#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM155A	728215	hgsc.bcm.edu	37	13	108518716	108518727	+	In_Frame_Del	DEL	GCTGCTGCTGCT	GCTGCTGCTGCT	-	rs80103752|rs3832903|rs372708176	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	GCTGCTGCTGCT	GCTGCTGCTGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr13:108518716_108518727delGCTGCTGCTGCT	ENST00000375915.2	-	1	356_367	c.218_229delAGCAGCAGCAGC	c.(217-231)cagcagcagcagcgg>cgg	p.QQQQ73del		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	73	Poly-Gln.					integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						tgctgctgccgctgctgctgctggtgctCCTT	0.66														438	0.0874601	0.0053	0.0663	5008	,	,		13537	0.2073		0.0636	False		,,,				2504	0.1145				p.73_77del		Atlas-Indel	.											.	FAM155A	82	.	0			c.219_230del						PASS	.			4,1057,3167		0,0,4,341,375,1394						-0.3	1.0		dbSNP_107	26	7,2311,5888		0,0,7,542,1227,2327	no	codingComplex	FAM155A	NM_001080396.2		0,0,11,883,1602,3721	A1A1,A1A2,A1R,A2A2,A2R,RR		28.2476,25.0946,27.1755				11,3368,9055				SO:0001651	inframe_deletion	728215	exon1			.	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.218_229delAGCAGCAGCAGC	13.37:g.108518716_108518727delGCTGCTGCTGCT	ENSP00000365080:p.Gln73_Gln76del	Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	18	12	0.666667	NM_001080396	B2RUV1|B7Z334	In_Frame_Del	DEL	ENST00000375915.2	37	CCDS32006.1																																																																																			GCTGCTGCTGCT|0.909;-|0.091	0.091	strong		0.660	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396	
C6	729	hgsc.bcm.edu	37	5	41181559	41181560	+	Frame_Shift_Ins	INS	-	-	C	rs372345940		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:41181559_41181560insC	ENST00000263413.3	-	7	1092_1093	c.828_829insG	c.(826-831)gggagcfs	p.S277fs	C6_ENST00000337836.5_Frame_Shift_Ins_p.S277fs|C6_ENST00000475349.1_5'UTR	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	277	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTGAAAGAGCTCCCCCCCTGAC	0.376																																					p.S277fs		Pindel,Atlas-Indel	.											.	C6	197	.	0			c.829_830insG	GRCh37	CD982526	C6	D		PASS	.																																			SO:0001589	frameshift_variant	729	exon7			.	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.829dupG	5.37:g.41181566_41181566dupC	ENSP00000263413:p.Ser277fs	Somatic	145	.	.		WXS	Illumina HiSeq	Phase_I	156	31	0.199	NM_001115131		Frame_Shift_Ins	INS	ENST00000263413.3	37	CCDS3936.1																																																																																			.	.	weak		0.376	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
CHST4	10164	hgsc.bcm.edu	37	16	71570645	71570645	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:71570645delT	ENST00000338482.5	+	3	408	c.65delT	c.(64-66)ctafs	p.L22fs	CHST4_ENST00000572450.1_Frame_Shift_Del_p.L22fs|ZNF19_ENST00000568446.1_Intron|CHST4_ENST00000539698.3_Frame_Shift_Del_p.L22fs			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	22					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						ATCTTGGCTCTATTCTTCCAC	0.502																																					p.L22fs		Pindel,Atlas-Indel	.											.	CHST4	47	.	0			c.64delC						PASS	.						111.0	108.0	109.0					16																	71570645		2198	4300	6498	SO:0001589	frameshift_variant	10164	exon2			.	AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.65delT	16.37:g.71570645delT	ENSP00000341206:p.Leu22fs	Somatic	84	.	.		WXS	Illumina HiSeq	Phase_I	83	17	0.205	NM_001166395	Q8IV46|Q9Y5R3	Frame_Shift_Del	DEL	ENST00000338482.5	37	CCDS10902.1																																																																																			.	.	none		0.502	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268992.4	NM_005769	
AR	367	hgsc.bcm.edu	37	X	66765158	66765159	+	In_Frame_Ins	INS	-	-	GCTGCA	rs78686797|rs3032358|rs4045402		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chrX:66765158_66765159insGCTGCA	ENST00000374690.3	+	1	694_695	c.170_171insGCTGCA	c.(169-174)ctgcag>ctGCTGCAgcag	p.57_58LQ>LLQQ	AR_ENST00000504326.1_In_Frame_Ins_p.57_58LQ>LLQQ|AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_In_Frame_Ins_p.57_58LQ>LLQQ	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	57	Gln-rich.|Modulating.|Poly-Gln.|Poly-Leu.		L -> Q (in prostate cancer).		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L57Q(3)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	TTGCTGCTGCTgcagcagcagc	0.668									Androgen Insensitivity Syndrome																												p.L57delinsLLQ		Atlas-Indel	.											.	AR	249	.	3	Substitution - Missense(3)	lung(1)|endometrium(1)|central_nervous_system(1)	c.170_171insGCTGCA						PASS	.																																			SO:0001652	inframe_insertion	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	.	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	Exception_encountered	X.37:g.66765158_66765159insGCTGCA	ENSP00000363822:p.Leu57_Gln58insLeuGln	Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	20	14	0.7	NM_000044	A2RUN2|B1AKD7|Q9UD95	In_Frame_Ins	INS	ENST00000374690.3	37	CCDS14387.1																																																																																			.	.	alt		0.668	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
NEFH	4744	hgsc.bcm.edu	37	22	29885581	29885604	+	In_Frame_Del	DEL	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs79235463|rs200984527|rs370803228	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENST00000310624.6	+	4	1985_2008	c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	c.(1951-1977)aaggccaagtccccagagaaggaagag>aag	p.AKSPEKEE652del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	658	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCTGAGAAGGCCAAGTCCCCAGAGAAGGAAGAGGCCAAGTC	0.562																																					p.651_658del		Atlas-Indel	.											.	NEFH	178	.	0			c.1951_1974del						PASS	.																																			SO:0001651	inframe_deletion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	22.37:g.29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENSP00000311997:p.Ala652_Glu659del	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	92	13	0.141304	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	weak		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
SPEF2	79925	hgsc.bcm.edu	37	5	35705894	35705894	+	Frame_Shift_Del	DEL	A	A	-			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:35705894delA	ENST00000356031.3	+	18	2803	c.2649delA	c.(2647-2649)gcafs	p.A883fs	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000509059.1_Frame_Shift_Del_p.A878fs|SPEF2_ENST00000440995.2_Frame_Shift_Del_p.A878fs	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	883					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.K886fs*8(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTGAAATAGCAAAAAAAAAGA	0.269																																					p.A883fs		Atlas-Indel	.											.	SPEF2	324	.	1	Deletion - Frameshift(1)	lung(1)	c.2648delC						PASS	.			35,46,3367		0,0,35,0,46,1643	20.0	18.0	18.0			-2.4	0.0	5		19	95,88,7525		0,1,94,0,87,3672	no	codingComplex	SPEF2	NM_024867.3		0,1,129,0,133,5315	A1A1,A1A2,A1R,A2A2,A2R,RR		2.3742,2.3492,2.3664			35705894	130,134,10892	1785	4033	5818	SO:0001589	frameshift_variant	79925	exon18			.	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2649delA	5.37:g.35705894delA	ENSP00000348314:p.Ala883fs	Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	69	11	0.15942	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Frame_Shift_Del	DEL	ENST00000356031.3	37	CCDS43309.1																																																																																			.	.	none		0.269	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
LPIN3	64900	hgsc.bcm.edu	37	20	39977298	39977299	+	Frame_Shift_Ins	INS	-	-	G	rs546459459		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:39977298_39977299insG	ENST00000373257.3	+	4	419_420	c.328_329insG	c.(328-330)tggfs	p.W110fs		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	110					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				ACCCATCCCTTGGGGGGGTCTG	0.663																																					p.W110fs		Pindel,Atlas-Indel	.											.	LPIN3	69	.	0			c.328_329insG						PASS	.																																			SO:0001589	frameshift_variant	64900	exon4			.	AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.335dupG	20.37:g.39977305_39977305dupG	ENSP00000362354:p.Trp110fs	Somatic	40	.	.		WXS	Illumina HiSeq	Phase_I	56	12	0.214	NM_022896	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Frame_Shift_Ins	INS	ENST00000373257.3	37	CCDS33469.1																																																																																			.	.	none		0.663	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1	NM_022896	
STAT4	6775	hgsc.bcm.edu	37	2	192011486	192011486	+	Intron	DEL	A	A	-			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:192011486delA	ENST00000392320.2	-	3	443				STAT4_ENST00000358470.4_Intron|STAT4_ENST00000409995.1_Intron	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4						cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			CTGCCTCCCTAAAAAAAAAAA	0.308																																					.		Pindel	.											.	STAT4	85	.	0			c.129-2T>-						PASS	.			149,614,3501		0,1,148,0,613,1370	42.0	41.0	41.0			5.4	1.0	2		47	347,1153,6750		0,0,347,0,1153,2625	no	intron	STAT4	NM_003151.3		0,1,495,0,1766,3995	A1A1,A1A2,A1R,A2A2,A2R,RR		18.1818,17.894,18.0837			192011486	496,1767,10251	2202	4300	6502	SO:0001627	intron_variant	6775	exon4			.		CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.129-3T>-	2.37:g.192011486delA		Somatic	55	.	.		WXS	Illumina HiSeq	Phase_I	68	12	0.176	NM_003151	Q96NZ6	Splice_Site	DEL	ENST00000392320.2	37	CCDS2310.1																																																																																			.	.	none		0.308	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335586.1	NM_003151	
SETDB1	9869	hgsc.bcm.edu	37	1	150917623	150917624	+	Intron	INS	-	-	G	rs587715611|rs587751384|rs186820437	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:150917623_150917624insG	ENST00000271640.5	+	9	1330				SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368962.2_Frame_Shift_Ins_p.G394fs|SETDB1_ENST00000368969.4_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1						bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGAGGTTGGTGGGGGGGGAAC	0.475																																					p.G393fs		Pindel	.											.	SETDB1	204	.	0			c.1179_1180insG						PASS	.		,	53,4213		1,51,2081					,	-6.3	0.0			32	26,8228		0,26,4101	no	intron,intron	SETDB1	NM_012432.3,NM_001145415.1	,	1,77,6182	A1A1,A1R,RR		0.315,1.2424,0.631	,	,		79,12441				SO:0001627	intron_variant	9869	exon9			.	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.1140+39->G	1.37:g.150917631_150917631dupG		Somatic	176	.	.		WXS	Illumina HiSeq	Phase_I	191	32	0.168	NM_001243491	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Frame_Shift_Ins	INS	ENST00000271640.5	37	CCDS44217.1																																																																																			.	.	none		0.475	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
CASP5	838	hgsc.bcm.edu	37	11	104879687	104879687	+	Frame_Shift_Del	DEL	T	T	-	rs372526393		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:104879687delT	ENST00000260315.3	-	2	27	c.28delA	c.(28-30)aggfs	p.R11fs	CASP5_ENST00000444749.2_Intron|CASP5_ENST00000393141.2_Frame_Shift_Del_p.R24fs|CASP5_ENST00000393139.2_5'UTR|CASP5_ENST00000531367.1_Intron|CASP5_ENST00000526056.1_Frame_Shift_Del_p.R24fs|CASP5_ENST00000418434.1_Intron			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	11					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		TTCTTACGCCTTTTTTTTTTG	0.388																																					p.R23fs		Pindel	.											.	CASP5	213	.	0			c.68delG						PASS	.		,,,	18,749,3497		0,0,18,1,747,1366	101.0	98.0	99.0		,,,	-1.9	0.0	11		107	8,1495,6751		0,0,8,0,1495,2624	no	codingComplex,codingComplex,intron,intron	CASP5	NM_004347.3,NM_001136112.1,NM_001136110.1,NM_001136109.1	,,,	0,0,26,1,2242,3990	A1A1,A1A2,A1R,A2A2,A2R,RR		18.2094,17.9878,18.1339	,,,	,,,	104879687	26,2244,10248	2201	4299	6500	SO:0001589	frameshift_variant	838	exon2			.		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.28delA	11.37:g.104879687delT	ENSP00000260315:p.Arg11fs	Somatic	49	.	.		WXS	Illumina HiSeq	Phase_I	67	12	0.179	NM_001136112	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Frame_Shift_Del	DEL	ENST00000260315.3	37	CCDS8328.2																																																																																			.	.	weak		0.388	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347	
CBWD3	445571	hgsc.bcm.edu	37	9	70900911	70900912	+	Frame_Shift_Ins	INS	-	-	A	rs200498038|rs367958837	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:70900911_70900912insA	ENST00000360171.6	+	11	1322_1323	c.771_772insA	c.(772-774)aaafs	p.K258fs	CBWD3_ENST00000377342.5_Frame_Shift_Ins_p.K238fs	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3	258							ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		TTAGTTTGCAGAAAAAACTTCA	0.317													|||unknown(NO_COVERAGE)	2457	0.490615	0.4319	0.5951	5008	,	,		19815	0.4355		0.5934	False		,,,				2504	0.4468				p.Q257fs		Pindel	.											.	CBWD3	10	.	0			c.771_772insA						PASS	.			42,54		20,2,26						3.1	1.0			1	91,101		44,3,49	no	frameshift	CBWD3	NM_201453.2		64,5,75	A1A1,A1R,RR		47.3958,43.75,46.1806				133,155				SO:0001589	frameshift_variant	445571	exon11			.	BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.777dupA	9.37:g.70900917_70900917dupA	ENSP00000353295:p.Lys258fs	Somatic	108	.	.		WXS	Illumina HiSeq	Phase_I	120	20	0.167	NM_201453	B4DNG9|Q6VB91	Frame_Shift_Ins	INS	ENST00000360171.6	37	CCDS35038.1																																																																																			.	.	weak		0.317	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1	NM_201453	
RBM43	375287	hgsc.bcm.edu	37	2	152108088	152108088	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:152108088delT	ENST00000331426.5	-	4	557	c.406delA	c.(406-408)atcfs	p.I136fs		NM_198557.2	NP_940959.1	Q6ZSC3	RBM43_HUMAN	RNA binding motif protein 43	136							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.I136fs*4(1)		endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.131)		AAACTCGGGATTTTTTTTTTC	0.388																																					p.I136fs		Pindel	.											.	RBM43	35	.	1	Deletion - Frameshift(1)	ovary(1)	c.407delT						PASS	.			67,49,4116		3,1,60,6,36,2010	81.0	90.0	87.0			4.3	0.8	2	dbSNP_134	89	115,71,8038		0,1,114,8,54,3935	no	codingComplex	RBM43	NM_198557.2		3,2,174,14,90,5945	A1A1,A1A2,A1R,A2A2,A2R,RR		2.2617,2.741,2.4245			152108088	182,120,12154	2198	4292	6490	SO:0001589	frameshift_variant	375287	exon4			.	AK127552	CCDS2191.1	2q23.3	2007-01-30	2007-01-30	2007-01-30	ENSG00000184898	ENSG00000184898		"""RNA binding motif (RRM) containing"""	24790	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 38"""	C2orf38			Standard	NM_198557		Approved	FLJ45645	uc002txh.3	Q6ZSC3	OTTHUMG00000131866	ENST00000331426.5:c.406delA	2.37:g.152108088delT	ENSP00000331211:p.Ile136fs	Somatic	68	.	.		WXS	Illumina HiSeq	Phase_I	75	15	0.200	NM_198557	B2RMT5	Frame_Shift_Del	DEL	ENST00000331426.5	37	CCDS2191.1																																																																																			.	.	strong		0.388	RBM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254816.2	NM_198557	
ASPN	54829	hgsc.bcm.edu	37	9	95237025	95237030	+	In_Frame_Del	DEL	TCATCA	TCATCA	-	rs397840756|rs143279922|rs200538582|rs3078372|rs397838876|rs557103556		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	TCATCA	TCATCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:95237025_95237030delTCATCA	ENST00000375544.3	-	2	393_398	c.150_155delTGATGA	c.(148-156)gatgatgag>gag	p.DD50del	ASPN_ENST00000375543.1_In_Frame_Del_p.DD50del|ASPN_ENST00000450139.2_In_Frame_Del_p.DD22del|ASPN_ENST00000395538.3_In_Frame_Del_p.DD50del|CENPP_ENST00000375587.3_Intron	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	50	Poly-Asp.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						AGAGTTGTCCtcatcatcatcatcat	0.398																																					p.51_52del		Pindel	.											.	ASPN	52	.	0			c.151_156del						PASS	.																																			SO:0001651	inframe_deletion	54829	exon2			.	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.150_155delTGATGA	9.37:g.95237031_95237036delTCATCA	ENSP00000364694:p.Asp50_Asp51del	Somatic	92	.	.		WXS	Illumina HiSeq	Phase_I	127	19	0.150	NM_001193335	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	In_Frame_Del	DEL	ENST00000375544.3	37																																																																																				-|0.500;TCA|0.500	0.500	alt		0.398	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1	NM_017680	
SIRPA	140885	hgsc.bcm.edu	37	20	1896052	1896054	+	In_Frame_Del	DEL	CGA	CGA	-	rs139878822|rs202172737	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	CGA	CGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:1896052_1896054delCGA	ENST00000358771.4	+	2	539_541	c.387_389delCGA	c.(385-390)cccgat>cct	p.D131del	SIRPA_ENST00000356025.3_In_Frame_Del_p.D131del|SIRPA_ENST00000400068.3_In_Frame_Del_p.D131del	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	131	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.D131delD(2)|p.D130A(1)|p.P129P(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		AAGGGAGCCCCGATGACGTGGAG	0.527														1950	0.389377	0.264	0.4063	5008	,	,		16040	0.5933		0.2932	False		,,,				2504	0.4356				p.129_130del	GBM(155;1668 1920 5945 42733 48121)	Pindel	.											SIRPA,NS,carcinoma,-1,1	SIRPA	83	1	4	Deletion - In frame(2)|Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)|upper_aerodigestive_tract(1)|large_intestine(1)	c.386_388del						PASS	.		,,	1147,3105		167,813,1146					,,	2.0	0.0		dbSNP_134	106	2654,5494		452,1750,1872	no	coding,coding,coding	SIRPA	NM_080792.2,NM_001040023.1,NM_001040022.1	,,	619,2563,3018	A1A1,A1R,RR		32.5724,26.9755,30.6532	,,	,,		3801,8599				SO:0001651	inframe_deletion	140885	exon3			.	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.387_389delCGA	20.37:g.1896052_1896054delCGA	ENSP00000351621:p.Asp131del	Somatic	78	.	.		WXS	Illumina HiSeq	Phase_I	71	15	0.211	NM_001040022	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	In_Frame_Del	DEL	ENST00000358771.4	37	CCDS13022.1																																																																																			.	.	strong		0.527	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
OR13C2	392376	hgsc.bcm.edu	37	9	107367665	107367666	+	Frame_Shift_Del	DEL	GC	GC	-	rs377668801|rs143760725|rs144815315|rs140970710	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:107367665_107367666delGC	ENST00000542196.1	-	1	285_286	c.243_244delGC	c.(241-246)acgctafs	p.L82fs		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						AAGCTCACTAGCGTGGAGGGAA	0.515														1574	0.314297	0.4138	0.2003	5008	,	,		20880	0.4097		0.16	False		,,,				2504	0.3211				p.82_82del		Pindel	.											.	OR13C2	46	.	0			c.244_245del						PASS	.			2387,1861		730,927,467						2.2	0.0		dbSNP_134	35	1565,6681		171,1223,2729	no	frameshift	OR13C2	NM_001004481.1		901,2150,3196	A1A1,A1R,RR		18.9789,43.8089,31.6312				3952,8542				SO:0001589	frameshift_variant	392376	exon1			.		CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.243_244delGC	9.37:g.107367665_107367666delGC	ENSP00000438815:p.Leu82fs	Somatic	507	.	.		WXS	Illumina HiSeq	Phase_I	579	118	0.204	NM_001004481	B9EGV8|Q6IF54	Frame_Shift_Del	DEL	ENST00000542196.1	37	CCDS35092.1																																																																																			.	.	strong		0.515	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053489.2	NM_001004481	
TPO	7173	hgsc.bcm.edu	37	2	1544451	1544451	+	Missense_Mutation	SNP	G	G	A	rs368181428		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:1544451G>A	ENST00000345913.4	+	16	2795	c.2704G>A	c.(2704-2706)Gta>Ata	p.V902I	TPO_ENST00000382198.1_Missense_Mutation_p.V729I|TPO_ENST00000349624.3_Missense_Mutation_p.V729I|TPO_ENST00000346956.3_Missense_Mutation_p.V858I|TPO_ENST00000329066.4_Missense_Mutation_p.V902I|TPO_ENST00000382201.3_Missense_Mutation_p.V845I|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	902					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.V902I(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GCACCAGGCCGTAGGGACCTC	0.637																																					p.V902I		Atlas-SNP	.											TPO,brainstem,primitive_neuroectodermal_tumour-medulloblastoma,0,1	TPO	224	1	1	Substitution - Missense(1)	central_nervous_system(1)	c.G2704A						scavenged	.	A	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	77.0	66.0	70.0		2704,2704,2533,2533,2572,2185	-2.9	0.0	2		70	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	29,29,29,29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign	902/934,902/934,845/877,845/877,858/890,729/761	1544451	1,13005	2203	4300	6503	SO:0001583	missense	7173	exon16			CAGGCCGTAGGGA		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2704G>A	2.37:g.1544451G>A	ENSP00000318820:p.Val902Ile	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	71	2	0.028169	NM_001206744	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	g	0.152	-1.090855	0.01858	0.0	1.16E-4	ENSG00000115705	ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607;ENST00000425083	T;T;T;T;T;T;T;T;T	0.70164	-0.2;-0.24;0.04;-0.2;-0.16;0.04;-0.28;0.53;-0.46	1.43	-2.86	0.05717	.	2.591470	0.02479	N	0.088351	T	0.40498	0.1119	N	0.08118	0	0.09310	N	1	B;B;B;B	0.24426	0.043;0.025;0.103;0.062	B;B;B;B	0.14578	0.011;0.003;0.011;0.005	T	0.25398	-1.0133	10	0.10377	T	0.69	-0.0765	5.9353	0.19163	0.6539:0.0:0.3461:0.0	.	858;729;845;902	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	I	902;858;729;902;845;729;787;332;123	ENSP00000318820:V902I;ENSP00000263886:V858I;ENSP00000332044:V729I;ENSP00000329869:V902I;ENSP00000371636:V845I;ENSP00000371633:V729I;ENSP00000405788:V787I;ENSP00000419461:V332I;ENSP00000389659:V123I	ENSP00000329869:V902I	V	+	1	0	TPO	1523458	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.784000	0.01769	-1.117000	0.02965	-1.801000	0.00618	GTA	.	.	weak		0.637	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
SPOCK3	50859	hgsc.bcm.edu	37	4	167675875	167675875	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:167675875C>T	ENST00000357154.3	-	9	861	c.724G>A	c.(724-726)Gat>Aat	p.D242N	SPOCK3_ENST00000534949.1_Missense_Mutation_p.D146N|SPOCK3_ENST00000506886.1_Missense_Mutation_p.D242N|SPOCK3_ENST00000510741.1_Missense_Mutation_p.D199N|SPOCK3_ENST00000541637.1_Missense_Mutation_p.D144N|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000512648.1_Missense_Mutation_p.D239N|SPOCK3_ENST00000535728.1_Missense_Mutation_p.D110N|SPOCK3_ENST00000511531.1_Missense_Mutation_p.D242N|SPOCK3_ENST00000512681.1_Missense_Mutation_p.D144N|SPOCK3_ENST00000541354.1_Missense_Mutation_p.D122N|SPOCK3_ENST00000504953.1_Missense_Mutation_p.D239N|SPOCK3_ENST00000502330.1_Missense_Mutation_p.D242N|SPOCK3_ENST00000421836.2_Missense_Mutation_p.D191N|SPOCK3_ENST00000357545.4_Missense_Mutation_p.D239N|SPOCK3_ENST00000511269.1_Missense_Mutation_p.D239N	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	242					negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		ATGCTGGTATCGAATCCTAAA	0.388																																					p.D242N		Atlas-SNP	.											SPOCK3,rectum,carcinoma,+2,1	SPOCK3	90	1	0			c.G724A						scavenged	.						104.0	95.0	98.0					4																	167675875		2203	4300	6503	SO:0001583	missense	50859	exon9			TGGTATCGAATCC	AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.724G>A	4.37:g.167675875C>T	ENSP00000349677:p.Asp242Asn	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	143	2	0.013986	NM_016950	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	ENST00000357154.3	37	CCDS54817.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373746	0.82573	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000541354;ENST00000512681;ENST00000511269;ENST00000535728;ENST00000421836;ENST00000541637;ENST00000534949;ENST00000512648;ENST00000510403	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;D	0.87491	1.4;1.41;1.41;1.4;1.4;1.4;1.42;1.34;0.85;1.41;1.39;1.21;0.85;1.1;2.13;-2.26	5.64	5.64	0.86602	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.107040	0.64402	D	0.000005	D	0.91620	0.7352	L	0.48986	1.54	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.87578	0.966;0.984;0.997;0.998;0.998;0.984;0.996;0.998	D	0.88269	0.2928	10	0.23891	T	0.37	-1.5653	20.0723	0.97728	0.0:1.0:0.0:0.0	.	144;146;191;251;199;242;239;242	B4DGK5;F5H099;B4DHB4;B4DFW5;E7EP61;Q9BQ16-2;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;.;TICN3_HUMAN	N	242;239;239;242;242;242;199;122;144;239;110;191;144;146;239;121	ENSP00000349677:D242N;ENSP00000350153:D239N;ENSP00000425570:D239N;ENSP00000420920:D242N;ENSP00000423421:D242N;ENSP00000423606:D242N;ENSP00000426716:D199N;ENSP00000444789:D122N;ENSP00000426318:D144N;ENSP00000425502:D239N;ENSP00000441396:D110N;ENSP00000411344:D191N;ENSP00000445430:D144N;ENSP00000438142:D146N;ENSP00000426177:D239N;ENSP00000423176:D121N	ENSP00000349677:D242N	D	-	1	0	SPOCK3	167912450	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	7.687000	0.84139	2.819000	0.97034	0.650000	0.86243	GAT	.	.	none		0.388	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1		
