00000417310:p.Arg202Trp	Somatic	149	2	0.0134228		WXS	Illumina HiSeq	Phase_I	172	86	0.5	NM_003392	A8K4A4|Q6P278	Missense_Mutation	SNP	ENST00000474267.1	37	CCDS46850.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171647	0.78452	.	.	ENSG00000114251	ENST00000474267;ENST00000264634;ENST00000536765;ENST00000497027;ENST00000482079	T;T;T;D	0.85861	-1.12;-1.12;-1.12;-2.04	4.84	1.2	0.21068	.	0.113021	0.56097	D	0.000031	D	0.92831	0.7720	M	0.93854	3.465	0.58432	D	0.999994	D	0.76494	0.999	D	0.63192	0.912	D	0.94072	0.7336	10	0.87932	D	0	.	13.9657	0.64207	0.0:0.0:0.4521:0.5478	.	202	P41221	WNT5A_HUMAN	W	202;202;113;187;187	ENSP00000417310:R202W;ENSP00000264634:R202W;ENSP00000420104:R187W;ENSP00000418184:R187W	ENSP00000264634:R202W	R	-	1	2	WNT5A	55483485	0.992000	0.36948	1.000000	0.80357	0.971000	0.66376	0.423000	0.21313	0.479000	0.27511	0.557000	0.71058	CGG	.	.	none		0.682	WNT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350793.3	NM_003392	
HRNR	388697	hgsc.bcm.edu	37	1	152186490	152186490	+	Missense_Mutation	SNP	C	C	T	rs201463788	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:152186490C>T	ENST00000368801.2	-	3	7690	c.7615G>A	c.(7615-7617)Ggc>Agc	p.G2539S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2539				G -> S (in Ref. 1; BAC57496). {ECO:0000305}.	establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCACGCTGGCCGTGGCCTGGA	0.632													C|||	888	0.177316	0.1203	0.2147	5008	,	,		40970	0.2679		0.0934	False		,,,				2504	0.2209				p.G2539S		Atlas-SNP	.											HRNR,NS,carcinoma,0,2	HRNR	403	2	0			c.G7615A						scavenged	.						1.0	1.0	1.0					1																	152186490		2	12	14	SO:0001583	missense	388697	exon3			GCTGGCCGTGGCC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7615G>A	1.37:g.152186490C>T	ENSP00000357791:p.Gly2539Ser	Somatic	155	56	0.36129		WXS	Illumina HiSeq	Phase_I	75	31	0.413333	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	8.448	0.852355	0.17106	.	.	ENSG00000197915	ENST00000368801	T	0.05081	3.5	3.1	-1.4	0.08968	.	.	.	.	.	T	0.00967	0.0032	L	0.40543	1.245	0.80722	P	0.0	P	0.39181	0.663	B	0.20184	0.028	T	0.49818	-0.8899	8	0.11794	T	0.64	.	7.0816	0.25234	0.0:0.4912:0.0:0.5088	rs7514457;rs9661330	2539	Q86YZ3	HORN_HUMAN	S	2539	ENSP00000357791:G2539S	ENSP00000357791:G2539S	G	-	1	0	HRNR	150453114	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.984000	0.03755	-0.477000	0.06832	0.603000	0.83216	GGC	C|0.500;T|0.500	0.500	strong		0.632	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
EXOG	9941	hgsc.bcm.edu	37	3	38537954	38537954	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:38537954G>A	ENST00000287675.5	+	1	192	c.96G>A	c.(94-96)ggG>ggA	p.G32G	EXOG_ENST00000358249.2_5'UTR|EXOG_ENST00000422077.2_Silent_p.G32G	NM_005107.3	NP_005098.2	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	32					DNA catabolic process, endonucleolytic (GO:0000737)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			central_nervous_system(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	17						CGGGAGCTGGGCTCGCGGCCC	0.657											OREG0015479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G32G		Atlas-SNP	.											.	EXOG	29	.	0			c.G96A						PASS	.						45.0	46.0	45.0					3																	38537954		2203	4300	6503	SO:0001819	synonymous_variant	9941	exon1			AGCTGGGCTCGCG	AB020523	CCDS2680.1, CCDS46795.1	3p21.3	2010-05-07	2009-01-08	2009-01-08	ENSG00000157036	ENSG00000157036	3.1.30.-		3347	protein-coding gene	gene with protein product		604051	"""endonuclease G-like 1"", ""endonuclease G-like 2"""	ENDOGL1, ENDOGL2		10231028, 18187503	Standard	NM_005107		Approved	ENGL-a, ENGL, ENGL-b	uc003cih.2	Q9Y2C4	OTTHUMG00000131295	ENST00000287675.5:c.96G>A	3.37:g.38537954G>A		Somatic	61	0	0	879	WXS	Illumina HiSeq	Phase_I	98	50	0.510204	NM_005107	A8K242|B4DVG2|Q3SXM9|Q9Y2C8	Silent	SNP	ENST00000287675.5	37	CCDS2680.1																																																																																			.	.	none		0.657	EXOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254063.2	NM_005107	
ANKRA2	57763	hgsc.bcm.edu	37	5	72857086	72857086	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:72857086G>A	ENST00000296785.3	-	3	975	c.317C>T	c.(316-318)tCt>tTt	p.S106F		NM_023039.4	NP_075526.1	Q9H9E1	ANRA2_HUMAN	ankyrin repeat, family A (RFXANK-like), 2	106						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	low-density lipoprotein particle binding (GO:0030169)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		Lung NSC(167;0.0378)|Ovarian(174;0.0908)		OV - Ovarian serous cystadenocarcinoma(47;3.71e-54)		AATTCCCGGAGAAGGAGATGT	0.363																																					p.S106F		Atlas-SNP	.											ANKRA2,colon,carcinoma,0,1	ANKRA2	23	1	0			c.C317T						scavenged	.						198.0	174.0	182.0					5																	72857086		2203	4300	6503	SO:0001583	missense	57763	exon3			CCCGGAGAAGGAG	AA442702	CCDS4020.1	5q12-q13	2013-01-10			ENSG00000164331	ENSG00000164331		"""Ankyrin repeat domain containing"""	13208	protein-coding gene	gene with protein product		605787				10965114	Standard	NM_023039		Approved		uc003kcu.2	Q9H9E1	OTTHUMG00000102030	ENST00000296785.3:c.317C>T	5.37:g.72857086G>A	ENSP00000296785:p.Ser106Phe	Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	206	3	0.0145631	NM_023039		Missense_Mutation	SNP	ENST00000296785.3	37	CCDS4020.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.811397	0.90707	.	.	ENSG00000164331	ENST00000296785	T	0.40756	1.02	4.92	4.92	0.64577	Ankyrin repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.57636	0.2067	L	0.44542	1.39	0.80722	D	1	D	0.61697	0.99	D	0.69142	0.962	T	0.60954	-0.7160	10	0.66056	D	0.02	-14.2183	18.1209	0.89571	0.0:0.0:1.0:0.0	.	106	Q9H9E1	ANRA2_HUMAN	F	106	ENSP00000296785:S106F	ENSP00000296785:S106F	S	-	2	0	ANKRA2	72892842	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.576000	0.82467	2.262000	0.75019	0.455000	0.32223	TCT	.	.	none		0.363	ANKRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219814.2	NM_023039	
ASXL3	80816	hgsc.bcm.edu	37	18	31323877	31323877	+	Silent	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr18:31323877T>C	ENST00000269197.5	+	12	4065	c.4065T>C	c.(4063-4065)acT>acC	p.T1355T		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1355	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						ACCTCTCCACTAGCTCTGTCT	0.458											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T1355T		Atlas-SNP	.											ASXL3_ENST00000269197,NS,carcinoma,0,1	ASXL3	405	1	0			c.T4065C						scavenged	.						144.0	146.0	146.0					18																	31323877		1957	4144	6101	SO:0001819	synonymous_variant	80816	exon12			CTCCACTAGCTCT	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4065T>C	18.37:g.31323877T>C		Somatic	168	0	0	823	WXS	Illumina HiSeq	Phase_I	270	3	0.0111111	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	ENST00000269197.5	37	CCDS45847.1																																																																																			.	.	none		0.458	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
VAV1	7409	hgsc.bcm.edu	37	19	6828475	6828475	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:6828475C>T	ENST00000602142.1	+	11	1151	c.1069C>T	c.(1069-1071)Cgg>Tgg	p.R357W	VAV1_ENST00000596764.1_Missense_Mutation_p.R325W|VAV1_ENST00000539284.1_Missense_Mutation_p.R260W|VAV1_ENST00000599806.1_Missense_Mutation_p.R302W|VAV1_ENST00000304076.2_Missense_Mutation_p.R357W	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	357	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R357W(1)		biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						GGAGAACCTGCGGCTGGCCCT	0.627																																					p.R357W		Atlas-SNP	.											VAV1,NS,carcinoma,0,1	VAV1	140	1	1	Substitution - Missense(1)	kidney(1)	c.C1069T						scavenged	.						60.0	63.0	62.0					19																	6828475		2203	4300	6503	SO:0001583	missense	7409	exon11			AACCTGCGGCTGG		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1069C>T	19.37:g.6828475C>T	ENSP00000472929:p.Arg357Trp	Somatic	220	0	0		WXS	Illumina HiSeq	Phase_I	243	3	0.0123457	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.144975	0.57044	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.63913	-0.07;-0.07	5.0	2.81	0.32909	Dbl homology (DH) domain (5);	0.071358	0.53938	D	0.000043	T	0.78259	0.4255	M	0.83953	2.67	0.50171	D	0.999854	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.981;0.992;0.993;0.998	T	0.79274	-0.1871	10	0.87932	D	0	.	11.1257	0.48317	0.4865:0.5135:0.0:0.0	.	260;357;302;357	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	W	357;260	ENSP00000302269:R357W;ENSP00000443242:R260W	ENSP00000302269:R357W	R	+	1	2	VAV1	6779475	0.873000	0.30073	0.995000	0.50966	0.398000	0.30690	0.216000	0.17585	0.499000	0.27970	-0.518000	0.04402	CGG	.	.	none		0.627	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
KRTAP2-4	85294	hgsc.bcm.edu	37	17	39221736	39221736	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:39221736G>A	ENST00000394015.2	-	1	395	c.362C>T	c.(361-363)aCc>aTc	p.T121I		NM_033184.3	NP_149440.1	Q9BYR9	KRA24_HUMAN	keratin associated protein 2-4	121						keratin filament (GO:0045095)				skin(1)	1		Breast(137;0.000496)|Myeloproliferative disorder(1115;0.204)	STAD - Stomach adenocarcinoma(17;0.000371)			CCTGCAGGTGGTGCTGCAAGG	0.592																																					p.T121I		Atlas-SNP	.											.	KRTAP2-4	2	.	0			c.C362T						PASS	.						23.0	26.0	25.0					17																	39221736		1869	3804	5673	SO:0001583	missense	85294	exon1			CAGGTGGTGCTGC	AJ406930		17q21.2	2012-04-19			ENSG00000213417	ENSG00000213417		"""Keratin associated proteins"""	18891	protein-coding gene	gene with protein product						11279113	Standard	NM_033184		Approved	KAP2.4	uc002hvy.3	Q9BYR9	OTTHUMG00000133594	ENST00000394015.2:c.362C>T	17.37:g.39221736G>A	ENSP00000377583:p.Thr121Ile	Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	53	22	0.415094	NM_033184	Q495J2	Missense_Mutation	SNP	ENST00000394015.2	37	CCDS32648.1	.	.	.	.	.	.	.	.	.	.	.	14.08	2.427347	0.43122	.	.	ENSG00000213417	ENST00000394015	.	.	.	5.58	0.192	0.15134	.	0.809286	0.09927	U	0.737644	T	0.38134	0.1029	L	0.47078	1.49	0.23813	N	0.996777	.	.	.	.	.	.	T	0.40683	-0.9550	7	0.72032	D	0.01	.	4.2698	0.10780	0.3539:0.1622:0.4839:0.0	.	.	.	.	I	121	.	ENSP00000377583:T121I	T	-	2	0	KRTAP2-4	36475262	0.990000	0.36364	0.460000	0.27093	0.971000	0.66376	0.499000	0.22546	0.044000	0.15775	0.655000	0.94253	ACC	.	.	none		0.592	KRTAP2-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257698.1	NM_033184	
PRUNE2	158471	hgsc.bcm.edu	37	9	79323927	79323927	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr9:79323927T>C	ENST00000376718.3	-	8	3386	c.3263A>G	c.(3262-3264)tAc>tGc	p.Y1088C	PRUNE2_ENST00000428286.1_Missense_Mutation_p.Y729C	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1088					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TGTTTCATTGTACAGTTGCAT	0.517																																					p.Y1088C		Atlas-SNP	.											PRUNE2_ENST00000376718,NS,carcinoma,+1,1	PRUNE2	331	1	0			c.A3263G						scavenged	.						299.0	250.0	265.0					9																	79323927		1568	3582	5150	SO:0001583	missense	158471	exon8			TCATTGTACAGTT	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.3263A>G	9.37:g.79323927T>C	ENSP00000365908:p.Tyr1088Cys	Somatic	312	1	0.00320513		WXS	Illumina HiSeq	Phase_I	332	5	0.0150602	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	T	15.73	2.919886	0.52653	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.60171	0.21;0.26	5.94	4.81	0.61882	.	0.530381	0.17500	N	0.172036	T	0.61048	0.2316	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	T	0.61530	-0.7044	10	0.87932	D	0	-1.0293	7.1781	0.25757	0.0:0.0737:0.1468:0.7795	.	1088	Q8WUY3	PRUN2_HUMAN	C	1088;729;1087	ENSP00000365908:Y1088C;ENSP00000397425:Y729C	ENSP00000365908:Y1088C	Y	-	2	0	PRUNE2	78513747	0.996000	0.38824	0.997000	0.53966	0.596000	0.36781	1.356000	0.34079	1.084000	0.41184	0.459000	0.35465	TAC	.	.	none		0.517	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
BCAP29	55973	hgsc.bcm.edu	37	7	107221236	107221236	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:107221236G>A	ENST00000005259.4	+	2	358	c.19G>A	c.(19-21)Gca>Aca	p.A7T	RP4-593H12.1_ENST00000610269.1_RNA|BCAP29_ENST00000445771.2_Missense_Mutation_p.A7T|BCAP29_ENST00000379117.2_Missense_Mutation_p.A7T|BCAP29_ENST00000379119.2_Missense_Mutation_p.A7T|BCAP29_ENST00000494086.1_Intron|BCAP29_ENST00000465919.1_Intron	NM_018844.3	NP_061332.2	Q9UHQ4	BAP29_HUMAN	B-cell receptor-associated protein 29	7					apoptotic process (GO:0006915)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|osteoblast differentiation (GO:0001649)|protein localization to endoplasmic reticulum exit site (GO:0070973)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	14						CCAATGGGCTGCAGTGGCAAC	0.413																																					p.A7T		Atlas-SNP	.											.	BCAP29	46	.	0			c.G19A						PASS	.						104.0	93.0	97.0					7																	107221236		2203	4300	6503	SO:0001583	missense	55973	exon2			TGGGCTGCAGTGG		CCDS34730.1, CCDS34731.1	7q22.3	2012-09-20			ENSG00000075790	ENSG00000075790			24131	protein-coding gene	gene with protein product						12477932	Standard	NM_018844		Approved	BAP29, DKFZp686M2086	uc011kma.1	Q9UHQ4	OTTHUMG00000154770	ENST00000005259.4:c.19G>A	7.37:g.107221236G>A	ENSP00000005259:p.Ala7Thr	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	123	42	0.341463	NM_018844	G5E9L4|O95003	Missense_Mutation	SNP	ENST00000005259.4	37	CCDS34731.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600874	0.87055	.	.	ENSG00000075790	ENST00000005259;ENST00000445771;ENST00000479917;ENST00000421217;ENST00000457837;ENST00000379117;ENST00000473124;ENST00000379119	.	.	.	4.63	4.63	0.57726	.	0.054140	0.64402	D	0.000001	T	0.78886	0.4354	M	0.81942	2.565	0.80722	D	1	D;D;D	0.76494	0.993;0.999;0.999	D;D;D	0.68943	0.91;0.961;0.961	T	0.80379	-0.1407	9	0.48119	T	0.1	-14.1844	16.2143	0.82195	0.0:0.0:1.0:0.0	.	7;7;7	G5E9L4;C9JTE9;Q9UHQ4	.;.;BAP29_HUMAN	T	7	.	ENSP00000005259:A7T	A	+	1	0	BCAP29	107008472	1.000000	0.71417	0.932000	0.37286	0.854000	0.48673	7.886000	0.87288	2.548000	0.85928	0.655000	0.94253	GCA	.	.	none		0.413	BCAP29-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337011.2	NM_018844	
EPHA3	2042	hgsc.bcm.edu	37	3	89259340	89259340	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:89259340C>T	ENST00000336596.2	+	3	709	c.484C>T	c.(484-486)Ctg>Ttg	p.L162L	EPHA3_ENST00000494014.1_Silent_p.L162L|EPHA3_ENST00000452448.2_Silent_p.L162L	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	162	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GGACCGTATTCTGAAGCTCAA	0.418										TSP Lung(6;0.00050)																											p.L162L		Atlas-SNP	.											EPHA3_ENST00000452448,colon,carcinoma,-1,7	EPHA3	501	7	0			c.C484T						scavenged	.						154.0	135.0	142.0					3																	89259340		2203	4300	6503	SO:0001819	synonymous_variant	2042	exon3			CGTATTCTGAAGC	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.484C>T	3.37:g.89259340C>T		Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	179	2	0.0111732	NM_005233	Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	37	CCDS2922.1																																																																																			.	.	none		0.418	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
MUC16	94025	hgsc.bcm.edu	37	19	9002612	9002612	+	Missense_Mutation	SNP	T	T	G	rs544501645	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:9002612T>G	ENST00000397910.4	-	51	40407	c.40204A>C	c.(40204-40206)Aaa>Caa	p.K13402Q	MUC16_ENST00000380951.5_Missense_Mutation_p.K43Q	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13404	SEA 9. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCAGGGCTTTTGGGGTCAGGA	0.567													t|||	2	0.000399361	0.0008	0.0	5008	,	,		17513	0.0		0.001	False		,,,				2504	0.0				p.K13402Q		Atlas-SNP	.											MUC16_ENST00000397910,NS,lymphoid_neoplasm,0,2	MUC16	4315	2	0			c.A40204C						scavenged	.						97.0	88.0	91.0					19																	9002612		2010	4179	6189	SO:0001583	missense	94025	exon51			GGCTTTTGGGGTC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40204A>C	19.37:g.9002612T>G	ENSP00000381008:p.Lys13402Gln	Somatic	178	14	0.0786517		WXS	Illumina HiSeq	Phase_I	249	23	0.0923695	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	6.712	0.500044	0.12762	.	.	ENSG00000181143	ENST00000397910;ENST00000380951	T;T	0.29142	1.58;1.58	2.75	-5.49	0.02584	SEA (1);	.	.	.	.	T	0.34542	0.0901	L	0.57536	1.79	.	.	.	B;D	0.56287	0.0;0.975	B;D	0.71656	0.001;0.974	T	0.28332	-1.0047	8	0.12103	T	0.63	5.8029	0.561	0.00679	0.3225:0.3115:0.1633:0.2027	.	21047;13402	Q8WXI7;B5ME49	MUC16_HUMAN;.	Q	13402;43	ENSP00000381008:K13402Q;ENSP00000370338:K43Q	ENSP00000370338:K43Q	K	-	1	0	MUC16	8863612	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-7.834000	0.00029	-1.603000	0.01597	-0.867000	0.03001	AAA	.	.	none		0.567	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
VSX2	338917	hgsc.bcm.edu	37	14	74726455	74726455	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:74726455A>G	ENST00000261980.2	+	4	820	c.730A>G	c.(730-732)Atc>Gtc	p.I244V		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	244	CVC. {ECO:0000255|PROSITE- ProRule:PRU00829}.				cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		CAAGGATGGCATCATGGACTC	0.662																																					p.I244V		Atlas-SNP	.											VSX2,NS,carcinoma,-2,1	VSX2	32	1	0			c.A730G						scavenged	.						88.0	72.0	78.0					14																	74726455		2203	4300	6503	SO:0001583	missense	338917	exon4			GATGGCATCATGG	AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.730A>G	14.37:g.74726455A>G	ENSP00000261980:p.Ile244Val	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	120	2	0.0166667	NM_182894	A1A4X6	Missense_Mutation	SNP	ENST00000261980.2	37	CCDS9827.1	.	.	.	.	.	.	.	.	.	.	A	13.24	2.177785	0.38413	.	.	ENSG00000119614	ENST00000261980	D	0.89552	-2.53	5.13	5.13	0.70059	CVC domain (1);	0.151633	0.64402	D	0.000016	T	0.76271	0.3964	N	0.03608	-0.345	0.42638	D	0.993409	B	0.14805	0.011	B	0.18871	0.023	T	0.71836	-0.4472	10	0.22706	T	0.39	.	15.11	0.72349	1.0:0.0:0.0:0.0	.	244	P58304	VSX2_HUMAN	V	244	ENSP00000261980:I244V	ENSP00000261980:I244V	I	+	1	0	VSX2	73796208	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.048000	0.57390	2.157000	0.67596	0.533000	0.62120	ATC	.	.	none		0.662	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412323.1	NM_182894	
IFT122	55764	hgsc.bcm.edu	37	3	129214405	129214405	+	Silent	SNP	C	C	T	rs553526454		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:129214405C>T	ENST00000348417.2	+	18	2240	c.2163C>T	c.(2161-2163)ctC>ctT	p.L721L	IFT122_ENST00000440957.2_Silent_p.L512L|IFT122_ENST00000504021.1_Silent_p.L597L|IFT122_ENST00000347300.2_Silent_p.L662L|IFT122_ENST00000296266.3_Silent_p.L772L|IFT122_ENST00000513932.1_3'UTR|IFT122_ENST00000431818.2_Silent_p.L571L|IFT122_ENST00000349441.2_Silent_p.L610L|IFT122_ENST00000507564.1_Silent_p.L713L	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	721					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						ACGAGAACCTCGCGCTTGAAA	0.532																																					p.L772L		Atlas-SNP	.											IFT122,NS,carcinoma,+2,1	IFT122	117	1	0			c.C2316T						scavenged	.						129.0	114.0	119.0					3																	129214405		2203	4300	6503	SO:0001819	synonymous_variant	55764	exon19			GAACCTCGCGCTT	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.2163C>T	3.37:g.129214405C>T		Somatic	175	1	0.00571429		WXS	Illumina HiSeq	Phase_I	198	2	0.010101	NM_052985	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Silent	SNP	ENST00000348417.2	37	CCDS3061.1																																																																																			.	.	none		0.532	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262	
PIK3R4	30849	hgsc.bcm.edu	37	3	130447403	130447403	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:130447403G>T	ENST00000356763.3	-	6	2268	c.1711C>A	c.(1711-1713)Cag>Aag	p.Q571K		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	571					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q571E(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						TTGGCTTTCTGACGTCCAAAG	0.368																																					p.Q571K		Atlas-SNP	.											PIK3R4,NS,carcinoma,0,1	PIK3R4	145	1	1	Substitution - Missense(1)	lung(1)	c.C1711A						scavenged	.						109.0	113.0	112.0					3																	130447403		2203	4300	6503	SO:0001583	missense	30849	exon6			CTTTCTGACGTCC	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.1711C>A	3.37:g.130447403G>T	ENSP00000349205:p.Gln571Lys	Somatic	278	0	0		WXS	Illumina HiSeq	Phase_I	290	4	0.0137931	NM_014602	Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	37	CCDS3067.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803515	0.70682	.	.	ENSG00000196455	ENST00000356763	T	0.50001	0.76	5.57	5.57	0.84162	Armadillo-like helical (1);Armadillo-type fold (1);	0.109608	0.64402	D	0.000004	T	0.59569	0.2203	M	0.72624	2.21	0.80722	D	1	P	0.42620	0.785	P	0.48598	0.583	T	0.53620	-0.8413	10	0.27785	T	0.31	-20.4633	19.9093	0.97021	0.0:0.0:1.0:0.0	.	571	Q99570	PI3R4_HUMAN	K	571	ENSP00000349205:Q571K	ENSP00000349205:Q571K	Q	-	1	0	PIK3R4	131930093	1.000000	0.71417	1.000000	0.80357	0.602000	0.36980	9.388000	0.97237	2.785000	0.95823	0.655000	0.94253	CAG	.	.	none		0.368	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
AADAC	13	hgsc.bcm.edu	37	3	151542519	151542519	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:151542519T>C	ENST00000232892.7	+	4	626	c.500T>C	c.(499-501)tTc>tCc	p.F167S	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA|AADAC_ENST00000488869.1_Missense_Mutation_p.F167S	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	167					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TTAAGGTGGTTCTTACGTAAA	0.368																																					p.F167S	Ovarian(30;839 841 2699 32801 46334)	Atlas-SNP	.											.	AADAC	49	.	0			c.T500C						PASS	.						100.0	100.0	100.0					3																	151542519		2203	4300	6503	SO:0001583	missense	13	exon4			GGTGGTTCTTACG	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.500T>C	3.37:g.151542519T>C	ENSP00000232892:p.Phe167Ser	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	123	5	0.0406504	NM_001086	A8K3L3|D3DNJ6|Q8N1A9	Missense_Mutation	SNP	ENST00000232892.7	37	CCDS33877.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.970163	0.53614	.	.	ENSG00000114771	ENST00000232892;ENST00000488869	T;T	0.58940	0.3;2.79	4.73	4.73	0.59995	Alpha/beta hydrolase fold-3 (1);	0.000000	0.85682	D	0.000000	T	0.76278	0.3965	M	0.81682	2.555	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.80535	-0.1339	10	0.87932	D	0	-49.2631	14.2071	0.65741	0.0:0.0:0.0:1.0	.	167	P22760	AAAD_HUMAN	S	167	ENSP00000232892:F167S;ENSP00000419620:F167S	ENSP00000232892:F167S	F	+	2	0	AADAC	153025209	1.000000	0.71417	0.780000	0.31762	0.078000	0.17371	7.000000	0.76290	1.739000	0.51704	0.472000	0.43445	TTC	.	.	none		0.368	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086	
DSPP	1834	hgsc.bcm.edu	37	4	88536460	88536460	+	Silent	SNP	C	C	T	rs199691318		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:88536460C>T	ENST00000282478.7	+	4	2679	c.2646C>T	c.(2644-2646)agC>agT	p.S882S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S882S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	882	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagtgatagcagtgacagca	0.498																																					p.S882S		Atlas-SNP	.											.	DSPP	174	.	0			c.C2646T						PASS	.						73.0	87.0	82.0					4																	88536460		1617	2929	4546	SO:0001819	synonymous_variant	1834	exon5			TGATAGCAGTGAC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2646C>T	4.37:g.88536460C>T		Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	91	18	0.197802	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	weak		0.498	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
NAV1	89796	hgsc.bcm.edu	37	1	201779198	201779198	+	Missense_Mutation	SNP	G	G	A	rs201416032		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:201779198G>A	ENST00000367296.4	+	23	4946	c.4526G>A	c.(4525-4527)cGt>cAt	p.R1509H	NAV1_ENST00000367297.4_Missense_Mutation_p.R1501H|NAV1_ENST00000367300.3_Missense_Mutation_p.R1449H|IPO9-AS1_ENST00000413035.1_RNA|MIR1231_ENST00000408101.1_RNA|NAV1_ENST00000367302.1_Missense_Mutation_p.R1462H|NAV1_ENST00000367295.1_Missense_Mutation_p.R1115H|NAV1_ENST00000295624.6_Missense_Mutation_p.R1506H	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1509					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CCTCCTTGCCGTCGAGGTGTC	0.532																																					p.R1509H		Atlas-SNP	.											NAV1,right_upper_lobe,carcinoma,0,2	NAV1	143	2	0			c.G4526A						PASS	.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	150.0	114.0	126.0		3344,4526	5.4	1.0	1		126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	NAV1	NM_001167738.1,NM_020443.4	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	1115/1484,1509/1878	201779198	1,13005	2203	4300	6503	SO:0001583	missense	89796	exon23			CTTGCCGTCGAGG	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.4526G>A	1.37:g.201779198G>A	ENSP00000356265:p.Arg1509His	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	164	10	0.0609756	NM_020443	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	G	20.1	3.940056	0.73557	0.0	1.16E-4	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295	T;T;T;T;T;T	0.07444	3.2;3.19;3.19;3.19;3.2;3.19	5.38	5.38	0.77491	.	0.252855	0.38897	N	0.001527	T	0.09291	0.0229	L	0.43152	1.355	0.40705	D	0.982517	P;P	0.42248	0.774;0.774	B;B	0.33454	0.096;0.164	T	0.09037	-1.0693	10	0.52906	T	0.07	-14.844	18.7379	0.91763	0.0:0.0:1.0:0.0	.	1115;1506	Q8NEY1-5;Q8NEY1-3	.;.	H	1462;1509;1506;1501;1449;1115	ENSP00000356271:R1462H;ENSP00000356265:R1509H;ENSP00000295624:R1506H;ENSP00000356266:R1501H;ENSP00000356269:R1449H;ENSP00000356264:R1115H	ENSP00000295624:R1506H	R	+	2	0	NAV1	200045821	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.197000	0.58413	2.498000	0.84270	0.561000	0.74099	CGT	G|0.999;A|0.001	0.001	weak		0.532	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
CDH5	1003	hgsc.bcm.edu	37	16	66423409	66423409	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:66423409C>T	ENST00000341529.3	+	5	913	c.765C>T	c.(763-765)ttC>ttT	p.F255F	CDH5_ENST00000563425.2_Silent_p.F255F	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	255	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	ATGACAACTTCCCCTTCTTCA	0.612																																					p.F255F		Atlas-SNP	.											.	CDH5	111	.	0			c.C765T						PASS	.						59.0	57.0	58.0					16																	66423409		2202	4300	6502	SO:0001819	synonymous_variant	1003	exon5			CAACTTCCCCTTC	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.765C>T	16.37:g.66423409C>T		Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	82	5	0.0609756	NM_001795	Q4VAI5|Q4VAI6	Silent	SNP	ENST00000341529.3	37	CCDS10804.1																																																																																			.	.	none		0.612	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
ZNF285	26974	hgsc.bcm.edu	37	19	44891202	44891202	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:44891202C>G	ENST00000330997.4	-	4	1269	c.1205G>C	c.(1204-1206)tGc>tCc	p.C402S	ZNF285_ENST00000544719.2_Missense_Mutation_p.C402S|ZNF285_ENST00000591679.1_Missense_Mutation_p.C409S|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C402S(2)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						ACACTCACTGCATTTGTAGGG	0.478																																					p.C402S		Atlas-SNP	.											ZNF285,NS,carcinoma,0,2	ZNF285	86	2	2	Substitution - Missense(2)	prostate(2)	c.G1205C						scavenged	.						54.0	52.0	52.0					19																	44891202		2203	4300	6503	SO:0001583	missense	26974	exon4			TCACTGCATTTGT	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1205G>C	19.37:g.44891202C>G	ENSP00000333595:p.Cys402Ser	Somatic	53	1	0.0188679		WXS	Illumina HiSeq	Phase_I	52	4	0.0769231	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.689844	0.68271	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	D	0.85171	-1.95	3.36	3.36	0.38483	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93262	0.7853	M	0.91612	3.225	0.39148	D	0.962161	D;B	0.89917	1.0;0.007	D;B	0.97110	1.0;0.151	D	0.95026	0.8165	9	0.62326	D	0.03	.	13.918	0.63914	0.0:1.0:0.0:0.0	.	426;402	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	S	425;402	ENSP00000333595:C402S	ENSP00000333595:C402S	C	-	2	0	ZNF285	49583042	1.000000	0.71417	0.664000	0.29753	0.967000	0.64934	4.406000	0.59748	1.598000	0.50083	0.298000	0.19748	TGC	.	.	none		0.478	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
ALMS1	7840	hgsc.bcm.edu	37	2	73680673	73680673	+	Missense_Mutation	SNP	C	C	T	rs577661314		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:73680673C>T	ENST00000264448.6	+	8	7127	c.7016C>T	c.(7015-7017)aCg>aTg	p.T2339M	ALMS1_ENST00000377715.1_Missense_Mutation_p.T2339M|ALMS1_ENST00000409009.1_Missense_Mutation_p.T2297M	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2339					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GGCACACAGACGAATTTGAAA	0.448																																					p.T2339M		Atlas-SNP	.											ALMS1,colon,carcinoma,-1,1	ALMS1	384	1	0			c.C7016T						scavenged	.						57.0	54.0	55.0					2																	73680673		1876	4118	5994	SO:0001583	missense	7840	exon8			CACAGACGAATTT	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.7016C>T	2.37:g.73680673C>T	ENSP00000264448:p.Thr2339Met	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	110	2	0.0181818	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291926	0.59976	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.18016	3.16;3.16;2.24	5.92	3.85	0.44370	.	0.124039	0.37393	N	0.002118	T	0.31670	0.0804	L	0.54323	1.7	0.26106	N	0.980759	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.988;0.988	T	0.02581	-1.1138	10	0.87932	D	0	.	7.903	0.29746	0.2462:0.6009:0.1529:0.0	.	2339;2297;2339	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	M	2297;2339;2339	ENSP00000386627:T2297M;ENSP00000264448:T2339M;ENSP00000366944:T2339M	ENSP00000264448:T2339M	T	+	2	0	ALMS1	73534181	0.714000	0.27936	0.954000	0.39281	0.973000	0.67179	2.153000	0.42282	2.809000	0.96659	0.655000	0.94253	ACG	.	.	none		0.448	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ZNF799	90576	hgsc.bcm.edu	37	19	12501466	12501466	+	Silent	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:12501466A>G	ENST00000430385.3	-	4	1946	c.1746T>C	c.(1744-1746)caT>caC	p.H582H	ZNF799_ENST00000419318.1_Silent_p.H550H|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	582					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TCTCTCCAGTATGAGTTTTTT	0.393																																					p.H582H		Atlas-SNP	.											ZNF799_ENST00000430385,NS,malignant_melanoma,0,2	ZNF799	111	2	0			c.T1746C						scavenged	.						74.0	78.0	76.0					19																	12501466		2202	4295	6497	SO:0001819	synonymous_variant	90576	exon4			TCCAGTATGAGTT	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1746T>C	19.37:g.12501466A>G		Somatic	174	2	0.0114943		WXS	Illumina HiSeq	Phase_I	232	4	0.0172414	NM_001080821		Silent	SNP	ENST00000430385.3	37	CCDS45989.1																																																																																			.	.	none		0.393	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
KIAA0226L	80183	hgsc.bcm.edu	37	13	46942917	46942917	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr13:46942917G>A	ENST00000429979.1	-	4	1173	c.569C>T	c.(568-570)tCg>tTg	p.S190L	KIAA0226L_ENST00000378797.2_Missense_Mutation_p.S190L|KIAA0226L_ENST00000389908.3_Missense_Mutation_p.S190L|KIAA0226L_ENST00000409879.2_Missense_Mutation_p.S33L|KIAA0226L_ENST00000378787.3_Missense_Mutation_p.S190L|KIAA0226L_ENST00000534925.1_Missense_Mutation_p.S55L|KIAA0226L_ENST00000322896.6_Missense_Mutation_p.S33L|KIAA0226L_ENST00000378781.3_Missense_Mutation_p.S190L|KIAA0226L_ENST00000378784.4_Missense_Mutation_p.S123L	NM_025113.2	NP_079389.2	Q9H714	K226L_HUMAN	KIAA0226-like	190										NS(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|pancreas(1)	26						GAAGGAATTCGAAGAAATGGT	0.343																																					p.S190L		Atlas-SNP	.											KIAA0226L,colon,carcinoma,+1,1	KIAA0226L	63	1	0			c.C569T						scavenged	.						126.0	130.0	129.0					13																	46942917		2203	4300	6503	SO:0001583	missense	80183	exon4			GAATTCGAAGAAA	AK025215	CCDS31970.2, CCDS66543.1, CCDS66544.1, CCDS66545.1, CCDS73569.1	13q14.11	2011-08-09	2011-08-09	2011-08-09	ENSG00000102445	ENSG00000102445			20420	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 18"""	C13orf18			Standard	NM_001286766		Approved	FLJ21562	uc010acl.3	Q9H714	OTTHUMG00000016868	ENST00000429979.1:c.569C>T	13.37:g.46942917G>A	ENSP00000396935:p.Ser190Leu	Somatic	61	4	0.0655738		WXS	Illumina HiSeq	Phase_I	74	7	0.0945946	NM_025113	A8KAG9|A8XR19|B3KS87|Q5W051|Q5W053|Q6PJ74|Q6PK94|Q86XH7|Q8N5J6	Missense_Mutation	SNP	ENST00000429979.1	37	CCDS31970.2	.	.	.	.	.	.	.	.	.	.	A	12.95	2.091798	0.36952	.	.	ENSG00000102445	ENST00000378781;ENST00000429979;ENST00000378797;ENST00000378784;ENST00000389908;ENST00000378787;ENST00000409879;ENST00000322896;ENST00000534925;ENST00000417405	T;T;T;T;T;T;T;T	0.39592	1.08;1.1;1.07;1.08;1.1;1.07;1.09;1.08	6.04	0.285	0.15705	.	0.778438	0.11238	N	0.584975	T	0.11495	0.0280	N	0.02011	-0.69	0.09310	N	0.999999	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.29088	-1.0023	10	0.02654	T	1	-0.8662	1.8635	0.03193	0.4786:0.2592:0.1439:0.1183	.	190;33;190;33;190;123;190	E7EMA2;B7ZBN5;Q9H714-1;B7Z6E4;Q9H714;Q9H714-3;Q9H714-4	.;.;.;.;K226L_HUMAN;.;.	L	190;190;190;123;190;190;33;33;55;55	ENSP00000368057:S190L;ENSP00000396935:S190L;ENSP00000368074:S190L;ENSP00000368061:S123L;ENSP00000374558:S190L;ENSP00000368064:S190L;ENSP00000437501:S55L;ENSP00000402357:S55L	ENSP00000315633:S33L	S	-	2	0	KIAA0226L	45840918	0.995000	0.38212	0.959000	0.39883	0.818000	0.46254	0.275000	0.18698	-0.099000	0.12263	-1.539000	0.00912	TCG	.	.	none		0.343	KIAA0226L-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044809.2	NM_025113	
CSMD1	64478	hgsc.bcm.edu	37	8	3141793	3141793	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:3141793G>A	ENST00000520002.1	-	27	4584	c.4029C>T	c.(4027-4029)gaC>gaT	p.D1343D	CSMD1_ENST00000537824.1_Silent_p.D1342D|CSMD1_ENST00000602723.1_Silent_p.D1343D|CSMD1_ENST00000400186.3_Silent_p.D1343D|CSMD1_ENST00000542608.1_Silent_p.D1342D|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602557.1_Silent_p.D1343D|CSMD1_ENST00000539096.1_Silent_p.D1342D			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1343	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCAGCAGGATGTCACTGTCCA	0.562											OREG0018505	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D1342D		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C4026T						PASS	.						99.0	107.0	104.0					8																	3141793		2131	4245	6376	SO:0001819	synonymous_variant	64478	exon26			CAGGATGTCACTG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4029C>T	8.37:g.3141793G>A		Somatic	51	0	0	608	WXS	Illumina HiSeq	Phase_I	64	22	0.34375	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	g	3.847	-0.032700	0.07543	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.12	4.25	0.50352	.	.	.	.	.	T	0.59074	0.2167	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56025	-0.8047	4	.	.	.	.	8.5228	0.33287	0.2323:0.0:0.7677:0.0	.	.	.	.	Y	823	.	.	H	-	1	0	CSMD1	3129200	0.999000	0.42202	0.879000	0.34478	0.348000	0.29142	0.833000	0.27504	1.165000	0.42670	-0.213000	0.12676	CAT	.	.	none		0.562	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
KCNQ3	3786	hgsc.bcm.edu	37	8	133186530	133186530	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:133186530C>T	ENST00000388996.4	-	6	1420	c.1000G>A	c.(1000-1002)Gcc>Acc	p.A334T	KCNQ3_ENST00000521134.1_Missense_Mutation_p.A214T|KCNQ3_ENST00000519445.1_Missense_Mutation_p.A334T	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	334					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GAAAAGGTGGCGGCAATCAGA	0.512																																					p.A334T		Atlas-SNP	.											.	KCNQ3	164	.	0			c.G1000A						PASS	.						125.0	82.0	96.0					8																	133186530		2166	4186	6352	SO:0001583	missense	3786	exon6			AGGTGGCGGCAAT	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1000G>A	8.37:g.133186530C>T	ENSP00000373648:p.Ala334Thr	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	150	45	0.3	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	C	36	5.679407	0.96774	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.98329	-4.87;-4.87;-4.87	4.96	4.96	0.65561	Ion transport (1);	0.055265	0.64402	D	0.000001	D	0.98232	0.9415	L	0.43757	1.38	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.69479	0.964;0.964	D	0.99859	1.1081	10	0.87932	D	0	-23.3549	17.5496	0.87872	0.0:1.0:0.0:0.0	.	334;334	E7ET42;O43525	.;KCNQ3_HUMAN	T	334;214;334;323;213	ENSP00000373648:A334T;ENSP00000429799:A214T;ENSP00000428790:A334T	ENSP00000373648:A334T	A	-	1	0	KCNQ3	133255712	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.814000	0.86154	2.446000	0.82766	0.563000	0.77884	GCC	.	.	none		0.512	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
ALDH9A1	223	hgsc.bcm.edu	37	1	165652258	165652258	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:165652258C>T	ENST00000354775.4	-	3	721	c.417G>A	c.(415-417)caG>caA	p.Q139Q	ALDH9A1_ENST00000538148.1_Silent_p.Q45Q|ALDH9A1_ENST00000461664.1_5'UTR	NM_000696.3	NP_000687.3	P49189	AL9A1_HUMAN	aldehyde dehydrogenase 9 family, member A1	115					carnitine biosynthetic process (GO:0045329)|cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|hormone metabolic process (GO:0042445)|kidney development (GO:0001822)|liver development (GO:0001889)|neurotransmitter biosynthetic process (GO:0042136)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	1-pyrroline dehydrogenase activity (GO:0033737)|3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|4-trimethylammoniobutyraldehyde dehydrogenase activity (GO:0047105)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|amine binding (GO:0043176)|aminobutyraldehyde dehydrogenase activity (GO:0019145)|NAD binding (GO:0051287)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	21	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					ACTCCAGGCACTGCCAGGAAA	0.512																																					p.Q139Q	Ovarian(179;1583 2014 18106 33801 42447)	Atlas-SNP	.											.	ALDH9A1	75	.	0			c.G417A						PASS	.						113.0	98.0	103.0					1																	165652258		2203	4300	6503	SO:0001819	synonymous_variant	223	exon3			CAGGCACTGCCAG	U34252	CCDS1250.2	1q22-q23	2008-02-05			ENSG00000143149	ENSG00000143149		"""Aldehyde dehydrogenases"""	412	protein-coding gene	gene with protein product		602733		ALDH7, ALDH4, ALDH9		8112751, 8786138	Standard	NM_000696		Approved	E3	uc001gdh.1	P49189	OTTHUMG00000034677	ENST00000354775.4:c.417G>A	1.37:g.165652258C>T		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	92	4	0.0434783	NM_000696	B2R6X1|B4DXY7|Q5VV90|Q6LCL1|Q9NZT7	Silent	SNP	ENST00000354775.4	37	CCDS1250.2																																																																																			.	.	none		0.512	ALDH9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083899.1		
NQO1	1728	hgsc.bcm.edu	37	16	69745172	69745172	+	Missense_Mutation	SNP	G	G	A	rs148539025	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:69745172G>A	ENST00000320623.5	-	6	1043	c.532C>T	c.(532-534)Cat>Tat	p.H178Y	NQO1_ENST00000561500.1_Missense_Mutation_p.H140Y|CTD-2033A16.1_ENST00000562696.1_RNA|NQO1_ENST00000439109.2_Missense_Mutation_p.H106Y|NQO1_ENST00000564043.1_Missense_Mutation_p.H157Y|snoU13_ENST00000459361.1_RNA|NQO1_ENST00000379047.3_Missense_Mutation_p.H144Y|NQO1_ENST00000379046.2_Missense_Mutation_p.H140Y	NM_000903.2	NP_000894.1	P15559	NQO1_HUMAN	NAD(P)H dehydrogenase, quinone 1	178					aging (GO:0007568)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cellular amino acid metabolic process (GO:0006521)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|NAD(P)H dehydrogenase (quinone) activity (GO:0003955)|poly(A) RNA binding (GO:0044822)|superoxide dismutase activity (GO:0004784)			autonomic_ganglia(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	10					Carboplatin(DB00958)|Cisplatin(DB00515)|Dicoumarol(DB00266)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|Menadione(DB00170)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	CCACAGAAATGCAGAATGCCA	0.458													G|||	3	0.000599042	0.0023	0.0	5008	,	,		21546	0.0		0.0	False		,,,				2504	0.0				p.H178Y		Atlas-SNP	.											.	NQO1	21	.	0			c.C532T						PASS	.	G	TYR/HIS,TYR/HIS,TYR/HIS	4,4392	8.1+/-20.4	0,4,2194	132.0	135.0	134.0		532,430,418	1.3	1.0	16	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	NQO1	NM_000903.2,NM_001025433.1,NM_001025434.1	83,83,83	0,5,6493	AA,AG,GG		0.0116,0.091,0.0385	benign,benign,benign	178/275,144/241,140/237	69745172	5,12991	2198	4300	6498	SO:0001583	missense	1728	exon6			AGAAATGCAGAAT	M81600	CCDS10883.1, CCDS32471.1, CCDS32472.1, CCDS67067.1	16q12-q22	2012-10-02	2001-11-30	2001-12-07	ENSG00000181019	ENSG00000181019	1.6.5.2		2874	protein-coding gene	gene with protein product		125860	"""diaphorase (NADH/NADPH) (cytochrome b-5 reductase)"""	NMOR1, DIA4		2843525	Standard	NM_001286137		Approved	DHQU, QR1, DTD	uc002exp.3	P15559	OTTHUMG00000137575	ENST00000320623.5:c.532C>T	16.37:g.69745172G>A	ENSP00000319788:p.His178Tyr	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	86	4	0.0465116	NM_000903	B2R5Y9|B4DNM7|B7ZAD1|Q86UK1	Missense_Mutation	SNP	ENST00000320623.5	37	CCDS10883.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.193510	0.38707	9.1E-4	1.16E-4	ENSG00000181019	ENST00000320623;ENST00000379047;ENST00000379046;ENST00000439109	T;T;T;T	0.10099	2.91;3.15;3.15;3.15	5.41	1.26	0.21427	Flavodoxin-like fold (1);	0.392618	0.30428	N	0.009659	T	0.05823	0.0152	N	0.16478	0.41	0.32949	D	0.51943	B;B;B;B	0.18610	0.005;0.029;0.006;0.028	B;B;B;B	0.23716	0.005;0.048;0.005;0.014	T	0.36040	-0.9764	10	0.12430	T	0.62	-2.5129	9.1805	0.37138	0.3053:0.0:0.6947:0.0	.	106;140;144;178	B4DLR8;B4DNM7;B7ZAD1;P15559	.;.;.;NQO1_HUMAN	Y	178;144;140;106	ENSP00000319788:H178Y;ENSP00000368335:H144Y;ENSP00000368334:H140Y;ENSP00000398330:H106Y	ENSP00000319788:H178Y	H	-	1	0	NQO1	68302673	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	1.942000	0.40243	0.355000	0.24131	0.655000	0.94253	CAT	G|1.000;A|0.000	0.000	weak		0.458	NQO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268956.2		
SCN1A	6323	hgsc.bcm.edu	37	2	166930113	166930113	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:166930113C>A	ENST00000303395.4	-	1	18	c.19G>T	c.(19-21)Gta>Tta	p.V7L	SCN1A_ENST00000375405.3_Missense_Mutation_p.V7L|SCN1A_ENST00000409050.1_Missense_Mutation_p.V7L|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.V7L			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	7					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.V7L(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCTGGTGGTACAAGCACTGTT	0.383																																					p.V7L		Atlas-SNP	.											SCN1A,NS,carcinoma,0,1	SCN1A	641	1	1	Substitution - Missense(1)	prostate(1)	c.G19T						scavenged	.						138.0	130.0	133.0					2																	166930113		2203	4300	6503	SO:0001583	missense	6323	exon1			GTGGTACAAGCAC	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.19G>T	2.37:g.166930113C>A	ENSP00000303540:p.Val7Leu	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	154	2	0.012987	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.632999	0.47049	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.95949	-3.86;-3.86;-3.81;-3.79	5.77	5.77	0.91146	.	0.000000	0.53938	D	0.000046	D	0.93933	0.8058	L	0.47016	1.485	0.40125	D	0.976641	B	0.24426	0.103	B	0.32342	0.144	D	0.90544	0.4504	10	0.22109	T	0.4	.	19.3504	0.94381	0.0:1.0:0.0:0.0	.	7	P35498-2	.	L	7	ENSP00000407030:V7L;ENSP00000303540:V7L;ENSP00000364554:V7L;ENSP00000386312:V7L	ENSP00000303540:V7L	V	-	1	0	SCN1A	166638359	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.130000	0.50508	2.885000	0.99019	0.655000	0.94253	GTA	.	.	none		0.383	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
MMP20	9313	hgsc.bcm.edu	37	11	102487591	102487591	+	Missense_Mutation	SNP	C	C	T	rs146053692	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:102487591C>T	ENST00000260228.2	-	2	338	c.326G>A	c.(325-327)cGc>cAc	p.R109H	RP11-817J15.2_ENST00000542119.1_RNA	NM_004771.3	NP_004762.2	Q9NPA2	MMP25_HUMAN	matrix metallopeptidase 20	107					hard palate development (GO:0060022)|inflammatory response (GO:0006954)|proteolysis (GO:0006508)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)	Marimastat(DB00786)	AGGGAAGAGGCGATAATTGGC	0.448													C|||	2	0.000399361	0.0	0.0029	5008	,	,		20154	0.0		0.0	False		,,,				2504	0.0				p.R109H		Atlas-SNP	.											MMP20,NS,carcinoma,-1,1	MMP20	52	1	0			c.G326A						scavenged	.						125.0	107.0	113.0					11																	102487591		2203	4299	6502	SO:0001583	missense	9313	exon2			AAGAGGCGATAAT	Y12779	CCDS8318.1	11q22.3	2008-05-22	2008-05-22			ENSG00000137674			7167	protein-coding gene	gene with protein product	"""enamelysin"""	604629	"""matrix metalloproteinase 20 (enamelysin)"""			9398237	Standard	NM_004771		Approved		uc001phc.3	O60882		ENST00000260228.2:c.326G>A	11.37:g.102487591C>T	ENSP00000260228:p.Arg109His	Somatic	211	0	0		WXS	Illumina HiSeq	Phase_I	324	6	0.0185185	NM_004771	D3DUA8|Q9H3Q0	Missense_Mutation	SNP	ENST00000260228.2	37	CCDS8318.1	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	C	11.57	1.677953	0.29783	.	.	ENSG00000137674	ENST00000260228	T	0.53640	0.61	5.09	5.09	0.68999	Metallopeptidase, catalytic domain (1);	0.111271	0.64402	D	0.000008	T	0.37461	0.1004	M	0.78801	2.425	0.09310	N	1	B	0.19935	0.04	B	0.09377	0.004	T	0.24584	-1.0156	10	0.32370	T	0.25	.	8.9325	0.35680	0.0:0.7688:0.1512:0.08	.	109	O60882	MMP20_HUMAN	H	109	ENSP00000260228:R109H	ENSP00000260228:R109H	R	-	2	0	MMP20	101992801	0.000000	0.05858	0.977000	0.42913	0.910000	0.53928	-0.237000	0.08990	2.804000	0.96469	0.655000	0.94253	CGC	C|0.999;T|0.001	0.001	strong		0.448	MMP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398012.1		
ZNF628	89887	hgsc.bcm.edu	37	19	55994387	55994387	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:55994387G>A	ENST00000598519.1	+	3	2380	c.1827G>A	c.(1825-1827)ctG>ctA	p.L609L	NAT14_ENST00000587400.1_5'Flank|NAT14_ENST00000591590.1_5'Flank|ZNF628_ENST00000391718.2_Silent_p.L605L|NAT14_ENST00000205194.4_5'Flank			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	609					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		CCTCCAACCTGCTGCTGCACC	0.697																																					p.L609L		Atlas-SNP	.											ZNF628_ENST00000391718,NS,carcinoma,+2,2	ZNF628	75	2	0			c.G1827A						scavenged	.						32.0	35.0	34.0					19																	55994387		2203	4297	6500	SO:0001819	synonymous_variant	89887	exon3			CAACCTGCTGCTG	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.1827G>A	19.37:g.55994387G>A		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	121	3	0.0247934	NM_033113	Q86X34	Silent	SNP	ENST00000598519.1	37	CCDS33116.3																																																																																			.	.	none		0.697	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
RAPGEF3	10411	hgsc.bcm.edu	37	12	48144895	48144895	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:48144895C>T	ENST00000449771.2	-	6	695	c.607G>A	c.(607-609)Gaa>Aaa	p.E203K	RAPGEF3_ENST00000389212.3_Missense_Mutation_p.E203K|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.E161K|RAPGEF3_ENST00000171000.4_Missense_Mutation_p.E161K|RAPGEF3_ENST00000548919.1_Missense_Mutation_p.E161K|RAPGEF3_ENST00000395358.3_Missense_Mutation_p.E203K|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.E161K|RAPGEF3_ENST00000549347.1_5'Flank			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	203					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		GCCACAGCTTCGGCCAACTCC	0.657																																					p.E203K		Atlas-SNP	.											.	RAPGEF3	98	.	0			c.G607A						PASS	.						22.0	23.0	23.0					12																	48144895		2201	4292	6493	SO:0001583	missense	10411	exon6			CAGCTTCGGCCAA	AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.607G>A	12.37:g.48144895C>T	ENSP00000395708:p.Glu203Lys	Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	184	42	0.228261	NM_001098531	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	37	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.952233	0.73787	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919;ENST00000395358;ENST00000466322	T;T;T;T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53;2.53;2.53;2.53	4.97	4.97	0.65823	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.28632	0.0709	L	0.41710	1.295	0.80722	D	1	D;D;D	0.89917	0.977;1.0;1.0	P;D;D	0.87578	0.611;0.998;0.996	T	0.01074	-1.1460	10	0.27082	T	0.32	.	17.1887	0.86873	0.0:1.0:0.0:0.0	.	215;203;203	B7Z5J6;O95398-2;O95398	.;.;RPGF3_HUMAN	K	161;203;161;161;161;203;215;161;203;161	ENSP00000384521:E161K;ENSP00000395708:E203K;ENSP00000448619:E161K;ENSP00000171000:E161K;ENSP00000373864:E203K;ENSP00000448480:E161K;ENSP00000378764:E203K;ENSP00000446731:E161K	ENSP00000171000:E161K	E	-	1	0	RAPGEF3	46431162	1.000000	0.71417	0.914000	0.36105	0.338000	0.28826	7.125000	0.77193	2.478000	0.83669	0.561000	0.74099	GAA	.	.	none		0.657	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	NM_006105	
OR5H1	26341	hgsc.bcm.edu	37	3	97851689	97851689	+	Missense_Mutation	SNP	T	T	C	rs201501927	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:97851689T>C	ENST00000354565.2	+	1	148	c.148T>C	c.(148-150)Tgg>Cgg	p.W50R	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W50R(4)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TGCTGTCATCTGGAAAGACCC	0.418																																					p.W50R		Atlas-SNP	.											OR5H1,NS,carcinoma,0,4	OR5H1	71	4	4	Substitution - Missense(4)	endometrium(2)|kidney(2)	c.T148C						scavenged	.						56.0	59.0	58.0					3																	97851689		2193	4271	6464	SO:0001583	missense	26341	exon1			GTCATCTGGAAAG	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.148T>C	3.37:g.97851689T>C	ENSP00000346575:p.Trp50Arg	Somatic	913	8	0.00876232		WXS	Illumina HiSeq	Phase_I	1097	15	0.0136737	NM_001005338		Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	T	5.108	0.205565	0.09704	.	.	ENSG00000231192	ENST00000354565	T	0.03801	3.8	3.63	2.42	0.29668	GPCR, rhodopsin-like superfamily (1);	0.983509	0.08277	N	0.970503	T	0.05135	0.0137	N	0.04162	-0.26	0.22435	N	0.999102	D	0.56968	0.978	P	0.55871	0.786	T	0.50145	-0.8862	10	0.24483	T	0.36	.	8.0198	0.30402	0.0:0.0:0.2075:0.7924	.	50	A6NKK0	OR5H1_HUMAN	R	50	ENSP00000346575:W50R	ENSP00000346575:W50R	W	+	1	0	OR5H1	99334379	0.000000	0.05858	0.978000	0.43139	0.160000	0.22226	-0.055000	0.11807	0.438000	0.26450	0.164000	0.16699	TGG	T|0.796;C|0.204	0.204	strong		0.418	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
MUC4	4585	hgsc.bcm.edu	37	3	195506482	195506482	+	Missense_Mutation	SNP	G	G	T	rs113936020	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195506482G>T	ENST00000463781.3	-	2	12428	c.11969C>A	c.(11968-11970)aCt>aAt	p.T3990N	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3990N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTCGGTGAC	0.592																																					p.T3990N		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,1	MUC4	1505	1	0			c.C11969A						scavenged	.						10.0	7.0	8.0					3																	195506482		623	1357	1980	SO:0001583	missense	4585	exon2			GAGGAAGTGTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11969C>A	3.37:g.195506482G>T	ENSP00000417498:p.Thr3990Asn	Somatic	7	1	0.142857		WXS	Illumina HiSeq	Phase_I	18	6	0.333333	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	0.405	-0.916416	0.02415	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.46	0.481	0.481	0.16809	.	0.562686	0.09843	U	0.748557	T	0.35913	0.0948	N	0.14661	0.345	0.09310	N	1	D	0.57257	0.979	D	0.68192	0.956	T	0.29852	-0.9998	9	.	.	.	.	6.8687	0.24108	1.0E-4:0.0:0.9999:0.0	.	3862	E7ESK3	.	N	3990	ENSP00000417498:T3990N;ENSP00000420243:T3990N	.	T	-	2	0	MUC4	196991261	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-0.001000	0.12947	0.537000	0.28751	0.064000	0.15345	ACT	.	.	weak		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
C6	729	hgsc.bcm.edu	37	5	41199992	41199992	+	Missense_Mutation	SNP	C	C	T	rs200213547		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:41199992C>T	ENST00000263413.3	-	4	587	c.323G>A	c.(322-324)cGt>cAt	p.R108H	C6_ENST00000337836.5_Missense_Mutation_p.R108H	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	108	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTGACTGGGACGCAAGACAGA	0.468													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16584	0.0		0.0	False		,,,				2504	0.0				p.R108H		Atlas-SNP	.											.	C6	197	.	0			c.G323A						PASS	.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	77.0	72.0	74.0		323,323	3.3	1.0	5		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	C6	NM_000065.2,NM_001115131.1	29,29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	108/935,108/935	41199992	2,13004	2203	4300	6503	SO:0001583	missense	729	exon4			CTGGGACGCAAGA	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.323G>A	5.37:g.41199992C>T	ENSP00000263413:p.Arg108His	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	144	64	0.444444	NM_001115131		Missense_Mutation	SNP	ENST00000263413.3	37	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	C	16.87	3.240753	0.58995	2.27E-4	1.16E-4	ENSG00000039537	ENST00000337836;ENST00000263413;ENST00000417809	T;T;T	0.54279	0.58;0.58;0.58	6.02	3.34	0.38264	.	0.153716	0.56097	D	0.000026	T	0.54615	0.1869	M	0.83312	2.635	0.46849	D	0.99922	B	0.30281	0.275	B	0.31245	0.126	T	0.54964	-0.8214	10	0.66056	D	0.02	-6.8361	9.4574	0.38762	0.0:0.7151:0.0:0.2849	.	108	P13671	CO6_HUMAN	H	108	ENSP00000338861:R108H;ENSP00000263413:R108H;ENSP00000396565:R108H	ENSP00000263413:R108H	R	-	2	0	C6	41235749	0.445000	0.25657	0.999000	0.59377	0.907000	0.53573	0.370000	0.20433	0.460000	0.27045	0.650000	0.86243	CGT	.	.	weak		0.468	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
WFDC9	259240	hgsc.bcm.edu	37	20	44238795	44238795	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:44238795A>G	ENST00000326000.1	-	3	243	c.26T>C	c.(25-27)gTc>gCc	p.V9A		NM_147198.3	NP_671731.1	Q8NEX5	WFDC9_HUMAN	WAP four-disulfide core domain 9	9						extracellular region (GO:0005576)				breast(1)|large_intestine(1)|liver(1)|lung(1)|prostate(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				GATGAACATGACGAGTAGAAG	0.498																																					p.V9A		Atlas-SNP	.											.	WFDC9	10	.	0			c.T26C						PASS	.						141.0	123.0	129.0					20																	44238795		2203	4300	6503	SO:0001583	missense	259240	exon3			AACATGACGAGTA	AL031671	CCDS13362.1	20q13.12	2013-01-21			ENSG00000180205	ENSG00000180205		"""WAP four-disulfide core domain containing"""	20380	protein-coding gene	gene with protein product						12206714	Standard	NM_147198		Approved	WAP9, dJ688G8.2	uc002xoy.3	Q8NEX5	OTTHUMG00000046332	ENST00000326000.1:c.26T>C	20.37:g.44238795A>G	ENSP00000320532:p.Val9Ala	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	120	54	0.45	NM_147198	Q3MIX6|Q5TGZ8	Missense_Mutation	SNP	ENST00000326000.1	37	CCDS13362.1	.	.	.	.	.	.	.	.	.	.	A	9.066	0.995806	0.19043	.	.	ENSG00000180205	ENST00000326000	T	0.36157	1.27	3.71	-1.07	0.09968	.	0.959088	0.08545	N	0.929885	T	0.17789	0.0427	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.26224	-1.0109	9	0.27785	T	0.31	.	0.372	0.00381	0.4004:0.1899:0.2258:0.184	.	9	Q8NEX5	WFDC9_HUMAN	A	9	ENSP00000320532:V9A	ENSP00000320532:V9A	V	-	2	0	WFDC9	43672209	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.580000	0.05827	-0.234000	0.09782	-0.280000	0.10049	GTC	.	.	none		0.498	WFDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106945.1		
SLC5A5	6528	hgsc.bcm.edu	37	19	17992828	17992828	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:17992828C>T	ENST00000222248.3	+	9	1465	c.1118C>T	c.(1117-1119)cCt>cTt	p.P373L		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	373					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CTCATCAAACCTCGGCTGCGG	0.597																																					p.P373L	Melanoma(65;1008 1708 7910 46650)	Atlas-SNP	.											SLC5A5,rectum,carcinoma,-1,1	SLC5A5	67	1	0			c.C1118T						scavenged	.						91.0	86.0	88.0					19																	17992828		2203	4300	6503	SO:0001583	missense	6528	exon9			TCAAACCTCGGCT		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1118C>T	19.37:g.17992828C>T	ENSP00000222248:p.Pro373Leu	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	166	2	0.0120482	NM_000453	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013763	0.54468	.	.	ENSG00000105641	ENST00000222248	D	0.87256	-2.23	4.36	4.36	0.52297	.	0.057597	0.64402	D	0.000001	D	0.94591	0.8257	H	0.94385	3.53	0.80722	D	1	D	0.59357	0.985	D	0.64144	0.922	D	0.95812	0.8842	10	0.72032	D	0.01	.	14.4234	0.67200	0.0:1.0:0.0:0.0	.	373	Q92911	SC5A5_HUMAN	L	373	ENSP00000222248:P373L	ENSP00000222248:P373L	P	+	2	0	SLC5A5	17853828	1.000000	0.71417	0.911000	0.35937	0.034000	0.12701	5.530000	0.67141	2.277000	0.76020	0.561000	0.74099	CCT	.	.	none		0.597	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
CES3	23491	hgsc.bcm.edu	37	16	67005096	67005096	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:67005096C>T	ENST00000303334.4	+	10	1236	c.1165C>T	c.(1165-1167)Ccc>Tcc	p.P389S	CES3_ENST00000543856.1_Missense_Mutation_p.P28S|CES3_ENST00000394037.1_Missense_Mutation_p.P389S	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	389						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)	p.P389A(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		TGAGATGATGCCCACCGTCAT	0.562																																					p.P389S		Atlas-SNP	.											CES3,NS,carcinoma,0,1	CES3	56	1	1	Substitution - Missense(1)	kidney(1)	c.C1165T						scavenged	.						93.0	76.0	82.0					16																	67005096		2200	4300	6500	SO:0001583	missense	23491	exon10			ATGATGCCCACCG	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.1165C>T	16.37:g.67005096C>T	ENSP00000304782:p.Pro389Ser	Somatic	114	2	0.0175439		WXS	Illumina HiSeq	Phase_I	76	2	0.0263158	NM_024922	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	ENST00000303334.4	37	CCDS10826.1	.	.	.	.	.	.	.	.	.	.	C	5.113	0.206531	0.09704	.	.	ENSG00000172828	ENST00000303334;ENST00000394037;ENST00000543856	T;T;T	0.66099	-0.19;-0.19;-0.19	4.44	-4.44	0.03557	Carboxylesterase, type B (1);	1.930530	0.02886	N	0.133453	T	0.50069	0.1594	L	0.39397	1.21	0.09310	N	1	B;B	0.28512	0.214;0.003	B;B	0.24701	0.055;0.01	T	0.41592	-0.9500	10	0.54805	T	0.06	.	6.8381	0.23947	0.0:0.4035:0.3818:0.2147	.	28;389	F5H242;Q6UWW8	.;EST3_HUMAN	S	389;389;28	ENSP00000304782:P389S;ENSP00000377602:P389S;ENSP00000445559:P28S	ENSP00000304782:P389S	P	+	1	0	CES3	65562597	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.738000	0.04871	-1.160000	0.02804	-0.230000	0.12252	CCC	.	.	none		0.562	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	NM_024922	
ZNF880	400713	hgsc.bcm.edu	37	19	52888050	52888050	+	Missense_Mutation	SNP	A	A	G	rs76053634	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:52888050A>G	ENST00000422689.2	+	4	1232	c.1217A>G	c.(1216-1218)cAa>cGa	p.Q406R		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	406					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						ACGGGAGAGCAACCTTACAAA	0.398																																					p.Q406R		Atlas-SNP	.											ZNF880,colon,carcinoma,0,2	ZNF880	45	2	0			c.A1217G						scavenged	.						70.0	64.0	66.0					19																	52888050		1568	3582	5150	SO:0001583	missense	400713	exon4			GAGAGCAACCTTA	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1217A>G	19.37:g.52888050A>G	ENSP00000406318:p.Gln406Arg	Somatic	33	6	0.181818		WXS	Illumina HiSeq	Phase_I	38	13	0.342105	NM_001145434	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	A	4.567	0.105370	0.08731	.	.	ENSG00000221923	ENST00000422689	T	0.15718	2.4	1.84	1.84	0.25277	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04182	0.0116	N	0.00392	-1.555	0.19775	N	0.999952	B	0.17667	0.023	B	0.23150	0.044	T	0.43360	-0.9396	8	.	.	.	.	8.4442	0.32833	1.0:0.0:0.0:0.0	.	406	Q6PDB4	ZN880_HUMAN	R	406	ENSP00000406318:Q406R	.	Q	+	2	0	ZNF880	57579862	0.002000	0.14202	0.418000	0.26571	0.177000	0.22998	0.149000	0.16243	0.834000	0.34852	0.450000	0.29827	CAA	A|0.867;G|0.133	0.133	strong		0.398	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
SRRM1	10250	hgsc.bcm.edu	37	1	24993374	24993374	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:24993374C>A	ENST00000323848.9	+	13	2012	c.1697C>A	c.(1696-1698)cCt>cAt	p.P566H	SRRM1_ENST00000374389.4_Missense_Mutation_p.P575H|SRRM1_ENST00000479034.1_3'UTR|snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000537199.1_3'UTR|SRRM1_ENST00000447431.2_Missense_Mutation_p.P578H	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	566	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.P566H(2)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CCCGCCCCTCCTCCTCGACGG	0.542																																					p.P566H	Ovarian(68;897 1494 3282 17478)	Atlas-SNP	.											SRRM1,bladder,carcinoma,0,2	SRRM1	81	2	2	Substitution - Missense(2)	urinary_tract(1)|central_nervous_system(1)	c.C1697A						scavenged	.						53.0	45.0	48.0					1																	24993374		2203	4300	6503	SO:0001583	missense	10250	exon13			CCCCTCCTCCTCG	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1697C>A	1.37:g.24993374C>A	ENSP00000326261:p.Pro566His	Somatic	170	1	0.00588235		WXS	Illumina HiSeq	Phase_I	238	5	0.0210084	NM_005839	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173271	0.78452	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.56776	0.44;0.65;0.71	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000007	T	0.70613	0.3244	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.68074	-0.5505	10	0.42905	T	0.14	-3.0627	19.3453	0.94361	0.0:1.0:0.0:0.0	.	578;566	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	H	566;578;575	ENSP00000326261:P566H;ENSP00000391430:P578H;ENSP00000363510:P575H	ENSP00000326261:P566H	P	+	2	0	SRRM1	24865961	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.865000	0.62998	2.654000	0.90174	0.650000	0.86243	CCT	.	.	none		0.542	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