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240804	39240804	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:39240804C>A	ENST00000391417.4	+	1	346	c.346C>A	c.(346-348)Cgc>Agc	p.R116S		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	141	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cagctgctgccgcccctgctg	0.672																																					p.R116S		Atlas-SNP	.											KRTAP4-7,caecum,carcinoma,0,1	KRTAP4-7	49	1	0			c.C346A						scavenged	.						15.0	16.0	16.0					17																	39240804		692	1588	2280	SO:0001583	missense	100132476	exon1			TGCTGCCGCCCCT	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.346C>A	17.37:g.39240804C>A	ENSP00000375236:p.Arg116Ser	Somatic	30	4	0.133333		WXS	Illumina HiSeq	Phase_I	43	10	0.232558	NM_033061	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	0.016	-1.524493	0.00959	.	.	ENSG00000240871	ENST00000391417	T	0.00596	6.32	3.15	-6.29	0.02013	.	0.163808	0.19966	U	0.102091	T	0.00241	0.0007	.	.	.	0.09310	N	0.999997	B	0.33748	0.423	B	0.29524	0.103	T	0.47661	-0.9100	9	0.11794	T	0.64	.	1.8893	0.03244	0.1228:0.1811:0.2435:0.4526	.	171	Q9BYR0	KRA47_HUMAN	S	116	ENSP00000375236:R116S	ENSP00000375236:R116S	R	+	1	0	KRTAP4-7	36494330	0.000000	0.05858	0.002000	0.10522	0.468000	0.32798	-3.208000	0.00557	-2.496000	0.00513	-0.734000	0.03567	CGC	.	.	none		0.672	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
ZNF233	353355	hgsc.bcm.edu	37	19	44777859	44777859	+	Missense_Mutation	SNP	G	G	A	rs569951523		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:44777859G>A	ENST00000391958.2	+	5	1173	c.1046G>A	c.(1045-1047)cGg>cAg	p.R349Q	ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000334152.1_Missense_Mutation_p.R331Q|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				GTATATGCCCGGAGCTCCAAC	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		20355	0.0		0.0	False		,,,				2504	0.001				p.R349Q		Atlas-SNP	.											.	ZNF233	73	.	0			c.G1046A						PASS	.						102.0	97.0	99.0					19																	44777859		2203	4300	6503	SO:0001583	missense	353355	exon5			ATGCCCGGAGCTC	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1046G>A	19.37:g.44777859G>A	ENSP00000375820:p.Arg349Gln	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	142	44	0.309859	NM_001207005	B2RN78|B2RN79|Q86WL8	Missense_Mutation	SNP	ENST00000391958.2	37	CCDS33047.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.610015	0.28712	.	.	ENSG00000159915	ENST00000334152;ENST00000391958;ENST00000280305	T;T	0.15718	2.4;2.4	4.29	-0.708	0.11241	.	.	.	.	.	T	0.11024	0.0269	L	0.28400	0.85	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30119	-0.9989	9	0.62326	D	0.03	0.0227	5.1768	0.15139	0.6014:0.1424:0.2562:0.0	.	349	A6NK53	ZN233_HUMAN	Q	331;349;270	ENSP00000334957:R331Q;ENSP00000375820:R349Q	ENSP00000280305:R270Q	R	+	2	0	ZNF233	49469699	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.049000	0.14099	-0.106000	0.12110	-0.355000	0.07637	CGG	.	.	none		0.527	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
SRRM2	23524	hgsc.bcm.edu	37	16	2816548	2816548	+	Missense_Mutation	SNP	C	C	T	rs555127784		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:2816548C>T	ENST00000301740.8	+	11	6568	c.6019C>T	c.(6019-6021)Cgc>Tgc	p.R2007C		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2007	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AAGAAGGTCCCGCTCTCGAAC	0.567													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17179	0.0		0.0	False		,,,				2504	0.0				p.R2007C		Atlas-SNP	.											SRRM2,colon,carcinoma,-1,1	SRRM2	263	1	0			c.C6019T						PASS	.						73.0	78.0	76.0					16																	2816548		2198	4300	6498	SO:0001583	missense	23524	exon11			AGGTCCCGCTCTC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6019C>T	16.37:g.2816548C>T	ENSP00000301740:p.Arg2007Cys	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	114	5	0.0438596	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	9.797	1.179393	0.21787	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.27890	1.64	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000020	T	0.33818	0.0876	N	0.08118	0	0.45791	D	0.998673	D	0.89917	1.0	D	0.80764	0.994	T	0.35822	-0.9773	10	0.72032	D	0.01	-6.8635	11.8353	0.52321	0.1749:0.8251:0.0:0.0	.	2007	Q9UQ35	SRRM2_HUMAN	C	2007;2007;1259	ENSP00000301740:R2007C	ENSP00000301740:R2007C	R	+	1	0	SRRM2	2756549	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	2.556000	0.45862	2.572000	0.86782	0.650000	0.86243	CGC	.	.	none		0.567	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
GPR139	124274	hgsc.bcm.edu	37	16	20043683	20043683	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:20043683G>A	ENST00000570682.1	-	2	736	c.436C>T	c.(436-438)Cgg>Tgg	p.R146W		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	146					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						ATGACTTTCCGGGTGCGGGCT	0.512																																					p.R146W		Atlas-SNP	.											GPR139,lower_third,carcinoma,+1,1	GPR139	75	1	0			c.C436T						scavenged	.						176.0	136.0	149.0					16																	20043683		2203	4300	6503	SO:0001583	missense	124274	exon2			CTTTCCGGGTGCG	AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.436C>T	16.37:g.20043683G>A	ENSP00000458791:p.Arg146Trp	Somatic	236	2	0.00847458		WXS	Illumina HiSeq	Phase_I	240	4	0.0166667	NM_001002911	A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	ENST00000570682.1	37	CCDS32398.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141162	0.56936	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.73	2.47	0.30058	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.68851	0.3046	L	0.51914	1.62	0.53005	D	0.99996	D	0.89917	1.0	D	0.87578	0.998	T	0.70342	-0.4898	9	0.56958	D	0.05	-35.7826	13.8024	0.63208	0.0:0.0:0.4434:0.5565	.	146	Q6DWJ6	GP139_HUMAN	W	146	.	ENSP00000370779:R146W	R	-	1	2	GPR139	19951184	0.998000	0.40836	1.000000	0.80357	0.858000	0.48976	2.360000	0.44151	0.721000	0.32231	-0.274000	0.10170	CGG	.	.	none		0.512	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438522.1	NM_001002911	
DCAF10	79269	hgsc.bcm.edu	37	9	37860089	37860089	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:37860089C>T	ENST00000377724.3	+	6	1575	c.1210C>T	c.(1210-1212)Ctt>Ttt	p.L404F	DCAF10_ENST00000242323.7_Missense_Mutation_p.L367F|RP11-613M10.9_ENST00000540557.1_Intron|DCAF10_ENST00000483167.1_3'UTR	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	404					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						CCCTGAAGTTCTTGGTGAGAG	0.453																																					p.L404F		Atlas-SNP	.											DCAF10,NS,carcinoma,0,1	DCAF10	31	1	0			c.C1210T						scavenged	.						133.0	114.0	120.0					9																	37860089		2203	4300	6503	SO:0001583	missense	79269	exon6			GAAGTTCTTGGTG	BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	ENST00000377724.3:c.1210C>T	9.37:g.37860089C>T	ENSP00000366953:p.Leu404Phe	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	183	3	0.0163934	NM_024345	A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Missense_Mutation	SNP	ENST00000377724.3	37	CCDS6613.2	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695355	0.68386	.	.	ENSG00000122741	ENST00000377724;ENST00000242323	T;T	0.72167	-0.3;-0.63	5.9	5.9	0.94986	WD40 repeat-like-containing domain (1);	0.048759	0.85682	D	0.000000	T	0.50222	0.1603	N	0.08118	0	0.34506	D	0.706606	B;B	0.32425	0.006;0.371	B;B	0.30716	0.002;0.119	T	0.56547	-0.7961	10	0.09843	T	0.71	.	17.776	0.88508	0.0:1.0:0.0:0.0	.	367;404	Q5QP82-2;Q5QP82	.;DCA10_HUMAN	F	404;367	ENSP00000366953:L404F;ENSP00000242323:L367F	ENSP00000242323:L367F	L	+	1	0	DCAF10	37850089	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.295000	0.78780	2.806000	0.96561	0.655000	0.94253	CTT	.	.	none		0.453	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052485.2	NM_024345	
FHOD1	29109	hgsc.bcm.edu	37	16	67263851	67263851	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:67263851G>A	ENST00000258201.4	-	21	3504	c.3257C>T	c.(3256-3258)cCc>cTc	p.P1086L	LRRC29_ENST00000341546.3_5'Flank|AC040160.1_ENST00000454102.2_5'Flank|LRRC29_ENST00000409509.1_5'Flank|LRRC29_ENST00000462169.1_5'Flank	NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	1086	DAD.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		TGCAGTGGAGGGCCCCACTGT	0.572																																					p.P1086L		Atlas-SNP	.											FHOD1,NS,carcinoma,+1,1	FHOD1	86	1	0			c.C3257T						scavenged	.						65.0	69.0	68.0					16																	67263851		2198	4300	6498	SO:0001583	missense	29109	exon21			GTGGAGGGCCCCA	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.3257C>T	16.37:g.67263851G>A	ENSP00000258201:p.Pro1086Leu	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	122	2	0.0163934	NM_013241	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	37	CCDS10834.1	.	.	.	.	.	.	.	.	.	.	G	8.022	0.759789	0.15846	.	.	ENSG00000135723	ENST00000258201	T	0.36157	1.27	5.46	5.46	0.80206	.	1.121610	0.06720	N	0.774745	T	0.36936	0.0985	L	0.52573	1.65	0.26196	N	0.979511	B	0.14805	0.011	B	0.15870	0.014	T	0.12218	-1.0556	10	0.48119	T	0.1	.	10.1273	0.42658	0.0878:0.0:0.9122:0.0	.	1086	Q9Y613	FHOD1_HUMAN	L	1086	ENSP00000258201:P1086L	ENSP00000258201:P1086L	P	-	2	0	FHOD1	65821352	0.849000	0.29639	0.467000	0.27180	0.024000	0.10985	3.198000	0.51035	2.840000	0.97914	0.655000	0.94253	CCC	.	.	none		0.572	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
KRTAP4-8	728224	hgsc.bcm.edu	37	17	39254058	39254058	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:39254058G>T	ENST00000333822.4	-	1	335	c.279C>A	c.(277-279)agC>agA	p.S93R		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	93	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						agatgcagcagcTAGGGTGGC	0.677																																					p.S93R		Atlas-SNP	.											KRTAP4-8,NS,carcinoma,0,2	KRTAP4-8	57	2	0			c.C279A						scavenged	.						8.0	11.0	10.0					17																	39254058		683	1581	2264	SO:0001583	missense	728224	exon1			GCAGCAGCTAGGG	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.279C>A	17.37:g.39254058G>T	ENSP00000328444:p.Ser93Arg	Somatic	74	8	0.108108		WXS	Illumina HiSeq	Phase_I	100	14	0.14	NM_031960	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	12.38	1.921689	0.33908	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.01629	4.72	2.84	0.649	0.17806	.	1.381260	0.05066	U	0.480753	T	0.03220	0.0094	M	0.69823	2.125	0.19575	N	0.999964	B	0.13145	0.007	B	0.14578	0.011	T	0.47249	-0.9132	10	0.36615	T	0.2	.	5.5258	0.16957	0.4095:0.0:0.5905:0.0	.	93	Q9BYQ9	KRA48_HUMAN	R	93;78	ENSP00000328444:S93R	ENSP00000414561:S78R	S	-	3	2	KRTAP4-8	36507584	0.001000	0.12720	0.112000	0.21494	0.752000	0.42762	-0.433000	0.06948	0.063000	0.16370	0.456000	0.33151	AGC	.	.	none		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960	
ALG6	29929	hgsc.bcm.edu	37	1	63867944	63867944	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:63867944A>G	ENST00000371108.4	+	4	492	c.187A>G	c.(187-189)Aac>Gac	p.N63D	ALG6_ENST00000263440.4_Missense_Mutation_p.N63D	NM_013339.3	NP_037471.2	Q9Y672	ALG6_HUMAN	ALG6, alpha-1,3-glucosyltransferase	63					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosyltransferase activity (GO:0046527)			endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CAGCAGTGATAACAATTTACA	0.318																																					p.N63D		Atlas-SNP	.											.	ALG6	33	.	0			c.A187G						PASS	.						109.0	109.0	109.0					1																	63867944		2203	4299	6502	SO:0001583	missense	29929	exon4			AGTGATAACAATT	AF063604	CCDS30735.1	1p31.3	2013-03-01	2013-03-01		ENSG00000088035	ENSG00000088035	2.4.1.267		23157	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	604566	"""asparagine-linked glycosylation 6 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""			10359825, 11875054	Standard	NM_013339		Approved		uc021oof.1	Q9Y672	OTTHUMG00000009140	ENST00000371108.4:c.187A>G	1.37:g.63867944A>G	ENSP00000360149:p.Asn63Asp	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	66	4	0.0606061	NM_013339	B3KMU2|Q5SXR9|Q9H3I0	Missense_Mutation	SNP	ENST00000371108.4	37	CCDS30735.1	.	.	.	.	.	.	.	.	.	.	a	26.4	4.734192	0.89482	.	.	ENSG00000088035	ENST00000371108;ENST00000263440	D;D	0.83837	-1.77;-1.77	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	D	0.90515	0.7028	M	0.91406	3.205	0.80722	D	1	D	0.67145	0.996	D	0.72625	0.978	D	0.90800	0.4693	10	0.36615	T	0.2	-20.3602	14.4035	0.67065	1.0:0.0:0.0:0.0	.	63	A2A2G4	.	D	63	ENSP00000360149:N63D;ENSP00000263440:N63D	ENSP00000263440:N63D	N	+	1	0	ALG6	63640532	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.928000	0.92853	1.806000	0.52798	0.455000	0.32223	AAC	.	.	none		0.318	ALG6-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025330.2	NM_013339	
RFX7	64864	hgsc.bcm.edu	37	15	56387864	56387864	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:56387864G>A	ENST00000559447.2	-	9	2042	c.1771C>T	c.(1771-1773)Cag>Tag	p.Q591*	RFX7_ENST00000317318.6_Nonsense_Mutation_p.Q688*|RFX7_ENST00000423270.1_Nonsense_Mutation_p.Q688*|RFX7_ENST00000422057.1_Nonsense_Mutation_p.Q591*			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	591					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						CCTTGTTTCTGCCCTTCTATG	0.458																																					p.Q688X		Atlas-SNP	.											.	RFX7	170	.	0			c.C2062T						PASS	.						119.0	110.0	113.0					15																	56387864		1903	4122	6025	SO:0001587	stop_gained	64864	exon9			GTTTCTGCCCTTC			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.1771C>T	15.37:g.56387864G>A	ENSP00000453281:p.Gln591*	Somatic	242	0	0		WXS	Illumina HiSeq	Phase_I	319	127	0.398119	NM_022841	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Nonsense_Mutation	SNP	ENST00000559447.2	37		.	.	.	.	.	.	.	.	.	.	G	35	5.487851	0.96323	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	.	.	.	5.57	5.57	0.84162	.	0.272984	0.27134	N	0.020761	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-2.2321	18.5333	0.91000	0.0:0.0:1.0:0.0	.	.	.	.	X	591;688;688	.	ENSP00000313299:Q688X	Q	-	1	0	RFX7	54175156	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	4.113000	0.57851	2.600000	0.87896	0.655000	0.94253	CAG	.	.	none		0.458	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
COL11A1	1301	hgsc.bcm.edu	37	1	103491838	103491838	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:103491838C>T	ENST00000370096.3	-	6	1143	c.831G>A	c.(829-831)gaG>gaA	p.E277E	COL11A1_ENST00000512756.1_Silent_p.E277E|COL11A1_ENST00000358392.2_Intron|COL11A1_ENST00000353414.4_Intron	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	277	Nonhelical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCTCTTTATACTCTGCTTCCC	0.418																																					p.E277E		Atlas-SNP	.											COL11A1_ENST00000370096,NS,carcinoma,-2,1	COL11A1	972	1	0			c.G831A						scavenged	.						238.0	208.0	218.0					1																	103491838		2203	4300	6503	SO:0001819	synonymous_variant	1301	exon6			TTTATACTCTGCT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.831G>A	1.37:g.103491838C>T		Somatic	333	0	0		WXS	Illumina HiSeq	Phase_I	374	4	0.0106952	NM_001854	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	37	CCDS778.1																																																																																			.	.	none		0.418	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
MN1	4330	hgsc.bcm.edu	37	22	28194933	28194933	+	Silent	SNP	T	T	C	rs572936881|rs373314940|rs71194738	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:28194933T>C	ENST00000302326.4	-	1	2553	c.1599A>G	c.(1597-1599)caA>caG	p.Q533Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	533	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgctgct	0.652			T	ETV6	"""AML, meningioma"""								T|||	98	0.0195687	0.0613	0.0086	5008	,	,		12327	0.002		0.005	False		,,,				2504	0.0041				p.Q533Q		Atlas-SNP	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	MN1,caecum,carcinoma,0,2	MN1	122	2	0			c.A1599G						scavenged	.	C		9,3561		0,9,1776	4.0	5.0	5.0		1599	-0.4	1.0	22		5	5,7341		0,5,3668	no	coding-synonymous	MN1	NM_002430.2		0,14,5444	CC,CT,TT		0.0681,0.2521,0.1283		533/1321	28194933	14,10902	1785	3673	5458	SO:0001819	synonymous_variant	4330	exon1			CTGCTGTTGCTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1599A>G	22.37:g.28194933T>C		Somatic	46	1	0.0217391		WXS	Illumina HiSeq	Phase_I	38	6	0.157895	NM_002430	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																			.	.	weak		0.652	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
TNFRSF10C	8794	hgsc.bcm.edu	37	8	22974370	22974370	+	Silent	SNP	G	G	A	rs151239314	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:22974370G>A	ENST00000356864.3	+	5	1138	c.606G>A	c.(604-606)ccG>ccA	p.P202P	TNFRSF10C_ENST00000540813.1_Silent_p.P100P	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	202					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		CCACCAGCCCGGGGACTCCTG	0.642																																					p.P202P		Atlas-SNP	.											TNFRSF10C,colon,carcinoma,0,2	TNFRSF10C	30	2	0			c.G606A						scavenged	.						57.0	72.0	67.0					8																	22974370		2203	4297	6500	SO:0001819	synonymous_variant	8794	exon5			CAGCCCGGGGACT	AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.606G>A	8.37:g.22974370G>A		Somatic	143	1	0.00699301		WXS	Illumina HiSeq	Phase_I	152	6	0.0394737	NM_003841	O14755|Q08AS6|Q6FH98|Q6UXM5	Silent	SNP	ENST00000356864.3	37	CCDS6037.1																																																																																			G|0.882;A|0.118	0.118	strong		0.642	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
CNGB3	54714	hgsc.bcm.edu	37	8	87641188	87641188	+	Missense_Mutation	SNP	C	C	T	rs77277189	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:87641188C>T	ENST00000320005.5	-	12	1486	c.1439G>A	c.(1438-1440)cGg>cAg	p.R480Q		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	480					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						ATACCAAGTCCGAACTCGCTT	0.418													C|||	11	0.00219649	0.0083	0.0	5008	,	,		18826	0.0		0.0	False		,,,				2504	0.0				p.R480Q		Atlas-SNP	.											.	CNGB3	176	.	0			c.G1439A						PASS	.	C	GLN/ARG	30,4376	36.0+/-67.5	0,30,2173	221.0	207.0	212.0		1439	4.1	0.8	8	dbSNP_131	212	0,8600		0,0,4300	yes	missense	CNGB3	NM_019098.4	43	0,30,6473	TT,TC,CC		0.0,0.6809,0.2307	probably-damaging	480/810	87641188	30,12976	2203	4300	6503	SO:0001583	missense	54714	exon12			CAAGTCCGAACTC	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.1439G>A	8.37:g.87641188C>T	ENSP00000316605:p.Arg480Gln	Somatic	190	0	0		WXS	Illumina HiSeq	Phase_I	165	41	0.248485	NM_019098	C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	CCDS6244.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	C	22.5	4.298296	0.81025	0.006809	0.0	ENSG00000170289	ENST00000320005	D	0.97186	-4.28	5.92	4.14	0.48551	Cyclic nucleotide-binding-like (1);	0.062472	0.64402	D	0.000013	D	0.94879	0.8345	M	0.68728	2.09	0.52501	D	0.999959	P;P	0.50819	0.939;0.899	P;P	0.47162	0.54;0.49	D	0.92368	0.5903	10	0.33141	T	0.24	.	12.7654	0.57388	0.0:0.8674:0.0:0.1326	.	480;480	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	Q	480	ENSP00000316605:R480Q	ENSP00000316605:R480Q	R	-	2	0	CNGB3	87710304	0.964000	0.33143	0.750000	0.31169	0.945000	0.59286	3.226000	0.51254	0.853000	0.35312	0.555000	0.69702	CGG	C|0.997;T|0.003	0.003	strong		0.418	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098	
LILRB1	10859	hgsc.bcm.edu	37	19	55148031	55148031	+	Silent	SNP	T	T	C	rs41308746	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:55148031T>C	ENST00000396331.1	+	15	2091	c.1734T>C	c.(1732-1734)ccT>ccC	p.P578P	LILRB1_ENST00000396315.1_Silent_p.P580P|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000418536.2_Silent_p.P562P|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396321.2_Silent_p.P578P|LILRB1_ENST00000427581.2_Silent_p.P629P|LILRB1_ENST00000396332.4_Silent_p.P579P|LILRB1_ENST00000396317.1_Silent_p.P562P|LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000434867.2_Silent_p.P578P|LILRB1_ENST00000324602.7_Silent_p.P580P|LILRB1_ENST00000396327.3_Silent_p.P579P	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	578					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CCTCTCCTCCTTCCCCACTGT	0.582										HNSCC(37;0.09)			t|||	554	0.110623	0.1785	0.0893	5008	,	,		16680	0.0139		0.1491	False		,,,				2504	0.0941				p.P580P		Atlas-SNP	.											LILRB1,NS,carcinoma,+2,1	LILRB1	140	1	0			c.T1740C						scavenged	.						111.0	95.0	100.0					19																	55148031		2200	4295	6495	SO:0001819	synonymous_variant	10859	exon14			TCCTCCTTCCCCA	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1734T>C	19.37:g.55148031T>C		Somatic	298	4	0.0134228		WXS	Illumina HiSeq	Phase_I	320	8	0.025	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	ENST00000396331.1	37	CCDS42617.1																																																																																			.	.	weak		0.582	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
GRK4	2868	hgsc.bcm.edu	37	4	2986263	2986263	+	Missense_Mutation	SNP	C	C	T	rs146194528		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:2986263C>T	ENST00000398052.4	+	2	419	c.76C>T	c.(76-78)Cgt>Tgt	p.R26C	GRK4_ENST00000398051.4_Intron|GRK4_ENST00000504933.1_Missense_Mutation_p.R26C|GRK4_ENST00000345167.6_Intron	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4	26	N-terminal.				G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)	p.R26C(1)		lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AAAAAGTGGTCGTAGTAAAAA	0.388																																					p.R26C		Atlas-SNP	.											GRK4_ENST00000398052,NS,carcinoma,0,3	GRK4	72	3	1	Substitution - Missense(1)	large_intestine(1)	c.C76T						scavenged	.	C	,CYS/ARG,CYS/ARG	1,4405		0,1,2202	86.0	82.0	83.0		,76,76	4.7	0.9	4	dbSNP_134	83	0,8600		0,0,4300	no	intron,missense,missense	GRK4	NM_001004056.1,NM_001004057.1,NM_182982.2	,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,probably-damaging,probably-damaging	,26/533,26/579	2986263	1,13005	2203	4300	6503	SO:0001583	missense	2868	exon2			AGTGGTCGTAGTA		CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.76C>T	4.37:g.2986263C>T	ENSP00000381129:p.Arg26Cys	Somatic	292	0	0		WXS	Illumina HiSeq	Phase_I	391	7	0.0179028	NM_182982	O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Missense_Mutation	SNP	ENST00000398052.4	37	CCDS33946.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.034195	0.54896	2.27E-4	0.0	ENSG00000125388	ENST00000398052;ENST00000504933	T;T	0.69685	-0.42;-0.4	4.69	4.69	0.59074	.	0.000000	0.85682	U	0.000000	D	0.82545	0.5060	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.993	D	0.85486	0.1182	10	0.87932	D	0	-21.0407	15.1751	0.72903	0.0:1.0:0.0:0.0	.	26;26	P32298-4;P32298	.;GRK4_HUMAN	C	26	ENSP00000381129:R26C;ENSP00000427445:R26C	ENSP00000381129:R26C	R	+	1	0	GRK4	2956061	1.000000	0.71417	0.945000	0.38365	0.120000	0.20174	3.049000	0.49869	2.431000	0.82371	0.650000	0.86243	CGT	C|1.000;T|0.000	0.000	weak		0.388	GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358176.2	NM_005307	
MPPED1	758	hgsc.bcm.edu	37	22	43870629	43870629	+	Silent	SNP	C	C	T	rs532827143	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:43870629C>T	ENST00000417669.2	+	4	864	c.420C>T	c.(418-420)taC>taT	p.Y140Y	MPPED1_ENST00000542779.1_Silent_p.Y140Y|MPPED1_ENST00000439548.1_5'UTR|MPPED1_ENST00000443721.1_Silent_p.Y140Y|MPPED1_ENST00000414469.2_Silent_p.Y34Y|MPPED1_ENST00000538182.1_Silent_p.Y173Y			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	140							hydrolase activity (GO:0016787)	p.Y140*(1)		endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				GCCTGCCCTACGAGTACAAGA	0.582													C|||	5	0.000998403	0.0	0.0	5008	,	,		22219	0.001		0.0	False		,,,				2504	0.0041				p.Y140Y		Atlas-SNP	.											MPPED1_ENST00000538182,NS,carcinoma,0,5	MPPED1	59	5	1	Substitution - Nonsense(1)	lung(1)	c.C420T						scavenged	.						98.0	100.0	100.0					22																	43870629		2116	4250	6366	SO:0001819	synonymous_variant	758	exon4			GCCCTACGAGTAC	U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.420C>T	22.37:g.43870629C>T		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	110	2	0.0181818	NM_001044370	A8K159|B7Z2S9|Q8N361	Silent	SNP	ENST00000417669.2	37	CCDS46723.1																																																																																			.	.	none		0.582	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318938.2	NM_001044370	