CUL1	8454	hgsc.bcm.edu	37	7	148486911	148486911	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:148486911C>T	ENST00000325222.4	+	15	1946	c.1667C>T	c.(1666-1668)cCg>cTg	p.P556L	CUL1_ENST00000409469.1_Missense_Mutation_p.P556L|CUL1_ENST00000602748.1_Missense_Mutation_p.P556L	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	556					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TTTGCCTTGCCGTCAGAGGTA	0.572																																					p.P556L		Atlas-SNP	.											CUL1,NS,carcinoma,0,1	CUL1	80	1	0			c.C1667T						scavenged	.						147.0	142.0	144.0					7																	148486911		2203	4300	6503	SO:0001583	missense	8454	exon15			CCTTGCCGTCAGA	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1667C>T	7.37:g.148486911C>T	ENSP00000326804:p.Pro556Leu	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	138	3	0.0217391	NM_003592	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	37	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757262	0.69648	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	D;D	0.93547	-3.24;-3.24	5.08	5.08	0.68730	Cullin, N-terminal (1);Cullin homology (3);	0.108726	0.64402	D	0.000005	D	0.98169	0.9395	H	0.97962	4.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99824	1.1049	10	0.87932	D	0	-15.6332	18.4804	0.90809	0.0:1.0:0.0:0.0	.	483;556	E7EWR0;Q13616	.;CUL1_HUMAN	L	556;556;514;483	ENSP00000387160:P556L;ENSP00000326804:P556L	ENSP00000326804:P556L	P	+	2	0	CUL1	148117844	1.000000	0.71417	0.940000	0.37924	0.155000	0.21991	7.354000	0.79424	2.359000	0.80004	0.591000	0.81541	CCG	.	.	none		0.572	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
RYR2	6262	hgsc.bcm.edu	37	1	237777420	237777420	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:237777420C>T	ENST00000366574.2	+	37	5309	c.4992C>T	c.(4990-4992)gtC>gtT	p.V1664V	RYR2_ENST00000360064.6_Silent_p.V1662V|RYR2_ENST00000542537.1_Silent_p.V1648V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1664	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACTCAGCCGTCTGTGCTCTTG	0.517																																					p.V1664V		Atlas-SNP	.											RYR2,NS,carcinoma,+2,1	RYR2	1273	1	0			c.C4992T						scavenged	.						64.0	65.0	65.0					1																	237777420		2027	4197	6224	SO:0001819	synonymous_variant	6262	exon37			AGCCGTCTGTGCT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4992C>T	1.37:g.237777420C>T		Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	114	2	0.0175439	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																			.	.	none		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
RPS15	6209	hgsc.bcm.edu	37	19	1440068	1440068	+	Missense_Mutation	SNP	G	G	C	rs201657403		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:1440068G>C	ENST00000586686.2	+	3	179	c.140G>C	c.(139-141)cGg>cCg	p.R47P	RPS15_ENST00000591804.2_Missense_Mutation_p.R14P|RPS15_ENST00000589656.2_Missense_Mutation_p.R47P|AC027307.3_ENST00000594262.1_5'Flank|RPS15_ENST00000593052.1_Missense_Mutation_p.R54P|RPS15_ENST00000585665.1_Missense_Mutation_p.R14P|RPS15_ENST00000591032.1_Missense_Mutation_p.R14P|RPS15_ENST00000586096.2_Missense_Mutation_p.R47P|RPS15_ENST00000233609.4_Missense_Mutation_p.R20P			P62841	RS15_HUMAN	ribosomal protein S15	47					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|osteoblast differentiation (GO:0001649)|ribosomal small subunit biogenesis (GO:0042274)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.R47P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCTGAACCGGGGCCTGCGG	0.687																																					p.R47P	Ovarian(170;79 2680 5719 44260)	Atlas-SNP	.											RPS15,extremity,malignant_melanoma,0,1	RPS15	11	1	1	Substitution - Missense(1)	skin(1)	c.G140C						scavenged	.						3.0	5.0	4.0					19																	1440068		2019	3993	6012	SO:0001583	missense	6209	exon3			TGAACCGGGGCCT		CCDS12067.1	19p13.3	2012-12-20			ENSG00000115268	ENSG00000115268		"""S ribosomal proteins"""	10388	protein-coding gene	gene with protein product	"""40S ribosomal protein S15"", ""homolog of rat insulinoma"", ""insulinoma protein"""	180535				2159154	Standard	NM_001018		Approved	RIG, MGC111130, S15	uc002lsp.1	P62841	OTTHUMG00000140099	ENST00000586686.2:c.140G>C	19.37:g.1440068G>C	ENSP00000467676:p.Arg47Pro	Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	41	5	0.121951	NM_001018	A5D8V9|P11174|Q3KRA1|Q9UDC2	Missense_Mutation	SNP	ENST00000586686.2	37	CCDS12067.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.516509	0.27123	.	.	ENSG00000115268	ENST00000233609	.	.	.	4.26	3.21	0.36854	Ribosomal protein S19, superfamily (2);	0.000000	0.64402	U	0.000002	T	0.79452	0.4448	H	0.96489	3.83	0.80722	D	1	B	0.17465	0.022	B	0.26310	0.068	T	0.78595	-0.2143	9	0.51188	T	0.08	-26.4524	11.4241	0.50001	0.0902:0.0:0.9098:0.0	.	47	P62841	RS15_HUMAN	P	47	.	ENSP00000233609:R47P	R	+	2	0	RPS15	1391068	1.000000	0.71417	0.710000	0.30468	0.007000	0.05969	9.198000	0.94994	0.908000	0.36671	-0.192000	0.12808	CGG	G|0.442;C|0.558	0.558	strong		0.687	RPS15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449609.4	NM_001018	
PCDHA7	56141	hgsc.bcm.edu	37	5	140215022	140215022	+	Missense_Mutation	SNP	C	C	A	rs150063888		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:140215022C>A	ENST00000525929.1	+	1	1054	c.1054C>A	c.(1054-1056)Ctc>Atc	p.L352I	PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.L352I|PCDHA6_ENST00000527624.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	352	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L352F(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGTTGACTCTCACTTCCCT	0.507																																					p.L352I	NSCLC(160;258 2013 5070 22440 28951)	Atlas-SNP	.											PCDHA7,shoulder,malignant_melanoma,0,1	PCDHA7	367	1	1	Substitution - Missense(1)	skin(1)	c.C1054A						scavenged	.						181.0	157.0	165.0					5																	140215022		2203	4299	6502	SO:0001583	missense	56141	exon1			TTGACTCTCACTT	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1054C>A	5.37:g.140215022C>A	ENSP00000436426:p.Leu352Ile	Somatic	355	4	0.0112676		WXS	Illumina HiSeq	Phase_I	389	8	0.0205656	NM_031852	O75282	Missense_Mutation	SNP	ENST00000525929.1	37	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	C	0.413	-0.912035	0.02415	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.61274	0.12;0.26	4.04	-1.41	0.08941	Cadherin (2);Cadherin-like (1);	0.343115	0.15286	N	0.270413	T	0.21347	0.0514	N	0.03268	-0.37	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.001	T	0.19877	-1.0292	10	0.05833	T	0.94	.	2.2003	0.03921	0.3512:0.1209:0.4122:0.1158	.	352;352	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	I	352	ENSP00000436426:L352I;ENSP00000367365:L352I	ENSP00000367365:L352I	L	+	1	0	PCDHA7	140195206	0.000000	0.05858	0.000000	0.03702	0.882000	0.50991	-3.197000	0.00562	-0.656000	0.05380	0.305000	0.20034	CTC	.	.	alt		0.507	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
JAG1	182	hgsc.bcm.edu	37	20	10639293	10639293	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:10639293T>C	ENST00000254958.5	-	4	1032	c.517A>G	c.(517-519)Aac>Gac	p.N173D	JAG1_ENST00000423891.2_Missense_Mutation_p.N14D	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	173					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						ACGCCCGTGTTCTGCTTCAGC	0.502									Alagille Syndrome																												p.N173D		Atlas-SNP	.											JAG1_ENST00000254958,NS,carcinoma,+2,2	JAG1	213	2	0			c.A517G						scavenged	.						129.0	115.0	120.0					20																	10639293		2203	4300	6503	SO:0001583	missense	182	exon4	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	CCGTGTTCTGCTT	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.517A>G	20.37:g.10639293T>C	ENSP00000254958:p.Asn173Asp	Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	190	2	0.0105263	NM_000214	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	ENST00000254958.5	37	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.666539	0.47677	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.95949	-3.86;-3.86	5.36	5.36	0.76844	Delta/Serrate/lag-2 (DSL) protein (2);	0.000000	0.85682	D	0.000000	D	0.95043	0.8395	M	0.76574	2.34	0.47065	D	0.999303	B	0.20887	0.049	B	0.29440	0.102	D	0.93192	0.6584	10	0.44086	T	0.13	.	15.3473	0.74350	0.0:0.0:0.0:1.0	.	173	P78504	JAG1_HUMAN	D	173;14	ENSP00000254958:N173D;ENSP00000389519:N14D	ENSP00000254958:N173D	N	-	1	0	JAG1	10587293	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	6.277000	0.72608	2.036000	0.60181	0.421000	0.28195	AAC	.	.	none		0.502	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
SUPT6H	6830	hgsc.bcm.edu	37	17	27010108	27010108	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:27010108A>G	ENST00000314616.6	+	15	2159	c.1876A>G	c.(1876-1878)Aag>Gag	p.K626E	SUPT6H_ENST00000347486.4_Missense_Mutation_p.K626E	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	626	Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GAAAGGTAGAAAGGTGAGCTG	0.512																																					p.K626E		Atlas-SNP	.											.	SUPT6H	165	.	0			c.A1876G						PASS	.						28.0	26.0	26.0					17																	27010108		2203	4300	6503	SO:0001583	missense	6830	exon15			GGTAGAAAGGTGA	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.1876A>G	17.37:g.27010108A>G	ENSP00000319104:p.Lys626Glu	Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	70	31	0.442857	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.167849	0.38315	.	.	ENSG00000109111	ENST00000314616	T	0.39997	1.05	5.95	5.95	0.96441	Tex-like domain (1);	0.000000	0.85682	D	0.000000	T	0.36826	0.0981	L	0.55481	1.735	0.58432	D	0.999999	B	0.33103	0.397	B	0.28011	0.085	T	0.18053	-1.0349	10	0.33940	T	0.23	-27.6642	12.212	0.54386	0.9322:0.0:0.0678:0.0	.	626	Q7KZ85	SPT6H_HUMAN	E	626	ENSP00000319104:K626E	ENSP00000319104:K626E	K	+	1	0	SUPT6H	24034235	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.068000	0.76748	2.279000	0.76181	0.533000	0.62120	AAG	.	.	none		0.512	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
ARMC4	55130	hgsc.bcm.edu	37	10	28250635	28250635	+	Silent	SNP	A	A	C	rs202113129	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:28250635A>C	ENST00000305242.5	-	10	1340	c.1248T>G	c.(1246-1248)gcT>gcG	p.A416A	ARMC4_ENST00000480504.1_5'UTR|ARMC4_ENST00000537576.1_Silent_p.A108A|ARMC4_ENST00000239715.3_Silent_p.A273A|ARMC4_ENST00000545014.1_5'UTR	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	416					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						CAATCTTTTCAGCACTCTTCC	0.453																																					p.A416A		Atlas-SNP	.											ARMC4,NS,carcinoma,0,1	ARMC4	177	1	0			c.T1248G						scavenged	.						65.0	58.0	61.0					10																	28250635		2203	4297	6500	SO:0001819	synonymous_variant	55130	exon10			CTTTTCAGCACTC	AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1248T>G	10.37:g.28250635A>C		Somatic	139	2	0.0143885		WXS	Illumina HiSeq	Phase_I	155	12	0.0774194	NM_018076	A8K906|B7Z7I1|Q9H0C0	Silent	SNP	ENST00000305242.5	37	CCDS7157.1																																																																																			.	.	weak		0.453	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076	
AFM	173	hgsc.bcm.edu	37	4	74361142	74361142	+	Missense_Mutation	SNP	G	G	A	rs41265665	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:74361142G>A	ENST00000226355.3	+	9	1277	c.1184G>A	c.(1183-1185)cGt>cAt	p.R395H		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	395	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.		R -> H (in dbSNP:rs41265665).		vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGTTGTTACCGTTACGCGGTA	0.388													G|||	190	0.0379393	0.0598	0.0274	5008	,	,		17837	0.0109		0.0258	False		,,,				2504	0.0562				p.R395H		Atlas-SNP	.											.	AFM	101	.	0			c.G1184A						PASS	.	G	HIS/ARG	274,4130	151.0+/-185.0	5,264,1933	64.0	71.0	68.0		1184	2.3	0.0	4	dbSNP_127	68	216,8384	89.4+/-151.6	4,208,4088	yes	missense	AFM	NM_001133.2	29	9,472,6021	AA,AG,GG		2.5116,6.2216,3.7681	benign	395/600	74361142	490,12514	2202	4300	6502	SO:0001583	missense	173	exon9			GTTACCGTTACGC	L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.1184G>A	4.37:g.74361142G>A	ENSP00000226355:p.Arg395His	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	26	18	0.692308	NM_001133	A8K3E1|Q32MR3|Q4W5C5	Missense_Mutation	SNP	ENST00000226355.3	37	CCDS3557.1	53	0.024267399267399268	20	0.04065040650406504	13	0.03591160220994475	3	0.005244755244755245	17	0.022427440633245383	G	10.23	1.292088	0.23564	0.062216	0.025116	ENSG00000079557	ENST00000226355	T	0.73575	-0.76	4.01	2.27	0.28462	Serum albumin, conserved site (1);Serum albumin-like (1);Serum albumin, N-terminal (2);	0.889220	0.09793	N	0.755068	T	0.20618	0.0496	L	0.57536	1.79	0.09310	N	1	B	0.19073	0.033	B	0.12156	0.007	T	0.36359	-0.9751	10	0.39692	T	0.17	.	6.2778	0.20991	0.2273:0.0:0.7727:0.0	rs41265665;rs61747692	395	P43652	AFAM_HUMAN	H	395	ENSP00000226355:R395H	ENSP00000226355:R395H	R	+	2	0	AFM	74580006	0.000000	0.05858	0.002000	0.10522	0.209000	0.24338	-0.543000	0.06084	0.475000	0.27415	0.650000	0.86243	CGT	G|0.966;A|0.034	0.034	strong		0.388	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252275.2		
P2RX3	5024	hgsc.bcm.edu	37	11	57106058	57106058	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:57106058A>G	ENST00000263314.2	+	1	68	c.34A>G	c.(34-36)Acc>Gcc	p.T12A	P2RX3_ENST00000533436.1_3'UTR|SSRP1_ENST00000278412.2_5'Flank	NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	12					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)			endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						CACCTATGAGACCACCAAGTC	0.542																																					p.T12A		Atlas-SNP	.											P2RX3,NS,carcinoma,-2,1	P2RX3	55	1	0			c.A34G						scavenged	.						257.0	232.0	241.0					11																	57106058		2201	4296	6497	SO:0001583	missense	5024	exon1			TATGAGACCACCA	Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.34A>G	11.37:g.57106058A>G	ENSP00000263314:p.Thr12Ala	Somatic	218	1	0.00458716		WXS	Illumina HiSeq	Phase_I	336	8	0.0238095	NM_002559	Q6DK37|Q9UQB6	Missense_Mutation	SNP	ENST00000263314.2	37	CCDS7953.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.535914	0.85812	.	.	ENSG00000109991	ENST00000439993;ENST00000263314	T	0.10668	2.85	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.39733	0.1089	M	0.90252	3.1	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.47548	-0.9109	10	0.87932	D	0	-39.1614	13.174	0.59615	1.0:0.0:0.0:0.0	.	12	P56373	P2RX3_HUMAN	A	12	ENSP00000263314:T12A	ENSP00000263314:T12A	T	+	1	0	P2RX3	56862634	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.091000	0.89528	2.137000	0.66172	0.533000	0.62120	ACC	.	.	none		0.542	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392465.1	NM_002559	
GPRIN3	285513	hgsc.bcm.edu	37	4	90170368	90170368	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:90170368G>A	ENST00000609438.1	-	2	1412	c.894C>T	c.(892-894)gcC>gcT	p.A298A	GPRIN3_ENST00000333209.4_Silent_p.A298A	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	298										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TCATCGTACTGGCTTCTTTGA	0.567																																					p.A298A		Atlas-SNP	.											.	GPRIN3	90	.	0			c.C894T						PASS	.						117.0	116.0	116.0					4																	90170368		2203	4300	6503	SO:0001819	synonymous_variant	285513	exon2			CGTACTGGCTTCT	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.894C>T	4.37:g.90170368G>A		Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	115	5	0.0434783	NM_198281	Q8IVE4	Silent	SNP	ENST00000609438.1	37	CCDS34030.1																																																																																			.	.	none		0.567	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281	
H2AFY2	55506	hgsc.bcm.edu	37	10	71835546	71835546	+	Silent	SNP	C	C	T	rs373125930		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:71835546C>T	ENST00000373255.4	+	2	396	c.132C>T	c.(130-132)ggC>ggT	p.G44G		NM_018649.2	NP_061119.1	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	44	Histone H2A.				brain development (GO:0007420)|chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(4)|skin(1)	15						TCAGCGTGGGCGCCCCTGTCT	0.602																																					p.G44G		Atlas-SNP	.											.	H2AFY2	30	.	0			c.C132T						PASS	.	C		1,4405	2.1+/-5.4	0,1,2202	120.0	95.0	103.0		132	-11.8	0.0	10		103	0,8600		0,0,4300	no	coding-synonymous	H2AFY2	NM_018649.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		44/373	71835546	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55506	exon2			CGTGGGCGCCCCT	AF336304	CCDS7296.1	10q22.1	2011-01-27			ENSG00000099284	ENSG00000099284		"""Histones / Replication-independent"""	14453	protein-coding gene	gene with protein product						11331621, 11262398	Standard	NM_018649		Approved	macroH2A2	uc001jqm.3	Q9P0M6	OTTHUMG00000018396	ENST00000373255.4:c.132C>T	10.37:g.71835546C>T		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	162	73	0.450617	NM_018649	Q5SQT2	Silent	SNP	ENST00000373255.4	37	CCDS7296.1																																																																																			.	.	none		0.602	H2AFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048480.2	NM_018649	
ORC1	4998	hgsc.bcm.edu	37	1	52838903	52838903	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:52838903G>A	ENST00000371568.3	-	17	2754	c.2536C>T	c.(2536-2538)Cgg>Tgg	p.R846W	ORC1_ENST00000371566.1_Missense_Mutation_p.R846W	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	846	Necessary and sufficient for ORC complex assembly.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						ACGTTGAGCCGCACCCGAAGG	0.552																																					p.R846W		Atlas-SNP	.											.	ORC1	79	.	0			c.C2536T						PASS	.						102.0	107.0	105.0					1																	52838903		2203	4300	6503	SO:0001583	missense	4998	exon17			TGAGCCGCACCCG		CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.2536C>T	1.37:g.52838903G>A	ENSP00000360623:p.Arg846Trp	Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	148	61	0.412162	NM_004153	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	ENST00000371568.3	37	CCDS566.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527904	0.44969	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.46819	0.86;0.86	5.25	2.27	0.28462	CDC6, C-terminal (1);	0.115966	0.56097	D	0.000023	T	0.64505	0.2604	M	0.78637	2.42	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.63537	-0.6615	10	0.87932	D	0	-16.4175	8.0772	0.30722	0.0714:0.0:0.5136:0.415	.	841;846	B7Z8H0;Q13415	.;ORC1_HUMAN	W	846	ENSP00000360623:R846W;ENSP00000360621:R846W	ENSP00000360621:R846W	R	-	1	2	ORC1	52611491	1.000000	0.71417	0.994000	0.49952	0.007000	0.05969	4.294000	0.59043	0.318000	0.23185	-0.142000	0.14014	CGG	.	.	none		0.552	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1	NM_004153	
ANO7	50636	hgsc.bcm.edu	37	2	242149776	242149776	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:242149776T>C	ENST00000274979.8	+	14	1691	c.1588T>C	c.(1588-1590)Tcc>Ccc	p.S530P	ANO7_ENST00000402430.3_Missense_Mutation_p.S529P	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	530					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						CATCGTGGTGTCCAGGTCGGG	0.677																																					p.S530P		Atlas-SNP	.											ANO7,leg,malignant_melanoma,-2,2	ANO7	136	2	0			c.T1588C						scavenged	.						111.0	87.0	95.0					2																	242149776		2203	4300	6503	SO:0001583	missense	50636	exon14			GTGGTGTCCAGGT	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1588T>C	2.37:g.242149776T>C	ENSP00000274979:p.Ser530Pro	Somatic	159	3	0.0188679		WXS	Illumina HiSeq	Phase_I	191	4	0.0209424	NM_001001891	Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	T	15.03	2.713452	0.48517	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.64991	-0.13;-0.13	3.38	2.14	0.27477	.	1.041020	0.07546	N	0.914725	T	0.79299	0.4422	M	0.87381	2.88	0.28193	N	0.927667	D	0.69078	0.997	D	0.68621	0.959	T	0.61461	-0.7058	10	0.36615	T	0.2	.	8.4519	0.32875	0.0:0.0:0.198:0.802	.	530	Q6IWH7	ANO7_HUMAN	P	530;529	ENSP00000274979:S530P;ENSP00000385418:S529P	ENSP00000274979:S530P	S	+	1	0	ANO7	241798449	0.998000	0.40836	0.502000	0.27614	0.704000	0.40688	2.212000	0.42835	0.175000	0.19841	0.260000	0.18958	TCC	.	.	none		0.677	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
MED12L	116931	hgsc.bcm.edu	37	3	150881802	150881802	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:150881802G>A	ENST00000474524.1	+	8	1268	c.1230G>A	c.(1228-1230)ccG>ccA	p.P410P	MED12L_ENST00000422248.2_Silent_p.P410P|MED12L_ENST00000309237.4_Silent_p.P410P|MED12L_ENST00000273432.4_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	410						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCCCCATGCCGGGTGGGAACA	0.522																																					p.P410P		Atlas-SNP	.											MED12L,NS,carcinoma,+1,1	MED12L	271	1	0			c.G1230A						scavenged	.						53.0	53.0	53.0					3																	150881802		2203	4300	6503	SO:0001819	synonymous_variant	116931	exon8			CATGCCGGGTGGG	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.1230G>A	3.37:g.150881802G>A		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	134	2	0.0149254	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	37	CCDS33876.1																																																																																			.	.	none		0.522	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
COL22A1	169044	hgsc.bcm.edu	37	8	139833539	139833539	+	Missense_Mutation	SNP	C	C	T	rs146329974		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:139833539C>T	ENST00000303045.6	-	7	1531	c.1085G>A	c.(1084-1086)cGg>cAg	p.R362Q	COL22A1_ENST00000435777.1_Missense_Mutation_p.R362Q	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	362	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTGCCAGTCCCGGTCAAAGAG	0.567										HNSCC(7;0.00092)			C|||	1	0.000199681	0.0	0.0014	5008	,	,		20235	0.0		0.0	False		,,,				2504	0.0				p.R362Q		Atlas-SNP	.											COL22A1,colon,carcinoma,0,1	COL22A1	390	1	0			c.G1085A						scavenged	.	C	GLN/ARG	0,4406		0,0,2203	152.0	129.0	137.0		1085	5.2	1.0	8	dbSNP_134	137	3,8597	3.0+/-9.4	0,3,4297	yes	missense	COL22A1	NM_152888.1	43	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging	362/1627	139833539	3,13003	2203	4300	6503	SO:0001583	missense	169044	exon7			CAGTCCCGGTCAA	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1085G>A	8.37:g.139833539C>T	ENSP00000303153:p.Arg362Gln	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	228	6	0.0263158	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.462463	0.84425	0.0	3.49E-4	ENSG00000169436	ENST00000303045;ENST00000435777	T;T	0.13538	2.58;2.58	5.21	5.21	0.72293	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.45867	D	0.000327	T	0.40372	0.1114	M	0.78637	2.42	0.58432	D	0.999998	D	0.89917	1.0	D	0.79108	0.992	T	0.14671	-1.0464	9	.	.	.	.	18.1827	0.89783	0.0:1.0:0.0:0.0	.	362	Q8NFW1	COMA1_HUMAN	Q	362	ENSP00000303153:R362Q;ENSP00000387655:R362Q	.	R	-	2	0	COL22A1	139902721	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.788000	0.69020	2.616000	0.88540	0.558000	0.71614	CGG	C|1.000;T|0.000	0.000	strong		0.567	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
CDHR5	53841	hgsc.bcm.edu	37	11	618688	618688	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:618688T>C	ENST00000358353.3	-	14	2193	c.1871A>G	c.(1870-1872)cAa>cGa	p.Q624R	IRF7_ENST00000397562.3_5'Flank|IRF7_ENST00000397570.1_5'Flank|CDHR5_ENST00000397542.2_Missense_Mutation_p.Q624R|CDHR5_ENST00000349570.7_Intron|IRF7_ENST00000330243.5_5'Flank|IRF7_ENST00000397566.1_5'Flank|IRF7_ENST00000397574.2_5'Flank			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	624	4 X 31 AA approximate tandem repeats.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						TGTGGTTGGTTGGTGGGAGGT	0.657																																					p.Q624R		Atlas-SNP	.											CDHR5,NS,carcinoma,-1,1	CDHR5	77	1	0			c.A1871G						scavenged	.						137.0	139.0	139.0					11																	618688		2203	4300	6503	SO:0001583	missense	53841	exon13			GTTGGTTGGTGGG	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.1871A>G	11.37:g.618688T>C	ENSP00000351118:p.Gln624Arg	Somatic	304	1	0.00328947		WXS	Illumina HiSeq	Phase_I	286	4	0.013986	NM_021924	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	ENST00000358353.3	37	CCDS7707.1	.	.	.	.	.	.	.	.	.	.	N	5.492	0.275744	0.10403	.	.	ENSG00000099834	ENST00000397542;ENST00000358353	T;T	0.40225	1.04;1.04	2.65	-5.31	0.02730	.	.	.	.	.	T	0.17323	0.0416	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.15065	-1.0450	9	0.36615	T	0.2	.	4.6589	0.12632	0.0:0.2838:0.3495:0.3667	.	618;624	Q9HBB8-4;Q9HBB8	.;CDHR5_HUMAN	R	624	ENSP00000380676:Q624R;ENSP00000351118:Q624R	ENSP00000351118:Q624R	Q	-	2	0	CDHR5	608688	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	0.015000	0.13355	-1.215000	0.02610	0.329000	0.21502	CAA	.	.	none		0.657	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924	
POC5	134359	hgsc.bcm.edu	37	5	74970335	74970335	+	Silent	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:74970335A>G	ENST00000428202.2	-	12	1842	c.1653T>C	c.(1651-1653)gcT>gcC	p.A551A	POC5_ENST00000446329.2_Silent_p.A526A|POC5_ENST00000514838.2_Silent_p.A523A|POC5_ENST00000510798.1_Silent_p.A375A|POC5_ENST00000380475.2_Silent_p.A375A	NM_001099271.1	NP_001092741.1	Q8NA72	POC5_HUMAN	POC5 centriolar protein	551					cell cycle (GO:0007049)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GTGATCTGGAAGCTGAGGTAC	0.418																																					p.A551A		Atlas-SNP	.											POC5_ENST00000428202,NS,neuroblastoma,-2,2	POC5	82	2	0			c.T1653C						scavenged	.						250.0	247.0	248.0					5																	74970335		1905	4131	6036	SO:0001819	synonymous_variant	134359	exon12			TCTGGAAGCTGAG	AK093098	CCDS47236.1, CCDS47237.1	5q13.3	2013-08-05	2013-08-05	2010-03-26	ENSG00000152359	ENSG00000152359			26658	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 37"", ""POC5 centriolar protein homolog (Chlamydomonas)"""	C5orf37		19349582	Standard	NM_152408		Approved	FLJ35779, MGC120442, MGC120443, MGC120444, hPOC5	uc003keh.4	Q8NA72	OTTHUMG00000162487	ENST00000428202.2:c.1653T>C	5.37:g.74970335A>G		Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	271	3	0.0110701	NM_001099271	B4DJG7|Q494X7|Q494X9|Q6P085	Silent	SNP	ENST00000428202.2	37	CCDS47236.1																																																																																			.	.	none		0.418	POC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369124.1	NM_152408	
HSPD1	3329	hgsc.bcm.edu	37	2	198363534	198363534	+	Silent	SNP	C	C	T	rs565153254		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:198363534C>T	ENST00000388968.3	-	2	306	c.39G>A	c.(37-39)ccG>ccA	p.P13P	HSPE1_ENST00000409468.1_5'Flank|HSPD1_ENST00000544407.1_Silent_p.P13P|HSPE1-MOB4_ENST00000604458.1_5'Flank|HSPE1_ENST00000233893.5_5'Flank|HSPD1_ENST00000345042.2_Silent_p.P13P|HSPE1_ENST00000409729.1_5'Flank	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	13					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)	p.P13P(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			CCCTGGACACCGGTCTCATCT	0.502																																					p.P13P		Atlas-SNP	.											HSPD1_ENST00000426480,NS,haematopoietic_neoplasm,0,3	HSPD1	68	3	1	Substitution - coding silent(1)	breast(1)	c.G39A						scavenged	.						52.0	49.0	50.0					2																	198363534		2203	4300	6503	SO:0001819	synonymous_variant	3329	exon2			GGACACCGGTCTC	M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.39G>A	2.37:g.198363534C>T		Somatic	291	3	0.0103093		WXS	Illumina HiSeq	Phase_I	263	7	0.026616	NM_002156	B2R5M6|B7Z712|Q38L19|Q9UCR6	Silent	SNP	ENST00000388968.3	37	CCDS33357.1																																																																																			.	.	none		0.502	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335324.2	NM_002156	
ZNF195	7748	hgsc.bcm.edu	37	11	3380465	3380465	+	Silent	SNP	T	T	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:3380465T>G	ENST00000399602.4	-	6	1899	c.1773A>C	c.(1771-1773)tcA>tcC	p.S591S	ZNF195_ENST00000429541.2_Silent_p.S523S|ZNF195_ENST00000354599.6_Silent_p.S519S|ZNF195_ENST00000343338.7_Silent_p.S523S|ZNF195_ENST00000526601.1_Silent_p.S572S|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000005082.9_Silent_p.S568S	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	591					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		CAATAAGGTTTGAGGACTGGG	0.408																																					p.S591S		Atlas-SNP	.											ZNF195,NS,carcinoma,-2,1	ZNF195	77	1	0			c.A1773C						scavenged	.																																			SO:0001819	synonymous_variant	7748	exon6			AAGGTTTGAGGAC		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1773A>C	11.37:g.3380465T>G		Somatic	66	2	0.030303		WXS	Illumina HiSeq	Phase_I	65	2	0.0307692	NM_001130520	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Silent	SNP	ENST00000399602.4	37	CCDS44522.1																																																																																			.	.	none		0.408	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2		
ACIN1	22985	hgsc.bcm.edu	37	14	23548793	23548793	+	Missense_Mutation	SNP	C	C	T	rs80007670	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:23548793C>T	ENST00000262710.1	-	6	2252	c.1925G>A	c.(1924-1926)cGt>cAt	p.R642H	ACIN1_ENST00000457657.1_Missense_Mutation_p.R602H|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000605057.1_Missense_Mutation_p.R584H|ACIN1_ENST00000555053.1_Missense_Mutation_p.R642H	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	642	Ser-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		AGAACGTGAACGTGACCTTGA	0.478																																					p.R642H		Atlas-SNP	.											.	ACIN1	147	.	0			c.G1925A						PASS	.	C	HIS/ARG,HIS/ARG,HIS/ARG	6,4400	6.2+/-15.9	0,6,2197	258.0	226.0	237.0		1925,1805,1925	3.2	0.8	14	dbSNP_131	237	24,8576	11.9+/-42.8	0,24,4276	yes	missense,missense,missense	ACIN1	NM_001164814.1,NM_001164815.1,NM_014977.3	29,29,29	0,30,6473	TT,TC,CC		0.2791,0.1362,0.2307	probably-damaging,probably-damaging,probably-damaging	642/1329,602/1302,642/1342	23548793	30,12976	2203	4300	6503	SO:0001583	missense	22985	exon6			CGTGAACGTGACC	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1925G>A	14.37:g.23548793C>T	ENSP00000262710:p.Arg642His	Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	204	11	0.0539216	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	9	0.004120879120879121	1	0.0020325203252032522	4	0.011049723756906077	0	0.0	4	0.005277044854881266	C	14.59	2.580077	0.46006	0.001362	0.002791	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.29917	2.39;1.55;2.39	5.05	3.18	0.36537	.	0.000000	0.40144	N	0.001165	T	0.20170	0.0485	L	0.27053	0.805	0.26413	N	0.976231	D;D;D	0.67145	0.992;0.986;0.996	P;P;P	0.51582	0.674;0.475;0.572	T	0.04440	-1.0951	10	0.59425	D	0.04	-4.3727	7.238	0.26079	0.0:0.7908:0.0:0.2092	.	642;642;602	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	H	642;602;642	ENSP00000262710:R642H;ENSP00000405677:R602H;ENSP00000451328:R642H	ENSP00000262710:R642H	R	-	2	0	ACIN1	22618633	0.984000	0.35163	0.847000	0.33407	0.542000	0.35054	0.703000	0.25646	0.669000	0.31146	-0.216000	0.12614	CGT	C|0.994;T|0.006	0.006	strong		0.478	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
CLN5	1203	hgsc.bcm.edu	37	13	77570183	77570183	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr13:77570183C>T	ENST00000377453.3	+	3	1925	c.633C>T	c.(631-633)ggC>ggT	p.G211G	CLN5_ENST00000485938.1_3'UTR	NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	162					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		GTAATCAAGGCGCTGCCTGCT	0.413																																					p.G211G		Atlas-SNP	.											CLN5,caecum,carcinoma,0,1	CLN5	32	1	0			c.C633T						scavenged	.						164.0	154.0	157.0					13																	77570183		2203	4300	6503	SO:0001819	synonymous_variant	1203	exon3			TCAAGGCGCTGCC		CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.633C>T	13.37:g.77570183C>T		Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	110	3	0.0272727	NM_006493	B3KQK7	Silent	SNP	ENST00000377453.3	37	CCDS9456.1																																																																																			.	.	none		0.413	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1	NM_006493	
ZNF224	7767	hgsc.bcm.edu	37	19	44605366	44605366	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:44605366G>T	ENST00000336976.6	+	5	477	c.223G>T	c.(223-225)Gaa>Taa	p.E75*	AC084219.3_ENST00000591772.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	75	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				AATCCAAAGGGAAGGGAATTC	0.438																																					p.E75X		Atlas-SNP	.											.	ZNF224	70	.	0			c.G223T						PASS	.						115.0	106.0	109.0					19																	44605366		2203	4300	6503	SO:0001587	stop_gained	7767	exon5			CAAAGGGAAGGGA	AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.223G>T	19.37:g.44605366G>T	ENSP00000337368:p.Glu75*	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	43	21	0.488372	NM_013398	A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Nonsense_Mutation	SNP	ENST00000336976.6	37	CCDS33046.1	.	.	.	.	.	.	.	.	.	.	g	19.31	3.802189	0.70682	.	.	ENSG00000186019	ENST00000336976;ENST00000269981	.	.	.	1.89	-0.0148	0.13979	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	4.7134	0.12884	0.2729:0.0:0.7271:0.0	.	.	.	.	X	75	.	ENSP00000269981:E75X	E	+	1	0	ZNF224	49297206	0.001000	0.12720	0.002000	0.10522	0.020000	0.10135	-0.140000	0.10342	0.040000	0.15660	0.579000	0.79373	GAA	.	.	none		0.438	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460477.1	NM_013398	
TECPR2	9895	hgsc.bcm.edu	37	14	102843128	102843128	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:102843128C>T	ENST00000359520.7	+	2	296	c.70C>T	c.(70-72)Ccg>Tcg	p.P24S	TECPR2_ENST00000561228.1_3'UTR|TECPR2_ENST00000558678.1_Missense_Mutation_p.P24S	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	24					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						CAATGCCATTCCGACAAAGAT	0.532																																					p.P24S		Atlas-SNP	.											TECPR2,caecum,carcinoma,-2,1	TECPR2	114	1	0			c.C70T						scavenged	.						132.0	110.0	118.0					14																	102843128		2203	4300	6503	SO:0001583	missense	9895	exon2			GCCATTCCGACAA	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.70C>T	14.37:g.102843128C>T	ENSP00000352510:p.Pro24Ser	Somatic	210	2	0.00952381		WXS	Illumina HiSeq	Phase_I	314	4	0.0127389	NM_001172631	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	37	CCDS32162.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.735188	0.89482	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	T	0.32023	1.47	5.5	5.5	0.81552	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.60209	0.2251	M	0.79123	2.44	0.45025	D	0.998044	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;0.982	T	0.62992	-0.6736	10	0.87932	D	0	.	19.7578	0.96301	0.0:1.0:0.0:0.0	.	24;24;24	B4DK51;A5PKY3;O15040	.;.;TCPR2_HUMAN	S	24	ENSP00000352510:P24S	ENSP00000352510:P24S	P	+	1	0	TECPR2	101912881	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.701000	0.68325	2.748000	0.94277	0.655000	0.94253	CCG	.	.	none		0.532	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
WTAP	9589	hgsc.bcm.edu	37	6	160174529	160174529	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:160174529C>T	ENST00000358372.4	+	7	2247	c.490C>T	c.(490-492)Ctt>Ttt	p.L164F	SOD2_ENST00000546087.1_Intron	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein	164					cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)		p.M163_L164delML(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		GTGTCGAATGCTTATCCAGGA	0.438																																					p.L164F		Atlas-SNP	.											WTAP,bladder,carcinoma,-1,1	WTAP	44	1	1	Deletion - In frame(1)	prostate(1)	c.C490T						scavenged	.						125.0	118.0	120.0					6																	160174529		2203	4300	6503	SO:0001583	missense	9589	exon7			CGAATGCTTATCC	AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.490C>T	6.37:g.160174529C>T	ENSP00000351141:p.Leu164Phe	Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	158	2	0.0126582	NM_001270531	Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Missense_Mutation	SNP	ENST00000358372.4	37	CCDS5266.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.912862	0.92178	.	.	ENSG00000146457	ENST00000358372	T	0.62941	-0.01	6.17	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.78935	0.4362	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.80341	-0.1423	10	0.59425	D	0.04	0.4661	15.8758	0.79159	0.0:0.9348:0.0:0.0652	.	164;164	A8K489;Q15007	.;FL2D_HUMAN	F	164	ENSP00000351141:L164F	ENSP00000351141:L164F	L	+	1	0	WTAP	160094519	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.954000	0.63631	2.941000	0.99782	0.655000	0.94253	CTT	.	.	none		0.438	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042905.1	NM_152857	
RNF40	9810	hgsc.bcm.edu	37	16	30776604	30776604	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:30776604C>T	ENST00000324685.6	+	7	1309	c.874C>T	c.(874-876)Cga>Tga	p.R292*	C16orf93_ENST00000543610.1_5'Flank|RNF40_ENST00000357890.5_Nonsense_Mutation_p.R292*|RNF40_ENST00000563683.1_Nonsense_Mutation_p.R292*|RNF40_ENST00000402121.3_Intron	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	292					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GCTGCGGAAGCGAGAGCAAAA	0.597																																					p.R292X		Atlas-SNP	.											RNF40,NS,carcinoma,-1,2	RNF40	83	2	0			c.C874T						scavenged	.						106.0	103.0	104.0					16																	30776604		2197	4300	6497	SO:0001587	stop_gained	9810	exon7			CGGAAGCGAGAGC	AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.874C>T	16.37:g.30776604C>T	ENSP00000325677:p.Arg292*	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	118	2	0.0169492	NM_014771	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Nonsense_Mutation	SNP	ENST00000324685.6	37	CCDS10691.1	.	.	.	.	.	.	.	.	.	.	C	37	6.396305	0.97533	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000452273	.	.	.	5.66	5.66	0.87406	.	0.057067	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.844	14.0697	0.64852	0.1514:0.8486:0.0:0.0	.	.	.	.	X	292;292;141	.	ENSP00000325677:R292X	R	+	1	2	RNF40	30684105	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	1.393000	0.34497	2.667000	0.90743	0.563000	0.77884	CGA	.	.	none		0.597	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255524.2	NM_014771	
MAGI2	9863	hgsc.bcm.edu	37	7	77885700	77885700	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:77885700A>G	ENST00000354212.4	-	10	1860	c.1607T>C	c.(1606-1608)gTg>gCg	p.V536A	MAGI2_ENST00000522391.1_Missense_Mutation_p.V536A|MAGI2_ENST00000535697.1_Missense_Mutation_p.V373A|MAGI2_ENST00000536571.1_Missense_Mutation_p.V368A|MAGI2_ENST00000419488.1_Missense_Mutation_p.V536A	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	536					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ATTGACCATCACTGGAGGTGG	0.493																																					p.V536A		Atlas-SNP	.											.	MAGI2	246	.	0			c.T1607C						PASS	.						101.0	83.0	89.0					7																	77885700		2203	4300	6503	SO:0001583	missense	9863	exon10			ACCATCACTGGAG	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1607T>C	7.37:g.77885700A>G	ENSP00000346151:p.Val536Ala	Somatic	267	0	0		WXS	Illumina HiSeq	Phase_I	278	124	0.446043	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.751936	0.49362	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.10573	2.96;2.96;2.86;3.81;3.82	5.93	4.75	0.60458	.	0.229068	0.20981	U	0.082212	T	0.12178	0.0296	L	0.36672	1.1	0.39497	D	0.96814	P;B;B;B;B;B	0.39601	0.68;0.312;0.038;0.038;0.059;0.08	B;B;B;B;B;B	0.41412	0.356;0.356;0.02;0.02;0.064;0.025	T	0.04268	-1.0964	10	0.56958	D	0.05	.	12.5202	0.56054	0.8606:0.1394:0.0:0.0	.	373;368;536;536;536;536	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	A	536;536;536;536;368;373	ENSP00000405766:V536A;ENSP00000346151:V536A;ENSP00000428389:V536A;ENSP00000441584:V368A;ENSP00000441603:V373A	ENSP00000346151:V536A	V	-	2	0	MAGI2	77723636	0.995000	0.38212	0.998000	0.56505	0.992000	0.81027	5.314000	0.65804	1.031000	0.39867	0.454000	0.30748	GTG	.	.	none		0.493	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
RNF213	57674	hgsc.bcm.edu	37	17	78332155	78332155	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:78332155G>A	ENST00000582970.1	+	37	11073	c.10930G>A	c.(10930-10932)Gac>Aac	p.D3644N	RNF213_ENST00000336301.6_Missense_Mutation_p.D1717N|CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.D3693N	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3644					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ATCATTCATCGACAGAGACGG	0.542																																					p.D3644N		Atlas-SNP	.											.	RNF213	766	.	0			c.G10930A						PASS	.						104.0	86.0	92.0					17																	78332155		2203	4300	6503	SO:0001583	missense	57674	exon37			TTCATCGACAGAG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10930G>A	17.37:g.78332155G>A	ENSP00000464087:p.Asp3644Asn	Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	123	6	0.0487805	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990624	0.74589	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.53206	0.63	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.72977	0.3528	M	0.84511	2.7	0.39810	D	0.972696	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.78191	-0.2300	10	0.72032	D	0.01	.	17.3431	0.87303	0.0:0.0:1.0:0.0	.	3693;1717	C9JCP4;Q63HN8	.;RN213_HUMAN	N	3644;3693;1717	ENSP00000338218:D1717N	ENSP00000338218:D1717N	D	+	1	0	RNF213	75946750	1.000000	0.71417	0.312000	0.25196	0.177000	0.22998	7.921000	0.87530	2.612000	0.88384	0.637000	0.83480	GAC	.	.	none		0.542	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
OR6Q1	219952	hgsc.bcm.edu	37	11	57799050	57799050	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:57799050C>T	ENST00000302622.3	+	1	649	c.626C>T	c.(625-627)gCt>gTt	p.A209V	OR9Q1_ENST00000335397.3_Intron	NM_001005186.2	NP_001005186.2	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q, member 1	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			biliary_tract(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(21;0.0707)|all_epithelial(135;0.142)				GTGTCTCTGGCTGTGCTACTG	0.537																																					p.A209V		Atlas-SNP	.											OR6Q1,NS,carcinoma,+1,1	OR6Q1	58	1	0			c.C626T						scavenged	.						212.0	184.0	193.0					11																	57799050		2201	4296	6497	SO:0001583	missense	219952	exon1			CTCTGGCTGTGCT	AB065737	CCDS31541.1	11q12.1	2012-08-09			ENSG00000172381	ENSG00000172381		"""GPCR / Class A : Olfactory receptors"""	15302	protein-coding gene	gene with protein product							Standard	NM_001005186		Approved		uc010rjz.2	Q8NGQ2	OTTHUMG00000168831	ENST00000302622.3:c.626C>T	11.37:g.57799050C>T	ENSP00000307734:p.Ala209Val	Somatic	230	1	0.00434783		WXS	Illumina HiSeq	Phase_I	450	6	0.0133333	NM_001005186	B9EKW1|Q6IFH1|Q96R34	Missense_Mutation	SNP	ENST00000302622.3	37	CCDS31541.1	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.453834	0.01071	.	.	ENSG00000172381	ENST00000302622	T	0.34859	1.34	5.0	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.410373	0.17760	N	0.162940	T	0.13030	0.0316	N	0.03050	-0.425	0.09310	N	1	B	0.10296	0.003	B	0.12156	0.007	T	0.32107	-0.9919	10	0.08837	T	0.75	.	7.1523	0.25618	0.0:0.6545:0.0:0.3455	.	209	Q8NGQ2	OR6Q1_HUMAN	V	209	ENSP00000307734:A209V	ENSP00000307734:A209V	A	+	2	0	OR6Q1	57555626	0.000000	0.05858	0.558000	0.28319	0.531000	0.34715	0.143000	0.16115	0.527000	0.28560	0.638000	0.83543	GCT	.	.	none		0.537	OR6Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401257.1	NM_001005186	
CDH5	1003	hgsc.bcm.edu	37	16	66423379	66423379	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:66423379G>A	ENST00000341529.3	+	5	883	c.735G>A	c.(733-735)ctG>ctA	p.L245L	CDH5_ENST00000563425.2_Silent_p.L245L	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	245	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	CCACCGTGCTGGTCACTCTGC	0.627																																					p.L245L		Atlas-SNP	.											.	CDH5	111	.	0			c.G735A						PASS	.						64.0	62.0	63.0					16																	66423379		2202	4300	6502	SO:0001819	synonymous_variant	1003	exon5			CGTGCTGGTCACT	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.735G>A	16.37:g.66423379G>A		Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	91	57	0.626374	NM_001795	Q4VAI5|Q4VAI6	Silent	SNP	ENST00000341529.3	37	CCDS10804.1																																																																																			.	.	none		0.627	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
KRTAP19-7	337974	hgsc.bcm.edu	37	21	31933581	31933581	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr21:31933581C>T	ENST00000334849.2	-	1	52	c.28G>A	c.(28-30)Ggc>Agc	p.G10S		NM_181614.1	NP_853645.1	Q3SYF9	KR197_HUMAN	keratin associated protein 19-7	10						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	11						TAGCCTAGGCCTCCATAGTAG	0.527																																					p.G10S		Atlas-SNP	.											KRTAP19-7,colon,carcinoma,0,1	KRTAP19-7	23	1	0			c.G28A						scavenged	.						126.0	108.0	114.0					21																	31933581		2203	4300	6503	SO:0001583	missense	337974	exon1			CTAGGCCTCCATA	AP001708	CCDS13599.1	21q22.1	2006-03-13			ENSG00000244362	ENSG00000244362		"""Keratin associated proteins"""	18942	protein-coding gene	gene with protein product						12359730	Standard	NM_181614		Approved	KAP19.7	uc011adb.2	Q3SYF9	OTTHUMG00000057785	ENST00000334849.2:c.28G>A	21.37:g.31933581C>T	ENSP00000334696:p.Gly10Ser	Somatic	198	0	0		WXS	Illumina HiSeq	Phase_I	304	4	0.0131579	NM_181614	Q08EP7	Missense_Mutation	SNP	ENST00000334849.2	37	CCDS13599.1	.	.	.	.	.	.	.	.	.	.	c	3.803	-0.041391	0.07452	.	.	ENSG00000244362	ENST00000334849	T	0.15603	2.41	4.15	2.19	0.27852	.	0.625273	0.14144	N	0.338466	T	0.13030	0.0316	.	.	.	0.09310	N	1	B	0.25272	0.122	B	0.24155	0.051	T	0.23547	-1.0185	9	0.87932	D	0	.	6.2952	0.21081	0.0:0.7327:0.0:0.2673	.	10	Q3SYF9	KR197_HUMAN	S	10	ENSP00000334696:G10S	ENSP00000334696:G10S	G	-	1	0	KRTAP19-7	30855452	0.018000	0.18449	0.029000	0.17559	0.008000	0.06430	0.303000	0.19210	0.413000	0.25759	0.405000	0.27470	GGC	.	.	none		0.527	KRTAP19-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128237.2		
ATF7IP	55729	hgsc.bcm.edu	37	12	14578150	14578150	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:14578150A>G	ENST00000540793.1	+	1	1456	c.1301A>G	c.(1300-1302)gAa>gGa	p.E434G	ATF7IP_ENST00000261168.4_Missense_Mutation_p.E434G|ATF7IP_ENST00000543189.1_Missense_Mutation_p.E434G|ATF7IP_ENST00000544627.1_Missense_Mutation_p.E442G|ATF7IP_ENST00000536444.1_Missense_Mutation_p.E434G|ATF7IP_ENST00000541654.1_3'UTR			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	434	Glu-rich.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						GAGACAGATGAAATCATTCCT	0.338																																					p.E434G		Atlas-SNP	.											.	ATF7IP	136	.	0			c.A1301G						PASS	.						64.0	66.0	65.0					12																	14578150		2203	4300	6503	SO:0001583	missense	55729	exon2			CAGATGAAATCAT	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.1301A>G	12.37:g.14578150A>G	ENSP00000444589:p.Glu434Gly	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	126	49	0.388889	NM_018179	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.204229	0.79127	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000396279;ENST00000540793	T;T;T;T;T;T	0.36699	1.64;1.64;1.64;1.64;1.24;1.64	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000019	T	0.57242	0.2040	L	0.59436	1.845	0.47441	D	0.999429	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.992;0.998;0.998;0.999;0.999	D;D;D;D;D;D;D	0.85130	0.997;0.995;0.943;0.961;0.961;0.984;0.984	T	0.60581	-0.7235	10	0.87932	D	0	-21.0202	15.639	0.76981	1.0:0.0:0.0:0.0	.	442;434;442;434;434;434;45	B4E2A2;B4DRL6;F5GX74;G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;.;.;.;MCAF1_HUMAN;.;.	G	434;434;434;442;434;434	ENSP00000261168:E434G;ENSP00000443179:E434G;ENSP00000445955:E434G;ENSP00000440440:E442G;ENSP00000379575:E434G;ENSP00000444589:E434G	ENSP00000261168:E434G	E	+	2	0	ATF7IP	14469417	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.355000	0.73041	2.140000	0.66376	0.482000	0.46254	GAA	.	.	none		0.338	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
ZNF285	26974	hgsc.bcm.edu	37	19	44891126	44891126	+	Silent	SNP	T	T	A	rs553045966	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:44891126T>A	ENST00000330997.4	-	4	1345	c.1281A>T	c.(1279-1281)ccA>ccT	p.P427P	ZNF285_ENST00000544719.2_Silent_p.P427P|ZNF285_ENST00000591679.1_Silent_p.P434P|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	427					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P427P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						CACACCTATATGGTTTCTCCC	0.483																																					p.P427P		Atlas-SNP	.											ZNF285,NS,carcinoma,0,1	ZNF285	86	1	1	Substitution - coding silent(1)	prostate(1)	c.A1281T						scavenged	.						62.0	59.0	60.0					19																	44891126		2203	4300	6503	SO:0001819	synonymous_variant	26974	exon4			CCTATATGGTTTC	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1281A>T	19.37:g.44891126T>A		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	90	3	0.0333333	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Silent	SNP	ENST00000330997.4	37	CCDS12638.1																																																																																			.	.	none		0.483	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
SSR1	6745	hgsc.bcm.edu	37	6	7313275	7313275	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:7313275C>T	ENST00000244763.4	-	1	165	c.79G>A	c.(79-81)Ggc>Agc	p.G27S	SSR1_ENST00000474597.1_Splice_Site_p.G27S|SSR1_ENST00000479365.1_Splice_Site_p.G27S|SSR1_ENST00000462112.1_Splice_Site_p.G27S|SSR1_ENST00000397511.2_Splice_Site_p.G27S|SSR1_ENST00000534851.1_Splice_Site_p.G27S|SSR1_ENST00000489567.1_Splice_Site_p.G27S|SSR1_ENST00000488834.1_Intron	NM_003144.3	NP_003135.2	P43307	SSRA_HUMAN	signal sequence receptor, alpha	27					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|positive regulation of cell proliferation (GO:0008284)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(1)	9	Ovarian(93;0.0398)					CCAGCCTCACCTCTGGGGCCG	0.647																																					p.G27S		Atlas-SNP	.											.	SSR1	21	.	0			c.G79A						PASS	.						43.0	41.0	42.0					6																	7313275		2193	4282	6475	SO:0001630	splice_region_variant	6745	exon1			CCTCACCTCTGGG		CCDS4499.1	6p24.3	2010-11-24	2008-08-26		ENSG00000124783	ENSG00000124783			11323	protein-coding gene	gene with protein product	"""translocon-associated protein alpha"""	600868					Standard	NM_001292008		Approved	TRAPA	uc003mxf.4	P43307	OTTHUMG00000014202	ENST00000244763.4:c.79+1G>A	6.37:g.7313275C>T		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	80	42	0.525	NM_003144	A8K685|Q53GX2|Q53H19|Q5TAM3|Q6IB43|Q8NBH9|Q96IA2|Q9TNQ8|Q9UN49	Missense_Mutation	SNP	ENST00000244763.4	37	CCDS4499.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040668	0.75732	.	.	ENSG00000124783	ENST00000474597;ENST00000244763;ENST00000397511;ENST00000534851;ENST00000489567;ENST00000479365;ENST00000462112	T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0	4.32	4.32	0.51571	.	0.133138	0.49305	D	0.000157	T	0.32556	0.0833	N	0.12569	0.235	0.49915	D	0.99983	P;D;P	0.62365	0.928;0.991;0.833	P;D;P	0.68621	0.756;0.959;0.677	T	0.21895	-1.0232	9	.	.	.	.	15.7303	0.77794	0.0:1.0:0.0:0.0	.	27;27;27	C9J5W0;C9JBX5;P43307	.;.;SSRA_HUMAN	S	27	ENSP00000418617:G27S;ENSP00000244763:G27S;ENSP00000380647:G27S;ENSP00000443020:G27S;ENSP00000420730:G27S;ENSP00000417911:G27S;ENSP00000417290:G27S	.	G	-	1	0	SSR1	7258274	1.000000	0.71417	0.997000	0.53966	0.595000	0.36748	2.096000	0.41738	2.089000	0.63090	0.462000	0.41574	GGC	.	.	none		0.647	SSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039775.2		Missense_Mutation
POMT2	29954	hgsc.bcm.edu	37	14	77746416	77746416	+	Missense_Mutation	SNP	C	C	T	rs571330846		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:77746416C>T	ENST00000261534.4	-	17	1935	c.1733G>A	c.(1732-1734)cGc>cAc	p.R578H		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	578						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		CCCTGAGAAGCGTAGGCCCTG	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		17795	0.0		0.0	False		,,,				2504	0.001				p.R578H		Atlas-SNP	.											POMT2,colon,carcinoma,-1,2	POMT2	47	2	0			c.G1733A						PASS	.						120.0	99.0	106.0					14																	77746416		2203	4300	6503	SO:0001583	missense	29954	exon17			GAGAAGCGTAGGC	AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1733G>A	14.37:g.77746416C>T	ENSP00000261534:p.Arg578His	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	116	54	0.465517	NM_013382	Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	ENST00000261534.4	37	CCDS9857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.3|27.3	4.815127|4.815127	0.90790|0.90790	.|.	.|.	ENSG00000009830|ENSG00000009830	ENST00000556171|ENST00000261534	.|D	.|0.92299	.|-3.01	5.67|5.67	4.79|4.79	0.61399|0.61399	.|.	.|0.051252	.|0.85682	.|N	.|0.000000	D|D	0.90113|0.90113	0.6911|0.6911	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	.|B	.|0.18461	.|0.028	.|B	.|0.14023	.|0.01	D|D	0.86195|0.86195	0.1615|0.1615	5|10	.|0.14656	.|T	.|0.56	-12.6745|-12.6745	14.5883|14.5883	0.68344|0.68344	0.0:0.9299:0.0:0.0701|0.0:0.9299:0.0:0.0701	.|.	.|578	.|Q9UKY4	.|POMT2_HUMAN	T|H	46|578	.|ENSP00000261534:R578H	.|ENSP00000261534:R578H	A|R	-|-	1|2	0|0	POMT2|POMT2	76816169|76816169	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.739000|0.739000	0.42172|0.42172	3.812000|3.812000	0.55628|0.55628	1.416000|1.416000	0.47057|0.47057	0.563000|0.563000	0.77884|0.77884	GCT|CGC	.	.	none		0.597	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382	
NPHS2	7827	hgsc.bcm.edu	37	1	179526214	179526214	+	Missense_Mutation	SNP	C	C	T	rs61747728	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:179526214C>T	ENST00000367615.4	-	5	754	c.686G>A	c.(685-687)cGa>cAa	p.R229Q	NPHS2_ENST00000367616.4_Intron	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	229			R -> Q (appears to enhance susceptibility to NPHS2 in association with a second mutant allele; disease-associated 3' mutations exert a dominant-negative effect on this mutation but behave as recessive alleles when associated with the wild-type protein). {ECO:0000269|PubMed:12464671, ECO:0000269|PubMed:21722858, ECO:0000269|PubMed:23800802, ECO:0000269|PubMed:24509478}.		actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						AGTGAGGGATCGATGTGCTAG	0.408													C|||	73	0.0145767	0.003	0.013	5008	,	,		20498	0.0		0.0417	False		,,,				2504	0.0184				p.R229Q		Atlas-SNP	.											NPHS2,caecum,carcinoma,-1,1	NPHS2	46	1	0			c.G686A	GRCh37	CM023107|CM077322	NPHS2	M	rs61747728	scavenged	.	C	GLN/ARG	34,4372	39.2+/-71.8	0,34,2169	106.0	88.0	94.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	686	5.9	1.0	1	dbSNP_129	94	323,8277	113.3+/-173.4	2,319,3979	yes	missense	NPHS2	NM_014625.2	43	2,353,6148	TT,TC,CC		3.7558,0.7717,2.7449	possibly-damaging	229/384	179526214	357,12649	2203	4300	6503	SO:0001583	missense	7827	exon5			AGGGATCGATGTG	AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.686G>A	1.37:g.179526214C>T	ENSP00000356587:p.Arg229Gln	Somatic	259	0	0		WXS	Illumina HiSeq	Phase_I	281	4	0.0142349	NM_014625	B1AM32|B1AM33|Q8N6Q5	Missense_Mutation	SNP	ENST00000367615.4	37	CCDS1331.1	47	0.02152014652014652	3	0.006097560975609756	7	0.019337016574585635	0	0.0	37	0.048812664907651716	C	21.0	4.074946	0.76415	0.007717	0.037558	ENSG00000116218	ENST00000367615	D	0.94966	-3.57	5.93	5.93	0.95920	.	0.070347	0.64402	D	0.000015	T	0.72606	0.3481	L	0.43152	1.355	0.80722	D	1	P	0.47962	0.903	B	0.39904	0.313	D	0.83551	0.0101	10	0.46703	T	0.11	-10.5416	18.9177	0.92512	0.0:1.0:0.0:0.0	.	229	Q9NP85	PODO_HUMAN	Q	229	ENSP00000356587:R229Q	ENSP00000356587:R229Q	R	-	2	0	NPHS2	177792837	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	2.410000	0.44592	2.826000	0.97356	0.655000	0.94253	CGA	C|0.974;T|0.026	0.026	strong		0.408	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085283.1		
GPR20	2843	hgsc.bcm.edu	37	8	142367400	142367400	+	Silent	SNP	G	G	A	rs11167054	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:142367400G>A	ENST00000377741.3	-	2	714	c.624C>T	c.(622-624)ccC>ccT	p.P208P	CTD-3064M3.3_ENST00000562459.1_RNA	NM_005293.2	NP_005284.2	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	208					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(3)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	15	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			TGACCAGCAGGGGCAGCAGGA	0.701													A|||	3770	0.752796	0.8533	0.8573	5008	,	,		17946	0.5099		0.8171	False		,,,				2504	0.727				p.P208P		Atlas-SNP	.											GPR20,NS,carcinoma,0,2	GPR20	43	2	0			c.C624T						scavenged	.	A		3616,550		1570,476,37	10.0	11.0	11.0		624	-8.4	0.7	8	dbSNP_120	11	6656,1574		2708,1240,167	no	coding-synonymous	GPR20	NM_005293.2		4278,1716,204	AA,AG,GG		19.1252,13.2021,17.1346		208/359	142367400	10272,2124	2083	4115	6198	SO:0001819	synonymous_variant	2843	exon2			CAGCAGGGGCAGC	U66579	CCDS34949.1	8q24.3	2012-08-21				ENSG00000204882		"""GPCR / Class A : Orphans"""	4475	protein-coding gene	gene with protein product		601908				18347022	Standard	NM_005293		Approved		uc003ywf.3	Q99678		ENST00000377741.3:c.624C>T	8.37:g.142367400G>A		Somatic	2	1	0.5		WXS	Illumina HiSeq	Phase_I	8	4	0.5	NM_005293	Q17R96	Silent	SNP	ENST00000377741.3	37	CCDS34949.1																																																																																			G|0.248;A|0.752	0.752	strong		0.701	GPR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378968.1	NM_005293	
LITAF	9516	hgsc.bcm.edu	37	16	11650529	11650529	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:11650529G>A	ENST00000571688.1	-	2	288	c.58C>T	c.(58-60)Cct>Tct	p.P20S	LITAF_ENST00000574703.1_Missense_Mutation_p.P20S|LITAF_ENST00000570904.1_Missense_Mutation_p.P20S|LITAF_ENST00000572255.1_Intron|LITAF_ENST00000413364.2_Missense_Mutation_p.P20S|LITAF_ENST00000574763.1_Missense_Mutation_p.P20S|LITAF_ENST00000339430.5_Missense_Mutation_p.P20S|LITAF_ENST00000571976.1_Missense_Mutation_p.P20S|LITAF_ENST00000381810.3_Missense_Mutation_p.P20S|LITAF_ENST00000571459.1_Missense_Mutation_p.P20S|LITAF_ENST00000576036.1_Missense_Mutation_p.P20S	NM_001136472.1	NP_001129944.1	Q99732	LITAF_HUMAN	lipopolysaccharide-induced TNF factor	20					aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of cytokine production (GO:0001817)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			endometrium(1)|large_intestine(1)|liver(1)|lung(3)|skin(1)	7						TAGGATGGAGGTGCGGATGGT	0.532																																					p.P20S		Atlas-SNP	.											.	LITAF	16	.	0			c.C58T						PASS	.						95.0	87.0	90.0					16																	11650529		2197	4300	6497	SO:0001583	missense	9516	exon2			ATGGAGGTGCGGA	AB034747	CCDS32386.1, CCDS45411.1	16p13.3-p12	2014-09-17							16841	protein-coding gene	gene with protein product		603795				9305847, 10200294	Standard	NM_004862		Approved	PIG7, SIMPLE, FLJ38636, TP53I7	uc002dbb.3	Q99732		ENST00000571688.1:c.58C>T	16.37:g.11650529G>A	ENSP00000459533:p.Pro20Ser	Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	309	40	0.12945	NM_001136473	D3DUG1|G5E9K0|Q05DW0|Q9C0L6	Missense_Mutation	SNP	ENST00000571688.1	37	CCDS32386.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316524	0.60524	.	.	ENSG00000189067	ENST00000339430;ENST00000413364;ENST00000381810	D;D;D	0.93189	-2.45;-3.18;-2.52	5.63	5.63	0.86233	.	0.065688	0.64402	D	0.000010	D	0.95579	0.8563	L	0.52364	1.645	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.996	D	0.95558	0.8627	10	0.59425	D	0.04	-23.8973	17.2034	0.86912	0.0:0.0:1.0:0.0	.	20;20;20	Q99732-2;G5E9K0;Q99732	.;.;LITAF_HUMAN	S	20	ENSP00000340118:P20S;ENSP00000397958:P20S;ENSP00000371231:P20S	ENSP00000340118:P20S	P	-	1	0	LITAF	11558030	1.000000	0.71417	0.451000	0.26982	0.146000	0.21551	5.921000	0.70028	2.652000	0.90054	0.655000	0.94253	CCT	.	.	none		0.532	LITAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436794.2	NM_004862	
SLC44A5	204962	hgsc.bcm.edu	37	1	75685006	75685006	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:75685006G>T	ENST00000370855.5	-	16	1315	c.1202C>A	c.(1201-1203)cCt>cAt	p.P401H	SLC44A5_ENST00000370859.3_Missense_Mutation_p.P401H|SLC44A5_ENST00000535611.1_Missense_Mutation_p.P271H	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	401					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						TTTGTATACAGGTACCCCCGA	0.378																																					p.P401H		Atlas-SNP	.											SLC44A5,caecum,carcinoma,-1,1	SLC44A5	231	1	0			c.C1202A						scavenged	.						99.0	92.0	95.0					1																	75685006		2203	4300	6503	SO:0001583	missense	204962	exon16			TATACAGGTACCC	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1202C>A	1.37:g.75685006G>T	ENSP00000359892:p.Pro401His	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	87	3	0.0344828	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.707200	0.48412	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.25912	1.77;1.77;1.77	5.04	5.04	0.67666	.	0.104481	0.64402	D	0.000003	T	0.45175	0.1329	M	0.83384	2.64	0.54753	D	0.999988	D;D;D;D;D	0.76494	0.996;0.999;0.996;0.999;0.998	D;D;D;D;D	0.73708	0.972;0.979;0.979;0.981;0.952	T	0.35201	-0.9798	10	0.22109	T	0.4	-11.2995	18.7654	0.91869	0.0:0.0:1.0:0.0	.	395;440;401;401;440	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	H	401;440;401;271;394	ENSP00000359896:P401H;ENSP00000359892:P401H;ENSP00000443090:P271H	ENSP00000359892:P401H	P	-	2	0	SLC44A5	75457594	1.000000	0.71417	0.149000	0.22428	0.003000	0.03518	8.995000	0.93534	2.504000	0.84457	0.655000	0.94253	CCT	.	.	none		0.378	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
FAM186A	121006	hgsc.bcm.edu	37	12	50746166	50746166	+	Silent	SNP	G	G	C	rs368983791		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:50746166G>C	ENST00000327337.5	-	4	4448	c.4449C>G	c.(4447-4449)ctC>ctG	p.L1483L	FAM186A_ENST00000543111.1_Silent_p.L1483L|FAM186A_ENST00000543096.1_5'Flank	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1483								p.L1483L(2)									GCGGAGGGATGAGAGGGATCC	0.647																																					p.L1483L	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											FAM186A_ENST00000327337,NS,carcinoma,0,3	FAM186A	181	3	2	Substitution - coding silent(2)	endometrium(2)	c.C4449G						scavenged	.						22.0	21.0	21.0					12																	50746166		692	1591	2283	SO:0001819	synonymous_variant	121006	exon4			AGGGATGAGAGGG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4449C>G	12.37:g.50746166G>C		Somatic	277	3	0.0108303		WXS	Illumina HiSeq	Phase_I	854	12	0.0140515	NM_001145475		Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																			.	.	weak		0.647	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
SMC5	23137	hgsc.bcm.edu	37	9	72897468	72897468	+	Missense_Mutation	SNP	G	G	A	rs115131883		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr9:72897468G>A	ENST00000361138.5	+	7	1008	c.950G>A	c.(949-951)cGt>cAt	p.R317H		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	317					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						GAAAACGAGCGTCACAATTTG	0.343													G|||	1	0.000199681	0.0	0.0	5008	,	,		16784	0.0		0.001	False		,,,				2504	0.0				p.R317H		Atlas-SNP	.											.	SMC5	96	.	0			c.G950A						PASS	.						80.0	79.0	79.0					9																	72897468		2203	4300	6503	SO:0001583	missense	23137	exon7			ACGAGCGTCACAA	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.950G>A	9.37:g.72897468G>A	ENSP00000354957:p.Arg317His	Somatic	257	0	0		WXS	Illumina HiSeq	Phase_I	247	103	0.417004	NM_015110	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	37	CCDS6632.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	8.955	0.969095	0.18659	.	.	ENSG00000198887	ENST00000361138	T	0.18016	2.24	5.61	5.61	0.85477	RecF/RecN/SMC (1);	0.276654	0.37715	N	0.001971	T	0.12689	0.0308	N	0.19112	0.55	0.09310	N	1	D	0.64830	0.994	P	0.49192	0.602	T	0.23226	-1.0194	10	0.15952	T	0.53	-11.1893	7.1841	0.25789	0.1378:0.0:0.7171:0.1451	.	317	Q8IY18	SMC5_HUMAN	H	317	ENSP00000354957:R317H	ENSP00000354957:R317H	R	+	2	0	SMC5	72087288	0.357000	0.24938	0.463000	0.27130	0.326000	0.28443	2.392000	0.44433	2.804000	0.96469	0.650000	0.86243	CGT	G|1.000;A|0.000	0.000	strong		0.343	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
RRAS2	22800	hgsc.bcm.edu	37	11	14300971	14300971	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:14300971C>T	ENST00000256196.4	-	6	841		c.e6-1		RRAS2_ENST00000526063.1_Splice_Site|RRAS2_ENST00000534746.1_Splice_Site|RRAS2_ENST00000529237.1_Splice_Site|RRAS2_ENST00000414023.2_Splice_Site|RRAS2_ENST00000537760.1_Splice_Site|RRAS2_ENST00000545643.1_Splice_Site|RRAS2_ENST00000532814.1_Splice_Site			P62070	RRAS2_HUMAN	related RAS viral (r-ras) oncogene homolog 2						osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(3)|endometrium(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	12				Epithelial(150;0.203)		TTGAAATTTCCTGTAAGATAA	0.343																																					.		Atlas-SNP	.											.	RRAS2	29	.	0			c.528-1G>A						PASS	.						121.0	117.0	118.0					11																	14300971		2200	4294	6494	SO:0001630	splice_region_variant	22800	exon7			AATTTCCTGTAAG	M31468	CCDS7814.1, CCDS44544.1, CCDS53603.1	11p15.2	2014-05-09			ENSG00000133818	ENSG00000133818			17271	protein-coding gene	gene with protein product		600098				2108320, 8052619	Standard	NM_012250		Approved	TC21	uc001mlf.4	P62070	OTTHUMG00000165756	ENST00000256196.4:c.528-1G>A	11.37:g.14300971C>T		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	107	5	0.046729	NM_012250	B2R9Z3|B7Z5Z2|B7Z6C4|B7Z7H6|P17082	Splice_Site	SNP	ENST00000256196.4	37	CCDS7814.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.871523	0.51695	.	.	ENSG00000133818	ENST00000537760;ENST00000545643;ENST00000414023;ENST00000529237;ENST00000256196;ENST00000534746;ENST00000526063;ENST00000532814;ENST00000531807	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3437	0.98782	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RRAS2	14257547	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	7.760000	0.85248	2.821000	0.97095	0.555000	0.69702	.	.	.	none		0.343	RRAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386035.1	NM_012250	Intron
OR8U1	219417	hgsc.bcm.edu	37	11	56143360	56143360	+	Silent	SNP	C	C	T	rs79469149	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:56143360C>T	ENST00000302270.1	+	1	261	c.261C>T	c.(259-261)taC>taT	p.Y87Y		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					ATTTCTTGTACAAACAAAATG	0.403																																					p.Y87Y		Atlas-SNP	.											OR8U1,rectum,carcinoma,0,1	OR8U1	59	1	0			c.C261T						scavenged	.						234.0	214.0	220.0					11																	56143360		1982	4171	6153	SO:0001819	synonymous_variant	219417	exon1			CTTGTACAAACAA	AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.261C>T	11.37:g.56143360C>T		Somatic	90	7	0.0777778		WXS	Illumina HiSeq	Phase_I	177	17	0.0960452	NM_001005204		Silent	SNP	ENST00000302270.1	37	CCDS41647.1																																																																																			C|0.852;T|0.148	0.148	strong		0.403	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204	
KCNT1	57582	hgsc.bcm.edu	37	9	138671231	138671231	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr9:138671231C>T	ENST00000263604.3	+	24	2699	c.2699C>T	c.(2698-2700)aCg>aTg	p.T900M	KCNT1_ENST00000298480.5_Missense_Mutation_p.T919M|KCNT1_ENST00000371757.2_Missense_Mutation_p.T919M|KCNT1_ENST00000488444.2_Missense_Mutation_p.T900M|KCNT1_ENST00000486577.2_Missense_Mutation_p.T878M|KCNT1_ENST00000490355.2_Missense_Mutation_p.T898M|KCNT1_ENST00000491806.2_Missense_Mutation_p.T886M|KCNT1_ENST00000487664.1_Missense_Mutation_p.T874M			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	900					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		AGCATCACCACGGAGCTCACC	0.622																																					p.T919M		Atlas-SNP	.											.	KCNT1	139	.	0			c.C2756T						PASS	.						149.0	146.0	147.0					9																	138671231		2203	4300	6503	SO:0001583	missense	57582	exon24			TCACCACGGAGCT	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2699C>T	9.37:g.138671231C>T	ENSP00000263604:p.Thr900Met	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	101	46	0.455446	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37		.	.	.	.	.	.	.	.	.	.	C	19.41	3.821619	0.71028	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	3.77	3.77	0.43336	.	0.000000	0.85682	U	0.000000	D	0.86994	0.6067	M	0.81497	2.545	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.978;0.978;0.994;0.978	D	0.88055	0.2790	10	0.54805	T	0.06	-30.3053	12.6769	0.56899	0.1657:0.8343:0.0:0.0	.	886;919;874;900	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	M	874;919;919;878;886;900;898;900	ENSP00000417851:T874M;ENSP00000298480:T919M;ENSP00000360822:T919M;ENSP00000263604:T900M	ENSP00000263604:T900M	T	+	2	0	KCNT1	137811052	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.830000	0.69324	1.778000	0.52293	0.455000	0.32223	ACG	.	.	none		0.622	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
SFXN5	94097	hgsc.bcm.edu	37	2	73215387	73215387	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:73215387C>T	ENST00000272433.2	-	10	755	c.625G>A	c.(625-627)Gcc>Acc	p.A209T	SFXN5_ENST00000474528.1_5'UTR|SFXN5_ENST00000410065.1_Splice_Site_p.G209R	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	209					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						CAGGTCTTACCTACAGCAGGG	0.572																																					p.A209T		Atlas-SNP	.											.	SFXN5	31	.	0			c.G625A						PASS	.						107.0	92.0	97.0					2																	73215387		2203	4300	6503	SO:0001630	splice_region_variant	94097	exon10			TCTTACCTACAGC	AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.625+1G>A	2.37:g.73215387C>T		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	91	4	0.043956	NM_144579	A8K116|Q494Y3|Q53T29	Missense_Mutation	SNP	ENST00000272433.2	37	CCDS1922.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	27.7|27.7|27.7	4.856674|4.856674|4.856674	0.91433|0.91433|0.91433	.|.|.	.|.|.	ENSG00000144040|ENSG00000144040|ENSG00000144040	ENST00000272433|ENST00000410065|ENST00000411783	T|T|.	0.36157|0.30714|.	1.27|1.52|.	5.39|5.39|5.39	4.5|4.5|4.5	0.54988|0.54988|0.54988	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.66973|0.66973|0.66973	0.2844|0.2844|0.2844	M|M|M	0.82193|0.82193|0.82193	2.58|2.58|2.58	0.30785|0.30785|0.30785	N|N|N	0.741602|0.741602|0.741602	D|P|.	0.55605|0.42584|.	0.972|0.784|.	P|B|.	0.55303|0.42522|.	0.773|0.39|.	T|T|T	0.69262|0.69262|0.69262	-0.5191|-0.5191|-0.5191	9|8|5	.|.|.	.|.|.	.|.|.	-17.7252|-17.7252|-17.7252	11.478|11.478|11.478	0.50310|0.50310|0.50310	0.0:0.9128:0.0:0.0872|0.0:0.9128:0.0:0.0872|0.0:0.9128:0.0:0.0872	.|.|.	209|209|.	Q8TD22|B8ZZJ6|.	SFXN5_HUMAN|.|.	T|R|K	209|209|198	ENSP00000272433:A209T|ENSP00000387076:G209R|.	.|.|.	A|G|R	-|-|-	1|1|2	0|0|0	SFXN5|SFXN5|SFXN5	73068895|73068895|73068895	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.994000|0.994000|0.994000	0.84299|0.84299|0.84299	4.673000|4.673000|4.673000	0.61604|0.61604|0.61604	2.699000|2.699000|2.699000	0.92147|0.92147|0.92147	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GCC|GGA|AGG	.	.	none		0.572	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251991.1	NM_144579	Missense_Mutation
PRAMEF1	65121	hgsc.bcm.edu	37	1	12855752	12855752	+	Silent	SNP	G	G	A	rs80197258	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:12855752G>A	ENST00000332296.7	+	4	1135	c.1032G>A	c.(1030-1032)ctG>ctA	p.L344L	PRAMEF1_ENST00000400814.3_Silent_p.L99L	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	344					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L344L(2)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAGCTCTGCTGGAGAAAATTG	0.557																																					p.L344L		Atlas-SNP	.											PRAMEF1,NS,carcinoma,0,2	PRAMEF1	78	2	2	Substitution - coding silent(2)	prostate(2)	c.G1032A						scavenged	.						188.0	192.0	191.0					1																	12855752		2203	4300	6503	SO:0001819	synonymous_variant	65121	exon4			TCTGCTGGAGAAA	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.1032G>A	1.37:g.12855752G>A		Somatic	764	9	0.0117801		WXS	Illumina HiSeq	Phase_I	862	13	0.0150812	NM_023013	Q9UQP2	Silent	SNP	ENST00000332296.7	37	CCDS148.1																																																																																			G|0.997;A|0.003	0.003	strong		0.557	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
LCE1F	353137	hgsc.bcm.edu	37	1	152749039	152749039	+	Silent	SNP	T	T	C	rs202038292|rs149277953	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:152749039T>C	ENST00000334371.2	+	1	192	c.192T>C	c.(190-192)ggT>ggC	p.G64G		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	64	Poly-Gly.				keratinization (GO:0031424)			p.G64_G65delGG(1)		kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTCTGGGGGTGGTGGCTGCT	0.672																																					p.G64G		Atlas-SNP	.											LCE1F,NS,carcinoma,+2,1	LCE1F	42	1	1	Deletion - In frame(1)	stomach(1)	c.T192C						scavenged	.						30.0	33.0	32.0					1																	152749039		2201	4299	6500	SO:0001819	synonymous_variant	353137	exon1			TGGGGGTGGTGGC		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.192T>C	1.37:g.152749039T>C		Somatic	81	1	0.0123457		WXS	Illumina HiSeq	Phase_I	46	12	0.26087	NM_178354		Silent	SNP	ENST00000334371.2	37	CCDS1023.1																																																																																			T|0.954;C|0.046	0.046	strong		0.672	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
DSPP	1834	hgsc.bcm.edu	37	4	88536451	88536451	+	Silent	SNP	C	C	T	rs111205176|rs149201255		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:88536451C>T	ENST00000282478.7	+	4	2670	c.2637C>T	c.(2635-2637)agC>agT	p.S879S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S879S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	879	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagtgacagcagtgatagca	0.493																																					p.S879S		Atlas-SNP	.											DSPP,colon,carcinoma,0,1	DSPP	174	1	0			c.C2637T						PASS	.						71.0	84.0	80.0					4																	88536451		1629	2928	4557	SO:0001819	synonymous_variant	1834	exon5			TGACAGCAGTGAT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2637C>T	4.37:g.88536451C>T		Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	95	18	0.189474	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	weak		0.493	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
XPNPEP3	63929	hgsc.bcm.edu	37	22	41305142	41305142	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr22:41305142G>A	ENST00000357137.4	+	6	956	c.872G>A	c.(871-873)cGg>cAg	p.R291Q	XPNPEP3_ENST00000544094.1_Missense_Mutation_p.R268Q|XPNPEP3_ENST00000541156.1_3'UTR	NM_022098.3	NP_071381.1	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3, putative	291					glomerular filtration (GO:0003094)|protein processing (GO:0016485)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metallopeptidase activity (GO:0008237)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	17						TTTGAATGCCGGGCTCGTGGC	0.473																																					p.R291Q	Ovarian(145;306 1841 7037 21878 30110)	Atlas-SNP	.											XPNPEP3,NS,carcinoma,0,1	XPNPEP3	46	1	0			c.G872A						scavenged	.						173.0	156.0	162.0					22																	41305142		2203	4300	6503	SO:0001583	missense	63929	exon6			AATGCCGGGCTCG		CCDS14007.1, CCDS74869.1	22q13.2	2010-07-20			ENSG00000196236	ENSG00000196236			28052	protein-coding gene	gene with protein product		613553				15708373, 20179356	Standard	NM_022098		Approved	APP3, NPHPL1	uc003azh.3	Q9NQH7	OTTHUMG00000151312	ENST00000357137.4:c.872G>A	22.37:g.41305142G>A	ENSP00000349658:p.Arg291Gln	Somatic	303	2	0.00660066		WXS	Illumina HiSeq	Phase_I	190	4	0.0210526	NM_022098	B2R9G1|B7Z790|B7Z7B2|Q6I9V9|Q8NDA6|Q9BV27|Q9BVH0	Missense_Mutation	SNP	ENST00000357137.4	37	CCDS14007.1	.	.	.	.	.	.	.	.	.	.	G	37	6.013765	0.97200	.	.	ENSG00000196236	ENST00000357137;ENST00000544094	T;T	0.76839	-1.05;-1.05	5.58	5.58	0.84498	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.88980	0.6585	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88851	0.3319	10	0.51188	T	0.08	.	19.1701	0.93574	0.0:0.0:1.0:0.0	.	291	Q9NQH7	XPP3_HUMAN	Q	291;268	ENSP00000349658:R291Q;ENSP00000441942:R268Q	ENSP00000349658:R291Q	R	+	2	0	XPNPEP3	39635088	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.682000	0.91232	2.642000	0.89623	0.561000	0.74099	CGG	.	.	none		0.473	XPNPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322201.2	NM_022098	
UBXN11	91544	hgsc.bcm.edu	37	1	26608867	26608867	+	Missense_Mutation	SNP	C	C	A	rs193142354		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:26608867C>A	ENST00000374222.1	-	16	1950	c.1486G>T	c.(1486-1488)Ggt>Tgt	p.G496C	UBXN11_ENST00000357089.4_Missense_Mutation_p.G463C|UBXN11_ENST00000314675.7_Missense_Mutation_p.G376C|UBXN11_ENST00000374217.2_Missense_Mutation_p.G463C|UBXN11_ENST00000374223.1_Missense_Mutation_p.G253C|UBXN11_ENST00000374221.3_Missense_Mutation_p.G496C			Q5T124	UBX11_HUMAN	UBX domain protein 11	496	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						ggaccgggaccgggactgggg	0.721																																					p.G496C		Atlas-SNP	.											UBXN11,colon,carcinoma,0,2	UBXN11	54	2	1	Deletion - In frame(1)	ovary(1)	c.G1486T						scavenged	.						25.0	29.0	28.0					1																	26608867		1765	4016	5781	SO:0001583	missense	91544	exon16			CGGGACCGGGACT	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1486G>T	1.37:g.26608867C>A	ENSP00000363339:p.Gly496Cys	Somatic	26	2	0.0769231		WXS	Illumina HiSeq	Phase_I	26	7	0.269231	NM_183008	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	261	0.11950549450549451	72	0.14634146341463414	35	0.09668508287292818	16	0.027972027972027972	138	0.1820580474934037	A	8.132	0.783217	0.16189	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.23950	1.88;1.96;2.3;2.24;2.24;2.3	.	.	.	.	.	.	.	.	T	0.00073	0.0002	N	0.22421	0.69	0.58432	P	2.9999999999752447E-6	D;D;D;D	0.76494	0.999;0.999;0.999;0.998	D;D;D;P	0.65323	0.934;0.934;0.934;0.861	T	0.12578	-1.0542	7	0.66056	D	0.02	.	6.1326	0.20213	0.0:0.6805:0.3194:0.0	.	463;458;376;496	Q5T124-2;Q5T124-4;Q5T124-3;Q5T124	.;.;.;UBX11_HUMAN	C	376;253;463;496;496;463	ENSP00000324721:G376C;ENSP00000363340:G253C;ENSP00000349601:G463C;ENSP00000363338:G496C;ENSP00000363339:G496C;ENSP00000363334:G463C	ENSP00000324721:G376C	G	-	1	0	UBXN11	26481454	0.000000	0.05858	0.121000	0.21740	0.128000	0.20619	-1.193000	0.03049	0.392000	0.25172	0.391000	0.25812	GGT	C|0.880;A|0.120	0.120	strong		0.721	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
PLEKHA7	144100	hgsc.bcm.edu	37	11	17035718	17035718	+	Silent	SNP	A	A	G	rs202005932|rs61881311	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:17035718A>G	ENST00000355661.3	-	2	127	c.117T>C	c.(115-117)caT>caC	p.H39H	PLEKHA7_ENST00000448080.2_Silent_p.H39H|OR7E14P_ENST00000530490.1_RNA|PLEKHA7_ENST00000532079.1_Missense_Mutation_p.I18T|PLEKHA7_ENST00000531066.1_Silent_p.H39H			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	39	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						CGGTGCGCGGATGCAGCCAGG	0.771													g|||	3545	0.707867	0.5408	0.7334	5008	,	,		6163	0.9653		0.6143	False		,,,				2504	0.7464				p.H39H		Atlas-SNP	.											.	PLEKHA7	120	.	0			c.T117C						PASS	.			2252,1710		684,884,413	8.0	10.0	9.0		117	3.2	0.8	11	dbSNP_129	9	5300,2730		1826,1648,541	no	coding-synonymous	PLEKHA7	NM_175058.4		2510,2532,954	GG,GA,AA		33.9975,43.16,37.0247		39/1122	17035718	7552,4440	1981	4015	5996	SO:0001819	synonymous_variant	144100	exon2			GCGCGGATGCAGC	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.117T>C	11.37:g.17035718A>G		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	15	15	1	NM_175058	B4DK33|B4DWC3|Q86VZ7	Silent	SNP	ENST00000355661.3	37	CCDS31434.1	1562	0.7152014652014652	288	0.5853658536585366	256	0.7071823204419889	552	0.965034965034965	466	0.6147757255936676	g	8.595	0.885600	0.17540	0.5684	0.660025	ENSG00000166689	ENST00000532079	.	.	.	3.15	3.15	0.36227	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.10800	-1.0614	4	0.87932	D	0	.	8.2593	0.31775	0.213:0.0:0.787:0.0	rs61881311	.	.	.	T	18	.	ENSP00000434812:I18T	I	-	2	0	PLEKHA7	16992294	1.000000	0.71417	0.816000	0.32577	0.127000	0.20565	1.878000	0.39608	0.316000	0.23135	-1.196000	0.01674	ATC	A|0.305;G|0.695	0.695	strong		0.771	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058	
PDE9A	5152	hgsc.bcm.edu	37	21	44181017	44181017	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr21:44181017C>T	ENST00000291539.6	+	13	1145	c.1085C>T	c.(1084-1086)aCg>aTg	p.T362M	PDE9A_ENST00000398234.3_Splice_Site_p.T261M|PDE9A_ENST00000349112.3_Splice_Site_p.T234M|PDE9A_ENST00000335440.6_Splice_Site_p.T260M|PDE9A_ENST00000335512.4_Splice_Site_p.T302M|PDE9A_ENST00000398227.3_Splice_Site_p.T202M|PDE9A_ENST00000328862.6_Splice_Site_p.T336M|PDE9A_ENST00000398224.3_Splice_Site_p.T235M|PDE9A_ENST00000398236.3_Splice_Site_p.T276M|PDE9A_ENST00000398225.3_Splice_Site_p.T321M|PDE9A_ENST00000398229.3_Splice_Site_p.T228M|PDE9A_ENST00000380328.2_Splice_Site_p.T309M|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000539837.1_Splice_Site_p.T234M|PDE9A_ENST00000398232.3_Splice_Site_p.T295M	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	362	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	TACAACAACACGTATGTACAG	0.502																																					p.T362M		Atlas-SNP	.											PDE9A,NS,carcinoma,0,1	PDE9A	69	1	0			c.C1085T						scavenged	.						116.0	101.0	106.0					21																	44181017		2203	4300	6503	SO:0001630	splice_region_variant	5152	exon13			ACAACACGTATGT	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.1085+1C>T	21.37:g.44181017C>T		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	144	3	0.0208333	NM_002606	B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Missense_Mutation	SNP	ENST00000291539.6	37	CCDS13690.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.340140	0.81911	.	.	ENSG00000160191	ENST00000335512;ENST00000539837;ENST00000291539;ENST00000380328;ENST00000398232;ENST00000398234;ENST00000398236;ENST00000328862;ENST00000335440;ENST00000398225;ENST00000398229;ENST00000398227;ENST00000349112;ENST00000398224	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49	5.29	5.29	0.74685	Metal-dependent phosphohydrolase, HD domain (1);-cyclic nucleotide phosphodiesterase, conserved site (1);5&apos (3);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (3);	0.096026	0.64402	D	0.000001	D	0.83064	0.5173	L	0.48877	1.53	0.58432	D	0.999993	P;D;P;D;D;D;D;D;P;P;D;P;D;D;D;D	0.67145	0.949;0.974;0.949;0.978;0.989;0.996;0.991;0.974;0.866;0.866;0.978;0.949;0.979;0.974;0.978;0.979	B;B;B;B;P;P;B;B;B;B;B;B;B;P;B;P	0.52031	0.259;0.371;0.259;0.259;0.524;0.688;0.411;0.422;0.116;0.116;0.259;0.259;0.358;0.524;0.259;0.656	D	0.84786	0.0776	10	0.62326	D	0.03	.	18.9492	0.92635	0.0:1.0:0.0:0.0	.	234;295;276;261;336;321;254;302;145;202;228;234;260;309;235;362	F5GWD0;O76083-13;O76083-8;O76083-6;O76083-15;O76083-14;O76083-16;O76083-2;O76083-10;O76083-9;O76083-11;O76083-4;O76083-12;O76083-5;O76083-3;O76083	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;PDE9A_HUMAN	M	302;234;362;309;295;261;276;336;260;321;228;202;234;235	ENSP00000335242:T302M;ENSP00000441899:T234M;ENSP00000291539:T362M;ENSP00000369685:T309M;ENSP00000381287:T295M;ENSP00000381289:T261M;ENSP00000381291:T276M;ENSP00000328699:T336M;ENSP00000335365:T260M;ENSP00000381281:T321M;ENSP00000381285:T228M;ENSP00000381283:T202M;ENSP00000344730:T234M;ENSP00000381280:T235M	ENSP00000291539:T362M	T	+	2	0	PDE9A	43054086	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.033000	0.76504	2.470000	0.83445	0.655000	0.94253	ACG	.	.	none		0.502	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1		Missense_Mutation
PEG3	5178	hgsc.bcm.edu	37	19	57325511	57325511	+	Silent	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:57325511A>G	ENST00000326441.9	-	10	4662	c.4299T>C	c.(4297-4299)atT>atC	p.I1433I	ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Silent_p.I1307I|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000598410.1_Silent_p.I1309I|PEG3_ENST00000423103.2_Silent_p.I1433I	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1433	4 X 5 AA repeat of P-X-G-E-A.|Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CAGCCTCTCCAATGGGCTCTG	0.587																																					p.I1433I		Atlas-SNP	.											ZIM2_ENST00000326441,NS,carcinoma,-1,2	PEG3	414	2	0			c.T4299C						scavenged	.						47.0	48.0	48.0					19																	57325511		2202	4299	6501	SO:0001819	synonymous_variant	5178	exon9			CTCTCCAATGGGC	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4299T>C	19.37:g.57325511A>G		Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	179	3	0.0167598	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	ENST00000326441.9	37	CCDS12948.1																																																																																			.	.	none		0.587	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
FLT1	2321	hgsc.bcm.edu	37	13	28964201	28964201	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr13:28964201C>T	ENST00000282397.4	-	13	1952	c.1701G>A	c.(1699-1701)ccG>ccA	p.P567P	FLT1_ENST00000541932.1_Silent_p.P567P	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	567	Ig-like C2-type 6.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCCTTCCGTCGGCATTTTTT	0.358																																					p.P567P		Atlas-SNP	.											FLT1_ENST00000541932,rectum,carcinoma,-1,2	FLT1	393	2	0			c.G1701A						scavenged	.						113.0	107.0	109.0					13																	28964201		2203	4300	6503	SO:0001819	synonymous_variant	2321	exon13			TTCCGTCGGCATT	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1701G>A	13.37:g.28964201C>T		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	99	2	0.020202	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Silent	SNP	ENST00000282397.4	37	CCDS9330.1																																																																																			.	.	none		0.358	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
MTF1	4520	hgsc.bcm.edu	37	1	38305756	38305756	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:38305756C>T	ENST00000373036.4	-	3	623	c.483G>A	c.(481-483)caG>caA	p.Q161Q		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	161					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.Q161H(1)		endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GGTGAGTCTTCTGGTGGGTTC	0.537																																					p.Q161Q		Atlas-SNP	.											MTF1,NS,NS,0,1	MTF1	67	1	1	Substitution - Missense(1)	pancreas(1)	c.G483A						scavenged	.						156.0	137.0	144.0					1																	38305756		2203	4300	6503	SO:0001819	synonymous_variant	4520	exon3			AGTCTTCTGGTGG	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.483G>A	1.37:g.38305756C>T		Somatic	226	0	0		WXS	Illumina HiSeq	Phase_I	301	3	0.00996678	NM_005955	B2RAK6|Q96CB1	Silent	SNP	ENST00000373036.4	37	CCDS30676.1																																																																																			.	.	none		0.537	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955	
FLG	2312	hgsc.bcm.edu	37	1	152284649	152284649	+	Missense_Mutation	SNP	C	C	T	rs142623038	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:152284649C>T	ENST00000368799.1	-	3	2748	c.2713G>A	c.(2713-2715)Ggc>Agc	p.G905S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	905	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCCTGGAGCCGTCTCTTGAT	0.567									Ichthyosis				-|||	15	0.00299521	0.003	0.0029	5008	,	,		21416	0.001		0.006	False		,,,				2504	0.002				p.G905S		Atlas-SNP	.											FLG,NS,carcinoma,+1,1	FLG	900	1	0			c.G2713A						scavenged	.	C	SER/GLY	9,4397		0,9,2194	400.0	381.0	388.0		2713	-5.8	0.0	1	dbSNP_134	388	50,8550		0,50,4250	no	missense	FLG	NM_002016.1	56	0,59,6444	TT,TC,CC		0.5814,0.2043,0.4536	benign	905/4062	152284649	59,12947	2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TGGAGCCGTCTCT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2713G>A	1.37:g.152284649C>T	ENSP00000357789:p.Gly905Ser	Somatic	419	5	0.0119332		WXS	Illumina HiSeq	Phase_I	265	5	0.0188679	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	8	0.003663003663003663	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	6	0.0079155672823219	-	8.071	0.770148	0.15983	0.002043	0.005814	ENSG00000143631	ENST00000368799	T	0.00824	5.65	2.93	-5.77	0.02369	.	.	.	.	.	T	0.00210	0.0006	L	0.59436	1.845	0.09310	N	1	B	0.28760	0.221	B	0.19666	0.026	T	0.51212	-0.8734	9	0.05721	T	0.95	.	0.3944	0.00415	0.1836:0.2463:0.1864:0.3837	.	905	P20930	FILA_HUMAN	S	905	ENSP00000357789:G905S	ENSP00000357789:G905S	G	-	1	0	FLG	150551273	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.440000	0.02412	-1.405000	0.02048	-0.532000	0.04303	GGC	C|0.995;T|0.005	0.005	strong		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
DST	667	hgsc.bcm.edu	37	6	56374517	56374517	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:56374517A>G	ENST00000361203.3	-	69	17982	c.17975T>C	c.(17974-17976)tTg>tCg	p.L5992S	DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_Missense_Mutation_p.L6103S|DST_ENST00000421834.2_Missense_Mutation_p.L4015S|DST_ENST00000446842.2_Missense_Mutation_p.L5777S|DST_ENST00000370788.2_Missense_Mutation_p.L3906S|DST_ENST00000370754.5_Missense_Mutation_p.L6281S|DST_ENST00000244364.6_Missense_Mutation_p.L3689S|DST_ENST00000340834.4_5'UTR			Q03001	DYST_HUMAN	dystonin	5993					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGTTTCATACAACGGCTGTAG	0.428																																					p.L3689S		Atlas-SNP	.											.	DST	1427	.	0			c.T11066C						PASS	.						118.0	109.0	112.0					6																	56374517		1872	4115	5987	SO:0001583	missense	667	exon55			TCATACAACGGCT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17975T>C	6.37:g.56374517A>G	ENSP00000354508:p.Leu5992Ser	Somatic	219	0	0		WXS	Illumina HiSeq	Phase_I	239	94	0.393305	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	A	11.64	1.698379	0.30142	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203;ENST00000537444	T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.76	5.76	0.90799	.	0.185737	0.24242	N	0.040256	T	0.25827	0.0629	N	0.04880	-0.145	0.28311	N	0.922675	D;B;B;B;B	0.53745	0.962;0.201;0.104;0.016;0.007	P;B;B;B;B	0.58077	0.832;0.2;0.059;0.034;0.01	T	0.14200	-1.0481	9	0.08179	T	0.78	.	16.0663	0.80878	1.0:0.0:0.0:0.0	.	4015;6103;6281;6101;3689	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	S	3689;6281;6103;4015;5777;3906;5992;105	ENSP00000244364:L3689S;ENSP00000359790:L6281S;ENSP00000359805:L6103S;ENSP00000400883:L4015S;ENSP00000393645:L5777S;ENSP00000359824:L3906S;ENSP00000354508:L5992S	ENSP00000244364:L3689S	L	-	2	0	DST	56482476	0.160000	0.22878	0.882000	0.34594	0.831000	0.47069	3.609000	0.54117	2.196000	0.70406	0.533000	0.62120	TTG	.	.	none		0.428	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
MAML2	84441	hgsc.bcm.edu	37	11	95825404	95825404	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:95825404C>T	ENST00000524717.1	-	2	3075	c.1791G>A	c.(1789-1791)caG>caA	p.Q597Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	597					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgct	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q597Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,caecum,carcinoma,0,1	MAML2	94	1	0			c.G1791A						scavenged	.						25.0	32.0	29.0					11																	95825404		2096	4109	6205	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1791G>A	11.37:g.95825404C>T		Somatic	117	2	0.017094		WXS	Illumina HiSeq	Phase_I	194	4	0.0206186	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.	.	none		0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
CD8B	926	hgsc.bcm.edu	37	2	87085302	87085302	+	Missense_Mutation	SNP	C	C	G	rs201066720		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:87085302C>G	ENST00000390655.6	-	2	339	c.281G>C	c.(280-282)cGg>cCg	p.R94P	CD8B_ENST00000393761.2_Missense_Mutation_p.R94P|CD8B_ENST00000431506.2_Intron|CD8B_ENST00000349455.3_Missense_Mutation_p.R94P|CD8B_ENST00000393759.2_Missense_Mutation_p.R94P|CD8B_ENST00000331469.2_Missense_Mutation_p.R94P	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	94	Ig-like V-type.				immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						GCTTGCATCCCGAAACACAGC	0.562																																					p.R94P		Atlas-SNP	.											CD8B,colon,carcinoma,-1,1	CD8B	37	1	0			c.G281C						scavenged	.						109.0	98.0	102.0					2																	87085302		2203	4298	6501	SO:0001583	missense	926	exon2			GCATCCCGAAACA		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.281G>C	2.37:g.87085302C>G	ENSP00000375070:p.Arg94Pro	Somatic	317	12	0.0378549		WXS	Illumina HiSeq	Phase_I	480	17	0.0354167	NM_004931	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Missense_Mutation	SNP	ENST00000390655.6	37	CCDS1997.1	172	0.07875457875457875	33	0.06707317073170732	24	0.06629834254143646	56	0.0979020979020979	59	0.07783641160949868	C	10.13	1.265637	0.23136	.	.	ENSG00000172116	ENST00000393761;ENST00000393759;ENST00000349455;ENST00000331469;ENST00000390655;ENST00000445248	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12	4.35	-7.3	0.01446	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.173270	0.01667	N	0.025437	T	0.01320	0.0043	L	0.28274	0.84	0.09310	N	1	B;B;B;B;B;B	0.23591	0.045;0.088;0.016;0.014;0.017;0.072	B;B;B;B;B;B	0.23574	0.047;0.025;0.027;0.008;0.012;0.015	T	0.03695	-1.1012	10	0.44086	T	0.13	3.5479	1.7502	0.02970	0.1128:0.2394:0.2248:0.423	.	94;94;94;94;94;94	Q496E2;Q53QL8;P10966;P10966-3;P10966-2;P10966-6	.;.;CD8B_HUMAN;.;.;.	P	94	ENSP00000377358:R94P;ENSP00000377356:R94P;ENSP00000340592:R94P;ENSP00000331172:R94P;ENSP00000375070:R94P	ENSP00000331172:R94P	R	-	2	0	CD8B	86938813	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	-1.356000	0.02609	-1.551000	0.01706	0.555000	0.69702	CGG	C|0.921;G|0.079	0.079	strong		0.562	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	NM_172099	
TMEM169	92691	hgsc.bcm.edu	37	2	216965057	216965057	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:216965057C>T	ENST00000295658.4	+	3	893	c.686C>T	c.(685-687)gCt>gTt	p.A229V	TMEM169_ENST00000406027.2_Missense_Mutation_p.A229V|TMEM169_ENST00000454545.1_Missense_Mutation_p.A229V|TMEM169_ENST00000437356.2_Missense_Mutation_p.A229V	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	229						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGCCTCTACGCTGCTGTGGTC	0.582																																					p.A229V		Atlas-SNP	.											TMEM169,NS,carcinoma,+1,1	TMEM169	46	1	0			c.C686T						scavenged	.						231.0	183.0	200.0					2																	216965057		2203	4300	6503	SO:0001583	missense	92691	exon4			TCTACGCTGCTGT	AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.686C>T	2.37:g.216965057C>T	ENSP00000295658:p.Ala229Val	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	259	3	0.011583	NM_001142310	B2R8W6	Missense_Mutation	SNP	ENST00000295658.4	37	CCDS2401.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839156	0.71373	.	.	ENSG00000163449	ENST00000454545;ENST00000437356;ENST00000295658;ENST00000406027	.	.	.	4.93	4.93	0.64822	.	0.167251	0.53938	D	0.000044	T	0.55940	0.1952	L	0.58101	1.795	0.45822	D	0.998698	P	0.42296	0.775	B	0.39660	0.306	T	0.57877	-0.7735	8	.	.	.	-15.1008	17.308	0.87200	0.0:1.0:0.0:0.0	.	229	Q96HH4	TM169_HUMAN	V	229	.	.	A	+	2	0	TMEM169	216673302	1.000000	0.71417	0.984000	0.44739	0.556000	0.35491	7.635000	0.83286	2.550000	0.86006	0.655000	0.94253	GCT	.	.	none		0.582	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256666.2	NM_138390	
PHGR1	644844	hgsc.bcm.edu	37	15	40648372	40648372	+	Silent	SNP	T	T	C	rs12900982		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr15:40648372T>C	ENST00000448599.2	+	4	173	c.117T>C	c.(115-117)ggT>ggC	p.G39G	DISP2_ENST00000267889.3_5'Flank	NM_001145643.1	NP_001139115.1	C9JFL3	PHGR1_HUMAN	proline/histidine/glycine-rich 1	39	Gly-rich.																CCCACCATGGTCCAGGGCCCT	0.776																																					p.G39G		Atlas-SNP	.											PHGR1,rectum,carcinoma,0,2	PHGR1	14	2	0			c.T117C						scavenged	.						1.0	2.0	2.0					15																	40648372		356	1106	1462	SO:0001819	synonymous_variant	644844	exon3			CCATGGTCCAGGG		CCDS45225.1	15q15.1	2009-10-08				ENSG00000233041			37226	protein-coding gene	gene with protein product							Standard	NM_001145643		Approved		uc010uco.2	C9JFL3		ENST00000448599.2:c.117T>C	15.37:g.40648372T>C		Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	5	4	0.8	NM_001145643		Silent	SNP	ENST00000448599.2	37	CCDS45225.1																																																																																			T|0.839;C|0.161	0.161	strong		0.776	PHGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418450.1	NM_001145643	
TNFRSF10C	8794	hgsc.bcm.edu	37	8	22974360	22974360	+	Missense_Mutation	SNP	C	C	A	rs12550828		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:22974360C>A	ENST00000356864.3	+	5	1128	c.596C>A	c.(595-597)aCc>aAc	p.T199N	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.T97N	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	199			T -> N (in dbSNP:rs12550828).		apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.T199N(3)		endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGACCACCAGCCCG	0.627																																					p.T199N		Atlas-SNP	.											TNFRSF10C,colon,carcinoma,0,3	TNFRSF10C	30	3	3	Substitution - Missense(3)	large_intestine(3)	c.C596A						scavenged	.						63.0	81.0	75.0					8																	22974360		2203	4298	6501	SO:0001583	missense	8794	exon5			CAATGACCACCAG	AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.596C>A	8.37:g.22974360C>A	ENSP00000349324:p.Thr199Asn	Somatic	148	6	0.0405405		WXS	Illumina HiSeq	Phase_I	181	9	0.0497238	NM_003841	O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.942372	0.00479	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.61510	0.1;0.69	.	.	.	.	60.732300	0.00622	N	0.000444	T	0.35364	0.0929	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.42959	0.403	T	0.37842	-0.9688	9	0.13470	T	0.59	.	4.6548	0.12611	0.3618:0.6381:0.0:1.0E-4	rs12550828	199	O14798	TR10C_HUMAN	N	199;97;199	ENSP00000349324:T199N;ENSP00000437612:T97N	ENSP00000349324:T199N	T	+	2	0	TNFRSF10C	23030305	0.000000	0.05858	0.011000	0.14972	0.077000	0.17291	-1.773000	0.01786	-1.934000	0.01051	-1.966000	0.00469	ACC	C|1.000;|0.000	.	weak		0.627	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
TBC1D3	729873	hgsc.bcm.edu	37	17	36339597	36339597	+	Missense_Mutation	SNP	G	G	T	rs373252714		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:36339597G>T	ENST00000354664.4	-	13	1216	c.1060C>A	c.(1060-1062)Cag>Aag	p.Q354K	TBC1D3_ENST00000519532.1_Missense_Mutation_p.Q332K|TBC1D3_ENST00000339023.4_3'UTR|TBC1D3_ENST00000537432.1_Missense_Mutation_p.Q354K	NM_001123391.2	NP_001116863.2	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3	354				Q -> K (in Ref. 2; CAB66794). {ECO:0000305}.		plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			breast(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGGTCCCCCTGCTTTCTTGTT	0.592																																					p.Q354K		Atlas-SNP	.											TBC1D3_ENST00000537432,NS,carcinoma,0,4	TBC1D3F	14	4	0			c.C1060A						scavenged	.																																			SO:0001583	missense	84218	exon13			CCCCCTGCTTTCT		CCDS45658.1	17q12	2014-09-16			ENSG00000274611	ENSG00000274419			19031	protein-coding gene	gene with protein product	"""prostate cancer gene 17"""	607741				12604796, 12359748, 16863688	Standard	NM_001123391		Approved	TBC1D3A, DKFZp434P2235, PRC17	uc002hoo.2	Q8IZP1	OTTHUMG00000188487	ENST00000354664.4:c.1060C>A	17.37:g.36339597G>T	ENSP00000346691:p.Gln354Lys	Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	9	5	0.555556	NM_032258	A6NGX2|A8K007|Q6DCB4|Q9H0B9|Q9UDD4	Missense_Mutation	SNP	ENST00000354664.4	37	CCDS45658.1	.	.	.	.	.	.	.	.	.	.	-	0.004	-2.271786	0.00257	.	.	ENSG00000197681	ENST00000518551;ENST00000354664;ENST00000431880;ENST00000519532;ENST00000537432	T;T;T;T	0.13901	3.07;3.1;2.55;3.1	0.109	0.109	0.14578	.	0.201240	0.41097	N	0.000949	T	0.07818	0.0196	N	0.05280	-0.08	0.80722	D	1	P;D;D	0.58970	0.836;0.984;0.977	B;P;P	0.53224	0.325;0.633;0.721	T	0.17379	-1.0371	9	0.02654	T	1	.	.	.	.	.	354;354;332	A8K007;Q8IZP1;F6U074	.;TBC3A_HUMAN;.	K	398;354;104;332;354	ENSP00000428847:Q398K;ENSP00000346691:Q354K;ENSP00000429926:Q332K;ENSP00000439621:Q354K	ENSP00000346691:Q354K	Q	-	1	0	TBC1D3	33593403	0.793000	0.28825	0.049000	0.19019	0.051000	0.14879	0.961000	0.29267	0.181000	0.19994	0.184000	0.17185	CAG	.	.	weak		0.592	TBC1D3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378681.1	NM_001123391	
FAM47C	442444	hgsc.bcm.edu	37	X	37028314	37028314	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chrX:37028314C>T	ENST00000358047.3	+	1	1883	c.1831C>T	c.(1831-1833)Cca>Tca	p.P611S		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	611										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCCGGAGCCTCCAGAGACTCG	0.647																																					p.P611S		Atlas-SNP	.											.	FAM47C	267	.	0			c.C1831T						PASS	.						22.0	25.0	24.0					X																	37028314		2186	4274	6460	SO:0001583	missense	442444	exon1			GAGCCTCCAGAGA	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1831C>T	X.37:g.37028314C>T	ENSP00000367913:p.Pro611Ser	Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	227	94	0.414097	NM_001013736	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	12.85	2.061132	0.36373	.	.	ENSG00000198173	ENST00000358047	T	0.22134	1.97	1.02	0.0439	0.14224	.	.	.	.	.	T	0.22898	0.0553	M	0.80183	2.485	0.09310	N	1	P	0.50710	0.938	B	0.41202	0.35	T	0.15009	-1.0452	9	0.42905	T	0.14	.	5.3242	0.15896	0.0:0.7636:0.0:0.2364	.	611	Q5HY64	FA47C_HUMAN	S	611	ENSP00000367913:P611S	ENSP00000367913:P611S	P	+	1	0	FAM47C	36938235	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.449000	0.21744	-0.043000	0.13513	-0.457000	0.05445	CCA	.	.	none		0.647	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
ARNTL2	56938	hgsc.bcm.edu	37	12	27573380	27573380	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:27573380C>T	ENST00000266503.5	+	17	1844	c.1826C>T	c.(1825-1827)gCc>gTc	p.A609V	ARNTL2_ENST00000395901.2_Missense_Mutation_p.A572V|ARNTL2_ENST00000546179.1_Missense_Mutation_p.P536S|ARNTL2_ENST00000311001.5_Missense_Mutation_p.A595V|ARNTL2_ENST00000542388.1_Missense_Mutation_p.A524V|ARNTL2_ENST00000544915.1_Missense_Mutation_p.A575V|ARNTL2_ENST00000261178.5_Missense_Mutation_p.A561V|RP11-165P7.1_ENST00000500498.2_RNA			Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear translocator-like 2	609					circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	21	Colorectal(261;0.0847)|Lung SC(9;0.184)					GATGACACAGCCATGGCTGCA	0.458																																					p.A609V		Atlas-SNP	.											ARNTL2,NS,carcinoma,-1,1	ARNTL2	54	1	0			c.C1826T						scavenged	.						108.0	107.0	107.0					12																	27573380		2203	4300	6503	SO:0001583	missense	56938	exon17			ACACAGCCATGGC	AF246961	CCDS8712.1, CCDS58219.1, CCDS58220.1, CCDS58221.1, CCDS58222.1	12p12.2-p11.2	2013-05-21			ENSG00000029153	ENSG00000029153		"""Basic helix-loop-helix proteins"""	18984	protein-coding gene	gene with protein product		614517				10864977, 10964693	Standard	NM_020183		Approved	BMAL2, MOP9, CLIF, PASD9, bHLHe6	uc001rht.2	Q8WYA1	OTTHUMG00000169257	ENST00000266503.5:c.1826C>T	12.37:g.27573380C>T	ENSP00000266503:p.Ala609Val	Somatic	107	2	0.0186916		WXS	Illumina HiSeq	Phase_I	121	2	0.0165289	NM_020183	B7Z429|F5H402|Q8WYA2|Q8WYA3|Q8WYA4|Q96J63|Q9H2M4|Q9NS70|Q9NYQ4|Q9NYQ5	Missense_Mutation	SNP	ENST00000266503.5	37	CCDS8712.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.63|15.63	2.889464|2.889464	0.52014|0.52014	.|.	.|.	ENSG00000029153|ENSG00000029153	ENST00000544915;ENST00000395901;ENST00000311001;ENST00000261178;ENST00000266503;ENST00000542388|ENST00000546179;ENST00000457040	T;T;T;T;T;T|T	0.36520|0.06849	1.25;1.25;1.25;1.25;1.25;1.25|3.25	3.48|3.48	2.57|2.57	0.30868|0.30868	.|.	0.521097|.	0.18803|.	N|.	0.130738|.	T|T	0.12305|0.12305	0.0299|0.0299	M|M	0.80422|0.80422	2.495|2.495	0.30411|0.30411	N|N	0.779104|0.779104	P;B;B;P;P|B	0.45212|0.32829	0.853;0.326;0.326;0.468;0.75|0.386	B;B;B;B;B|B	0.43508|0.28139	0.422;0.238;0.238;0.128;0.242|0.086	T|T	0.03268|0.03268	-1.1054|-1.1054	10|8	0.87932|.	D|.	0|.	.|.	10.9188|10.9188	0.47152|0.47152	0.1868:0.8132:0.0:0.0|0.1868:0.8132:0.0:0.0	.|.	575;572;561;595;609|536	Q8WYA1-5;Q8WYA1-3;Q8WYA1-4;Q8WYA1-2;Q8WYA1|F5H402	.;.;.;.;BMAL2_HUMAN|.	V|S	575;572;595;561;609;524|536;561	ENSP00000442438:A575V;ENSP00000379238:A572V;ENSP00000312247:A595V;ENSP00000261178:A561V;ENSP00000266503:A609V;ENSP00000445836:A524V|ENSP00000438545:P536S	ENSP00000261178:A561V|.	A|P	+|+	2|1	0|0	ARNTL2|ARNTL2	27464647|27464647	0.991000|0.991000	0.36638|0.36638	0.873000|0.873000	0.34254|0.34254	0.977000|0.977000	0.68977|0.68977	1.348000|1.348000	0.33987|0.33987	0.761000|0.761000	0.33130|0.33130	0.563000|0.563000	0.77884|0.77884	GCC|CCA	.	.	none		0.458	ARNTL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403162.1	NM_020183	
GAD2	2572	hgsc.bcm.edu	37	10	26508109	26508109	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:26508109C>T	ENST00000376261.3	+	4	927	c.424C>T	c.(424-426)Ctc>Ttc	p.L142F	GAD2_ENST00000259271.3_Missense_Mutation_p.L142F|GAD2_ENST00000376248.1_Missense_Mutation_p.L28F	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	142					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TAATGAGCTTCTCCAAGAATA	0.343																																					p.L142F		Atlas-SNP	.											.	GAD2	116	.	0			c.C424T						PASS	.						100.0	105.0	103.0					10																	26508109		2203	4300	6503	SO:0001583	missense	2572	exon4			GAGCTTCTCCAAG	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.424C>T	10.37:g.26508109C>T	ENSP00000365437:p.Leu142Phe	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	87	4	0.045977	NM_000818	Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	37	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328723	0.60743	.	.	ENSG00000136750	ENST00000376261;ENST00000259271;ENST00000428517;ENST00000376248	T;T;T;T	0.59906	0.23;0.23;0.23;1.13	5.61	5.61	0.85477	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.70762	0.3261	L	0.53671	1.685	0.80722	D	1	D;B	0.89917	1.0;0.288	D;B	0.91635	0.999;0.12	T	0.62751	-0.6788	10	0.09843	T	0.71	-15.2362	19.6436	0.95767	0.0:1.0:0.0:0.0	.	142;142	Q4G154;Q05329	.;DCE2_HUMAN	F	142;142;142;28	ENSP00000365437:L142F;ENSP00000259271:L142F;ENSP00000390434:L142F;ENSP00000365424:L28F	ENSP00000259271:L142F	L	+	1	0	GAD2	26548115	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.666000	0.68059	2.621000	0.88768	0.650000	0.86243	CTC	.	.	none		0.343	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
CUL2	8453	hgsc.bcm.edu	37	10	35317807	35317807	+	Silent	SNP	C	C	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:35317807C>A	ENST00000374748.1	-	17	1861	c.1548G>T	c.(1546-1548)gcG>gcT	p.A516A	CUL2_ENST00000374749.3_Silent_p.A516A|CUL2_ENST00000374746.1_Silent_p.A516A|CUL2_ENST00000374751.3_Silent_p.A516A|CUL2_ENST00000602371.1_Silent_p.A459A|CUL2_ENST00000537177.1_Silent_p.A535A|CUL2_ENST00000374742.1_Silent_p.A516A			Q13617	CUL2_HUMAN	cullin 2	516					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						TAAGAGGCCACGCACCAGCCT	0.318																																					p.A535A		Atlas-SNP	.											CUL2,caecum,carcinoma,-1,2	CUL2	63	2	0			c.G1605T						scavenged	.						38.0	39.0	39.0					10																	35317807		2203	4300	6503	SO:0001819	synonymous_variant	8453	exon16			AGGCCACGCACCA	U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.1548G>T	10.37:g.35317807C>A		Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	113	2	0.0176991	NM_001198778	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Silent	SNP	ENST00000374748.1	37	CCDS7179.1																																																																																			.	.	none		0.318	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591	
PRAMEF11	440560	hgsc.bcm.edu	37	1	12887686	12887686	+	Silent	SNP	T	T	C	rs59802947	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:12887686T>C	ENST00000535591.1	-	3	366	c.171A>G	c.(169-171)agA>agG	p.R57R		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	57					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.R57R(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GAAGTTTCCATCTCCTGTGGG	0.468													.|||	5	0.000998403	0.0008	0.0	5008	,	,		21622	0.001		0.0	False		,,,				2504	0.0031				p.R57R		Atlas-SNP	.											PRAMEF11,NS,carcinoma,0,1	PRAMEF11	72	1	1	Substitution - coding silent(1)	endometrium(1)	c.A171G						scavenged	.																																			SO:0001819	synonymous_variant	440560	exon3			TTTCCATCTCCTG	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.171A>G	1.37:g.12887686T>C		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	53	5	0.0943396	NM_001146344		Silent	SNP	ENST00000535591.1	37	CCDS53268.1																																																																																			T|0.986;C|0.014	0.014	strong		0.468	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341	
CYP2J2	1573	hgsc.bcm.edu	37	1	60381646	60381646	+	Missense_Mutation	SNP	C	C	T	rs11572242	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:60381646C>T	ENST00000371204.3	-	2	380	c.337G>A	c.(337-339)Gtg>Atg	p.V113M	CYP2J2_ENST00000492633.1_5'Flank	NM_000775.2	NP_000766.2	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J, polypeptide 2	113			V -> M (in dbSNP:rs11572242).		arachidonic acid metabolic process (GO:0019369)|epoxygenase P450 pathway (GO:0019373)|icosanoid metabolic process (GO:0006690)|linoleic acid metabolic process (GO:0043651)|regulation of heart contraction (GO:0008016)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	arachidonic acid 11,12-epoxygenase activity (GO:0008405)|arachidonic acid 14,15-epoxygenase activity (GO:0008404)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|linoleic acid epoxygenase activity (GO:0071614)	p.V113M(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|skin(1)	26	all_cancers(7;0.000396)				Apixaban(DB06605)|Astemizole(DB00637)|Cholecalciferol(DB00169)|Levomilnacipran(DB08918)|Masoprocol(DB00179)|Rivaroxaban(DB06228)	ATAGGGGTCACGGGGCGGTTC	0.428													C|||	3	0.000599042	0.0008	0.0029	5008	,	,		19082	0.0		0.0	False		,,,				2504	0.0				p.V113M		Atlas-SNP	.											CYP2J2,colon,carcinoma,0,1	CYP2J2	34	1	1	Substitution - Missense(1)	large_intestine(1)	c.G337A						PASS	.						108.0	110.0	110.0					1																	60381646		2203	4300	6503	SO:0001583	missense	1573	exon2			GGGTCACGGGGCG	BC032594	CCDS613.1	1p31.3-p31.2	2008-02-05	2003-01-14		ENSG00000134716	ENSG00000134716		"""Cytochrome P450s"""	2634	protein-coding gene	gene with protein product		601258	"""cytochrome P450, subfamily IIJ (arachidonic acid epoxygenase) polypeptide 2"""			9570962	Standard	NM_000775		Approved		uc001czq.3	P51589	OTTHUMG00000008991	ENST00000371204.3:c.337G>A	1.37:g.60381646C>T	ENSP00000360247:p.Val113Met	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	128	44	0.34375	NM_000775	B2RD33|Q8TF13	Missense_Mutation	SNP	ENST00000371204.3	37	CCDS613.1	3	0.0013736263736263737	1	0.0020325203252032522	2	0.0055248618784530384	0	0.0	0	0.0	C	7.417	0.635998	0.14386	.	.	ENSG00000134716	ENST00000371204	T	0.69040	-0.37	5.8	-11.6	0.00059	.	3.755470	0.00166	N	0.000010	T	0.40372	0.1114	N	0.25789	0.76	0.09310	N	1	P	0.38020	0.615	B	0.36186	0.219	T	0.56275	-0.8006	10	0.44086	T	0.13	.	10.2805	0.43537	0.0643:0.5248:0.2124:0.1986	rs11572242;rs52814181;rs11572242	113	P51589	CP2J2_HUMAN	M	113	ENSP00000360247:V113M	ENSP00000360247:V113M	V	-	1	0	CYP2J2	60154234	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.110000	0.00150	-3.492000	0.00153	-2.084000	0.00378	GTG	C|0.998;T|0.002	0.002	strong		0.428	CYP2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024940.1	NM_000775	
XYLB	9942	hgsc.bcm.edu	37	3	38415956	38415956	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:38415956C>T	ENST00000207870.3	+	11	941	c.851C>T	c.(850-852)tCg>tTg	p.S284L	XYLB_ENST00000542835.1_Missense_Mutation_p.S147L	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	284					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		TTCTCAGCGTCGCTGGCAGGC	0.587																																					p.S284L		Atlas-SNP	.											XYLB,bladder,carcinoma,0,2	XYLB	50	2	0			c.C851T						scavenged	.						126.0	112.0	117.0					3																	38415956		2203	4300	6503	SO:0001583	missense	9942	exon11			CAGCGTCGCTGGC	AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.851C>T	3.37:g.38415956C>T	ENSP00000207870:p.Ser284Leu	Somatic	218	0	0		WXS	Illumina HiSeq	Phase_I	240	3	0.0125	NM_005108	B2RAW4|B4DDT2|B9EH64	Missense_Mutation	SNP	ENST00000207870.3	37	CCDS2678.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.906612	0.92107	.	.	ENSG00000093217	ENST00000207870;ENST00000542835	T;T	0.50277	0.75;0.75	5.63	5.63	0.86233	Carbohydrate kinase, FGGY, N-terminal (1);	0.118924	0.64402	D	0.000014	T	0.68007	0.2954	M	0.80746	2.51	0.54753	D	0.999983	D;D	0.58620	0.983;0.978	P;P	0.58820	0.846;0.745	T	0.71464	-0.4585	10	0.72032	D	0.01	.	17.5362	0.87832	0.0:1.0:0.0:0.0	.	147;284	B4DDT2;O75191	.;XYLB_HUMAN	L	284;147	ENSP00000207870:S284L;ENSP00000443659:S147L	ENSP00000207870:S284L	S	+	2	0	XYLB	38390960	1.000000	0.71417	0.675000	0.29917	0.964000	0.63967	6.444000	0.73452	2.815000	0.96918	0.561000	0.74099	TCG	.	.	none		0.587	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254062.2	NM_005108	
TMC7	79905	hgsc.bcm.edu	37	16	19027805	19027805	+	Silent	SNP	C	C	T	rs547245832		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:19027805C>T	ENST00000304381.5	+	3	475	c.345C>T	c.(343-345)tcC>tcT	p.S115S	TMC7_ENST00000421369.3_Silent_p.S5S|TMC7_ENST00000569532.1_Silent_p.S115S	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	115					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						AGTATCTCTCCGAATGGGACC	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		22009	0.0		0.0	False		,,,				2504	0.001				p.S115S		Atlas-SNP	.											TMC7,NS,carcinoma,+1,1	TMC7	75	1	0			c.C345T						scavenged	.						126.0	102.0	110.0					16																	19027805		2197	4300	6497	SO:0001819	synonymous_variant	79905	exon3			TCTCTCCGAATGG	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.345C>T	16.37:g.19027805C>T		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	322	4	0.0124224	NM_024847	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Silent	SNP	ENST00000304381.5	37	CCDS10573.1																																																																																			.	.	none		0.512	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	
POTEF	728378	hgsc.bcm.edu	37	2	130872529	130872529	+	Silent	SNP	G	G	A	rs556671650	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:130872529G>A	ENST00000409914.2	-	5	1134	c.735C>T	c.(733-735)taC>taT	p.Y245Y	POTEF_ENST00000361163.4_Silent_p.Y255Y|POTEF_ENST00000360967.5_Silent_p.Y245Y|POTEF_ENST00000357462.5_Silent_p.Y245Y	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	245					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						TATAGATAGCGTAGTGCAGAG	0.383													.|||	220	0.0439297	0.0151	0.0504	5008	,	,		20686	0.1121		0.0338	False		,,,				2504	0.0184				p.Y245Y		Atlas-SNP	.											POTEF,NS,carcinoma,0,2	POTEF	140	2	0			c.C735T						scavenged	.																																			SO:0001819	synonymous_variant	728378	exon5			GATAGCGTAGTGC	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.735C>T	2.37:g.130872529G>A		Somatic	1281	2	0.00156128		WXS	Illumina HiSeq	Phase_I	816	2	0.00245098	NM_001099771	A6NC34	Silent	SNP	ENST00000409914.2	37	CCDS46409.1																																																																																			.	.	none		0.383	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643246	1643246	+	Silent	SNP	A	A	G	rs142004120	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:1643246A>G	ENST00000399682.1	-	1	122	c.78T>C	c.(76-78)tcT>tcC	p.S26S		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccccacagccagagccacagc	0.682													-|||	374	0.0746805	0.0908	0.0562	5008	,	,		7183	0.0923		0.0596	False		,,,				2504	0.0634				p.S26S		Atlas-SNP	.											KRTAP5-4,colon,carcinoma,0,2	KRTAP5-4	78	2	0			c.T78C						scavenged	.						4.0	8.0	7.0					11																	1643246		639	1494	2133	SO:0001819	synonymous_variant	387267	exon1			ACAGCCAGAGCCA	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.78T>C	11.37:g.1643246A>G		Somatic	120	12	0.1		WXS	Illumina HiSeq	Phase_I	197	33	0.167513	NM_001012709		Silent	SNP	ENST00000399682.1	37																																																																																				A|0.886;G|0.114	0.114	strong		0.682	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
RUNX1	861	hgsc.bcm.edu	37	21	36252870	36252870	+	Silent	SNP	G	G	A	rs200907577		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr21:36252870G>A	ENST00000344691.4	-	2	1988	c.411C>T	c.(409-411)gtC>gtT	p.V137V	RUNX1_ENST00000358356.5_Silent_p.V137V|RUNX1_ENST00000437180.1_Silent_p.V164V|RUNX1_ENST00000486278.2_Silent_p.V140V|RUNX1_ENST00000399240.1_Silent_p.V137V|RUNX1_ENST00000325074.5_Silent_p.V152V|RUNX1_ENST00000300305.3_Silent_p.V164V	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	137	Interaction with DNA.|Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.G165fs*1(3)|p.V164_G165insG(1)|p.?(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						CACTTCGACCGACAAACCTGA	0.438			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																p.V164V		Atlas-SNP	.		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	RUNX1,NS,lymphoid_neoplasm,-1,1	RUNX1	687	1	5	Insertion - Frameshift(3)|Insertion - In frame(1)|Unknown(1)	haematopoietic_and_lymphoid_tissue(5)	c.C492T						scavenged	.	G	,,	0,4406		0,0,2203	122.0	108.0	113.0		411,411,492	3.3	1.0	21		113	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	RUNX1	NM_001001890.2,NM_001122607.1,NM_001754.4	,,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,	137/454,137/251,164/481	36252870	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	861	exon5			TCGACCGACAAAC	X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.411C>T	21.37:g.36252870G>A		Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	213	4	0.0187793	NM_001754	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Silent	SNP	ENST00000344691.4	37	CCDS42922.1																																																																																			G|0.999;A|0.001	0.001	weak		0.438	RUNX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000194230.1		
ULK4	54986	hgsc.bcm.edu	37	3	41723017	41723017	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:41723017C>T	ENST00000301831.4	-	29	3422	c.2960G>A	c.(2959-2961)cGa>cAa	p.R987Q		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	987					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R987Q(1)|p.R139Q(1)		breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TAAGACATCTCGAATGAGAGC	0.468																																					p.R987Q		Atlas-SNP	.											ULK4_ENST00000301831,colon,carcinoma,0,2	ULK4	150	2	2	Substitution - Missense(2)	large_intestine(2)	c.G2960A						scavenged	.						121.0	117.0	118.0					3																	41723017		1963	4142	6105	SO:0001583	missense	54986	exon29			ACATCTCGAATGA	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2960G>A	3.37:g.41723017C>T	ENSP00000301831:p.Arg987Gln	Somatic	135	1	0.00740741		WXS	Illumina HiSeq	Phase_I	161	4	0.0248447	NM_017886	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	c	22.4	4.286703	0.80803	.	.	ENSG00000168038	ENST00000301831	T	0.64260	-0.09	5.75	5.75	0.90469	Armadillo-type fold (1);	0.537072	0.15973	U	0.235657	T	0.72244	0.3436	L	0.48642	1.525	0.80722	D	1	D	0.76494	0.999	P	0.56788	0.806	T	0.71922	-0.4446	10	0.56958	D	0.05	.	19.9433	0.97172	0.0:1.0:0.0:0.0	.	987	Q96C45	ULK4_HUMAN	Q	987	ENSP00000301831:R987Q	ENSP00000301831:R987Q	R	-	2	0	ULK4	41698021	1.000000	0.71417	0.778000	0.31720	0.942000	0.58702	2.826000	0.48104	2.716000	0.92895	0.655000	0.94253	CGA	.	.	none		0.468	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989	
MICU1	10367	hgsc.bcm.edu	37	10	74183072	74183072	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:74183072G>A	ENST00000361114.5	-	9	1087	c.991C>T	c.(991-993)Cta>Tta	p.L331L	MICU1_ENST00000398761.4_Silent_p.L333L|MICU1_ENST00000398763.4_Silent_p.L133L|MICU1_ENST00000401998.3_Silent_p.L331L|MICU1_ENST00000418483.2_Silent_p.L133L	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	331					calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TAGGCAAGTAGCATGCCACCA	0.512																																					p.L331L		Atlas-SNP	.											.	.	.	.	0			c.C991T						PASS	.						104.0	96.0	99.0					10																	74183072		2000	4197	6197	SO:0001819	synonymous_variant	10367	exon9			CAAGTAGCATGCC	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.991C>T	10.37:g.74183072G>A		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	149	54	0.362416	NM_001195518	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Silent	SNP	ENST00000361114.5	37	CCDS55715.1																																																																																			.	.	none		0.512	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077	
ZNF285	26974	hgsc.bcm.edu	37	19	44891217	44891217	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:44891217T>C	ENST00000330997.4	-	4	1254	c.1190A>G	c.(1189-1191)gAg>gGg	p.E397G	ZNF285_ENST00000544719.2_Missense_Mutation_p.E397G|ZNF285_ENST00000591679.1_Missense_Mutation_p.E404G|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	397					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E397G(2)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GTAGGGCTTCTCTCCAGTGTG	0.483																																					p.E397G		Atlas-SNP	.											ZNF285,NS,carcinoma,0,2	ZNF285	86	2	2	Substitution - Missense(2)	prostate(2)	c.A1190G						scavenged	.						57.0	56.0	57.0					19																	44891217		2203	4300	6503	SO:0001583	missense	26974	exon4			GGCTTCTCTCCAG	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1190A>G	19.37:g.44891217T>C	ENSP00000333595:p.Glu397Gly	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	57	4	0.0701754	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.812415	0.70912	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.27557	1.66	3.36	3.36	0.38483	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53012	0.1770	M	0.75150	2.29	0.34602	D	0.716652	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.933	T	0.67393	-0.5682	9	0.87932	D	0	.	11.1099	0.48226	0.0:0.0:0.0:1.0	.	421;397	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	G	420;397	ENSP00000333595:E397G	ENSP00000333595:E397G	E	-	2	0	ZNF285	49583057	1.000000	0.71417	0.745000	0.31077	0.941000	0.58515	7.429000	0.80309	1.308000	0.44962	0.248000	0.18094	GAG	.	.	none		0.483	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