ARID5B	84159	hgsc.bcm.edu	37	10	63852686	63852686	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:63852686G>T	ENST00000279873.7	+	10	3874	c.3464G>T	c.(3463-3465)gGg>gTg	p.G1155V	ARID5B_ENST00000309334.5_Missense_Mutation_p.G912V	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1155					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					AGTTCATATGGGGACCTTTTG	0.468																																					p.G1155V		Atlas-SNP	.											ARID5B,NS,haematopoietic_neoplasm,0,1	ARID5B	125	1	0			c.G3464T						scavenged	.						132.0	135.0	134.0					10																	63852686		2203	4300	6503	SO:0001583	missense	84159	exon10			CATATGGGGACCT	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.3464G>T	10.37:g.63852686G>T	ENSP00000279873:p.Gly1155Val	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	128	3	0.0234375	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	37	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.189564	0.57909	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.60171	0.26;0.21	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.62441	0.2428	M	0.67953	2.075	0.80722	D	1	P	0.37663	0.604	B	0.38616	0.277	T	0.66606	-0.5881	10	0.87932	D	0	-17.1979	19.8646	0.96799	0.0:0.0:1.0:0.0	.	1155	Q14865	ARI5B_HUMAN	V	1155;912	ENSP00000279873:G1155V;ENSP00000308862:G912V	ENSP00000279873:G1155V	G	+	2	0	ARID5B	63522692	1.000000	0.71417	0.999000	0.59377	0.883000	0.51084	7.639000	0.83342	2.702000	0.92279	0.655000	0.94253	GGG	.	.	none		0.468	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
GRB2	2885	hgsc.bcm.edu	37	17	73321980	73321980	+	Splice_Site	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:73321980T>C	ENST00000392562.1	-	4	1080	c.298A>G	c.(298-300)Aag>Gag	p.K100E	GRB2_ENST00000578961.1_Splice_Site_p.N100D|GRB2_ENST00000316804.5_Splice_Site_p.K100E|GRB2_ENST00000462266.1_5'UTR|GRB2_ENST00000316615.5_Intron|GRB2_ENST00000392564.1_Splice_Site_p.K100E|GRB2_ENST00000392563.1_Intron			P62993	GRB2_HUMAN	growth factor receptor-bound protein 2	100	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				aging (GO:0007568)|anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to ionizing radiation (GO:0071479)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of MAPK cascade (GO:0043408)|signal transduction in response to DNA damage (GO:0042770)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Grb2-EGFR complex (GO:0070436)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|identical protein binding (GO:0042802)|insulin receptor substrate binding (GO:0043560)|neurotrophin TRKA receptor binding (GO:0005168)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	17	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	AATACTTACTTGACAGAGAGG	0.522																																					p.K100E		Atlas-SNP	.											.	GRB2	33	.	0			c.A298G						PASS	.						87.0	91.0	90.0					17																	73321980		2203	4300	6503	SO:0001630	splice_region_variant	2885	exon4			CTTACTTGACAGA		CCDS11721.1, CCDS11722.1	17q24-q25	2013-02-14			ENSG00000177885	ENSG00000177885		"""SH2 domain containing"""	4566	protein-coding gene	gene with protein product		108355					Standard	NM_002086		Approved	NCKAP2	uc002jnx.4	P62993	OTTHUMG00000134332	ENST00000392562.1:c.299+1A>G	17.37:g.73321980T>C		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	41	11	0.268293	NM_002086	P29354|Q14450|Q63057|Q63059	Missense_Mutation	SNP	ENST00000392562.1	37	CCDS11721.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.396281	0.83011	.	.	ENSG00000177885	ENST00000316804;ENST00000392562;ENST00000392564	D;D;D	0.89196	-2.48;-2.48;-2.48	5.28	5.28	0.74379	SH2 motif (5);	0.083338	0.85682	D	0.000000	D	0.93239	0.7846	M	0.93420	3.415	0.80722	D	1	B	0.22211	0.066	B	0.35770	0.21	D	0.92705	0.6178	10	0.72032	D	0.01	-25.8083	15.4247	0.75041	0.0:0.0:0.0:1.0	.	100	P62993	GRB2_HUMAN	E	100	ENSP00000339007:K100E;ENSP00000376345:K100E;ENSP00000376347:K100E	ENSP00000339007:K100E	K	-	1	0	GRB2	70833575	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.838000	0.86804	2.240000	0.73641	0.477000	0.44152	AAG	.	.	none		0.522	GRB2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259476.1		Missense_Mutation
DOCK3	1795	hgsc.bcm.edu	37	3	51317590	51317590	+	Silent	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:51317590T>C	ENST00000266037.9	+	27	2900	c.2877T>C	c.(2875-2877)caT>caC	p.H959H		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	959					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GTGACACCCATTTCCAGCACC	0.537																																					p.H959H		Atlas-SNP	.											.	DOCK3	397	.	0			c.T2877C						PASS	.						76.0	77.0	77.0					3																	51317590		2092	4220	6312	SO:0001819	synonymous_variant	1795	exon27			CACCCATTTCCAG	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2877T>C	3.37:g.51317590T>C		Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	228	64	0.280702	NM_004947	O15017	Silent	SNP	ENST00000266037.9	37	CCDS46835.1																																																																																			.	.	none		0.537	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
ZMYND15	84225	hgsc.bcm.edu	37	17	4645298	4645298	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:4645298G>A	ENST00000433935.1	+	4	973	c.916G>A	c.(916-918)Gct>Act	p.A306T	ZMYND15_ENST00000592813.1_Missense_Mutation_p.A306T|CXCL16_ENST00000574412.1_5'Flank|ZMYND15_ENST00000573751.2_Missense_Mutation_p.A306T|CXCL16_ENST00000293778.6_5'Flank|ZMYND15_ENST00000269289.6_Missense_Mutation_p.A306T	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	306					negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						CTTCACCTTTGCTTCCCTTCG	0.567																																					p.A306T		Atlas-SNP	.											.	ZMYND15	87	.	0			c.G916A						PASS	.						79.0	83.0	82.0					17																	4645298		2203	4300	6503	SO:0001583	missense	84225	exon4			ACCTTTGCTTCCC	AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.916G>A	17.37:g.4645298G>A	ENSP00000391742:p.Ala306Thr	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	118	40	0.338983	NM_001136046	B4DXY5|I3L296	Missense_Mutation	SNP	ENST00000433935.1	37	CCDS45584.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806938	0.70797	.	.	ENSG00000141497	ENST00000433935;ENST00000269289	T;T	0.53206	0.67;0.63	5.15	5.15	0.70609	.	0.094778	0.45606	D	0.000355	T	0.53965	0.1829	L	0.29908	0.895	0.33804	D	0.627042	D;D	0.69078	0.997;0.997	D;D	0.73380	0.913;0.98	T	0.64322	-0.6435	10	0.56958	D	0.05	-19.1442	11.1144	0.48252	0.0:0.0:0.8159:0.1841	.	306;306	B4DXY5;Q9H091	.;ZMY15_HUMAN	T	306	ENSP00000391742:A306T;ENSP00000269289:A306T	ENSP00000269289:A306T	A	+	1	0	ZMYND15	4592047	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.585000	0.46111	2.677000	0.91161	0.563000	0.77884	GCT	.	.	none		0.567	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1	NM_032265	
MUC4	4585	hgsc.bcm.edu	37	3	195510706	195510706	+	Missense_Mutation	SNP	G	G	A	rs71291868|rs575062122	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:195510706G>A	ENST00000463781.3	-	2	8204	c.7745C>T	c.(7744-7746)aCt>aTt	p.T2582I	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T2582I	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGTGCTGGTGAC	0.597													.|||	39	0.00778754	0.0023	0.0029	5008	,	,		10501	0.004		0.0179	False		,,,				2504	0.0123				p.T2582I		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,2	MUC4	1505	2	0			c.C7745T						scavenged	.						27.0	24.0	25.0					3																	195510706		681	1574	2255	SO:0001583	missense	4585	exon2			GAGGAAGTGCTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7745C>T	3.37:g.195510706G>A	ENSP00000417498:p.Thr2582Ile	Somatic	106	7	0.0660377		WXS	Illumina HiSeq	Phase_I	92	9	0.0978261	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	9.503	1.103744	0.20632	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32515	1.45;1.5	1.19	1.19	0.21007	.	.	.	.	.	T	0.14700	0.0355	N	0.08118	0	0.24499	N	0.994268	D	0.59357	0.985	B	0.43728	0.429	T	0.09552	-1.0669	8	.	.	.	.	5.8647	0.18768	0.0:0.0:1.0:0.0	.	2582	E7ESK3	.	I	2582	ENSP00000417498:T2582I;ENSP00000420243:T2582I	.	T	-	2	0	MUC4	196995101	0.000000	0.05858	0.013000	0.15412	0.040000	0.13550	-0.183000	0.09712	0.661000	0.30985	0.264000	0.19307	ACT	AAGC|0.500;GTGT|0.500	.	alt		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12907708	12907708	+	Silent	SNP	A	A	G	rs4026149	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:12907708A>G	ENST00000317869.6	-	2	660	c.435T>C	c.(433-435)cgT>cgC	p.R145R		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	145						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						ATAGACGTTGACGTTTCGAGG	0.483																																					p.R145R		Atlas-SNP	.											HNRNPCL1,NS,carcinoma,-1,1	HNRNPCL1	68	1	0			c.T435C						scavenged	.						120.0	124.0	122.0					1																	12907708		2201	4297	6498	SO:0001819	synonymous_variant	343069	exon2			ACGTTGACGTTTC	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.435T>C	1.37:g.12907708A>G		Somatic	199	7	0.0351759		WXS	Illumina HiSeq	Phase_I	198	6	0.030303	NM_001013631	B2RP44	Silent	SNP	ENST00000317869.6	37	CCDS30591.1																																																																																			A|0.667;G|0.333	0.333	strong		0.483	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
TMCC2	9911	hgsc.bcm.edu	37	1	205238355	205238355	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:205238355A>G	ENST00000358024.3	+	3	1414	c.1025A>G	c.(1024-1026)aAg>aGg	p.K342R	TMCC2_ENST00000329800.7_Missense_Mutation_p.K102R|TMCC2_ENST00000545499.1_Missense_Mutation_p.K264R|TMCC2_ENST00000330675.7_Missense_Mutation_p.K117R|TMCC2_ENST00000495538.1_3'UTR	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	342						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			AAGAACCAGAAGTCAGCCCAG	0.592																																					p.K342R		Atlas-SNP	.											.	TMCC2	89	.	0			c.A1025G						PASS	.						57.0	46.0	50.0					1																	205238355		2203	4300	6503	SO:0001583	missense	9911	exon3			ACCAGAAGTCAGC	AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.1025A>G	1.37:g.205238355A>G	ENSP00000350718:p.Lys342Arg	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	83	4	0.0481928	NM_014858	A2RRH3|B7Z1P7|Q6ZN09	Missense_Mutation	SNP	ENST00000358024.3	37	CCDS30984.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.746863	0.89663	.	.	ENSG00000133069	ENST00000358024;ENST00000545499;ENST00000367159;ENST00000330675;ENST00000329800	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.64811	0.2632	L	0.59912	1.85	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.972	D;D;D;D	0.87578	0.998;0.997;0.998;0.946	T	0.62609	-0.6818	10	0.35671	T	0.21	.	15.5977	0.76599	1.0:0.0:0.0:0.0	.	138;102;117;342	Q8IW47;G5E963;B2RAX5;O75069	.;.;.;TMCC2_HUMAN	R	342;264;146;117;102	ENSP00000350718:K342R;ENSP00000437943:K264R;ENSP00000356127:K146R;ENSP00000331842:K117R;ENSP00000329436:K102R	ENSP00000329436:K102R	K	+	2	0	TMCC2	203504978	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.339000	0.96797	2.170000	0.68504	0.379000	0.24179	AAG	.	.	none		0.592	TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090383.1	NM_014858	
ANKRD36	375248	hgsc.bcm.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	A	T	rs76309140		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:97869931A>T	ENST00000461153.2	+	50	3236	c.2992A>T	c.(2992-2994)Aca>Tca	p.T998S	ANKRD36_ENST00000420699.2_Missense_Mutation_p.T998S			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998								p.T998S(13)		endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						CATTCAGGCTACAAGTGATGA	0.289																																					p.T998S		Atlas-SNP	.											ANKRD36_ENST00000420699,NS,carcinoma,0,14	ANKRD36	170	14	13	Substitution - Missense(13)	kidney(6)|endometrium(4)|prostate(3)	c.A2992T						scavenged	.						37.0	44.0	42.0					2																	97869931		692	1587	2279	SO:0001583	missense	375248	exon50			CAGGCTACAAGTG	BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2992A>T	2.37:g.97869931A>T	ENSP00000419530:p.Thr998Ser	Somatic	27	1	0.037037		WXS	Illumina HiSeq	Phase_I	23	4	0.173913	NM_001164315	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	ENST00000461153.2	37	CCDS54379.1	.	.	.	.	.	.	.	.	.	.	.	3.819	-0.038219	0.07497	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.32753	1.44;1.44	0.63	-0.824	0.10812	.	.	.	.	.	T	0.14056	0.0340	L	0.27053	0.805	0.09310	N	1	P	0.40476	0.718	B	0.28849	0.095	T	0.12837	-1.0532	8	0.38643	T	0.18	.	.	.	.	.	998	A6QL64	AN36A_HUMAN	S	998;998;360	ENSP00000419530:T998S;ENSP00000391950:T998S	ENSP00000391950:T998S	T	+	1	0	ANKRD36	97233658	0.019000	0.18553	0.011000	0.14972	0.022000	0.10575	-0.850000	0.04317	-0.324000	0.08589	0.147000	0.16070	ACA	.	.	weak		0.289	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5		
SRP68	6730	hgsc.bcm.edu	37	17	74063378	74063378	+	Silent	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:74063378T>C	ENST00000307877.2	-	3	446	c.285A>G	c.(283-285)cgA>cgG	p.R95R	SRP68_ENST00000355113.5_5'UTR|SRP68_ENST00000539137.1_Intron	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	95					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						TGAGTGTTTTTCGAAGACGTC	0.408																																					p.R95R		Atlas-SNP	.											SRP68,colon,carcinoma,-1,1	SRP68	61	1	0			c.A285G						scavenged	.						210.0	184.0	193.0					17																	74063378		2203	4300	6503	SO:0001819	synonymous_variant	6730	exon3			TGTTTTTCGAAGA	AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.285A>G	17.37:g.74063378T>C		Somatic	251	1	0.00398406		WXS	Illumina HiSeq	Phase_I	284	5	0.0176056	NM_014230	B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	Silent	SNP	ENST00000307877.2	37	CCDS11738.1																																																																																			.	.	none		0.408	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449487.1	NM_014230	
NRF1	4899	hgsc.bcm.edu	37	7	129317486	129317486	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:129317486C>T	ENST00000393232.1	+	4	470	c.353C>T	c.(352-354)aCg>aTg	p.T118M	NRF1_ENST00000353868.4_Missense_Mutation_p.T118M|NRF1_ENST00000539636.1_5'UTR|NRF1_ENST00000223190.4_Missense_Mutation_p.T118M|NRF1_ENST00000393231.3_Missense_Mutation_p.T118M|NRF1_ENST00000311967.2_Missense_Mutation_p.T118M|NRF1_ENST00000393230.2_Missense_Mutation_p.T118M	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	118					cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						CTTCGAGCCACGTTAGATGAA	0.393																																					p.T118M		Atlas-SNP	.											NRF1,NS,carcinoma,0,1	NRF1	40	1	0			c.C353T						scavenged	.						146.0	131.0	136.0					7																	129317486		2203	4300	6503	SO:0001583	missense	4899	exon4			GAGCCACGTTAGA	L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.353C>T	7.37:g.129317486C>T	ENSP00000376924:p.Thr118Met	Somatic	95	1	0.0105263		WXS	Illumina HiSeq	Phase_I	112	3	0.0267857	NM_005011	A8K4C6|B4DDV6|Q15305|Q96AN2	Missense_Mutation	SNP	ENST00000393232.1	37	CCDS5813.2	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566805	0.65651	.	.	ENSG00000106459	ENST00000393232;ENST00000353868;ENST00000454688;ENST00000223190;ENST00000311967;ENST00000393230;ENST00000393231	.	.	.	4.87	4.87	0.63330	Nuclear respiratory factor 1, NLS/DNA-binding, dimerisation domain (1);	0.000000	0.85682	D	0.000000	T	0.60958	0.2309	M	0.67953	2.075	0.80722	D	1	P;D	0.54207	0.88;0.965	B;P	0.44732	0.329;0.459	T	0.65631	-0.6121	9	0.44086	T	0.13	-16.1707	17.3667	0.87366	0.0:1.0:0.0:0.0	.	118;118	Q96AN2;Q16656	.;NRF1_HUMAN	M	118	.	ENSP00000223190:T118M	T	+	2	0	NRF1	129104722	1.000000	0.71417	0.965000	0.40720	0.988000	0.76386	7.343000	0.79319	2.405000	0.81733	0.603000	0.83216	ACG	.	.	none		0.393	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289813.1	NM_001040110	
KMT2C	58508	hgsc.bcm.edu	37	7	151932991	151932991	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:151932991G>A	ENST00000262189.6	-	16	2898	c.2680C>T	c.(2680-2682)Cgg>Tgg	p.R894W	KMT2C_ENST00000355193.2_Missense_Mutation_p.R894W	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	894					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CGAGGTCTCCGCTTTCCTGGA	0.507																																					p.R894W		Atlas-SNP	.											MLL3_ENST00000355193,NS,malignant_melanoma,+2,4	MLL3	1564	4	0			c.C2680T						scavenged	.						32.0	34.0	33.0					7																	151932991		2203	4295	6498	SO:0001583	missense	58508	exon16			GTCTCCGCTTTCC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2680C>T	7.37:g.151932991G>A	ENSP00000262189:p.Arg894Trp	Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	192	6	0.03125	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.65|15.65	2.896744|2.896744	0.52121|0.52121	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000418673|ENST00000262189;ENST00000355193	.|D;D	.|0.89875	.|-2.57;-2.58	5.1|5.1	2.1|2.1	0.27182|0.27182	.|.	.|0.000000	.|0.42294	.|D	.|0.000721	D|D	0.91952|0.91952	0.7451|0.7451	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.79784	.|0.993	D|D	0.91065|0.91065	0.4888|0.4888	5|10	.|0.87932	.|D	.|0	.|.	9.9957|9.9957	0.41898|0.41898	0.0:0.1323:0.5941:0.2736|0.0:0.1323:0.5941:0.2736	.|.	.|894	.|Q8NEZ4	.|MLL3_HUMAN	V|W	49|894	.|ENSP00000262189:R894W;ENSP00000347325:R894W	.|ENSP00000262189:R894W	A|R	-|-	2|1	0|2	MLL3|MLL3	151563924|151563924	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.946000|0.946000	0.59487|0.59487	2.043000|2.043000	0.41231|0.41231	0.653000|0.653000	0.30826|0.30826	-0.885000|-0.885000	0.02943|0.02943	GCG|CGG	.	.	none		0.507	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
HRCT1	646962	hgsc.bcm.edu	37	9	35906607	35906607	+	Missense_Mutation	SNP	G	G	C	rs201684694		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:35906607G>C	ENST00000354323.2	+	1	419	c.323G>C	c.(322-324)cGc>cCc	p.R108P	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	108	His-rich.					integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						cacccccaccgccaccatccc	0.677																																					p.R108P		Atlas-SNP	.											HRCT1,NS,carcinoma,0,1	HRCT1	14	1	0			c.G323C						scavenged	.						5.0	6.0	5.0					9																	35906607		1670	3248	4918	SO:0001583	missense	646962	exon1			CCCACCGCCACCA		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.323G>C	9.37:g.35906607G>C	ENSP00000346283:p.Arg108Pro	Somatic	32	2	0.0625		WXS	Illumina HiSeq	Phase_I	22	11	0.5	NM_001039792	B7ZBJ1	Missense_Mutation	SNP	ENST00000354323.2	37	CCDS35012.1	.	.	.	.	.	.	.	.	.	.	G	3.247	-0.154060	0.06585	.	.	ENSG00000196196	ENST00000354323	.	.	.	0.698	-1.4	0.08968	.	0.824948	0.09848	N	0.747995	T	0.09335	0.0230	N	0.08118	0	0.09310	N	1	D	0.53312	0.959	B	0.36989	0.238	T	0.17077	-1.0381	8	0.87932	D	0	-29.2099	.	.	.	.	108	Q6UXD1	HRCT1_HUMAN	P	108	.	ENSP00000346283:R108P	R	+	2	0	HRCT1	35896607	0.000000	0.05858	0.002000	0.10522	0.343000	0.28985	-0.250000	0.08830	-0.783000	0.04534	-0.346000	0.07831	CGC	.	.	alt		0.677	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334099.1	NM_001039792	
KDM2A	22992	hgsc.bcm.edu	37	11	67022437	67022437	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:67022437C>T	ENST00000529006.2	+	21	3846	c.3400C>T	c.(3400-3402)Cga>Tga	p.R1134*	KDM2A_ENST00000530342.1_Nonsense_Mutation_p.R695*|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_3'UTR|KDM2A_ENST00000308783.5_Nonsense_Mutation_p.R592*	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	1134					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						GCAGATCACTCGAAAAGCCTG	0.512																																					p.R1134X		Atlas-SNP	.											KDM2A,NS,carcinoma,-1,2	KDM2A	80	2	0			c.C3400T						scavenged	.						85.0	84.0	84.0					11																	67022437		2036	4196	6232	SO:0001587	stop_gained	22992	exon21			ATCACTCGAAAAG	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.3400C>T	11.37:g.67022437C>T	ENSP00000432786:p.Arg1134*	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	145	2	0.0137931	NM_012308	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Nonsense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	C	41	8.657581	0.98903	.	.	ENSG00000173120	ENST00000529006;ENST00000530342;ENST00000308783	.	.	.	5.32	2.23	0.28157	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-9.443	13.9094	0.63857	0.5415:0.4585:0.0:0.0	.	.	.	.	X	1134;695;592	.	ENSP00000309302:R592X	R	+	1	2	KDM2A	66779013	0.575000	0.26692	0.996000	0.52242	0.997000	0.91878	0.549000	0.23329	0.287000	0.22375	0.655000	0.94253	CGA	.	.	none		0.512	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308	
DPY19L4	286148	hgsc.bcm.edu	37	8	95800214	95800214	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:95800214C>T	ENST00000414645.2	+	18	2040	c.1941C>T	c.(1939-1941)atC>atT	p.I647I		NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	647						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					AGGATGCTATCTGCAATGAGG	0.353																																					p.I647I		Atlas-SNP	.											DPY19L4,NS,carcinoma,+2,1	DPY19L4	60	1	0			c.C1941T						scavenged	.						69.0	72.0	71.0					8																	95800214		2203	4300	6503	SO:0001819	synonymous_variant	286148	exon18			TGCTATCTGCAAT		CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.1941C>T	8.37:g.95800214C>T		Somatic	276	2	0.00724638		WXS	Illumina HiSeq	Phase_I	279	3	0.0107527	NM_181787	Q6ZW32|Q6ZW42|Q7Z329	Silent	SNP	ENST00000414645.2	37	CCDS34924.1																																																																																			.	.	none		0.353	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379339.1	NM_181787	
VPS33A	65082	hgsc.bcm.edu	37	12	122748725	122748725	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:122748725G>A	ENST00000267199.4	-	2	236	c.124C>T	c.(124-126)Cta>Tta	p.L42L	VPS33A_ENST00000451053.2_Silent_p.L42L|RP11-512M8.5_ENST00000535844.1_Silent_p.L42L|VPS33A_ENST00000542310.1_5'UTR	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	42					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		GGTCCAGTTAGGTATTCATCC	0.343																																					p.L42L		Atlas-SNP	.											VPS33A,NS,carcinoma,+2,1	VPS33A	61	1	0			c.C124T						scavenged	.						128.0	129.0	129.0					12																	122748725		2203	4299	6502	SO:0001819	synonymous_variant	65082	exon2			CAGTTAGGTATTC	AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.124C>T	12.37:g.122748725G>A		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	185	3	0.0162162	NM_022916	Q547V4|Q9H5Q0	Silent	SNP	ENST00000267199.4	37	CCDS9231.1																																																																																			.	.	none		0.343	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401607.2		
PLIN4	729359	hgsc.bcm.edu	37	19	4511679	4511679	+	Missense_Mutation	SNP	C	C	T	rs200355083		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:4511679C>T	ENST00000301286.3	-	3	2250	c.2251G>A	c.(2251-2253)Gct>Act	p.A751T		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	751	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GTGGACACAGCATCTTTAGTG	0.582																																					p.A751T		Atlas-SNP	.											PLIN4,NS,carcinoma,+2,1	PLIN4	191	1	0			c.G2251A						scavenged	.						120.0	88.0	99.0					19																	4511679		2009	4153	6162	SO:0001583	missense	729359	exon3			ACACAGCATCTTT	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2251G>A	19.37:g.4511679C>T	ENSP00000301286:p.Ala751Thr	Somatic	111	29	0.261261		WXS	Illumina HiSeq	Phase_I	124	25	0.201613	NM_001080400	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	c	0.021	-1.419065	0.01136	.	.	ENSG00000167676	ENST00000301286	T	0.05513	3.43	4.76	-1.11	0.09840	.	0.458324	0.18290	N	0.145745	T	0.02688	0.0081	N	0.11313	0.125	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47355	-0.9124	10	0.10377	T	0.69	-1.9713	8.3707	0.32412	0.0:0.2324:0.1029:0.6646	.	751	Q96Q06	PLIN4_HUMAN	T	751	ENSP00000301286:A751T	ENSP00000301286:A751T	A	-	1	0	PLIN4	4462679	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.799000	0.00762	-0.765000	0.04645	-4.265000	0.00008	GCT	.	.	weak		0.582	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
SVEP1	79987	hgsc.bcm.edu	37	9	113259095	113259095	+	Splice_Site	SNP	C	C	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:113259095C>G	ENST00000401783.2	-	8	2136	c.1800G>C	c.(1798-1800)aaG>aaC	p.K600N	SVEP1_ENST00000302728.8_Splice_Site_p.K600N|SVEP1_ENST00000374461.1_Splice_Site_p.K577N|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Splice_Site_p.K577N	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	600	HYR 1. {ECO:0000255|PROSITE- ProRule:PRU00113}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.K600N(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CAAACCTTACCTTTTCACCAG	0.383																																					p.K600N		Atlas-SNP	.											SVEP1,colon,carcinoma,0,1	SVEP1	326	1	1	Substitution - Missense(1)	large_intestine(1)	c.G1800C						PASS	.						122.0	110.0	114.0					9																	113259095		1867	4071	5938	SO:0001630	splice_region_variant	79987	exon8			CCTTACCTTTTCA	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1800+1G>C	9.37:g.113259095C>G		Somatic	204	0	0		WXS	Illumina HiSeq	Phase_I	198	60	0.30303	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181594	0.57800	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.77750	-0.97;-0.98;-1.12;1.21	5.71	4.81	0.61882	Hyalin (2);	0.152075	0.64402	D	0.000013	T	0.70657	0.3249	N	0.16233	0.39	0.39786	D	0.972375	P;P;P	0.43231	0.801;0.801;0.557	P;B;B	0.49192	0.602;0.339;0.167	T	0.69993	-0.4994	9	.	.	.	.	13.6089	0.62063	0.0:0.9241:0.0:0.0759	.	600;600;600	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	N	600;577;600;577	ENSP00000384917:K600N;ENSP00000363593:K577N;ENSP00000304118:K600N;ENSP00000363585:K577N	.	K	-	3	2	SVEP1	112298916	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	6.089000	0.71384	1.430000	0.47334	-0.237000	0.12165	AAG	.	.	none		0.383	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			Missense_Mutation
SBNO2	22904	hgsc.bcm.edu	37	19	1113655	1113655	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:1113655T>C	ENST00000361757.3	-	19	2363	c.2126A>G	c.(2125-2127)gAg>gGg	p.E709G	SBNO2_ENST00000587024.1_Missense_Mutation_p.E699G|SBNO2_ENST00000438103.2_Missense_Mutation_p.E652G	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	709					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCACCCGCTCCAGGACCCC	0.672																																					p.E709G		Atlas-SNP	.											SBNO2_ENST00000250872,NS,carcinoma,-1,2	SBNO2	112	2	0			c.A2126G						scavenged	.						10.0	13.0	12.0					19																	1113655		1842	4087	5929	SO:0001583	missense	22904	exon19			ACCCGCTCCAGGA	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.2126A>G	19.37:g.1113655T>C	ENSP00000354733:p.Glu709Gly	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	110	4	0.0363636	NM_014963	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	37	CCDS45894.1	.	.	.	.	.	.	.	.	.	.	T	14.10	2.433610	0.43224	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	.	.	.	4.3	4.3	0.51218	.	0.134734	0.47093	D	0.000251	T	0.59500	0.2198	M	0.77486	2.375	0.32992	D	0.525124	B;B	0.27498	0.113;0.18	B;B	0.29862	0.05;0.108	T	0.70655	-0.4812	9	0.49607	T	0.09	-35.9957	12.7593	0.57354	0.0:0.0:0.0:1.0	.	709;652	Q9Y2G9;Q9Y2G9-3	SBNO2_HUMAN;.	G	709;652;716	.	ENSP00000250872:E716G	E	-	2	0	SBNO2	1064655	0.932000	0.31603	0.915000	0.36163	0.319000	0.28217	3.171000	0.50824	1.805000	0.52779	0.459000	0.35465	GAG	.	.	none		0.672	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
MYC	4609	hgsc.bcm.edu	37	8	128752802	128752802	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128752802G>C	ENST00000377970.2	+	3	1473	c.963G>C	c.(961-963)caG>caC	p.Q321H	MYC_ENST00000524013.1_Missense_Mutation_p.Q320H	NM_002467.4	NP_002458	P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	306					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	CCACACATCAGCACAACTACG	0.567		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""																																p.Q321H		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	MYC_ENST00000377970,NS,carcinoma,+2,2	MYC	168	2	0			c.G963C						scavenged	.						87.0	66.0	73.0					8																	128752802		2203	4300	6503	SO:0001583	missense	4609	exon3			ACATCAGCACAAC		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000377970.2:c.963G>C	8.37:g.128752802G>C	ENSP00000367207:p.Gln321His	Somatic	131	1	0.00763359		WXS	Illumina HiSeq	Phase_I	127	46	0.362205	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000377970.2	37	CCDS6359.2	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437078	0.62955	.	.	ENSG00000136997	ENST00000377970;ENST00000524013;ENST00000454617	T;T	0.29142	1.58;1.58	5.54	3.75	0.43078	Transcription regulator Myc, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53136	-0.8481	10	0.87932	D	0	-23.0286	7.9696	0.30119	0.3035:0.0:0.6965:0.0	.	306	P01106	MYC_HUMAN	H	321;320;287	ENSP00000367207:Q321H;ENSP00000430235:Q320H	ENSP00000367207:Q321H	Q	+	3	2	MYC	128821984	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	0.831000	0.27476	1.338000	0.45544	0.650000	0.86243	CAG	.	.	none		0.567	MYC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250277.3		
SALL2	6297	hgsc.bcm.edu	37	14	21992636	21992636	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr14:21992636C>T	ENST00000327430.3	-	2	1520	c.1226G>A	c.(1225-1227)cGt>cAt	p.R409H	SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000450879.2_Missense_Mutation_p.R272H|SALL2_ENST00000538754.1_Intron	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	409					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R409H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GGTGGTAAAACGGTTTCCACA	0.537																																					p.R409H		Atlas-SNP	.											SALL2,scalp,malignant_melanoma,-1,2	SALL2	95	2	1	Substitution - Missense(1)	large_intestine(1)	c.G1226A						scavenged	.						124.0	103.0	110.0					14																	21992636		2203	4300	6503	SO:0001583	missense	6297	exon2			GTAAAACGGTTTC	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.1226G>A	14.37:g.21992636C>T	ENSP00000333537:p.Arg409His	Somatic	174	1	0.00574713		WXS	Illumina HiSeq	Phase_I	200	2	0.01	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.160985|4.160985	0.78226|0.78226	.|.	.|.	ENSG00000165821|ENSG00000165821	ENST00000327430;ENST00000450879;ENST00000541876|ENST00000546363	T;T|.	0.53640|.	0.61;0.61|.	4.63|4.63	4.63|4.63	0.57726|0.57726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.38111|.	N|.	0.001809|.	T|T	0.55893|0.55893	0.1949|0.1949	L|L	0.33093|0.33093	0.98|0.98	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.999;0.999;0.999;0.999|.	T|T	0.51896|0.51896	-0.8647|-0.8647	10|5	0.87932|.	D|.	0|.	-36.6116|-36.6116	15.0135|15.0135	0.71567|0.71567	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	272;272;407;409|.	B4DK65;E7EW59;B4DFD9;Q9Y467|.	.;.;.;SALL2_HUMAN|.	H|I	409;272;409|268	ENSP00000333537:R409H;ENSP00000396773:R272H|.	ENSP00000333537:R409H|.	R|V	-|-	2|1	0|0	SALL2|SALL2	21062476|21062476	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.905000|0.905000	0.53344|0.53344	7.651000|7.651000	0.83577|0.83577	2.398000|2.398000	0.81561|0.81561	0.655000|0.655000	0.94253|0.94253	CGT|GTT	.	.	none		0.537	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
TKT	7086	hgsc.bcm.edu	37	3	53259825	53259825	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:53259825T>C	ENST00000462138.1	-	14	1907	c.1819A>G	c.(1819-1821)Atc>Gtc	p.I607V	TKT_ENST00000423525.2_Missense_Mutation_p.I607V|TKT_ENST00000423516.1_Missense_Mutation_p.I615V|TKT_ENST00000296289.6_Missense_Mutation_p.I560V|TKT_ENST00000461139.1_5'UTR			P29401	TKT_HUMAN	transketolase	607					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		TCCCTGTCGATACCAAACATC	0.572																																					p.I615V	Colon(133;1506 2347 35238 42177)	Atlas-SNP	.											TKT,NS,carcinoma,+2,1	TKT	38	1	0			c.A1843G						scavenged	.						94.0	79.0	84.0					3																	53259825		2203	4300	6503	SO:0001583	missense	7086	exon15			TGTCGATACCAAA		CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.1819A>G	3.37:g.53259825T>C	ENSP00000417773:p.Ile607Val	Somatic	161	1	0.00621118		WXS	Illumina HiSeq	Phase_I	129	3	0.0232558	NM_001258028	A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Missense_Mutation	SNP	ENST00000462138.1	37	CCDS2871.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.939903	0.52972	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289;ENST00000414014	D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78	5.49	5.49	0.81192	Transketolase, C-terminal (1);Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (1);Transketolase-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94978	0.8375	M	0.77103	2.36	0.80722	D	1	P;B;B	0.41475	0.751;0.33;0.087	P;B;B	0.61800	0.894;0.185;0.06	D	0.94911	0.8065	10	0.52906	T	0.07	-17.0819	15.5932	0.76554	0.0:0.0:0.0:1.0	.	615;524;607	E7EPA7;B3KSI4;P29401	.;.;TKT_HUMAN	V	607;607;615;560;441	ENSP00000417773:I607V;ENSP00000405455:I607V;ENSP00000391481:I615V;ENSP00000296289:I560V	ENSP00000296289:I560V	I	-	1	0	TKT	53234865	1.000000	0.71417	0.989000	0.46669	0.500000	0.33767	7.788000	0.85771	2.074000	0.62210	0.460000	0.39030	ATC	.	.	none		0.572	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350356.1		
ID3	3399	hgsc.bcm.edu	37	1	23885690	23885690	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:23885690G>T	ENST00000374561.5	-	1	595	c.228C>A	c.(226-228)taC>taA	p.Y76*	ID3_ENST00000486541.1_5'UTR	NM_002167.4	NP_002158.3	Q02535	ID3_HUMAN	inhibitor of DNA binding 3, dominant negative helix-loop-helix protein	76	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				central nervous system development (GO:0007417)|epithelial cell differentiation (GO:0030855)|heart development (GO:0007507)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|notochord development (GO:0030903)|odontogenesis (GO:0042476)|positive regulation of apoptotic process (GO:0043065)|regulation of cell cycle (GO:0051726)|regulation of DNA replication (GO:0006275)|response to wounding (GO:0009611)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|lung(3)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00314)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;8.83e-25)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;6.5e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		GGTCGAGAATGTAGTCGATGA	0.622																																					p.Y76X		Atlas-SNP	.											ID3,NS,lymphoid_neoplasm,-1,1	ID3	29	1	0			c.C228A						PASS	.						58.0	64.0	62.0					1																	23885690		2203	4300	6503	SO:0001587	stop_gained	3399	exon1			GAGAATGTAGTCG	X69111	CCDS237.1	1p36.13-p36.12	2013-05-21			ENSG00000117318	ENSG00000117318		"""Basic helix-loop-helix proteins"""	5362	protein-coding gene	gene with protein product		600277				1628620	Standard	NM_002167		Approved	HEIR-1, bHLHb25	uc001bhh.4	Q02535	OTTHUMG00000003229	ENST00000374561.5:c.228C>A	1.37:g.23885690G>T	ENSP00000363689:p.Tyr76*	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	111	70	0.630631	NM_002167	A8K1T8|O75641	Nonsense_Mutation	SNP	ENST00000374561.5	37	CCDS237.1	.	.	.	.	.	.	.	.	.	.	G	39	7.592021	0.98378	.	.	ENSG00000117318	ENST00000374561	.	.	.	5.6	3.74	0.42951	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.6025	10.9515	0.47332	0.1528:0.0:0.8472:0.0	.	.	.	.	X	76	.	ENSP00000363689:Y76X	Y	-	3	2	ID3	23758277	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.456000	0.53000	0.736000	0.32559	0.591000	0.81541	TAC	.	.	none		0.622	ID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008904.1	NM_002167	
PFKFB2	5208	hgsc.bcm.edu	37	1	207242832	207242832	+	Silent	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:207242832C>A	ENST00000367080.3	+	11	1175	c.1051C>A	c.(1051-1053)Cga>Aga	p.R351R	PFKFB2_ENST00000545806.1_Silent_p.R318R|PFKFB2_ENST00000367079.2_Silent_p.R351R|PFKFB2_ENST00000541914.1_Silent_p.R165R|PFKFB2_ENST00000473310.1_3'UTR|PFKFB2_ENST00000411990.2_Silent_p.R253R	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	351	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					GTTTGCACTTCGAGATCAAGA	0.463																																					p.R351R		Atlas-SNP	.											PFKFB2_ENST00000367079,bladder,carcinoma,0,4	PFKFB2	70	4	0			c.C1051A						scavenged	.						185.0	161.0	169.0					1																	207242832		2203	4300	6503	SO:0001819	synonymous_variant	5208	exon11			GCACTTCGAGATC		CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.1051C>A	1.37:g.207242832C>A		Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	182	2	0.010989	NM_001018053	O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Silent	SNP	ENST00000367080.3	37	CCDS31004.1																																																																																			.	.	none		0.463	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087838.1		
UGT2B28	54490	hgsc.bcm.edu	37	4	70152499	70152499	+	Silent	SNP	T	T	A	rs41292341	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:70152499T>A	ENST00000335568.5	+	3	902	c.900T>A	c.(898-900)ggT>ggA	p.G300G	UGT2B28_ENST00000511240.1_Silent_p.G300G	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	300					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						AGAGCTCTGGTGAAAATGGTG	0.413													t|||	142	0.0283546	0.0371	0.036	5008	,	,		10829	0.004		0.0388	False		,,,				2504	0.0256				p.G300G		Atlas-SNP	.											UGT2B28,caecum,carcinoma,0,1	UGT2B28	101	1	0			c.T900A						scavenged	.	A	,	93,4047		15,63,1992	140.0	158.0	152.0		900,900	0.7	1.0	4	dbSNP_127	152	305,8197		44,217,3990	no	coding-synonymous,coding-synonymous	UGT2B28	NM_001207004.1,NM_053039.1	,	59,280,5982	AA,AT,TT		3.5874,2.2464,3.1482	,	300/336,300/530	70152499	398,12244	2070	4251	6321	SO:0001819	synonymous_variant	54490	exon3			CTCTGGTGAAAAT	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.900T>A	4.37:g.70152499T>A		Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	183	7	0.0382514	NM_053039	B5BUM0|Q9BY62|Q9BY63	Silent	SNP	ENST00000335568.5	37	CCDS3528.1																																																																																			T|0.972;A|0.028	0.028	strong		0.413	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	
TRIM58	25893	hgsc.bcm.edu	37	1	248039526	248039526	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:248039526C>T	ENST00000366481.3	+	6	1244	c.1196C>T	c.(1195-1197)tCa>tTa	p.S399L	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	399	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GCCTCCCCATCAGTGCCTCTT	0.502																																					p.S399L		Atlas-SNP	.											TRIM58,NS,carcinoma,0,1	TRIM58	143	1	0			c.C1196T						scavenged	.						141.0	144.0	143.0					1																	248039526		2203	4300	6503	SO:0001583	missense	25893	exon6			CCCCATCAGTGCC	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1196C>T	1.37:g.248039526C>T	ENSP00000355437:p.Ser399Leu	Somatic	186	0	0		WXS	Illumina HiSeq	Phase_I	209	3	0.0143541	NM_015431	Q6B0H9	Missense_Mutation	SNP	ENST00000366481.3	37	CCDS1636.1	.	.	.	.	.	.	.	.	.	.	C	5.434	0.265163	0.10294	.	.	ENSG00000162722	ENST00000366481	T	0.68765	-0.35	4.05	3.12	0.35913	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.264625	0.27240	N	0.020271	T	0.50000	0.1590	N	0.20304	0.555	0.33930	D	0.641959	B	0.20052	0.041	B	0.32022	0.139	T	0.52245	-0.8601	10	0.11485	T	0.65	.	11.2734	0.49153	0.184:0.816:0.0:0.0	.	399	Q8NG06	TRI58_HUMAN	L	399	ENSP00000355437:S399L	ENSP00000355437:S399L	S	+	2	0	TRIM58	246106149	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.084000	0.14891	1.266000	0.44231	0.650000	0.86243	TCA	.	.	none		0.502	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431	
GPR101	83550	hgsc.bcm.edu	37	X	136112327	136112327	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chrX:136112327C>T	ENST00000298110.1	-	1	1506	c.1507G>A	c.(1507-1509)Gat>Aat	p.D503N		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	503						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					GTAGCAGAATCGTAGGAAGGG	0.463																																					p.D503N		Atlas-SNP	.											.	GPR101	96	.	0			c.G1507A						PASS	.						82.0	76.0	78.0					X																	136112327		2203	4300	6503	SO:0001583	missense	83550	exon1			CAGAATCGTAGGA	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1507G>A	X.37:g.136112327C>T	ENSP00000298110:p.Asp503Asn	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	48	33	0.6875	NM_054021	Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	C	2.727	-0.265337	0.05754	.	.	ENSG00000165370	ENST00000298110	T	0.64618	-0.11	5.32	0.906	0.19314	.	.	.	.	.	T	0.38772	0.1053	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.06405	0.002	T	0.21759	-1.0236	9	0.45353	T	0.12	-6.3616	3.4501	0.07495	0.2836:0.4116:0.0:0.3048	.	503	Q96P66	GP101_HUMAN	N	503	ENSP00000298110:D503N	ENSP00000298110:D503N	D	-	1	0	GPR101	135939993	0.319000	0.24607	0.010000	0.14722	0.254000	0.26022	0.603000	0.24149	0.194000	0.20326	-0.511000	0.04467	GAT	.	.	none		0.463	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		
PRAMEF2	65122	hgsc.bcm.edu	37	1	12921277	12921277	+	Silent	SNP	A	A	G	rs3204826	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:12921277A>G	ENST00000240189.2	+	4	1155	c.1068A>G	c.(1066-1068)ttA>ttG	p.L356L		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	356					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L356F(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCCTCGTGTTAGAGGGCTGTC	0.542													.|||	93	0.0185703	0.0091	0.0115	5008	,	,		23369	0.0437		0.008	False		,,,				2504	0.0215				p.L356L		Atlas-SNP	.											PRAMEF2,NS,carcinoma,0,1	PRAMEF2	85	1	1	Substitution - Missense(1)	prostate(1)	c.A1068G						scavenged	.						161.0	158.0	159.0					1																	12921277		2201	4291	6492	SO:0001819	synonymous_variant	65122	exon4			CGTGTTAGAGGGC		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.1068A>G	1.37:g.12921277A>G		Somatic	348	5	0.0143678		WXS	Illumina HiSeq	Phase_I	373	12	0.0321716	NM_023014		Silent	SNP	ENST00000240189.2	37	CCDS149.1																																																																																			A|0.996;G|0.004	0.004	strong		0.542	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
PRG4	10216	hgsc.bcm.edu	37	1	186277188	186277188	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:186277188G>A	ENST00000445192.2	+	7	2382	c.2337G>A	c.(2335-2337)aaG>aaA	p.K779K	PRG4_ENST00000367485.4_Silent_p.K686K|PRG4_ENST00000367483.4_Silent_p.K738K|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Silent_p.K736K	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	779	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CTACCCCTAAGGGGACTGCTC	0.602																																					p.K779K		Atlas-SNP	.											PRG4,NS,carcinoma,0,1	PRG4	259	1	0			c.G2337A						scavenged	.						172.0	195.0	187.0					1																	186277188		2203	4299	6502	SO:0001819	synonymous_variant	10216	exon7			CCCTAAGGGGACT	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2337G>A	1.37:g.186277188G>A		Somatic	175	2	0.0114286		WXS	Illumina HiSeq	Phase_I	193	4	0.0207254	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	CCDS1369.1																																																																																			.	.	none		0.602	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
RGPD3	653489	hgsc.bcm.edu	37	2	107049631	107049631	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:107049631C>T	ENST00000409886.3	-	16	2403	c.2316G>A	c.(2314-2316)gcG>gcA	p.A772A	RGPD3_ENST00000304514.7_Silent_p.A772A	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	772					protein targeting to Golgi (GO:0000042)			p.A772A(4)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTTCTGAATCCGCATTTCGCA	0.373																																					p.A772A		Atlas-SNP	.											RGPD3_ENST00000304514,bladder,carcinoma,0,6	RGPD3	316	6	4	Substitution - coding silent(4)	kidney(2)|endometrium(2)	c.G2316A						scavenged	.						81.0	68.0	72.0					2																	107049631		692	1590	2282	SO:0001819	synonymous_variant	653489	exon16			TGAATCCGCATTT		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2316G>A	2.37:g.107049631C>T		Somatic	551	3	0.00544465		WXS	Illumina HiSeq	Phase_I	542	10	0.0184502	NM_001144013	B8ZZM4	Silent	SNP	ENST00000409886.3	37	CCDS46379.1																																																																																			.	.	weak		0.373	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
SULF2	55959	hgsc.bcm.edu	37	20	46295036	46295036	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:46295036G>A	ENST00000359930.4	-	12	2624	c.1773C>T	c.(1771-1773)taC>taT	p.Y591Y	SULF2_ENST00000467815.1_Silent_p.Y591Y|SULF2_ENST00000484875.1_Silent_p.Y591Y|SULF2_ENST00000361612.4_Silent_p.Y591Y	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	591					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.Y591Y(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						TGGCGGCTGAGTAGTCGGGAA	0.612																																					p.Y591Y		Atlas-SNP	.											SULF2,NS,carcinoma,0,1	SULF2	131	1	1	Substitution - coding silent(1)	prostate(1)	c.C1773T						scavenged	.						118.0	118.0	118.0					20																	46295036		2203	4300	6503	SO:0001819	synonymous_variant	55959	exon12			GGCTGAGTAGTCG	AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.1773C>T	20.37:g.46295036G>A		Somatic	167	2	0.011976		WXS	Illumina HiSeq	Phase_I	243	5	0.0205761	NM_001161841	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Silent	SNP	ENST00000359930.4	37	CCDS13408.1																																																																																			.	.	none		0.612	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
ZNF880	400713	hgsc.bcm.edu	37	19	52888049	52888049	+	Missense_Mutation	SNP	C	C	A	rs75346003	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:52888049C>A	ENST00000422689.2	+	4	1231	c.1216C>A	c.(1216-1218)Caa>Aaa	p.Q406K		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	406					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						CACGGGAGAGCAACCTTACAA	0.398																																					p.Q406K		Atlas-SNP	.											ZNF880,colon,carcinoma,-1,2	ZNF880	45	2	0			c.C1216A						scavenged	.						69.0	63.0	65.0					19																	52888049		1568	3582	5150	SO:0001583	missense	400713	exon4			GGAGAGCAACCTT	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1216C>A	19.37:g.52888049C>A	ENSP00000406318:p.Gln406Lys	Somatic	28	2	0.0714286		WXS	Illumina HiSeq	Phase_I	33	9	0.272727	NM_001145434	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.634723	0.00114	.	.	ENSG00000221923	ENST00000422689	T	0.10860	2.83	1.84	0.731	0.18277	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01835	0.0058	N	0.00128	-2.045	0.20638	N	0.999879	B	0.17667	0.023	B	0.14023	0.01	T	0.46105	-0.9215	8	.	.	.	.	6.7224	0.23338	0.7399:0.2601:0.0:0.0	.	406	Q6PDB4	ZN880_HUMAN	K	406	ENSP00000406318:Q406K	.	Q	+	1	0	ZNF880	57579861	0.006000	0.16342	0.407000	0.26434	0.151000	0.21798	0.708000	0.25719	0.007000	0.14760	-0.493000	0.04662	CAA	C|0.872;A|0.128	0.128	strong		0.398	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
ITGA5	3678	hgsc.bcm.edu	37	12	54792481	54792481	+	Splice_Site	SNP	C	C	T	rs370125974		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:54792481C>T	ENST00000293379.4	-	28	3104	c.2843G>A	c.(2842-2844)cGg>cAg	p.R948Q	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	948					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.R948Q(1)|p.R948L(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						CTGGTGCTCCCGCTGTGGGTA	0.552																																					p.R948Q		Atlas-SNP	.											ITGA5,colon,carcinoma,-1,2	ITGA5	99	2	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G2843A						scavenged	.	C	GLN/ARG	0,4406		0,0,2203	79.0	70.0	73.0		2843	-0.5	0.0	12		73	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice	ITGA5	NM_002205.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	948/1050	54792481	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	3678	exon28			TGCTCCCGCTGTG		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.2842-1G>A	12.37:g.54792481C>T		Somatic	138	2	0.0144928		WXS	Illumina HiSeq	Phase_I	165	4	0.0242424	NM_002205	Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	37	CCDS8880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.125|9.125	1.009893|1.009893	0.19277|0.19277	0.0|0.0	1.16E-4|1.16E-4	ENSG00000161638|ENSG00000161638	ENST00000547197|ENST00000293379	.|T	.|0.50813	.|0.73	5.25|5.25	-0.516|-0.516	0.11950|0.11950	.|.	.|0.656381	.|0.14482	.|N	.|0.316913	T|T	0.38983|0.38983	0.1061|0.1061	M|M	0.61703|0.61703	1.905|1.905	0.09310|0.09310	N|N	1|1	.|B	.|0.18013	.|0.025	.|B	.|0.12156	.|0.007	T|T	0.36311|0.36311	-0.9753|-0.9753	5|10	.|0.66056	.|D	.|0.02	.|.	4.7958|4.7958	0.13272|0.13272	0.1412:0.4074:0.0:0.4515|0.1412:0.4074:0.0:0.4515	.|.	.|948	.|P08648	.|ITA5_HUMAN	R|Q	18|948	.|ENSP00000293379:R948Q	.|ENSP00000293379:R948Q	G|R	-|-	1|2	0|0	ITGA5|ITGA5	53078748|53078748	0.002000|0.002000	0.14202|0.14202	0.003000|0.003000	0.11579|0.11579	0.011000|0.011000	0.07611|0.07611	-0.034000|-0.034000	0.12225|0.12225	-0.310000|-0.310000	0.08766|0.08766	-0.345000|-0.345000	0.07892|0.07892	GGG|CGG	.	.	weak		0.552	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		Missense_Mutation
EP400	57634	hgsc.bcm.edu	37	12	132474551	132474551	+	Missense_Mutation	SNP	C	C	T	rs146333218		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:132474551C>T	ENST00000333577.4	+	9	2669	c.2560C>T	c.(2560-2562)Cgt>Tgt	p.R854C	EP400_ENST00000389561.2_Missense_Mutation_p.R818C|EP400_ENST00000330386.6_Missense_Mutation_p.R818C|EP400_ENST00000389562.2_Missense_Mutation_p.R817C|EP400_ENST00000332482.4_Missense_Mutation_p.R781C			Q96L91	EP400_HUMAN	E1A binding protein p400	854	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GAAGCAGCTCCGTGAAGAAAG	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		19217	0.001		0.0	False		,,,				2504	0.0				p.R818C		Atlas-SNP	.											EP400,NS,carcinoma,-1,1	EP400	370	1	0			c.C2452T						scavenged	.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	65.0	64.0	65.0		2452	5.1	0.8	12	dbSNP_134	65	2,8598	2.2+/-6.3	0,2,4298	yes	missense	EP400	NM_015409.4	180	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	818/3124	132474551	3,13003	2203	4300	6503	SO:0001583	missense	57634	exon8			CAGCTCCGTGAAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.2560C>T	12.37:g.132474551C>T	ENSP00000333602:p.Arg854Cys	Somatic	74	1	0.0135135		WXS	Illumina HiSeq	Phase_I	95	2	0.0210526	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	13.52	2.262285	0.39995	2.27E-4	2.33E-4	ENSG00000183495	ENST00000537902;ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000423130;ENST00000541296;ENST00000542457	D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.69;-2.7	5.11	5.11	0.69529	.	0.213333	0.50627	D	0.000119	D	0.89339	0.6687	L	0.32530	0.975	0.46222	D	0.998932	D;D;D;D;D	0.71674	0.998;0.998;0.998;0.983;0.998	P;P;P;P;P	0.53649	0.731;0.648;0.731;0.599;0.731	D	0.89546	0.3796	10	0.56958	D	0.05	.	12.1625	0.54110	0.288:0.712:0.0:0.0	.	818;818;817;854;781	Q96L91-2;Q96L91-4;Q96L91-5;F8WCN8;Q96L91-3	.;.;.;.;.	C	781;854;818;817;781;818;854;818;818	ENSP00000333602:R854C;ENSP00000374212:R818C;ENSP00000374213:R817C;ENSP00000331737:R781C;ENSP00000330620:R818C	ENSP00000330620:R818C	R	+	1	0	EP400	131040504	0.013000	0.17824	0.822000	0.32727	0.706000	0.40770	1.509000	0.35780	2.539000	0.85634	0.603000	0.83216	CGT	C|1.000;T|0.000	0.000	strong		0.498	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