BRSK2	9024	hgsc.bcm.edu	37	11	1467077	1467077	+	Missense_Mutation	SNP	C	C	T	rs368418167		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:1467077C>T	ENST00000528841.1	+	12	1550	c.1166C>T	c.(1165-1167)aCg>aTg	p.T389M	BRSK2_ENST00000531197.1_Missense_Mutation_p.T389M|BRSK2_ENST00000526678.1_Missense_Mutation_p.T389M|BRSK2_ENST00000308219.9_Missense_Mutation_p.T389M|BRSK2_ENST00000528710.1_Missense_Mutation_p.T329M|BRSK2_ENST00000382179.1_Missense_Mutation_p.T435M|BRSK2_ENST00000544817.1_Missense_Mutation_p.T84M|BRSK2_ENST00000308230.5_Missense_Mutation_p.T389M			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	389					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		CTCAGCGTGACGGACGGCGGC	0.701																																					p.T435M		Atlas-SNP	.											.	BRSK2	97	.	0			c.C1304T						PASS	.	C	MET/THR	0,4342		0,0,2171	35.0	45.0	42.0		1166	3.7	0.9	11		42	1,8531		0,1,4265	no	missense	BRSK2	NM_003957.2	81	0,1,6436	TT,TC,CC		0.0117,0.0,0.0078	probably-damaging	389/669	1467077	1,12873	2171	4266	6437	SO:0001583	missense	9024	exon12			GCGTGACGGACGG	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.1166C>T	11.37:g.1467077C>T	ENSP00000432000:p.Thr389Met	Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	61	32	0.52459	NM_001256630	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	ENST00000528841.1	37	CCDS58107.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732292	0.89482	0.0	1.17E-4	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179;ENST00000544817	T;T;T;T;T;T;T;T	0.73469	-0.75;1.82;-0.7;1.82;-0.7;1.82;-0.59;0.76	4.71	3.73	0.42828	Protein kinase-like domain (1);	0.000000	0.85682	U	0.000000	D	0.83792	0.5331	M	0.65975	2.015	0.51767	D	0.999935	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.994;1.0;0.998;0.992	D	0.85738	0.1335	10	0.66056	D	0.02	.	14.2379	0.65938	0.0:0.8498:0.1502:0.0	.	389;435;389;389;389	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	M	389;389;389;389;389;329;435;84	ENSP00000310697:T389M;ENSP00000431152:T389M;ENSP00000310805:T389M;ENSP00000432000:T389M;ENSP00000433370:T389M;ENSP00000433235:T329M;ENSP00000371614:T435M;ENSP00000445168:T84M	ENSP00000310697:T389M	T	+	2	0	BRSK2	1423653	1.000000	0.71417	0.920000	0.36463	0.942000	0.58702	5.583000	0.67484	2.182000	0.69389	0.462000	0.41574	ACG	.	.	weak		0.701	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393033.1	NM_003957	
DOCK1	1793	hgsc.bcm.edu	37	10	129209114	129209114	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:129209114G>T	ENST00000280333.6	+	43	4400	c.4291G>T	c.(4291-4293)Gtg>Ttg	p.V1431L		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1431	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TTTTTACAGGGTGAACGAGGT	0.438																																					p.V1431L		Atlas-SNP	.											.	DOCK1	188	.	0			c.G4291T						PASS	.						73.0	69.0	70.0					10																	129209114		1875	4103	5978	SO:0001583	missense	1793	exon43			TACAGGGTGAACG	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.4291G>T	10.37:g.129209114G>T	ENSP00000280333:p.Val1431Leu	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	60	23	0.383333	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	G	22.4	4.288809	0.80914	.	.	ENSG00000150760	ENST00000280333	T	0.17370	2.28	4.9	4.9	0.64082	.	0.062614	0.64402	D	0.000006	T	0.40839	0.1133	M	0.69523	2.12	0.54753	D	0.999989	P;D;P	0.63046	0.898;0.992;0.772	P;D;B	0.64237	0.542;0.923;0.326	T	0.19844	-1.0293	10	0.51188	T	0.08	.	18.3037	0.90172	0.0:0.0:1.0:0.0	.	1431;1497;1431	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	L	1431	ENSP00000280333:V1431L	ENSP00000280333:V1431L	V	+	1	0	DOCK1	129099104	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.097000	0.64542	2.546000	0.85860	0.655000	0.94253	GTG	.	.	none		0.438	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
SIRPA	140885	hgsc.bcm.edu	37	20	1896052	1896052	+	Silent	SNP	C	C	T	rs139878822|rs202172737	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:1896052C>T	ENST00000358771.4	+	2	539	c.387C>T	c.(385-387)ccC>ccT	p.P129P	SIRPA_ENST00000400068.3_Silent_p.P129P|SIRPA_ENST00000356025.3_Silent_p.P129P	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	129	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.D131delD(2)|p.P129P(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		AAGGGAGCCCCGATGACGTGG	0.532																																					p.P129P	GBM(155;1668 1920 5945 42733 48121)	Atlas-SNP	.											SIRPA,NS,carcinoma,0,1	SIRPA	83	1	3	Deletion - In frame(2)|Substitution - coding silent(1)	upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)	c.C387T						scavenged	.						114.0	98.0	103.0					20																	1896052		2120	4008	6128	SO:0001819	synonymous_variant	140885	exon3			GAGCCCCGATGAC	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.387C>T	20.37:g.1896052C>T		Somatic	69	68	0.985507		WXS	Illumina HiSeq	Phase_I	110	107	0.972727	NM_001040022	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Silent	SNP	ENST00000358771.4	37	CCDS13022.1																																																																																			C|0.872;T|0.128	0.128	strong		0.532	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
C17orf78	284099	hgsc.bcm.edu	37	17	35736170	35736170	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:35736170C>T	ENST00000300618.4	+	3	291	c.241C>T	c.(241-243)Ctt>Ttt	p.L81F	C17orf78_ENST00000586700.1_Missense_Mutation_p.L81F|ACACA_ENST00000353139.5_Intron|ACACA_ENST00000416895.1_Intron	NM_173625.3	NP_775896.3	Q8N4C9	CQ078_HUMAN	chromosome 17 open reading frame 78	81						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(1)|lung(2)|stomach(1)	6		Breast(25;0.00295)|Ovarian(249;0.15)				AAAAGTCAACCTTGTATATTT	0.453																																					p.L81F		Atlas-SNP	.											C17orf78,colon,carcinoma,0,1	C17orf78	23	1	0			c.C241T						scavenged	.						153.0	150.0	151.0					17																	35736170		1888	4115	6003	SO:0001583	missense	284099	exon3			GTCAACCTTGTAT	BC034672	CCDS45655.1	17q12	2014-05-06			ENSG00000167230	ENSG00000278505			26831	protein-coding gene	gene with protein product						14702039	Standard	NM_173625		Approved	FLJ39647	uc002hns.3	Q8N4C9	OTTHUMG00000188467	ENST00000300618.4:c.241C>T	17.37:g.35736170C>T	ENSP00000300618:p.Leu81Phe	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	124	2	0.016129	NM_173625	Q8N8D2	Missense_Mutation	SNP	ENST00000300618.4	37	CCDS45655.1	.	.	.	.	.	.	.	.	.	.	C	9.450	1.090229	0.20390	.	.	ENSG00000167230	ENST00000300618;ENST00000321564	T	0.68624	-0.34	4.36	1.29	0.21616	.	0.423314	0.16691	N	0.203553	T	0.50939	0.1645	L	0.36672	1.1	0.09310	N	1	B;B	0.18013	0.007;0.025	B;B	0.19666	0.026;0.026	T	0.46857	-0.9161	10	0.87932	D	0	-3.8027	4.2376	0.10634	0.0:0.599:0.1918:0.2092	.	81;81	Q8N4C9-2;Q8N4C9	.;CQ078_HUMAN	F	81	ENSP00000300618:L81F	ENSP00000300618:L81F	L	+	1	0	C17orf78	32810283	0.012000	0.17670	0.003000	0.11579	0.531000	0.34715	0.416000	0.21198	0.136000	0.18733	-0.122000	0.15005	CTT	.	.	none		0.453	C17orf78-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451570.2	NM_173625	
KRTAP10-2	386679	hgsc.bcm.edu	37	21	45970774	45970774	+	Missense_Mutation	SNP	G	G	A	rs76536096|rs67692969|rs71199610	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr21:45970774G>A	ENST00000391621.1	-	1	614	c.568C>T	c.(568-570)Cct>Tct	p.P190S	TSPEAR_ENST00000323084.4_Intron|KRTAP10-2_ENST00000498210.1_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	190	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						CAGCAGACAGGCTTGCAGCAG	0.607																																					p.P190S		Atlas-SNP	.											.	KRTAP10-2	21	.	0			c.C568T						PASS	.						110.0	112.0	111.0					21																	45970774		2192	4279	6471	SO:0001583	missense	386679	exon1			AGACAGGCTTGCA	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.568C>T	21.37:g.45970774G>A	ENSP00000375479:p.Pro190Ser	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	201	12	0.0597015	NM_198693	Q70LJ5	Missense_Mutation	SNP	ENST00000391621.1	37	CCDS42955.1	.	.	.	.	.	.	.	.	.	.	g	9.523	1.108901	0.20714	.	.	ENSG00000205445	ENST00000391621	T	0.01705	4.68	3.28	0.222	0.15288	.	.	.	.	.	T	0.02083	0.0065	L	0.49455	1.56	0.09310	N	1	B	0.26672	0.156	B	0.24394	0.053	T	0.42310	-0.9459	9	0.62326	D	0.03	.	4.9369	0.13944	0.2108:0.1755:0.6137:0.0	.	190	P60368	KR102_HUMAN	S	190	ENSP00000375479:P190S	ENSP00000375479:P190S	P	-	1	0	KRTAP10-2	44795202	0.105000	0.21958	0.000000	0.03702	0.002000	0.02628	1.284000	0.33249	-0.177000	0.10690	0.462000	0.41574	CCT	G|0.917;A|0.083	0.083	strong		0.607	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
DGKB	1607	hgsc.bcm.edu	37	7	14378196	14378196	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:14378196C>A	ENST00000403951.2	-	23	2488	c.2069G>T	c.(2068-2070)gGg>gTg	p.G690V	DGKB_ENST00000399322.3_Missense_Mutation_p.G690V|DGKB_ENST00000407950.1_Missense_Mutation_p.G682V|DGKB_ENST00000402815.1_Missense_Mutation_p.G689V|DGKB_ENST00000406247.3_Missense_Mutation_p.G690V|DGKB_ENST00000258767.5_Missense_Mutation_p.G690V|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000444700.2_Missense_Mutation_p.G671V			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	690					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.G690V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TTTGTCAGACCCTTTTTTCTC	0.398																																					p.G690V		Atlas-SNP	.											DGKB,NS,carcinoma,0,1	DGKB	166	1	1	Substitution - Missense(1)	lung(1)	c.G2069T						PASS	.						192.0	177.0	182.0					7																	14378196		1852	4091	5943	SO:0001583	missense	1607	exon22			TCAGACCCTTTTT	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2069G>T	7.37:g.14378196C>A	ENSP00000385780:p.Gly690Val	Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	180	64	0.355556	NM_145695	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.387379	0.25031	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.80480	-1.3;-1.3;-1.3;-1.3;-1.3;-1.29;-1.38	5.5	4.62	0.57501	Diacylglycerol kinase, accessory domain (2);	0.442134	0.23977	N	0.042716	T	0.65439	0.2691	N	0.17082	0.46	0.48975	D	0.999736	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.08055	0.003;0.002;0.002;0.0	T	0.58875	-0.7559	10	0.29301	T	0.29	.	10.1713	0.42911	0.0:0.8495:0.0:0.1505	.	689;671;690;690	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	V	690;690;690;689;682;671;690	ENSP00000385780:G690V;ENSP00000382260:G690V;ENSP00000258767:G690V;ENSP00000384909:G689V;ENSP00000385031:G682V;ENSP00000388451:G671V;ENSP00000386066:G690V	ENSP00000258767:G690V	G	-	2	0	DGKB	14344721	0.684000	0.27642	0.995000	0.50966	0.989000	0.77384	1.375000	0.34295	1.313000	0.45069	0.650000	0.86243	GGG	.	.	none		0.398	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
ZNF443	10224	hgsc.bcm.edu	37	19	12541141	12541141	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:12541141C>T	ENST00000301547.5	-	4	2042	c.1845G>A	c.(1843-1845)ccG>ccA	p.P615P	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	615					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						TACATTCATACGGGTTCTCTC	0.403																																					p.P615P		Atlas-SNP	.											ZNF443,lower_third,carcinoma,-1,1	ZNF443	63	1	0			c.G1845A						scavenged	.						62.0	67.0	65.0					19																	12541141		2197	4290	6487	SO:0001819	synonymous_variant	10224	exon4			TTCATACGGGTTC	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1845G>A	19.37:g.12541141C>T		Somatic	218	2	0.00917431		WXS	Illumina HiSeq	Phase_I	212	5	0.0235849	NM_005815		Silent	SNP	ENST00000301547.5	37	CCDS32918.1																																																																																			.	.	none		0.403	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815	
FKBP9	11328	hgsc.bcm.edu	37	7	33014908	33014908	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:33014908G>A	ENST00000242209.4	+	3	651	c.482G>A	c.(481-483)cGg>cAg	p.R161Q	FKBP9_ENST00000538336.1_Missense_Mutation_p.R214Q|FKBP9_ENST00000538443.1_Missense_Mutation_p.R23Q|AVL9_ENST00000404479.1_Intron	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	161					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			AGTTGCCCTCGGACCATCCAG	0.473																																					p.R161Q		Atlas-SNP	.											FKBP9,brain,glioma,0,9	FKBP9	335	9	0			c.G482A						scavenged	.						99.0	87.0	91.0					7																	33014908		2203	4300	6503	SO:0001583	missense	11328	exon3			GCCCTCGGACCAT	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.482G>A	7.37:g.33014908G>A	ENSP00000242209:p.Arg161Gln	Somatic	137	4	0.0291971		WXS	Illumina HiSeq	Phase_I	110	7	0.0636364	NM_007270	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Missense_Mutation	SNP	ENST00000242209.4	37	CCDS5439.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720086	0.89205	.	.	ENSG00000122642	ENST00000242209;ENST00000538336;ENST00000538443	D;D;D	0.86164	-2.08;-2.08;-2.08	5.36	5.36	0.76844	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (1);	0.000000	0.85682	D	0.000000	D	0.92714	0.7684	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.92752	0.6217	10	0.56958	D	0.05	-4.2611	19.0957	0.93249	0.0:0.0:1.0:0.0	.	214;161;161	B7Z6H3;O95302;B3KQQ0	.;FKBP9_HUMAN;.	Q	161;214;23	ENSP00000242209:R161Q;ENSP00000439250:R214Q;ENSP00000437504:R23Q	ENSP00000242209:R161Q	R	+	2	0	FKBP9	32981433	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	9.809000	0.99208	2.524000	0.85096	0.650000	0.86243	CGG	.	.	none		0.473	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
SUMO2	6613	hgsc.bcm.edu	37	17	73177275	73177275	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:73177275G>A	ENST00000420826.2	-	2	178	c.30C>T	c.(28-30)gtC>gtT	p.V10V	SUMO2_ENST00000314523.7_Silent_p.V10V|SUMO2_ENST00000578238.1_5'UTR	NM_006937.3	NP_008868.3			small ubiquitin-like modifier 2											NS(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)					TCTCAGTCTTGACTCCTTCCT	0.378																																					p.V10V		Atlas-SNP	.											.	SUMO2	4	.	0			c.C30T						PASS	.						32.0	35.0	34.0					17																	73177275		2195	4297	6492	SO:0001819	synonymous_variant	6613	exon2			AGTCTTGACTCCT		CCDS45773.1, CCDS45774.1	17q25	2013-06-05	2013-06-05	2004-05-19	ENSG00000188612	ENSG00000188612			11125	protein-coding gene	gene with protein product		603042	"""SMT3 (suppressor of mif two 3, yeast) homolog 2"", ""SMT3 suppressor of mif two 3 homolog 2 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)"""	SMT3H2		8630065	Standard	NM_006937		Approved	SMT3B	uc002jne.3	P61956		ENST00000420826.2:c.30C>T	17.37:g.73177275G>A		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	115	60	0.521739	NM_006937		Silent	SNP	ENST00000420826.2	37	CCDS45774.1																																																																																			.	.	none		0.378	SUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446614.1	NM_006937	
MUC4	4585	hgsc.bcm.edu	37	3	195509497	195509497	+	Missense_Mutation	SNP	G	G	A	rs201925754		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195509497G>A	ENST00000463781.3	-	2	9413	c.8954C>T	c.(8953-8955)gCa>gTa	p.A2985V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2985V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A2985V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.572																																					p.A2985V		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,3	MUC4	1505	3	1	Substitution - Missense(1)	endometrium(1)	c.C8954T						scavenged	.						18.0	10.0	12.0					3																	195509497		655	1551	2206	SO:0001583	missense	4585	exon2			GTGGATGCTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8954C>T	3.37:g.195509497G>A	ENSP00000417498:p.Ala2985Val	Somatic	116	19	0.163793		WXS	Illumina HiSeq	Phase_I	147	27	0.183673	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	3.895	-0.023177	0.07634	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29917	1.55;1.55	.	.	.	.	.	.	.	.	T	0.14141	0.0342	N	0.14661	0.345	0.09310	N	0.999999	B	0.11235	0.004	B	0.01281	0.0	T	0.28332	-1.0047	7	.	.	.	.	3.5027	0.07679	0.3048:0.0:0.6952:0.0	.	2857	E7ESK3	.	V	2985	ENSP00000417498:A2985V;ENSP00000420243:A2985V	.	A	-	2	0	MUC4	196994276	.	.	0.011000	0.14972	0.000000	0.00434	.	.	0.482000	0.27582	0.000000	0.15137	GCA	G|0.998;A|0.002	0.002	weak		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
FGF14	2259	hgsc.bcm.edu	37	13	102375281	102375281	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr13:102375281C>T	ENST00000376143.4	-	5	643	c.644G>A	c.(643-645)gGg>gAg	p.G215E	ITGBL1_ENST00000415285.1_3'UTR|FGF14_ENST00000376131.4_Missense_Mutation_p.G220E	NM_004115.3	NP_004106.1	Q92915	FGF14_HUMAN	fibroblast growth factor 14	215					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|JNK cascade (GO:0007254)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)	29	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GACCGTTTCCCCAACATCATG	0.473																																					p.G220E		Atlas-SNP	.											FGF14_ENST00000376143,NS,carcinoma,-1,2	FGF14	86	2	0			c.G659A						scavenged	.						218.0	173.0	188.0					13																	102375281		2203	4300	6503	SO:0001583	missense	2259	exon5			GTTTCCCCAACAT		CCDS9500.1, CCDS9501.1	13q34	2008-02-05			ENSG00000102466	ENSG00000102466			3671	protein-coding gene	gene with protein product		601515				8790420, 17236779	Standard	NM_175929		Approved	FHF4, SCA27	uc001vpf.2	Q92915	OTTHUMG00000017303	ENST00000376143.4:c.644G>A	13.37:g.102375281C>T	ENSP00000365313:p.Gly215Glu	Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	138	3	0.0217391	NM_175929	Q86YN7|Q96QX6	Missense_Mutation	SNP	ENST00000376143.4	37	CCDS9501.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.016431	0.35606	.	.	ENSG00000102466	ENST00000376131;ENST00000376143	T;T	0.77358	-1.09;-0.96	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.68595	0.3018	N	0.21373	0.66	0.80722	D	1	B;B	0.16396	0.017;0.001	B;B	0.21360	0.034;0.009	T	0.61402	-0.7070	10	0.23891	T	0.37	.	19.7432	0.96238	0.0:1.0:0.0:0.0	.	220;215	Q92915-2;Q92915	.;FGF14_HUMAN	E	220;215	ENSP00000365301:G220E;ENSP00000365313:G215E	ENSP00000365301:G220E	G	-	2	0	FGF14	101173282	1.000000	0.71417	0.890000	0.34922	0.960000	0.62799	7.487000	0.81328	2.663000	0.90544	0.563000	0.77884	GGG	.	.	none		0.473	FGF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045679.2		
PLXNA4	91584	hgsc.bcm.edu	37	7	132174144	132174144	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:132174144C>T	ENST00000359827.3	-	3	2240	c.1278G>A	c.(1276-1278)acG>acA	p.T426T	PLXNA4_ENST00000378539.5_Silent_p.T426T|PLXNA4_ENST00000321063.4_Silent_p.T426T|PLXNA4_ENST00000423507.2_Silent_p.T426T			Q9HCM2	PLXA4_HUMAN	plexin A4	426	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CCCTGTCCTCCGTGAAGACGG	0.512																																					p.T426T		Atlas-SNP	.											.	PLXNA4	873	.	0			c.G1278A						PASS	.						115.0	94.0	101.0					7																	132174144		2203	4300	6503	SO:0001819	synonymous_variant	91584	exon3			GTCCTCCGTGAAG	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1278G>A	7.37:g.132174144C>T		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	132	57	0.431818	NM_001105543	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	CCDS43646.1																																																																																			.	.	none		0.512	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
SFSWAP	6433	hgsc.bcm.edu	37	12	132198771	132198771	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:132198771A>G	ENST00000261674.4	+	2	515	c.374A>G	c.(373-375)gAg>gGg	p.E125G	SFSWAP_ENST00000541286.1_Missense_Mutation_p.E125G	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	125					mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						TTGCTTGAGGAGGAGGCAAGG	0.393																																					p.E125G		Atlas-SNP	.											.	SFSWAP	69	.	0			c.A374G						PASS	.						98.0	83.0	88.0					12																	132198771		2203	4300	6503	SO:0001583	missense	6433	exon2			TTGAGGAGGAGGC	U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.374A>G	12.37:g.132198771A>G	ENSP00000261674:p.Glu125Gly	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	92	4	0.0434783	NM_001261411	B2RN45|B7ZM97|F5H6B8|Q6PJF7	Missense_Mutation	SNP	ENST00000261674.4	37	CCDS9273.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.400017	0.62177	.	.	ENSG00000061936	ENST00000261674;ENST00000544623;ENST00000541286	T;T	0.24538	1.85;1.85	5.84	4.68	0.58851	Splicing factor, suppressor of white apricot (1);	0.048341	0.85682	D	0.000000	T	0.53658	0.1810	M	0.85197	2.74	0.80722	D	1	P;P	0.41673	0.699;0.759	P;P	0.60609	0.565;0.877	T	0.57329	-0.7830	10	0.66056	D	0.02	-35.4576	13.2516	0.60055	0.8674:0.1325:0.0:0.0	.	125;125	F5H6B8;Q12872	.;SFSWA_HUMAN	G	125;62;125	ENSP00000261674:E125G;ENSP00000437738:E125G	ENSP00000261674:E125G	E	+	2	0	SFSWAP	130764724	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.361000	0.79497	1.017000	0.39495	0.533000	0.62120	GAG	.	.	none		0.393	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399276.1	NM_004592	
MUC4	4585	hgsc.bcm.edu	37	3	195513590	195513590	+	Missense_Mutation	SNP	C	C	T	rs74192533		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195513590C>T	ENST00000463781.3	-	2	5320	c.4861G>A	c.(4861-4863)Gac>Aac	p.D1621N	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D1621N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.572																																					p.D1621N		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	0			c.G4861A						scavenged	.						16.0	21.0	19.0					3																	195513590		684	1562	2246	SO:0001583	missense	4585	exon2			AAGTGTCGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4861G>A	3.37:g.195513590C>T	ENSP00000417498:p.Asp1621Asn	Somatic	562	16	0.0284698		WXS	Illumina HiSeq	Phase_I	699	29	0.0414878	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.630	0.484649	0.12641	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35421	1.31;1.33	.	.	.	.	.	.	.	.	T	0.12774	0.0310	N	0.08118	0	0.09310	N	1	P	0.47545	0.897	B	0.35312	0.2	T	0.11690	-1.0577	7	.	.	.	.	3.6132	0.08067	2.0E-4:0.5026:0.4969:2.0E-4	.	1621	E7ESK3	.	N	1621	ENSP00000417498:D1621N;ENSP00000420243:D1621N	.	D	-	1	0	MUC4	196997985	0.000000	0.05858	0.018000	0.16275	0.018000	0.09664	-0.145000	0.10265	0.088000	0.17205	0.089000	0.15464	GAC	CGGTGACAG|0.500;TGGTGACAA|0.500	.	alt		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LYPLA2	11313	hgsc.bcm.edu	37	1	24121214	24121214	+	Missense_Mutation	SNP	C	C	T	rs143915461		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:24121214C>T	ENST00000374514.3	+	10	995	c.688C>T	c.(688-690)Cct>Tct	p.P230S	LYPLA2_ENST00000374501.1_Missense_Mutation_p.P163S|LYPLA2_ENST00000374502.3_3'UTR|LYPLA2_ENST00000374505.2_3'UTR|LYPLA2_ENST00000495365.1_3'UTR|LYPLA2_ENST00000400061.1_3'UTR|LYPLA2_ENST00000374503.3_3'UTR	NM_007260.2	NP_009191.1	O95372	LYPA2_HUMAN	lysophospholipase II	230					fatty acid metabolic process (GO:0006631)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)	p.P230S(1)		endometrium(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		GCTGCTGCCTCCTGTCTAACT	0.592																																					p.P230S		Atlas-SNP	.											LYPLA2,arm,malignant_melanoma,0,1	LYPLA2	16	1	1	Substitution - Missense(1)	skin(1)	c.C688T						scavenged	.						39.0	35.0	37.0					1																	24121214		2203	4297	6500	SO:0001583	missense	11313	exon10			CTGCCTCCTGTCT	AF098668	CCDS241.1	1p36.11	2008-08-08			ENSG00000011009	ENSG00000011009	3.1.1.5		6738	protein-coding gene	gene with protein product							Standard	NM_007260		Approved	APT-2	uc001bht.3	O95372	OTTHUMG00000002961	ENST00000374514.3:c.688C>T	1.37:g.24121214C>T	ENSP00000363638:p.Pro230Ser	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	185	3	0.0162162	NM_007260	Q7Z4Z2	Missense_Mutation	SNP	ENST00000374514.3	37	CCDS241.1	.	.	.	.	.	.	.	.	.	.	C	12.41	1.930525	0.34096	.	.	ENSG00000011009	ENST00000374514;ENST00000374506;ENST00000374501	T;T	0.23348	1.91;1.92	4.89	3.91	0.45181	.	0.057819	0.64402	D	0.000001	T	0.23806	0.0576	L	0.59912	1.85	0.80722	D	1	B;B	0.21147	0.046;0.052	B;B	0.23150	0.044;0.027	T	0.11421	-1.0588	10	0.54805	T	0.06	.	6.9947	0.24777	0.1727:0.7351:0.0:0.0922	.	207;230	E9PH41;O95372	.;LYPA2_HUMAN	S	230;207;163	ENSP00000363638:P230S;ENSP00000363625:P163S	ENSP00000363625:P163S	P	+	1	0	LYPLA2	23993801	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	3.125000	0.50469	2.265000	0.75225	0.455000	0.32223	CCT	.	.	weak		0.592	LYPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008245.1		
MLF1	4291	hgsc.bcm.edu	37	3	158289125	158289125	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:158289125C>T	ENST00000355893.5	+	1	174	c.36C>T	c.(34-36)gaC>gaT	p.D12D	MLF1_ENST00000478894.2_5'UTR|MLF1_ENST00000497004.1_3'UTR|RP11-538P18.2_ENST00000479233.1_RNA|MLF1_ENST00000469452.1_5'UTR|MLF1_ENST00000484955.1_5'UTR|MLF1_ENST00000482628.1_5'UTR|MLF1_ENST00000392822.3_5'UTR|MLF1_ENST00000471745.1_5'UTR|MLF1_ENST00000359117.5_5'UTR|RP11-538P18.2_ENST00000475981.1_RNA	NM_022443.4	NP_071888.1	P58340	MLF1_HUMAN	myeloid leukemia factor 1	12					cell cycle arrest (GO:0007050)|myeloid progenitor cell differentiation (GO:0002318)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)			large_intestine(3)	3		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)			TTGAGGATGACCCCTTCTTCT	0.542			T	NPM1	AML																																p.D12D		Atlas-SNP	.		Dom	yes		3	3q25.1	4291	myeloid leukemia factor 1		L	.	MLF1	62	.	0			c.C36T						PASS	.						58.0	59.0	58.0					3																	158289125		2203	4300	6503	SO:0001819	synonymous_variant	4291	exon1			GGATGACCCCTTC	L49054	CCDS3182.1, CCDS46945.1, CCDS56286.1, CCDS56287.1, CCDS56288.1	3q25	2008-07-18			ENSG00000178053	ENSG00000178053			7125	protein-coding gene	gene with protein product	"""myeloid leukemia factor 1 variant 1"", ""myeloid leukemia factor 1 variant 2"", ""myeloid leukemia factor 1 variant 3"""	601402				8570204	Standard	NM_022443		Approved		uc003fcb.3	P58340	OTTHUMG00000158775	ENST00000355893.5:c.36C>T	3.37:g.158289125C>T		Somatic	223	0	0		WXS	Illumina HiSeq	Phase_I	276	120	0.434783	NM_022443	E9PEU9|Q2TLE3|Q2TLE5|Q8N8F8|Q96MH1	Silent	SNP	ENST00000355893.5	37	CCDS3182.1	.	.	.	.	.	.	.	.	.	.	C	3.726	-0.056610	0.07362	.	.	ENSG00000178053	ENST00000498592	T	0.44083	0.93	4.0	-2.07	0.07276	.	.	.	.	.	T	0.47060	0.1425	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51942	-0.8641	6	0.87932	D	0	.	8.357	0.32335	0.0:0.3789:0.0:0.6211	.	.	.	.	I	2	ENSP00000419636:T2I	ENSP00000419636:T2I	T	+	2	0	MLF1	159771819	0.450000	0.25697	0.841000	0.33234	0.072000	0.16883	-1.082000	0.03400	-0.346000	0.08312	-0.379000	0.06801	ACC	.	.	none		0.542	MLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352164.3	NM_022443	
KCNN3	3782	hgsc.bcm.edu	37	1	154842243	154842243	+	Silent	SNP	A	A	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:154842243A>C	ENST00000271915.4	-	1	513	c.198T>G	c.(196-198)ctT>ctG	p.L66L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgaagctgcggag	0.701																																					p.L66L		Atlas-SNP	.											KCNN3,NS,carcinoma,0,3	KCNN3	141	3	0			c.T198G						PASS	.						6.0	4.0	5.0					1																	154842243		1926	3811	5737	SO:0001819	synonymous_variant	3782	exon1			CTGCTGAAGCTGC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.198T>G	1.37:g.154842243A>C		Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	40	14	0.35	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			.	.	none		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
DGKB	1607	hgsc.bcm.edu	37	7	14217692	14217692	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:14217692C>A	ENST00000403951.2	-	24	2629	c.2210G>T	c.(2209-2211)gGc>gTc	p.G737V	DGKB_ENST00000399322.3_Missense_Mutation_p.G737V|DGKB_ENST00000407950.1_Missense_Mutation_p.G729V|DGKB_ENST00000402815.1_Missense_Mutation_p.G736V|DGKB_ENST00000406247.3_Missense_Mutation_p.G737V|DGKB_ENST00000258767.5_Missense_Mutation_p.G737V|DGKB_ENST00000444700.2_Missense_Mutation_p.G718V			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	737					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.G737V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						CAGCCGCCGGCCAGCACTTTT	0.502																																					p.G737V		Atlas-SNP	.											DGKB,NS,carcinoma,0,1	DGKB	166	1	1	Substitution - Missense(1)	lung(1)	c.G2210T						PASS	.						62.0	71.0	68.0					7																	14217692		2108	4277	6385	SO:0001583	missense	1607	exon23			CGCCGGCCAGCAC	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2210G>T	7.37:g.14217692C>A	ENSP00000385780:p.Gly737Val	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	48	17	0.354167	NM_145695	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637047	0.87760	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.8	5.8	0.92144	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.75133	0.3808	M	0.93241	3.395	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.79108	0.991;0.99;0.987;0.992	T	0.81297	-0.0996	10	0.87932	D	0	.	19.6455	0.95775	0.0:1.0:0.0:0.0	.	736;718;737;737	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	V	737;737;737;736;729;718;737	ENSP00000385780:G737V;ENSP00000382260:G737V;ENSP00000258767:G737V;ENSP00000384909:G736V;ENSP00000385031:G729V;ENSP00000388451:G718V;ENSP00000386066:G737V	ENSP00000258767:G737V	G	-	2	0	DGKB	14184217	1.000000	0.71417	0.994000	0.49952	0.937000	0.57800	5.812000	0.69194	2.739000	0.93911	0.561000	0.74099	GGC	.	.	none		0.502	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
RP1L1	94137	hgsc.bcm.edu	37	8	10470003	10470003	+	Silent	SNP	C	C	T	rs200772091		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:10470003C>T	ENST00000382483.3	-	4	1828	c.1605G>A	c.(1603-1605)tcG>tcA	p.S535S		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	535					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TGCTGGCTGACGAGTCCGAAG	0.692																																					p.S535S		Atlas-SNP	.											.	RP1L1	453	.	0			c.G1605A						PASS	.	C		0,4096		0,0,2048	39.0	47.0	45.0		1605	-5.8	0.0	8		45	2,8346		0,2,4172	no	coding-synonymous	RP1L1	NM_178857.5		0,2,6220	TT,TC,CC		0.024,0.0,0.0161		535/2401	10470003	2,12442	2048	4174	6222	SO:0001819	synonymous_variant	94137	exon4			GGCTGACGAGTCC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1605G>A	8.37:g.10470003C>T		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	38	13	0.342105	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																			C|0.999;T|0.001	0.001	weak		0.692	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
TESK1	7016	hgsc.bcm.edu	37	9	35608460	35608460	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr9:35608460G>A	ENST00000336395.5	+	9	1204	c.954G>A	c.(952-954)ctG>ctA	p.L318L	TESK1_ENST00000498522.1_3'UTR|CD72_ENST00000490239.1_5'Flank|MIR4667_ENST00000578933.1_RNA	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	318					cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGGAGCAGCTGCCTGAGCCAG	0.587																																					p.L318L		Atlas-SNP	.											TESK1,NS,neuroblastoma,0,1	TESK1	46	1	0			c.G954A						PASS	.						57.0	54.0	55.0					9																	35608460		2203	4300	6503	SO:0001819	synonymous_variant	7016	exon9			GCAGCTGCCTGAG	D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.954G>A	9.37:g.35608460G>A		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	68	30	0.441176	NM_006285	Q8IXZ8	Silent	SNP	ENST00000336395.5	37	CCDS6580.1																																																																																			.	.	none		0.587	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052314.1	NM_006285	
SULT1A1	6817	hgsc.bcm.edu	37	16	28618318	28618318	+	Missense_Mutation	SNP	C	C	G	rs1042014	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:28618318C>G	ENST00000395607.1	-	5	726	c.453G>C	c.(451-453)gaG>gaC	p.E151D	SULT1A1_ENST00000569554.1_Missense_Mutation_p.E151D|SULT1A1_ENST00000314752.7_Missense_Mutation_p.E151D|SULT1A1_ENST00000395609.1_Missense_Mutation_p.E151D|SULT1A1_ENST00000350842.4_Missense_Mutation_p.E73D	NM_177530.2|NM_177534.2	NP_803566.1|NP_803878.1	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1	151			E -> D (in dbSNP:rs1042014).|E -> Q (in dbSNP:rs1042011).		3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)			endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	AGGTCCCAGGCTCAGGGTGCA	0.562																																					p.E151D		Atlas-SNP	.											.	SULT1A1	53	.	0			c.G453C						PASS	.						226.0	167.0	187.0					16																	28618318		2197	4300	6497	SO:0001583	missense	6817	exon4			CCCAGGCTCAGGG	U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000395607.1:c.453G>C	16.37:g.28618318C>G	ENSP00000378971:p.Glu151Asp	Somatic	239	0	0		WXS	Illumina HiSeq	Phase_I	393	248	0.631043	NM_177534	Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Missense_Mutation	SNP	ENST00000395607.1	37	CCDS32420.1	.	.	.	.	.	.	.	.	.	.	c	0.006	-2.097513	0.00360	.	.	ENSG00000196502	ENST00000314752;ENST00000350842;ENST00000395609;ENST00000395607	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	2.42	-4.84	0.03151	Sulfotransferase domain (1);	0.388985	0.26345	N	0.024915	T	0.44808	0.1311	N	0.02345	-0.59	0.22034	N	0.999403	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.55354	-0.8154	10	0.02654	T	1	.	0.2745	0.00236	0.3382:0.2548:0.1587:0.2483	rs1042014;rs1042014	103;73;151	Q59GG0;P50225-2;P50225	.;.;ST1A1_HUMAN	D	151;73;151;151	ENSP00000321988:E151D;ENSP00000329399:E73D;ENSP00000378972:E151D;ENSP00000378971:E151D	ENSP00000321988:E151D	E	-	3	2	SULT1A1	28525819	0.000000	0.05858	0.817000	0.32601	0.539000	0.34962	-2.571000	0.00913	-2.066000	0.00886	-0.840000	0.03056	GAG	C|0.970;G|0.030	0.030	strong		0.562	SULT1A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254694.2	NM_001055	
TCF4	6925	hgsc.bcm.edu	37	18	52896251	52896251	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr18:52896251C>T	ENST00000356073.4	-	18	2305	c.1694G>A	c.(1693-1695)cGg>cAg	p.R565Q	TCF4_ENST00000566286.1_Missense_Mutation_p.R562Q|TCF4_ENST00000398339.1_Missense_Mutation_p.R671Q|TCF4_ENST00000570287.2_Missense_Mutation_p.R405Q|TCF4_ENST00000540999.1_Missense_Mutation_p.R541Q|TCF4_ENST00000564999.1_Missense_Mutation_p.R565Q|TCF4_ENST00000570177.2_Missense_Mutation_p.R435Q|TCF4_ENST00000564228.1_Missense_Mutation_p.R494Q|TCF4_ENST00000561992.1_Missense_Mutation_p.R435Q|TCF4_ENST00000567880.1_Missense_Mutation_p.R505Q|TCF4_ENST00000543082.1_Missense_Mutation_p.R523Q|TCF4_ENST00000568740.1_Missense_Mutation_p.R540Q|TCF4_ENST00000564403.2_Missense_Mutation_p.R575Q|TCF4_ENST00000537578.1_Missense_Mutation_p.R545Q|TCF4_ENST00000568673.1_Missense_Mutation_p.R545Q|TCF4_ENST00000566279.1_Missense_Mutation_p.R509Q|TCF4_ENST00000544241.2_Missense_Mutation_p.R498Q|TCF4_ENST00000354452.3_Missense_Mutation_p.R569Q|TCF4_ENST00000537856.3_Missense_Mutation_p.R435Q|TCF4_ENST00000561831.3_Missense_Mutation_p.R405Q|TCF4_ENST00000457482.3_Missense_Mutation_p.R409Q|TCF4_ENST00000565018.2_Missense_Mutation_p.R569Q	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	565	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.		R -> W (in PTHS). {ECO:0000269|PubMed:22045651}.		DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		GGCCATCCTCCGCTCCTTCTC	0.552																																					p.R671Q		Atlas-SNP	.											TCF4_ENST00000398339,right_upper_lobe,carcinoma,0,2	TCF4	178	2	0			c.G2012A						scavenged	.						193.0	168.0	177.0					18																	52896251		2203	4300	6503	SO:0001583	missense	6925	exon19			ATCCTCCGCTCCT	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1694G>A	18.37:g.52896251C>T	ENSP00000348374:p.Arg565Gln	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	248	3	0.0120968	NM_001243226	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	ENST00000356073.4	37	CCDS11960.1	.	.	.	.	.	.	.	.	.	.	C	36	5.939604	0.97128	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	D;D;D;D;D;D;D;D;D	0.98178	-4.77;-4.77;-4.77;-4.77;-4.77;-4.77;-4.77;-4.77;-4.77	5.88	5.88	0.94601	Helix-loop-helix DNA-binding (4);	0.000000	0.85682	D	0.000000	D	0.98776	0.9588	M	0.67517	2.055	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.997;1.0;1.0;0.997;1.0	D;D;D;D;D;D;D;D;D	0.85130	0.997;0.987;0.987;0.992;0.979;0.996;0.997;0.964;0.987	D	0.99874	1.1101	10	0.87932	D	0	-4.2769	19.0127	0.92881	0.0:1.0:0.0:0.0	.	545;569;405;671;565;523;498;409;562	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	Q	569;409;565;523;541;545;498;435;671	ENSP00000346440:R569Q;ENSP00000409447:R409Q;ENSP00000348374:R565Q;ENSP00000439656:R523Q;ENSP00000445202:R541Q;ENSP00000440731:R545Q;ENSP00000441562:R498Q;ENSP00000439827:R435Q;ENSP00000381382:R671Q	ENSP00000346440:R569Q	R	-	2	0	TCF4	51047249	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.815000	0.86186	2.793000	0.96121	0.558000	0.71614	CGG	.	.	none		0.552	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	NM_003199	
C1orf27	54953	hgsc.bcm.edu	37	1	186363119	186363119	+	Missense_Mutation	SNP	C	C	G	rs12084264	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:186363119C>G	ENST00000287859.6	+	9	877	c.752C>G	c.(751-753)tCt>tGt	p.S251C	C1orf27_ENST00000432021.3_Intron|C1orf27_ENST00000367470.3_Intron|C1orf27_ENST00000419367.3_Missense_Mutation_p.S219C	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	251			S -> C (in dbSNP:rs12084264). {ECO:0000269|PubMed:14702039}.			integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						ACTAGTCATTCTTTTGATGTC	0.279													C|||	1164	0.232428	0.149	0.4078	5008	,	,		14393	0.127		0.335	False		,,,				2504	0.2239				p.S251C		Atlas-SNP	.											C1orf27_ENST00000287859,NS,carcinoma,0,2	C1orf27	41	2	0			c.C752G						scavenged	.	C	,CYS/SER,CYS/SER	581,2775		48,485,1145	27.0	24.0	25.0		,656,752	3.4	0.9	1	dbSNP_120	25	2399,5149		385,1629,1760	yes	intron,missense,missense	C1orf27	NM_001164245.1,NM_001164246.1,NM_017847.5	,112,112	433,2114,2905	GG,GC,CC		31.7833,17.3123,27.3294	,benign,benign	,219/423,251/455	186363119	2980,7924	1678	3774	5452	SO:0001583	missense	54953	exon9			GTCATTCTTTTGA	BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.752C>G	1.37:g.186363119C>G	ENSP00000287859:p.Ser251Cys	Somatic	236	0	0		WXS	Illumina HiSeq	Phase_I	245	3	0.0122449	NM_017847	B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Missense_Mutation	SNP	ENST00000287859.6	37	CCDS53448.1	557	0.25503663003663	65	0.13211382113821138	148	0.4088397790055249	77	0.1346153846153846	267	0.35224274406332456	C	15.80	2.939210	0.52972	0.173123	0.317833	ENSG00000157181	ENST00000419367;ENST00000432021;ENST00000287859	T;T	0.46451	0.87;0.87	5.34	3.43	0.39272	.	0.556512	0.18307	N	0.145224	T	0.00012	0.0000	L	0.50333	1.59	0.09310	P	0.99999999387866	D;B	0.57899	0.981;0.0	P;B	0.53062	0.717;0.003	T	0.43702	-0.9375	9	0.37606	T	0.19	-3.9611	6.5884	0.22634	0.0:0.5515:0.3334:0.1151	rs12084264;rs17521893;rs12084264	219;251	E9PFR7;Q5SWX8	.;ODR4_HUMAN	C	219;251;251	ENSP00000395084:S219C;ENSP00000287859:S251C	ENSP00000287859:S251C	S	+	2	0	C1orf27	184629742	0.008000	0.16893	0.940000	0.37924	0.976000	0.68499	0.050000	0.14120	0.605000	0.29947	-0.300000	0.09419	TCT	C|0.756;G|0.244	0.244	strong		0.279	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086352.2	NM_017847	
POU2F2	5452	hgsc.bcm.edu	37	19	42626522	42626522	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:42626522T>C	ENST00000526816.2	-	3	118	c.103A>G	c.(103-105)Aga>Gga	p.R35G	POU2F2_ENST00000529067.1_Missense_Mutation_p.R35G|POU2F2_ENST00000529952.1_Missense_Mutation_p.R35G|POU2F2_ENST00000560558.1_Missense_Mutation_p.R35G|POU2F2_ENST00000533720.1_Missense_Mutation_p.R35G|POU2F2_ENST00000389341.5_Missense_Mutation_p.R35G|POU2F2_ENST00000342301.4_Missense_Mutation_p.R35G|POU2F2_ENST00000524801.2_5'UTR|POU2F2_ENST00000560398.1_Missense_Mutation_p.R35G			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	35					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	GGTCCATTTCTTTCGGTGTCT	0.582																																					p.R35G		Atlas-SNP	.											POU2F2_ENST00000292077,NS,carcinoma,+1,2	POU2F2	106	2	0			c.A103G						scavenged	.						139.0	126.0	130.0					19																	42626522		2203	4300	6503	SO:0001583	missense	5452	exon3			CATTTCTTTCGGT		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.103A>G	19.37:g.42626522T>C	ENSP00000431603:p.Arg35Gly	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	193	5	0.0259067	NM_002698	Q16648|Q7M4M8|Q9BRS4	Missense_Mutation	SNP	ENST00000526816.2	37	CCDS56095.1	.	.	.	.	.	.	.	.	.	.	T	18.62	3.664192	0.67700	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952;ENST00000531773	D;D;D;D;D	0.85629	-1.95;-2.01;-2.01;-1.75;-1.94	3.56	3.56	0.40772	.	4.474200	0.00481	N	0.000134	T	0.77916	0.4202	L	0.27053	0.805	0.30177	N	0.800776	P;B;P	0.41848	0.763;0.421;0.763	B;B;B	0.33392	0.121;0.073;0.163	T	0.71523	-0.4567	10	0.62326	D	0.03	.	10.035	0.42122	0.0:0.0:0.0:1.0	.	35;35;35	P09086-4;P09086;P09086-3	.;PO2F2_HUMAN;.	G	35;35;35;35;34;35;35;23	ENSP00000373992:R35G;ENSP00000339369:R35G;ENSP00000437221:R35G;ENSP00000437224:R35G;ENSP00000436988:R35G	ENSP00000292077:R35G	R	-	1	2	POU2F2	47318362	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.676000	0.37565	1.631000	0.50456	0.391000	0.25812	AGA	.	.	none		0.582	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3		
RPUSD4	84881	hgsc.bcm.edu	37	11	126075445	126075445	+	Silent	SNP	C	C	T	rs201545291		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:126075445C>T	ENST00000298317.4	-	5	767	c.714G>A	c.(712-714)cgG>cgA	p.R238R	RPUSD4_ENST00000534393.1_5'Flank|RPUSD4_ENST00000533628.1_Intron	NM_032795.2	NP_116184.2	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	238					pseudouridine synthesis (GO:0001522)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		CTTGCGCATTCCGGCTGCGCC	0.537																																					p.R238R		Atlas-SNP	.											.	RPUSD4	36	.	0			c.G714A						PASS	.						137.0	123.0	128.0					11																	126075445		2201	4299	6500	SO:0001819	synonymous_variant	84881	exon5			CGCATTCCGGCTG	BC014131	CCDS8469.1, CCDS53721.1	11q24.2	2013-02-11			ENSG00000165526	ENSG00000165526		"""RNA pseudouridylate synthase domain containing"""	25898	protein-coding gene	gene with protein product							Standard	NM_032795		Approved	FLJ14494	uc001qde.3	Q96CM3	OTTHUMG00000165815	ENST00000298317.4:c.714G>A	11.37:g.126075445C>T		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	226	63	0.278761	NM_032795	E9PML2|Q96K56	Silent	SNP	ENST00000298317.4	37	CCDS8469.1																																																																																			C|0.999;A|0.001	.	alt		0.537	RPUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386336.1	NM_032795	
TDRKH	11022	hgsc.bcm.edu	37	1	151747586	151747586	+	Silent	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:151747586T>C	ENST00000368822.1	-	11	2124	c.1491A>G	c.(1489-1491)gaA>gaG	p.E497E	TDRKH_ENST00000440583.2_Silent_p.E273E|TDRKH_ENST00000368823.1_Silent_p.E493E|TDRKH_ENST00000368824.3_Silent_p.E497E|TDRKH_ENST00000368825.3_Silent_p.E452E|TDRKH_ENST00000458431.2_Silent_p.E497E|TDRKH_ENST00000368827.6_Silent_p.E497E			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	497					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)	p.E497E(1)		breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTTCTATGTCTTCAGGAAGCT	0.403																																					p.E497E		Atlas-SNP	.											TDRKH,NS,carcinoma,0,1	TDRKH	45	1	1	Substitution - coding silent(1)	breast(1)	c.A1491G						scavenged	.						155.0	138.0	144.0					1																	151747586		1890	4122	6012	SO:0001819	synonymous_variant	11022	exon11			TATGTCTTCAGGA	AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.1491A>G	1.37:g.151747586T>C		Somatic	258	0	0		WXS	Illumina HiSeq	Phase_I	151	2	0.013245	NM_001083965	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Silent	SNP	ENST00000368822.1	37	CCDS41394.1																																																																																			.	.	none		0.403	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000036648.2	NM_006862	
SF3B1	23451	hgsc.bcm.edu	37	2	198260985	198260985	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:198260985T>C	ENST00000335508.6	-	23	3425	c.3334A>G	c.(3334-3336)Acc>Gcc	p.T1112A		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1112					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCTACAGTGGTACAAACTCTG	0.393			Mis		myelodysplastic syndrome																																p.T1112A		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	SF3B1,NS,malignant_melanoma,+2,2	SF3B1	1038	2	0			c.A3334G						scavenged	.						129.0	122.0	125.0					2																	198260985		2203	4300	6503	SO:0001583	missense	23451	exon23			CAGTGGTACAAAC	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3334A>G	2.37:g.198260985T>C	ENSP00000335321:p.Thr1112Ala	Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	173	3	0.017341	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	32	5.129520	0.94473	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.93	5.93	0.95920	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85961	0.5819	H	0.94620	3.56	0.80722	D	1	D	0.56968	0.978	D	0.63192	0.912	D	0.89846	0.4006	9	0.87932	D	0	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	1112	O75533	SF3B1_HUMAN	A	1112	.	ENSP00000335321:T1112A	T	-	1	0	SF3B1	197969230	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.963000	0.87922	2.281000	0.76405	0.533000	0.62120	ACC	.	.	none		0.393	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
HIAT1	64645	hgsc.bcm.edu	37	1	100547630	100547630	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:100547630G>A	ENST00000370152.3	+	12	1474	c.1338G>A	c.(1336-1338)ttG>ttA	p.L446L	SASS6_ENST00000462159.1_5'Flank|RP4-714D9.2_ENST00000432294.1_RNA	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	446					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		TTGTTGCCTTGTTTATTCCGG	0.463																																					p.L446L		Atlas-SNP	.											.	HIAT1	46	.	0			c.G1338A						PASS	.						109.0	100.0	103.0					1																	100547630		2203	4300	6503	SO:0001819	synonymous_variant	64645	exon12			TGCCTTGTTTATT	AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.1338G>A	1.37:g.100547630G>A		Somatic	214	0	0		WXS	Illumina HiSeq	Phase_I	257	112	0.435798	NM_033055	Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Silent	SNP	ENST00000370152.3	37	CCDS763.1																																																																																			.	.	none		0.463	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029657.1	NM_033055	
MUC4	4585	hgsc.bcm.edu	37	3	195506555	195506555	+	Missense_Mutation	SNP	C	C	T	rs368695884	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195506555C>T	ENST00000463781.3	-	2	12355	c.11896G>A	c.(11896-11898)Gcc>Acc	p.A3966T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3966T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A3966T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGAGGTGGCGTGACCTGTG	0.592													.|||	176	0.0351438	0.0083	0.0677	5008	,	,		7977	0.0119		0.0915	False		,,,				2504	0.0143				p.A3966T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	c.G11896A						scavenged	.						15.0	10.0	11.0					3																	195506555		666	1488	2154	SO:0001583	missense	4585	exon2			AGGTGGCGTGACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11896G>A	3.37:g.195506555C>T	ENSP00000417498:p.Ala3966Thr	Somatic	35	2	0.0571429		WXS	Illumina HiSeq	Phase_I	44	8	0.181818	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.905	-0.721125	0.03182	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.48522	1.23;0.81	.	.	.	.	.	.	.	.	T	0.22551	0.0544	N	0.19112	0.55	0.09310	N	1	B	0.18741	0.03	B	0.06405	0.002	T	0.12915	-1.0529	7	.	.	.	-3.1782	2.1866	0.03888	0.0:0.3341:0.3337:0.3322	.	3838	E7ESK3	.	T	3966	ENSP00000417498:A3966T;ENSP00000420243:A3966T	.	A	-	1	0	MUC4	196991334	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.202000	0.09451	-2.037000	0.00920	-2.088000	0.00374	GCC	.	.	weak		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TRIP11	9321	hgsc.bcm.edu	37	14	92472612	92472612	+	Missense_Mutation	SNP	C	C	T	rs376096662		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:92472612C>T	ENST00000267622.4	-	11	2081	c.1708G>A	c.(1708-1710)Gcc>Acc	p.A570T		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	570					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TCATTTAGGGCCACTTCACTT	0.303			T	PDGFRB	AML																																p.A570T	Ovarian(84;609 1888 9852 42686)	Atlas-SNP	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	TRIP11,NS,carcinoma,+2,1	TRIP11	184	1	0			c.G1708A						scavenged	.						112.0	109.0	110.0					14																	92472612		2202	4297	6499	SO:0001583	missense	9321	exon11			TTAGGGCCACTTC	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.1708G>A	14.37:g.92472612C>T	ENSP00000267622:p.Ala570Thr	Somatic	242	0	0		WXS	Illumina HiSeq	Phase_I	243	3	0.0123457	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.571|0.571	-0.840942|-0.840942	0.02692|0.02692	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	T|.	0.03982|.	3.74|.	6.16|6.16	-1.14|-1.14	0.09741|0.09741	.|.	1.274600|.	0.04980|.	N|.	0.465424|.	T|T	0.21921|0.21921	0.0528|0.0528	N|N	0.25890|0.25890	0.77|0.77	0.09310|0.09310	N|N	1|1	B;B|.	0.12630|.	0.0;0.006|.	B;B|.	0.13407|.	0.002;0.009|.	T|T	0.27872|0.27872	-1.0061|-1.0061	10|5	0.22706|.	T|.	0.39|.	.|.	4.3632|4.3632	0.11211|0.11211	0.3191:0.387:0.0:0.2939|0.3191:0.387:0.0:0.2939	.|.	306;570|.	F5H1Z0;Q15643|.	.;TRIPB_HUMAN|.	T|D	570;306|285	ENSP00000267622:A570T|.	ENSP00000267622:A570T|.	A|G	-|-	1|2	0|0	TRIP11|TRIP11	91542365|91542365	0.019000|0.019000	0.18553|0.18553	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.651000|0.651000	0.24873|0.24873	-0.236000|-0.236000	0.09753|0.09753	-0.912000|-0.912000	0.02778|0.02778	GCC|GGC	.	.	alt		0.303	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
CHD5	26038	hgsc.bcm.edu	37	1	6186637	6186637	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:6186637T>C	ENST00000262450.3	-	26	4172	c.4073A>G	c.(4072-4074)gAc>gGc	p.D1358G	CHD5_ENST00000378021.1_Missense_Mutation_p.D215G	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CGCACCCTGGTCCTCCTGGGA	0.672																																					p.D1358G		Atlas-SNP	.											CHD5_ENST00000262450,right_upper_lobe,carcinoma,-1,1	CHD5	267	1	0			c.A4073G						scavenged	.						63.0	44.0	50.0					1																	6186637		2203	4300	6503	SO:0001583	missense	26038	exon26			CCCTGGTCCTCCT	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.4073A>G	1.37:g.6186637T>C	ENSP00000262450:p.Asp1358Gly	Somatic	166	1	0.0060241		WXS	Illumina HiSeq	Phase_I	220	6	0.0272727	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	T	34	5.295450	0.95574	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000378021;ENST00000536802;ENST00000538279;ENST00000377999	D;T	0.91996	-2.95;2.04	4.5	4.5	0.54988	Domain of unknown function DUF1087 (1);	0.000000	0.85682	D	0.000000	D	0.94729	0.8299	L	0.56769	1.78	0.80722	D	1	D;P	0.69078	0.997;0.947	D;P	0.83275	0.996;0.76	D	0.95184	0.8302	10	0.72032	D	0.01	-37.2401	14.1277	0.65233	0.0:0.0:0.0:1.0	.	1358;215	Q8TDI0;Q5TG85	CHD5_HUMAN;.	G	1358;874;215;766;766;215	ENSP00000262450:D1358G;ENSP00000367260:D215G	ENSP00000262450:D1358G	D	-	2	0	CHD5	6109224	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.513000	0.81739	1.807000	0.52817	0.459000	0.35465	GAC	.	.	none		0.672	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
UBE2E3	10477	hgsc.bcm.edu	37	2	181927517	181927517	+	Splice_Site	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:181927517G>T	ENST00000410062.4	+	6	919		c.e6-1		UBE2E3_ENST00000392415.2_Splice_Site|UBE2E3_ENST00000602837.1_Splice_Site|UBE2E3_ENST00000602959.1_Splice_Site|UBE2E3_ENST00000602710.1_Splice_Site	NM_006357.2	NP_006348.1	Q969T4	UB2E3_HUMAN	ubiquitin-conjugating enzyme E2E 3						protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(3)|lung(4)|ovary(1)|skin(1)	11						TGCTTTTCCAGCGGATCCTCT	0.378																																					.		Atlas-SNP	.											UBE2E3,NS,carcinoma,-2,1	UBE2E3	26	1	0			c.527-1G>T						scavenged	.						72.0	65.0	67.0					2																	181927517		2202	4299	6501	SO:0001630	splice_region_variant	10477	exon7			TTTCCAGCGGATC	AB017644	CCDS2282.1	2q31.3	2011-05-19	2011-05-19		ENSG00000170035	ENSG00000170035		"""Ubiquitin-conjugating enzymes E2"""	12479	protein-coding gene	gene with protein product		604151	"""ubiquitin-conjugating enzyme E2E 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast)"""			10343118	Standard	NM_006357		Approved	UbcH9	uc002unq.1	Q969T4	OTTHUMG00000132585	ENST00000410062.4:c.527-1G>T	2.37:g.181927517G>T		Somatic	207	0	0		WXS	Illumina HiSeq	Phase_I	266	5	0.018797	NM_182678	B2RAD6|D3DPG3|Q5U0R7|Q7Z4W4	Splice_Site	SNP	ENST00000410062.4	37	CCDS2282.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086757	0.76642	.	.	ENSG00000170035	ENST00000410114;ENST00000392415;ENST00000410062;ENST00000409247	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1521	0.93493	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UBE2E3	181635762	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.637000	0.98443	2.529000	0.85273	0.460000	0.39030	.	.	.	none		0.378	UBE2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255795.6	NM_006357	Intron
KRT19	3880	hgsc.bcm.edu	37	17	39684410	39684410	+	Silent	SNP	G	G	A	rs200623371|rs11550883	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:39684410G>A	ENST00000361566.3	-	1	150	c.90C>T	c.(88-90)gcC>gcT	p.A30A		NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	30	Head.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				GCGCGCGAAAGGCGACCCCCG	0.721													G|||	3426	0.684105	0.4183	0.7709	5008	,	,		11852	0.9177		0.6402	False		,,,				2504	0.7863				p.A30A		Atlas-SNP	.											KRT19,NS,carcinoma,0,1	KRT19	41	1	0			c.C90T						scavenged	.	G		2008,2162		537,934,614	6.0	10.0	9.0		90	1.0	0.0	17	dbSNP_120	9	5219,2943		1750,1719,612	no	coding-synonymous	KRT19	NM_002276.4		2287,2653,1226	AA,AG,GG		36.0573,48.1535,41.3964		30/401	39684410	7227,5105	2085	4081	6166	SO:0001819	synonymous_variant	3880	exon1			GCGAAAGGCGACC		CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.90C>T	17.37:g.39684410G>A		Somatic	1	1	1		WXS	Illumina HiSeq	Phase_I	2	2	1	NM_002276	B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Silent	SNP	ENST00000361566.3	37	CCDS11399.1																																																																																			G|0.323;A|0.677	0.677	strong		0.721	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257285.1	NM_002276	
P2RY8	286530	hgsc.bcm.edu	37	X	1585400	1585400	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chrX:1585400G>A	ENST00000381297.4	-	2	262	c.52C>T	c.(52-54)Cgg>Tgg	p.R18W	P2RY8_ENST00000460672.1_5'UTR	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCGGGTTCCGCAGCATCTGC	0.697			T	CRLF2	"""B-ALL, Downs associated ALL"""																																p.R18W		Atlas-SNP	.		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	.	P2RY8	53	.	0			c.C52T						PASS	.						32.0	37.0	36.0					X																	1585400		2203	4294	6497	SO:0001583	missense	286530	exon2			GGTTCCGCAGCAT	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.52C>T	X.37:g.1585400G>A	ENSP00000370697:p.Arg18Trp	Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	52	44	0.846154	NM_178129		Missense_Mutation	SNP	ENST00000381297.4	37	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	g	7.771	0.707456	0.15239	.	.	ENSG00000182162	ENST00000381297	T	0.37752	1.18	1.87	-1.37	0.09056	.	1.062470	0.07489	U	0.905207	T	0.21103	0.0508	N	0.08118	0	0.09310	N	1	D	0.67145	0.996	P	0.46629	0.522	T	0.25502	-1.0130	10	0.66056	D	0.02	.	5.9234	0.19094	0.0:0.2784:0.4476:0.274	.	18	Q86VZ1	P2RY8_HUMAN	W	18	ENSP00000370697:R18W	ENSP00000370697:R18W	R	-	1	2	P2RY8	1545400	0.008000	0.16893	0.082000	0.20525	0.013000	0.08279	0.872000	0.28037	0.473000	0.27368	0.279000	0.19357	CGG	.	.	none		0.697	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	NM_178129	
NPLOC4	55666	hgsc.bcm.edu	37	17	79532602	79532602	+	Missense_Mutation	SNP	C	C	T	rs371370139		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:79532602C>T	ENST00000331134.6	-	16	1813	c.1598G>A	c.(1597-1599)cGg>cAg	p.R533Q	NPLOC4_ENST00000572760.1_5'UTR|NPLOC4_ENST00000573876.1_5'UTR|NPLOC4_ENST00000539314.1_Missense_Mutation_p.R372Q|NPLOC4_ENST00000374747.5_Missense_Mutation_p.R533Q	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	533					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			ATTTCTGGTCCGCACGGCCTC	0.597																																					p.R533Q		Atlas-SNP	.											.	NPLOC4	27	.	0			c.G1598A						PASS	.	C	GLN/ARG	0,4110		0,0,2055	16.0	20.0	19.0		1598	5.0	0.9	17		19	1,8323		0,1,4161	no	missense	NPLOC4	NM_017921.2	43	0,1,6216	TT,TC,CC		0.012,0.0,0.0080	possibly-damaging	533/609	79532602	1,12433	2055	4162	6217	SO:0001583	missense	55666	exon16			CTGGTCCGCACGG	AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.1598G>A	17.37:g.79532602C>T	ENSP00000331487:p.Arg533Gln	Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	32	4	0.125	NM_017921	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Missense_Mutation	SNP	ENST00000331134.6	37	CCDS45812.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350695	0.41599	0.0	1.2E-4	ENSG00000182446	ENST00000331134;ENST00000374747;ENST00000539314	.	.	.	5.02	5.02	0.67125	Nuclear pore localisation protein NPL4 (1);	0.095949	0.64402	D	0.000002	T	0.62258	0.2413	M	0.70787	2.145	0.53005	D	0.999964	P;D;P	0.52996	0.636;0.957;0.894	B;B;P	0.44897	0.354;0.424;0.463	T	0.64909	-0.6296	9	0.36615	T	0.2	-33.3332	18.5911	0.91212	0.0:1.0:0.0:0.0	.	372;533;533	B4DG89;Q8TAT6-2;Q8TAT6	.;.;NPL4_HUMAN	Q	533;532;372	.	ENSP00000331487:R533Q	R	-	2	0	NPLOC4	77143044	1.000000	0.71417	0.944000	0.38274	0.130000	0.20726	3.250000	0.51445	2.628000	0.89032	0.650000	0.86243	CGG	.	.	weak		0.597	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440140.1		
MCMBP	79892	hgsc.bcm.edu	37	10	121586927	121586927	+	IGR	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:121586927T>C	ENST00000360003.3	-	0	4113				INPP5F_ENST00000361976.2_Missense_Mutation_p.S1012P|INPP5F_ENST00000369080.3_Missense_Mutation_p.S402P	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein						DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						TTCTCGGCCATCGCAATTAGA	0.458																																					p.S1012P		Atlas-SNP	.											INPP5F,colon,carcinoma,-2,3	INPP5F	112	3	0			c.T3034C						scavenged	.						130.0	123.0	125.0					10																	121586927		2203	4300	6503	SO:0001628	intergenic_variant	22876	exon20			CGGCCATCGCAAT	BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159		10.37:g.121586927T>C		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	142	4	0.028169	NM_014937	B3KSP7|Q6IA56|Q9BVT9|Q9H916	Missense_Mutation	SNP	ENST00000360003.3	37	CCDS7617.1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.819944	0.50633	.	.	ENSG00000198825	ENST00000361976;ENST00000369080	T;T	0.59906	0.65;0.23	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.73164	0.3552	L	0.58101	1.795	0.80722	D	1	D;D	0.76494	0.996;0.999	P;D	0.80764	0.844;0.994	T	0.74657	-0.3592	10	0.59425	D	0.04	-11.4343	16.3662	0.83325	0.0:0.0:0.0:1.0	.	402;1012	Q5W135;Q9Y2H2	.;SAC2_HUMAN	P	1012;402	ENSP00000354519:S1012P;ENSP00000358076:S402P	ENSP00000354519:S1012P	S	+	1	0	INPP5F	121576917	1.000000	0.71417	0.706000	0.30403	0.048000	0.14542	7.596000	0.82721	2.274000	0.75844	0.533000	0.62120	TCG	.	.	none		0.458	MCMBP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050684.1	NM_024834	
COX10	1352	hgsc.bcm.edu	37	17	14095348	14095348	+	Silent	SNP	G	G	A	rs587780910		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:14095348G>A	ENST00000261643.3	+	6	815	c.738G>A	c.(736-738)ccG>ccA	p.P246P	COX10_ENST00000536205.1_Silent_p.P54P|COX10_ENST00000537334.1_Silent_p.P29P	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	246					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		GTGCTGTTCCGGGAGTTGCCA	0.502																																					p.P246P		Atlas-SNP	.											COX10,NS,carcinoma,+1,1	COX10	36	1	0			c.G738A						scavenged	.						123.0	118.0	120.0					17																	14095348		2203	4300	6503	SO:0001819	synonymous_variant	1352	exon6			TGTTCCGGGAGTT	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.738G>A	17.37:g.14095348G>A		Somatic	108	2	0.0185185		WXS	Illumina HiSeq	Phase_I	133	8	0.0601504	NM_001303	B2R6U5|B4DJ50|O15334|Q969F7	Silent	SNP	ENST00000261643.3	37	CCDS11166.1																																																																																			T|0.054;A|0.946	0.946	alt		0.502	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303	