RBMXL1	494115	hgsc.bcm.edu	37	1	89448539	89448539	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:89448539C>G	ENST00000321792.5	-	2	1398	c.971G>C	c.(970-972)cGa>cCa	p.R324P	CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000446900.2_Intron|CCBL2_ENST00000370491.3_Intron|RBMXL1_ENST00000413769.1_5'Flank|RBMXL1_ENST00000399794.2_Missense_Mutation_p.R324P	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	324	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										GTAACTGTCTCGACTTCCACC	0.517																																					p.R324P		Atlas-SNP	.											CCBL2,NS,carcinoma,-1,1	.	.	1	0			c.G971C						scavenged	.						185.0	184.0	184.0					1																	89448539		2203	4300	6503	SO:0001583	missense	494115	exon3			CTGTCTCGACTTC	BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.971G>C	1.37:g.89448539C>G	ENSP00000318415:p.Arg324Pro	Somatic	327	6	0.0183486		WXS	Illumina HiSeq	Phase_I	350	10	0.0285714	NM_001162536		Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.844738	0.51164	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.77358	-1.09;-1.09	1.89	0.895	0.19247	.	0.070349	0.64402	D	0.000016	T	0.62925	0.2468	M	0.65498	2.005	0.33162	D	0.547093	D	0.55172	0.97	P	0.46796	0.527	T	0.60667	-0.7218	10	0.52906	T	0.07	-3.2327	6.12	0.20148	0.0:0.8158:0.0:0.1842	.	324	Q96E39	RBMXL_HUMAN	P	324	ENSP00000318415:R324P;ENSP00000446099:R324P	ENSP00000318415:R324P	R	-	2	0	RBMXL1	89221127	1.000000	0.71417	0.995000	0.50966	0.753000	0.42808	4.995000	0.63908	0.128000	0.18479	0.306000	0.20318	CGA	.	.	none		0.517	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
SRSF7	6432	hgsc.bcm.edu	37	2	38977316	38977316	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:38977316T>A	ENST00000313117.6	-	2	286	c.49A>T	c.(49-51)Aac>Tac	p.N17Y	SRSF7_ENST00000446327.2_Missense_Mutation_p.N17Y|GEMIN6_ENST00000409011.1_5'Flank|SRSF7_ENST00000409276.1_Missense_Mutation_p.N17Y	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	17	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GTTCCCAGGTTACCAACATAC	0.413																																					p.N17Y		Atlas-SNP	.											.	SRSF7	29	.	0			c.A49T						PASS	.						101.0	100.0	100.0					2																	38977316		2203	4300	6503	SO:0001583	missense	6432	exon2			CCAGGTTACCAAC	L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.49A>T	2.37:g.38977316T>A	ENSP00000325905:p.Asn17Tyr	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	87	33	0.37931	NM_001195446	B4DLU6|G5E9M3|Q564D3	Missense_Mutation	SNP	ENST00000313117.6	37	CCDS33183.1	.	.	.	.	.	.	.	.	.	.	T	19.10	3.762475	0.69763	.	.	ENSG00000115875	ENST00000313117;ENST00000446327;ENST00000409276	D;D;D	0.82803	-1.65;-1.65;-1.65	6.07	6.07	0.98685	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.92993	0.7770	M	0.91090	3.175	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.80764	0.993;0.994	D	0.94275	0.7514	10	0.87932	D	0	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	17;17	G5E9M3;Q16629	.;SRSF7_HUMAN	Y	17	ENSP00000325905:N17Y;ENSP00000402264:N17Y;ENSP00000386806:N17Y	ENSP00000325905:N17Y	N	-	1	0	SRSF7	38830820	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.233000	0.51311	2.326000	0.78906	0.533000	0.62120	AAC	.	.	none		0.413	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2	NM_001031684	
PRPF4B	8899	hgsc.bcm.edu	37	6	4058968	4058968	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:4058968C>T	ENST00000337659.6	+	14	2840	c.2740C>T	c.(2740-2742)Cga>Tga	p.R914*	PRPF4B_ENST00000538861.1_Nonsense_Mutation_p.R900*|PRPF4B_ENST00000494674.1_3'UTR	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	914	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R403*(1)|p.R914*(1)		breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GTAGATGATTCGAAAAGGTGT	0.294																																					p.R914X		Atlas-SNP	.											PRPF4B_ENST00000337659,rectum,carcinoma,0,2	PRPF4B	140	2	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2740T						scavenged	.						50.0	49.0	50.0					6																	4058968		2203	4298	6501	SO:0001587	stop_gained	8899	exon14			ATGATTCGAAAAG	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.2740C>T	6.37:g.4058968C>T	ENSP00000337194:p.Arg914*	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	98	2	0.0204082	NM_003913	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Nonsense_Mutation	SNP	ENST00000337659.6	37	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	C	35	5.570608	0.96540	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	.	.	.	5.93	3.95	0.45737	.	0.000000	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.6523	0.85219	0.2478:0.7521:0.0:0.0	.	.	.	.	X	914;900	.	ENSP00000337194:R914X	R	+	1	2	PRPF4B	4003967	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.723000	0.47277	1.472000	0.48140	0.655000	0.94253	CGA	.	.	none		0.294	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		
GTF2I	2969	hgsc.bcm.edu	37	7	74148279	74148279	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:74148279A>G	ENST00000324896.4	+	16	1708	c.1319A>G	c.(1318-1320)aAt>aGt	p.N440S	GTF2I_ENST00000416070.1_Missense_Mutation_p.N399S|GTF2I_ENST00000353920.4_Missense_Mutation_p.N420S|GTF2I_ENST00000346152.4_Missense_Mutation_p.N419S	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	440					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N440S(7)		NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						GAGCTTCTGAATTCAACACGT	0.358																																					p.N440S		Atlas-SNP	.											GTF2I,NS,carcinoma,0,7	GTF2I	40	7	7	Substitution - Missense(7)	endometrium(7)	c.A1319G						scavenged	.						111.0	102.0	105.0					7																	74148279		2201	4300	6501	SO:0001583	missense	2969	exon16			TTCTGAATTCAAC	U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1319A>G	7.37:g.74148279A>G	ENSP00000322542:p.Asn440Ser	Somatic	309	3	0.00970874		WXS	Illumina HiSeq	Phase_I	308	6	0.0194805	NM_032999	O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	ENST00000324896.4	37	CCDS5573.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.085752	0.55861	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.35236	1.34;1.32;1.32;1.32	4.07	4.07	0.47477	.	0.000000	0.64402	D	0.000002	T	0.40670	0.1126	N	0.16368	0.405	0.80722	D	1	D;D;D;D;D	0.71674	0.997;0.971;0.99;0.998;0.982	D;P;D;D;D	0.76071	0.97;0.717;0.979;0.987;0.952	T	0.31052	-0.9957	10	0.45353	T	0.12	-19.2887	11.2081	0.48782	1.0:0.0:0.0:0.0	.	418;399;420;419;440	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	S	440;435;420;419;399	ENSP00000322542:N440S;ENSP00000322671:N420S;ENSP00000322599:N419S;ENSP00000387651:N399S	ENSP00000322542:N440S	N	+	2	0	GTF2I	73786215	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.703000	0.54808	1.839000	0.53478	0.477000	0.44152	AAT	.	.	weak		0.358	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252708.1	NM_032999	
FBXW8	26259	hgsc.bcm.edu	37	12	117465850	117465850	+	Missense_Mutation	SNP	G	G	A	rs368052577	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:117465850G>A	ENST00000309909.5	+	11	1752	c.1670G>A	c.(1669-1671)cGc>cAc	p.R557H	FBXW8_ENST00000455858.2_Missense_Mutation_p.R491H			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	557					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)		p.R557H(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		GGGCTGATCCGCGCCTATGAG	0.622													G|||	3	0.000599042	0.0	0.0	5008	,	,		17432	0.003		0.0	False		,,,				2504	0.0				p.R557H		Atlas-SNP	.											FBXW8,colon,carcinoma,0,3	FBXW8	53	3	1	Substitution - Missense(1)	large_intestine(1)	c.G1670A						scavenged	.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	98.0	75.0	83.0		1472,1670	3.8	1.0	12		83	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	FBXW8	NM_012174.1,NM_153348.2	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	491/533,557/599	117465850	1,13005	2203	4300	6503	SO:0001583	missense	26259	exon11			TGATCCGCGCCTA	AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.1670G>A	12.37:g.117465850G>A	ENSP00000310686:p.Arg557His	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	149	3	0.0201342	NM_153348	Q9UK95	Missense_Mutation	SNP	ENST00000309909.5	37	CCDS9182.1	.	.	.	.	.	.	.	.	.	.	G	4.609	0.113274	0.08831	0.0	1.16E-4	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.09630	2.98;2.96	4.93	3.8	0.43715	.	0.408444	0.30528	N	0.009438	T	0.05090	0.0136	N	0.10809	0.05	0.22401	N	0.999134	B;B	0.15141	0.012;0.009	B;B	0.08055	0.003;0.002	T	0.43114	-0.9411	10	0.14656	T	0.56	-7.0038	8.3216	0.32132	0.9062:0.0:0.0938:0.0	.	557;491	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	H	557;491;491	ENSP00000310686:R557H;ENSP00000389144:R491H	ENSP00000310686:R557H	R	+	2	0	FBXW8	115950233	0.989000	0.36119	0.977000	0.42913	0.406000	0.30931	2.837000	0.48191	0.734000	0.32515	-0.469000	0.05056	CGC	.	.	weak		0.622	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403561.1	NM_012174	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240729	39240729	+	Missense_Mutation	SNP	A	A	G	rs200532954	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:39240729A>G	ENST00000391417.4	+	1	271	c.271A>G	c.(271-273)Atg>Gtg	p.M91V		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	116	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cagctgctgtatgtccagctg	0.677													g|||	366	0.0730831	0.0272	0.0663	5008	,	,		17277	0.1012		0.1431	False		,,,				2504	0.0389				p.M91V		Atlas-SNP	.											KRTAP4-9_ENST00000377734,bladder,carcinoma,0,4	KRTAP4-7	49	4	0			c.A271G						scavenged	.						11.0	17.0	15.0					17																	39240729		684	1582	2266	SO:0001583	missense	100132476	exon1			TGCTGTATGTCCA	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.271A>G	17.37:g.39240729A>G	ENSP00000375236:p.Met91Val	Somatic	55	7	0.127273		WXS	Illumina HiSeq	Phase_I	72	14	0.194444	NM_033061	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	0.030	-1.342089	0.01277	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.00567	6.54	3.74	-2.07	0.07276	.	5.393590	0.01146	N	0.006314	T	0.00300	0.0009	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46679	-0.9174	9	0.05959	T	0.93	.	9.7653	0.40557	0.3807:0.0:0.6193:0.0	.	91	Q9BYR0	KRA47_HUMAN	V	91;82	ENSP00000375236:M91V	ENSP00000375236:M91V	M	+	1	0	KRTAP4-9;KRTAP4-7	36494255	0.000000	0.05858	0.006000	0.13384	0.872000	0.50106	-4.081000	0.00299	-0.949000	0.03663	-0.374000	0.07098	ATG	.	.	weak		0.677	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
SDK2	54549	hgsc.bcm.edu	37	17	71431699	71431699	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:71431699T>C	ENST00000392650.3	-	9	1085	c.1085A>G	c.(1084-1086)gAc>gGc	p.D362G	SDK2_ENST00000388726.3_Missense_Mutation_p.D362G	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	362	Ig-like C2-type 4.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CAGGCCCCCGTCGTTGCGCTG	0.652																																					p.D362G		Atlas-SNP	.											SDK2,NS,carcinoma,+1,1	SDK2	219	1	0			c.A1085G						scavenged	.						48.0	34.0	39.0					17																	71431699		2201	4297	6498	SO:0001583	missense	54549	exon9			CCCCCGTCGTTGC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1085A>G	17.37:g.71431699T>C	ENSP00000376421:p.Asp362Gly	Somatic	101	1	0.00990099		WXS	Illumina HiSeq	Phase_I	69	3	0.0434783	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.071712	0.36566	.	.	ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.38722	1.12;1.12	4.84	4.84	0.62591	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.127433	0.53938	D	0.000057	T	0.20740	0.0499	N	0.04768	-0.165	0.33996	D	0.649673	B;B	0.11235	0.004;0.001	B;B	0.15052	0.012;0.012	T	0.25012	-1.0144	9	.	.	.	.	10.5573	0.45125	0.0:0.0:0.162:0.838	.	362;362	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	G	362	ENSP00000376421:D362G;ENSP00000373378:D362G	.	D	-	2	0	SDK2	68943294	0.990000	0.36364	0.843000	0.33291	0.816000	0.46133	3.419000	0.52728	1.798000	0.52647	0.459000	0.35465	GAC	.	.	none		0.652	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
PRSS3	5646	hgsc.bcm.edu	37	9	33798075	33798075	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:33798075T>C	ENST00000361005.5	+	3	620	c.620T>C	c.(619-621)tTt>tCt	p.F207S	PRSS3_ENST00000429677.3_Missense_Mutation_p.F143S|PRSS3_ENST00000342836.4_Missense_Mutation_p.F164S|PRSS3_ENST00000379405.3_Missense_Mutation_p.F150S|RP11-133O22.6_ENST00000454429.2_RNA	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	207	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			ACTCTGAGCTTTGGTGGTGAG	0.577																																					p.F207S		Atlas-SNP	.											PRSS3_ENST00000361005,brain,glioma,0,3	PRSS3	79	3	0			c.T620C						scavenged	.						121.0	104.0	109.0					9																	33798075		2203	4300	6503	SO:0001583	missense	5646	exon3			TGAGCTTTGGTGG		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.620T>C	9.37:g.33798075T>C	ENSP00000354280:p.Phe207Ser	Somatic	86	2	0.0232558		WXS	Illumina HiSeq	Phase_I	115	5	0.0434783	NM_007343	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	T	1.643	-0.516079	0.04200	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	T;D;D;T;D	0.92249	0.37;-2.35;-3.0;0.37;-3.0	3.61	-7.22	0.01485	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.710450	0.02946	N	0.141069	T	0.72630	0.3484	N	0.03224	-0.385	0.40775	D	0.983123	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.69907	-0.5018	10	0.02654	T	1	.	1.7451	0.02961	0.1264:0.1901:0.3621:0.3214	.	150;207;164	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	S	207;162;164;143;150	ENSP00000354280:F207S;ENSP00000401249:F162S;ENSP00000340889:F164S;ENSP00000401828:F143S;ENSP00000368715:F150S	ENSP00000340889:F164S	F	+	2	0	PRSS3	33788075	0.519000	0.26242	0.960000	0.40013	0.020000	0.10135	-0.135000	0.10420	-0.550000	0.06183	-1.390000	0.01156	TTT	.	.	none		0.577	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
SKOR1	390598	hgsc.bcm.edu	37	15	68118796	68118796	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:68118796C>T	ENST00000380035.2	+	2	688	c.630C>T	c.(628-630)tgC>tgT	p.C210C	SKOR1_ENST00000341418.5_Silent_p.C396C|SKOR1_ENST00000389002.1_Silent_p.C201C|SKOR1_ENST00000554240.1_Silent_p.C171C|SKOR1_ENST00000554054.1_Silent_p.C182C			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	210					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)	p.C201C(1)		endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						GCATCAAGTGCGGCTACTGCA	0.582																																					p.C396C		Atlas-SNP	.											SKOR1_ENST00000380035,NS,carcinoma,0,3	SKOR1	144	3	1	Substitution - coding silent(1)	large_intestine(1)	c.C1188T						scavenged	.						108.0	94.0	99.0					15																	68118796		2200	4298	6498	SO:0001819	synonymous_variant	390598	exon5			CAAGTGCGGCTAC		CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.630C>T	15.37:g.68118796C>T		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	142	2	0.0140845	NM_001258024	A6NIP4|A6NJY0|Q2VWA5	Silent	SNP	ENST00000380035.2	37																																																																																				.	.	none		0.582	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000410832.1	NM_001031807	
LRRC66	339977	hgsc.bcm.edu	37	4	52862081	52862081	+	Silent	SNP	C	C	T	rs367551436		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:52862081C>T	ENST00000343457.3	-	4	1113	c.1107G>A	c.(1105-1107)gaG>gaA	p.E369E		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	369						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GGGGAGCGTCCTCTTTTTTGC	0.582																																					p.E369E		Atlas-SNP	.											LRRC66,NS,carcinoma,-2,1	LRRC66	128	1	0			c.G1107A						scavenged	.						36.0	39.0	38.0					4																	52862081		1977	4160	6137	SO:0001819	synonymous_variant	339977	exon4			AGCGTCCTCTTTT	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1107G>A	4.37:g.52862081C>T		Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	241	4	0.0165975	NM_001024611		Silent	SNP	ENST00000343457.3	37	CCDS43229.1																																																																																			.	.	weak		0.582	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
ECM1	1893	hgsc.bcm.edu	37	1	150483581	150483581	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:150483581C>T	ENST00000369047.4	+	6	740	c.615C>T	c.(613-615)cgC>cgT	p.R205R	ECM1_ENST00000369049.4_Silent_p.R232R|ECM1_ENST00000470432.1_3'UTR|ECM1_ENST00000346569.6_Silent_p.R205R	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	205	2 X approximate repeats.				angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			ACCTCACTCGCCAGGGTGAGA	0.537																																					p.R232R	Melanoma(156;1696 2560 11093 19685)	Atlas-SNP	.											ECM1_ENST00000369049,colon,carcinoma,+1,2	ECM1	96	2	0			c.C696T						scavenged	.						133.0	135.0	134.0					1																	150483581		2203	4300	6503	SO:0001819	synonymous_variant	1893	exon6			CACTCGCCAGGGT	U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.615C>T	1.37:g.150483581C>T		Somatic	122	1	0.00819672		WXS	Illumina HiSeq	Phase_I	135	2	0.0148148	NM_001202858	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Silent	SNP	ENST00000369047.4	37	CCDS953.1																																																																																			.	.	none		0.537	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035832.2	NM_004425	
YOD1	55432	hgsc.bcm.edu	37	1	207222394	207222394	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:207222394T>C	ENST00000315927.4	-	2	1064	c.1018A>G	c.(1018-1020)Aca>Gca	p.T340A	YOD1_ENST00000367084.1_Missense_Mutation_p.T296A|YOD1_ENST00000391927.1_Missense_Mutation_p.T296A|PFKFB2_ENST00000411990.2_5'Flank	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	340					cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					GTATGGCCTGTCTCCTTGGCA	0.468																																					p.T340A		Atlas-SNP	.											YOD1,NS,carcinoma,+2,2	YOD1	24	2	0			c.A1018G						scavenged	.						250.0	234.0	239.0					1																	207222394		2203	4300	6503	SO:0001583	missense	55432	exon2			GGCCTGTCTCCTT		CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.1018A>G	1.37:g.207222394T>C	ENSP00000326813:p.Thr340Ala	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	180	4	0.0222222	NM_018566	B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Missense_Mutation	SNP	ENST00000315927.4	37	CCDS31002.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388823	0.82902	.	.	ENSG00000180667	ENST00000367084;ENST00000315927;ENST00000391927	.	.	.	6.03	6.03	0.97812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	D	0.86037	0.5837	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	1.0;0.982	D;P	0.85130	0.997;0.487	D	0.89274	0.3607	9	0.87932	D	0	-14.2617	15.7467	0.77949	0.0:0.0:0.0:1.0	.	296;340	Q5VVQ6-2;Q5VVQ6	.;OTU1_HUMAN	A	296;340;296	.	ENSP00000326813:T340A	T	-	1	0	YOD1	205289017	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.917000	0.87498	2.302000	0.77476	0.533000	0.62120	ACA	.	.	none		0.468	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087837.1	NM_018566	
LILRA2	11027	hgsc.bcm.edu	37	19	55086932	55086932	+	Missense_Mutation	SNP	C	C	T	rs532565720	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:55086932C>T	ENST00000251377.3	+	6	998	c.865C>T	c.(865-867)Cac>Tac	p.H289Y	LILRA2_ENST00000251376.3_Missense_Mutation_p.H289Y|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000391738.3_Missense_Mutation_p.H289Y|LILRA2_ENST00000391737.1_Missense_Mutation_p.H277Y|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000448689.1_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	289	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.H289Y(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		GAGCCCCTCCCACGGGGGCCA	0.647													c|||	6	0.00119808	0.0	0.0014	5008	,	,		16291	0.0		0.0	False		,,,				2504	0.0051				p.H289Y		Atlas-SNP	.											LILRA2,NS,carcinoma,0,1	LILRA2	99	1	1	Substitution - Missense(1)	kidney(1)	c.C865T						scavenged	.						49.0	51.0	50.0					19																	55086932		2203	4299	6502	SO:0001583	missense	11027	exon5			CCCTCCCACGGGG	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.865C>T	19.37:g.55086932C>T	ENSP00000251377:p.His289Tyr	Somatic	264	9	0.0340909		WXS	Illumina HiSeq	Phase_I	307	13	0.0423453	NM_001130917	O75020	Missense_Mutation	SNP	ENST00000251377.3	37	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	C	8.190	0.795735	0.16327	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.00824	5.65;5.65;5.65;5.65;5.65	2.8	2.8	0.32819	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.843870	0.10052	N	0.722156	T	0.02767	0.0083	M	0.81179	2.53	0.25235	N	0.989797	B;B;B;B	0.17038	0.018;0.02;0.009;0.001	B;B;B;B	0.38458	0.274;0.077;0.077;0.015	T	0.36648	-0.9739	10	0.28530	T	0.3	.	9.2391	0.37484	0.0:1.0:0.0:0.0	.	289;277;289;289	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	Y	289;289;289;289;277	ENSP00000388131:H289Y;ENSP00000251377:H289Y;ENSP00000375618:H289Y;ENSP00000251376:H289Y;ENSP00000375617:H277Y	ENSP00000251376:H289Y	H	+	1	0	LILRA2	59778744	0.000000	0.05858	0.006000	0.13384	0.119000	0.20118	0.417000	0.21214	1.570000	0.49709	0.400000	0.26472	CAC	.	.	none		0.647	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
CREBBP	1387	hgsc.bcm.edu	37	16	3790471	3790471	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:3790471G>A	ENST00000262367.5	-	24	4871	c.4062C>T	c.(4060-4062)gcC>gcT	p.A1354A	CREBBP_ENST00000382070.3_Silent_p.A1316A	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1354	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AAACCTCCCCGGCTTCAGGGT	0.562			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.A1354A		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	CREBBP,NS,carcinoma,-1,1	CREBBP	546	1	0			c.C4062T						scavenged	.						71.0	71.0	71.0					16																	3790471		2197	4300	6497	SO:0001819	synonymous_variant	1387	exon24			CTCCCCGGCTTCA	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4062C>T	16.37:g.3790471G>A		Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	143	5	0.034965	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	CCDS10509.1																																																																																			.	.	none		0.562	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
LGI3	203190	hgsc.bcm.edu	37	8	22005779	22005779	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:22005779C>T	ENST00000306317.2	-	8	1830	c.1541G>A	c.(1540-1542)cGg>cAg	p.R514Q	LGI3_ENST00000424267.2_Missense_Mutation_p.R490Q	NM_139278.2	NP_644807.1	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	514					exocytosis (GO:0006887)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|extracellular region (GO:0005576)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	catalytic activity (GO:0003824)			endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	17				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		GCAGAAGGCCCGAGGAGCCTG	0.582																																					p.R514Q		Atlas-SNP	.											LGI3,mouth,carcinoma,-1,1	LGI3	44	1	0			c.G1541A						scavenged	.						70.0	64.0	66.0					8																	22005779		2203	4300	6503	SO:0001583	missense	203190	exon8			AAGGCCCGAGGAG	AJ487518	CCDS6025.1	8p21.2	2008-07-28			ENSG00000168481	ENSG00000168481			18711	protein-coding gene	gene with protein product		608302				12023020, 18628660	Standard	NM_139278		Approved		uc003xav.3	Q8N145	OTTHUMG00000131599	ENST00000306317.2:c.1541G>A	8.37:g.22005779C>T	ENSP00000302297:p.Arg514Gln	Somatic	62	1	0.016129		WXS	Illumina HiSeq	Phase_I	47	8	0.170213	NM_139278	A5PLP2|Q86TL4|Q8N296	Missense_Mutation	SNP	ENST00000306317.2	37	CCDS6025.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962688	0.92791	.	.	ENSG00000168481	ENST00000306317;ENST00000424267	T;T	0.80994	-1.44;-1.44	4.95	4.95	0.65309	.	0.000000	0.64402	D	0.000001	D	0.89022	0.6597	M	0.73598	2.24	0.52501	D	0.99995	D;D	0.71674	0.998;0.998	D;D	0.76575	0.988;0.988	D	0.90464	0.4448	10	0.87932	D	0	-46.0234	15.6803	0.77364	0.0:1.0:0.0:0.0	.	490;514	A5PLP2;Q8N145	.;LGI3_HUMAN	Q	514;490	ENSP00000302297:R514Q;ENSP00000399121:R490Q	ENSP00000302297:R514Q	R	-	2	0	LGI3	22061724	0.981000	0.34729	0.993000	0.49108	0.994000	0.84299	7.479000	0.81095	2.246000	0.74042	0.561000	0.74099	CGG	.	.	none		0.582	LGI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254482.1		