SPATA3	130560	hgsc.bcm.edu	37	2	231861059	231861059	+	Silent	SNP	A	A	T	rs72362780		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:231861059A>T	ENST00000452881.1	+	1	219	c.111A>T	c.(109-111)ccA>ccT	p.P37P	AC105344.2_ENST00000414876.1_lincRNA|SPATA3_ENST00000433428.2_Silent_p.P37P|SPATA3_ENST00000424440.1_Silent_p.P37P|SPATA3_ENST00000455816.1_Silent_p.P37P			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	37										endometrium(2)|lung(1)	3						AATCCACACCACAGCAGCCTA	0.572																																					p.P37P		Atlas-SNP	.											SPATA3,NS,carcinoma,0,4	SPATA3	52	4	0			c.A111T						scavenged	.						127.0	133.0	131.0					2																	231861059		692	1591	2283	SO:0001819	synonymous_variant	130560	exon1			CACACCACAGCAG	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.111A>T	2.37:g.231861059A>T		Somatic	66	11	0.166667		WXS	Illumina HiSeq	Phase_I	103	27	0.262136	NM_139073	Q86WX5|Q8N9Y6	Silent	SNP	ENST00000452881.1	37	CCDS2481.1																																																																																			.	.	none		0.572	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
SRRM1	10250	hgsc.bcm.edu	37	1	24993386	24993386	+	Missense_Mutation	SNP	G	G	T	rs78787676		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:24993386G>T	ENST00000323848.9	+	13	2024	c.1709G>T	c.(1708-1710)cGc>cTc	p.R570L	SRRM1_ENST00000374389.4_Missense_Mutation_p.R579L|SRRM1_ENST00000479034.1_3'UTR|snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000537199.1_3'UTR|SRRM1_ENST00000447431.2_Missense_Mutation_p.R582L	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	570	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R570L(2)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CCTCGACGGCGCAGGACTCCC	0.557																																					p.R570L	Ovarian(68;897 1494 3282 17478)	Atlas-SNP	.											SRRM1,bladder,carcinoma,0,2	SRRM1	81	2	2	Substitution - Missense(2)	urinary_tract(1)|central_nervous_system(1)	c.G1709T						scavenged	.						54.0	45.0	48.0					1																	24993386		2203	4300	6503	SO:0001583	missense	10250	exon13			GACGGCGCAGGAC	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1709G>T	1.37:g.24993386G>T	ENSP00000326261:p.Arg570Leu	Somatic	160	1	0.00625		WXS	Illumina HiSeq	Phase_I	237	6	0.0253165	NM_005839	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693027	0.88735	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.34667	1.35;1.35;1.35	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000007	T	0.58104	0.2099	L	0.54323	1.7	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.76575	0.988;0.972	T	0.57318	-0.7832	10	0.62326	D	0.03	-1.2563	19.3453	0.94361	0.0:0.0:1.0:0.0	.	582;570	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	L	570;582;579	ENSP00000326261:R570L;ENSP00000391430:R582L;ENSP00000363510:R579L	ENSP00000326261:R570L	R	+	2	0	SRRM1	24865973	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.773000	0.85462	2.654000	0.90174	0.650000	0.86243	CGC	G|0.999;A|0.001	.	alt		0.557	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
SORBS2	8470	hgsc.bcm.edu	37	4	186544315	186544315	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:186544315C>T	ENST00000284776.7	-	13	2765	c.2256G>A	c.(2254-2256)ccG>ccA	p.P752P	SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000355634.5_Silent_p.P852P|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000431808.1_Silent_p.P752P|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000418609.1_Silent_p.P656P|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000393528.3_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	752					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TGCTGTTGTCCGGCAAGCTCC	0.527																																					p.P852P	Esophageal Squamous(153;41 2433 9491 36028)	Atlas-SNP	.											SORBS2_ENST00000418609,NS,carcinoma,-1,3	SORBS2	300	3	0			c.G2556A						scavenged	.						140.0	160.0	153.0					4																	186544315		2203	4300	6503	SO:0001819	synonymous_variant	8470	exon16			GTTGTCCGGCAAG		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2256G>A	4.37:g.186544315C>T		Somatic	115	1	0.00869565		WXS	Illumina HiSeq	Phase_I	90	2	0.0222222	NM_001270771	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Silent	SNP	ENST00000284776.7	37	CCDS3845.1																																																																																			.	.	none		0.527	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
MBD1	4152	hgsc.bcm.edu	37	18	47802076	47802076	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr18:47802076C>T	ENST00000591416.1	-	8	1117	c.686G>A	c.(685-687)cGg>cAg	p.R229Q	MBD1_ENST00000585595.1_Missense_Mutation_p.R229Q|MBD1_ENST00000587605.1_Missense_Mutation_p.R229Q|MBD1_ENST00000382948.5_Missense_Mutation_p.R229Q|MBD1_ENST00000349085.2_Missense_Mutation_p.R229Q|MBD1_ENST00000398493.1_Missense_Mutation_p.R229Q|MBD1_ENST00000590208.1_Missense_Mutation_p.R229Q|MBD1_ENST00000436910.1_Missense_Mutation_p.R229Q|MBD1_ENST00000353909.3_Missense_Mutation_p.R180Q|MBD1_ENST00000269471.5_Missense_Mutation_p.R229Q|MBD1_ENST00000398488.1_Missense_Mutation_p.R229Q|MBD1_ENST00000398495.2_Missense_Mutation_p.R229Q|MBD1_ENST00000424334.2_Missense_Mutation_p.R255Q|MBD1_ENST00000347968.3_Missense_Mutation_p.R229Q|MBD1_ENST00000585672.1_Missense_Mutation_p.R180Q|MBD1_ENST00000339998.6_Missense_Mutation_p.R229Q|MBD1_ENST00000591535.1_Missense_Mutation_p.R229Q|MBD1_ENST00000269468.5_Missense_Mutation_p.R229Q|MBD1_ENST00000457839.2_Missense_Mutation_p.R229Q|MBD1_ENST00000588937.1_Missense_Mutation_p.R229Q			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	229					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R229L(8)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						CTGACAGCCCCGGCATACTCC	0.672																																					p.R229Q		Atlas-SNP	.											MBD1_ENST00000457839,NS,carcinoma,0,4	MBD1	228	4	8	Substitution - Missense(8)	lung(4)|endometrium(4)	c.G686A						scavenged	.						58.0	50.0	52.0					18																	47802076		2203	4300	6503	SO:0001583	missense	4152	exon8			CAGCCCCGGCATA	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.686G>A	18.37:g.47802076C>T	ENSP00000467017:p.Arg229Gln	Somatic	110	1	0.00909091		WXS	Illumina HiSeq	Phase_I	183	2	0.010929	NM_001204137	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Missense_Mutation	SNP	ENST00000591416.1	37	CCDS11943.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.245472	0.59103	.	.	ENSG00000141644	ENST00000382948;ENST00000353909;ENST00000349085;ENST00000269468;ENST00000347968;ENST00000436910;ENST00000269471;ENST00000424334;ENST00000339998;ENST00000398495;ENST00000457839;ENST00000398493;ENST00000398488	D;D;D;D;D;D;D;D;D;D;D;D;D	0.95272	-3.61;-3.63;-3.6;-3.61;-3.6;-3.61;-3.61;-3.66;-3.6;-3.62;-3.65;-3.6;-3.6	4.91	3.0	0.34707	Zinc finger, CXXC-type (2);	0.420544	0.20408	N	0.092904	D	0.90672	0.7074	N	0.10874	0.06	0.29323	N	0.867248	P;D;P;D;D;D;P;P;D;P;P;D	0.76494	0.889;0.999;0.919;0.982;0.963;0.979;0.777;0.803;0.982;0.932;0.946;0.982	B;D;B;P;B;P;B;B;P;B;P;P	0.79784	0.391;0.993;0.2;0.605;0.401;0.751;0.2;0.147;0.605;0.44;0.525;0.807	T	0.82715	-0.0320	10	0.16896	T	0.51	-15.1991	4.1959	0.10443	0.0:0.6052:0.2044:0.1904	.	229;255;229;229;229;229;180;229;229;229;229;229	B4DUR3;B4DI41;Q9UIS9-8;A8K654;Q9UIS9-6;Q9UIS9-2;Q9UIS9-5;Q9UIS9-4;Q9UIS9;Q9UIS9-7;B4DXJ5;Q9UIS9-3	.;.;.;.;.;.;.;.;MBD1_HUMAN;.;.;.	Q	229;180;229;229;229;229;229;255;229;229;229;229;229	ENSP00000372407:R229Q;ENSP00000269469:R180Q;ENSP00000342531:R229Q;ENSP00000269468:R229Q;ENSP00000285102:R229Q;ENSP00000409561:R229Q;ENSP00000269471:R229Q;ENSP00000408846:R255Q;ENSP00000339546:R229Q;ENSP00000381508:R229Q;ENSP00000405268:R229Q;ENSP00000381506:R229Q;ENSP00000381502:R229Q	ENSP00000269468:R229Q	R	-	2	0	MBD1	46056074	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.191000	0.32138	2.418000	0.82041	0.655000	0.94253	CGG	.	.	none		0.672	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	
GYPB	2994	hgsc.bcm.edu	37	4	144922415	144922415	+	Missense_Mutation	SNP	A	A	G	rs189622883	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:144922415A>G	ENST00000502664.1	-	2	110	c.59T>C	c.(58-60)tTa>tCa	p.L20S	GYPB_ENST00000429670.2_Missense_Mutation_p.L20S|GYPB_ENST00000510196.2_5'UTR|GYPB_ENST00000513128.1_Intron|RP11-673E1.4_ENST00000506982.1_RNA|GYPB_ENST00000283126.7_Missense_Mutation_p.L20S	NM_002100.4	NP_002091	P06028	GLPB_HUMAN	glycophorin B (MNS blood group)	20						integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					AGTGGTACTTAATGCTGATAT	0.353																																					p.L20S		Atlas-SNP	.											GYPB_ENST00000502664,brain,glioma,0,2	GYPB	17	2	0			c.T59C						scavenged	.						129.0	161.0	150.0					4																	144922415		2196	4300	6496	SO:0001583	missense	2994	exon2			GTACTTAATGCTG		CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000502664.1:c.59T>C	4.37:g.144922415A>G	ENSP00000427690:p.Leu20Ser	Somatic	700	3	0.00428571		WXS	Illumina HiSeq	Phase_I	392	4	0.0102041	NM_002100	B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Missense_Mutation	SNP	ENST00000502664.1	37	CCDS54809.1	.	.	.	.	.	.	.	.	.	.	G	4.940	0.174631	0.09391	.	.	ENSG00000250361	ENST00000283126;ENST00000502664;ENST00000429670	T;T;T	0.04406	4.6;4.6;3.63	1.55	0.248	0.15526	.	.	.	.	.	T	0.03520	0.0101	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43621	-0.9380	8	0.51188	T	0.08	.	2.4243	0.04455	0.2725:0.0:0.2871:0.4404	.	20	E2QBW7	.	S	20	ENSP00000283126:L20S;ENSP00000427690:L20S;ENSP00000394200:L20S	ENSP00000283126:L20S	L	-	2	0	GYPB	145141865	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-4.249000	0.00266	-0.311000	0.08754	-1.389000	0.01157	TTA	A|0.986;C|0.014	.	alt		0.353	GYPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364791.1	NM_002100	
ZNF347	84671	hgsc.bcm.edu	37	19	53652059	53652059	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:53652059A>G	ENST00000334197.7	-	4	214	c.146T>C	c.(145-147)aTc>aCc	p.I49T	ZNF347_ENST00000601804.1_5'UTR|ZNF347_ENST00000601469.2_Missense_Mutation_p.I50T|ZNF347_ENST00000452676.2_Missense_Mutation_p.I50T	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	49	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		AAAACAAGAGATTCCTGCTTA	0.428																																					p.I50T	Melanoma(64;205 1597 17324 45721)	Atlas-SNP	.											ZNF347,NS,carcinoma,+1,1	ZNF347	87	1	0			c.T149C						scavenged	.						138.0	130.0	133.0					19																	53652059		2203	4300	6503	SO:0001583	missense	84671	exon4			CAAGAGATTCCTG	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.146T>C	19.37:g.53652059A>G	ENSP00000334146:p.Ile49Thr	Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	150	2	0.0133333	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	A	4.438	0.081068	0.08533	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.00808	5.67;5.67	1.82	-0.463	0.12164	Krueppel-associated box (3);	.	.	.	.	T	0.00875	0.0029	L	0.52266	1.64	0.09310	N	1	P;B	0.34684	0.463;0.118	B;B	0.29785	0.107;0.015	T	0.45745	-0.9240	9	0.23891	T	0.37	.	2.3988	0.04396	0.5061:0.3017:0.1922:0.0	.	50;49	G5E9N4;Q96SE7	.;ZN347_HUMAN	T	49;50	ENSP00000334146:I49T;ENSP00000405218:I50T	ENSP00000334146:I49T	I	-	2	0	ZNF347	58343871	0.001000	0.12720	0.001000	0.08648	0.007000	0.05969	0.425000	0.21346	-0.194000	0.10399	0.477000	0.44152	ATC	.	.	none		0.428	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
TROAP	10024	hgsc.bcm.edu	37	12	49724403	49724403	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:49724403A>G	ENST00000257909.3	+	13	1851	c.1775A>G	c.(1774-1776)tAc>tGc	p.Y592C	TROAP_ENST00000547923.1_Intron|TROAP_ENST00000551245.1_Missense_Mutation_p.Y592C	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	592	4 X 33 AA approximate tandem repeats.|Cys-rich.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						CTAGAGTCCTACTGTAGGATT	0.617																																					p.Y592C		Atlas-SNP	.											TROAP,bladder,carcinoma,0,3	TROAP	80	3	0			c.A1775G						scavenged	.						72.0	70.0	71.0					12																	49724403		2203	4300	6503	SO:0001583	missense	10024	exon13			AGTCCTACTGTAG	U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.1775A>G	12.37:g.49724403A>G	ENSP00000257909:p.Tyr592Cys	Somatic	157	1	0.00636943		WXS	Illumina HiSeq	Phase_I	321	16	0.0498442	NM_005480	F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	ENST00000257909.3	37	CCDS8784.1	.	.	.	.	.	.	.	.	.	.	a	5.880	0.346480	0.11126	.	.	ENSG00000135451	ENST00000551245;ENST00000257909	.	.	.	3.34	-3.85	0.04243	.	1.490010	0.03952	N	0.288732	T	0.09069	0.0224	N	0.00841	-1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18272	-1.0342	9	0.28530	T	0.3	7.0657	4.9225	0.13876	0.4025:0.2764:0.321:0.0	.	592;592	F8W130;Q12815	.;TROAP_HUMAN	C	592	.	ENSP00000257909:Y592C	Y	+	2	0	TROAP	48010670	0.904000	0.30761	0.000000	0.03702	0.008000	0.06430	-0.239000	0.08965	-0.648000	0.05437	-1.237000	0.01550	TAC	.	.	none		0.617	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480	
ASPM	259266	hgsc.bcm.edu	37	1	197070312	197070312	+	Missense_Mutation	SNP	C	C	T	rs191126815		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:197070312C>T	ENST00000367409.4	-	18	8325	c.8069G>A	c.(8068-8070)cGg>cAg	p.R2690Q	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2690	IQ 29. {ECO:0000255|PROSITE- ProRule:PRU00116}.|IQ 30. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TGTGGCAGCCCGGTGCATATT	0.368													C|||	1	0.000199681	0.0	0.0	5008	,	,		17870	0.001		0.0	False		,,,				2504	0.0				p.R2690Q		Atlas-SNP	.											ASPM,NS,carcinoma,+1,1	ASPM	444	1	0			c.G8069A						scavenged	.						52.0	51.0	51.0					1																	197070312		2203	4299	6502	SO:0001583	missense	259266	exon18			GCAGCCCGGTGCA	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.8069G>A	1.37:g.197070312C>T	ENSP00000356379:p.Arg2690Gln	Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	219	3	0.0136986	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	8.716	0.913259	0.17907	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	T	0.29917	1.55	5.34	-3.57	0.04612	.	0.856444	0.10014	N	0.726871	T	0.27524	0.0676	N	0.21324	0.655	0.58432	D	0.999998	D;B	0.71674	0.998;0.024	D;B	0.70016	0.967;0.019	T	0.55224	-0.8174	10	0.12430	T	0.62	.	3.386	0.07272	0.3348:0.3678:0.0645:0.233	.	676;2690	E7EQ84;Q8IZT6	.;ASPM_HUMAN	Q	2690;676	ENSP00000356379:R2690Q	ENSP00000356376:R676Q	R	-	2	0	ASPM	195336935	0.013000	0.17824	0.930000	0.37139	0.492000	0.33523	0.351000	0.20096	-0.213000	0.10094	-0.402000	0.06365	CGG	C|1.000;T|0.000	0.000	strong		0.368	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
KRTAP9-2	83899	hgsc.bcm.edu	37	17	39383041	39383041	+	Silent	SNP	C	C	T	rs71371479		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:39383041C>T	ENST00000377721.3	+	1	142	c.135C>T	c.(133-135)tcC>tcT	p.S45S	KRTAP9-2_ENST00000455970.2_Silent_p.S45S	NM_031961.2	NP_114167.2	Q9BYQ4	KRA92_HUMAN	keratin associated protein 9-2	45	17 X 5 AA repeats of C-C-[RQVSGE]-[SPTQ]- [TASP].					keratin filament (GO:0045095)		p.S45S(1)		large_intestine(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			GCTGTGTGTCCAGCTGCTGCC	0.647																																					p.S45S		Atlas-SNP	.											KRTAP9-2,NS,carcinoma,0,1	KRTAP9-2	24	1	1	Substitution - coding silent(1)	prostate(1)	c.C135T						scavenged	.						62.0	56.0	58.0					17																	39383041		2203	4299	6502	SO:0001819	synonymous_variant	83899	exon1			TGTGTCCAGCTGC	AJ406946	CCDS32651.1	17q21.2	2013-06-25			ENSG00000239886	ENSG00000239886		"""Keratin associated proteins"""	16926	protein-coding gene	gene with protein product						11279113	Standard	NM_031961		Approved	KAP9.2	uc002hwf.3	Q9BYQ4	OTTHUMG00000133609	ENST00000377721.3:c.135C>T	17.37:g.39383041C>T		Somatic	58	3	0.0517241		WXS	Illumina HiSeq	Phase_I	74	3	0.0405405	NM_031961	Q17RK8|Q2TB15|Q6ISF6	Silent	SNP	ENST00000377721.3	37	CCDS32651.1																																																																																			C|0.500;T|0.500	0.500	weak		0.647	KRTAP9-2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257717.1		
NBPF4	148545	hgsc.bcm.edu	37	1	108769307	108769307	+	Silent	SNP	G	G	A	rs367656931	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:108769307G>A	ENST00000415641.3	-	14	2072	c.1869C>T	c.(1867-1869)agC>agT	p.S623S		NM_001143989.2	NP_001137461.1	Q96M43	NBPF4_HUMAN	neuroblastoma breakpoint family, member 4	623						cytoplasm (GO:0005737)		p.S623S(2)		endometrium(2)|lung(1)|skin(1)	4						TTACCTCTGCGCTCTCAGCAT	0.493													G|||	1100	0.219649	0.025	0.3429	5008	,	,		14496	0.3611		0.1859	False		,,,				2504	0.2843				p.S623S		Atlas-SNP	.											NBPF4,NS,carcinoma,0,2	NBPF4	4	2	2	Substitution - coding silent(2)	endometrium(2)	c.C1869T						scavenged	.						94.0	74.0	81.0					1																	108769307		647	1398	2045	SO:0001819	synonymous_variant	148545	exon14			CTCTGCGCTCTCA	AK057395	CCDS44182.1	1p13.3	2013-01-17			ENSG00000196427	ENSG00000196427		"""neuroblastoma breakpoint family"""	26550	protein-coding gene	gene with protein product		613994				16079250	Standard	NM_001143989		Approved	FLJ32833	uc009weo.2	Q96M43	OTTHUMG00000011318	ENST00000415641.3:c.1869C>T	1.37:g.108769307G>A		Somatic	370	12	0.0324324		WXS	Illumina HiSeq	Phase_I	439	10	0.022779	NM_001143989	Q5T483	Silent	SNP	ENST00000415641.3	37	CCDS44182.1																																																																																			G|0.500;A|0.500	0.500	weak		0.493	NBPF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031255.5	NM_152488	
SYNE1	23345	hgsc.bcm.edu	37	6	152590378	152590378	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:152590378G>A	ENST00000367255.5	-	99	19218	c.18617C>T	c.(18616-18618)gCc>gTc	p.A6206V	SYNE1_ENST00000341594.5_Missense_Mutation_p.A5818V|SYNE1_ENST00000448038.1_Missense_Mutation_p.A6135V|SYNE1_ENST00000356820.4_Missense_Mutation_p.A730V|SYNE1_ENST00000265368.4_Missense_Mutation_p.A6206V|SYNE1_ENST00000423061.1_Missense_Mutation_p.A6135V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6206					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.A6206V(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCTCTGCGTGGCTGTTAGGTC	0.537										HNSCC(10;0.0054)																											p.A6206V		Atlas-SNP	.											SYNE1_ENST00000265368,colon,carcinoma,0,2	SYNE1	3227	2	2	Substitution - Missense(2)	large_intestine(2)	c.C18617T						scavenged	.						160.0	124.0	136.0					6																	152590378		2203	4300	6503	SO:0001583	missense	23345	exon99			TGCGTGGCTGTTA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18617C>T	6.37:g.152590378G>A	ENSP00000356224:p.Ala6206Val	Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	157	2	0.0127389	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269841	0.40095	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.54675	0.65;0.64;0.56;0.64;0.75;1.01	5.57	3.75	0.43078	.	0.313714	0.27270	N	0.020123	T	0.28234	0.0697	L	0.51422	1.61	0.09310	N	1	B;B;B	0.28055	0.075;0.075;0.199	B;B;B	0.30572	0.055;0.055;0.117	T	0.14839	-1.0458	10	0.29301	T	0.29	.	13.1112	0.59275	0.0:0.1229:0.7491:0.128	.	6206;6206;6135	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	V	6206;6135;6206;6135;5818;730	ENSP00000356224:A6206V;ENSP00000396024:A6135V;ENSP00000265368:A6206V;ENSP00000390975:A6135V;ENSP00000341887:A5818V;ENSP00000349276:A730V	ENSP00000265368:A6206V	A	-	2	0	SYNE1	152632071	1.000000	0.71417	0.002000	0.10522	0.290000	0.27261	5.995000	0.70631	0.786000	0.33708	0.655000	0.94253	GCC	.	.	none		0.537	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
CD300C	10871	hgsc.bcm.edu	37	17	72540836	72540836	+	Silent	SNP	G	G	A	rs530341053	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:72540836G>A	ENST00000330793.1	-	2	672	c.312C>T	c.(310-312)gaC>gaT	p.D104D		NM_006678.3	NP_006669.1	Q08708	CLM6_HUMAN	CD300c molecule	104	Ig-like V-type.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.D104E(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|skin(2)|upper_aerodigestive_tract(1)	21						AGGTGCCTGCGTCCTCCTCTG	0.582													A|||	2	0.000399361	0.0	0.0	5008	,	,		19613	0.0		0.0	False		,,,				2504	0.002				p.D104D	Esophageal Squamous(66;421 1121 20537 25337 27468)	Atlas-SNP	.											CD300C,NS,carcinoma,0,1	CD300C	41	1	1	Substitution - Missense(1)	lung(1)	c.C312T						scavenged	.						190.0	151.0	164.0					17																	72540836		2203	4300	6503	SO:0001819	synonymous_variant	10871	exon2			GCCTGCGTCCTCC	BC022279	CCDS11701.1	17q25.2	2014-05-15	2006-03-28		ENSG00000167850	ENSG00000167850		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19320	protein-coding gene	gene with protein product		606786	"""CD300c antigen"""			1349532, 10746781	Standard	NM_006678		Approved	CMRF35, LIR, CMRF-35A, CMRF35A, IGSF16	uc002jky.2	Q08708	OTTHUMG00000067608	ENST00000330793.1:c.312C>T	17.37:g.72540836G>A		Somatic	264	2	0.00757576		WXS	Illumina HiSeq	Phase_I	322	6	0.0186335	NM_006678		Silent	SNP	ENST00000330793.1	37	CCDS11701.1																																																																																			.	.	none		0.582	CD300C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145084.1	NM_006678	
RABL3	285282	hgsc.bcm.edu	37	3	120409318	120409318	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:120409318T>C	ENST00000273375.3	-	7	652	c.623A>G	c.(622-624)tAc>tGc	p.Y208C	RABL3_ENST00000491398.1_5'UTR|RABL3_ENST00000483733.1_Missense_Mutation_p.Y184C	NM_173825.3	NP_776186.2	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3	208	Small GTPase-like.				small GTPase mediated signal transduction (GO:0007264)		GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)	17				GBM - Glioblastoma multiforme(114;0.151)		TCTTAAAAAGTATCTCTTCTC	0.323																																					p.Y208C		Atlas-SNP	.											.	RABL3	23	.	0			c.A623G						PASS	.						40.0	43.0	42.0					3																	120409318		2199	4290	6489	SO:0001583	missense	285282	exon7			AAAAAGTATCTCT	BC020832	CCDS3001.1	3q13.33	2008-02-05			ENSG00000144840	ENSG00000144840			18072	protein-coding gene	gene with protein product						12477932	Standard	NM_173825		Approved	MGC23920	uc003edx.3	Q5HYI8	OTTHUMG00000159668	ENST00000273375.3:c.623A>G	3.37:g.120409318T>C	ENSP00000273375:p.Tyr208Cys	Somatic	199	0	0		WXS	Illumina HiSeq	Phase_I	237	102	0.43038	NM_173825	Q8WUD3	Missense_Mutation	SNP	ENST00000273375.3	37	CCDS3001.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338274	0.81911	.	.	ENSG00000144840	ENST00000273375;ENST00000483733	T;T	0.74737	-0.58;-0.87	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.69459	0.3113	N	0.08118	0	0.80722	D	1	D	0.64830	0.994	P	0.57371	0.819	T	0.75184	-0.3407	10	0.52906	T	0.07	-7.5345	14.2018	0.65710	0.0:0.0:0.0:1.0	.	208	Q5HYI8	RABL3_HUMAN	C	208;184	ENSP00000273375:Y208C;ENSP00000419986:Y184C	ENSP00000273375:Y208C	Y	-	2	0	RABL3	121892008	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.258000	0.78371	2.288000	0.76882	0.533000	0.62120	TAC	.	.	none		0.323	RABL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356776.1	NM_173825	
BMP2	650	hgsc.bcm.edu	37	20	6750880	6750880	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:6750880C>T	ENST00000378827.4	+	2	1326	c.107C>T	c.(106-108)gCg>gTg	p.A36V		NM_001200.2	NP_001191.1	P12643	BMP2_HUMAN	bone morphogenetic protein 2	36					activation of MAPK activity (GO:0000187)|atrioventricular valve morphogenesis (GO:0003181)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|bone mineralization (GO:0030282)|bone mineralization involved in bone maturation (GO:0035630)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiocyte differentiation (GO:0035051)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation (GO:0002062)|corticotropin hormone secreting cell differentiation (GO:0060128)|embryo development (GO:0009790)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchyme development (GO:0060485)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of calcium-independent cell-cell adhesion (GO:0051042)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|pericardium development (GO:0060039)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of odontogenesis (GO:0042482)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of Wnt signaling pathway by BMP signaling pathway (GO:0060804)|protein destabilization (GO:0031648)|protein phosphorylation (GO:0006468)|proteoglycan metabolic process (GO:0006029)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP receptor binding (GO:0070700)|phosphatase activator activity (GO:0019211)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)|retinol dehydrogenase activity (GO:0004745)|SMAD binding (GO:0046332)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	13						TTCGCGGCGGCGTCGTCGGGC	0.697																																					p.A36V		Atlas-SNP	.											.	BMP2	45	.	0			c.C107T						PASS	.						16.0	18.0	17.0					20																	6750880		2198	4294	6492	SO:0001583	missense	650	exon2			CGGCGGCGTCGTC		CCDS13099.1	20p12	2014-01-30			ENSG00000125845	ENSG00000125845		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1069	protein-coding gene	gene with protein product		112261		BMP2A		2376592	Standard	NM_001200		Approved		uc002wmu.1	P12643	OTTHUMG00000031833	ENST00000378827.4:c.107C>T	20.37:g.6750880C>T	ENSP00000368104:p.Ala36Val	Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	43	14	0.325581	NM_001200		Missense_Mutation	SNP	ENST00000378827.4	37	CCDS13099.1	.	.	.	.	.	.	.	.	.	.	C	12.18	1.860846	0.32884	.	.	ENSG00000125845	ENST00000378827	T	0.72394	-0.65	5.02	5.02	0.67125	.	0.340113	0.31199	N	0.008078	T	0.50017	0.1591	N	0.08118	0	0.22446	N	0.999094	B	0.28820	0.224	B	0.18263	0.021	T	0.40905	-0.9538	10	0.31617	T	0.26	.	16.1926	0.82004	0.0:1.0:0.0:0.0	.	36	P12643	BMP2_HUMAN	V	36	ENSP00000368104:A36V	ENSP00000368104:A36V	A	+	2	0	BMP2	6698880	0.348000	0.24861	0.012000	0.15200	0.042000	0.13812	5.100000	0.64560	2.466000	0.83321	0.460000	0.39030	GCG	.	.	none		0.697	BMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077918.3		
GJA1	2697	hgsc.bcm.edu	37	6	121768112	121768112	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:121768112C>T	ENST00000282561.3	+	2	276	c.119C>T	c.(118-120)gCg>gTg	p.A40V		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	40			A -> V (in ODDD). {ECO:0000269|PubMed:12457340, ECO:0000269|PubMed:14729836, ECO:0000269|PubMed:16378922, ECO:0000269|PubMed:19338053}.		adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	CTGGGGACAGCGGTTGAGTCA	0.493																																					p.A40V		Atlas-SNP	.											GJA1,caecum,carcinoma,0,1	GJA1	61	1	0			c.C119T	GRCh37	CM030456	GJA1	M		scavenged	.						111.0	100.0	104.0					6																	121768112		2203	4300	6503	SO:0001583	missense	2697	exon2			GGACAGCGGTTGA	BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.119C>T	6.37:g.121768112C>T	ENSP00000282561:p.Ala40Val	Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	241	3	0.0124481	NM_000165	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.223569	0.79576	.	.	ENSG00000152661	ENST00000282561	D	0.99176	-5.52	6.16	6.16	0.99307	Connexin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99042	0.9672	L	0.52759	1.655	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.99903	1.1170	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	40	P17302	CXA1_HUMAN	V	40	ENSP00000282561:A40V	ENSP00000282561:A40V	A	+	2	0	GJA1	121809811	1.000000	0.71417	0.958000	0.39756	0.114000	0.19823	7.776000	0.85560	2.937000	0.99478	0.650000	0.86243	GCG	.	.	weak		0.493	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
NEUROG3	50674	hgsc.bcm.edu	37	10	71332204	71332204	+	Missense_Mutation	SNP	A	A	G	rs4536103	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:71332204A>G	ENST00000242462.4	-	2	625	c.596T>C	c.(595-597)tTt>tCt	p.F199S		NM_020999.3	NP_066279.2	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	199			F -> S (in dbSNP:rs4536103). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1, ECO:0000269|Ref.2}.		central nervous system development (GO:0007417)|endocrine pancreas development (GO:0031018)|epithelial cell differentiation (GO:0030855)|forebrain development (GO:0030900)|hindbrain development (GO:0030902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|peripheral nervous system development (GO:0007422)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of dendrite morphogenesis (GO:0048814)|spinal cord development (GO:0021510)|transdifferentiation (GO:0060290)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription coactivator activity (GO:0003713)			endometrium(4)|large_intestine(2)|lung(6)|prostate(1)	13						GCAGGCGGAAAAGGTGGCCCC	0.657													G|||	2153	0.429912	0.2572	0.611	5008	,	,		14845	0.3125		0.666	False		,,,				2504	0.4131				p.F199S		Atlas-SNP	.											.	NEUROG3	33	.	0			c.T596C	GRCh37	CM068025	NEUROG3	M	rs4536103	PASS	.	G	SER/PHE	1453,2229		343,767,731	5.0	5.0	5.0		596	2.9	0.2	10	dbSNP_111	5	5305,2511		1897,1511,500	yes	missense	NEUROG3	NM_020999.3	155	2240,2278,1231	GG,GA,AA		32.1264,39.4622,41.2246	benign	199/215	71332204	6758,4740	1841	3908	5749	SO:0001583	missense	50674	exon2			GCGGAAAAGGTGG	AJ133776	CCDS31212.1	10q21.3	2013-05-21			ENSG00000122859	ENSG00000122859		"""Basic helix-loop-helix proteins"""	13806	protein-coding gene	gene with protein product		604882				9000438, 10677506	Standard	NM_020999		Approved	Atoh5, Math4B, ngn3, bHLHa7	uc001jpp.3	Q9Y4Z2	OTTHUMG00000018391	ENST00000242462.4:c.596T>C	10.37:g.71332204A>G	ENSP00000242462:p.Phe199Ser	Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	12	8	0.666667	NM_020999	Q5VVI0|Q6DJX6|Q9BY24	Missense_Mutation	SNP	ENST00000242462.4	37	CCDS31212.1	990	0.4532967032967033	121	0.2459349593495935	212	0.585635359116022	158	0.2762237762237762	499	0.658311345646438	G	3.112	-0.182485	0.06340	0.394622	0.678736	ENSG00000122859	ENST00000242462	D	0.92965	-3.14	4.83	2.94	0.34122	.	0.183574	0.26620	N	0.023369	T	0.00012	0.0000	N	0.01048	-1.04	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41787	-0.9489	9	0.06757	T	0.87	-13.4227	9.496	0.38989	0.2399:0.0:0.7601:0.0	rs4536103;rs4536103	199	Q9Y4Z2	NGN3_HUMAN	S	199	ENSP00000242462:F199S	ENSP00000242462:F199S	F	-	2	0	NEUROG3	71002210	0.013000	0.17824	0.179000	0.23059	0.003000	0.03518	1.496000	0.35638	0.643000	0.30638	-0.119000	0.15052	TTT	A|0.573;G|0.427	0.427	strong		0.657	NEUROG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048464.1	NM_020999	
HPS3	84343	hgsc.bcm.edu	37	3	148863210	148863210	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:148863210C>T	ENST00000296051.2	+	5	1180	c.1040C>T	c.(1039-1041)tCc>tTc	p.S347F	HPS3_ENST00000460120.1_Missense_Mutation_p.S182F	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	347					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TGCTTTTTCTCCTTACCTCAT	0.393									Hermansky-Pudlak syndrome																												p.S347F		Atlas-SNP	.											HPS3,NS,carcinoma,-1,1	HPS3	104	1	0			c.C1040T						scavenged	.						135.0	142.0	140.0					3																	148863210		2203	4300	6503	SO:0001583	missense	84343	exon5	Familial Cancer Database	HPS, HPS1-8	TTTTCTCCTTACC	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1040C>T	3.37:g.148863210C>T	ENSP00000296051:p.Ser347Phe	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	194	4	0.0206186	NM_032383	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	ENST00000296051.2	37	CCDS3140.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498024	0.85069	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.70749	-0.51;-0.51	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.84844	0.5562	M	0.74258	2.255	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85842	0.1398	10	0.87932	D	0	-16.1199	19.7151	0.96113	0.0:1.0:0.0:0.0	.	182;347	G5E9V4;Q969F9	.;HPS3_HUMAN	F	347;182	ENSP00000296051:S347F;ENSP00000418230:S182F	ENSP00000296051:S347F	S	+	2	0	HPS3	150345900	1.000000	0.71417	0.965000	0.40720	0.906000	0.53458	6.904000	0.75708	2.742000	0.94016	0.650000	0.86243	TCC	.	.	none		0.393	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356151.1	NM_032383	
TUBG2	27175	hgsc.bcm.edu	37	17	40818353	40818353	+	Silent	SNP	C	C	T	rs523338	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:40818353C>T	ENST00000251412.7	+	10	1208	c.1009C>T	c.(1009-1011)Ctg>Ttg	p.L337L	PLEKHH3_ENST00000456950.2_5'Flank	NM_016437.2	NP_057521.1	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	337					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|pericentriolar material (GO:0000242)|spindle microtubule (GO:0005876)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.L337L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		CCACAAGAGCCTGCAGAGGAT	0.672																																					p.L337L		Atlas-SNP	.											TUBG2,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	TUBG2	43	1	1	Substitution - coding silent(1)	central_nervous_system(1)	c.C1009T						scavenged	.						46.0	48.0	47.0					17																	40818353		2203	4300	6503	SO:0001819	synonymous_variant	27175	exon10			AAGAGCCTGCAGA	AF225971	CCDS32658.1	17q21.2	2014-09-04			ENSG00000037042	ENSG00000037042		"""Tubulins"""	12419	protein-coding gene	gene with protein product		605785					Standard	NM_016437		Approved		uc010wgr.2	Q9NRH3	OTTHUMG00000180640	ENST00000251412.7:c.1009C>T	17.37:g.40818353C>T		Somatic	348	21	0.0603448		WXS	Illumina HiSeq	Phase_I	371	28	0.0754717	NM_016437	A6NDI4|Q32NB2	Silent	SNP	ENST00000251412.7	37	CCDS32658.1																																																																																			C|0.801;T|0.199	0.199	strong		0.672	TUBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452326.1	NM_016437	
MUC2	4583	hgsc.bcm.edu	37	11	1093368	1093368	+	Silent	SNP	G	G	A	rs111440994		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:1093368G>A	ENST00000441003.2	+	30	5214	c.5187G>A	c.(5185-5187)acG>acA	p.T1729T	MUC2_ENST00000333592.6_Silent_p.T17T|MUC2_ENST00000359061.5_Silent_p.T1696T|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1696T(3)|p.T1729T(3)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccactacggtgaccccaa	0.647																																					p.T1729T		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,8	MUC2	614	8	6	Substitution - coding silent(6)	prostate(6)	c.G5187A						scavenged	.						175.0	224.0	207.0					11																	1093368		1971	3826	5797	SO:0001819	synonymous_variant	4583	exon30			CACTACGGTGACC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5187G>A	11.37:g.1093368G>A		Somatic	76	3	0.0394737		WXS	Illumina HiSeq	Phase_I	88	4	0.0454545	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.	.	weak		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
AMOTL1	154810	hgsc.bcm.edu	37	11	94583290	94583290	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:94583290T>G	ENST00000433060.2	+	7	1801	c.1660T>G	c.(1660-1662)Ttg>Gtg	p.L554V	AMOTL1_ENST00000317829.8_Missense_Mutation_p.L504V|AMOTL1_ENST00000317837.9_Intron	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	554					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				CAAAGAATTCTTGAAGGAAAA	0.468																																					p.L554V		Atlas-SNP	.											.	AMOTL1	95	.	0			c.T1660G						PASS	.						27.0	29.0	28.0					11																	94583290		1959	4155	6114	SO:0001583	missense	154810	exon7			GAATTCTTGAAGG	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.1660T>G	11.37:g.94583290T>G	ENSP00000387739:p.Leu554Val	Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	89	22	0.247191	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	T	7.496	0.651759	0.14516	.	.	ENSG00000166025	ENST00000317829;ENST00000542840;ENST00000433060	T;T	0.21543	2.0;2.0	5.82	-0.383	0.12477	.	0.000000	0.64402	D	0.000019	T	0.20536	0.0494	L	0.43152	1.355	0.80722	D	1	B;B	0.32302	0.363;0.024	B;B	0.42030	0.373;0.044	T	0.04737	-1.0930	10	0.23302	T	0.38	-15.6535	10.8757	0.46909	0.0:0.3874:0.0:0.6126	.	504;554	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	V	504;560;554	ENSP00000320968:L504V;ENSP00000387739:L554V	ENSP00000320968:L504V	L	+	1	2	AMOTL1	94222938	0.999000	0.42202	0.989000	0.46669	0.903000	0.53119	0.533000	0.23082	-0.318000	0.08665	-0.250000	0.11733	TTG	.	.	none		0.468	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
EBF3	253738	hgsc.bcm.edu	37	10	131761680	131761680	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:131761680G>A	ENST00000355311.5	-	2	314	c.242C>T	c.(241-243)cCg>cTg	p.P81L	EBF3_ENST00000368648.3_Missense_Mutation_p.P81L			Q9H4W6	COE3_HUMAN	early B-cell factor 3	81					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		AATCTCCACCGGCTGCCCCTG	0.557																																					p.P81L		Atlas-SNP	.											EBF3_ENST00000355311,NS,carcinoma,+1,2	EBF3	193	2	0			c.C242T						scavenged	.						70.0	78.0	75.0					10																	131761680		2203	4300	6503	SO:0001583	missense	253738	exon2			TCCACCGGCTGCC		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.242C>T	10.37:g.131761680G>A	ENSP00000347463:p.Pro81Leu	Somatic	127	1	0.00787402		WXS	Illumina HiSeq	Phase_I	142	65	0.457746	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37		.	.	.	.	.	.	.	.	.	.	G	19.06	3.754033	0.69648	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.52754	0.65;0.66	3.45	3.45	0.39498	.	0.000000	0.85682	U	0.000000	T	0.67078	0.2855	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.971	T	0.71111	-0.4687	10	0.51188	T	0.08	-6.4879	14.5175	0.67827	0.0:0.0:1.0:0.0	.	81;81	Q9H4W6;Q9H4W6-2	COE3_HUMAN;.	L	81	ENSP00000347463:P81L;ENSP00000357637:P81L	ENSP00000347463:P81L	P	-	2	0	EBF3	131651670	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.831000	0.92068	1.453000	0.47775	0.205000	0.17691	CCG	.	.	none		0.557	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
RECK	8434	hgsc.bcm.edu	37	9	36117028	36117028	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr9:36117028G>T	ENST00000377966.3	+	17	2673	c.2107G>T	c.(2107-2109)Gga>Tga	p.G703*		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	703	Kazal-like 2. {ECO:0000255|PROSITE- ProRule:PRU00798}.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			TGATAAATTTGGATGTAGCCA	0.502																																					p.G703X		Atlas-SNP	.											RECK,NS,carcinoma,-2,1	RECK	73	1	0			c.G2107T						scavenged	.						167.0	146.0	153.0					9																	36117028		2203	4300	6503	SO:0001587	stop_gained	8434	exon17			AAATTTGGATGTA	E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.2107G>T	9.37:g.36117028G>T	ENSP00000367202:p.Gly703*	Somatic	236	1	0.00423729		WXS	Illumina HiSeq	Phase_I	282	3	0.0106383	NM_021111	B2RNS1|Q5W0K6|Q8WX37	Nonsense_Mutation	SNP	ENST00000377966.3	37	CCDS6597.1	.	.	.	.	.	.	.	.	.	.	G	44	10.847311	0.99477	.	.	ENSG00000122707	ENST00000377966	.	.	.	5.91	5.91	0.95273	.	0.205237	0.42420	D	0.000707	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-14.4645	17.7923	0.88558	0.0:0.0:1.0:0.0	.	.	.	.	X	703	.	ENSP00000367202:G703X	G	+	1	0	RECK	36107028	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.240000	0.65378	2.793000	0.96121	0.655000	0.94253	GGA	.	.	none		0.502	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052409.1		
VPS41	27072	hgsc.bcm.edu	37	7	38783071	38783071	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:38783071C>T	ENST00000310301.4	-	24	2107	c.2053G>A	c.(2053-2055)Gaa>Aaa	p.E685K	VPS41_ENST00000395969.2_Missense_Mutation_p.E660K	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	685					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						TTGGCAAATTCGATTGCTTTA	0.418																																					p.E685K		Atlas-SNP	.											VPS41,NS,carcinoma,0,1	VPS41	102	1	0			c.G2053A						scavenged	.						155.0	142.0	146.0					7																	38783071		2203	4300	6503	SO:0001583	missense	27072	exon24			CAAATTCGATTGC	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.2053G>A	7.37:g.38783071C>T	ENSP00000309457:p.Glu685Lys	Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	184	3	0.0163043	NM_014396	E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	ENST00000310301.4	37	CCDS5457.1	.	.	.	.	.	.	.	.	.	.	C	36	5.607939	0.96626	.	.	ENSG00000006715	ENST00000310301;ENST00000395969;ENST00000439468	T;T;T	0.24151	1.87;1.87;1.87	5.74	5.74	0.90152	Tetratricopeptide-like helical (1);	0.187255	0.56097	D	0.000035	T	0.34629	0.0904	M	0.76328	2.33	0.80722	D	1	P;P;P	0.36944	0.574;0.574;0.574	B;B;B	0.35073	0.195;0.195;0.195	T	0.09729	-1.0661	10	0.37606	T	0.19	-18.6971	20.3116	0.98642	0.0:1.0:0.0:0.0	.	685;660;685	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	K	685;660;26	ENSP00000309457:E685K;ENSP00000379297:E660K;ENSP00000395410:E26K	ENSP00000309457:E685K	E	-	1	0	VPS41	38749596	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.082000	0.71318	2.890000	0.99128	0.650000	0.86243	GAA	.	.	none		0.418	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3		
WT1	7490	hgsc.bcm.edu	37	11	32456397	32456397	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:32456397G>A	ENST00000332351.3	-	1	779	c.495C>T	c.(493-495)tcC>tcT	p.S165S	WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000494911.1_RNA|WT1_ENST00000448076.3_Silent_p.S165S|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000395900.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	97					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TGAACTGGCCGGAAAAGTGGA	0.682			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.S165S		Atlas-SNP	.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1	744	.	0			c.C495T						PASS	.						17.0	19.0	18.0					11																	32456397		2198	4292	6490	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	CTGGCCGGAAAAG		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.495C>T	11.37:g.32456397G>A		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	109	41	0.376147	NM_024424	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			.	.	none		0.682	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
TTLL12	23170	hgsc.bcm.edu	37	22	43576904	43576904	+	Silent	SNP	G	G	A	rs2071723	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr22:43576904G>A	ENST00000216129.6	-	3	453	c.390C>T	c.(388-390)caC>caT	p.H130H		NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	130					cellular protein modification process (GO:0006464)					central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				GCTGGCGCGCGTGCTCCACAC	0.662													G|||	1641	0.327676	0.2383	0.3905	5008	,	,		17213	0.3165		0.4105	False		,,,				2504	0.3303				p.H130H		Atlas-SNP	.											TTLL12,NS,carcinoma,0,1	TTLL12	50	1	0			c.C390T						scavenged	.	G		1081,3325	377.5+/-322.5	126,829,1248	47.0	42.0	44.0		390	-10.7	0.4	22	dbSNP_96	44	3465,5131	494.2+/-373.8	718,2029,1551	no	coding-synonymous	TTLL12	NM_015140.3		844,2858,2799	AA,AG,GG		40.3094,24.5347,34.9639		130/645	43576904	4546,8456	2203	4298	6501	SO:0001819	synonymous_variant	23170	exon3			GCGCGCGTGCTCC	D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.390C>T	22.37:g.43576904G>A		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	67	2	0.0298507	NM_015140	Q20WK5|Q9UGU3	Silent	SNP	ENST00000216129.6	37	CCDS14047.1																																																																																			A|0.339;C|0.000;G|0.661	0.339	strong		0.662	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319611.1	NM_015140	
ARAP3	64411	hgsc.bcm.edu	37	5	141033945	141033945	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:141033945A>G	ENST00000239440.4	-	33	4272	c.4207T>C	c.(4207-4209)Tac>Cac	p.Y1403H	FCHSD1_ENST00000519800.1_5'Flank|ARAP3_ENST00000512390.1_5'UTR|FCHSD1_ENST00000435817.2_5'Flank|ARAP3_ENST00000508305.1_Missense_Mutation_p.Y1234H|ARAP3_ENST00000513878.1_Missense_Mutation_p.Y1052H	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1403					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GGCTCCTCGTACACAGGCTCC	0.552																																					p.Y1403H		Atlas-SNP	.											.	ARAP3	139	.	0			c.T4207C						PASS	.						96.0	97.0	97.0					5																	141033945		2203	4300	6503	SO:0001583	missense	64411	exon33			CCTCGTACACAGG	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.4207T>C	5.37:g.141033945A>G	ENSP00000239440:p.Tyr1403His	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	78	36	0.461538	NM_022481	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	A	13.65	2.300151	0.40694	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.14516	2.5;3.2;3.05	3.92	3.92	0.45320	.	0.405610	0.23234	N	0.050433	T	0.18882	0.0453	N	0.24115	0.695	0.34030	D	0.65374	D;D;D	0.69078	0.995;0.997;0.995	D;D;D	0.75484	0.969;0.986;0.969	T	0.13629	-1.0502	10	0.20046	T	0.44	.	9.4487	0.38712	1.0:0.0:0.0:0.0	.	1052;1234;1403	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	H	1234;1403;1052	ENSP00000421826:Y1234H;ENSP00000239440:Y1403H;ENSP00000421468:Y1052H	ENSP00000239440:Y1403H	Y	-	1	0	ARAP3	141014129	0.997000	0.39634	0.998000	0.56505	0.502000	0.33828	2.505000	0.45424	1.983000	0.57843	0.482000	0.46254	TAC	.	.	none		0.552	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
NCAM2	4685	hgsc.bcm.edu	37	21	22656612	22656612	+	Missense_Mutation	SNP	C	C	T	rs576610818		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr21:22656612C>T	ENST00000400546.1	+	3	478	c.229C>T	c.(229-231)Cgg>Tgg	p.R77W	NCAM2_ENST00000535285.1_Missense_Mutation_p.R102W|NCAM2_ENST00000486367.1_3'UTR|NCAM2_ENST00000284894.7_Intron	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	77	Ig-like C2-type 1.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R77G(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TGTTAGGTCACGGTTAACCAT	0.398													C|||	1	0.000199681	0.0	0.0	5008	,	,		13851	0.0		0.0	False		,,,				2504	0.001				p.R77W		Atlas-SNP	.											NCAM2,colon,carcinoma,0,2	NCAM2	220	2	1	Substitution - Missense(1)	lung(1)	c.C229T						PASS	.						124.0	117.0	119.0					21																	22656612		1886	4109	5995	SO:0001583	missense	4685	exon3			AGGTCACGGTTAA		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.229C>T	21.37:g.22656612C>T	ENSP00000383392:p.Arg77Trp	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	130	31	0.238462	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868687	0.51588	.	.	ENSG00000154654	ENST00000400546;ENST00000535285	T;T	0.68479	-0.33;-0.33	5.58	2.61	0.31194	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.167812	0.49916	D	0.000140	T	0.46814	0.1412	N	0.26162	0.8	0.49130	D	0.999757	P;P	0.49253	0.921;0.921	B;B	0.38458	0.274;0.274	T	0.32903	-0.9889	10	0.44086	T	0.13	-14.5846	7.7334	0.28799	0.4708:0.4548:0.0:0.0744	.	102;77	B7Z841;O15394	.;NCAM2_HUMAN	W	77;102	ENSP00000383392:R77W;ENSP00000441887:R102W	ENSP00000383392:R77W	R	+	1	2	NCAM2	21578483	0.379000	0.25123	0.999000	0.59377	0.990000	0.78478	0.230000	0.17852	0.230000	0.21059	0.591000	0.81541	CGG	.	.	none		0.398	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
MUC4	4585	hgsc.bcm.edu	37	3	195509563	195509563	+	Missense_Mutation	SNP	A	A	T	rs28605870		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195509563A>T	ENST00000463781.3	-	2	9347	c.8888T>A	c.(8887-8889)gTc>gAc	p.V2963D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V2963D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V2963D(5)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGTGTCGGTGACAGGAAGAGA	0.587																																					p.V2963D		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,5	MUC4	1505	5	5	Substitution - Missense(5)	kidney(2)|skin(2)|endometrium(1)	c.T8888A						scavenged	.						8.0	7.0	7.0					3																	195509563		603	1454	2057	SO:0001583	missense	4585	exon2			TCGGTGACAGGAA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8888T>A	3.37:g.195509563A>T	ENSP00000417498:p.Val2963Asp	Somatic	222	4	0.018018		WXS	Illumina HiSeq	Phase_I	269	8	0.0297398	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	5.292	0.239303	0.10023	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32023	1.47;1.53	.	.	.	.	.	.	.	.	T	0.28366	0.0701	N	0.19112	0.55	0.09310	N	1	D	0.65815	0.995	D	0.68483	0.958	T	0.11372	-1.0590	7	.	.	.	.	1.4974	0.02469	0.4322:0.0:0.2571:0.3107	rs60024035	2835	E7ESK3	.	D	2963	ENSP00000417498:V2963D;ENSP00000420243:V2963D	.	V	-	2	0	MUC4	196994342	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-1.570000	0.02140	-0.942000	0.03695	0.000000	0.15137	GTC	.	.	weak		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
KIRREL3	84623	hgsc.bcm.edu	37	11	126318983	126318983	+	Silent	SNP	C	C	T	rs548678938		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:126318983C>T	ENST00000525144.2	-	8	1167	c.918G>A	c.(916-918)acG>acA	p.T306T	KIRREL3_ENST00000529097.2_Silent_p.T306T|KIRREL3_ENST00000525704.2_Silent_p.T306T	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	306	Ig-like C2-type 3.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T306T(2)|p.T265T(1)		central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CTGAGAAGTACGTGTAGTCCA	0.612													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19343	0.0		0.0	False		,,,				2504	0.0				p.T306T		Atlas-SNP	.											KIRREL3_ENST00000525704,NS,carcinoma,0,3	KIRREL3	183	3	3	Substitution - coding silent(3)	endometrium(3)	c.G918A						scavenged	.						136.0	146.0	143.0					11																	126318983		2105	4224	6329	SO:0001819	synonymous_variant	84623	exon8			GAAGTACGTGTAG	AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.918G>A	11.37:g.126318983C>T		Somatic	193	0	0		WXS	Illumina HiSeq	Phase_I	296	3	0.0101351	NM_032531	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Silent	SNP	ENST00000525144.2	37	CCDS53723.1																																																																																			.	.	none		0.612	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531	
IRF4	3662	hgsc.bcm.edu	37	6	393224	393224	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:393224C>T	ENST00000380956.4	+	2	198	c.72C>T	c.(70-72)ctC>ctT	p.L24L	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	24					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		ACGGGAAGCTCCGCCAGTGGC	0.701			T	IGH@	MM																																p.L24L		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.C72T						PASS	.						31.0	32.0	32.0					6																	393224		2192	4288	6480	SO:0001819	synonymous_variant	3662	exon2			GAAGCTCCGCCAG	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.72C>T	6.37:g.393224C>T		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	124	46	0.370968	NM_001195286	Q5VUI7|Q99660	Silent	SNP	ENST00000380956.4	37	CCDS4469.1																																																																																			.	.	none		0.701	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
SENP6	26054	hgsc.bcm.edu	37	6	76357488	76357488	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:76357488C>T	ENST00000447266.2	+	7	999	c.521C>T	c.(520-522)cCt>cTt	p.P174L	SENP6_ENST00000370010.2_Missense_Mutation_p.P167L|SENP6_ENST00000436928.3_3'UTR|SENP6_ENST00000327284.8_Missense_Mutation_p.P167L|SENP6_ENST00000370014.3_Missense_Mutation_p.P174L	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	174					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				GAAATTAATCCTGTAAGGTTA	0.333																																					p.P174L		Atlas-SNP	.											SENP6_ENST00000447266,NS,carcinoma,0,2	SENP6	189	2	0			c.C521T						scavenged	.						91.0	83.0	86.0					6																	76357488		1821	4076	5897	SO:0001583	missense	26054	exon7			TTAATCCTGTAAG		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.521C>T	6.37:g.76357488C>T	ENSP00000402527:p.Pro174Leu	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	158	5	0.0316456	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	ENST00000447266.2	37	CCDS47454.1	.	.	.	.	.	.	.	.	.	.	C	5.985	0.365740	0.11352	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000538088;ENST00000327284;ENST00000447266;ENST00000483859;ENST00000424947	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.45	2.55	0.30701	.	0.691947	0.14256	N	0.331129	T	0.09818	0.0241	L	0.29908	0.895	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.08055	0.003;0.001;0.003	T	0.12400	-1.0549	10	0.29301	T	0.29	-0.1767	1.4367	0.02345	0.2313:0.4507:0.1409:0.1771	.	167;174;167	Q9GZR1-2;Q9GZR1;F8W6D9	.;SENP6_HUMAN;.	L	167;174;171;167;174;64;64	ENSP00000359027:P167L;ENSP00000359031:P174L;ENSP00000321820:P167L;ENSP00000402527:P174L;ENSP00000426480:P64L;ENSP00000391426:P64L	ENSP00000321820:P167L	P	+	2	0	SENP6	76414208	0.142000	0.22610	0.960000	0.40013	0.981000	0.71138	0.368000	0.20399	1.442000	0.47568	0.650000	0.86243	CCT	.	.	none		0.333	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
PRKRA	8575	hgsc.bcm.edu	37	2	179306336	179306336	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:179306336C>T	ENST00000325748.4	-	6	810		c.e6+1		AC009948.5_ENST00000453026.2_RNA|PRKRA_ENST00000432031.2_Splice_Site|PRKRA_ENST00000438687.3_Splice_Site|PRKRA_ENST00000487082.1_Splice_Site	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator						cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			ACATTACTCACTAAAGAAATG	0.353																																					.	Melanoma(200;68 3001 23825 48764)	Atlas-SNP	.											PRKRA,NS,carcinoma,0,1	PRKRA	56	1	1	Unknown(1)	lung(1)	c.534+1G>A						scavenged	.						70.0	74.0	73.0					2																	179306336		2203	4300	6503	SO:0001630	splice_region_variant	8575	exon7			TACTCACTAAAGA	AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.609+1G>A	2.37:g.179306336C>T		Somatic	280	3	0.0107143		WXS	Illumina HiSeq	Phase_I	268	5	0.0186567	NM_001139518	A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Splice_Site	SNP	ENST00000325748.4	37	CCDS2279.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.689950	0.68271	.	.	ENSG00000180228	ENST00000325748;ENST00000438687;ENST00000487082;ENST00000432031	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5111	0.44862	0.0:0.9114:0.0:0.0886	.	.	.	.	.	-1	.	.	.	-	.	.	PRKRA	179014582	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.492000	0.60334	2.618000	0.88619	0.591000	0.81541	.	.	.	none		0.353	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255782.2	NM_003690	Intron
ADAMTS7	11173	hgsc.bcm.edu	37	15	79066981	79066981	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr15:79066981G>C	ENST00000388820.4	-	12	2071	c.1861C>G	c.(1861-1863)Ccc>Gcc	p.P621A	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	621	Cys-rich.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TTGACCACGGGCACCCATGTG	0.632																																					p.P621A		Atlas-SNP	.											.	ADAMTS7	142	.	0			c.C1861G						PASS	.						56.0	54.0	55.0					15																	79066981		2196	4293	6489	SO:0001583	missense	11173	exon12			CCACGGGCACCCA	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1861C>G	15.37:g.79066981G>C	ENSP00000373472:p.Pro621Ala	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	51	25	0.490196	NM_014272	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.505696	0.26949	.	.	ENSG00000136378	ENST00000388820	T	0.00428	7.44	3.61	3.61	0.41365	.	0.145698	0.47852	D	0.000209	T	0.00468	0.0015	M	0.64676	1.99	0.35073	D	0.762647	B;B	0.32071	0.355;0.189	B;B	0.32211	0.142;0.077	T	0.64415	-0.6413	10	0.59425	D	0.04	.	14.4931	0.67665	0.0:0.0:1.0:0.0	.	621;621	A8MQ00;Q9UKP4	.;ATS7_HUMAN	A	621	ENSP00000373472:P621A	ENSP00000373472:P621A	P	-	1	0	ADAMTS7	76854036	1.000000	0.71417	0.960000	0.40013	0.885000	0.51271	4.864000	0.62990	2.044000	0.60594	0.289000	0.19496	CCC	.	.	none		0.632	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12907708	12907708	+	Silent	SNP	A	A	G	rs4026149	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:12907708A>G	ENST00000317869.6	-	2	660	c.435T>C	c.(433-435)cgT>cgC	p.R145R		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	145						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						ATAGACGTTGACGTTTCGAGG	0.483																																					p.R145R		Atlas-SNP	.											HNRNPCL1,NS,carcinoma,-1,1	HNRNPCL1	68	1	0			c.T435C						scavenged	.						120.0	124.0	122.0					1																	12907708		2201	4297	6498	SO:0001819	synonymous_variant	343069	exon2			ACGTTGACGTTTC	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.435T>C	1.37:g.12907708A>G		Somatic	299	10	0.0334448		WXS	Illumina HiSeq	Phase_I	341	23	0.0674487	NM_001013631	B2RP44	Silent	SNP	ENST00000317869.6	37	CCDS30591.1																																																																																			A|0.667;G|0.333	0.333	strong		0.483	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
CSGALNACT2	55454	hgsc.bcm.edu	37	10	43659372	43659372	+	Nonsense_Mutation	SNP	C	C	T	rs76607193	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:43659372C>T	ENST00000374466.3	+	5	1374	c.1039C>T	c.(1039-1041)Cga>Tga	p.R347*		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	347					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.R347*(1)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TAATCGTGGACGAGGACTAAA	0.408																																					p.R347X		Atlas-SNP	.											CSGALNACT2,trunk,malignant_melanoma,0,1	CSGALNACT2	67	1	1	Substitution - Nonsense(1)	skin(1)	c.C1039T						scavenged	.						191.0	181.0	184.0					10																	43659372		2203	4300	6503	SO:0001587	stop_gained	55454	exon5			CGTGGACGAGGAC	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1039C>T	10.37:g.43659372C>T	ENSP00000363590:p.Arg347*	Somatic	237	2	0.00843882		WXS	Illumina HiSeq	Phase_I	187	3	0.0160428	NM_018590	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Nonsense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	C	41	8.712957	0.98925	.	.	ENSG00000169826	ENST00000374466	.	.	.	6.08	4.19	0.49359	.	0.110120	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-3.2438	15.5126	0.75795	0.253:0.747:0.0:0.0	.	.	.	.	X	347	.	ENSP00000363590:R347X	R	+	1	2	CSGALNACT2	42979378	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	1.226000	0.32563	0.852000	0.35287	0.591000	0.81541	CGA	C|0.997;T|0.003	0.003	strong		0.408	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
RP1	6101	hgsc.bcm.edu	37	8	55534023	55534023	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:55534023C>T	ENST00000220676.1	+	2	645	c.497C>T	c.(496-498)aCg>aTg	p.T166M		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	166	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.T166M(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GACCCGAAGACGAGGCGTGCG	0.642																																					p.T166M	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											RP1,NS,carcinoma,0,1	RP1	429	1	1	Substitution - Missense(1)	lung(1)	c.C497T						PASS	.						83.0	85.0	84.0					8																	55534023		2203	4300	6503	SO:0001583	missense	6101	exon2			CGAAGACGAGGCG	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.497C>T	8.37:g.55534023C>T	ENSP00000220676:p.Thr166Met	Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	212	91	0.429245	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.709586	0.30322	.	.	ENSG00000104237	ENST00000220676	D	0.86562	-2.14	5.14	1.26	0.21427	Doublecortin domain (4);	0.635417	0.14570	N	0.311486	T	0.72930	0.3522	L	0.38175	1.15	0.09310	N	1	P	0.47604	0.898	B	0.30029	0.11	T	0.65496	-0.6154	10	0.62326	D	0.03	6.4508	4.3984	0.11374	0.1478:0.4103:0.0:0.4419	.	166	P56715	RP1_HUMAN	M	166	ENSP00000220676:T166M	ENSP00000220676:T166M	T	+	2	0	RP1	55696576	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.109000	0.15417	-0.050000	0.13356	0.650000	0.86243	ACG	.	.	none		0.642	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
PPP2R3C	55012	hgsc.bcm.edu	37	14	35554804	35554804	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:35554804C>T	ENST00000261475.5	-	13	1707	c.1354G>A	c.(1354-1356)Gat>Aat	p.D452N		NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	452					activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.D452N(1)		central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		GATCATGTATCATCAAGGTCT	0.378																																					p.D452N		Atlas-SNP	.											PPP2R3C,NS,carcinoma,0,1	PPP2R3C	44	1	1	Substitution - Missense(1)	lung(1)	c.G1354A						scavenged	.						126.0	116.0	120.0					14																	35554804		2202	4300	6502	SO:0001583	missense	55012	exon13			ATGTATCATCAAG	AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.1354G>A	14.37:g.35554804C>T	ENSP00000261475:p.Asp452Asn	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	106	3	0.0283019	NM_017917	B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Missense_Mutation	SNP	ENST00000261475.5	37	CCDS9654.1	.	.	.	.	.	.	.	.	.	.	c	22.1	4.240252	0.79912	.	.	ENSG00000092020	ENST00000261475;ENST00000555219	.	.	.	5.72	5.72	0.89469	.	0.093985	0.64402	D	0.000001	T	0.51907	0.1702	L	0.40543	1.245	0.80722	D	1	P	0.44139	0.827	B	0.38020	0.263	T	0.56475	-0.7973	9	0.54805	T	0.06	-12.7813	19.8858	0.96911	0.0:1.0:0.0:0.0	.	452	Q969Q6	P2R3C_HUMAN	N	452;127	.	ENSP00000261475:D452N	D	-	1	0	PPP2R3C	34624555	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.295000	0.78780	2.714000	0.92807	0.579000	0.79373	GAT	.	.	none		0.378	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276687.1	NM_017917	
FAM186A	121006	hgsc.bcm.edu	37	12	50746094	50746094	+	Silent	SNP	G	G	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:50746094G>C	ENST00000327337.5	-	4	4520	c.4521C>G	c.(4519-4521)ctC>ctG	p.L1507L	FAM186A_ENST00000543111.1_Silent_p.L1507L|FAM186A_ENST00000543096.1_5'Flank	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1507								p.L1507L(9)									GCGGAGGGATGAGAAGGATCC	0.662																																					p.L1507L	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											FAM186A_ENST00000327337,NS,carcinoma,0,8	FAM186A	181	8	9	Substitution - coding silent(9)	endometrium(8)|lung(1)	c.C4521G						scavenged	.																																			SO:0001819	synonymous_variant	121006	exon4			AGGGATGAGAAGG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4521C>G	12.37:g.50746094G>C		Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	394	11	0.0279188	NM_001145475		Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																			.	.	none		0.662	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
OR4X1	390113	hgsc.bcm.edu	37	11	48286318	48286318	+	Silent	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:48286318A>G	ENST00000320048.1	+	1	906	c.906A>G	c.(904-906)ggA>ggG	p.G302G		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						TTATTGGGGGAAAAGTAATTT	0.398																																					p.G302G		Atlas-SNP	.											OR4X1,extremity,malignant_melanoma,+1,1	OR4X1	75	1	0			c.A906G						scavenged	.						33.0	33.0	33.0					11																	48286318		2201	4297	6498	SO:0001819	synonymous_variant	390113	exon1			TGGGGGAAAAGTA	AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.906A>G	11.37:g.48286318A>G		Somatic	84	1	0.0119048		WXS	Illumina HiSeq	Phase_I	154	2	0.012987	NM_001004726	Q6IF74	Silent	SNP	ENST00000320048.1	37	CCDS31487.1																																																																																			.	.	none		0.398	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383373.1	NM_001004726	
SMCR8	140775	hgsc.bcm.edu	37	17	18220270	18220270	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:18220270A>G	ENST00000406438.3	+	1	1647	c.1167A>G	c.(1165-1167)atA>atG	p.I389M	TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	389						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						AAGAAAGCATACCCTCTAAGC	0.423																																					p.I389M		Atlas-SNP	.											.	SMCR8	62	.	0			c.A1167G						PASS	.						117.0	113.0	114.0					17																	18220270		2203	4300	6503	SO:0001583	missense	140775	exon1			AAGCATACCCTCT	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.1167A>G	17.37:g.18220270A>G	ENSP00000385025:p.Ile389Met	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	137	6	0.0437956	NM_144775	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	ENST00000406438.3	37	CCDS11195.2	.	.	.	.	.	.	.	.	.	.	A	1.223	-0.626275	0.03610	.	.	ENSG00000176994	ENST00000406438	T	0.22134	1.97	5.9	-10.4	0.00318	.	1.175130	0.06061	N	0.658377	T	0.05640	0.0148	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.36456	-0.9747	10	0.30854	T	0.27	-20.6322	6.4044	0.21656	0.1744:0.1901:0.4992:0.1362	.	389	Q8TEV9	SMCR8_HUMAN	M	389	ENSP00000385025:I389M	ENSP00000385025:I389M	I	+	3	3	SMCR8	18160995	0.000000	0.05858	0.000000	0.03702	0.276000	0.26787	-0.920000	0.04013	-1.650000	0.01506	-0.263000	0.10527	ATA	.	.	none		0.423	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2	NM_144775	
FANCC	2176	hgsc.bcm.edu	37	9	97887407	97887407	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr9:97887407C>T	ENST00000289081.3	-	10	1211	c.957G>A	c.(955-957)acG>acA	p.T319T	FANCC_ENST00000375305.1_Silent_p.T319T|FANCC_ENST00000464653.1_5'UTR	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	319					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				CAAAGCACTGCGTAAACACCT	0.428			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.T319T		Atlas-SNP	.	yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	FANCC_ENST00000289081,pharynx,carcinoma,-1,2	FANCC	53	2	0			c.G957A						scavenged	.						110.0	100.0	104.0					9																	97887407		2203	4300	6503	SO:0001819	synonymous_variant	2176	exon10	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GCACTGCGTAAAC	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.957G>A	9.37:g.97887407C>T		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	173	4	0.0231214	NM_001243743	B1ALR8	Silent	SNP	ENST00000289081.3	37	CCDS35071.1																																																																																			.	.	none		0.428	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053219.1	NM_000136	
NEK5	341676	hgsc.bcm.edu	37	13	52684696	52684696	+	Silent	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr13:52684696T>C	ENST00000355568.4	-	6	469	c.330A>G	c.(328-330)gtA>gtG	p.V110V		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		GAGAAATCTGTACAAACCAAC	0.388																																					p.V110V		Atlas-SNP	.											NEK5,mouth,carcinoma,-2,1	NEK5	189	1	0			c.A330G						scavenged	.						123.0	103.0	110.0					13																	52684696		2203	4300	6503	SO:0001819	synonymous_variant	341676	exon6			AATCTGTACAAAC	BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.330A>G	13.37:g.52684696T>C		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	175	3	0.0171429	NM_199289	Q5TAP5	Silent	SNP	ENST00000355568.4	37	CCDS31979.1																																																																																			.	.	none		0.388	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045045.3	NM_199289	
DSPP	1834	hgsc.bcm.edu	37	4	88537078	88537078	+	Silent	SNP	T	T	C	rs367717407|rs373805744	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:88537078T>C	ENST00000282478.7	+	4	3297	c.3264T>C	c.(3262-3264)agT>agC	p.S1088S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1088S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1088	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgatagcagtgacagcagca	0.547													t|||	1148	0.229233	0.27	0.2536	5008	,	,		14971	0.2103		0.2237	False		,,,				2504	0.182				p.S1088S		Atlas-SNP	.											DSPP,colon,carcinoma,0,1	DSPP	174	1	0			c.T3264C						scavenged	.						21.0	26.0	24.0					4																	88537078		1113	2064	3177	SO:0001819	synonymous_variant	1834	exon5			TAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3264T>C	4.37:g.88537078T>C		Somatic	112	5	0.0446429		WXS	Illumina HiSeq	Phase_I	49	15	0.306122	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	weak		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
SIPA1L1	26037	hgsc.bcm.edu	37	14	72054698	72054698	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:72054698C>T	ENST00000555818.1	+	2	457	c.109C>T	c.(109-111)Cgg>Tgg	p.R37W	SIPA1L1_ENST00000358550.2_Missense_Mutation_p.R37W|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.R37W	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	37					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)	p.R37W(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		TTTCTACATGCGGCGCTTCCG	0.547																																					p.R37W		Atlas-SNP	.											SIPA1L1,NS,carcinoma,0,2	SIPA1L1	219	2	1	Substitution - Missense(1)	prostate(1)	c.C109T						scavenged	.						87.0	90.0	89.0					14																	72054698		2203	4300	6503	SO:0001583	missense	26037	exon2			TACATGCGGCGCT	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.109C>T	14.37:g.72054698C>T	ENSP00000450832:p.Arg37Trp	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	158	3	0.0189873	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	37	CCDS9807.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365974	0.61513	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	T;T;T	0.79141	-1.24;-1.23;-1.24	5.48	3.49	0.39957	.	0.000000	0.85682	D	0.000000	D	0.83746	0.5321	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	1.0;0.978;1.0	D;P;D	0.77557	0.99;0.566;0.99	D	0.84354	0.0534	10	0.54805	T	0.06	-17.4715	12.4248	0.55540	0.5159:0.4841:0.0:0.0	.	37;37;37	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	W	37	ENSP00000370630:R37W;ENSP00000450832:R37W;ENSP00000351352:R37W	ENSP00000351352:R37W	R	+	1	2	SIPA1L1	71124451	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	2.803000	0.47924	1.387000	0.46486	0.655000	0.94253	CGG	.	.	none		0.547	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
DSPP	1834	hgsc.bcm.edu	37	4	88536472	88536472	+	Silent	SNP	C	C	T	rs561406193		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:88536472C>T	ENST00000282478.7	+	4	2691	c.2658C>T	c.(2656-2658)aaC>aaT	p.N886N	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.N886N			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	886	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcaacgaaagcagca	0.493																																					p.N886N		Atlas-SNP	.											.	DSPP	174	.	0			c.C2658T						PASS	.						72.0	87.0	82.0					4																	88536472		1623	2913	4536	SO:0001819	synonymous_variant	1834	exon5			CAGCAACGAAAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2658C>T	4.37:g.88536472C>T		Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	93	10	0.107527	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	none		0.493	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FAM43A	131583	hgsc.bcm.edu	37	3	194408350	194408350	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:194408350G>A	ENST00000329759.4	+	1	1729	c.795G>A	c.(793-795)gaG>gaA	p.E265E		NM_153690.4	NP_710157.2	Q8N2R8	FA43A_HUMAN	family with sequence similarity 43, member A	265										breast(2)|central_nervous_system(1)|lung(6)|skin(1)	10	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		TGGAGCAGGAGCTGCAGGAGG	0.677																																					p.E265E		Atlas-SNP	.											.	FAM43A	24	.	0			c.G795A						PASS	.						15.0	18.0	17.0					3																	194408350		2194	4293	6487	SO:0001819	synonymous_variant	131583	exon1			GCAGGAGCTGCAG	AK074503	CCDS33923.1	3q29	2004-07-28			ENSG00000185112	ENSG00000185112			26888	protein-coding gene	gene with protein product						12477932	Standard	NM_153690		Approved	FLJ90022	uc003fuj.3	Q8N2R8	OTTHUMG00000156016	ENST00000329759.4:c.795G>A	3.37:g.194408350G>A		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	183	88	0.480874	NM_153690	A3KME2|Q8IXP4|Q8WZ07	Silent	SNP	ENST00000329759.4	37	CCDS33923.1																																																																																			.	.	none		0.677	FAM43A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342734.1	NM_153690	
COL11A1	1301	hgsc.bcm.edu	37	1	103484376	103484376	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:103484376C>T	ENST00000370096.3	-	10	1660	c.1348G>A	c.(1348-1350)Gca>Aca	p.A450T	COL11A1_ENST00000353414.4_Missense_Mutation_p.A411T|COL11A1_ENST00000512756.1_Missense_Mutation_p.A334T|COL11A1_ENST00000358392.2_Missense_Mutation_p.A462T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	450	Collagen-like 1.|Triple-helical region (interrupted).				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTACATACTGCAGGTCCTGCT	0.328																																					p.A462T		Atlas-SNP	.											.	COL11A1	972	.	0			c.G1384A						PASS	.						54.0	55.0	55.0					1																	103484376		2203	4300	6503	SO:0001583	missense	1301	exon10			ATACTGCAGGTCC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1348G>A	1.37:g.103484376C>T	ENSP00000359114:p.Ala450Thr	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	130	53	0.407692	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845119	0.51164	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	D;D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25;-3.25	5.68	4.72	0.59763	.	0.172573	0.50627	D	0.000108	T	0.81192	0.4771	N	0.17082	0.46	0.45867	D	0.998729	B;B;B;B	0.23650	0.089;0.073;0.073;0.089	B;B;B;B	0.29077	0.098;0.059;0.059;0.098	T	0.76798	-0.2826	10	0.25106	T	0.35	.	11.916	0.52765	0.1356:0.7333:0.131:0.0	.	334;411;462;450	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	T	450;462;411;334;462	ENSP00000359114:A450T;ENSP00000351163:A462T;ENSP00000302551:A411T;ENSP00000426533:A334T;ENSP00000408640:A462T	ENSP00000302551:A411T	A	-	1	0	COL11A1	103256964	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.673000	0.37534	2.676000	0.91093	0.637000	0.83480	GCA	.	.	none		0.328	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
JSRP1	126306	hgsc.bcm.edu	37	19	2254194	2254194	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:2254194G>T	ENST00000300961.6	-	4	318	c.254C>A	c.(253-255)gCc>gAc	p.A85D	JSRP1_ENST00000586471.2_Missense_Mutation_p.A85D	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	85					protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCGCTCCGGCTTTCAGCCT	0.642											OREG0025137	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A85D		Atlas-SNP	.											.	JSRP1	18	.	0			c.C254A						PASS	.						133.0	131.0	132.0					19																	2254194		2203	4300	6503	SO:0001583	missense	126306	exon4			GCTCCGGCTTTCA	AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.254C>A	19.37:g.2254194G>T	ENSP00000300961:p.Ala85Asp	Somatic	60	0	0	602	WXS	Illumina HiSeq	Phase_I	62	24	0.387097	NM_144616		Missense_Mutation	SNP	ENST00000300961.6	37	CCDS12086.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150195	0.37923	.	.	ENSG00000167476	ENST00000300961	T	0.22336	1.96	3.24	-0.348	0.12613	.	0.669075	0.12336	N	0.477943	T	0.14657	0.0354	L	0.29908	0.895	0.09310	N	1	P	0.47677	0.899	P	0.45099	0.469	T	0.14783	-1.0460	10	0.87932	D	0	-0.0226	2.9112	0.05738	0.2903:0.245:0.4647:0.0	.	85	Q96MG2	JSPR1_HUMAN	D	85	ENSP00000300961:A85D	ENSP00000300961:A85D	A	-	2	0	JSRP1	2205194	0.000000	0.05858	0.259000	0.24435	0.174000	0.22865	-0.004000	0.12878	0.137000	0.18759	0.555000	0.69702	GCC	.	.	none		0.642	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451266.2	NM_144616	
SMOX	54498	hgsc.bcm.edu	37	20	4158174	4158174	+	Missense_Mutation	SNP	C	C	T	rs147730753		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:4158174C>T	ENST00000305958.4	+	3	610	c.385C>T	c.(385-387)Cgc>Tgc	p.R129C	SMOX_ENST00000339123.6_Missense_Mutation_p.R129C|SMOX_ENST00000346595.2_Missense_Mutation_p.R129C|SMOX_ENST00000484515.1_3'UTR|SMOX_ENST00000379460.2_Missense_Mutation_p.R129C|SMOX_ENST00000278795.3_Missense_Mutation_p.R129C	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	129					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	CAACCACGGCCGCAGGATCCC	0.582																																					p.R129C		Atlas-SNP	.											SMOX_ENST00000278795,NS,carcinoma,-1,2	SMOX	119	2	0			c.C385T						scavenged	.	C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	58.0	50.0	52.0		385,385,385,385	1.0	0.7	20	dbSNP_134	52	3,8595	2.2+/-6.3	0,3,4296	yes	missense,missense,missense,missense	SMOX	NM_175839.1,NM_175840.1,NM_175841.1,NM_175842.1	180,180,180,180	0,3,6499	TT,TC,CC		0.0349,0.0,0.0231	benign,benign,benign,benign	129/556,129/503,129/191,129/533	4158174	3,13001	2203	4299	6502	SO:0001583	missense	54498	exon3			CACGGCCGCAGGA	AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.385C>T	20.37:g.4158174C>T	ENSP00000307252:p.Arg129Cys	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	84	3	0.0357143	NM_175839	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Missense_Mutation	SNP	ENST00000305958.4	37	CCDS13075.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.870077	0.33069	0.0	3.49E-4	ENSG00000088826	ENST00000339123;ENST00000305958;ENST00000278795;ENST00000346595;ENST00000379460	D;D;D;T;D	0.92545	-3.06;-3.06;-3.06;0.87;-3.06	5.31	0.99	0.19807	Amine oxidase (1);	0.692056	0.15105	N	0.280320	D	0.84529	0.5492	L	0.34521	1.04	0.27559	N	0.950256	B;B;B;B;B;B	0.14012	0.009;0.001;0.0;0.004;0.008;0.001	B;B;B;B;B;B	0.09377	0.003;0.002;0.0;0.002;0.001;0.004	T	0.73344	-0.4012	10	0.49607	T	0.09	-0.1544	5.2872	0.15708	0.1412:0.6092:0.0:0.2496	.	106;129;129;129;129;129	B4DE63;Q9NWM0-6;Q9NWM0-3;Q9NWM0;Q9NWM0-2;Q9NWM0-4	.;.;.;SMOX_HUMAN;.;.	C	129	ENSP00000344595:R129C;ENSP00000307252:R129C;ENSP00000278795:R129C;ENSP00000341775:R129C;ENSP00000368773:R129C	ENSP00000278795:R129C	R	+	1	0	SMOX	4106174	0.992000	0.36948	0.741000	0.31004	0.985000	0.73830	1.062000	0.30555	-0.038000	0.13624	-0.251000	0.11542	CGC	C|1.000;T|0.000	0.000	weak		0.582	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
UBXN11	91544	hgsc.bcm.edu	37	1	26608866	26608866	+	Missense_Mutation	SNP	C	C	G	rs188535926		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:26608866C>G	ENST00000374222.1	-	16	1951	c.1487G>C	c.(1486-1488)gGt>gCt	p.G496A	UBXN11_ENST00000357089.4_Missense_Mutation_p.G463A|UBXN11_ENST00000314675.7_Missense_Mutation_p.G376A|UBXN11_ENST00000374217.2_Missense_Mutation_p.G463A|UBXN11_ENST00000374223.1_Missense_Mutation_p.G253A|UBXN11_ENST00000374221.3_Missense_Mutation_p.G496A			Q5T124	UBX11_HUMAN	UBX domain protein 11	496	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						gggaccgggaccgggactggg	0.721																																					p.G496A		Atlas-SNP	.											UBXN11,colon,carcinoma,-1,2	UBXN11	54	2	1	Deletion - In frame(1)	ovary(1)	c.G1487C						scavenged	.						25.0	29.0	28.0					1																	26608866		1767	4017	5784	SO:0001583	missense	91544	exon16			CCGGGACCGGGAC	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1487G>C	1.37:g.26608866C>G	ENSP00000363339:p.Gly496Ala	Somatic	25	2	0.08		WXS	Illumina HiSeq	Phase_I	25	7	0.28	NM_183008	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	20	0.009157509157509158	6	0.012195121951219513	1	0.0027624309392265192	5	0.008741258741258742	8	0.010554089709762533	C	2.556	-0.303022	0.05495	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.21932	1.98;2.16;2.48;2.34;2.34;2.48	.	.	.	.	.	.	.	.	T	0.06325	0.0163	N	0.08118	0	0.58432	P	2.9999999999752447E-6	P;P;P;P	0.49961	0.93;0.93;0.93;0.886	B;B;B;B	0.40444	0.329;0.329;0.329;0.176	T	0.15292	-1.0442	7	0.45353	T	0.12	.	5.6498	0.17610	0.0:0.6576:0.3424:0.0	.	463;458;376;496	Q5T124-2;Q5T124-4;Q5T124-3;Q5T124	.;.;.;UBX11_HUMAN	A	376;253;463;496;496;463	ENSP00000324721:G376A;ENSP00000363340:G253A;ENSP00000349601:G463A;ENSP00000363338:G496A;ENSP00000363339:G496A;ENSP00000363334:G463A	ENSP00000324721:G376A	G	-	2	0	UBXN11	26481453	0.000000	0.05858	0.127000	0.21898	0.134000	0.20937	-0.138000	0.10374	0.392000	0.25172	0.391000	0.25812	GGT	C|0.991;G|0.009	0.009	strong		0.721	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
ZNF20	7568	hgsc.bcm.edu	37	19	12243529	12243529	+	Missense_Mutation	SNP	T	T	C	rs557758485		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:12243529T>C	ENST00000334213.5	-	4	1696	c.1472A>G	c.(1471-1473)aAt>aGt	p.N491S	ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000600335.1_Intron|ZNF20_ENST00000485451.1_5'Flank	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	491					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						TCGAATGTAATTGGAAATAAA	0.418													T|||	1	0.000199681	0.0008	0.0	5008	,	,		22095	0.0		0.0	False		,,,				2504	0.0				p.N491S		Atlas-SNP	.											.	ZNF20	86	.	0			c.A1472G						PASS	.						172.0	183.0	179.0					19																	12243529		2203	4298	6501	SO:0001583	missense	7568	exon4			ATGTAATTGGAAA	X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.1472A>G	19.37:g.12243529T>C	ENSP00000335437:p.Asn491Ser	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	78	38	0.487179	NM_021143	Q8N457|Q9UG41	Missense_Mutation	SNP	ENST00000334213.5	37	CCDS45986.1	.	.	.	.	.	.	.	.	.	.	T	0.165	-1.077307	0.01903	.	.	ENSG00000132010	ENST00000334213;ENST00000292241	T	0.05319	3.46	0.94	-1.88	0.07713	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00875	0.0029	N	0.00064	-2.31	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40572	-0.9556	9	0.02654	T	1	.	2.726	0.05214	0.0:0.268:0.2608:0.4712	.	491	P17024	ZNF20_HUMAN	S	491	ENSP00000335437:N491S	ENSP00000292241:N491S	N	-	2	0	ZNF20	12104529	0.000000	0.05858	0.001000	0.08648	0.910000	0.53928	-3.261000	0.00536	-0.843000	0.04189	0.260000	0.18958	AAT	.	.	none		0.418	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344101.1	NM_021143	
ZNF749	388567	hgsc.bcm.edu	37	19	57955884	57955884	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:57955884C>T	ENST00000334181.4	+	3	1618	c.1368C>T	c.(1366-1368)caC>caT	p.H456H	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	456					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H369H(1)|p.H456H(1)		breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		TAGTTCAGCACCAGAAAATCC	0.423																																					p.H456H		Atlas-SNP	.											ZNF749,NS,carcinoma,0,2	ZNF749	75	2	2	Substitution - coding silent(2)	endometrium(2)	c.C1368T						scavenged	.						93.0	89.0	91.0					19																	57955884		2203	4300	6503	SO:0001819	synonymous_variant	388567	exon3			TCAGCACCAGAAA	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.1368C>T	19.37:g.57955884C>T		Somatic	210	4	0.0190476		WXS	Illumina HiSeq	Phase_I	195	7	0.0358974	NM_001023561		Silent	SNP	ENST00000334181.4	37	CCDS33132.2																																																																																			.	.	none		0.423	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
PLCXD3	345557	hgsc.bcm.edu	37	5	41382437	41382437	+	Silent	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:41382437G>T	ENST00000377801.3	-	2	377	c.303C>A	c.(301-303)acC>acA	p.T101T	PLCXD3_ENST00000328457.3_Silent_p.T101T			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	101	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)	p.T101T(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						CTCTGGGCTTGGTGGAAATTC	0.448																																					p.T101T		Atlas-SNP	.											PLCXD3,NS,carcinoma,0,1	PLCXD3	86	1	1	Substitution - coding silent(1)	lung(1)	c.C303A						scavenged	.						78.0	82.0	81.0					5																	41382437		2203	4300	6503	SO:0001819	synonymous_variant	345557	exon2			GGGCTTGGTGGAA		CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.303C>A	5.37:g.41382437G>T		Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	195	2	0.0102564	NM_001005473	A6NL04	Silent	SNP	ENST00000377801.3	37	CCDS34150.1																																																																																			.	.	none		0.448	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367109.1	XM_293875	
OR10H5	284433	hgsc.bcm.edu	37	19	15905664	15905664	+	Missense_Mutation	SNP	C	C	T	rs144567857	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:15905664C>T	ENST00000308940.8	+	1	904	c.806C>T	c.(805-807)cCg>cTg	p.P269L		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						CCCCAGTCTCCGGAAGGAGAC	0.567													.|||	5	0.000998403	0.003	0.0014	5008	,	,		17105	0.0		0.0	False		,,,				2504	0.0				p.P269L		Atlas-SNP	.											OR10H5,NS,carcinoma,-1,1	OR10H5	49	1	0			c.C806T						scavenged	.						111.0	90.0	98.0					19																	15905664		2203	4300	6503	SO:0001583	missense	284433	exon1			AGTCTCCGGAAGG	AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.806C>T	19.37:g.15905664C>T	ENSP00000310704:p.Pro269Leu	Somatic	222	1	0.0045045		WXS	Illumina HiSeq	Phase_I	173	63	0.364162	NM_001004466	Q6IFJ0|Q96R60	Missense_Mutation	SNP	ENST00000308940.8	37	CCDS32940.1	5	0.0022893772893772895	1	0.0020325203252032522	0	0.0	0	0.0	4	0.005277044854881266	.	0	-2.679788	0.00102	.	.	ENSG00000172519	ENST00000308940	T	0.00207	8.55	3.88	-4.19	0.03835	GPCR, rhodopsin-like superfamily (1);	0.571038	0.14488	N	0.316535	T	0.00039	0.0001	N	0.03000	-0.44	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14200	-1.0481	10	0.26408	T	0.33	.	2.5734	0.04800	0.2427:0.418:0.1238:0.2154	.	269	Q8NGA6	O10H5_HUMAN	L	269	ENSP00000310704:P269L	ENSP00000310704:P269L	P	+	2	0	OR10H5	15766664	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.821000	0.00749	-1.726000	0.01370	-4.535000	0.00005	CCG	C|0.998;T|0.002	0.002	strong		0.567	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1		
AHNAK2	113146	hgsc.bcm.edu	37	14	105418008	105418008	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:105418008G>T	ENST00000333244.5	-	7	3899	c.3780C>A	c.(3778-3780)gaC>gaA	p.D1260E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1260						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCCCTTGAGGTCCACTTTGG	0.617																																					p.D1260E		Atlas-SNP	.											.	AHNAK2	719	.	0			c.C3780A						PASS	.						85.0	70.0	75.0					14																	105418008		1788	3218	5006	SO:0001583	missense	113146	exon7			CTTGAGGTCCACT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3780C>A	14.37:g.105418008G>T	ENSP00000353114:p.Asp1260Glu	Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	209	86	0.411483	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	9.476	1.096873	0.20552	.	.	ENSG00000185567	ENST00000333244	T	0.01838	4.61	3.99	-2.74	0.05932	.	.	.	.	.	T	0.02342	0.0072	M	0.76328	2.33	0.09310	N	1	B	0.30146	0.27	B	0.28139	0.086	T	0.49606	-0.8922	9	0.05959	T	0.93	.	3.689	0.08339	0.0883:0.1204:0.4663:0.325	.	1260	Q8IVF2	AHNK2_HUMAN	E	1260	ENSP00000353114:D1260E	ENSP00000353114:D1260E	D	-	3	2	AHNAK2	104489053	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.304000	0.08199	-0.748000	0.04753	-1.280000	0.01385	GAC	.	.	none		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ASH1L	55870	hgsc.bcm.edu	37	1	155491066	155491066	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:155491066T>C	ENST00000368346.3	-	2	884	c.245A>G	c.(244-246)gAg>gGg	p.E82G	ASH1L_ENST00000548830.1_Missense_Mutation_p.E82G|ASH1L_ENST00000392403.3_Missense_Mutation_p.E82G			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	82					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TAAATTTCCCTCTGAAAAGTT	0.388																																					p.E82G		Atlas-SNP	.											ASH1L,colon,carcinoma,+1,1	ASH1L	279	1	0			c.A245G						scavenged	.						158.0	167.0	164.0					1																	155491066		2203	4300	6503	SO:0001583	missense	55870	exon2			TTTCCCTCTGAAA	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.245A>G	1.37:g.155491066T>C	ENSP00000357330:p.Glu82Gly	Somatic	260	1	0.00384615		WXS	Illumina HiSeq	Phase_I	222	4	0.018018	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	T	25.8	4.676972	0.88445	.	.	ENSG00000116539	ENST00000368346;ENST00000392403;ENST00000548830	D;D	0.94184	-3.37;-3.37	5.89	5.89	0.94794	.	0.154403	0.45606	D	0.000347	D	0.93141	0.7816	L	0.27053	0.805	0.51233	D	0.99991	D;D	0.76494	0.998;0.999	D;D	0.83275	0.991;0.996	D	0.94970	0.8116	10	0.87932	D	0	.	15.9698	0.80004	0.0:0.0:0.0:1.0	.	82;82	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	G	82	ENSP00000357330:E82G;ENSP00000376204:E82G	ENSP00000357330:E82G	E	-	2	0	ASH1L	153757690	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.257000	0.78362	2.250000	0.74265	0.455000	0.32223	GAG	.	.	none		0.388	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
ZNF749	388567	hgsc.bcm.edu	37	19	57955885	57955885	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:57955885C>G	ENST00000334181.4	+	3	1619	c.1369C>G	c.(1369-1371)Cag>Gag	p.Q457E	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q457E(1)|p.Q370E(1)		breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		AGTTCAGCACCAGAAAATCCA	0.423																																					p.Q457E		Atlas-SNP	.											ZNF749,right_upper_lobe,carcinoma,0,14	ZNF749	75	14	2	Substitution - Missense(2)	endometrium(2)	c.C1369G						scavenged	.						92.0	89.0	90.0					19																	57955885		2203	4300	6503	SO:0001583	missense	388567	exon3			CAGCACCAGAAAA	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.1369C>G	19.37:g.57955885C>G	ENSP00000333980:p.Gln457Glu	Somatic	210	4	0.0190476		WXS	Illumina HiSeq	Phase_I	197	5	0.0253807	NM_001023561		Missense_Mutation	SNP	ENST00000334181.4	37	CCDS33132.2	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410685	0.25465	.	.	ENSG00000186230	ENST00000334181	T	0.07327	3.2	1.62	0.523	0.17060	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06826	0.0174	L	0.38649	1.16	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.33904	-0.9850	9	0.52906	T	0.07	.	5.9852	0.19430	0.5886:0.4114:0.0:0.0	.	457	O43361	ZN749_HUMAN	E	457	ENSP00000333980:Q457E	ENSP00000333980:Q457E	Q	+	1	0	ZNF749	62647697	.	.	0.001000	0.08648	0.750000	0.42670	.	.	0.202000	0.20498	0.650000	0.86243	CAG	.	.	none		0.423	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
EPHA10	284656	hgsc.bcm.edu	37	1	38227086	38227086	+	Missense_Mutation	SNP	A	A	T	rs4653328	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:38227086A>T	ENST00000373048.4	-	3	840	c.841T>A	c.(841-843)Ttc>Atc	p.F281I	EPHA10_ENST00000427468.2_Missense_Mutation_p.F281I|EPHA10_ENST00000319637.6_Missense_Mutation_p.F281I	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	281			F -> I (in dbSNP:rs4653328). {ECO:0000269|PubMed:17344846}.		ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCTTCGCAGAAGTCACCACGC	0.667													T|||	1769	0.353235	0.4402	0.3012	5008	,	,		11536	0.4831		0.2833	False		,,,				2504	0.2106				p.F281I		Atlas-SNP	.											.	EPHA10	120	.	0			c.T841A						PASS	.	T	ILE/PHE,ILE/PHE	1706,2604		311,1084,760	59.0	63.0	62.0		841,841	-1.5	0.8	1	dbSNP_111	62	2269,6083		305,1659,2212	yes	missense,missense	EPHA10	NM_001099439.1,NM_173641.2	21,21	616,2743,2972	TT,TA,AA		27.1671,39.5824,31.3931	benign,benign	281/1009,281/296	38227086	3975,8687	2155	4176	6331	SO:0001583	missense	284656	exon3			CGCAGAAGTCACC	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.841T>A	1.37:g.38227086A>T	ENSP00000362139:p.Phe281Ile	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	8	8	1	NM_001099439	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	37	CCDS41305.1	785	0.35943223443223443	208	0.42276422764227645	97	0.26795580110497236	252	0.4405594405594406	228	0.3007915567282322	T	7.996	0.754258	0.15778	0.395824	0.271671	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	D;D;T	0.97279	-4.32;-4.32;4.58	4.23	-1.55	0.08558	.	0.934531	0.08818	N	0.889212	T	0.00012	0.0000	N	0.01352	-0.895	0.09310	P	0.999999624185	B;B	0.10296	0.0;0.003	B;B	0.04013	0.0;0.001	T	0.26121	-1.0112	9	0.25751	T	0.34	.	3.9977	0.09566	0.3304:0.2198:0.0:0.4498	rs4653328;rs52814760;rs4653328	281;281	Q5JZY3;Q5JZY3-2	EPHAA_HUMAN;.	I	281	ENSP00000397746:F281I;ENSP00000362139:F281I;ENSP00000316395:F281I	ENSP00000316395:F281I	F	-	1	0	EPHA10	37999673	0.003000	0.15002	0.803000	0.32268	0.397000	0.30659	-0.342000	0.07801	-0.327000	0.08551	-1.255000	0.01485	TTC	A|0.665;T|0.335	0.335	strong		0.667	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
FEM1B	10116	hgsc.bcm.edu	37	15	68582376	68582376	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr15:68582376C>T	ENST00000306917.4	+	2	1295	c.680C>T	c.(679-681)gCc>gTc	p.A227V		NM_015322.4	NP_056137.1	Q9UK73	FEM1B_HUMAN	fem-1 homolog b (C. elegans)	227					apoptotic process (GO:0006915)|branching involved in prostate gland morphogenesis (GO:0060442)|epithelial cell maturation involved in prostate gland development (GO:0060743)|regulation of DNA damage checkpoint (GO:2000001)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death receptor binding (GO:0005123)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						AAAGTAGCTGCCGAAAGCTGT	0.473																																					p.A227V		Atlas-SNP	.											FEM1B,colon,carcinoma,+1,2	FEM1B	38	2	0			c.C680T						scavenged	.						116.0	109.0	111.0					15																	68582376		2200	4298	6498	SO:0001583	missense	10116	exon2			TAGCTGCCGAAAG		CCDS10228.1	15q22	2013-02-19	2001-11-28		ENSG00000169018	ENSG00000169018		"""Ankyrin repeat domain containing"""	3649	protein-coding gene	gene with protein product		613539	"""FEM-1 (C. elegans) homolog b"""			10623617	Standard	NM_015322		Approved		uc002arg.3	Q9UK73	OTTHUMG00000133285	ENST00000306917.4:c.680C>T	15.37:g.68582376C>T	ENSP00000307298:p.Ala227Val	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	61	2	0.0327869	NM_015322	O43146	Missense_Mutation	SNP	ENST00000306917.4	37	CCDS10228.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.178356	0.78564	.	.	ENSG00000169018	ENST00000306917	T	0.68624	-0.34	5.77	5.77	0.91146	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.78489	0.4291	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.78863	-0.2036	10	0.66056	D	0.02	-9.9279	18.9741	0.92728	0.0:1.0:0.0:0.0	.	227	Q9UK73	FEM1B_HUMAN	V	227	ENSP00000307298:A227V	ENSP00000307298:A227V	A	+	2	0	FEM1B	66369430	0.999000	0.42202	0.996000	0.52242	0.997000	0.91878	4.062000	0.57492	2.717000	0.92951	0.555000	0.69702	GCC	.	.	none		0.473	FEM1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257065.1		
DSPP	1834	hgsc.bcm.edu	37	4	88536448	88536448	+	Silent	SNP	C	C	T	rs111205175		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:88536448C>T	ENST00000282478.7	+	4	2667	c.2634C>T	c.(2632-2634)gaC>gaT	p.D878D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D878D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	878	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgacagcagtgata	0.498																																					p.D878D		Atlas-SNP	.											.	DSPP	174	.	0			c.C2634T						PASS	.						70.0	84.0	79.0					4																	88536448		1633	2930	4563	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2634C>T	4.37:g.88536448C>T		Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	102	15	0.147059	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	weak		0.498	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
NR2C1	7181	hgsc.bcm.edu	37	12	95442844	95442844	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:95442844C>T	ENST00000333003.5	-	9	1461	c.1131G>A	c.(1129-1131)agG>agA	p.R377R	NR2C1_ENST00000393101.3_Splice_Site_p.R377R|NR2C1_ENST00000330677.7_Splice_Site_p.R377R|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	377					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						ATAGAAATACCCTGAAAGCTA	0.363																																					p.R377R		Atlas-SNP	.											.	NR2C1	56	.	0			c.G1131A						PASS	.						100.0	92.0	95.0					12																	95442844		2203	4300	6503	SO:0001630	splice_region_variant	7181	exon9			AAATACCCTGAAA	M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.1131+1G>A	12.37:g.95442844C>T		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	67	24	0.358209	NM_001032287	A8K5K4|Q15625|Q15626	Silent	SNP	ENST00000333003.5	37	CCDS9051.1																																																																																			.	.	none		0.363	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407565.2	NM_003297	Silent
WDR7	23335	hgsc.bcm.edu	37	18	54353208	54353208	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr18:54353208C>T	ENST00000254442.3	+	6	753	c.542C>T	c.(541-543)tCg>tTg	p.S181L	WDR7_ENST00000357574.3_Missense_Mutation_p.S181L|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	181					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		GTAGCACTCTCGGTGACTGGC	0.413																																					p.S181L		Atlas-SNP	.											WDR7,NS,carcinoma,-1,1	WDR7	166	1	0			c.C542T						scavenged	.						140.0	144.0	143.0					18																	54353208		2203	4300	6503	SO:0001583	missense	23335	exon6			CACTCTCGGTGAC	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.542C>T	18.37:g.54353208C>T	ENSP00000254442:p.Ser181Leu	Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	97	3	0.0309278	NM_052834	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338188	0.60963	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.07800	3.16;3.16	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.20941	0.0504	M	0.69823	2.125	0.80722	D	1	D;P	0.60575	0.988;0.848	P;B	0.49421	0.61;0.121	T	0.00183	-1.1945	10	0.87932	D	0	.	19.6802	0.95960	0.0:1.0:0.0:0.0	.	181;181	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	L	181	ENSP00000254442:S181L;ENSP00000350187:S181L	ENSP00000254442:S181L	S	+	2	0	WDR7	52504206	1.000000	0.71417	0.888000	0.34837	0.122000	0.20287	7.558000	0.82253	2.758000	0.94735	0.650000	0.86243	TCG	.	.	none		0.413	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		
NMNAT1	64802	hgsc.bcm.edu	37	1	10042628	10042628	+	Missense_Mutation	SNP	C	C	T	rs375110174		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:10042628C>T	ENST00000377205.1	+	5	853	c.709C>T	c.(709-711)Cgc>Tgc	p.R237C	RP11-807G9.2_ENST00000413148.1_RNA	NM_022787.3	NP_073624.2	Q9HAN9	NMNA1_HUMAN	nicotinamide nucleotide adenylyltransferase 1	237			R -> C (in LCA9; does not affect nuclear localization). {ECO:0000269|PubMed:22842227, ECO:0000269|PubMed:22842229}.|R -> L (in LCA9). {ECO:0000269|PubMed:22842230}.		NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			large_intestine(2)|lung(2)|stomach(1)	5		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)		CCAGAGCATTCGCTACTTGGT	0.478																																					p.R237C		Atlas-SNP	.											NMNAT1,NS,adenocarcinoma,-1,1	NMNAT1	18	1	0			c.C709T						scavenged	.	C	CYS/ARG	0,4406		0,0,2203	67.0	66.0	66.0		709	5.0	1.0	1		66	2,8598	2.2+/-6.3	0,2,4298	no	missense	NMNAT1	NM_022787.3	180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	237/280	10042628	2,13004	2203	4300	6503	SO:0001583	missense	64802	exon5			AGCATTCGCTACT	AF312734	CCDS108.1, CCDS72698.1	1p36.22	2014-01-28	2003-04-30	2003-05-02	ENSG00000173614	ENSG00000173614	2.7.7.1		17877	protein-coding gene	gene with protein product		608700	"""nicotinamide nucleotide adenylyltransferase"", ""Leber congenital amaurosis 9"", ""Leber's congenital amaurosis 9"""	LCA9		11248244, 11027696, 22842227	Standard	XR_244792		Approved	NMNAT, PNAT1	uc001aqp.3	Q9HAN9	OTTHUMG00000001799	ENST00000377205.1:c.709C>T	1.37:g.10042628C>T	ENSP00000366410:p.Arg237Cys	Somatic	181	1	0.00552486		WXS	Illumina HiSeq	Phase_I	163	2	0.0122699	NM_022787	B1AN63|Q8TAE9|Q9H247|Q9H6B6	Missense_Mutation	SNP	ENST00000377205.1	37	CCDS108.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803897	0.70682	0.0	2.33E-4	ENSG00000173614	ENST00000377205	D	0.98028	-4.67	5.01	5.01	0.66863	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.058855	0.64402	D	0.000004	D	0.98927	0.9636	M	0.92784	3.345	0.58432	D	0.999998	D	0.89917	1.0	D	0.63192	0.912	D	0.99690	1.1001	10	0.87932	D	0	-39.9159	18.6767	0.91531	0.0:1.0:0.0:0.0	.	237	Q9HAN9	NMNA1_HUMAN	C	237	ENSP00000366410:R237C	ENSP00000366410:R237C	R	+	1	0	NMNAT1	9965215	0.986000	0.35501	1.000000	0.80357	0.925000	0.55904	2.604000	0.46274	2.476000	0.83614	0.462000	0.41574	CGC	.	.	none		0.478	NMNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005029.1		
SMAD9	4093	hgsc.bcm.edu	37	13	37441511	37441511	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr13:37441511G>T	ENST00000399275.2	-	3	819	c.680C>A	c.(679-681)cCa>cAa	p.P227Q	SMAD9_ENST00000379826.4_Missense_Mutation_p.P227Q|SMAD9_ENST00000350148.5_Intron			O15198	SMAD9_HUMAN	SMAD family member 9	227					BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		AGGCAGGGGTGGTGTGTCAAC	0.448																																					p.P227Q		Atlas-SNP	.											SMAD9_ENST00000379826,colon,carcinoma,0,1	SMAD9	91	1	0			c.C680A						scavenged	.						141.0	121.0	128.0					13																	37441511		692	1591	2283	SO:0001583	missense	4093	exon4			AGGGGTGGTGTGT		CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.680C>A	13.37:g.37441511G>T	ENSP00000382216:p.Pro227Gln	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	99	2	0.020202	NM_001127217	A2A2Y6|O14989|Q5TBA1	Missense_Mutation	SNP	ENST00000399275.2	37	CCDS45032.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.233296	0.58886	.	.	ENSG00000120693	ENST00000399275;ENST00000379826	D;D	0.94687	-3.49;-3.49	3.9	3.05	0.35203	SMAD/FHA domain (1);	0.337447	0.35495	N	0.003179	D	0.93615	0.7961	L	0.56124	1.755	0.49299	D	0.999773	P	0.39883	0.693	P	0.49999	0.628	D	0.89899	0.4043	10	0.30854	T	0.27	.	8.7773	0.34769	0.1075:0.0:0.8925:0.0	.	227	O15198	SMAD9_HUMAN	Q	227	ENSP00000382216:P227Q;ENSP00000369154:P227Q	ENSP00000369154:P227Q	P	-	2	0	SMAD9	36339511	1.000000	0.71417	0.503000	0.27626	0.997000	0.91878	5.333000	0.65917	0.633000	0.30452	0.655000	0.94253	CCA	.	.	none		0.448	SMAD9-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044525.2	NM_005905	
TP53	7157	hgsc.bcm.edu	37	17	7578419	7578419	+	Nonsense_Mutation	SNP	C	C	A	rs587781845		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:7578419C>A	ENST00000269305.4	-	5	700	c.511G>T	c.(511-513)Gag>Tag	p.E171*	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Nonsense_Mutation_p.E171*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E171*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E171*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E171*|TP53_ENST00000413465.2_Nonsense_Mutation_p.E171*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	171	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in a sporadic cancer; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E171K(11)|p.E171*(10)|p.0?(8)|p.E171Q(4)|p.E171fs*2(3)|p.E171fs*3(2)|p.E171fs*10(2)|p.V157_C176del20(1)|p.T170fs*8(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.E171fs*9(1)|p.T170fs*2(1)|p.E171fs*1(1)|p.E78fs*2(1)|p.H168fs*3(1)|p.H168fs*69(1)|p.T170_E171insXX(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.E39fs*2(1)|p.E171_V172delEV(1)|p.E39K(1)|p.E78K(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCACAACCTCCGTCATGTGC	0.662		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E171X	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,bladder,carcinoma,0,47	TP53	33396	47	57	Substitution - Missense(17)|Deletion - Frameshift(15)|Substitution - Nonsense(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(2)|Insertion - In frame(1)	urinary_tract(8)|lung(8)|breast(8)|oesophagus(6)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|large_intestine(3)|stomach(3)|central_nervous_system(3)|skin(3)|upper_aerodigestive_tract(2)|thyroid(1)|kidney(1)|endometrium(1)|liver(1)|ovary(1)	c.G511T						PASS	.						52.0	52.0	52.0					17																	7578419		2203	4300	6503	SO:0001587	stop_gained	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CAACCTCCGTCAT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.511G>T	17.37:g.7578419C>A	ENSP00000269305:p.Glu171*	Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	83	72	0.86747	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186918	0.78789	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.47	5.47	0.80525	.	0.106949	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-29.8225	17.1938	0.86887	0.0:1.0:0.0:0.0	.	.	.	.	X	171;171;171;171;171;171;160;78;39;78;39	.	ENSP00000269305:E171X	E	-	1	0	TP53	7519144	1.000000	0.71417	0.689000	0.30133	0.389000	0.30415	7.775000	0.85489	2.735000	0.93741	0.563000	0.77884	GAG	.	.	none		0.662	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CDC27	996	hgsc.bcm.edu	37	17	45232075	45232075	+	Missense_Mutation	SNP	A	A	T	rs199711781		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:45232075A>T	ENST00000066544.3	-	8	1013	c.920T>A	c.(919-921)gTa>gAa	p.V307E	CDC27_ENST00000531206.1_Missense_Mutation_p.V307E|CDC27_ENST00000527547.1_Missense_Mutation_p.V307E|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Missense_Mutation_p.V246E	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	307					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.V307E(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CACATCAATTACAGGAGGTGT	0.378																																					p.V307E		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,0,2	CDC27	337	2	2	Substitution - Missense(2)	kidney(2)	c.T920A						scavenged	.						50.0	50.0	50.0					17																	45232075		2203	4300	6503	SO:0001583	missense	996	exon8			TCAATTACAGGAG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.920T>A	17.37:g.45232075A>T	ENSP00000066544:p.Val307Glu	Somatic	51	1	0.0196078		WXS	Illumina HiSeq	Phase_I	51	3	0.0588235	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	15.91	2.973416	0.53614	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.69040	-0.36;-0.35;-0.04;-0.37;0.63	5.92	5.92	0.95590	.	0.302185	0.32401	N	0.006159	T	0.43299	0.1241	N	0.08118	0	0.58432	D	0.99999	P;B;B;B	0.36465	0.554;0.255;0.341;0.089	B;B;B;B	0.27608	0.081;0.075;0.076;0.034	T	0.47861	-0.9084	10	0.30078	T	0.28	-36.9477	14.323	0.66499	1.0:0.0:0.0:0.0	.	246;307;307;307	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	E	307;307;246;307;307	ENSP00000066544:V307E;ENSP00000434614:V307E;ENSP00000392802:V246E;ENSP00000437339:V307E;ENSP00000432105:V307E	ENSP00000066544:V307E	V	-	2	0	CDC27	42587074	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.746000	0.74866	2.267000	0.75376	0.477000	0.44152	GTA	A|0.999;T|0.001	0.001	weak		0.378	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
DNAH1	25981	hgsc.bcm.edu	37	3	52427469	52427469	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:52427469C>T	ENST00000420323.2	+	66	10855	c.10594C>T	c.(10594-10596)Cgc>Tgc	p.R3532C		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3597					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3532C(1)		cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GCTGTGTGTTCGCATCATGAT	0.567																																					p.R3532C		Atlas-SNP	.											DNAH1_ENST00000420323,NS,carcinoma,0,3	DNAH1	534	3	1	Substitution - Missense(1)	large_intestine(1)	c.C10594T						scavenged	.						92.0	95.0	94.0					3																	52427469		2121	4238	6359	SO:0001583	missense	25981	exon66			TGTGTTCGCATCA	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.10594C>T	3.37:g.52427469C>T	ENSP00000401514:p.Arg3532Cys	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	161	2	0.0124224	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.724468	0.68959	.	.	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.59224	0.28	4.46	4.46	0.54185	.	0.100975	0.38111	N	0.001803	T	0.79493	0.4455	M	0.93283	3.4	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;P	0.65010	0.931;0.897	D	0.84535	0.0635	10	0.66056	D	0.02	.	12.8533	0.57871	0.0:0.9188:0.0:0.0812	.	3532;3597	C9JXH6;Q9P2D7-2	.;.	C	3532;285	ENSP00000401514:R3532C	ENSP00000273600:R285C	R	+	1	0	DNAH1	52402509	0.601000	0.26907	1.000000	0.80357	0.975000	0.68041	1.198000	0.32223	2.324000	0.78689	0.563000	0.77884	CGC	.	.	none		0.567	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
CTSH	1512	hgsc.bcm.edu	37	15	79220112	79220112	+	Missense_Mutation	SNP	G	G	C	rs142506062		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr15:79220112G>C	ENST00000220166.5	-	9	751	c.642C>G	c.(640-642)tgC>tgG	p.C214W	CTSH_ENST00000534533.1_5'UTR	NM_004390.3	NP_004381.2	P09668	CATH_HUMAN	cathepsin H	214					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|bradykinin catabolic process (GO:0010815)|cellular response to thyroid hormone stimulus (GO:0097067)|dichotomous subdivision of terminal units involved in lung branching (GO:0060448)|ERK1 and ERK2 cascade (GO:0070371)|immune response-regulating signaling pathway (GO:0002764)|membrane protein proteolysis (GO:0033619)|metanephros development (GO:0001656)|negative regulation of apoptotic process (GO:0043066)|neuropeptide catabolic process (GO:0010813)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidase activity (GO:0010952)|protein destabilization (GO:0031648)|proteolysis (GO:0006508)|response to retinoic acid (GO:0032526)|spermatogenesis (GO:0007283)|surfactant homeostasis (GO:0043129)|T cell mediated cytotoxicity (GO:0001913)|zymogen activation (GO:0031638)	acrosomal vesicle (GO:0001669)|alveolar lamellar body (GO:0097208)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|outer dense fiber (GO:0001520)	aminopeptidase activity (GO:0004177)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)|HLA-A specific activating MHC class I receptor activity (GO:0030108)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|thyroid hormone binding (GO:0070324)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)	10						GTTGGAACTTGCAATAACCAT	0.483																																					p.C214W		Atlas-SNP	.											.	CTSH	23	.	0			c.C642G						PASS	.						158.0	119.0	132.0					15																	79220112		2196	4293	6489	SO:0001583	missense	1512	exon9			GAACTTGCAATAA	X07549	CCDS10308.1	15q25.1	2014-01-28			ENSG00000103811	ENSG00000103811	3.4.22.16	"""Cathepsins"""	2535	protein-coding gene	gene with protein product		116820		CPSB		2849458	Standard	NM_004390		Approved	ACC-4, ACC-5	uc021srk.1	P09668	OTTHUMG00000144171	ENST00000220166.5:c.642C>G	15.37:g.79220112G>C	ENSP00000220166:p.Cys214Trp	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	44	28	0.636364	NM_004390	B2RBK0|Q96NY6|Q9BUM7	Missense_Mutation	SNP	ENST00000220166.5	37	CCDS10308.1	.	.	.	.	.	.	.	.	.	.	G	10.13	1.264475	0.23136	.	.	ENSG00000103811	ENST00000220166;ENST00000394758	D	0.93712	-3.27	4.94	4.02	0.46733	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.97936	0.9321	H	0.99225	4.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97240	0.9890	10	0.87932	D	0	.	9.4585	0.38769	0.0996:0.0:0.9004:0.0	.	214;202	P09668;E9PBP2	CATH_HUMAN;.	W	214;202	ENSP00000220166:C214W	ENSP00000220166:C214W	C	-	3	2	CTSH	77007167	1.000000	0.71417	0.996000	0.52242	0.027000	0.11550	2.681000	0.46926	1.094000	0.41399	-0.216000	0.12614	TGC	G|1.000;A|0.000	.	alt		0.483	CTSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291370.1	NM_004390	
ATF7IP2	80063	hgsc.bcm.edu	37	16	10575768	10575768	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:10575768C>T	ENST00000396560.2	+	12	1938	c.1711C>T	c.(1711-1713)Cga>Tga	p.R571*	ATF7IP2_ENST00000543967.1_Nonsense_Mutation_p.R115*|ATF7IP2_ENST00000324570.5_3'UTR|ATF7IP2_ENST00000356427.2_Nonsense_Mutation_p.R571*|ATF7IP2_ENST00000396559.1_3'UTR	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	571					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				large_intestine(3)	3						AGACAAAACCCGAGACACACT	0.458																																					p.R571X		Atlas-SNP	.											ATF7IP2_ENST00000396560,NS,carcinoma,0,1	ATF7IP2	40	1	0			c.C1711T						scavenged	.						102.0	101.0	101.0					16																	10575768		2197	4300	6497	SO:0001587	stop_gained	80063	exon12			AAAACCCGAGACA	AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.1711C>T	16.37:g.10575768C>T	ENSP00000379808:p.Arg571*	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	80	2	0.025	NM_024997	B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Nonsense_Mutation	SNP	ENST00000396560.2	37	CCDS10540.1	.	.	.	.	.	.	.	.	.	.	C	37	6.590210	0.97688	.	.	ENSG00000166669	ENST00000543967;ENST00000396560;ENST00000356427	.	.	.	5.62	2.32	0.28847	.	1.074000	0.07248	N	0.865345	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.5128	7.9603	0.30068	0.3245:0.5184:0.1572:0.0	.	.	.	.	X	115;571;571	.	ENSP00000348799:R571X	R	+	1	2	ATF7IP2	10483269	0.000000	0.05858	0.698000	0.30274	0.830000	0.47004	-0.153000	0.10144	0.681000	0.31386	0.484000	0.47621	CGA	.	.	none		0.458	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251961.1	NM_024997	
SLC1A4	6509	hgsc.bcm.edu	37	2	65245351	65245351	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:65245351C>T	ENST00000234256.3	+	6	1424	c.1181C>T	c.(1180-1182)gCg>gTg	p.A394V	SLC1A4_ENST00000531327.1_Missense_Mutation_p.A96V	NM_003038.4	NP_003029.2	P43007	SATT_HUMAN	solute carrier family 1 (glutamate/neutral amino acid transporter), member 4	394					amino acid transport (GO:0006865)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cognition (GO:0050890)|glutamine transport (GO:0006868)|hydroxyproline transport (GO:0034589)|ion transport (GO:0006811)|L-alanine transport (GO:0015808)|L-cystine transport (GO:0015811)|L-serine transport (GO:0015825)|proline transmembrane transport (GO:0035524)|proline transport (GO:0015824)|synaptic transmission, glutamatergic (GO:0035249)|threonine transport (GO:0015826)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|centrosome (GO:0005813)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament (GO:0005882)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|L-alanine transmembrane transporter activity (GO:0015180)|L-cystine transmembrane transporter activity (GO:0015184)|L-glutamine transmembrane transporter activity (GO:0015186)|L-hydroxyproline transmembrane transporter activity (GO:0034590)|L-proline transmembrane transporter activity (GO:0015193)|L-serine transmembrane transporter activity (GO:0015194)|L-threonine transmembrane transporter activity (GO:0015195)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|urinary_tract(1)	13					L-Alanine(DB00160)	GTGTTCATTGCGCAACTCAAC	0.507																																					p.A394V		Atlas-SNP	.											SLC1A4,NS,carcinoma,-1,1	SLC1A4	33	1	0			c.C1181T						scavenged	.						140.0	129.0	133.0					2																	65245351		2203	4300	6503	SO:0001583	missense	6509	exon6			TCATTGCGCAACT		CCDS1879.1, CCDS54362.1	2p15-p13	2013-05-22			ENSG00000115902	ENSG00000115902		"""Solute carriers"""	10942	protein-coding gene	gene with protein product	"""alanine/serine/cysteine/threonine transporter"""	600229				7896285, 8910405	Standard	NM_003038		Approved	SATT, ASCT1	uc010yqa.2	P43007	OTTHUMG00000129537	ENST00000234256.3:c.1181C>T	2.37:g.65245351C>T	ENSP00000234256:p.Ala394Val	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	339	4	0.0117994	NM_003038	B7Z3C0|D6W5F0	Missense_Mutation	SNP	ENST00000234256.3	37	CCDS1879.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.819938	0.90873	.	.	ENSG00000115902	ENST00000531327;ENST00000448784;ENST00000234256	T;T	0.66460	-0.21;-0.21	6.17	6.17	0.99709	Sodium:dicarboxylate symporter, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.87289	0.6140	M	0.92880	3.355	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.971;1.0	D	0.88502	0.3083	9	.	.	.	-17.0195	20.8794	0.99867	0.0:1.0:0.0:0.0	.	394;96;394	P43007;B7Z3C0;B2R7N6	SATT_HUMAN;.;.	V	96;314;394	ENSP00000431942:A96V;ENSP00000234256:A394V	.	A	+	2	0	SLC1A4	65098855	1.000000	0.71417	0.997000	0.53966	0.229000	0.25112	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GCG	.	.	none		0.507	SLC1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251726.2	NM_003038	
KRTAP10-1	386677	hgsc.bcm.edu	37	21	45959773	45959773	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr21:45959773C>T	ENST00000400375.1	-	1	305	c.261G>A	c.(259-261)ccG>ccA	p.P87P	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198691.2	NP_941964.2	P60331	KR101_HUMAN	keratin associated protein 10-1	87	24 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.P87P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(3)|prostate(4)|skin(1)	11						tgcagcaagccggctggcagc	0.672																																					p.P87P		Atlas-SNP	.											KRTAP10-1,NS,carcinoma,0,1	KRTAP10-1	34	1	1	Substitution - coding silent(1)	prostate(1)	c.G261A						scavenged	.						38.0	44.0	42.0					21																	45959773		2183	4271	6454	SO:0001819	synonymous_variant	386677	exon1			GCAAGCCGGCTGG	AJ566380	CCDS42954.1	21q22.3	2007-10-05			ENSG00000215455	ENSG00000215455		"""Keratin associated proteins"""	22966	protein-coding gene	gene with protein product				KRTAP18-1			Standard	NM_198691		Approved	KAP10.1, KAP18.1	uc002zfh.1	P60331	OTTHUMG00000057627	ENST00000400375.1:c.261G>A	21.37:g.45959773C>T		Somatic	123	4	0.0325203		WXS	Illumina HiSeq	Phase_I	203	7	0.0344828	NM_198691	Q0VAR0|Q0VAR1	Silent	SNP	ENST00000400375.1	37	CCDS42954.1																																																																																			.	.	weak		0.672	KRTAP10-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128030.1		
HSPG2	3339	hgsc.bcm.edu	37	1	22201196	22201196	+	Silent	SNP	C	C	T	rs550724412		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:22201196C>T	ENST00000374695.3	-	27	3520	c.3441G>A	c.(3439-3441)acG>acA	p.T1147T		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1147	Laminin EGF-like 5; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.T1147T(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGCCACTGGGCGTGCGTGTGT	0.637													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16595	0.0		0.0	False		,,,				2504	0.0				p.T1147T		Atlas-SNP	.											HSPG2,colon,carcinoma,0,1	HSPG2	311	1	1	Substitution - coding silent(1)	large_intestine(1)	c.G3441A						scavenged	.						39.0	41.0	40.0					1																	22201196		2202	4299	6501	SO:0001819	synonymous_variant	3339	exon27			ACTGGGCGTGCGT	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.3441G>A	1.37:g.22201196C>T		Somatic	265	0	0		WXS	Illumina HiSeq	Phase_I	289	3	0.0103806	NM_005529	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	8.277	0.814592	0.16607	.	.	ENSG00000142798	ENST00000427897	.	.	.	5.02	-3.63	0.04529	.	.	.	.	.	T	0.18215	0.0437	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.29731	-1.0002	4	.	.	.	.	1.7401	0.02950	0.1147:0.3514:0.2255:0.3084	.	.	.	.	T	2	.	.	A	-	1	0	HSPG2	22073783	0.000000	0.05858	0.781000	0.31783	0.945000	0.59286	-0.631000	0.05496	-0.066000	0.12998	-0.301000	0.09380	GCC	.	.	none		0.637	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
HSP90AA1	3320	hgsc.bcm.edu	37	14	102551314	102551314	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:102551314C>T	ENST00000216281.8	-	5	890	c.685G>A	c.(685-687)Gaa>Aaa	p.E229K	HSP90AA1_ENST00000441629.2_Missense_Mutation_p.E50K|HSP90AA1_ENST00000334701.7_Missense_Mutation_p.E351K	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	229					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)	p.E351Q(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	TCGCTTACTTCTTTATCACGT	0.408																																					p.E351K		Atlas-SNP	.											HSP90AA1,NS,carcinoma,0,1	HSP90AA1	65	1	1	Substitution - Missense(1)	breast(1)	c.G1051A						scavenged	.						50.0	53.0	52.0					14																	102551314		2203	4299	6502	SO:0001583	missense	3320	exon6			TTACTTCTTTATC	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.685G>A	14.37:g.102551314C>T	ENSP00000216281:p.Glu229Lys	Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	182	4	0.021978	NM_001017963	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	ENST00000216281.8	37	CCDS9967.1	.	.	.	.	.	.	.	.	.	.	c	26.7	4.763541	0.89932	.	.	ENSG00000080824	ENST00000216281;ENST00000334701;ENST00000441629;ENST00000553585	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	4.47	4.47	0.54385	.	0.075524	0.51477	U	0.000094	T	0.53834	0.1821	H	0.94345	3.525	0.80722	D	1	P;D;D	0.56968	0.941;0.978;0.957	D;D;D	0.71414	0.973;0.948;0.933	T	0.70139	-0.4954	10	0.87932	D	0	-23.098	17.1138	0.86683	0.0:1.0:0.0:0.0	.	50;351;229	Q86U12;P07900-2;P07900	.;.;HS90A_HUMAN	K	229;351;50;160	ENSP00000216281:E229K;ENSP00000335153:E351K;ENSP00000396189:E50K;ENSP00000450712:E160K	ENSP00000216281:E229K	E	-	1	0	HSP90AA1	101621067	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	4.783000	0.62403	2.200000	0.70718	0.655000	0.94253	GAA	.	.	none		0.408	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348	
PAK7	57144	hgsc.bcm.edu	37	20	9560944	9560944	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:9560944G>A	ENST00000378429.3	-	5	1384	c.838C>T	c.(838-840)Ccc>Tcc	p.P280S	PAK7_ENST00000378423.1_Missense_Mutation_p.P280S|PAK7_ENST00000353224.5_Missense_Mutation_p.P280S|RP5-986I17.2_ENST00000428769.1_RNA	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	280	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			CGCATGGTGGGCTGAGGGCTT	0.552																																					p.P280S		Atlas-SNP	.											.	PAK7	194	.	0			c.C838T						PASS	.						169.0	147.0	155.0					20																	9560944		2203	4300	6503	SO:0001583	missense	57144	exon4			TGGTGGGCTGAGG	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.838C>T	20.37:g.9560944G>A	ENSP00000367686:p.Pro280Ser	Somatic	266	0	0		WXS	Illumina HiSeq	Phase_I	400	125	0.3125	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.625175	0.46840	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.29917	1.55;1.55;1.55	5.6	5.6	0.85130	.	0.047698	0.85682	D	0.000000	T	0.26122	0.0637	L	0.29908	0.895	0.80722	D	1	P;P	0.48503	0.911;0.911	B;B	0.39840	0.311;0.311	T	0.01492	-1.1341	9	.	.	.	.	19.9969	0.97387	0.0:0.0:1.0:0.0	.	280;280	B0AZM9;Q9P286	.;PAK7_HUMAN	S	280;280;280;228	ENSP00000367686:P280S;ENSP00000322957:P280S;ENSP00000367679:P280S	.	P	-	1	0	PAK7	9508944	1.000000	0.71417	0.999000	0.59377	0.016000	0.09150	9.424000	0.97464	2.813000	0.96785	0.637000	0.83480	CCC	.	.	none		0.552	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
ZNF880	400713	hgsc.bcm.edu	37	19	52888049	52888049	+	Missense_Mutation	SNP	C	C	A	rs75346003	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:52888049C>A	ENST00000422689.2	+	4	1231	c.1216C>A	c.(1216-1218)Caa>Aaa	p.Q406K		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	406					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						CACGGGAGAGCAACCTTACAA	0.398																																					p.Q406K		Atlas-SNP	.											ZNF880,colon,carcinoma,-1,2	ZNF880	45	2	0			c.C1216A						scavenged	.						69.0	63.0	65.0					19																	52888049		1568	3582	5150	SO:0001583	missense	400713	exon4			GGAGAGCAACCTT	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1216C>A	19.37:g.52888049C>A	ENSP00000406318:p.Gln406Lys	Somatic	33	7	0.212121		WXS	Illumina HiSeq	Phase_I	37	12	0.324324	NM_001145434	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.634723	0.00114	.	.	ENSG00000221923	ENST00000422689	T	0.10860	2.83	1.84	0.731	0.18277	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01835	0.0058	N	0.00128	-2.045	0.20638	N	0.999879	B	0.17667	0.023	B	0.14023	0.01	T	0.46105	-0.9215	8	.	.	.	.	6.7224	0.23338	0.7399:0.2601:0.0:0.0	.	406	Q6PDB4	ZN880_HUMAN	K	406	ENSP00000406318:Q406K	.	Q	+	1	0	ZNF880	57579861	0.006000	0.16342	0.407000	0.26434	0.151000	0.21798	0.708000	0.25719	0.007000	0.14760	-0.493000	0.04662	CAA	C|0.872;A|0.128	0.128	strong		0.398	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000575389.2_Missense_Mutation_p.L593V|SALL3_ENST00000536229.3_Missense_Mutation_p.L460V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		Atlas-SNP	.											SALL3,NS,carcinoma,0,1	SALL3	162	1	1	Substitution - Missense(1)	prostate(1)	c.C1777G						scavenged	.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	2	2	1	NM_171999	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.211;G|0.789	0.789	strong		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643255	1643255	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:1643255G>A	ENST00000399682.1	-	1	113	c.69C>T	c.(67-69)ggC>ggT	p.G23G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)		p.G23G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cagagccacagcccccacagc	0.687																																					p.G23G		Atlas-SNP	.											KRTAP5-4,NS,carcinoma,0,1	KRTAP5-4	78	1	1	Substitution - coding silent(1)	kidney(1)	c.C69T						scavenged	.						4.0	8.0	7.0					11																	1643255		646	1526	2172	SO:0001819	synonymous_variant	387267	exon1			GCCACAGCCCCCA	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.69C>T	11.37:g.1643255G>A		Somatic	135	5	0.037037		WXS	Illumina HiSeq	Phase_I	226	20	0.0884956	NM_001012709		Silent	SNP	ENST00000399682.1	37																																																																																				.	.	none		0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