PIK3C2A	5286	hgsc.bcm.edu	37	11	17172170	17172170	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:17172170C>T	ENST00000265970.7	-	3	1201	c.1202G>A	c.(1201-1203)cGc>cAc	p.R401H	PIK3C2A_ENST00000531428.1_5'UTR|PIK3C2A_ENST00000540361.1_Missense_Mutation_p.R21H	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	401					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)	p.R401H(1)		central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TGGGTTTGTGCGGTGATTGGT	0.373																																					p.R401H		Atlas-SNP	.											PIK3C2A,NS,carcinoma,0,2	PIK3C2A	148	2	1	Substitution - Missense(1)	lung(1)	c.G1202A						scavenged	.						170.0	152.0	158.0					11																	17172170		2200	4293	6493	SO:0001583	missense	5286	exon3			TTTGTGCGGTGAT	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.1202G>A	11.37:g.17172170C>T	ENSP00000265970:p.Arg401His	Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	189	2	0.010582	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	C	1.240	-0.621565	0.03636	.	.	ENSG00000011405	ENST00000265970;ENST00000540361;ENST00000544896	T;T	0.42513	0.97;0.97	5.94	-2.21	0.06973	.	0.920435	0.09561	N	0.785613	T	0.15478	0.0373	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.25293	-1.0136	10	0.20519	T	0.43	8.3831	4.7189	0.12909	0.2829:0.1989:0.0:0.5182	.	401;401	F5H5W9;O00443	.;P3C2A_HUMAN	H	401;21;401	ENSP00000265970:R401H;ENSP00000438687:R21H	ENSP00000265970:R401H	R	-	2	0	PIK3C2A	17128746	0.000000	0.05858	0.059000	0.19551	0.148000	0.21650	0.401000	0.20948	-0.065000	0.13021	-1.119000	0.02030	CGC	.	.	none		0.373	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
MYO5B	4645	hgsc.bcm.edu	37	18	47462675	47462675	+	Silent	SNP	C	C	T	rs180849030	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr18:47462675C>T	ENST00000285039.7	-	16	2249	c.1950G>A	c.(1948-1950)acG>acA	p.T650T		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	650	Actin-binding. {ECO:0000255}.|Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.T650T(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AGTGAGGTGTCGTGGCATTCA	0.517													C|||	2	0.000399361	0.0	0.0	5008	,	,		20181	0.0		0.002	False		,,,				2504	0.0				p.T650T		Atlas-SNP	.											MYO5B,NS,carcinoma,0,1	MYO5B	178	1	1	Substitution - coding silent(1)	lung(1)	c.G1950A						PASS	.						97.0	100.0	99.0					18																	47462675		2083	4237	6320	SO:0001819	synonymous_variant	4645	exon16			AGGTGTCGTGGCA	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1950G>A	18.37:g.47462675C>T		Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	159	56	0.352201	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	ENST00000285039.7	37	CCDS42436.1																																																																																			C|0.999;T|0.001	0.001	strong		0.517	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
TBP	6908	hgsc.bcm.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000540980.1_Silent_p.Q56Q|TBP_ENST00000230354.6_Silent_p.Q76Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																					p.Q76Q		Atlas-SNP	.											TBP,NS,carcinoma,0,5	TBP	58	5	4	Substitution - coding silent(4)	lung(3)|prostate(1)	c.G228A						scavenged	.						14.0	19.0	17.0					6																	170871052		1952	3842	5794	SO:0001819	synonymous_variant	6908	exon3			ACAGCAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A		Somatic	37	3	0.0810811		WXS	Illumina HiSeq	Phase_I	45	8	0.177778	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			G|0.500;A|0.500	0.500	strong		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
FAM64A	54478	hgsc.bcm.edu	37	17	6352690	6352690	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:6352690T>C	ENST00000250056.8	+	4	732	c.649T>C	c.(649-651)Tcc>Ccc	p.S217P	FAM64A_ENST00000572595.2_Missense_Mutation_p.S248P|FAM64A_ENST00000576056.1_Missense_Mutation_p.S217P|FAM64A_ENST00000572447.1_Missense_Mutation_p.S217P|FAM64A_ENST00000570337.2_Missense_Mutation_p.S217P|FAM64A_ENST00000571373.1_Missense_Mutation_p.S217P	NM_001195228.1	NP_001182157.1	Q9BSJ6	FA64A_HUMAN	family with sequence similarity 64, member A	217					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				COAD - Colon adenocarcinoma(228;0.141)		CCAGAAGCTGTCCCAAGAGCT	0.537																																					p.S217P		Atlas-SNP	.											.	FAM64A	20	.	0			c.T649C						PASS	.						86.0	82.0	84.0					17																	6352690		2203	4300	6503	SO:0001583	missense	54478	exon4			AAGCTGTCCCAAG		CCDS32541.1, CCDS56016.1	17p13.2	2013-10-11			ENSG00000129195	ENSG00000129195			25483	protein-coding gene	gene with protein product	"""CALM interacting protein expressed in thymus and spleen"""					19383357, 16491119	Standard	NM_019013		Approved	FLJ10156, FLJ10491, CATS	uc002gcw.2	Q9BSJ6	OTTHUMG00000177832	ENST00000250056.8:c.649T>C	17.37:g.6352690T>C	ENSP00000250056:p.Ser217Pro	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	78	5	0.0641026	NM_019013	Q96CT4|Q9NVV1|Q9NWB5	Missense_Mutation	SNP	ENST00000250056.8	37	CCDS56016.1	.	.	.	.	.	.	.	.	.	.	.	20.5	4.007184	0.75046	.	.	ENSG00000129195	ENST00000250056;ENST00000308855	T	0.56611	0.45	5.75	5.75	0.90469	.	0.076511	0.51477	D	0.000093	T	0.70343	0.3213	M	0.72118	2.19	0.41665	D	0.989202	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.73852	-0.3852	10	0.66056	D	0.02	-19.9763	12.4405	0.55621	0.0:0.0:0.0:1.0	.	217;217	Q9BSJ6;Q9BSJ6-2	FA64A_HUMAN;.	P	217	ENSP00000250056:S217P	ENSP00000250056:S217P	S	+	1	0	FAM64A	6293414	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	2.868000	0.48436	2.196000	0.70406	0.460000	0.39030	TCC	.	.	none		0.537	FAM64A-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000439156.1	NM_019013	
MACROD2	140733	hgsc.bcm.edu	37	20	14665585	14665585	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:14665585G>T	ENST00000310348.4	+	5	398	c.398G>T	c.(397-399)gGc>gTc	p.G133V	MACROD2_ENST00000217246.4_Missense_Mutation_p.G133V|MACROD2_ENST00000464883.1_3'UTR			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	133	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				ATCACATGTGGCTATGACCTT	0.418																																					p.G133V		Atlas-SNP	.											.	MACROD2	34	.	0			c.G398T						PASS	.						133.0	125.0	127.0					20																	14665585		1924	4158	6082	SO:0001583	missense	140733	exon5			CATGTGGCTATGA	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.398G>T	20.37:g.14665585G>T	ENSP00000309809:p.Gly133Val	Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	139	51	0.366906	NM_080676	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.947925	0.92593	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	T;T	0.26957	1.7;1.7	5.62	5.62	0.85841	Appr-1-p processing (3);	0.000000	0.64402	D	0.000006	T	0.70666	0.3250	H	0.98866	4.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.83547	0.0099	10	0.87932	D	0	-13.8763	18.6571	0.91458	0.0:0.0:1.0:0.0	.	133;133	A1Z1Q3;A1Z1Q3-2	MACD2_HUMAN;.	V	133	ENSP00000217246:G133V;ENSP00000309809:G133V	ENSP00000217246:G133V	G	+	2	0	MACROD2	14613585	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.476000	0.97823	2.642000	0.89623	0.655000	0.94253	GGC	.	.	none		0.418	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	
HERC2	8924	hgsc.bcm.edu	37	15	28361877	28361877	+	Silent	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:28361877G>T	ENST00000261609.7	-	88	13651	c.13543C>A	c.(13543-13545)Cga>Aga	p.R4515R		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TAGCAGTCTCGGTTGGCCCCA	0.627																																					p.R4515R		Atlas-SNP	.											HERC2,NS,carcinoma,0,1	HERC2	501	1	0			c.C13543A						scavenged	.						90.0	85.0	87.0					15																	28361877		2203	4300	6503	SO:0001819	synonymous_variant	8924	exon88			AGTCTCGGTTGGC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.13543C>A	15.37:g.28361877G>T		Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	194	2	0.0103093	NM_004667		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																			.	.	none		0.627	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
ZNF880	400713	hgsc.bcm.edu	37	19	52888050	52888050	+	Missense_Mutation	SNP	A	A	G	rs76053634	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:52888050A>G	ENST00000422689.2	+	4	1232	c.1217A>G	c.(1216-1218)cAa>cGa	p.Q406R		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	406					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						ACGGGAGAGCAACCTTACAAA	0.398																																					p.Q406R		Atlas-SNP	.											ZNF880,colon,carcinoma,0,2	ZNF880	45	2	0			c.A1217G						scavenged	.						70.0	64.0	66.0					19																	52888050		1568	3582	5150	SO:0001583	missense	400713	exon4			GAGAGCAACCTTA	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1217A>G	19.37:g.52888050A>G	ENSP00000406318:p.Gln406Arg	Somatic	27	2	0.0740741		WXS	Illumina HiSeq	Phase_I	34	9	0.264706	NM_001145434	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	A	4.567	0.105370	0.08731	.	.	ENSG00000221923	ENST00000422689	T	0.15718	2.4	1.84	1.84	0.25277	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04182	0.0116	N	0.00392	-1.555	0.19775	N	0.999952	B	0.17667	0.023	B	0.23150	0.044	T	0.43360	-0.9396	8	.	.	.	.	8.4442	0.32833	1.0:0.0:0.0:0.0	.	406	Q6PDB4	ZN880_HUMAN	R	406	ENSP00000406318:Q406R	.	Q	+	2	0	ZNF880	57579862	0.002000	0.14202	0.418000	0.26571	0.177000	0.22998	0.149000	0.16243	0.834000	0.34852	0.450000	0.29827	CAA	A|0.867;G|0.133	0.133	strong		0.398	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
SLC35G6	643664	hgsc.bcm.edu	37	17	7386300	7386300	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:7386300G>A	ENST00000412468.2	+	2	1112	c.997G>A	c.(997-999)Gaa>Aaa	p.E333K	ZBTB4_ENST00000311403.4_Intron|POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	333						integral component of membrane (GO:0016021)											CTGTGAGAGGGAAGGGAAGGT	0.557																																					p.E333K		Atlas-SNP	.											POLR2A_ENST00000412468,NS,carcinoma,-1,1	.	.	1	0			c.G997A						scavenged	.						60.0	59.0	59.0					17																	7386300		2203	4300	6503	SO:0001583	missense	643664	exon2			GAGAGGGAAGGGA		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.997G>A	17.37:g.7386300G>A	ENSP00000396523:p.Glu333Lys	Somatic	93	6	0.0645161		WXS	Illumina HiSeq	Phase_I	111	6	0.0540541	NM_001102614		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.322479	0.01320	.	.	ENSG00000181222	ENST00000412468	T	0.26518	1.73	4.69	1.44	0.22558	.	.	.	.	.	T	0.14056	0.0340	L	0.36672	1.1	0.09310	N	1	B	0.18013	0.025	B	0.15870	0.014	T	0.37526	-0.9702	9	0.02654	T	1	-0.2286	4.7772	0.13185	0.2637:0.1728:0.5636:0.0	.	333	P0C7Q6	S35G6_HUMAN	K	333	ENSP00000396523:E333K	ENSP00000396523:E333K	E	+	1	0	SLC35G6	7327024	1.000000	0.71417	0.321000	0.25320	0.451000	0.32288	4.403000	0.59729	0.499000	0.27970	-0.225000	0.12378	GAA	.	.	none		0.557	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
CLK3	1198	hgsc.bcm.edu	37	15	74912467	74912467	+	Silent	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:74912467T>C	ENST00000395066.3	+	3	1175	c.714T>C	c.(712-714)cgT>cgC	p.R238R	CLK3_ENST00000345005.4_Silent_p.R90R|CLK3_ENST00000348245.3_Silent_p.R90R|CLK3_ENST00000352989.5_Silent_p.R90R	NM_001130028.1	NP_001123500.1	P49761	CLK3_HUMAN	CDC-like kinase 3	238	Arg-rich.				protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	cytoplasmic vesicle (GO:0031410)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)|stomach(2)|urinary_tract(1)	15						CACGTTCTCGTCATCGTCGGC	0.627																																					p.R238R	Ovarian(133;694 1754 28950 29027 31859)	Atlas-SNP	.											CLK3_ENST00000454830,NS,carcinoma,+1,4	CLK3	78	4	0			c.T714C						scavenged	.						198.0	190.0	193.0					15																	74912467		2197	4296	6493	SO:0001819	synonymous_variant	1198	exon3			TTCTCGTCATCGT	L29220	CCDS10265.1, CCDS45304.1	15q24	2008-05-02			ENSG00000179335	ENSG00000179335		"""CDC-like kinases"""	2071	protein-coding gene	gene with protein product		602990				7990150, 9856501	Standard	NM_003992		Approved	clk3	uc010uln.2	P49761	OTTHUMG00000141320	ENST00000395066.3:c.714T>C	15.37:g.74912467T>C		Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	196	4	0.0204082	NM_001130028	D3DW59|Q53Y48|Q9BRS3|Q9BUJ7	Silent	SNP	ENST00000395066.3	37	CCDS45304.1																																																																																			.	.	none		0.627	CLK3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390442.3		
LRIG1	26018	hgsc.bcm.edu	37	3	66432748	66432748	+	Missense_Mutation	SNP	C	C	G	rs147267806		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:66432748C>G	ENST00000273261.3	-	16	3090	c.2566G>C	c.(2566-2568)Gtg>Ctg	p.V856L	SLC25A26_ENST00000536651.1_Intron|LRIG1_ENST00000496559.2_5'UTR|LRIG1_ENST00000383703.3_Missense_Mutation_p.V833L	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	856					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GTCCTGACCACGGTTTCTTGT	0.532																																					p.V856L		Atlas-SNP	.											.	LRIG1	138	.	0			c.G2566C						PASS	.						149.0	153.0	151.0					3																	66432748		2203	4300	6503	SO:0001583	missense	26018	exon16			TGACCACGGTTTC	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.2566G>C	3.37:g.66432748C>G	ENSP00000273261:p.Val856Leu	Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	146	39	0.267123	NM_015541	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	.	.	.	.	.	.	.	.	.	.	C	6.761	0.509283	0.12883	.	.	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	T;T	0.63913	-0.05;-0.07	5.5	2.73	0.32206	.	0.414681	0.26991	N	0.021468	T	0.49813	0.1579	L	0.40543	1.245	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.001	T	0.35549	-0.9784	10	0.33141	T	0.24	.	10.5755	0.45225	0.0:0.7859:0.0:0.2141	.	833;856;856	Q96JA1-2;Q5XWD3;Q96JA1	.;.;LRIG1_HUMAN	L	856;833;759	ENSP00000273261:V856L;ENSP00000373208:V833L	ENSP00000273261:V856L	V	-	1	0	LRIG1	66515438	0.000000	0.05858	0.117000	0.21633	0.136000	0.21042	0.099000	0.15210	0.280000	0.22209	-0.751000	0.03497	GTG	C|1.000;T|0.000	.	alt		0.532	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
POTEC	388468	hgsc.bcm.edu	37	18	14542888	14542888	+	Silent	SNP	A	A	G	rs543140115	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr18:14542888A>G	ENST00000358970.5	-	1	257	c.258T>C	c.(256-258)caT>caC	p.H86H	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	86			H -> D (in dbSNP:rs45469098). {ECO:0000269|PubMed:15489334}.							NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						AGGAGTTGTCATGGTCTCCAG	0.587													.|||	10	0.00199681	0.0076	0.0	5008	,	,		28860	0.0		0.0	False		,,,				2504	0.0				p.H86H		Atlas-SNP	.											POTEC,NS,carcinoma,-2,1	POTEC	129	1	0			c.T258C						scavenged	.						51.0	57.0	55.0					18																	14542888		692	1591	2283	SO:0001819	synonymous_variant	388468	exon1			GTTGTCATGGTCT	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.258T>C	18.37:g.14542888A>G		Somatic	344	3	0.00872093		WXS	Illumina HiSeq	Phase_I	384	12	0.03125	NM_001137671		Silent	SNP	ENST00000358970.5	37	CCDS45835.1																																																																																			.	.	weak		0.587	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
CYP4A11	1579	hgsc.bcm.edu	37	1	47395874	47395874	+	Missense_Mutation	SNP	A	A	C	rs148507594	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:47395874A>C	ENST00000310638.4	-	12	1504	c.1473T>G	c.(1471-1473)atT>atG	p.I491M	CYP4A11_ENST00000462347.1_Missense_Mutation_p.I393M|CYP4A11_ENST00000371904.4_Missense_Mutation_p.I492M	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	491					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)	p.I491M(1)		endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	CAAGTCGTGCAATGGGGATGG	0.562													N|||	7	0.00139776	0.0015	0.0	5008	,	,		21860	0.0		0.001	False		,,,				2504	0.0041				p.I491M		Atlas-SNP	.											CYP4A11,NS,carcinoma,0,1	CYP4A11	77	1	1	Substitution - Missense(1)	endometrium(1)	c.T1473G						scavenged	.						124.0	109.0	114.0					1																	47395874		2203	4300	6503	SO:0001583	missense	1579	exon12			TCGTGCAATGGGG	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.1473T>G	1.37:g.47395874A>C	ENSP00000311095:p.Ile491Met	Somatic	206	1	0.00485437		WXS	Illumina HiSeq	Phase_I	274	3	0.0109489	NM_000778	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	37	CCDS543.1	.	.	.	.	.	.	.	.	.	.	A	5.139	0.211298	0.09757	.	.	ENSG00000187048	ENST00000310638;ENST00000371904	T;T	0.70164	-0.46;-0.46	4.41	-8.82	0.00810	.	1.064920	0.07281	N	0.870735	T	0.37237	0.0996	N	0.17564	0.495	0.09310	N	1	B	0.09022	0.002	B	0.23018	0.043	T	0.24799	-1.0150	10	0.13108	T	0.6	.	2.0606	0.03591	0.2182:0.3451:0.2706:0.166	.	491	Q02928	CP4AB_HUMAN	M	491;492	ENSP00000311095:I491M;ENSP00000360971:I492M	ENSP00000311095:I491M	I	-	3	3	CYP4A11	47168461	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-2.724000	0.00809	-2.209000	0.00739	-1.524000	0.00929	ATT	.	.	weak		0.562	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778	
MAPKAPK5	8550	hgsc.bcm.edu	37	12	112318333	112318333	+	Splice_Site	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:112318333T>A	ENST00000551404.2	+	8	768		c.e8+2		MAPKAPK5_ENST00000550735.2_Splice_Site			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5						activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		endometrium(1)|lung(11)|ovary(1)	13						TACAACAAGGTACAGGAAGAG	0.502																																					.		Atlas-SNP	.											MAPKAPK5,NS,carcinoma,0,1	MAPKAPK5	56	1	1	Unknown(1)	ovary(1)	c.660+2T>A						scavenged	.						126.0	116.0	119.0					12																	112318333		1961	4144	6105	SO:0001630	splice_region_variant	8550	exon8			ACAAGGTACAGGA	AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.660+2T>A	12.37:g.112318333T>A		Somatic	79	1	0.0126582		WXS	Illumina HiSeq	Phase_I	89	3	0.0337079	NM_139078	B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Splice_Site	SNP	ENST00000551404.2	37	CCDS44975.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.009017	0.75046	.	.	ENSG00000089022	ENST00000550735;ENST00000202788;ENST00000428907;ENST00000551404	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5655	0.84588	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAPKAPK5	110802716	1.000000	0.71417	0.992000	0.48379	0.724000	0.41520	5.970000	0.70431	2.302000	0.77476	0.533000	0.62120	.	.	.	none		0.502	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405019.2	NM_139078	Intron
PLK4	10733	hgsc.bcm.edu	37	4	128804641	128804641	+	Silent	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:128804641A>G	ENST00000270861.5	+	4	544	c.270A>G	c.(268-270)gaA>gaG	p.E90E	PLK4_ENST00000513090.1_Silent_p.E58E|PLK4_ENST00000507249.1_Silent_p.E90E|PLK4_ENST00000514379.1_Silent_p.E49E|PLK4_ENST00000511942.1_3'UTR|PLK4_ENST00000515069.1_Silent_p.E90E	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	90	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						TGGTATTAGAAATGTGCCATA	0.299																																					p.E90E	Colon(135;508 1718 19061 31832 42879)	Atlas-SNP	.											PLK4,NS,carcinoma,+1,1	PLK4	65	1	0			c.A270G						scavenged	.						66.0	71.0	69.0					4																	128804641		2203	4294	6497	SO:0001819	synonymous_variant	10733	exon4			ATTAGAAATGTGC	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.270A>G	4.37:g.128804641A>G		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	71	3	0.0422535	NM_014264	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Silent	SNP	ENST00000270861.5	37	CCDS3735.1																																																																																			.	.	none		0.299	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
ATF7IP	55729	hgsc.bcm.edu	37	12	14577330	14577330	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:14577330T>C	ENST00000540793.1	+	1	636	c.481T>C	c.(481-483)Tct>Cct	p.S161P	ATF7IP_ENST00000261168.4_Missense_Mutation_p.S161P|ATF7IP_ENST00000543189.1_Missense_Mutation_p.S161P|ATF7IP_ENST00000544627.1_Missense_Mutation_p.S169P|ATF7IP_ENST00000536444.1_Missense_Mutation_p.S161P|ATF7IP_ENST00000541654.1_3'UTR			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	161					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						TGATCCCACCTCTAGCGAGCC	0.587																																					p.S161P		Atlas-SNP	.											ATF7IP,NS,carcinoma,-1,1	ATF7IP	136	1	0			c.T481C						scavenged	.						74.0	69.0	71.0					12																	14577330		2203	4300	6503	SO:0001583	missense	55729	exon2			CCCACCTCTAGCG	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.481T>C	12.37:g.14577330T>C	ENSP00000444589:p.Ser161Pro	Somatic	222	3	0.0135135		WXS	Illumina HiSeq	Phase_I	279	5	0.0179211	NM_018179	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.980962	0.53827	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000542967;ENST00000544627;ENST00000541056;ENST00000539057;ENST00000545769;ENST00000396279;ENST00000540793	T;T;T;T;T;T	0.26518	2.04;2.06;2.04;2.03;1.73;2.04	4.94	-0.197	0.13228	.	0.380812	0.23023	N	0.052830	T	0.17746	0.0426	L	0.44542	1.39	0.09310	N	1	B;B;B;B;B	0.14012	0.009;0.009;0.003;0.003;0.001	B;B;B;B;B	0.16722	0.016;0.016;0.004;0.004;0.005	T	0.17137	-1.0379	10	0.62326	D	0.03	-1.6504	4.851	0.13537	0.0:0.1716:0.3056:0.5227	.	169;161;161;161;161	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2	.;.;.;MCAF1_HUMAN;.	P	161;161;161;161;169;161;161;161;161;161	ENSP00000261168:S161P;ENSP00000443179:S161P;ENSP00000445955:S161P;ENSP00000440440:S169P;ENSP00000379575:S161P;ENSP00000444589:S161P	ENSP00000261168:S161P	S	+	1	0	ATF7IP	14468597	0.000000	0.05858	0.003000	0.11579	0.014000	0.08584	-0.016000	0.12613	0.065000	0.16485	0.460000	0.39030	TCT	.	.	none		0.587	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
HECTD4	283450	hgsc.bcm.edu	37	12	112616820	112616820	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:112616820C>T	ENST00000430131.2	-	63	11157	c.10012G>A	c.(10012-10014)Gag>Aag	p.E3338K	HECTD4_ENST00000377560.5_Missense_Mutation_p.E3588K|HECTD4_ENST00000550722.1_Missense_Mutation_p.E3614K			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3338					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GGGTGCTGCTCCTTCCCGGCC	0.617																																					p.E3626K		Atlas-SNP	.											C12orf51_ENST00000377560,NS,carcinoma,+2,2	.	.	2	0			c.G10876A						scavenged	.						40.0	43.0	42.0					12																	112616820		2084	4220	6304	SO:0001583	missense	283450	exon64			GCTGCTCCTTCCC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.10012G>A	12.37:g.112616820C>T	ENSP00000404379:p.Glu3338Lys	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	133	2	0.0150376	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	C	36	5.671516	0.96754	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.52526	0.66;0.66;0.66	5.51	5.51	0.81932	.	.	.	.	.	T	0.55784	0.1942	N	0.19112	0.55	0.58432	D	0.999999	P	0.52842	0.956	D	0.65010	0.931	T	0.61302	-0.7090	9	0.87932	D	0	.	19.3944	0.94601	0.0:1.0:0.0:0.0	.	3338	Q9Y4D8	K0614_HUMAN	K	3588;3338;3614	ENSP00000366783:E3588K;ENSP00000404379:E3338K;ENSP00000449784:E3614K	ENSP00000366783:E3588K	E	-	1	0	C12orf51	111101203	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.487000	0.81328	2.574000	0.86865	0.591000	0.81541	GAG	.	.	none		0.617	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
OR1S2	219958	hgsc.bcm.edu	37	11	57971203	57971203	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:57971203C>G	ENST00000302592.6	-	1	450	c.451G>C	c.(451-453)Gcc>Ccc	p.A151P		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				CCGAACCTGGCCCGCATGAAA	0.473																																					p.A151P		Atlas-SNP	.											OR1S2,NS,carcinoma,0,3	OR1S2	119	3	0			c.G451C						scavenged	.						163.0	154.0	157.0					11																	57971203		2201	4296	6497	SO:0001583	missense	219958	exon1			ACCTGGCCCGCAT	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.451G>C	11.37:g.57971203C>G	ENSP00000305469:p.Ala151Pro	Somatic	226	6	0.0265487		WXS	Illumina HiSeq	Phase_I	259	6	0.023166	NM_001004459	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.753352	0.00085	.	.	ENSG00000197887	ENST00000302592	T	0.34275	1.37	4.47	-1.08	0.09936	GPCR, rhodopsin-like superfamily (1);	0.857144	0.09920	N	0.738596	T	0.04770	0.0129	N	0.00089	-2.185	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30149	-0.9988	10	0.02654	T	1	.	0.1523	0.00094	0.2967:0.2321:0.2346:0.2366	.	151	Q8NGQ3	OR1S2_HUMAN	P	151	ENSP00000305469:A151P	ENSP00000305469:A151P	A	-	1	0	OR1S2	57727779	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.298000	0.02756	-0.572000	0.06006	-0.120000	0.15030	GCC	.	.	none		0.473	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
PRR21	643905	hgsc.bcm.edu	37	2	240982271	240982271	+	Silent	SNP	G	G	A	rs76841013	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:240982271G>A	ENST00000408934.1	-	1	128	c.129C>T	c.(127-129)caC>caT	p.H43H		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	43	Pro-rich.							p.H43H(4)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGAAGAGCCGTGGATGAAGG	0.577													N|||	1226	0.244808	0.1838	0.2061	5008	,	,		19244	0.4167		0.2555	False		,,,				2504	0.1667				p.H43H		Atlas-SNP	.											PRR21,NS,lymphoid_neoplasm,0,4	PRR21	53	4	4	Substitution - coding silent(4)	haematopoietic_and_lymphoid_tissue(4)	c.C129T						scavenged	.						110.0	98.0	102.0					2																	240982271		2203	4300	6503	SO:0001819	synonymous_variant	643905	exon1			AGAGCCGTGGATG	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.129C>T	2.37:g.240982271G>A		Somatic	79	2	0.0253165		WXS	Illumina HiSeq	Phase_I	64	14	0.21875	NM_001080835		Silent	SNP	ENST00000408934.1	37	CCDS33417.1																																																																																			G|0.755;A|0.245	0.245	strong		0.577	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
PLIN4	729359	hgsc.bcm.edu	37	19	4512945	4512945	+	Missense_Mutation	SNP	C	C	T	rs75031432	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:4512945C>T	ENST00000301286.3	-	3	984	c.985G>A	c.(985-987)Ggt>Agt	p.G329S		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	329	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TTCATGGCACCAGTCACCCCA	0.567													C|||	840	0.167732	0.4539	0.1037	5008	,	,		18994	0.0119		0.0934	False		,,,				2504	0.0634				p.G329S		Atlas-SNP	.											PLIN4_ENST00000301286,NS,carcinoma,0,2	PLIN4	191	2	0			c.G985A						scavenged	.						39.0	40.0	39.0					19																	4512945		1862	4105	5967	SO:0001583	missense	729359	exon3			TGGCACCAGTCAC	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.985G>A	19.37:g.4512945C>T	ENSP00000301286:p.Gly329Ser	Somatic	329	3	0.00911854		WXS	Illumina HiSeq	Phase_I	415	10	0.0240964	NM_001080400	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.776204	0.49786	.	.	ENSG00000167676	ENST00000301286	T	0.13901	2.55	4.53	1.21	0.21127	.	0.420915	0.19796	N	0.105865	T	0.13543	0.0328	L	0.46157	1.445	0.80722	P	0.0	D	0.54397	0.966	P	0.45794	0.493	T	0.19353	-1.0308	9	0.87932	D	0	-15.096	7.3812	0.26856	0.0:0.7112:0.0:0.2888	rs56366613	329	Q96Q06	PLIN4_HUMAN	S	329	ENSP00000301286:G329S	ENSP00000301286:G329S	G	-	1	0	PLIN4	4463945	0.091000	0.21658	0.003000	0.11579	0.001000	0.01503	0.810000	0.27183	0.906000	0.36621	0.407000	0.27541	GGT	C|0.826;T|0.174	0.174	strong		0.567	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
PKD1L1	168507	hgsc.bcm.edu	37	7	47873941	47873941	+	Missense_Mutation	SNP	C	C	T	rs17131834	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:47873941C>T	ENST00000289672.2	-	40	6220	c.6170G>A	c.(6169-6171)cGc>cAc	p.R2057H		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2057			R -> H (in dbSNP:rs17131834).		detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ATTTACCTTGCGTGGCTCCTG	0.428													C|||	98	0.0195687	0.0696	0.0072	5008	,	,		21422	0.001		0.0	False		,,,				2504	0.0				p.R2057H		Atlas-SNP	.											.	PKD1L1	328	.	0			c.G6170A						PASS	.	C	HIS/ARG	203,4203	125.3+/-162.5	6,191,2006	144.0	128.0	134.0		6170	-7.9	0.0	7	dbSNP_123	134	0,8600		0,0,4300	yes	missense	PKD1L1	NM_138295.3	29	6,191,6306	TT,TC,CC		0.0,4.6074,1.5608	benign	2057/2850	47873941	203,12803	2203	4300	6503	SO:0001583	missense	168507	exon40			ACCTTGCGTGGCT	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6170G>A	7.37:g.47873941C>T	ENSP00000289672:p.Arg2057His	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	81	4	0.0493827	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	37	0.01694139194139194	32	0.06504065040650407	4	0.011049723756906077	1	0.0017482517482517483	0	0.0	C	3.158	-0.172750	0.06421	0.046074	0.0	ENSG00000158683	ENST00000289672	T	0.19669	2.13	3.93	-7.87	0.01183	.	2749.160000	0.00357	U	0.000035	T	0.00724	0.0024	N	0.22421	0.69	0.09310	N	1	B	0.31077	0.307	B	0.20384	0.029	T	0.06534	-1.0821	10	0.15499	T	0.54	.	8.1002	0.30852	0.0:0.1383:0.574:0.2877	rs17131834	2057	Q8TDX9	PK1L1_HUMAN	H	2057	ENSP00000289672:R2057H	ENSP00000289672:R2057H	R	-	2	0	PKD1L1	47840466	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.982000	0.03762	-2.060000	0.00893	-0.369000	0.07265	CGC	C|0.978;T|0.022	0.022	strong		0.428	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
ZC3HAV1	56829	hgsc.bcm.edu	37	7	138732496	138732496	+	Silent	SNP	A	A	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:138732496A>C	ENST00000242351.5	-	13	2869	c.2553T>G	c.(2551-2553)acT>acG	p.T851T	ZC3HAV1_ENST00000464606.1_Silent_p.T973T	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	851	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.		T -> I (in dbSNP:rs3735007). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005}.		defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.T851T(1)		cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						TATTTCCTTCAGTAAACTTTC	0.428																																					p.T851T		Atlas-SNP	.											ZC3HAV1,colon,carcinoma,0,1	ZC3HAV1	75	1	1	Substitution - coding silent(1)	large_intestine(1)	c.T2553G						scavenged	.						138.0	138.0	138.0					7																	138732496		2203	4300	6503	SO:0001819	synonymous_variant	56829	exon13			TCCTTCAGTAAAC	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.2553T>G	7.37:g.138732496A>C		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	95	2	0.0210526	NM_020119	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Silent	SNP	ENST00000242351.5	37	CCDS5851.1																																																																																			.	.	none		0.428	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
GALNT6	11226	hgsc.bcm.edu	37	12	51754559	51754559	+	Silent	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:51754559G>T	ENST00000543196.2	-	6	1318	c.1113C>A	c.(1111-1113)acC>acA	p.T371T	GALNT6_ENST00000356317.3_Silent_p.T371T			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	371	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GATTATCATAGGTACCGATGT	0.542																																					p.T371T		Atlas-SNP	.											GALNT6,colon,NS,-2,1	GALNT6	63	1	0			c.C1113A						scavenged	.						112.0	97.0	102.0					12																	51754559		2203	4300	6503	SO:0001819	synonymous_variant	11226	exon7			ATCATAGGTACCG	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.1113C>A	12.37:g.51754559G>T		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	132	4	0.030303	NM_007210	Q8IYH4|Q9H6G2|Q9UIV5	Silent	SNP	ENST00000543196.2	37	CCDS8813.1																																																																																			.	.	none		0.542	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
TPTE	7179	hgsc.bcm.edu	37	21	10971306	10971306	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr21:10971306G>A	ENST00000361285.4	-	5	380	c.51C>T	c.(49-51)ctC>ctT	p.L17L	TPTE_ENST00000342420.5_Silent_p.L17L|TPTE_ENST00000298232.7_Silent_p.L17L|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	17					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CATTGGGGCCGAGCTCAATGA	0.468																																					p.L17L		Atlas-SNP	.											.	TPTE	513	.	0			c.C51T						PASS	.						130.0	100.0	110.0					21																	10971306		2203	4300	6503	SO:0001819	synonymous_variant	7179	exon5			GGGGCCGAGCTCA	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.51C>T	21.37:g.10971306G>A		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	124	15	0.120968	NM_199259	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	ENST00000361285.4	37	CCDS13560.2																																																																																			.	.	none		0.468	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
CDS2	8760	hgsc.bcm.edu	37	20	5157301	5157301	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:5157301G>A	ENST00000460006.1	+	4	606	c.299G>A	c.(298-300)tGc>tAc	p.C100Y	CDS2_ENST00000379070.3_3'UTR|CDS2_ENST00000535100.1_5'Flank|CDS2_ENST00000379062.4_Intron	NM_003818.3	NP_003809.1	O95674	CDS2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2	100					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	phosphatidate cytidylyltransferase activity (GO:0004605)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|stomach(1)	14						CAGGTGATGTGCGTTCAGATT	0.443																																					p.C100Y		Atlas-SNP	.											CDS2,caecum,carcinoma,-1,1	CDS2	27	1	0			c.G299A						scavenged	.						221.0	201.0	208.0					20																	5157301		2203	4300	6503	SO:0001583	missense	8760	exon4			TGATGTGCGTTCA	AF069532	CCDS13088.1	20p13	2006-03-28			ENSG00000101290	ENSG00000101290	2.7.7.41		1801	protein-coding gene	gene with protein product		603549				9806839, 9889000	Standard	NM_003818		Approved		uc002wls.3	O95674	OTTHUMG00000031801	ENST00000460006.1:c.299G>A	20.37:g.5157301G>A	ENSP00000419879:p.Cys100Tyr	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	159	4	0.0251572	NM_003818	B2RDC6|D3DW04|Q5TDY2|Q5TDY3|Q5TDY4|Q5TDY5|Q9BYK5|Q9NTT2	Missense_Mutation	SNP	ENST00000460006.1	37	CCDS13088.1	.	.	.	.	.	.	.	.	.	.	G	5.750	0.322711	0.10900	.	.	ENSG00000101290	ENST00000460006;ENST00000450570	T;T	0.41758	0.99;0.99	4.72	4.72	0.59763	.	0.086042	0.85682	D	0.000000	T	0.36248	0.0960	L	0.29908	0.895	0.80722	D	1	B;B;B	0.31174	0.311;0.174;0.174	B;B;B	0.36335	0.222;0.222;0.222	T	0.13124	-1.0521	10	0.30078	T	0.28	-2.0E-4	16.7771	0.85553	0.0:0.0:1.0:0.0	.	100;100;100	B3KM95;O95674;B3KNK4	.;CDS2_HUMAN;.	Y	100;45	ENSP00000419879:C100Y;ENSP00000403205:C45Y	ENSP00000403205:C45Y	C	+	2	0	CDS2	5105301	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.641000	0.83368	2.607000	0.88179	0.561000	0.74099	TGC	.	.	none		0.443	CDS2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077858.2		
ACP1	52	hgsc.bcm.edu	37	2	277273	277273	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:277273G>A	ENST00000272065.5	+	6	539	c.446G>A	c.(445-447)tGc>tAc	p.C149Y	ACP1_ENST00000272067.6_Missense_Mutation_p.C149Y|ACP1_ENST00000484464.1_3'UTR	NM_004300.3	NP_004291.1	P24666	PPAC_HUMAN	acid phosphatase 1, soluble	149						cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|extracellular vesicular exosome (GO:0070062)	acid phosphatase activity (GO:0003993)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.000391)|Epithelial(75;0.00281)|OV - Ovarian serous cystadenocarcinoma(76;0.00542)|GBM - Glioblastoma multiforme(21;0.127)	Adenine(DB00173)	TGTGTCAGGTGCTGCAGAGCG	0.532																																					p.C149Y		Atlas-SNP	.											ACP1_ENST00000272067,colon,carcinoma,-1,2	ACP1	42	2	0			c.G446A						scavenged	.						142.0	135.0	138.0					2																	277273		2203	4300	6503	SO:0001583	missense	52	exon6			TCAGGTGCTGCAG	M87546	CCDS1639.1, CCDS1640.1, CCDS46217.1	2p25	2011-06-09			ENSG00000143727	ENSG00000143727	3.1.3.2	"""Protein tyrosine phosphatases / Class II Cys-based PTPs"""	122	protein-coding gene	gene with protein product		171500					Standard	NM_001040649		Approved		uc002qwf.3	P24666	OTTHUMG00000086933	ENST00000272065.5:c.446G>A	2.37:g.277273G>A	ENSP00000272065:p.Cys149Tyr	Somatic	214	0	0		WXS	Illumina HiSeq	Phase_I	208	4	0.0192308	NM_007099	A8K1L9|B5MCC7|P24667|Q16035|Q16036|Q16725|Q3KQX8|Q53RU0	Missense_Mutation	SNP	ENST00000272065.5	37	CCDS1639.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001526	0.74818	.	.	ENSG00000143727	ENST00000272067;ENST00000272065	T;T	0.29397	1.57;1.57	5.62	5.62	0.85841	Phosphotyrosine protein phosphatase I superfamily (3);	0.000000	0.85682	D	0.000000	T	0.39784	0.1091	M	0.67517	2.055	0.80722	D	1	B;B	0.31640	0.333;0.279	B;B	0.36378	0.199;0.223	T	0.32428	-0.9907	10	0.72032	D	0.01	-12.6608	17.1625	0.86807	0.0:0.0:1.0:0.0	.	149;149	P24666-2;P24666	.;PPAC_HUMAN	Y	149	ENSP00000272067:C149Y;ENSP00000272065:C149Y	ENSP00000272065:C149Y	C	+	2	0	ACP1	267273	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.899000	0.92544	2.632000	0.89209	0.655000	0.94253	TGC	.	.	none		0.532	ACP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195862.3		
MUC2	4583	hgsc.bcm.edu	37	11	1093295	1093295	+	Missense_Mutation	SNP	C	C	T	rs200837746|rs200145328		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:1093295C>T	ENST00000441003.2	+	30	5141	c.5114C>T	c.(5113-5115)aCt>aTt	p.T1705I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1672I	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1705I(1)|p.T1672I(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccaccactacggtgacc	0.642																																					p.T1705I		Atlas-SNP	.											MUC2_ENST00000441003,rectum,carcinoma,0,2	MUC2	614	2	2	Substitution - Missense(2)	large_intestine(2)	c.C5114T						scavenged	.						113.0	161.0	144.0					11																	1093295		1882	3466	5348	SO:0001583	missense	4583	exon30			CCACCACTACGGT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5114C>T	11.37:g.1093295C>T	ENSP00000415183:p.Thr1705Ile	Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	48	3	0.0625	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.775	-0.764347	0.02996	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11277	3.02;2.79	1.6	-0.698	0.11280	.	0.547305	0.11728	U	0.535177	T	0.05868	0.0153	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.38457	-0.9660	9	0.34782	T	0.22	.	3.0673	0.06219	0.0:0.5189:0.2842:0.1969	.	1705	E7EUV1	.	I	1705;1672	ENSP00000415183:T1705I;ENSP00000351956:T1672I	ENSP00000351956:T1672I	T	+	2	0	MUC2	1083295	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.065000	0.14466	-0.392000	0.07751	-1.238000	0.01547	ACT	.	.	alt		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
KIAA0586	9786	hgsc.bcm.edu	37	14	58910793	58910793	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr14:58910793A>G	ENST00000556134.1	+	7	936	c.662A>G	c.(661-663)gAg>gGg	p.E221G	KIAA0586_ENST00000354386.6_Missense_Mutation_p.E289G|KIAA0586_ENST00000423743.3_Missense_Mutation_p.E192G|Y_RNA_ENST00000516389.1_RNA|KIAA0586_ENST00000261244.5_Missense_Mutation_p.E236G|KIAA0586_ENST00000538571.2_3'UTR	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	221					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGGAAACAAGAGAAATTACAT	0.348																																					p.E289G		Atlas-SNP	.											KIAA0586_ENST00000261244,colon,carcinoma,-1,2	KIAA0586	180	2	0			c.A866G						scavenged	.						99.0	90.0	93.0					14																	58910793		1941	4145	6086	SO:0001583	missense	9786	exon8			AACAAGAGAAATT	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.662A>G	14.37:g.58910793A>G	ENSP00000452351:p.Glu221Gly	Somatic	349	0	0		WXS	Illumina HiSeq	Phase_I	365	4	0.0109589	NM_001244189	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	A	17.83	3.486674	0.63962	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000555833;ENST00000261244;ENST00000546216	T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12	5.84	4.71	0.59529	.	0.159354	0.44483	D	0.000446	T	0.71005	0.3289	M	0.62723	1.935	0.27723	N	0.945078	P;D;D;D;D;P	0.89917	0.873;0.977;1.0;0.977;0.977;0.873	P;P;D;P;P;P	0.87578	0.523;0.73;0.998;0.73;0.73;0.599	T	0.65071	-0.6257	10	0.87932	D	0	.	11.0593	0.47938	0.9273:0.0:0.0727:0.0	.	96;96;289;236;221;192	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	G	289;221;192;151;236;96	ENSP00000346359:E289G;ENSP00000452351:E221G;ENSP00000399427:E192G;ENSP00000450855:E151G;ENSP00000261244:E236G	ENSP00000261244:E236G	E	+	2	0	KIAA0586	57980546	1.000000	0.71417	0.290000	0.24890	0.520000	0.34377	4.681000	0.61663	2.234000	0.73211	0.528000	0.53228	GAG	.	.	none		0.348	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749	
PPAPDC3	84814	hgsc.bcm.edu	37	9	134165636	134165636	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:134165636C>T	ENST00000372264.3	+	1	556	c.252C>T	c.(250-252)tcC>tcT	p.S84S	PPAPDC3_ENST00000372261.1_Silent_p.S84S	NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	84	interaction with MTOR. {ECO:0000250}.				negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)	p.S84S(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		CCTTCAACTCCCTGCTGGCCA	0.652																																					p.S84S		Atlas-SNP	.											PPAPDC3,NS,carcinoma,0,1	PPAPDC3	24	1	1	Substitution - coding silent(1)	lung(1)	c.C252T						scavenged	.						79.0	76.0	77.0					9																	134165636		2203	4300	6503	SO:0001819	synonymous_variant	84814	exon1			CAACTCCCTGCTG	AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.252C>T	9.37:g.134165636C>T		Somatic	165	1	0.00606061		WXS	Illumina HiSeq	Phase_I	140	3	0.0214286	NM_032728	Q5T6P0|Q96SS7|Q9BRC3	Silent	SNP	ENST00000372264.3	37	CCDS6942.1																																																																																			.	.	none		0.652	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054724.1	NM_032728	
KCNA1	3736	hgsc.bcm.edu	37	12	5021624	5021624	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:5021624C>T	ENST00000382545.3	+	2	2187	c.1080C>T	c.(1078-1080)ccC>ccT	p.P360P	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	360					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CCAGTATCCCCGATGCTTTCT	0.537																																					p.P360P		Atlas-SNP	.											KCNA1,NS,carcinoma,0,3	KCNA1	112	3	0			c.C1080T						scavenged	.						186.0	178.0	181.0					12																	5021624		2203	4300	6503	SO:0001819	synonymous_variant	3736	exon2			TATCCCCGATGCT	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.1080C>T	12.37:g.5021624C>T		Somatic	188	0	0		WXS	Illumina HiSeq	Phase_I	212	5	0.0235849	NM_000217	A6NM83|Q3MIQ9	Silent	SNP	ENST00000382545.3	37	CCDS8535.1																																																																																			.	.	none		0.537	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
XPOT	11260	hgsc.bcm.edu	37	12	64812728	64812728	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:64812728A>G	ENST00000332707.5	+	6	872	c.343A>G	c.(343-345)Aca>Gca	p.T115A		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	115	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.T115A(2)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		GCTTTTTGTTACAGAGTATCT	0.433																																					p.T115A		Atlas-SNP	.											XPOT,bladder,carcinoma,0,3	XPOT	105	3	2	Substitution - Missense(2)	kidney(2)	c.A343G						scavenged	.						108.0	103.0	105.0					12																	64812728		2203	4300	6503	SO:0001583	missense	11260	exon6			TTTGTTACAGAGT	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.343A>G	12.37:g.64812728A>G	ENSP00000327821:p.Thr115Ala	Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	228	6	0.0263158	NM_007235	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	A	7.950	0.744725	0.15710	.	.	ENSG00000184575	ENST00000332707;ENST00000400935	T;T	0.39406	1.08;1.08	4.78	4.78	0.61160	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.149484	0.64402	D	0.000017	T	0.19046	0.0457	N	0.02296	-0.605	0.46356	D	0.999	B	0.18610	0.029	B	0.14578	0.011	T	0.09596	-1.0667	9	.	.	.	.	14.633	0.68671	1.0:0.0:0.0:0.0	.	115	O43592	XPOT_HUMAN	A	115	ENSP00000327821:T115A;ENSP00000383722:T115A	.	T	+	1	0	XPOT	63098995	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.253000	0.78320	1.918000	0.55548	0.455000	0.32223	ACA	.	.	none		0.433	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
ZBTB7C	201501	hgsc.bcm.edu	37	18	45566798	45566798	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr18:45566798G>A	ENST00000588982.1	-	3	1182	c.681C>T	c.(679-681)atC>atT	p.I227I	ZBTB7C_ENST00000590800.1_Silent_p.I227I|ZBTB7C_ENST00000535628.2_Silent_p.I227I|ZBTB7C_ENST00000586438.1_Silent_p.I227I|ZBTB7C_ENST00000332053.2_Silent_p.I227I			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	227							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						GCAGAGATTCGATGGAGAAGT	0.587																																					p.I227I		Atlas-SNP	.											.	ZBTB7C	73	.	0			c.C681T						PASS	.						49.0	50.0	49.0					18																	45566798		2203	4300	6503	SO:0001819	synonymous_variant	201501	exon2			AGATTCGATGGAG	Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.681C>T	18.37:g.45566798G>A		Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	171	63	0.368421	NM_001039360	O73453	Silent	SNP	ENST00000588982.1	37	CCDS32830.1																																																																																			.	.	none		0.587	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
TRPM7	54822	hgsc.bcm.edu	37	15	50901921	50901921	+	Splice_Site	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:50901921C>T	ENST00000313478.7	-	19	2718	c.2437G>A	c.(2437-2439)Gaa>Aaa	p.E813K	TRPM7_ENST00000560955.1_Splice_Site_p.E813K	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	813					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TTAAACACTTCCtaaaattaa	0.279																																					p.E813K		Atlas-SNP	.											TRPM7,NS,other,+2,1	TRPM7	145	1	0			c.G2437A						scavenged	.						93.0	83.0	86.0					15																	50901921		1784	4047	5831	SO:0001630	splice_region_variant	54822	exon19			ACACTTCCTAAAA	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.2437-1G>A	15.37:g.50901921C>T		Somatic	77	1	0.012987		WXS	Illumina HiSeq	Phase_I	89	2	0.0224719	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	37	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.098049	0.37048	.	.	ENSG00000092439	ENST00000313478	T	0.62941	-0.01	5.65	5.65	0.86999	.	0.152298	0.64402	D	0.000016	T	0.35158	0.0922	N	0.05383	-0.06	0.53688	D	0.999975	P	0.38922	0.651	B	0.25140	0.058	T	0.34950	-0.9808	10	0.24483	T	0.36	-23.2072	12.9996	0.58667	0.0:0.9262:0.0:0.0738	.	813	Q96QT4	TRPM7_HUMAN	K	813	ENSP00000320239:E813K	ENSP00000320239:E813K	E	-	1	0	TRPM7	48689213	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.782000	0.68973	2.680000	0.91292	0.467000	0.42956	GAA	.	.	none		0.279	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	Missense_Mutation
GPR37L1	9283	hgsc.bcm.edu	37	1	202097123	202097123	+	Silent	SNP	C	C	T	rs144820477		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:202097123C>T	ENST00000367282.5	+	2	991	c.885C>T	c.(883-885)ccC>ccT	p.P295P		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	295					negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.P295P(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						CCAGCCTGCCCGAGTCCCTGT	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19887	0.0		0.0	False		,,,				2504	0.0				p.P295P		Atlas-SNP	.											GPR37L1,NS,carcinoma,0,1	GPR37L1	33	1	1	Substitution - coding silent(1)	endometrium(1)	c.C885T						scavenged	.						66.0	60.0	62.0					1																	202097123		2203	4300	6503	SO:0001819	synonymous_variant	9283	exon2			CCTGCCCGAGTCC	AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.885C>T	1.37:g.202097123C>T		Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	147	3	0.0204082	NM_004767	B2R7M9|Q5SXP7|Q86VP7	Silent	SNP	ENST00000367282.5	37	CCDS1420.1																																																																																			C|1.000;G|0.000	.	alt		0.607	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087496.2	NM_004767	
ITGA2	3673	hgsc.bcm.edu	37	5	52351856	52351856	+	Silent	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:52351856T>C	ENST00000296585.5	+	9	1116	c.973T>C	c.(973-975)Tta>Cta	p.L325L		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	325	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TACTAAAAATTTAATAAAAGA	0.358																																					p.L325L		Atlas-SNP	.											.	ITGA2	211	.	0			c.T973C						PASS	.						37.0	42.0	41.0					5																	52351856		2198	4297	6495	SO:0001819	synonymous_variant	3673	exon9			AAAAATTTAATAA		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.973T>C	5.37:g.52351856T>C		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	102	5	0.0490196	NM_002203	Q14595	Silent	SNP	ENST00000296585.5	37	CCDS3957.1																																																																																			.	.	none		0.358	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
PABPC1	26986	hgsc.bcm.edu	37	8	101724606	101724606	+	Missense_Mutation	SNP	G	G	A	rs202060459		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:101724606G>A	ENST00000318607.5	-	7	2084	c.956C>T	c.(955-957)aCa>aTa	p.T319I	PABPC1_ENST00000519004.1_Missense_Mutation_p.T274I|PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000522387.1_Missense_Mutation_p.T287I	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	319	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.T319I(2)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ACTAGTGATTGTACCAAATGG	0.284																																					p.T319I		Atlas-SNP	.											PABPC1,NS,carcinoma,0,2	PABPC1	76	2	2	Substitution - Missense(2)	kidney(1)|endometrium(1)	c.C956T						scavenged	.						154.0	166.0	162.0					8																	101724606		2203	4298	6501	SO:0001583	missense	26986	exon7			GTGATTGTACCAA	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.956C>T	8.37:g.101724606G>A	ENSP00000313007:p.Thr319Ile	Somatic	203	1	0.00492611		WXS	Illumina HiSeq	Phase_I	222	3	0.0135135	NM_002568	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.768189|4.768189	0.90020|0.90020	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000519100|ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387	.|T;T;T	.|0.16196	.|2.36;2.36;2.36	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.64402	.|D	.|0.000009	.|T	.|0.37652	.|0.1011	M|M	0.62154|0.62154	1.92|1.92	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.54964	.|0.917;0.784;0.969	.|P;B;P	.|0.56916	.|0.747;0.442;0.809	.|T	.|0.03784	.|-1.1004	.|10	.|0.87932	.|D	.|0	.|.	20.0919|20.0919	0.97823|0.97823	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|287;319;319	.|E7ERJ7;B3KT93;P11940	.|.;.;PABP1_HUMAN	X|I	188|319;319;274;287	.|ENSP00000313007:T319I;ENSP00000429594:T274I;ENSP00000429395:T287I	.|ENSP00000313007:T319I	Q|T	-|-	1|2	0|0	PABPC1|PABPC1	101793782|101793782	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.776000|9.776000	0.99001|0.99001	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	CAA|ACA	.	.	weak		0.284	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