SLC35G6	643664	hgsc.bcm.edu	37	17	7386301	7386301	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:7386301A>C	ENST00000412468.2	+	2	1113	c.998A>C	c.(997-999)gAa>gCa	p.E333A	POLR2A_ENST00000322644.6_5'Flank|POLR2A_ENST00000572844.1_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	333						integral component of membrane (GO:0016021)		p.E333A(1)									TGTGAGAGGGAAGGGAAGGTG	0.557																																					p.E333A		Atlas-SNP	.											POLR2A_ENST00000412468,NS,carcinoma,0,1	.	.	1	1	Substitution - Missense(1)	prostate(1)	c.A998C						scavenged	.						60.0	58.0	59.0					17																	7386301		2203	4300	6503	SO:0001583	missense	643664	exon2			AGAGGGAAGGGAA		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.998A>C	17.37:g.7386301A>C	ENSP00000396523:p.Glu333Ala	Somatic	142	4	0.028169		WXS	Illumina HiSeq	Phase_I	98	6	0.0612245	NM_001102614		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	A	2.913	-0.225018	0.06022	.	.	ENSG00000181222	ENST00000412468	T	0.26067	1.76	4.69	1.0	0.19881	.	.	.	.	.	T	0.15609	0.0376	N	0.25647	0.755	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.22626	-1.0211	9	0.36615	T	0.2	-0.2286	5.7938	0.18375	0.4278:0.471:0.1012:0.0	.	333	P0C7Q6	S35G6_HUMAN	A	333	ENSP00000396523:E333A	ENSP00000396523:E333A	E	+	2	0	SLC35G6	7327025	0.886000	0.30341	0.428000	0.26697	0.484000	0.33280	1.649000	0.37281	0.732000	0.32470	0.477000	0.44152	GAA	.	.	none		0.557	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
EP400	57634	hgsc.bcm.edu	37	12	132547096	132547096	+	Silent	SNP	G	G	A	rs74479394|rs113304321	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:132547096G>A	ENST00000333577.4	+	48	8401	c.8292G>A	c.(8290-8292)caG>caA	p.Q2764Q	EP400_ENST00000332482.4_Silent_p.Q2691Q|EP400_ENST00000389562.2_Silent_p.Q2727Q|EP400_ENST00000389561.2_Silent_p.Q2728Q|EP400_ENST00000330386.6_Silent_p.Q2647Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2764	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcaacaacagcagcagcagc	0.567													G|||	734	0.146565	0.3215	0.0432	5008	,	,		15582	0.1111		0.0417	False		,,,				2504	0.1278				p.Q2728Q		Atlas-SNP	.											EP400,colon,carcinoma,0,3	EP400	370	3	0			c.G8184A						scavenged	.	G		0,4324		0,0,2162	24.0	29.0	27.0		8184	0.5	0.9	12	dbSNP_131	27	1,8349		0,1,4174	no	coding-synonymous	EP400	NM_015409.4		0,1,6336	AA,AG,GG		0.012,0.0,0.0079		2728/3124	132547096	1,12673	2162	4175	6337	SO:0001819	synonymous_variant	57634	exon47			ACAACAGCAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8292G>A	12.37:g.132547096G>A		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	94	3	0.0319149	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.	.	weak		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
PTPRZ1	5803	hgsc.bcm.edu	37	7	121650463	121650463	+	Silent	SNP	A	A	C	rs199595173	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:121650463A>C	ENST00000393386.2	+	12	1774	c.1363A>C	c.(1363-1365)Agg>Cgg	p.R455R	PTPRZ1_ENST00000449182.1_Silent_p.R455R	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	455					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AAACCAAATCAGGAAAAAGGA	0.423													A|||	6	0.00119808	0.0	0.0	5008	,	,		18694	0.0		0.0	False		,,,				2504	0.0061				p.R455R		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.A1363C						PASS	.						153.0	143.0	146.0					7																	121650463		2203	4300	6503	SO:0001819	synonymous_variant	5803	exon12			CAAATCAGGAAAA	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1363A>C	7.37:g.121650463A>C		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	80	38	0.475	NM_001206838	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	CCDS34740.1																																																																																			A|0.999;C|0.001	0.001	weak		0.423	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
AMN	81693	hgsc.bcm.edu	37	14	103394811	103394811	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:103394811G>A	ENST00000299155.5	+	4	289	c.256G>A	c.(256-258)Ggc>Agc	p.G86S		NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein	86					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGCCGGATTCGGCGTCTCAGA	0.716																																					p.G86S		Atlas-SNP	.											.	AMN	13	.	0			c.G256A						PASS	.						17.0	17.0	17.0					14																	103394811		2193	4292	6485	SO:0001583	missense	81693	exon4			GGATTCGGCGTCT	AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7		ENST00000299155.5:c.256G>A	14.37:g.103394811G>A	ENSP00000299155:p.Gly86Ser	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	103	43	0.417476	NM_030943	Q6UX83	Missense_Mutation	SNP	ENST00000299155.5	37	CCDS9977.1	.	.	.	.	.	.	.	.	.	.	G	6.859	0.527850	0.13127	.	.	ENSG00000166126	ENST00000299155;ENST00000541086	D	0.87887	-2.31	3.33	-3.8	0.04307	.	1.167550	0.06155	N	0.674896	T	0.67887	0.2941	N	0.11560	0.145	0.09310	N	1	B	0.22983	0.078	B	0.20384	0.029	T	0.59752	-0.7395	10	0.06099	T	0.92	-10.4145	5.7356	0.18065	0.2807:0.1937:0.5256:0.0	.	86	Q9BXJ7	AMNLS_HUMAN	S	86;32	ENSP00000299155:G86S	ENSP00000299155:G86S	G	+	1	0	AMN	102464564	0.000000	0.05858	0.063000	0.19743	0.325000	0.28411	-0.484000	0.06528	-0.663000	0.05331	-0.390000	0.06520	GGC	.	.	none		0.716	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415704.1		
MUC4	4585	hgsc.bcm.edu	37	3	195513589	195513589	+	Missense_Mutation	SNP	T	T	C	rs74192533		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195513589T>C	ENST00000463781.3	-	2	5321	c.4862A>G	c.(4861-4863)gAc>gGc	p.D1621G	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D1621G	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGTCGGTGACAGG	0.567																																					p.D1621G		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,2	MUC4	1505	2	0			c.A4862G						scavenged	.						18.0	22.0	21.0					3																	195513589		689	1567	2256	SO:0001583	missense	4585	exon2			GAAGTGTCGGTGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4862A>G	3.37:g.195513589T>C	ENSP00000417498:p.Asp1621Gly	Somatic	563	14	0.0248668		WXS	Illumina HiSeq	Phase_I	703	22	0.0312945	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.614	0.114180	0.08831	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35789	1.29;1.3	.	.	.	.	.	.	.	.	T	0.20618	0.0496	N	0.08118	0	0.09310	N	1	P	0.47409	0.895	P	0.48189	0.57	T	0.10870	-1.0611	7	.	.	.	.	4.5176	0.11943	0.0:7.0E-4:0.0:0.9993	.	1621	E7ESK3	.	G	1621	ENSP00000417498:D1621G;ENSP00000420243:D1621G	.	D	-	2	0	MUC4	196997984	0.000000	0.05858	0.015000	0.15790	0.015000	0.08874	-2.627000	0.00874	0.077000	0.16863	0.076000	0.15429	GAC	.	.	none		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ENPP7	339221	hgsc.bcm.edu	37	17	77709108	77709108	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:77709108C>T	ENST00000328313.5	+	3	887	c.666C>T	c.(664-666)acC>acT	p.T222T		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TGGACCGGACCGTGGGCTACC	0.657																																					p.T222T		Atlas-SNP	.											.	ENPP7	63	.	0			c.C666T						PASS	.						53.0	51.0	51.0					17																	77709108		2203	4300	6503	SO:0001819	synonymous_variant	339221	exon3			CCGGACCGTGGGC	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.666C>T	17.37:g.77709108C>T		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	41	17	0.414634	NM_178543		Silent	SNP	ENST00000328313.5	37	CCDS11763.1																																																																																			.	.	none		0.657	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543	
PTGER3	5733	hgsc.bcm.edu	37	1	71318536	71318536	+	3'UTR	SNP	A	A	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:71318536A>C	ENST00000370931.3	-	0	1413				PTGER3_ENST00000370932.2_Missense_Mutation_p.F362V|PTGER3_ENST00000351052.5_3'UTR|PTGER3_ENST00000460330.1_Missense_Mutation_p.F371V	NM_198714.1	NP_942007.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)						cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	TTTCCCCAAAATTCCTCCTGG	0.328																																					p.F371V		Atlas-SNP	.											PTGER3_ENST00000460330,NS,carcinoma,0,1	PTGER3	246	1	0			c.T1111G						PASS	.						131.0	146.0	141.0					1																	71318536		2203	4300	6503	SO:0001624	3_prime_UTR_variant	5733	exon4			CCCAAAATTCCTC	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000370931.3:c.*30T>G	1.37:g.71318536A>C		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	122	45	0.368852	NM_198716	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000370931.3	37	CCDS656.1	.	.	.	.	.	.	.	.	.	.	A	3.509	-0.100135	0.07010	.	.	ENSG00000050628	ENST00000370932;ENST00000460330	T;T	0.17370	2.28;2.5	2.92	1.79	0.24919	.	.	.	.	.	T	0.02494	0.0076	.	.	.	0.30139	N	0.804125	B;B	0.15141	0.012;0.012	B;B	0.19946	0.017;0.027	T	0.47156	-0.9139	8	0.17369	T	0.5	.	4.5446	0.12074	0.8453:0.0:0.1547:0.0	.	362;371	P43115-3;P43115-4	.;.	V	362;371	ENSP00000359970:F362V;ENSP00000418073:F371V	ENSP00000359970:F362V	F	-	1	0	PTGER3	71091124	0.128000	0.22383	0.482000	0.27366	0.272000	0.26649	0.026000	0.13599	0.528000	0.28580	0.377000	0.23210	TTT	.	.	none		0.328	PTGER3-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026077.1	NM_000957	
ITPRIPL1	150771	hgsc.bcm.edu	37	2	96993026	96993026	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:96993026C>T	ENST00000439118.2	+	3	908	c.657C>T	c.(655-657)atC>atT	p.I219I	ITPRIPL1_ENST00000542887.1_Silent_p.I211I|ITPRIPL1_ENST00000536814.1_Silent_p.I211I|ITPRIPL1_ENST00000361124.4_Silent_p.I227I	NM_001008949.2	NP_001008949.1	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 1	219						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GCCTGGGCATCGGGGCTGCCT	0.552																																					p.I227I		Atlas-SNP	.											ITPRIPL1,NS,carcinoma,0,1	ITPRIPL1	58	1	0			c.C681T						scavenged	.						55.0	57.0	56.0					2																	96993026		2203	4300	6503	SO:0001819	synonymous_variant	150771	exon1			GGGCATCGGGGCT		CCDS33250.1, CCDS46360.1, CCDS54378.1	2q11.2	2011-04-28	2011-04-28	2008-08-11	ENSG00000198885	ENSG00000198885			29371	protein-coding gene	gene with protein product			"""KIAA1754-like"", ""inositol 1,4,5-triphosphate receptor interacting protein-like 1"""	KIAA1754L		12477932	Standard	NM_178495		Approved		uc010yul.2	Q6GPH6	OTTHUMG00000155230	ENST00000439118.2:c.657C>T	2.37:g.96993026C>T		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	75	2	0.0266667	NM_178495	F5H1L8|Q8NE61	Silent	SNP	ENST00000439118.2	37	CCDS46360.1	.	.	.	.	.	.	.	.	.	.	C	4.994	0.184541	0.09495	.	.	ENSG00000198885	ENST00000420728	.	.	.	5.17	-9.56	0.00566	.	.	.	.	.	T	0.46190	0.1380	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54490	-0.8286	4	.	.	.	-4.0449	7.9069	0.29767	0.0824:0.1319:0.0773:0.7084	.	.	.	.	L	251	.	.	S	+	2	0	ITPRIPL1	96356753	0.004000	0.15560	0.634000	0.29324	0.992000	0.81027	-2.016000	0.01446	-1.643000	0.01519	-0.136000	0.14681	TCG	.	.	none		0.552	ITPRIPL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338896.1	NM_178495	
DDB2	1643	hgsc.bcm.edu	37	11	47259476	47259476	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:47259476C>T	ENST00000256996.4	+	8	1307	c.1112C>T	c.(1111-1113)aCg>aTg	p.T371M	DDB2_ENST00000378600.3_Missense_Mutation_p.T182M|DDB2_ENST00000378603.3_Missense_Mutation_p.T307M|DDB2_ENST00000378601.3_3'UTR|ACP2_ENST00000525230.1_5'Flank	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	371					DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						GAATTGAGGACGATCGACGTG	0.483			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.T371M		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	DDB2,NS,carcinoma,0,2	DDB2	31	2	0			c.C1112T						scavenged	.						121.0	112.0	115.0					11																	47259476		2201	4298	6499	SO:0001583	missense	1643	exon8	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	TGAGGACGATCGA		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.1112C>T	11.37:g.47259476C>T	ENSP00000256996:p.Thr371Met	Somatic	144	1	0.00694444		WXS	Illumina HiSeq	Phase_I	169	6	0.035503	NM_000107	B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Missense_Mutation	SNP	ENST00000256996.4	37	CCDS7927.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692522	0.88735	.	.	ENSG00000134574	ENST00000256996;ENST00000378603;ENST00000378600	T;T;T	0.69040	-0.35;-0.37;-0.22	6.08	6.08	0.98989	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82697	0.5093	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.994;1.0	T	0.82659	-0.0348	10	0.87932	D	0	-9.5278	20.6634	0.99662	0.0:1.0:0.0:0.0	.	307;182;371	Q92466-4;Q92466-2;Q92466	.;.;DDB2_HUMAN	M	371;307;182	ENSP00000256996:T371M;ENSP00000367866:T307M;ENSP00000367863:T182M	ENSP00000256996:T371M	T	+	2	0	DDB2	47216052	1.000000	0.71417	0.972000	0.41901	0.785000	0.44390	5.584000	0.67490	2.894000	0.99253	0.655000	0.94253	ACG	.	.	none		0.483	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000107	
PRDM7	11105	hgsc.bcm.edu	37	16	90126766	90126766	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:90126766T>C	ENST00000449207.2	-	9	1235	c.1216A>G	c.(1216-1218)Agc>Ggc	p.S406G	PRDM7_ENST00000325921.6_Intron|PRDM7_ENST00000407825.1_Intron	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	406					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		TGCCATGAGCTCTTTCTTCCA	0.463																																					p.S406G		Atlas-SNP	.											PRDM7_ENST00000449207,rectum,carcinoma,+2,1	PRDM7	53	1	0			c.A1216G						scavenged	.						95.0	98.0	97.0					16																	90126766		1902	4106	6008	SO:0001583	missense	11105	exon9			ATGAGCTCTTTCT	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.1216A>G	16.37:g.90126766T>C	ENSP00000396732:p.Ser406Gly	Somatic	294	0	0		WXS	Illumina HiSeq	Phase_I	175	5	0.0285714	NM_001098173	A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	ENST00000449207.2	37	CCDS45557.1	.	.	.	.	.	.	.	.	.	.	.	2.134	-0.398387	0.04865	.	.	ENSG00000126856	ENST00000449207	T	0.17691	2.26	2.23	0.846	0.18955	.	.	.	.	.	T	0.07728	0.0194	N	0.08118	0	0.21604	N	0.999627	B	0.32409	0.37	B	0.35688	0.208	T	0.37776	-0.9691	8	.	.	.	-2.6838	4.5243	0.11975	0.0:0.0:0.3449:0.6551	.	406	Q9NQW5	PRDM7_HUMAN	G	406	ENSP00000396732:S406G	.	S	-	1	0	PRDM7	88654267	0.064000	0.20934	0.318000	0.25279	0.103000	0.19146	0.283000	0.18846	0.999000	0.39023	0.397000	0.26171	AGC	.	.	none		0.463	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420560.1		
CCR1	1230	hgsc.bcm.edu	37	3	46245407	46245407	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:46245407A>G	ENST00000296140.3	-	2	523	c.398T>C	c.(397-399)cTg>cCg	p.L133P	CCR3_ENST00000357422.2_Intron	NM_001295.2	NP_001286.1	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	133					calcium ion transport (GO:0006816)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of osteoclast differentiation (GO:0045672)|response to wounding (GO:0009611)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine (C-C motif) ligand 7 binding (GO:0035717)|chemokine receptor activity (GO:0004950)|phosphatidylinositol phospholipase C activity (GO:0004435)			autonomic_ganglia(1)|large_intestine(6)|lung(6)|pancreas(1)|skin(3)	17				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GACGATGGCCAGGTACCTGTC	0.512																																					p.L133P		Atlas-SNP	.											CCR1,colon,carcinoma,0,1	CCR1	36	1	0			c.T398C						scavenged	.						84.0	80.0	81.0					3																	46245407		2203	4300	6503	SO:0001583	missense	1230	exon2			ATGGCCAGGTACC		CCDS2737.1	3p21	2012-08-08			ENSG00000163823	ENSG00000163823		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1602	protein-coding gene	gene with protein product		601159		SCYAR1, CMKBR1		7679328	Standard	NM_001295		Approved	CKR-1, MIP1aR, CD191	uc003cph.1	P32246	OTTHUMG00000133451	ENST00000296140.3:c.398T>C	3.37:g.46245407A>G	ENSP00000296140:p.Leu133Pro	Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	159	2	0.0125786	NM_001295	Q86VA9	Missense_Mutation	SNP	ENST00000296140.3	37	CCDS2737.1	.	.	.	.	.	.	.	.	.	.	A	19.66	3.868998	0.72065	.	.	ENSG00000163823	ENST00000296140	T	0.48201	0.82	4.86	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000083	T	0.81664	0.4870	H	0.99273	4.495	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89542	0.3793	10	0.87932	D	0	.	14.7717	0.69684	1.0:0.0:0.0:0.0	.	133	P32246	CCR1_HUMAN	P	133	ENSP00000296140:L133P	ENSP00000296140:L133P	L	-	2	0	CCR1	46220411	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.433000	0.80362	1.955000	0.56771	0.533000	0.62120	CTG	.	.	none		0.512	CCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257325.2	NM_001295	
KIF19	124602	hgsc.bcm.edu	37	17	72350412	72350412	+	Missense_Mutation	SNP	G	G	A	rs2271535	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:72350412G>A	ENST00000389916.4	+	18	2558	c.2420G>A	c.(2419-2421)cGc>cAc	p.R807H	AC103809.2_ENST00000599136.1_5'Flank	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	807			R -> H (in dbSNP:rs2271535).		ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GCGACAGAGCGCAGCAGCCTG	0.711													G|||	1718	0.343051	0.0756	0.4207	5008	,	,		13893	0.4008		0.4712	False		,,,				2504	0.4581				p.R807H		Atlas-SNP	.											KIF19,NS,carcinoma,0,1	KIF19	102	1	0			c.G2420A						scavenged	.	G	HIS/ARG	571,3475		68,435,1520	16.0	22.0	20.0		2420	1.8	1.0	17	dbSNP_100	20	3907,4455		949,2009,1223	yes	missense	KIF19	NM_153209.3	29	1017,2444,2743	AA,AG,GG		46.7233,14.1127,36.0896	possibly-damaging	807/999	72350412	4478,7930	2023	4181	6204	SO:0001583	missense	124602	exon18			CAGAGCGCAGCAG	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2420G>A	17.37:g.72350412G>A	ENSP00000374566:p.Arg807His	Somatic	4	1	0.25		WXS	Illumina HiSeq	Phase_I	14	5	0.357143	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	790	0.3617216117216117	40	0.08130081300813008	149	0.4116022099447514	242	0.4230769230769231	359	0.4736147757255937	G	12.77	2.036734	0.35893	0.141127	0.467233	ENSG00000196169	ENST00000389916	T	0.71817	-0.6	5.06	1.78	0.24846	.	.	.	.	.	T	0.00012	0.0000	L	0.54323	1.7	0.41050	P	0.014703000000000022	B	0.13594	0.008	B	0.06405	0.002	T	0.38351	-0.9665	8	0.37606	T	0.19	.	6.784	0.23664	0.2165:0.2365:0.547:0.0	rs2271535;rs58995647	807	Q2TAC6	KIF19_HUMAN	H	807	ENSP00000374566:R807H	ENSP00000374566:R807H	R	+	2	0	KIF19	69862007	1.000000	0.71417	0.967000	0.41034	0.417000	0.31264	1.286000	0.33273	1.141000	0.42275	0.556000	0.70494	CGC	G|0.631;A|0.369	0.369	strong		0.711	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
ATP6V0B	533	hgsc.bcm.edu	37	1	44442793	44442793	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:44442793G>A	ENST00000472174.2	+	7	889	c.496G>A	c.(496-498)Gat>Aat	p.D166N	ATP6V0B_ENST00000472277.1_3'UTR|ATP6V0B_ENST00000498664.1_Missense_Mutation_p.D119N|ATP6V0B_ENST00000471859.2_Missense_Mutation_p.D213N|ATP6V0B_ENST00000236067.4_Missense_Mutation_p.D119N|ATP6V0B_ENST00000532642.1_Missense_Mutation_p.D166N|B4GALT2_ENST00000356836.6_5'Flank|B4GALT2_ENST00000372324.1_5'Flank|B4GALT2_ENST00000434555.2_5'Flank|B4GALT2_ENST00000309519.7_5'Flank	NM_004047.3	NP_004038.1	Q99437	VATO_HUMAN	ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b	166					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuole (GO:0005773)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(2)|kidney(1)|large_intestine(3)|lung(3)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				TGCCCTGGCCGATGCTCAGAA	0.577																																					p.D166N		Atlas-SNP	.											ATP6V0B,NS,carcinoma,0,1	ATP6V0B	22	1	0			c.G496A						scavenged	.						77.0	80.0	79.0					1																	44442793		2203	4300	6503	SO:0001583	missense	533	exon7			CTGGCCGATGCTC	BC000423	CCDS505.1, CCDS41315.1, CCDS72772.1	1p32.3	2010-04-21	2006-01-20	2002-05-10	ENSG00000117410	ENSG00000117410		"""ATPases / V-type"""	861	protein-coding gene	gene with protein product		603717	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 21kD"", ""ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c''"""	ATP6F		9653649	Standard	XM_005270944		Approved	VMA16, HATPL	uc001cld.3	Q99437	OTTHUMG00000008298	ENST00000472174.2:c.496G>A	1.37:g.44442793G>A	ENSP00000431605:p.Asp166Asn	Somatic	218	0	0		WXS	Illumina HiSeq	Phase_I	243	4	0.0164609	NM_004047	D3DPY5|Q6IB32	Missense_Mutation	SNP	ENST00000472174.2	37	CCDS505.1	.	.	.	.	.	.	.	.	.	.	G	33	5.214019	0.95104	.	.	ENSG00000117410	ENST00000472174;ENST00000532642;ENST00000236067;ENST00000471859;ENST00000498664;ENST00000440531	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.1	5.1	0.69264	ATPase, F0/V0 complex, subunit C (3);	0.000000	0.85682	D	0.000000	T	0.65238	0.2672	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.989	T	0.62426	-0.6857	10	0.23302	T	0.38	-9.361	18.5145	0.90931	0.0:0.0:1.0:0.0	.	166;166	Q99437;E9PNL3	VATO_HUMAN;.	N	166;166;119;213;119;9	ENSP00000431605:D166N;ENSP00000434729:D166N;ENSP00000236067:D119N;ENSP00000432754:D213N;ENSP00000434094:D119N	ENSP00000236067:D119N	D	+	1	0	ATP6V0B	44215380	1.000000	0.71417	0.808000	0.32385	0.997000	0.91878	9.351000	0.97073	2.379000	0.81126	0.655000	0.94253	GAT	.	.	none		0.577	ATP6V0B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022854.2	NM_004047	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369951	65369951	+	Silent	SNP	A	A	G	rs2919359	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr15:65369951A>G	ENST00000432196.2	+	1	798	c.798A>G	c.(796-798)gaA>gaG	p.E266E	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	266					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						TCGGCGGCGAATTCCAGAGGA	0.731													g|||	4526	0.903754	0.9107	0.866	5008	,	,		11604	0.9831		0.8439	False		,,,				2504	0.9008				p.E266E		Atlas-SNP	.											.	KBTBD13	9	.	0			c.A798G						PASS	.			3216,294		1470,276,9	4.0	6.0	6.0		798	3.4	0.9	15	dbSNP_101	6	6735,1057		2913,909,74	no	coding-synonymous	KBTBD13	NM_001101362.2		4383,1185,83	GG,GA,AA		13.5652,8.3761,11.9536		266/459	65369951	9951,1351	1755	3896	5651	SO:0001819	synonymous_variant	390594	exon1			CGGCGAATTCCAG		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.798A>G	15.37:g.65369951A>G		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	8	8	1	NM_001101362		Silent	SNP	ENST00000432196.2	37	CCDS45281.1																																																																																			A|0.109;G|0.891	0.891	strong		0.731	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
ANKRD30A	91074	hgsc.bcm.edu	37	10	37486392	37486392	+	Silent	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:37486392A>G	ENST00000602533.1	+	29	2631	c.2532A>G	c.(2530-2532)gaA>gaG	p.E844E	ANKRD30A_ENST00000374660.1_Silent_p.E963E|ANKRD30A_ENST00000361713.1_Silent_p.E844E			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	900					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TGAAGAATGAACAAACATTGA	0.328																																					p.E844E		Atlas-SNP	.											ANKRD30A_ENST00000602533,NS,carcinoma,+2,2	ANKRD30A	448	2	0			c.A2532G						scavenged	.						106.0	94.0	98.0					10																	37486392		1814	4073	5887	SO:0001819	synonymous_variant	91074	exon29			GAATGAACAAACA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2532A>G	10.37:g.37486392A>G		Somatic	260	0	0		WXS	Illumina HiSeq	Phase_I	336	5	0.014881	NM_052997	Q5W025	Silent	SNP	ENST00000602533.1	37																																																																																				.	.	none		0.328	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
LILRB3	11025	hgsc.bcm.edu	37	19	54725980	54725980	+	Silent	SNP	G	G	A	rs150024950	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:54725980G>A	ENST00000391750.1	-	5	514	c.378C>T	c.(376-378)ctC>ctT	p.L126L	LILRB3_ENST00000424807.1_Silent_p.L126L|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRA6_ENST00000391735.3_Intron|LILRB3_ENST00000245620.9_Silent_p.L126L|LILRA6_ENST00000419410.2_Intron|LILRA6_ENST00000440558.2_Intron|LILRB3_ENST00000407860.2_Silent_p.L126L|LILRB3_ENST00000469273.1_5'Flank|LILRB3_ENST00000346401.6_Silent_p.L126L|LILRA6_ENST00000270464.5_Intron			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	126	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.L126L(1)		endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCAGGGCTGAGAGGGTGGGTT	0.582													.|||	570	0.113818	0.0507	0.1037	5008	,	,		13484	0.0486		0.1471	False		,,,				2504	0.2393				p.L126L		Atlas-SNP	.											LILRB3,NS,carcinoma,0,1	LILRB3	67	1	1	Substitution - coding silent(1)	kidney(1)	c.C378T						scavenged	.						55.0	36.0	42.0					19																	54725980		2117	3871	5988	SO:0001819	synonymous_variant	11025	exon4			GGCTGAGAGGGTG	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.378C>T	19.37:g.54725980G>A		Somatic	120	4	0.0333333		WXS	Illumina HiSeq	Phase_I	137	6	0.0437956	NM_006864	C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	ENST00000391750.1	37	CCDS33105.1																																																																																			G|0.947;A|0.053	0.053	strong		0.582	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
KCNN3	3782	hgsc.bcm.edu	37	1	154842244	154842244	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:154842244A>T	ENST00000271915.4	-	1	512	c.197T>A	c.(196-198)cTt>cAt	p.L66H	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ctgctgctgaagctgcggagg	0.701																																					p.L66H		Atlas-SNP	.											KCNN3,NS,carcinoma,+1,3	KCNN3	141	3	0			c.T197A						scavenged	.																																			SO:0001583	missense	3782	exon1			TGCTGAAGCTGCG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.197T>A	1.37:g.154842244A>T	ENSP00000271915:p.Leu66His	Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	40	13	0.325	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	37	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	a	9.986	1.229557	0.22542	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.58060	0.36	4.47	-1.06	0.10002	.	2.530250	0.01603	N	0.022141	T	0.17152	0.0412	N	0.08118	0	0.35103	D	0.765442	.	.	.	.	.	.	T	0.03807	-1.1002	8	0.72032	D	0.01	-1.1381	4.5154	0.11932	0.5982:0.0:0.2622:0.1396	.	.	.	.	H	66;161	ENSP00000271915:L66H	ENSP00000271915:L66H	L	-	2	0	KCNN3	153108868	0.001000	0.12720	0.839000	0.33178	0.980000	0.70556	0.019000	0.13444	0.013000	0.14918	0.460000	0.39030	CTT	.	.	none		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
HIVEP1	3096	hgsc.bcm.edu	37	6	12124727	12124727	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:12124727T>C	ENST00000379388.2	+	4	5031	c.4699T>C	c.(4699-4701)Ttc>Ctc	p.F1567L	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1567					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TTGTCAGGTTTTCACTTCAGG	0.413																																					p.F1567L		Atlas-SNP	.											HIVEP1,NS,carcinoma,-2,1	HIVEP1	242	1	0			c.T4699C						scavenged	.						147.0	139.0	141.0					6																	12124727		1908	4116	6024	SO:0001583	missense	3096	exon4			CAGGTTTTCACTT	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.4699T>C	6.37:g.12124727T>C	ENSP00000368698:p.Phe1567Leu	Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	192	4	0.0208333	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	T	4.944	0.175382	0.09391	.	.	ENSG00000095951	ENST00000379388	T	0.05786	3.39	5.92	-0.739	0.11120	.	0.221517	0.23252	N	0.050235	T	0.00815	0.0027	N	0.05230	-0.09	0.46185	D	0.998912	B	0.02656	0.0	B	0.01281	0.0	T	0.41910	-0.9482	9	.	.	.	-7.1625	6.1833	0.20484	0.0:0.2879:0.2484:0.4638	.	1567	P15822	ZEP1_HUMAN	L	1567	ENSP00000368698:F1567L	.	F	+	1	0	HIVEP1	12232713	0.349000	0.24870	0.137000	0.22149	0.973000	0.67179	0.849000	0.27723	0.167000	0.19631	0.533000	0.62120	TTC	.	.	none		0.413	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
TUFM	7284	hgsc.bcm.edu	37	16	28854369	28854369	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:28854369C>T	ENST00000313511.3	-	10	1433	c.1295G>A	c.(1294-1296)cGg>cAg	p.R432Q	MIR4721_ENST00000577590.1_RNA	NM_003321.4	NP_003312.3	P49411	EFTU_HUMAN	Tu translation elongation factor, mitochondrial	429					translational elongation (GO:0006414)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation elongation factor activity (GO:0003746)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13						GCCAATAGTCCGGTTGCCATC	0.542																																					p.R432Q		Atlas-SNP	.											TUFM,colon,carcinoma,-1,1	TUFM	33	1	0			c.G1295A						PASS	.						171.0	142.0	152.0					16																	28854369		2197	4300	6497	SO:0001583	missense	7284	exon10			ATAGTCCGGTTGC	L38995	CCDS10642.1	16p11.2	2010-10-26			ENSG00000178952	ENSG00000178952			12420	protein-coding gene	gene with protein product		602389				9332382, 9545647	Standard	NM_003321		Approved	EFTu, EF-TuMT, EFTU	uc002drh.2	P49411	OTTHUMG00000097039	ENST00000313511.3:c.1295G>A	16.37:g.28854369C>T	ENSP00000322439:p.Arg432Gln	Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	98	4	0.0408163	NM_003321	O15276	Missense_Mutation	SNP	ENST00000313511.3	37	CCDS10642.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.734727	0.48939	.	.	ENSG00000178952	ENST00000313511	T	0.73258	-0.73	4.92	2.46	0.29980	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation elongation factor EFTu/EF1A, C-terminal (1);	0.448187	0.22595	N	0.058034	T	0.57740	0.2074	L	0.38838	1.175	0.25971	N	0.982508	B	0.12013	0.005	B	0.10450	0.005	T	0.55438	-0.8141	10	0.87932	D	0	-5.2056	8.3795	0.32463	0.0:0.6754:0.0:0.3246	.	429	P49411	EFTU_HUMAN	Q	432	ENSP00000322439:R432Q	ENSP00000322439:R432Q	R	-	2	0	TUFM	28761870	0.522000	0.26266	1.000000	0.80357	0.871000	0.50021	0.842000	0.27627	0.870000	0.35726	0.655000	0.94253	CGG	.	.	none		0.542	TUFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214140.1	NM_003321	
SCN10A	6336	hgsc.bcm.edu	37	3	38739806	38739806	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:38739806C>T	ENST00000449082.2	-	27	4904	c.4905G>A	c.(4903-4905)gaG>gaA	p.E1635E		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1635					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CGATGCCAGCCTCCCACCTCA	0.557																																					p.E1635E		Atlas-SNP	.											SCN10A,bladder,carcinoma,-1,1	SCN10A	359	1	0			c.G4905A						scavenged	.						178.0	165.0	170.0					3																	38739806		2203	4300	6503	SO:0001819	synonymous_variant	6336	exon27			GCCAGCCTCCCAC	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.4905G>A	3.37:g.38739806C>T		Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	160	2	0.0125	NM_006514	A6NDQ1	Silent	SNP	ENST00000449082.2	37	CCDS33736.1																																																																																			.	.	none		0.557	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
OBSCN	84033	hgsc.bcm.edu	37	1	228522538	228522538	+	Silent	SNP	G	G	A	rs373968488		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:228522538G>A	ENST00000422127.1	+	61	16154	c.16110G>A	c.(16108-16110)ccG>ccA	p.P5370P	OBSCN_ENST00000570156.2_Silent_p.P6327P|OBSCN_ENST00000366709.4_Silent_p.P2489P|OBSCN_ENST00000366707.4_Silent_p.P3004P|OBSCN_ENST00000284548.11_Silent_p.P5370P	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5370					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGCTGGTGCCGCCCCGAATGC	0.617																																					p.P6327P		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G18981A						PASS	.	G	,	0,4092		0,0,2046	25.0	31.0	29.0		16110,16110	-6.5	1.0	1		29	1,8309		0,1,4154	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	0,1,6200	AA,AG,GG		0.012,0.0,0.0081	,	5370/7969,5370/6621	228522538	1,12401	2046	4155	6201	SO:0001819	synonymous_variant	84033	exon72			GGTGCCGCCCCGA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16110G>A	1.37:g.228522538G>A		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	42	32	0.761905	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			.	.	none		0.617	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
PCDHGB3	56102	hgsc.bcm.edu	37	5	140750729	140750729	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:140750729C>T	ENST00000576222.1	+	1	899	c.768C>T	c.(766-768)ccC>ccT	p.P256P	PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_5'Flank	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	256	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAACCTGCCCGCTGGCTCCT	0.478																																					p.P256P		Atlas-SNP	.											PCDHGB3_ENST00000576222,NS,carcinoma,+1,2	PCDHGB3	168	2	0			c.C768T						scavenged	.						73.0	79.0	77.0					5																	140750729		2105	4234	6339	SO:0001819	synonymous_variant	56102	exon1			CCTGCCCGCTGGC	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.768C>T	5.37:g.140750729C>T		Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	155	4	0.0258065	NM_018924	A7E229|Q9Y5C7	Silent	SNP	ENST00000576222.1	37	CCDS58980.1																																																																																			.	.	none		0.478	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
MSRB3	253827	hgsc.bcm.edu	37	12	65857048	65857048	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:65857048C>T	ENST00000355192.3	+	6	651	c.525C>T	c.(523-525)gcC>gcT	p.A175A	MSRB3_ENST00000308259.5_Silent_p.A168A|MSRB3_ENST00000535664.1_Silent_p.A168A	NM_198080.3	NP_932346.1	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3	175					protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		GTGGCACCGCCGAGGGAGGCA	0.527																																					p.A175A		Atlas-SNP	.											MSRB3_ENST00000355192,colon,carcinoma,+2,4	MSRB3	80	4	0			c.C525T						PASS	.						68.0	63.0	65.0					12																	65857048		2203	4300	6503	SO:0001819	synonymous_variant	253827	exon6			CACCGCCGAGGGA	BX640871	CCDS8973.1, CCDS31853.1	12q14.3	2011-11-29			ENSG00000174099	ENSG00000174099			27375	protein-coding gene	gene with protein product		613719	"""deafness, autosomal recessive 74"""	DFNB74		21185009	Standard	NM_198080		Approved	FLJ36866, DKFZp686C1178	uc021qzy.1	Q8IXL7	OTTHUMG00000168866	ENST00000355192.3:c.525C>T	12.37:g.65857048C>T		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	190	55	0.289474	NM_198080	B4DR19|B7ZAQ0|Q6UXS2	Silent	SNP	ENST00000355192.3	37	CCDS8973.1																																																																																			.	.	none		0.527	MSRB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401421.1	NM_198080	
NRG2	9542	hgsc.bcm.edu	37	5	139260442	139260442	+	Splice_Site	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:139260442G>A	ENST00000361474.1	-	3	1214	c.990C>T	c.(988-990)agC>agT	p.S330S	NRG2_ENST00000545385.1_Splice_Site_p.S330S|NRG2_ENST00000541337.1_Splice_Site_p.S330S|NRG2_ENST00000394770.1_Splice_Site_p.S330S|NRG2_ENST00000518130.1_5'UTR|NRG2_ENST00000340391.3_Splice_Site_p.S127S|NRG2_ENST00000289422.7_Splice_Site_p.S330S|NRG2_ENST00000289409.4_Splice_Site_p.S330S|NRG2_ENST00000358522.3_Splice_Site_p.S330S	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	330	Ig-like C2-type.|Ser/Thr-rich.				embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.S330S(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCACCTACCGCTGTTGACGT	0.642																																					p.S330S		Atlas-SNP	.											NRG2,NS,carcinoma,0,1	NRG2	69	1	1	Substitution - coding silent(1)	stomach(1)	c.C990T						PASS	.						75.0	78.0	77.0					5																	139260442		2203	4300	6503	SO:0001630	splice_region_variant	9542	exon3			CCTACCGCTGTTG		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.991+1C>T	5.37:g.139260442G>A		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	86	26	0.302326	NM_013982		Silent	SNP	ENST00000361474.1	37	CCDS4217.1																																																																																			.	.	none		0.642	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	Silent
RHPN2	85415	hgsc.bcm.edu	37	19	33493842	33493842	+	Missense_Mutation	SNP	C	C	A	rs137892450	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:33493842C>A	ENST00000254260.3	-	8	860	c.825G>T	c.(823-825)atG>atT	p.M275I	RHPN2_ENST00000400226.4_Missense_Mutation_p.M124I	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	275	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GCACGCTGAGCATGGCAGGGC	0.448																																					p.M275I		Atlas-SNP	.											RHPN2,NS,neuroblastoma,0,1	RHPN2	107	1	0			c.G825T						scavenged	.						54.0	49.0	50.0					19																	33493842		2203	4300	6503	SO:0001583	missense	85415	exon8			GCTGAGCATGGCA	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.825G>T	19.37:g.33493842C>A	ENSP00000254260:p.Met275Ile	Somatic	100	4	0.04		WXS	Illumina HiSeq	Phase_I	111	4	0.036036	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.524256	0.64747	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.16324	2.35;2.35	4.9	4.9	0.64082	BRO1 domain (3);	0.035852	0.85682	D	0.000000	T	0.23370	0.0565	M	0.72576	2.205	0.80722	D	1	P	0.41475	0.751	B	0.36959	0.237	T	0.07158	-1.0787	10	0.44086	T	0.13	-4.5596	18.4946	0.90860	0.0:1.0:0.0:0.0	.	275	Q8IUC4	RHPN2_HUMAN	I	275;5;124	ENSP00000254260:M275I;ENSP00000402244:M124I	ENSP00000254260:M275I	M	-	3	0	RHPN2	38185682	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.752000	0.85141	2.432000	0.82394	0.478000	0.44815	ATG	A|0.000;C|0.999;T|0.000	0.000	strong		0.448	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
DMBT1	1755	hgsc.bcm.edu	37	10	124358568	124358568	+	Missense_Mutation	SNP	T	T	A	rs201802690		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:124358568T>A	ENST00000338354.3	+	26	3341	c.3235T>A	c.(3235-3237)Tcc>Acc	p.S1079T	DMBT1_ENST00000344338.3_Missense_Mutation_p.S1069T|DMBT1_ENST00000368955.3_Missense_Mutation_p.S1069T|DMBT1_ENST00000368909.3_Missense_Mutation_p.S1079T|DMBT1_ENST00000330163.4_Missense_Mutation_p.S580T|DMBT1_ENST00000368956.2_Missense_Mutation_p.S580T|DMBT1_ENST00000359586.6_Intron			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1079	SRCR 8. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGGCTGGCTCTCCCACAACTG	0.572																																					p.S1079T	Ovarian(182;93 2026 18125 22222 38972)	Atlas-SNP	.											DMBT1_ENST00000368915,NS,carcinoma,0,3	DMBT1	677	3	0			c.T3235A						scavenged	.						101.0	96.0	98.0					10																	124358568		1929	4141	6070	SO:0001583	missense	1755	exon26			TGGCTCTCCCACA		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.3235T>A	10.37:g.124358568T>A	ENSP00000342210:p.Ser1079Thr	Somatic	184	2	0.0108696		WXS	Illumina HiSeq	Phase_I	224	14	0.0625	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	T	8.702	0.909917	0.17833	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94	3.57	-6.98	0.01611	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.838313	0.10030	N	0.724884	T	0.30541	0.0768	L	0.27944	0.81	0.09310	N	1	B;D;B;B;B	0.57257	0.167;0.979;0.107;0.0;0.0	B;P;B;B;B	0.56563	0.087;0.801;0.023;0.001;0.001	T	0.20605	-1.0270	10	0.13853	T	0.58	.	4.1715	0.10332	0.6029:0.0791:0.1583:0.1597	.	586;1079;580;1069;1079	Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	T	1079;1079;1079;1079;1079;1079;580;1069;580;580;1079;1069;580	ENSP00000342210:S1079T;ENSP00000343175:S1069T;ENSP00000327747:S580T;ENSP00000357905:S1079T;ENSP00000357951:S1069T;ENSP00000357952:S580T	ENSP00000331522:S580T	S	+	1	0	DMBT1	124348558	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-5.877000	0.00093	-0.959000	0.03618	-0.386000	0.06593	TCC	.	.	weak		0.572	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
LEFTY2	7044	hgsc.bcm.edu	37	1	226127479	226127479	+	Silent	SNP	G	G	A	rs188858500	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:226127479G>A	ENST00000366820.5	-	2	822	c.474C>T	c.(472-474)aaC>aaT	p.N158N	RP4-559A3.6_ENST00000513672.1_RNA|LEFTY2_ENST00000474493.1_5'UTR|LEFTY2_ENST00000420304.2_Silent_p.N124N	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	158					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					GGGAGGTGCGGTTGGAGCCGT	0.776													G|||	32	0.00638978	0.0	0.0014	5008	,	,		12140	0.0298		0.0	False		,,,				2504	0.001				p.N158N	Colon(172;116 2643 9098 43333)	Atlas-SNP	.											.	LEFTY2	25	.	0			c.C474T						PASS	.						3.0	5.0	4.0					1																	226127479		1604	3499	5103	SO:0001819	synonymous_variant	7044	exon2			GGTGCGGTTGGAG	U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.474C>T	1.37:g.226127479G>A		Somatic	1	0	0		WXS	Illumina HiSeq	Phase_I	14	12	0.857143	NM_003240	B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Silent	SNP	ENST00000366820.5	37	CCDS1549.1																																																																																			G|0.990;A|0.010	0.010	strong		0.776	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091152.1	NM_003240	
ATF7	11016	hgsc.bcm.edu	37	12	53911012	53911012	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:53911012A>G	ENST00000548446.2	-	12	1506	c.1394T>C	c.(1393-1395)cTc>cCc	p.L465P	ATF7_ENST00000546661.1_5'UTR|ATF7_ENST00000420353.2_Missense_Mutation_p.L454P|ATF7_ENST00000456903.4_Missense_Mutation_p.L454P|RP11-793H13.10_ENST00000591834.1_Intron|ATF7_ENST00000328463.7_Missense_Mutation_p.L465P|ATF7_ENST00000415113.1_Missense_Mutation_p.L433P|RP11-793H13.3_ENST00000548347.1_RNA			P17544	ATF7_HUMAN	activating transcription factor 7	465	Essential for binding adenovirus 2 E1A.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	CATCTGAGTGAGGACCGAGGT	0.577																																					p.L454P		Atlas-SNP	.											.	ATF7	51	.	0			c.T1361C						PASS	.						103.0	104.0	104.0					12																	53911012		2075	4205	6280	SO:0001583	missense	11016	exon12			TGAGTGAGGACCG	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.1394T>C	12.37:g.53911012A>G	ENSP00000449938:p.Leu465Pro	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	147	7	0.047619	NM_006856	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	ENST00000548446.2	37		.	.	.	.	.	.	.	.	.	.	A	20.8	4.045077	0.75846	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000306727;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.57107	0.42;0.42;0.58;0.43;0.43	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.63522	0.2518	L	0.41710	1.295	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.993;0.999	T	0.66999	-0.5781	10	0.87932	D	0	-16.28	13.4618	0.61231	1.0:0.0:0.0:0.0	.	433;454;465	P17544-2;B2RMP1;P17544	.;.;ATF7_HUMAN	P	465;465;278;433;454;454	ENSP00000449938:L465P;ENSP00000329212:L465P;ENSP00000404880:L433P;ENSP00000399465:L454P;ENSP00000387406:L454P	ENSP00000304187:L278P	L	-	2	0	ATF7	52197279	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.366000	0.90111	2.087000	0.62958	0.454000	0.30748	CTC	.	.	none		0.577	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2	NM_001130059	
MYH4	4622	hgsc.bcm.edu	37	17	10369672	10369672	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:10369672T>C	ENST00000255381.2	-	4	376	c.266A>G	c.(265-267)gAg>gGg	p.E89G	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	89	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GGCCATGTCCTCGATCTTGTC	0.443																																					p.E89G		Atlas-SNP	.											MYH4,caecum,carcinoma,-1,1	MYH4	349	1	0			c.A266G						scavenged	.						263.0	229.0	241.0					17																	10369672		2203	4300	6503	SO:0001583	missense	4622	exon4			ATGTCCTCGATCT		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.266A>G	17.37:g.10369672T>C	ENSP00000255381:p.Glu89Gly	Somatic	294	0	0		WXS	Illumina HiSeq	Phase_I	195	4	0.0205128	NM_017533		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.895249	0.91962	.	.	ENSG00000141048;ENSG00000125414	ENST00000255381;ENST00000532288	T	0.73469	-0.75	4.74	4.74	0.60224	Myosin head, motor domain (2);	0.000000	0.37761	U	0.001951	D	0.88081	0.6341	M	0.90082	3.085	0.80722	D	1	D	0.67145	0.996	D	0.76575	0.988	D	0.90709	0.4626	10	0.87932	D	0	.	14.6752	0.68975	0.0:0.0:0.0:1.0	.	89	Q9Y623	MYH4_HUMAN	G	89	ENSP00000255381:E89G	ENSP00000431873:E89G	E	-	2	0	MYH2;MYH4	10310397	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.761000	0.85260	2.107000	0.64212	0.528000	0.53228	GAG	.	.	none		0.443	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
HNRNPL	3191	hgsc.bcm.edu	37	19	39330801	39330801	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:39330801C>G	ENST00000221419.5	-	8	1534	c.1168G>C	c.(1168-1170)Gat>Cat	p.D390H	AC104534.3_ENST00000594769.1_Missense_Mutation_p.W6C|HNRNPL_ENST00000600873.1_Missense_Mutation_p.D257H	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	390	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)	p.D390H(1)|p.D257H(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			TTAGATTGATCCAAGCCATAG	0.597																																					p.D390H		Atlas-SNP	.											HNRPL,NS,carcinoma,0,7	HNRNPL	67	7	2	Substitution - Missense(2)	lung(2)	c.G1168C						scavenged	.																																			SO:0001583	missense	3191	exon8			ATTGATCCAAGCC	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1168G>C	19.37:g.39330801C>G	ENSP00000221419:p.Asp390His	Somatic	167	6	0.0359281		WXS	Illumina HiSeq	Phase_I	208	5	0.0240385	NM_001533	A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	ENST00000221419.5	37	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524652	0.64747	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	T	0.44881	0.91	5.72	5.72	0.89469	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.042814	0.85682	D	0.000000	T	0.53562	0.1804	L	0.41492	1.28	0.80722	D	1	D;B;D	0.89917	0.985;0.093;1.0	P;B;D	0.63703	0.541;0.019;0.917	T	0.34551	-0.9824	10	0.20519	T	0.43	.	18.6604	0.91470	0.0:1.0:0.0:0.0	.	390;257;373	P14866;A6NIT8;Q6NTA2	HNRPL_HUMAN;.;.	H	390;257;257	ENSP00000221419:D390H	ENSP00000221419:D390H	D	-	1	0	HNRNPL	44022641	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.749000	0.68704	2.709000	0.92574	0.555000	0.69702	GAT	.	.	none		0.597	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
IFITM3	10410	hgsc.bcm.edu	37	11	320723	320723	+	Missense_Mutation	SNP	C	C	T	rs199582787	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:320723C>T	ENST00000399808.4	-	1	327	c.91G>A	c.(91-93)Gtg>Atg	p.V31M	RP11-326C3.11_ENST00000508004.2_RNA|RP11-326C3.11_ENST00000602756.1_RNA|IFITM3_ENST00000526811.1_Missense_Mutation_p.V10M|RP11-326C3.11_ENST00000602429.1_RNA|RP11-326C3.14_ENST00000602809.1_lincRNA|RP11-326C3.10_ENST00000534271.1_RNA|IFITM3_ENST00000602735.1_Missense_Mutation_p.V10M	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	31					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCCCCAGCACAGCCACCTCG	0.612																																					p.V31M		Atlas-SNP	.											IFITM3,brain,glioma,0,1	IFITM3	132	1	0			c.G91A						scavenged	.						87.0	98.0	95.0					11																	320723		1967	4140	6107	SO:0001583	missense	10410	exon1			CCAGCACAGCCAC	X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.91G>A	11.37:g.320723C>T	ENSP00000382707:p.Val31Met	Somatic	53	1	0.0188679		WXS	Illumina HiSeq	Phase_I	86	4	0.0465116	NM_021034	Q53Y76|Q96HK8|Q96J15	Missense_Mutation	SNP	ENST00000399808.4	37	CCDS41585.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526447	0.27299	.	.	ENSG00000142089	ENST00000399808;ENST00000270031;ENST00000526811	T;T	0.79454	-1.03;-1.27	4.61	-4.91	0.03085	.	11.488500	0.02440	N	0.084490	T	0.64516	0.2605	L	0.39147	1.195	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.46400	-0.9194	10	0.13108	T	0.6	0.9022	6.4601	0.21952	0.1231:0.361:0.0:0.5159	.	31	Q01628	IFM3_HUMAN	M	31;15;10	ENSP00000382707:V31M;ENSP00000432108:V10M	ENSP00000372047:V15M	V	-	1	0	IFITM3	310723	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.638000	0.02013	-0.562000	0.06086	-1.790000	0.00627	GTG	.	.	weak		0.612	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384765.1	NM_021034	
HOMEZ	57594	hgsc.bcm.edu	37	14	23744829	23744829	+	Silent	SNP	C	C	T	rs79723196|rs35076736|rs67447855	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:23744829C>T	ENST00000357460.5	-	2	1772	c.1608G>A	c.(1606-1608)gaG>gaA	p.E536E	HOMEZ_ENST00000561013.1_Silent_p.E538E|HOMEZ_ENST00000431326.2_Silent_p.E538E	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	536	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		catcatcttcctcctcctcct	0.483													C|||	22	0.00439297	0.0045	0.0058	5008	,	,		18800	0.001		0.0099	False		,,,				2504	0.001				p.E536E		Atlas-SNP	.											.	HOMEZ	80	.	0			c.G1608A						PASS	.						32.0	32.0	32.0					14																	23744829		2132	4146	6278	SO:0001819	synonymous_variant	57594	exon2			ATCTTCCTCCTCC	AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.1608G>A	14.37:g.23744829C>T		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	108	18	0.166667	NM_020834	A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Silent	SNP	ENST00000357460.5	37	CCDS45085.1																																																																																			.	.	weak		0.483	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000416939.2	NM_020834	
AOX1	316	hgsc.bcm.edu	37	2	201457926	201457926	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:201457926C>T	ENST00000374700.2	+	2	344	c.103C>T	c.(103-105)Ctt>Ttt	p.L35F		NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	35	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)	p.L35F(1)		breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GAGGAAGAAGCGTATCCTTTT	0.328																																					p.L35F		Atlas-SNP	.											AOX1,caecum,carcinoma,0,1	AOX1	152	1	1	Substitution - Missense(1)	large_intestine(1)	c.C103T						scavenged	.						282.0	239.0	253.0					2																	201457926		2203	4300	6503	SO:0001630	splice_region_variant	316	exon2			AAGAAGCGTATCC	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.103+1C>T	2.37:g.201457926C>T		Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	237	4	0.0168776	NM_001159	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.881333	0.51801	.	.	ENSG00000138356	ENST00000374700;ENST00000454629	T;T	0.58940	1.45;0.3	5.22	3.43	0.39272	Beta-grasp fold, ferredoxin-type (1);Ferredoxin (3);	0.156801	0.42821	N	0.000651	T	0.58424	0.2121	M	0.76727	2.345	0.54753	D	0.999981	B	0.25772	0.134	B	0.30782	0.12	T	0.60188	-0.7312	10	0.87932	D	0	-5.2863	10.7283	0.46081	0.0:0.8429:0.0:0.1571	.	35	Q06278	ADO_HUMAN	F	35;10	ENSP00000363832:L35F;ENSP00000392485:L10F	ENSP00000363832:L35F	L	+	1	0	AOX1	201166171	0.865000	0.29922	0.456000	0.27044	0.987000	0.75469	1.034000	0.30204	0.776000	0.33473	0.591000	0.81541	CTT	.	.	none		0.328	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	Missense_Mutation
OR5R1	219479	hgsc.bcm.edu	37	11	56185039	56185039	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:56185039C>T	ENST00000312253.1	-	1	669	c.670G>A	c.(670-672)Gct>Act	p.A224T		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					CTTAGGATAGCGGCAATAATA	0.443																																					p.A224T		Atlas-SNP	.											OR5R1,NS,carcinoma,0,1	OR5R1	83	1	0			c.G670A						scavenged	.						121.0	109.0	113.0					11																	56185039		2201	4296	6497	SO:0001583	missense	219479	exon1			GGATAGCGGCAAT	AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.670G>A	11.37:g.56185039C>T	ENSP00000308595:p.Ala224Thr	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	200	2	0.01	NM_001004744		Missense_Mutation	SNP	ENST00000312253.1	37	CCDS31530.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.725524	0.30593	.	.	ENSG00000174942	ENST00000312253	T	0.00188	8.59	5.53	3.66	0.41972	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32608	U	0.005877	T	0.00144	0.0004	N	0.25060	0.705	0.09310	N	1	B	0.29531	0.247	B	0.31191	0.125	T	0.15407	-1.0438	10	0.23302	T	0.38	-7.8759	9.7227	0.40313	0.0:0.7777:0.0:0.2223	.	224	Q8NH85	OR5R1_HUMAN	T	224	ENSP00000308595:A224T	ENSP00000308595:A224T	A	-	1	0	OR5R1	55941615	0.000000	0.05858	0.417000	0.26559	0.745000	0.42441	-0.383000	0.07398	1.339000	0.45563	0.579000	0.79373	GCT	.	.	none		0.443	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334444.1	NM_001004744	
NIPBL	25836	hgsc.bcm.edu	37	5	37045655	37045655	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:37045655C>T	ENST00000282516.8	+	37	6953	c.6454C>T	c.(6454-6456)Cgg>Tgg	p.R2152W	NIPBL_ENST00000448238.2_Missense_Mutation_p.R2152W	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2152					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AGCACTATGTCGGCATTTTGA	0.358																																					p.R2152W		Atlas-SNP	.											NIPBL_ENST00000448238,NS,carcinoma,-1,2	NIPBL	513	2	0			c.C6454T						scavenged	.						208.0	214.0	212.0					5																	37045655		2203	4300	6503	SO:0001583	missense	25836	exon37			CTATGTCGGCATT	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6454C>T	5.37:g.37045655C>T	ENSP00000282516:p.Arg2152Trp	Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	231	3	0.012987	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.378568	0.82682	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	T;T	0.66995	-0.24;-0.24	5.52	4.64	0.57946	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81465	0.4828	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84343	0.0528	10	0.87932	D	0	-7.466	15.901	0.79377	0.1366:0.8634:0.0:0.0	.	2152;2152	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	W	2152	ENSP00000282516:R2152W;ENSP00000406266:R2152W	ENSP00000282516:R2152W	R	+	1	2	NIPBL	37081412	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.383000	0.59600	1.428000	0.47296	0.557000	0.71058	CGG	.	.	none		0.358	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
EYS	346007	hgsc.bcm.edu	37	6	65612316	65612316	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:65612316C>A	ENST00000370621.3	-	17	3245	c.2719G>T	c.(2719-2721)Gat>Tat	p.D907Y	EYS_ENST00000370616.2_Missense_Mutation_p.D907Y|EYS_ENST00000503581.1_Missense_Mutation_p.D907Y			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	907	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TTGACCATATCTTCACAGTCA	0.333																																					p.D907Y		Atlas-SNP	.											EYS_ENST00000370621,NS,carcinoma,+2,1	EYS	527	1	0			c.G2719T						PASS	.						151.0	125.0	133.0					6																	65612316		692	1591	2283	SO:0001583	missense	346007	exon17			CCATATCTTCACA		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2719G>T	6.37:g.65612316C>A	ENSP00000359655:p.Asp907Tyr	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	98	43	0.438776	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	C	5.293	0.239526	0.10023	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.95656	-3.77;-3.77;-3.77	4.36	1.38	0.22167	.	.	.	.	.	D	0.93099	0.7803	M	0.94142	3.5	0.80722	D	1	B	0.18741	0.03	B	0.23419	0.046	D	0.88285	0.2939	9	0.87932	D	0	.	4.268	0.10773	0.1613:0.5952:0.156:0.0876	.	907	Q5T1H1-1	.	Y	907	ENSP00000424243:D907Y;ENSP00000359655:D907Y;ENSP00000359650:D907Y	ENSP00000359650:D907Y	D	-	1	0	EYS	65669037	1.000000	0.71417	0.010000	0.14722	0.116000	0.19942	2.134000	0.42102	0.034000	0.15491	-0.218000	0.12543	GAT	.	.	none		0.333	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
ZNF326	284695	hgsc.bcm.edu	37	1	90487882	90487882	+	Missense_Mutation	SNP	C	C	T	rs572409353		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:90487882C>T	ENST00000340281.4	+	11	1522	c.1379C>T	c.(1378-1380)gCg>gTg	p.A460V	ZNF326_ENST00000455342.2_Missense_Mutation_p.A254V|ZNF326_ENST00000370447.3_Missense_Mutation_p.A371V	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	460					mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)	p.A460V(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		ATAGTGAAGGCGCGATATGAA	0.323																																					p.A460V		Atlas-SNP	.											ZNF326,caecum,carcinoma,0,1	ZNF326	60	1	1	Substitution - Missense(1)	large_intestine(1)	c.C1379T						scavenged	.						198.0	219.0	212.0					1																	90487882		2203	4299	6502	SO:0001583	missense	284695	exon11			TGAAGGCGCGATA	BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.1379C>T	1.37:g.90487882C>T	ENSP00000340796:p.Ala460Val	Somatic	205	1	0.00487805		WXS	Illumina HiSeq	Phase_I	225	4	0.0177778	NM_182976	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Missense_Mutation	SNP	ENST00000340281.4	37	CCDS727.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603313	0.66445	.	.	ENSG00000162664	ENST00000394590;ENST00000340281;ENST00000370447;ENST00000455342	T;T;T	0.23147	1.92;1.92;1.92	5.26	4.35	0.52113	.	0.126175	0.52532	D	0.000067	T	0.12347	0.0300	L	0.44542	1.39	0.42777	D	0.993859	B;B	0.17268	0.021;0.008	B;B	0.12156	0.007;0.007	T	0.03545	-1.1026	10	0.51188	T	0.08	-2.7662	14.1345	0.65279	0.0:0.9269:0.0:0.073	.	460;460	A8MYX1;Q5BKZ1	.;ZN326_HUMAN	V	460;460;371;254	ENSP00000340796:A460V;ENSP00000359476:A371V;ENSP00000403470:A254V	ENSP00000340796:A460V	A	+	2	0	ZNF326	90260470	0.995000	0.38212	0.736000	0.30914	0.911000	0.54048	3.350000	0.52224	1.347000	0.45714	-0.229000	0.12294	GCG	.	.	none		0.323	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	
RAPH1	65059	hgsc.bcm.edu	37	2	204304225	204304225	+	Silent	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:204304225G>T	ENST00000319170.5	-	14	3987	c.3688C>A	c.(3688-3690)Cgg>Agg	p.R1230R	RAPH1_ENST00000457812.1_Intron|RAPH1_ENST00000374493.3_Silent_p.R1282R|ABI2_ENST00000295851.5_3'UTR	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	1230					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGTCCTCTCCGCAACGTTGCA	0.507																																					p.R1230R		Atlas-SNP	.											.	RAPH1	118	.	0			c.C3688A						PASS	.						85.0	81.0	83.0					2																	204304225		2203	4300	6503	SO:0001819	synonymous_variant	65059	exon14			CTCTCCGCAACGT	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.3688C>A	2.37:g.204304225G>T		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	87	4	0.045977	NM_213589	Q96Q37|Q9C0I2	Silent	SNP	ENST00000319170.5	37	CCDS2359.1																																																																																			.	.	none		0.507	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
ANKRD30B	374860	hgsc.bcm.edu	37	18	14848786	14848786	+	Missense_Mutation	SNP	A	A	C	rs368096733		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr18:14848786A>C	ENST00000358984.4	+	34	3076	c.2896A>C	c.(2896-2898)Aac>Cac	p.N966H		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	966								p.N966H(1)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TAAAAAAGATAACTGTGAACA	0.328																																					p.N966H		Atlas-SNP	.											ANKRD30B_ENST00000358984,trunk,malignant_melanoma,0,1	ANKRD30B	237	1	1	Substitution - Missense(1)	skin(1)	c.A2896C						scavenged	.						52.0	37.0	42.0					18																	14848786		692	1587	2279	SO:0001583	missense	374860	exon34			AAAGATAACTGTG	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2896A>C	18.37:g.14848786A>C	ENSP00000351875:p.Asn966His	Somatic	159	6	0.0377358		WXS	Illumina HiSeq	Phase_I	229	10	0.0436681	NM_001145029	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	0.001	-4.292239	0.00001	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.15603	2.41	1.48	-0.543	0.11851	.	.	.	.	.	T	0.03915	0.0110	N	0.01250	-0.93	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39702	-0.9601	9	0.02654	T	1	.	5.2623	0.15580	0.3861:0.4355:0.1784:0.0	.	1051;966	Q9BXX2;F8WAG3	AN30B_HUMAN;.	H	966;360;386	ENSP00000351875:N966H	ENSP00000277669:N386H	N	+	1	0	ANKRD30B	14838786	0.002000	0.14202	0.004000	0.12327	0.010000	0.07245	0.367000	0.20382	-0.650000	0.05423	-3.655000	0.00026	AAC	A|0.500;C|0.500	0.500	weak		0.328	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
MUC4	4585	hgsc.bcm.edu	37	3	195511051	195511051	+	Missense_Mutation	SNP	C	C	A	rs74867514		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195511051C>A	ENST00000463781.3	-	2	7859	c.7400G>T	c.(7399-7401)gGc>gTc	p.G2467V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.G2467V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.G2467V(3)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGTGTCGGTGCCAGGAAGAGG	0.582																																					p.G2467V		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,+1,5	MUC4	1505	5	3	Substitution - Missense(3)	stomach(2)|endometrium(1)	c.G7400T						scavenged	.						36.0	33.0	34.0					3																	195511051		657	1587	2244	SO:0001583	missense	4585	exon2			TCGGTGCCAGGAA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7400G>T	3.37:g.195511051C>A	ENSP00000417498:p.Gly2467Val	Somatic	352	28	0.0795455		WXS	Illumina HiSeq	Phase_I	418	38	0.0909091	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	A	4.251	0.045673	0.08196	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.27890	1.64;1.7	.	.	.	.	.	.	.	.	T	0.10121	0.0248	N	0.02539	-0.55	0.23765	N	0.996904	B	0.09022	0.002	B	0.01281	0.0	T	0.36237	-0.9756	7	.	.	.	.	5.8178	0.18506	0.0:0.999:0.0:0.001	.	2467	E7ESK3	.	V	2467	ENSP00000417498:G2467V;ENSP00000420243:G2467V	.	G	-	2	0	MUC4	196995446	0.001000	0.12720	0.021000	0.16686	0.000000	0.00434	-2.888000	0.00711	-0.000000	0.14550	0.000000	0.15137	GGC	C|0.500;A|0.500	0.500	weak		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
BTG1	694	hgsc.bcm.edu	37	12	92538187	92538187	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:92538187C>T	ENST00000256015.3	-	2	546	c.185G>A	c.(184-186)tGc>tAc	p.C62Y	RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000551563.2_5'Flank|C12orf79_ENST00000546975.1_5'Flank|C12orf79_ENST00000551843.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|C12orf79_ENST00000549802.1_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	62					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CGATCCCTTGCATGGCTTTTC	0.463			T	MYC	BCLL						OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C62Y		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	.	BTG1	30	.	0			c.G185A						PASS	.						119.0	120.0	120.0					12																	92538187		2203	4300	6503	SO:0001583	missense	694	exon2			CCCTTGCATGGCT		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.185G>A	12.37:g.92538187C>T	ENSP00000256015:p.Cys62Tyr	Somatic	118	0	0	1291	WXS	Illumina HiSeq	Phase_I	131	39	0.29771	NM_001731	P31607	Missense_Mutation	SNP	ENST00000256015.3	37	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.081433	0.36758	.	.	ENSG00000133639	ENST00000256015	T	0.22336	1.96	5.81	5.81	0.92471	Anti-proliferative protein (4);	0.139437	0.64402	D	0.000002	T	0.16128	0.0388	L	0.39085	1.19	0.51482	D	0.999929	B	0.06786	0.001	B	0.13407	0.009	T	0.04565	-1.0942	10	0.02654	T	1	-4.1118	15.5494	0.76137	0.0:0.8627:0.1373:0.0	.	62	P62324	BTG1_HUMAN	Y	62	ENSP00000256015:C62Y	ENSP00000256015:C62Y	C	-	2	0	BTG1	91062318	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.537000	0.60643	2.738000	0.93877	0.655000	0.94253	TGC	.	.	none		0.463	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
PSG2	5670	hgsc.bcm.edu	37	19	43585253	43585253	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:43585253C>T	ENST00000406487.1	-	2	308	c.210G>A	c.(208-210)ggG>ggA	p.G70G	PSG2_ENST00000491995.1_5'Flank	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	70	Ig-like V-type.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.G70G(2)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				CCCTGATTTGCCCTTTGTACC	0.433																																					p.G70G		Atlas-SNP	.											PSG2,NS,carcinoma,0,2	PSG2	84	2	2	Substitution - coding silent(2)	prostate(2)	c.G210A						scavenged	.						92.0	96.0	94.0					19																	43585253		2201	4285	6486	SO:0001819	synonymous_variant	5670	exon2			GATTTGCCCTTTG		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.210G>A	19.37:g.43585253C>T		Somatic	218	7	0.0321101		WXS	Illumina HiSeq	Phase_I	245	13	0.0530612	NM_031246	Q8TCD9|Q9UEA4|Q9UQ78	Silent	SNP	ENST00000406487.1	37	CCDS12616.1																																																																																			.	.	none		0.433	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
VARS2	57176	hgsc.bcm.edu	37	6	30893890	30893890	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:30893890C>T	ENST00000321897.5	+	29	3727	c.3095C>T	c.(3094-3096)tCt>tTt	p.S1032F	VARS2_ENST00000416670.2_Missense_Mutation_p.S1032F|VARS2_ENST00000541562.1_Missense_Mutation_p.S1062F|VARS2_ENST00000542001.1_Missense_Mutation_p.S892F|VARS2_ENST00000476162.1_3'UTR			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	1032					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						GTCCAGCTTTCTTCCCTCCAG	0.617																																					p.S1062F		Atlas-SNP	.											.	VARS2	60	.	0			c.C3185T						PASS	.						63.0	65.0	64.0					6																	30893890		1510	2709	4219	SO:0001583	missense	57176	exon30			AGCTTTCTTCCCT	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.3095C>T	6.37:g.30893890C>T	ENSP00000316092:p.Ser1032Phe	Somatic	263	0	0		WXS	Illumina HiSeq	Phase_I	307	128	0.416938	NM_001167734	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461584	0.63513	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.48241	0.1489	M	0.70595	2.14	0.37604	D	0.920671	D;D;D;D	0.76494	0.983;0.998;0.999;0.998	P;D;D;D	0.85130	0.837;0.994;0.997;0.994	T	0.50448	-0.8827	10	0.72032	D	0.01	-21.6103	15.561	0.76244	0.0:1.0:0.0:0.0	.	470;1030;1062;1032	Q5ST30-2;B7ZL25;F5GXJ0;Q5ST30	.;.;.;SYVM_HUMAN	F	1032;1032;892;1062	ENSP00000316092:S1032F;ENSP00000394802:S1032F;ENSP00000438200:S892F;ENSP00000441000:S1062F	ENSP00000316092:S1032F	S	+	2	0	VARS2	31001869	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	3.549000	0.53681	2.755000	0.94549	0.655000	0.94253	TCT	.	.	none		0.617	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
DNASE1L3	1776	hgsc.bcm.edu	37	3	58190568	58190568	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:58190568C>T	ENST00000394549.2	-	4	677	c.361G>A	c.(361-363)Gac>Aac	p.D121N	DNASE1L3_ENST00000483681.1_Missense_Mutation_p.D121N|DNASE1L3_ENST00000486455.1_Missense_Mutation_p.D91N|DNASE1L3_ENST00000318316.3_Missense_Mutation_p.D121N	NM_004944.3	NP_004935.1	Q13609	DNSL3_HUMAN	deoxyribonuclease I-like 3	121					apoptotic DNA fragmentation (GO:0006309)|developmental programmed cell death (GO:0010623)|DNA metabolic process (GO:0006259)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			breast(2)|large_intestine(4)|lung(6)	12				BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)		TCCTGATAGTCATGGTAGTGA	0.488																																					p.D121N	Esophageal Squamous(96;1069 1424 4841 43466 52325)	Atlas-SNP	.											DNASE1L3,NS,carcinoma,0,2	DNASE1L3	36	2	0			c.G361A						scavenged	.						128.0	115.0	119.0					3																	58190568		2203	4300	6503	SO:0001583	missense	1776	exon4			GATAGTCATGGTA	AF047354	CCDS2886.1, CCDS58836.1	3p14.3	2008-05-15			ENSG00000163687	ENSG00000163687			2959	protein-coding gene	gene with protein product	"""DNase gamma"""	602244				9205125, 9714828, 14646506	Standard	NM_004944		Approved	DNAS1L3, LSD	uc003djo.2	Q13609	OTTHUMG00000159153	ENST00000394549.2:c.361G>A	3.37:g.58190568C>T	ENSP00000378053:p.Asp121Asn	Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	157	3	0.0191083	NM_004944	B2R8B1|B7Z707|O75803	Missense_Mutation	SNP	ENST00000394549.2	37	CCDS2886.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.332469	0.60853	.	.	ENSG00000163687	ENST00000486455;ENST00000450710;ENST00000318316;ENST00000483681;ENST00000394549;ENST00000461914	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61	5.81	5.81	0.92471	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	T	0.79299	0.4422	H	0.94620	3.56	0.53005	D	0.999965	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.84379	0.0548	10	0.87932	D	0	.	20.0628	0.97684	0.0:1.0:0.0:0.0	.	91;121;121	B7Z707;E9PES0;Q13609	.;.;DNSL3_HUMAN	N	91;121;121;121;121;121	ENSP00000419052:D91N;ENSP00000316193:D121N;ENSP00000417047:D121N;ENSP00000378053:D121N;ENSP00000418113:D121N	ENSP00000316193:D121N	D	-	1	0	DNASE1L3	58165608	1.000000	0.71417	0.999000	0.59377	0.041000	0.13682	7.349000	0.79376	2.745000	0.94114	0.655000	0.94253	GAC	.	.	none		0.488	DNASE1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353533.1	NM_004944	
TMEM198	130612	hgsc.bcm.edu	37	2	220413913	220413913	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:220413913G>A	ENST00000344458.2	+	5	1367	c.782G>A	c.(781-783)cGg>cAg	p.R261Q	TMEM198_ENST00000373883.3_Missense_Mutation_p.R261Q|RP11-256I23.1_ENST00000596829.1_RNA|MIR3132_ENST00000581997.1_RNA			Q66K66	TM198_HUMAN	transmembrane protein 198	261	Arg-rich.				multicellular organismal development (GO:0007275)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	16		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CAACTGATGCGGATTCGGCAG	0.637																																					p.R261Q		Atlas-SNP	.											TMEM198,NS,carcinoma,+1,2	TMEM198	36	2	0			c.G782A						scavenged	.						91.0	98.0	95.0					2																	220413913		2203	4300	6503	SO:0001583	missense	130612	exon4			TGATGCGGATTCG	BC068567	CCDS33385.1	2q35	2011-12-06			ENSG00000188760	ENSG00000188760			33704	protein-coding gene	gene with protein product							Standard	NM_001005209		Approved	MGC99813, TMEM198A	uc002vmf.3	Q66K66	OTTHUMG00000059156	ENST00000344458.2:c.782G>A	2.37:g.220413913G>A	ENSP00000343507:p.Arg261Gln	Somatic	216	0	0		WXS	Illumina HiSeq	Phase_I	215	3	0.0139535	NM_001005209		Missense_Mutation	SNP	ENST00000344458.2	37	CCDS33385.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194315	0.78902	.	.	ENSG00000188760	ENST00000344458;ENST00000373883	.	.	.	4.53	4.53	0.55603	.	0.067851	0.56097	D	0.000021	T	0.36220	0.0959	L	0.38175	1.15	0.31278	N	0.690932	D	0.64830	0.994	P	0.45913	0.497	T	0.44267	-0.9339	9	0.48119	T	0.1	-24.8191	11.0316	0.47776	0.0869:0.0:0.9131:0.0	.	261	Q66K66	TM198_HUMAN	Q	261	.	ENSP00000343507:R261Q	R	+	2	0	TMEM198	220122157	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.593000	0.74100	2.521000	0.84997	0.561000	0.74099	CGG	.	.	none		0.637	TMEM198-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131063.1	NM_001005209	
HGS	9146	hgsc.bcm.edu	37	17	79668552	79668552	+	Silent	SNP	C	C	T	rs34897798	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:79668552C>T	ENST00000329138.4	+	22	2373	c.2238C>T	c.(2236-2238)ggC>ggT	p.G746G	SLC25A10_ENST00000571730.1_5'Flank|SLC25A10_ENST00000541223.1_5'Flank|RP13-1032I1.7_ENST00000575312.1_RNA|MRPL12_ENST00000333676.3_5'Flank	NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	746	Gln-rich.|Interaction with NF2.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.G746G(1)		endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			CACCCTCTGGCGGTCCCCCCC	0.682													C|||	449	0.0896565	0.0318	0.0432	5008	,	,		14780	0.2222		0.0696	False		,,,				2504	0.0849				p.G746G		Atlas-SNP	.											HGS,NS,carcinoma,0,1	HGS	54	1	1	Substitution - coding silent(1)	prostate(1)	c.C2238T						PASS	.	C		124,4184		0,124,2030	15.0	13.0	14.0		2238	-8.2	0.0	17	dbSNP_126	14	479,8003		11,457,3773	no	coding-synonymous	HGS	NM_004712.4		11,581,5803	TT,TC,CC		5.6473,2.8784,4.7146		746/778	79668552	603,12187	2154	4241	6395	SO:0001819	synonymous_variant	9146	exon22			CTCTGGCGGTCCC	D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.2238C>T	17.37:g.79668552C>T		Somatic	3	0	0		WXS	Illumina HiSeq	Phase_I	19	15	0.789474	NM_004712	Q9NR36	Silent	SNP	ENST00000329138.4	37	CCDS11784.1																																																																																			C|0.900;T|0.100	0.100	strong		0.682	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440541.1	NM_004712	
MTUS2	23281	hgsc.bcm.edu	37	13	29608098	29608098	+	Missense_Mutation	SNP	G	G	A	rs376698099		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr13:29608098G>A	ENST00000431530.3	+	2	2370	c.2312G>A	c.(2311-2313)cGg>cAg	p.R771Q		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	761	Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						ACTTTCTATCGGTCAGCCATG	0.458																																					p.R771Q		Atlas-SNP	.											MTUS2_ENST00000431530,NS,carcinoma,+1,2	MTUS2	279	2	0			c.G2312A						scavenged	.	G	GLN/ARG	1,3965		0,1,1982	89.0	86.0	87.0		2312	5.5	0.5	13		87	0,8330		0,0,4165	no	missense	MTUS2	NM_001033602.2	43	0,1,6147	AA,AG,GG		0.0,0.0252,0.0081	probably-damaging	771/1380	29608098	1,12295	1983	4165	6148	SO:0001583	missense	23281	exon2			TCTATCGGTCAGC	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2312G>A	13.37:g.29608098G>A	ENSP00000392057:p.Arg771Gln	Somatic	190	1	0.00526316		WXS	Illumina HiSeq	Phase_I	256	3	0.0117188	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701527	0.88924	2.52E-4	0.0	ENSG00000132938	ENST00000431530	T	0.44083	0.93	5.46	5.46	0.80206	.	0.000000	0.56097	D	0.000022	T	0.65144	0.2663	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64162	-0.6472	9	.	.	.	.	18.2952	0.90143	0.0:0.0:1.0:0.0	.	761	Q5JR59	MTUS2_HUMAN	Q	771	ENSP00000392057:R771Q	.	R	+	2	0	MTUS2	28506098	1.000000	0.71417	0.513000	0.27749	0.936000	0.57629	6.981000	0.76166	2.543000	0.85770	0.655000	0.94253	CGG	.	.	weak		0.458	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
BMP15	9210	hgsc.bcm.edu	37	X	50659280	50659280	+	Silent	SNP	C	C	T	rs17003221	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chrX:50659280C>T	ENST00000252677.3	+	2	852	c.852C>T	c.(850-852)agC>agT	p.S284S		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	284					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					CAAAACATAGCGGGCCTGAAA	0.527													t|||	694	0.183841	0.3918	0.0591	3775	,	,		11819	0.0615		0.003	False		,,,				2504	0.0716				p.S284S		Atlas-SNP	.											.	BMP15	62	.	0			c.C852T						PASS	.	T		1730,2105		341,793,255,498,316	90.0	77.0	81.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	852	-2.8	0.0	X	dbSNP_123	81	37,6690		0,30,7,2398,1864	no	coding-synonymous	BMP15	NM_005448.2		341,823,262,2896,2180	TT,TC,T,CC,C		0.55,45.1108,16.7298		284/393	50659280	1767,8795	2203	4299	6502	SO:0001819	synonymous_variant	9210	exon2			ACATAGCGGGCCT	AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.852C>T	X.37:g.50659280C>T		Somatic	167	1	0.00598802		WXS	Illumina HiSeq	Phase_I	201	168	0.835821	NM_005448	Q17RM6|Q5JST1|Q9UMS1	Silent	SNP	ENST00000252677.3	37	CCDS14334.1																																																																																			C|0.811;0|0.015	.	strong		0.527	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448	
ZBTB22	9278	hgsc.bcm.edu	37	6	33283277	33283277	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:33283277C>G	ENST00000431845.2	-	2	1568	c.1417G>C	c.(1417-1419)Gtc>Ctc	p.V473L	ZBTB22_ENST00000418724.1_Missense_Mutation_p.V473L|TAPBP_ENST00000456592.2_5'Flank|TAPBP_ENST00000489157.1_5'Flank|TAPBP_ENST00000434618.2_5'Flank|TAPBP_ENST00000475304.1_5'Flank|TAPBP_ENST00000426633.2_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						CCTCCAGGGACCCCACCAACG	0.642																																					p.V473L		Atlas-SNP	.											.	ZBTB22	48	.	0			c.G1417C						PASS	.						131.0	145.0	141.0					6																	33283277		2203	4300	6503	SO:0001583	missense	9278	exon2			CAGGGACCCCACC	Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.1417G>C	6.37:g.33283277C>G	ENSP00000407545:p.Val473Leu	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	78	35	0.448718	NM_001145338	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Missense_Mutation	SNP	ENST00000431845.2	37	CCDS4775.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.332545	0.00227	.	.	ENSG00000236104	ENST00000418724;ENST00000431845	T;T	0.04970	3.52;3.52	4.11	-1.01	0.10169	.	1.112010	0.07113	N	0.842560	T	0.00998	0.0033	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48246	-0.9052	10	0.27082	T	0.32	.	8.6065	0.33775	0.0:0.3929:0.0:0.6071	.	473	O15209	ZBT22_HUMAN	L	473	ENSP00000404403:V473L;ENSP00000407545:V473L	ENSP00000404403:V473L	V	-	1	0	ZBTB22	33391255	0.000000	0.05858	0.011000	0.14972	0.025000	0.11179	-0.980000	0.03770	-0.115000	0.11915	0.448000	0.29417	GTC	.	.	none		0.642	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076183.2		
SLC22A4	6583	hgsc.bcm.edu	37	5	131630691	131630691	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:131630691G>A	ENST00000200652.3	+	1	556	c.382G>A	c.(382-384)Gtc>Atc	p.V128I	P4HA2_ENST00000471826.1_Intron	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	128					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	CCTGTCCACCGTCGTGACCGA	0.706																																					p.V128I		Atlas-SNP	.											SLC22A4,NS,carcinoma,-2,1	SLC22A4	45	1	0			c.G382A						scavenged	.						16.0	20.0	18.0					5																	131630691		2186	4271	6457	SO:0001583	missense	6583	exon1			TCCACCGTCGTGA	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.382G>A	5.37:g.131630691G>A	ENSP00000200652:p.Val128Ile	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	124	3	0.0241935	NM_003059	O14546	Missense_Mutation	SNP	ENST00000200652.3	37	CCDS4153.1	.	.	.	.	.	.	.	.	.	.	G	4.305	0.055893	0.08291	.	.	ENSG00000197208	ENST00000200652	T	0.72394	-0.65	4.61	3.36	0.38483	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.114836	0.56097	N	0.000028	T	0.28034	0.0691	N	0.00280	-1.71	0.35384	D	0.790137	B	0.09022	0.002	B	0.13407	0.009	T	0.44128	-0.9348	10	0.02654	T	1	.	9.0762	0.36522	0.9012:0.0:0.0988:0.0	.	128	Q9H015	S22A4_HUMAN	I	128	ENSP00000200652:V128I	ENSP00000200652:V128I	V	+	1	0	SLC22A4	131658590	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	3.706000	0.54830	0.810000	0.34279	-0.345000	0.07892	GTC	.	.	none		0.706	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059	
SMO	6608	hgsc.bcm.edu	37	7	128846041	128846041	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:128846041C>T	ENST00000249373.3	+	5	1251	c.971C>T	c.(970-972)gCc>gTc	p.A324V		NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	324					adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	GTGTACTACGCCCTGATGGCT	0.562			Mis		skin basal cell																																p.A324V		Atlas-SNP	.		Dom	yes		7	7q31-q32	6608	smoothened homolog (Drosophila)		E	SMO,bile_duct,carcinoma,+1,4	SMO	145	4	0			c.C971T						scavenged	.						335.0	279.0	298.0					7																	128846041		2203	4300	6503	SO:0001583	missense	6608	exon5			ACTACGCCCTGAT	U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.971C>T	7.37:g.128846041C>T	ENSP00000249373:p.Ala324Val	Somatic	346	0	0		WXS	Illumina HiSeq	Phase_I	370	4	0.0108108	NM_005631	A4D1K5	Missense_Mutation	SNP	ENST00000249373.3	37	CCDS5811.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.162365	0.38217	.	.	ENSG00000128602	ENST00000249373	D	0.81739	-1.53	5.54	4.66	0.58398	GPCR, family 2-like (1);	0.213831	0.49916	D	0.000133	T	0.71550	0.3353	N	0.22421	0.69	0.41172	D	0.986173	B	0.25441	0.126	B	0.31946	0.138	T	0.68849	-0.5300	10	0.44086	T	0.13	.	13.2067	0.59800	0.1593:0.8407:0.0:0.0	.	324	Q99835	SMO_HUMAN	V	324	ENSP00000249373:A324V	ENSP00000249373:A324V	A	+	2	0	SMO	128633277	1.000000	0.71417	0.994000	0.49952	0.273000	0.26683	7.783000	0.85696	1.319000	0.45190	-0.324000	0.08512	GCC	.	.	none		0.562	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350986.1	NM_005631	
METTL13	51603	hgsc.bcm.edu	37	1	171759644	171759644	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:171759644G>A	ENST00000361735.3	+	5	1628	c.1362G>A	c.(1360-1362)gaG>gaA	p.E454E	METTL13_ENST00000367737.5_Silent_p.E298E|METTL13_ENST00000362019.3_Silent_p.E368E|METTL13_ENST00000458517.1_Silent_p.E453E|METTL13_ENST00000466643.1_Intron	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	454							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						CTGATGCGGAGGACCTCCCTG	0.537																																					p.E454E		Atlas-SNP	.											METTL13,middle_lobe,carcinoma,+2,1	METTL13	67	1	0			c.G1362A						scavenged	.						99.0	94.0	96.0					1																	171759644		2203	4300	6503	SO:0001819	synonymous_variant	51603	exon5			TGCGGAGGACCTC	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1362G>A	1.37:g.171759644G>A		Somatic	271	4	0.0147601		WXS	Illumina HiSeq	Phase_I	300	3	0.01	NM_015935	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Silent	SNP	ENST00000361735.3	37	CCDS1299.1																																																																																			.	.	none		0.537	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084528.5	NM_014955	
MUC4	4585	hgsc.bcm.edu	37	3	195506569	195506569	+	Missense_Mutation	SNP	A	A	G	rs201891747	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195506569A>G	ENST00000463781.3	-	2	12341	c.11882T>C	c.(11881-11883)gTa>gCa	p.V3961A	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V3961A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAGT	0.592													.|||	988	0.197284	0.1755	0.2075	5008	,	,		8418	0.0804		0.336	False		,,,				2504	0.1973				p.V3961A		Atlas-SNP	.											MUC4_ENST00000463781,NS,lymphoid_neoplasm,0,1	MUC4	1505	1	0			c.T11882C						scavenged	.						17.0	11.0	13.0					3																	195506569		677	1513	2190	SO:0001583	missense	4585	exon2			GTGGATACTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11882T>C	3.37:g.195506569A>G	ENSP00000417498:p.Val3961Ala	Somatic	35	23	0.657143		WXS	Illumina HiSeq	Phase_I	49	26	0.530612	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	0.974	-0.699236	0.03279	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.36;1.3	.	.	.	.	.	.	.	.	T	0.16642	0.0400	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.18935	-1.0321	7	.	.	.	6.9246	3.9397	0.09321	0.6657:0.0:0.3343:0.0	.	3833	E7ESK3	.	A	3961	ENSP00000417498:V3961A;ENSP00000420243:V3961A	.	V	-	2	0	MUC4	196991348	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-4.523000	0.00221	-2.036000	0.00922	-2.094000	0.00368	GTA	.	.	weak		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ACIN1	22985	hgsc.bcm.edu	37	14	23548787	23548787	+	Missense_Mutation	SNP	C	C	T	rs55838227|rs34870944|rs61741619	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:23548787C>T	ENST00000262710.1	-	6	2258	c.1931G>A	c.(1930-1932)cGt>cAt	p.R644H	ACIN1_ENST00000457657.1_Missense_Mutation_p.R604H|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000605057.1_Missense_Mutation_p.R586H|ACIN1_ENST00000555053.1_Missense_Mutation_p.R644H	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	644	Ser-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S643_R644insHS(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TGAACGAGAACGTGAACGTGA	0.488																																					p.R644H		Atlas-SNP	.											.	ACIN1	147	.	1	Insertion - In frame(1)	upper_aerodigestive_tract(1)	c.G1931A						PASS	.						255.0	224.0	235.0					14																	23548787		2203	4300	6503	SO:0001583	missense	22985	exon6			CGAGAACGTGAAC	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1931G>A	14.37:g.23548787C>T	ENSP00000262710:p.Arg644His	Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	198	34	0.171717	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061864	0.76187	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.30448	2.29;1.53;2.29	5.46	5.46	0.80206	.	0.000000	0.41001	D	0.000979	T	0.42720	0.1215	L	0.27053	0.805	0.36352	D	0.86012	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79784	0.993;0.984;0.984	T	0.50808	-0.8784	10	0.59425	D	0.04	-1.7144	14.8141	0.70017	0.0:1.0:0.0:0.0	.	644;644;604	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	H	644;604;644	ENSP00000262710:R644H;ENSP00000405677:R604H;ENSP00000451328:R644H	ENSP00000262710:R644H	R	-	2	0	ACIN1	22618627	0.999000	0.42202	1.000000	0.80357	0.906000	0.53458	1.398000	0.34554	2.556000	0.86216	0.655000	0.94253	CGT	C|0.985;T|0.015	0.015	strong		0.488	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
SMPD2	6610	hgsc.bcm.edu	37	6	109764054	109764054	+	Silent	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:109764054T>C	ENST00000258052.3	+	7	950	c.591T>C	c.(589-591)ctT>ctC	p.L197L	PPIL6_ENST00000440797.2_5'Flank|PPIL6_ENST00000521072.2_5'Flank|PPIL6_ENST00000424445.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	197					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		GGACAGGGCTTCATGATGCCT	0.552																																					p.L197L		Atlas-SNP	.											SMPD2,NS,carcinoma,+2,1	SMPD2	25	1	0			c.T591C						scavenged	.						166.0	128.0	141.0					6																	109764054		2203	4300	6503	SO:0001819	synonymous_variant	6610	exon7			AGGGCTTCATGAT	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.591T>C	6.37:g.109764054T>C		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	81	2	0.0246914	NM_003080	Q5TED1|Q9BWR3	Silent	SNP	ENST00000258052.3	37	CCDS5075.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.934335	0.00488	.	.	ENSG00000135587	ENST00000458487	.	.	.	5.43	-1.0	0.10196	.	.	.	.	.	T	0.20981	0.0505	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	T	0.28427	-1.0044	4	.	.	.	-11.6778	0.3184	0.00299	0.2239:0.2264:0.2194:0.3302	.	.	.	.	S	94	.	.	F	+	2	0	SMPD2	109870747	0.000000	0.05858	0.002000	0.10522	0.047000	0.14425	-0.554000	0.06006	-0.672000	0.05266	-3.170000	0.00057	TTC	.	.	none		0.552	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041755.1		
CCNY	219771	hgsc.bcm.edu	37	10	35819129	35819129	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:35819129C>T	ENST00000374704.4	+	7	717	c.537C>T	c.(535-537)ttC>ttT	p.F179F	CCNY_ENST00000374706.1_Silent_p.F125F|CCNY_ENST00000492478.1_3'UTR|CCNY_ENST00000265375.9_Silent_p.F125F|CCNY_ENST00000339497.5_Silent_p.F154F	NM_145012.4	NP_659449.3	Q8ND76	CCNY_HUMAN	cyclin Y	179	Cyclin N-terminal.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	8						GGACACTGTTCAGTGCTGCTC	0.547																																					p.F179F		Atlas-SNP	.											CCNY,NS,carcinoma,0,1	CCNY	22	1	0			c.C537T						scavenged	.						114.0	80.0	91.0					10																	35819129		2203	4300	6503	SO:0001819	synonymous_variant	219771	exon7			ACTGTTCAGTGCT	AF413522, AY504868	CCDS7189.1, CCDS7190.1, CCDS60513.1	10p11.22	2011-01-25	2007-02-09	2007-02-09	ENSG00000108100	ENSG00000108100			23354	protein-coding gene	gene with protein product		612786	"""chromosome 10 open reading frame 9"""	C10orf9		20441050	Standard	XM_005252388		Approved	CFP1, CBCP1	uc001iyw.4	Q8ND76	OTTHUMG00000017955	ENST00000374704.4:c.537C>T	10.37:g.35819129C>T		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	100	2	0.02	NM_145012	B7ZKX9|D3DRY9|Q2M3V4|Q2TU96|Q6NT86|Q7Z4U7|Q8TEX2|Q8TEX3|Q96M99|Q96P45	Silent	SNP	ENST00000374704.4	37	CCDS7189.1																																																																																			.	.	none		0.547	CCNY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047568.2	NM_181698	
AHCTF1	25909	hgsc.bcm.edu	37	1	247014689	247014689	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:247014689A>G	ENST00000391829.2	-	33	4742	c.4619T>C	c.(4618-4620)cTt>cCt	p.L1540P	AHCTF1_ENST00000366508.1_Missense_Mutation_p.L1575P|AHCTF1_ENST00000326225.3_Missense_Mutation_p.L1549P|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1540	Disordered. {ECO:0000250}.|Mediates transcriptional activity. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ATTAAATGAAAGATTCCTAGC	0.328																																					p.L1549P	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											AHCTF1,NS,carcinoma,-1,2	AHCTF1	187	2	0			c.T4646C						scavenged	.						29.0	30.0	30.0					1																	247014689		2200	4296	6496	SO:0001583	missense	25909	exon33			AATGAAAGATTCC		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4619T>C	1.37:g.247014689A>G	ENSP00000375705:p.Leu1540Pro	Somatic	223	1	0.00448431		WXS	Illumina HiSeq	Phase_I	272	6	0.0220588	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37		.	.	.	.	.	.	.	.	.	.	A	11.66	1.704201	0.30232	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.35973	1.28;1.29;1.29	6.17	2.54	0.30619	.	0.483231	0.21226	N	0.078066	T	0.32102	0.0818	M	0.66939	2.045	0.33733	D	0.618492	B;B;B	0.24368	0.102;0.058;0.034	B;B;B	0.25759	0.063;0.022;0.01	T	0.29274	-1.0017	10	0.30078	T	0.28	-2.4389	5.8391	0.18623	0.595:0.2614:0.1436:0.0	.	401;1575;1540	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	P	1575;1549;1540	ENSP00000355464:L1575P;ENSP00000355465:L1549P;ENSP00000375705:L1540P	ENSP00000355465:L1549P	L	-	2	0	AHCTF1	245081312	0.993000	0.37304	0.275000	0.24674	0.648000	0.38561	2.576000	0.46033	0.178000	0.19917	0.533000	0.62120	CTT	.	.	none		0.328	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
CDC27	996	hgsc.bcm.edu	37	17	45234300	45234300	+	Missense_Mutation	SNP	G	G	T	rs199588670		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:45234300G>T	ENST00000066544.3	-	7	914	c.821C>A	c.(820-822)gCt>gAt	p.A274D	CDC27_ENST00000531206.1_Missense_Mutation_p.A274D|CDC27_ENST00000527547.1_Missense_Mutation_p.A274D|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Missense_Mutation_p.A213D	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	274					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.A274D(11)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGGACTAAGAGCTGCTGGTCC	0.363																																					p.A274D		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,0,10	CDC27	337	10	11	Substitution - Missense(11)	prostate(9)|skin(2)	c.C821A						scavenged	.						61.0	65.0	63.0					17																	45234300		2201	4292	6493	SO:0001583	missense	996	exon7			CTAAGAGCTGCTG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.821C>A	17.37:g.45234300G>T	ENSP00000066544:p.Ala274Asp	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	56	3	0.0535714	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604295	0.66445	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.69175	-0.38;-0.38;-0.13;-0.38;0.68	5.64	5.64	0.86602	.	0.058237	0.64402	D	0.000002	T	0.64735	0.2625	N	0.24115	0.695	0.58432	D	0.999999	P;P;P;B	0.51351	0.704;0.886;0.944;0.363	B;P;P;B	0.51615	0.216;0.495;0.675;0.143	T	0.64685	-0.6349	10	0.40728	T	0.16	-20.3108	17.2083	0.86924	0.0:0.0:1.0:0.0	.	213;274;274;274	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	D	274;274;213;274;274	ENSP00000066544:A274D;ENSP00000434614:A274D;ENSP00000392802:A213D;ENSP00000437339:A274D;ENSP00000432105:A274D	ENSP00000066544:A274D	A	-	2	0	CDC27	42589299	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.260000	0.95568	2.665000	0.90641	0.460000	0.39030	GCT	.	.	weak		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
APEH	327	hgsc.bcm.edu	37	3	49723296	49723296	+	IGR	SNP	G	G	A	rs2087733	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:49723296G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000383728.3_3'UTR|MST1_ENST00000449682.2_Missense_Mutation_p.P416L|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'Flank	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.P402L(4)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GACTCACTGCGGCTTGTGCGG	0.677													G|||	3	0.000599042	0.0	0.0	5008	,	,		23747	0.0		0.003	False		,,,				2504	0.0				p.P416L		Atlas-SNP	.											MST1,trunk,malignant_melanoma,0,3	MST1	84	3	4	Substitution - Missense(4)	NS(2)|lung(1)|skin(1)	c.C1247T						scavenged	.						67.0	64.0	65.0					3																	49723296		2197	4282	6479	SO:0001628	intergenic_variant	4485	exon10			CACTGCGGCTTGT	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723296G>A		Somatic	175	8	0.0457143		WXS	Illumina HiSeq	Phase_I	187	6	0.0320856	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117796	0.37339	.	.	ENSG00000173531	ENST00000449682	T	0.66280	-0.2	5.1	5.1	0.69264	.	0.000000	0.42053	D	0.000772	T	0.52980	0.1768	L	0.33137	0.985	0.80722	D	1	B	0.18013	0.025	B	0.17979	0.02	T	0.48969	-0.8987	10	0.38643	T	0.18	.	16.2918	0.82756	0.0:0.0:1.0:0.0	rs2087733	416	G3XAK1	.	L	416	ENSP00000414287:P416L	ENSP00000414287:P416L	P	-	2	0	MST1	49698300	1.000000	0.71417	0.996000	0.52242	0.047000	0.14425	8.980000	0.93460	2.373000	0.80994	0.561000	0.74099	CCG	G|0.375;A|0.625	0.625	strong		0.677	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
TEX15	56154	hgsc.bcm.edu	37	8	30701914	30701914	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:30701914C>T	ENST00000256246.2	-	1	4694	c.4620G>A	c.(4618-4620)gaG>gaA	p.E1540E		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1540					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CCCCCTTCTTCTCTCTTTTGT	0.368																																					p.E1540E		Atlas-SNP	.											.	TEX15	350	.	0			c.G4620A						PASS	.						185.0	188.0	187.0					8																	30701914		2203	4300	6503	SO:0001819	synonymous_variant	56154	exon1			CTTCTTCTCTCTT	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.4620G>A	8.37:g.30701914C>T		Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	196	75	0.382653	NM_031271		Silent	SNP	ENST00000256246.2	37	CCDS6080.1																																																																																			.	.	none		0.368	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
OR2T2	401992	hgsc.bcm.edu	37	1	248616764	248616764	+	Silent	SNP	C	C	T	rs376553658		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:248616764C>T	ENST00000342927.3	+	1	688	c.666C>T	c.(664-666)atC>atT	p.I222I		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACACGCACATCCTCCTGACTG	0.542																																					p.I222I		Atlas-SNP	.											OR2T2,NS,carcinoma,0,1	OR2T2	73	1	0			c.C666T						scavenged	.						182.0	125.0	144.0					1																	248616764		2186	4264	6450	SO:0001819	synonymous_variant	401992	exon1			GCACATCCTCCTG	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.666C>T	1.37:g.248616764C>T		Somatic	475	14	0.0294737		WXS	Illumina HiSeq	Phase_I	569	22	0.0386643	NM_001004136	B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	CCDS31116.1																																																																																			C|0.500;T|0.500	0.500	strong		0.542	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
MUC21	394263	hgsc.bcm.edu	37	6	30954754	30954754	+	Missense_Mutation	SNP	G	G	A	rs9262365	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:30954754G>A	ENST00000376296.3	+	2	1043	c.802G>A	c.(802-804)Ggc>Agc	p.G268S	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	268	28 X 15 AA approximate tandem repeats.|Ser-rich.			G -> S (in Ref. 3; AAQ88781 and 4; CAQ08321). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CAGTGGGGCCGGCACAGCCAC	0.632																																					p.G268S		Atlas-SNP	.											MUC21,NS,carcinoma,0,1	MUC21	98	1	0			c.G802A						scavenged	.						154.0	154.0	154.0					6																	30954754		2203	4300	6503	SO:0001583	missense	394263	exon2			GGGGCCGGCACAG	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.802G>A	6.37:g.30954754G>A	ENSP00000365473:p.Gly268Ser	Somatic	128	7	0.0546875		WXS	Illumina HiSeq	Phase_I	188	9	0.0478723	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	A	2.261	-0.369337	0.05069	.	.	ENSG00000204544	ENST00000376296	T	0.01369	4.97	3.74	-0.338	0.12651	.	.	.	.	.	T	0.00178	0.0005	N	0.01576	-0.805	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.19778	-1.0295	8	.	.	.	-0.7336	4.2134	0.10522	0.5818:0.0:0.2661:0.1521	.	268	Q5SSG8	MUC21_HUMAN	S	268	ENSP00000365473:G268S	.	G	+	1	0	MUC21	31062733	0.003000	0.15002	0.000000	0.03702	0.174000	0.22865	1.375000	0.34295	-0.310000	0.08766	-0.490000	0.04691	GGC	G|0.901;A|0.099	0.099	strong		0.632	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
TUBB4A	10382	hgsc.bcm.edu	37	19	6495416	6495416	+	Missense_Mutation	SNP	G	G	A	rs1053267		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:6495416G>A	ENST00000264071.2	-	4	1465	c.1094C>T	c.(1093-1095)gCg>gTg	p.A365V	CTD-2396E7.9_ENST00000599292.1_RNA|TUBB4A_ENST00000540257.1_Missense_Mutation_p.A365V|CTD-2396E7.10_ENST00000596027.1_RNA			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	365			A -> V (in dbSNP:rs1053267). {ECO:0000269|PubMed:6462917}.		'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										GATGAAGGTCGCGGCCATCTT	0.617																																					p.A365V		Atlas-SNP	.											TUBB4,colon,carcinoma,+1,1	.	.	1	0			c.C1094T						scavenged	.						176.0	154.0	162.0					19																	6495416		2203	4300	6503	SO:0001583	missense	10382	exon4			AAGGTCGCGGCCA	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.1094C>T	19.37:g.6495416G>A	ENSP00000264071:p.Ala365Val	Somatic	98	1	0.0102041		WXS	Illumina HiSeq	Phase_I	108	57	0.527778	NM_006087	B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	37	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519188	0.27211	.	.	ENSG00000104833	ENST00000264071;ENST00000540257;ENST00000412858	D;D	0.83837	-1.77;-1.77	3.43	3.43	0.39272	.	0.000000	0.64402	U	0.000003	T	0.71525	0.3350	N	0.16478	0.41	0.48452	D	0.999651	B	0.14012	0.009	B	0.12837	0.008	T	0.70594	-0.4829	10	0.87932	D	0	.	13.6752	0.62449	0.0:0.0:1.0:0.0	rs1053267	365	P04350	TBB4A_HUMAN	V	365;365;283	ENSP00000264071:A365V;ENSP00000443590:A365V	ENSP00000264071:A365V	A	-	2	0	TUBB4	6446416	1.000000	0.71417	0.965000	0.40720	0.833000	0.47200	5.606000	0.67641	1.473000	0.48159	0.306000	0.20318	GCG	G|1.000;|0.000	.	weak		0.617	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
OR2T2	401992	hgsc.bcm.edu	37	1	248616749	248616749	+	Silent	SNP	C	C	G	rs151176830		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:248616749C>G	ENST00000342927.3	+	1	673	c.651C>G	c.(649-651)gtC>gtG	p.V217V		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCATCTCTGTCTCCTACACGC	0.542																																					p.V217V		Atlas-SNP	.											OR2T2,NS,carcinoma,0,1	OR2T2	73	1	0			c.C651G						scavenged	.						255.0	173.0	201.0					1																	248616749		2189	4267	6456	SO:0001819	synonymous_variant	401992	exon1			CTCTGTCTCCTAC	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.651C>G	1.37:g.248616749C>G		Somatic	496	4	0.00806452		WXS	Illumina HiSeq	Phase_I	577	10	0.017331	NM_001004136	B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	CCDS31116.1																																																																																			C|0.500;G|0.500	0.500	strong		0.542	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
SLC35G6	643664	hgsc.bcm.edu	37	17	7386300	7386300	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:7386300G>A	ENST00000412468.2	+	2	1112	c.997G>A	c.(997-999)Gaa>Aaa	p.E333K	POLR2A_ENST00000322644.6_5'Flank|POLR2A_ENST00000572844.1_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	333						integral component of membrane (GO:0016021)											CTGTGAGAGGGAAGGGAAGGT	0.557																																					p.E333K		Atlas-SNP	.											POLR2A_ENST00000412468,NS,carcinoma,-1,1	.	.	1	0			c.G997A						scavenged	.						60.0	59.0	59.0					17																	7386300		2203	4300	6503	SO:0001583	missense	643664	exon2			GAGAGGGAAGGGA		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.997G>A	17.37:g.7386300G>A	ENSP00000396523:p.Glu333Lys	Somatic	142	3	0.0211268		WXS	Illumina HiSeq	Phase_I	100	6	0.06	NM_001102614		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.322479	0.01320	.	.	ENSG00000181222	ENST00000412468	T	0.26518	1.73	4.69	1.44	0.22558	.	.	.	.	.	T	0.14056	0.0340	L	0.36672	1.1	0.09310	N	1	B	0.18013	0.025	B	0.15870	0.014	T	0.37526	-0.9702	9	0.02654	T	1	-0.2286	4.7772	0.13185	0.2637:0.1728:0.5636:0.0	.	333	P0C7Q6	S35G6_HUMAN	K	333	ENSP00000396523:E333K	ENSP00000396523:E333K	E	+	1	0	SLC35G6	7327024	1.000000	0.71417	0.321000	0.25320	0.451000	0.32288	4.403000	0.59729	0.499000	0.27970	-0.225000	0.12378	GAA	.	.	none		0.557	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
MUC4	4585	hgsc.bcm.edu	37	3	195509611	195509611	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195509611A>T	ENST00000463781.3	-	2	9299	c.8840T>A	c.(8839-8841)gTc>gAc	p.V2947D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V2947D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V2947D(3)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGTGTCGGTGACAGGAAGAGG	0.592																																					p.V2947D		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	3	3	Substitution - Missense(3)	skin(2)|endometrium(1)	c.T8840A						scavenged	.						10.0	8.0	9.0					3																	195509611		654	1505	2159	SO:0001583	missense	4585	exon2			TCGGTGACAGGAA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8840T>A	3.37:g.195509611A>T	ENSP00000417498:p.Val2947Asp	Somatic	286	1	0.0034965		WXS	Illumina HiSeq	Phase_I	320	8	0.025	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	4.900	0.167345	0.09339	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31510	1.5;1.49	.	.	.	.	.	.	.	.	T	0.24509	0.0594	N	0.08118	0	0.09310	N	1	D	0.65815	0.995	D	0.68483	0.958	T	0.10154	-1.0642	7	.	.	.	.	1.3928	0.02254	0.3276:0.0:0.3249:0.3475	.	2819	E7ESK3	.	D	2947	ENSP00000417498:V2947D;ENSP00000420243:V2947D	.	V	-	2	0	MUC4	196994390	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.286000	0.08399	-0.000000	0.14550	0.000000	0.15137	GTC	.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CFAP53	220136	hgsc.bcm.edu	37	18	47777943	47777943	+	Missense_Mutation	SNP	T	T	C	rs574145243		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr18:47777943T>C	ENST00000398545.4	-	4	802	c.685A>G	c.(685-687)Aac>Gac	p.N229D		NM_145020.3	NP_659457.2														endometrium(1)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|pancreas(1)|skin(1)	20				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)		AGGCGTGTGTTCTCCATCAGC	0.567													T|||	1	0.000199681	0.0008	0.0	5008	,	,		20116	0.0		0.0	False		,,,				2504	0.0				p.N229D		Atlas-SNP	.											CCDC11,NS,carcinoma,+1,1	CCDC11	59	1	0			c.A685G						scavenged	.						138.0	139.0	139.0					18																	47777943		2055	4199	6254	SO:0001583	missense	220136	exon4			GTGTGTTCTCCAT																												ENST00000398545.4:c.685A>G	18.37:g.47777943T>C	ENSP00000381553:p.Asn229Asp	Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	267	4	0.0149813	NM_145020		Missense_Mutation	SNP	ENST00000398545.4	37	CCDS11940.2	.	.	.	.	.	.	.	.	.	.	T	6.870	0.529967	0.13127	.	.	ENSG00000172361	ENST00000398545	T	0.09163	3.01	5.32	-0.284	0.12870	.	0.557950	0.19355	N	0.116295	T	0.07683	0.0193	L	0.54323	1.7	0.19300	N	0.999979	B	0.09022	0.002	B	0.08055	0.003	T	0.30446	-0.9978	10	0.23891	T	0.37	-3.5367	1.519	0.02512	0.1408:0.1678:0.1455:0.5459	.	229	Q96M91	CCD11_HUMAN	D	229	ENSP00000381553:N229D	ENSP00000381553:N229D	N	-	1	0	CCDC11	46031941	0.023000	0.18921	0.961000	0.40146	0.641000	0.38312	0.291000	0.18994	0.305000	0.22832	-0.327000	0.08410	AAC	.	.	none		0.567	CCDC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255922.3		
ZBED9	114821	hgsc.bcm.edu	37	6	28540209	28540209	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:28540209C>T	ENST00000452236.2	-	4	4074	c.3457G>A	c.(3457-3459)Gac>Aac	p.D1153N		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						tgaaacatgtcataacaatct	0.308																																					p.D1153N		Atlas-SNP	.											SCAND3,bladder,carcinoma,0,1	SCAND3	156	1	0			c.G3457A						scavenged	.						55.0	57.0	57.0					6																	28540209		2162	4285	6447	SO:0001583	missense	114821	exon4			ACATGTCATAACA																												ENST00000452236.2:c.3457G>A	6.37:g.28540209C>T	ENSP00000395259:p.Asp1153Asn	Somatic	208	1	0.00480769		WXS	Illumina HiSeq	Phase_I	242	3	0.0123967	NM_052923		Missense_Mutation	SNP	ENST00000452236.2	37	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.817218	0.50633	.	.	ENSG00000232040	ENST00000452236	T	0.41400	1.0	2.53	2.53	0.30540	Ribonuclease H-like (1);	0.554098	0.12119	U	0.497794	T	0.45377	0.1339	M	0.70275	2.135	0.26616	N	0.972744	D	0.57571	0.98	D	0.72338	0.977	T	0.12192	-1.0557	10	0.33141	T	0.24	.	8.7013	0.34327	0.0:1.0:0.0:0.0	.	1153	Q6R2W3	SCND3_HUMAN	N	1153	ENSP00000395259:D1153N	ENSP00000395259:D1153N	D	-	1	0	SCAND3	28648188	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.851000	0.39338	1.719000	0.51432	0.655000	0.94253	GAC	.	.	none		0.308	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
PACRG	135138	hgsc.bcm.edu	37	6	163735921	163735921	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:163735921C>T	ENST00000337019.3	+	7	1017	c.793C>T	c.(793-795)Cag>Tag	p.Q265*	PACRG_ENST00000366888.2_Nonsense_Mutation_p.Q226*|PACRG_ENST00000366889.2_Nonsense_Mutation_p.Q226*	NM_152410.2	NP_689623.2	Q96M98	PACRG_HUMAN	PARK2 co-regulated	265					spermatid development (GO:0007286)	cell body (GO:0044297)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm midpiece (GO:0097225)				endometrium(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		GGACTTGATCCAGGAGACACT	0.498																																					p.Q265X		Atlas-SNP	.											PACRG,larynx,carcinoma,-2,1	PACRG	48	1	0			c.C793T						scavenged	.						141.0	125.0	131.0					6																	163735921		2203	4300	6503	SO:0001587	stop_gained	135138	exon7			TTGATCCAGGAGA	AK057286	CCDS5284.1, CCDS43524.1	6q26	2004-07-01			ENSG00000112530	ENSG00000112530			19152	protein-coding gene	gene with protein product		608427				12547187	Standard	NM_001080378		Approved	PARK2CRG, FLJ32724, Glup, HAK005771	uc003qua.3	Q96M98	OTTHUMG00000016116	ENST00000337019.3:c.793C>T	6.37:g.163735921C>T	ENSP00000337946:p.Gln265*	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	217	3	0.0138249	NM_152410	E1P5B5|Q6IMB8|Q8IZM1|Q8NHP5|Q9H1V9	Nonsense_Mutation	SNP	ENST00000337019.3	37	CCDS5284.1	.	.	.	.	.	.	.	.	.	.	C	37	6.332139	0.97480	.	.	ENSG00000112530	ENST00000337019;ENST00000366889;ENST00000366888	.	.	.	5.87	5.87	0.94306	.	0.190704	0.47093	D	0.000241	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-29.4042	20.5827	0.99408	0.0:1.0:0.0:0.0	.	.	.	.	X	265;226;226	.	ENSP00000337946:Q265X	Q	+	1	0	PACRG	163655911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.473000	0.45145	2.941000	0.99782	0.655000	0.94253	CAG	.	.	none		0.498	PACRG-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400424.1	NM_152410	
IGSF3	3321	hgsc.bcm.edu	37	1	117158983	117158983	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:117158983T>G	ENST00000369486.3	-	3	905	c.140A>C	c.(139-141)tAc>tCc	p.Y47S	IGSF3_ENST00000369483.1_Missense_Mutation_p.Y47S|IGSF3_ENST00000318837.6_Missense_Mutation_p.Y47S	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	47	Ig-like C2-type 1.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		AGGTCCCTGGTAGCCACTCAC	0.577																																					p.Y47S		Atlas-SNP	.											IGSF3_ENST00000369483,NS,carcinoma,+1,2	IGSF3	294	2	0			c.A140C						scavenged	.						28.0	28.0	28.0					1																	117158983		2203	4292	6495	SO:0001583	missense	3321	exon3			CCCTGGTAGCCAC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.140A>C	1.37:g.117158983T>G	ENSP00000358498:p.Tyr47Ser	Somatic	88	2	0.0227273		WXS	Illumina HiSeq	Phase_I	139	6	0.0431655	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	T	18.18	3.567123	0.65651	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.02323	4.34;4.34;4.34	4.65	-3.71	0.04424	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.463445	0.23369	N	0.048939	T	0.03915	0.0110	M	0.69823	2.125	0.52099	D	0.999948	P;P	0.49783	0.928;0.919	P;P	0.56823	0.784;0.807	T	0.16394	-1.0404	10	0.72032	D	0.01	-17.8621	10.721	0.46040	0.6328:0.0:0.0:0.3672	.	47;47	O75054;A6NJZ6	IGSF3_HUMAN;.	S	47	ENSP00000358498:Y47S;ENSP00000358495:Y47S;ENSP00000321184:Y47S	ENSP00000321184:Y47S	Y	-	2	0	IGSF3	116960506	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	1.704000	0.37857	-0.387000	0.07809	0.454000	0.30748	TAC	T|0.500;G|0.500	0.500	weak		0.577	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
DLG5	9231	hgsc.bcm.edu	37	10	79590551	79590551	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:79590551T>C	ENST00000372391.2	-	10	1834	c.1829A>G	c.(1828-1830)gAc>gGc	p.D610G	DLG5_ENST00000372388.2_Missense_Mutation_p.D610G	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	610					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GGAATCCGTGTCAATGGCCGA	0.547																																					p.D610G		Atlas-SNP	.											DLG5,colon,carcinoma,-1,1	DLG5	154	1	0			c.A1829G						scavenged	.						139.0	111.0	121.0					10																	79590551		2203	4300	6503	SO:0001583	missense	9231	exon10			TCCGTGTCAATGG	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.1829A>G	10.37:g.79590551T>C	ENSP00000361467:p.Asp610Gly	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	103	4	0.038835	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	T	27.0	4.792042	0.90453	.	.	ENSG00000151208	ENST00000372391;ENST00000372388;ENST00000372392	T;T	0.16897	2.31;2.31	5.67	5.67	0.87782	PDZ/DHR/GLGF (1);	0.000000	0.41396	D	0.000889	T	0.36963	0.0986	L	0.55481	1.735	0.48185	D	0.999601	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.87578	0.997;0.998;0.995	T	0.02942	-1.1091	10	0.29301	T	0.29	.	15.909	0.79456	0.0:0.0:0.0:1.0	.	500;610;610	Q8TDM6-4;Q8TDM6;Q8TDM6-2	.;DLG5_HUMAN;.	G	610;610;159	ENSP00000361467:D610G;ENSP00000361464:D610G	ENSP00000361464:D610G	D	-	2	0	DLG5	79260557	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	7.698000	0.84413	2.155000	0.67459	0.459000	0.35465	GAC	.	.	none		0.547	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
SPATA3	130560	hgsc.bcm.edu	37	2	231861056	231861056	+	Silent	SNP	A	A	C	rs72362780		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:231861056A>C	ENST00000452881.1	+	1	216	c.108A>C	c.(106-108)acA>acC	p.T36T	AC105344.2_ENST00000414876.1_lincRNA|SPATA3_ENST00000433428.2_Silent_p.T36T|SPATA3_ENST00000424440.1_Silent_p.T36T|SPATA3_ENST00000455816.1_Silent_p.T36T			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	36										endometrium(2)|lung(1)	3						CTGAATCCACACCACAGCAGC	0.577																																					p.T36T		Atlas-SNP	.											SPATA3,rectum,carcinoma,0,1	SPATA3	52	1	0			c.A108C						scavenged	.						133.0	139.0	137.0					2																	231861056		692	1591	2283	SO:0001819	synonymous_variant	130560	exon1			ATCCACACCACAG	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.108A>C	2.37:g.231861056A>C		Somatic	65	10	0.153846		WXS	Illumina HiSeq	Phase_I	100	22	0.22	NM_139073	Q86WX5|Q8N9Y6	Silent	SNP	ENST00000452881.1	37	CCDS2481.1																																																																																			.	.	none		0.577	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
HERC2	8924	hgsc.bcm.edu	37	15	28483809	28483809	+	Silent	SNP	G	G	A	rs149204675	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr15:28483809G>A	ENST00000261609.7	-	24	3795	c.3687C>T	c.(3685-3687)gaC>gaT	p.D1229D		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACACCTTCCCGTCAATCACAG	0.373													G|||	26	0.00519169	0.0129	0.0	5008	,	,		17942	0.0		0.004	False		,,,				2504	0.0051				p.D1229D		Atlas-SNP	.											HERC2,NS,carcinoma,0,1	HERC2	501	1	0			c.C3687T						scavenged	.						73.0	68.0	70.0					15																	28483809		2203	4300	6503	SO:0001819	synonymous_variant	8924	exon24			CTTCCCGTCAATC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.3687C>T	15.37:g.28483809G>A		Somatic	482	6	0.0124481		WXS	Illumina HiSeq	Phase_I	311	9	0.0289389	NM_004667		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																			G|0.998;A|0.002	0.002	strong		0.373	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
CLCN2	1181	hgsc.bcm.edu	37	3	184071474	184071474	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:184071474T>G	ENST00000265593.4	-	16	2002	c.1831A>C	c.(1831-1833)Atg>Ctg	p.M611L	CLCN2_ENST00000457512.1_Missense_Mutation_p.M611L|CLCN2_ENST00000344937.7_Missense_Mutation_p.M594L|CLCN2_ENST00000434054.2_Missense_Mutation_p.M567L|CLCN2_ENST00000423355.2_3'UTR|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000475279.1_5'Flank	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	611	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	AGGGCCAGCATTCGGCCCTTG	0.657																																					p.M611L		Atlas-SNP	.											.	CLCN2	74	.	0			c.A1831C						PASS	.						38.0	37.0	37.0					3																	184071474		2202	4300	6502	SO:0001583	missense	1181	exon16			CCAGCATTCGGCC	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.1831A>C	3.37:g.184071474T>G	ENSP00000265593:p.Met611Leu	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	74	30	0.405405	NM_004366	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	t	16.00	2.998041	0.54147	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	5.0	3.81	0.43845	Cystathionine beta-synthase, core (1);	0.387182	0.31709	N	0.007192	T	0.76364	0.3977	N	0.22421	0.69	0.80722	D	1	B;B;B;B;B	0.16166	0.016;0.009;0.015;0.004;0.009	B;B;B;B;B	0.15052	0.005;0.005;0.012;0.005;0.005	T	0.69172	-0.5215	10	0.62326	D	0.03	-12.1521	5.9788	0.19395	0.1445:0.0793:0.0:0.7762	.	567;611;594;611;567	E9PBD9;E9PCD2;P51788-3;P51788;B4DZ58	.;.;.;CLCN2_HUMAN;.	L	611;594;567;611	ENSP00000265593:M611L;ENSP00000345056:M594L;ENSP00000400425:M567L;ENSP00000391928:M611L	ENSP00000265593:M611L	M	-	1	0	CLCN2	185554168	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	3.305000	0.51873	0.734000	0.32515	0.460000	0.39030	ATG	.	.	none		0.657	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
MUC4	4585	hgsc.bcm.edu	37	3	195507539	195507539	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195507539G>A	ENST00000463781.3	-	2	11371	c.10912C>T	c.(10912-10914)Ctt>Ttt	p.L3638F	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L3638F	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGACA	0.582																																					p.L3638F		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.C10912T						scavenged	.						15.0	13.0	14.0					3																	195507539		617	1515	2132	SO:0001583	missense	4585	exon2			AGGAAAGGCTGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10912C>T	3.37:g.195507539G>A	ENSP00000417498:p.Leu3638Phe	Somatic	239	2	0.0083682		WXS	Illumina HiSeq	Phase_I	275	6	0.0218182	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	9.111	1.006664	0.19199	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36520	1.25;1.49	0.743	-1.49	0.08718	.	.	.	.	.	T	0.13114	0.0318	N	0.08118	0	0.09310	N	1	B	0.26876	0.162	B	0.08055	0.003	T	0.15235	-1.0444	8	.	.	.	.	2.9195	0.05764	0.0:0.3015:0.3959:0.3025	.	3510	E7ESK3	.	F	3638	ENSP00000417498:L3638F;ENSP00000420243:L3638F	.	L	-	1	0	MUC4	196992318	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-3.553000	0.00433	-1.969000	0.01005	-1.982000	0.00454	CTT	.	.	weak		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PSME4	23198	hgsc.bcm.edu	37	2	54135501	54135501	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:54135501G>A	ENST00000404125.1	-	24	2795	c.2740C>T	c.(2740-2742)Cga>Tga	p.R914*	PSME4_ENST00000421748.2_Nonsense_Mutation_p.R58*	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	914					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CTTTTCCATCGGGAGTCAAAT	0.338																																					p.R914X		Atlas-SNP	.											PSME4,rectum,carcinoma,+1,1	PSME4	247	1	0			c.C2740T						PASS	.						55.0	55.0	55.0					2																	54135501		2203	4298	6501	SO:0001587	stop_gained	23198	exon24			TCCATCGGGAGTC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2740C>T	2.37:g.54135501G>A	ENSP00000384211:p.Arg914*	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	57	43	0.754386	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Nonsense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600660	0.87055	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	13.9841	0.64324	0.0:0.0:0.8484:0.1515	.	.	.	.	X	58;914	.	ENSP00000384211:R914X	R	-	1	2	PSME4	53989005	1.000000	0.71417	0.990000	0.47175	0.983000	0.72400	3.927000	0.56499	2.486000	0.83907	0.655000	0.94253	CGA	.	.	none		0.338	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
ABCA12	26154	hgsc.bcm.edu	37	2	215843661	215843661	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:215843661T>C	ENST00000272895.7	-	32	5063	c.4844A>G	c.(4843-4845)gAg>gGg	p.E1615G	ABCA12_ENST00000389661.4_Missense_Mutation_p.E1297G	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1615					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATAAACAAGCTCTCCCCCAAT	0.507																																					p.E1615G	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											ABCA12,NS,carcinoma,+1,1	ABCA12	368	1	0			c.A4844G						scavenged	.						162.0	142.0	149.0					2																	215843661		2203	4300	6503	SO:0001583	missense	26154	exon32			ACAAGCTCTCCCC	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4844A>G	2.37:g.215843661T>C	ENSP00000272895:p.Glu1615Gly	Somatic	226	1	0.00442478		WXS	Illumina HiSeq	Phase_I	264	6	0.0227273	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.774079	0.90108	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.89485	-2.52;-2.52	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000001	D	0.94391	0.8196	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76071	0.962;0.987	D	0.95106	0.8234	10	0.87932	D	0	.	15.6478	0.77068	0.0:0.0:0.0:1.0	.	1615;1297	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	G	1615;1297	ENSP00000272895:E1615G;ENSP00000374312:E1297G	ENSP00000272895:E1615G	E	-	2	0	ABCA12	215551906	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.997000	0.88414	2.156000	0.67533	0.533000	0.62120	GAG	.	.	none		0.507	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
TMC5	79838	hgsc.bcm.edu	37	16	19481009	19481009	+	Silent	SNP	C	C	T	rs145726955		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:19481009C>T	ENST00000396229.2	+	10	2393	c.1644C>T	c.(1642-1644)gcC>gcT	p.A548A	TMC5_ENST00000381414.4_Silent_p.A548A|TMC5_ENST00000541464.1_Silent_p.A548A|TMC5_ENST00000219821.5_Silent_p.A302A|TMC5_ENST00000564959.1_Silent_p.A231A|TMC5_ENST00000542583.2_Silent_p.A548A|TMC5_ENST00000561503.1_Silent_p.A189A	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	548					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CTAGCATGGCCAAGTATTTCC	0.473													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17834	0.0		0.0	False		,,,				2504	0.0				p.A548A		Atlas-SNP	.											.	TMC5	169	.	0			c.C1644T						PASS	.	C	,,	8,4386	14.3+/-33.2	0,8,2189	112.0	103.0	106.0		1644,1644,906	2.5	1.0	16	dbSNP_134	106	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	TMC5	NM_001105248.1,NM_001105249.1,NM_024780.4	,,	0,8,6489	TT,TC,CC		0.0,0.1821,0.0616	,,	548/1007,548/949,302/761	19481009	8,12986	2197	4300	6497	SO:0001819	synonymous_variant	79838	exon10			CATGGCCAAGTAT	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1644C>T	16.37:g.19481009C>T		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	304	94	0.309211	NM_001105249	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Silent	SNP	ENST00000396229.2	37	CCDS45431.1																																																																																			C|0.999;T|0.001	0.001	strong		0.473	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
CCDC82	79780	hgsc.bcm.edu	37	11	96117573	96117573	+	Silent	SNP	C	C	T	rs575911765		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:96117573C>T	ENST00000278520.5	-	3	767	c.339G>A	c.(337-339)acG>acA	p.T113T	CCDC82_ENST00000525786.1_5'Flank|CCDC82_ENST00000423339.2_Silent_p.T113T|CCDC82_ENST00000542662.1_Silent_p.T113T			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	113								p.T113T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		TGATTTTGTTCGTTTCTTCTT	0.333																																					p.T113T		Atlas-SNP	.											CCDC82,NS,carcinoma,0,1	CCDC82	63	1	1	Substitution - coding silent(1)	prostate(1)	c.G339A						scavenged	.						196.0	188.0	191.0					11																	96117573		2201	4297	6498	SO:0001819	synonymous_variant	79780	exon4			TTTGTTCGTTTCT	AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.339G>A	11.37:g.96117573C>T		Somatic	264	0	0		WXS	Illumina HiSeq	Phase_I	435	6	0.0137931	NM_024725	B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Silent	SNP	ENST00000278520.5	37	CCDS8307.1																																																																																			.	.	none		0.333	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395542.2	NM_024725	
PCDHA8	56140	hgsc.bcm.edu	37	5	140221195	140221195	+	Missense_Mutation	SNP	G	G	C	rs199713478	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:140221195G>C	ENST00000531613.1	+	1	289	c.289G>C	c.(289-291)Ggg>Cgg	p.G97R	PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.G97R|PCDHA6_ENST00000527624.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G97R(2)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCTGTGCGGGCGGAGCGC	0.577													.|||	572	0.114217	0.1036	0.1499	5008	,	,		18938	0.0933		0.1103	False		,,,				2504	0.1288				p.G97R		Atlas-SNP	.											PCDHA8_ENST00000531613,NS,carcinoma,0,8	PCDHA8	366	8	2	Substitution - Missense(2)	NS(2)	c.G289C						scavenged	.																																			SO:0001583	missense	56140	exon1			CTGTGCGGGCGGA	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.289G>C	5.37:g.140221195G>C	ENSP00000434655:p.Gly97Arg	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	100	12	0.12	NM_031856	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373716	0.61624	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.30981	1.51;1.51	3.91	3.91	0.45181	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.213176	0.22539	U	0.058753	T	0.36413	0.0966	M	0.70595	2.14	0.24709	N	0.993216	P;D	0.56287	0.915;0.975	P;P	0.47744	0.49;0.556	T	0.29397	-1.0013	10	0.49607	T	0.09	.	7.8746	0.29586	0.1899:0.0:0.8101:0.0	.	97;97	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	R	97	ENSP00000434655:G97R;ENSP00000367363:G97R	ENSP00000367363:G97R	G	+	1	0	PCDHA8	140201379	0.396000	0.25262	1.000000	0.80357	0.974000	0.67602	2.166000	0.42406	1.900000	0.55004	0.552000	0.68991	GGG	G|0.921;C|0.079	0.079	strong		0.577	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
MUC4	4585	hgsc.bcm.edu	37	3	195511237	195511237	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195511237T>C	ENST00000463781.3	-	2	7673	c.7214A>G	c.(7213-7215)gAc>gGc	p.D2405G	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2405G	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGTCGGTGACAGG	0.587																																					p.D2405G		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,3	MUC4	1505	3	0			c.A7214G						scavenged	.																																			SO:0001583	missense	4585	exon2			GAAGTGTCGGTGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7214A>G	3.37:g.195511237T>C	ENSP00000417498:p.Asp2405Gly	Somatic	396	5	0.0126263		WXS	Illumina HiSeq	Phase_I	471	15	0.0318471	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	T	5.343	0.248518	0.10130	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.48;1.46	.	.	.	.	.	.	.	.	T	0.28732	0.0712	N	0.19112	0.55	0.09310	N	0.999999	P	0.52170	0.951	D	0.65443	0.935	T	0.12993	-1.0526	7	.	.	.	.	1.4125	0.02295	0.3443:0.3266:0.0:0.3291	.	2405	E7ESK3	.	G	2405	ENSP00000417498:D2405G;ENSP00000420243:D2405G	.	D	-	2	0	MUC4	196995632	0.000000	0.05858	0.003000	0.11579	0.080000	0.17528	-0.862000	0.04263	-0.437000	0.07243	0.000000	0.15137	GAC	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
POTEH	23784	hgsc.bcm.edu	37	22	16287562	16287562	+	Missense_Mutation	SNP	G	G	C	rs202187764	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr22:16287562G>C	ENST00000343518.6	-	1	375	c.324C>G	c.(322-324)tgC>tgG	p.C108W		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	108										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TCCCCCTGCAGCAGGGGAAGC	0.587																																					p.C108W		Atlas-SNP	.											POTEH,NS,carcinoma,0,1	POTEH	114	1	0			c.C324G						scavenged	.						97.0	113.0	107.0					22																	16287562		2057	3890	5947	SO:0001583	missense	23784	exon1			CCTGCAGCAGGGG	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.324C>G	22.37:g.16287562G>C	ENSP00000340610:p.Cys108Trp	Somatic	443	14	0.0316027		WXS	Illumina HiSeq	Phase_I	525	17	0.032381	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	37	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	4.136	0.023586	0.08006	.	.	ENSG00000198062	ENST00000343518;ENST00000355872	T	0.37411	1.2	.	.	.	.	.	.	.	.	T	0.40297	0.1111	L	0.53249	1.67	0.09310	N	1	P	0.46578	0.88	P	0.51615	0.675	T	0.21314	-1.0249	7	0.38643	T	0.18	.	.	.	.	.	108	Q6S545	POTEH_HUMAN	W	108	ENSP00000340610:C108W	ENSP00000340610:C108W	C	-	3	2	POTEH	14667562	0.075000	0.21258	0.021000	0.16686	0.022000	0.10575	0.263000	0.18478	0.269000	0.21961	0.274000	0.19336	TGC	G|0.975;C|0.025	0.025	strong		0.587	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