PCDHB4	56131	hgsc.bcm.edu	37	5	140502487	140502487	+	Missense_Mutation	SNP	A	A	G	rs372292910		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:140502487A>G	ENST00000194152.1	+	1	907	c.907A>G	c.(907-909)Aaa>Gaa	p.K303E	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	303	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K305fs*12(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATACTGTTGAAAAAAAAATT	0.368																																					p.K303E		Atlas-SNP	.											PCDHB4,NS,carcinoma,-2,1	PCDHB4	177	1	1	Deletion - Frameshift(1)	lung(1)	c.A907G						scavenged	.						88.0	105.0	99.0					5																	140502487		2202	4299	6501	SO:0001583	missense	56131	exon1			CTGTTGAAAAAAA	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.907A>G	5.37:g.140502487A>G	ENSP00000194152:p.Lys303Glu	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	76	2	0.0263158	NM_018938	Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	A	8.408	0.843501	0.16963	.	.	ENSG00000081818	ENST00000194152	T	0.52754	0.65	4.41	1.86	0.25419	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.49253	0.1546	M	0.69823	2.125	0.09310	N	1	B	0.22800	0.075	B	0.39339	0.297	T	0.50294	-0.8845	9	0.15066	T	0.55	.	6.5705	0.22535	0.5632:0.2349:0.0:0.2018	.	303	Q9Y5E5	PCDB4_HUMAN	E	303	ENSP00000194152:K303E	ENSP00000194152:K303E	K	+	1	0	PCDHB4	140482671	0.000000	0.05858	0.607000	0.28956	0.520000	0.34377	0.782000	0.26788	0.278000	0.22164	0.528000	0.53228	AAA	.	.	none		0.368	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
MYC	4609	hgsc.bcm.edu	37	8	128750625	128750625	+	Missense_Mutation	SNP	G	G	C	rs121918684		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128750625G>C	ENST00000259523.6	+	2	1322	c.117G>C	c.(115-117)gaG>gaC	p.E39D	MYC_ENST00000524013.1_Missense_Mutation_p.E53D|MYC_ENST00000377970.2_Missense_Mutation_p.E54D			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	39			E -> D (in a Burkitt lymphoma symple). {ECO:0000269|PubMed:6419122, ECO:0000269|PubMed:8220424}.		branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	AGCAGAGCGAGCTGCAGCCCC	0.632		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E54D		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	MYC_ENST00000377970,NS,lymphoid_neoplasm,0,8	MYC	168	8	0			c.G162C						PASS	.						35.0	39.0	38.0					8																	128750625		2203	4300	6503	SO:0001583	missense	4609	exon2			GAGCGAGCTGCAG		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.117G>C	8.37:g.128750625G>C	ENSP00000259523:p.Glu39Asp	Somatic	71	0	0	1567	WXS	Illumina HiSeq	Phase_I	74	25	0.337838	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000259523.6	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.32|12.32	1.903276|1.903276	0.33628|0.33628	.|.	.|.	ENSG00000136997|ENSG00000136997	ENST00000259523;ENST00000517291;ENST00000377970;ENST00000524013|ENST00000520751	T;T;T;T|.	0.18810|.	2.19;2.19;2.19;2.19|.	4.78|4.78	3.9|3.9	0.45041|0.45041	Transcription regulator Myc, N-terminal (1);|.	0.367998|.	0.32671|.	N|.	0.005795|.	T|T	0.25717|0.25717	0.0626|0.0626	N|N	0.04508|0.04508	-0.205|-0.205	0.35092|0.35092	A|A	0.764443|0.764443	B|.	0.28667|.	0.219|.	B|.	0.30251|.	0.113|.	T|T	0.39461|0.39461	-0.9613|-0.9613	9|5	0.38643|0.87932	T|D	0.18|0	-20.4721|-20.4721	8.9469|8.9469	0.35764|0.35764	0.1688:0.0:0.8312:0.0|0.1688:0.0:0.8312:0.0	.|.	39|.	P01106|.	MYC_HUMAN|.	D|T	39;53;54;53|28	ENSP00000259523:E39D;ENSP00000429441:E53D;ENSP00000367207:E54D;ENSP00000430235:E53D|.	ENSP00000259523:E39D|ENSP00000430226:S28T	E|S	+|+	3|2	2|0	MYC|MYC	128819807|128819807	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	4.447000|4.447000	0.60020|0.60020	1.389000|1.389000	0.46526|0.46526	0.561000|0.561000	0.74099|0.74099	GAG|AGC	.	.	weak		0.632	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
MUC7	4589	hgsc.bcm.edu	37	4	71347240	71347240	+	Missense_Mutation	SNP	T	T	C	rs145745951	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:71347240T>C	ENST00000304887.5	+	3	969	c.779T>C	c.(778-780)gTc>gCc	p.V260A	MUC7_ENST00000456088.1_Missense_Mutation_p.V260A|MUC7_ENST00000413702.1_Missense_Mutation_p.V260A	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	260	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.V260A(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			ACCACAGCTGTCCCACCCACA	0.587													C|||	16	0.00319489	0.0038	0.0029	5008	,	,		19991	0.0		0.008	False		,,,				2504	0.001				p.V260A		Atlas-SNP	.											MUC7,extremity,malignant_melanoma,0,2	MUC7	91	2	1	Substitution - Missense(1)	skin(1)	c.T779C						scavenged	.						521.0	441.0	468.0					4																	71347240		2201	4300	6501	SO:0001583	missense	4589	exon4			CAGCTGTCCCACC	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.779T>C	4.37:g.71347240T>C	ENSP00000302021:p.Val260Ala	Somatic	331	27	0.081571		WXS	Illumina HiSeq	Phase_I	468	37	0.0790598	NM_001145007	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.737530	0.00681	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.44482	0.92;0.92;0.92	1.11	-2.23	0.06930	.	.	.	.	.	T	0.13543	0.0328	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20438	-1.0275	8	.	.	.	.	3.5881	0.07978	0.0:0.2514:0.2169:0.5317	.	260	Q8TAX7	MUC7_HUMAN	A	260	ENSP00000407422:V260A;ENSP00000400585:V260A;ENSP00000302021:V260A	.	V	+	2	0	MUC7	71381829	0.000000	0.05858	0.003000	0.11579	0.040000	0.13550	-0.078000	0.11375	-1.146000	0.02854	-0.330000	0.08379	GTC	.	.	weak		0.587	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
MTRNR2L7	100288485	hgsc.bcm.edu	37	10	37890955	37890955	+	Silent	SNP	G	G	A	rs2180706	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:37890955G>A	ENST00000544824.1	-	1	904	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_001190489.1	NP_001177418.1			MT-RNR2-like 7																		AGAGGCAGCCGAACCCTCCTG	0.408													a|||	3355	0.669928	0.6278	0.6715	5008	,	,		18486	0.6032		0.6372	False		,,,				2504	0.8282				p.F6F		Atlas-SNP	.											.	.	.	.	0			c.C18T						PASS	.																																			SO:0001819	synonymous_variant	100288485	exon1			GCAGCCGAACCCT		CCDS53524.1	10p11.21	2014-02-18			ENSG00000256892	ENSG00000256892			37164	protein-coding gene	gene with protein product	"""humanin-like 7"""					19477263	Standard	NM_001190489		Approved		uc021ppd.1	P0CJ74	OTTHUMG00000184979	ENST00000544824.1:c.18C>T	10.37:g.37890955G>A		Somatic	1	0	0		WXS	Illumina HiSeq	Phase_I	9	6	0.666667	NM_001190489		Silent	SNP	ENST00000544824.1	37	CCDS53524.1																																																																																			G|0.434;A|0.566	0.566	strong		0.408	MTRNR2L7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469397.1	NM_001190489	
KCNC2	3747	hgsc.bcm.edu	37	12	75444965	75444965	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:75444965A>G	ENST00000549446.1	-	3	1500	c.820T>C	c.(820-822)Tat>Cat	p.Y274H	KCNC2_ENST00000548243.1_5'Flank|KCNC2_ENST00000298972.1_Missense_Mutation_p.Y274H|KCNC2_ENST00000548513.1_Missense_Mutation_p.Y274H|KCNC2_ENST00000350228.2_Missense_Mutation_p.Y274H|KCNC2_ENST00000540018.1_Missense_Mutation_p.Y274H|KCNC2_ENST00000341669.3_Missense_Mutation_p.Y274H|KCNC2_ENST00000550433.1_Missense_Mutation_p.Y274H|KCNC2_ENST00000393288.2_Missense_Mutation_p.Y274H	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	274					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	TCAATTTCATACTGTAGAACA	0.363																																					p.Y274H		Atlas-SNP	.											KCNC2_ENST00000549446,NS,carcinoma,0,2	KCNC2	239	2	0			c.T820C						scavenged	.						154.0	141.0	145.0					12																	75444965		2203	4300	6503	SO:0001583	missense	3747	exon3			TTTCATACTGTAG	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.820T>C	12.37:g.75444965A>G	ENSP00000449253:p.Tyr274His	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	182	3	0.0164835	NM_139137	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	37	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	A	7.178	0.589014	0.13812	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000350228;ENST00000540018;ENST00000393288	D;D;D;D;D;D;D;D	0.97430	-4.38;-4.38;-4.38;-4.38;-4.38;-4.38;-4.38;-4.38	5.52	5.52	0.82312	.	0.468974	0.15856	U	0.241255	D	0.92835	0.7721	N	0.19112	0.55	0.51012	D	0.999909	B;B;B;B;B	0.15141	0.0;0.001;0.0;0.001;0.012	B;B;B;B;B	0.19666	0.005;0.007;0.002;0.005;0.026	D	0.88903	0.3354	10	0.32370	T	0.25	.	10.7935	0.46447	0.8585:0.0:0.0:0.1415	.	274;274;274;274;274	F5H030;Q96PR1-2;Q96PR1;Q96PR1-4;Q96PR1-3	.;.;KCNC2_HUMAN;.;.	H	274	ENSP00000448301:Y274H;ENSP00000449941:Y274H;ENSP00000449253:Y274H;ENSP00000340121:Y274H;ENSP00000298972:Y274H;ENSP00000319877:Y274H;ENSP00000438423:Y274H;ENSP00000376966:Y274H	ENSP00000298972:Y274H	Y	-	1	0	KCNC2	73731232	1.000000	0.71417	0.997000	0.53966	0.969000	0.65631	4.644000	0.61397	2.218000	0.71995	0.533000	0.62120	TAT	.	.	none		0.363	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748	
ASIC5	51802	hgsc.bcm.edu	37	4	156784634	156784634	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:156784634C>T	ENST00000537611.2	-	2	359	c.313G>A	c.(313-315)Gag>Aag	p.E105K	TDO2_ENST00000506181.1_Intron	NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	105					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)										GCTGGGAACTCCATCTTTTCC	0.358																																					p.E105K		Atlas-SNP	.											.	.	.	.	0			c.G313A						PASS	.						73.0	64.0	67.0					4																	156784634		2203	4300	6503	SO:0001583	missense	51802	exon2			GGAACTCCATCTT	AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.313G>A	4.37:g.156784634C>T	ENSP00000442477:p.Glu105Lys	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	96	4	0.0416667	NM_017419		Missense_Mutation	SNP	ENST00000537611.2	37	CCDS3793.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533035	0.45073	.	.	ENSG00000256394	ENST00000537611	T	0.63417	-0.04	4.34	4.34	0.51931	.	0.501251	0.19042	N	0.124277	T	0.48892	0.1525	L	0.40543	1.245	0.80722	D	1	B	0.12630	0.006	B	0.15870	0.014	T	0.36383	-0.9750	10	0.09590	T	0.72	0.3777	11.8835	0.52589	0.0:0.9036:0.0:0.0964	.	105	Q9NY37	ACCN5_HUMAN	K	105	ENSP00000442477:E105K	ENSP00000264432:E105K	E	-	1	0	ACCN5	157004084	0.985000	0.35326	0.997000	0.53966	0.998000	0.95712	2.520000	0.45554	2.369000	0.80426	0.650000	0.86243	GAG	.	.	none		0.358	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1		
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12907275	12907275	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:12907275G>C	ENST00000317869.6	-	2	1093	c.868C>G	c.(868-870)Cag>Gag	p.Q290E		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	290						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						GAGTCATCCTGGCCATTGGTG	0.443																																					p.Q290E		Atlas-SNP	.											HNRNPCL1,NS,neuroblastoma,0,1	HNRNPCL1	68	1	0			c.C868G						scavenged	.						125.0	135.0	132.0					1																	12907275		2203	4299	6502	SO:0001583	missense	343069	exon2			CATCCTGGCCATT	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.868C>G	1.37:g.12907275G>C	ENSP00000365370:p.Gln290Glu	Somatic	186	1	0.00537634		WXS	Illumina HiSeq	Phase_I	169	5	0.0295858	NM_001013631	B2RP44	Missense_Mutation	SNP	ENST00000317869.6	37	CCDS30591.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-4.135616	0.00001	.	.	ENSG00000179172	ENST00000317869	T	0.07216	3.21	1.09	-2.18	0.07037	.	0.420350	0.20880	N	0.084017	T	0.01353	0.0044	N	0.00583	-1.355	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.31971	-0.9924	10	0.02654	T	1	.	2.6632	0.05032	0.0:0.3331:0.2756:0.3913	.	290	O60812	HNRCL_HUMAN	E	290	ENSP00000365370:Q290E	ENSP00000365370:Q290E	Q	-	1	0	HNRNPCL1	12829862	0.994000	0.37717	0.016000	0.15963	0.063000	0.16089	-0.019000	0.12546	-1.068000	0.03156	-0.786000	0.03341	CAG	.	.	none		0.443	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
MTMR7	9108	hgsc.bcm.edu	37	8	17206499	17206499	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:17206499C>T	ENST00000180173.5	-	5	594	c.560G>A	c.(559-561)cGa>cAa	p.R187Q	MTMR7_ENST00000521857.1_Missense_Mutation_p.R187Q|MTMR7_ENST00000523571.1_5'UTR	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	187	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		GACAGGAAATCGCCGTCTACT	0.433																																					p.R187Q		Atlas-SNP	.											MTMR7,NS,carcinoma,0,1	MTMR7	75	1	0			c.G560A						scavenged	.						135.0	129.0	131.0					8																	17206499		2203	4300	6503	SO:0001583	missense	9108	exon5			GGAAATCGCCGTC	AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.560G>A	8.37:g.17206499C>T	ENSP00000180173:p.Arg187Gln	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	71	3	0.0422535	NM_004686	A1L4K9|B4DG87|Q68DX4	Missense_Mutation	SNP	ENST00000180173.5	37	CCDS34851.1	.	.	.	.	.	.	.	.	.	.	C	35	5.516652	0.96402	.	.	ENSG00000003987	ENST00000180173;ENST00000521857	D;D	0.98135	-4.74;-4.74	5.24	5.24	0.73138	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.99272	0.9746	H	0.99286	4.5	0.80722	D	1	D	0.76494	0.999	P	0.59288	0.855	D	0.98623	1.0668	10	0.87932	D	0	.	19.719	0.96135	0.0:1.0:0.0:0.0	.	187	Q9Y216	MTMR7_HUMAN	Q	187	ENSP00000180173:R187Q;ENSP00000429733:R187Q	ENSP00000180173:R187Q	R	-	2	0	MTMR7	17250870	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.364000	0.79526	2.828000	0.97474	0.655000	0.94253	CGA	.	.	none		0.433	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375311.1	NM_004686	
UGT1A3	54659	hgsc.bcm.edu	37	2	234638186	234638186	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:234638186C>T	ENST00000482026.1	+	1	433	c.414C>T	c.(412-414)atC>atT	p.I138I	UGT1A9_ENST00000354728.4_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609767.1_Silent_p.I138I|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000305139.6_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	138					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)	p.I138I(1)		breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	AGGCCCTGATCAGGCACCTGA	0.428																																					p.I138I		Atlas-SNP	.											UGT1A3,NS,carcinoma,0,1	UGT1A3	91	1	1	Substitution - coding silent(1)	breast(1)	c.C414T						scavenged	.						193.0	199.0	197.0					2																	234638186		2203	4300	6503	SO:0001819	synonymous_variant	54659	exon1			CCTGATCAGGCAC	M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.414C>T	2.37:g.234638186C>T		Somatic	274	0	0		WXS	Illumina HiSeq	Phase_I	294	3	0.0102041	NM_019093	B8K287	Silent	SNP	ENST00000482026.1	37	CCDS2509.1																																																																																			.	.	none		0.428	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130983.1	NM_019093	
MFSD3	113655	hgsc.bcm.edu	37	8	145738768	145738768	+	IGR	SNP	G	G	C	rs11342077|rs398010167|rs199605511		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:145738768G>C	ENST00000301327.4	+	0	1548				RECQL4_ENST00000532237.1_5'UTR|CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000428558.2_Splice_Site_p.R766G	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			ACCACCACCCGGCAACTGGCC	0.677																																					.		Atlas-SNP	.											.	RECQL4	75	.	0			c.2296+1C>G						PASS	.																																			SO:0001628	intergenic_variant	9401	exon15			CCACCCGGCAACT		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145738768G>C		Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	95	11	0.115789	NM_004260		Splice_Site	SNP	ENST00000301327.4	37	CCDS6431.1																																																																																			.	.	weak		0.677	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
HIST1H2AC	8334	hgsc.bcm.edu	37	6	26124688	26124688	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:26124688G>A	ENST00000602637.1	+	1	258	c.228G>A	c.(226-228)aaG>aaA	p.K76K	HIST1H2BC_ENST00000314332.5_5'Flank|HIST1H2AC_ENST00000377791.2_Silent_p.K76K|HIST1H2BC_ENST00000396984.1_5'Flank			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	76						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						ACAACAAGAAGACTCGCATCA	0.657																																					p.K76K		Atlas-SNP	.											.	HIST1H2AC	29	.	0			c.G228A						PASS	.						97.0	94.0	95.0					6																	26124688		2203	4300	6503	SO:0001819	synonymous_variant	8334	exon1			CAAGAAGACTCGC	Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.228G>A	6.37:g.26124688G>A		Somatic	276	0	0		WXS	Illumina HiSeq	Phase_I	265	59	0.222642	NM_003512	B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Silent	SNP	ENST00000602637.1	37	CCDS4585.1																																																																																			.	.	none		0.657	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468023.1	NM_003512	
SLC35G5	83650	hgsc.bcm.edu	37	8	11189387	11189387	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:11189387G>A	ENST00000382435.4	+	1	991	c.772G>A	c.(772-774)Gca>Aca	p.A258T		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	258						integral component of membrane (GO:0016021)		p.A258T(1)									TTGTGTGGGGGCAGAGGGGAT	0.632																																					p.A258T		Atlas-SNP	.											AMAC1L2,trunk,malignant_melanoma,0,1	.	.	1	1	Substitution - Missense(1)	skin(1)	c.G772A						scavenged	.						113.0	111.0	111.0					8																	11189387		2203	4300	6503	SO:0001583	missense	83650	exon1			GTGGGGGCAGAGG	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.772G>A	8.37:g.11189387G>A	ENSP00000371872:p.Ala258Thr	Somatic	233	1	0.00429185		WXS	Illumina HiSeq	Phase_I	280	4	0.0142857	NM_054028	A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	G	9.059	0.994027	0.19043	.	.	ENSG00000177710	ENST00000382435	T	0.52983	0.64	.	.	.	.	0.157695	0.28865	N	0.013888	T	0.37156	0.0993	M	0.61703	1.905	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.22034	-1.0228	9	0.23302	T	0.38	-0.0577	5.8679	0.18786	8.0E-4:0.0:0.9992:0.0	.	258	Q96KT7	S35G5_HUMAN	T	258	ENSP00000371872:A258T	ENSP00000371872:A258T	A	+	1	0	SLC35G5	11226797	0.004000	0.15560	0.149000	0.22428	0.151000	0.21798	1.286000	0.33273	0.088000	0.17205	0.089000	0.15464	GCA	A|1.000;|0.000	1.000	weak		0.632	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156941496	156941496	+	Intron	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:156941496C>A	ENST00000361409.2	-	8	1325				ARHGEF11_ENST00000368194.3_Missense_Mutation_p.G232V	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CACCACTGAGCCACCAGTCTC	0.557																																					p.G232V		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.G695T						PASS	.						98.0	91.0	93.0					1																	156941496		2203	4300	6503	SO:0001627	intron_variant	9826	exon8			ACTGAGCCACCAG	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.583-1661G>T	1.37:g.156941496C>A		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	61	17	0.278689	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.829147	0.50845	.	.	ENSG00000132694	ENST00000368194	T	0.65732	-0.17	5.46	4.54	0.55810	.	0.203312	0.34828	N	0.003657	T	0.41351	0.1155	.	.	.	0.80722	D	1	B	0.17268	0.021	B	0.18263	0.021	T	0.42783	-0.9431	9	0.45353	T	0.12	-21.6118	15.2508	0.73545	0.0:0.8587:0.1413:0.0	.	232	O15085-2	.	V	232	ENSP00000357177:G232V	ENSP00000357177:G232V	G	-	2	0	ARHGEF11	155208120	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.332000	0.43903	1.517000	0.48917	0.655000	0.94253	GGC	.	.	none		0.557	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
SLCO5A1	81796	hgsc.bcm.edu	37	8	70585453	70585453	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:70585453G>A	ENST00000260126.4	-	10	2904	c.2198C>T	c.(2197-2199)tCg>tTg	p.S733L	SLCO5A1_ENST00000530307.1_Missense_Mutation_p.S678L|SLCO5A1_ENST00000524945.1_3'UTR	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	733						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			AAAACGAAACGACGTCACGTT	0.463																																					p.S733L		Atlas-SNP	.											SLCO5A1,colon,carcinoma,0,1	SLCO5A1	142	1	0			c.C2198T						scavenged	.						153.0	155.0	154.0					8																	70585453		2203	4300	6503	SO:0001583	missense	81796	exon10			CGAAACGACGTCA	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.2198C>T	8.37:g.70585453G>A	ENSP00000260126:p.Ser733Leu	Somatic	76	1	0.0131579		WXS	Illumina HiSeq	Phase_I	62	2	0.0322581	NM_030958	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543375	0.65198	.	.	ENSG00000137571	ENST00000260126;ENST00000530307	D;D	0.81996	-1.56;-1.56	5.93	5.93	0.95920	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.82148	0.4974	N	0.21373	0.66	0.58432	D	0.999998	D;B	0.67145	0.996;0.1	P;B	0.55055	0.767;0.04	T	0.77210	-0.2671	10	0.15952	T	0.53	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	678;733	E9PKK5;Q9H2Y9	.;SO5A1_HUMAN	L	733;678	ENSP00000260126:S733L;ENSP00000431611:S678L	ENSP00000260126:S733L	S	-	2	0	SLCO5A1	70748007	1.000000	0.71417	0.114000	0.21550	0.968000	0.65278	7.832000	0.86757	2.826000	0.97356	0.655000	0.94253	TCG	.	.	none		0.463	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
ITGA10	8515	hgsc.bcm.edu	37	1	145528314	145528314	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:145528314T>A	ENST00000369304.3	+	4	510	c.335T>A	c.(334-336)cTg>cAg	p.L112Q	ITGA10_ENST00000539363.1_Intron|ITGA10_ENST00000538811.1_Intron	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	112					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGGATGTCTCTGTTAGAGACA	0.483																																					p.L112Q		Atlas-SNP	.											.	ITGA10	131	.	0			c.T335A						PASS	.						101.0	99.0	99.0					1																	145528314		2203	4300	6503	SO:0001583	missense	8515	exon4			TGTCTCTGTTAGA	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.335T>A	1.37:g.145528314T>A	ENSP00000358310:p.Leu112Gln	Somatic	199	0	0		WXS	Illumina HiSeq	Phase_I	235	63	0.268085	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.062469	0.76187	.	.	ENSG00000143127	ENST00000369304;ENST00000543043	T	0.72835	-0.69	5.46	5.46	0.80206	.	0.000000	0.56097	D	0.000028	T	0.80396	0.4615	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.998	D	0.83917	0.0299	10	0.87932	D	0	.	11.9274	0.52827	0.0:0.0:0.0:1.0	.	78;112;112	F5H3T9;O75578;O75578-2	.;ITA10_HUMAN;.	Q	112;78	ENSP00000358310:L112Q	ENSP00000358310:L112Q	L	+	2	0	ITGA10	144239671	0.940000	0.31905	0.900000	0.35374	0.992000	0.81027	4.296000	0.59055	2.070000	0.61991	0.459000	0.35465	CTG	.	.	none		0.483	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
MLLT3	4300	hgsc.bcm.edu	37	9	20414343	20414343	+	Silent	SNP	A	A	G	rs372894655	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:20414343A>G	ENST00000380338.4	-	5	787	c.501T>C	c.(499-501)agT>agC	p.S167S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S164S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	167	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S167S(19)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.532			T	MLL	ALL								A|||	612	0.122204	0.1505	0.1066	5008	,	,		12422	0.0833		0.0716	False		,,,				2504	0.1871				p.S167S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,bladder,carcinoma,0,25	MLLT3	125	25	19	Substitution - coding silent(19)	lung(8)|kidney(5)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|prostate(1)	c.T501C						scavenged	.						8.0	15.0	13.0					9																	20414343		1537	3257	4794	SO:0001819	synonymous_variant	4300	exon5			GCTGCTACTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.501T>C	9.37:g.20414343A>G		Somatic	35	1	0.0285714		WXS	Illumina HiSeq	Phase_I	48	10	0.208333	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.	.	weak		0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
MYC	4609	hgsc.bcm.edu	37	8	128752907	128752907	+	Silent	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128752907A>G	ENST00000377970.2	+	3	1578	c.1068A>G	c.(1066-1068)aaA>aaG	p.K356K	MYC_ENST00000524013.1_Silent_p.K355K	NM_002467.4	NP_002458	P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	341	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACAACCGAAAATGCACCAGCC	0.557		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""																																p.K356K		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.A1068G						PASS	.						91.0	86.0	87.0					8																	128752907		2203	4300	6503	SO:0001819	synonymous_variant	4609	exon3			CCGAAAATGCACC		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000377970.2:c.1068A>G	8.37:g.128752907A>G		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	144	56	0.388889	NM_002467	A8WFE7|P01107|Q14026	Silent	SNP	ENST00000377970.2	37	CCDS6359.2																																																																																			.	.	none		0.557	MYC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250277.3		
TBP	6908	hgsc.bcm.edu	37	6	170871058	170871058	+	Silent	SNP	G	G	A	rs113440919		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:170871058G>A	ENST00000392092.2	+	3	513	c.234G>A	c.(232-234)caG>caA	p.Q78Q	TBP_ENST00000540980.1_Silent_p.Q58Q|TBP_ENST00000230354.6_Silent_p.Q78Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	78	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcagcagcagcagc	0.577																																					p.Q78Q		Atlas-SNP	.											TBP,caecum,carcinoma,0,1	TBP	58	1	0			c.G234A						scavenged	.						13.0	18.0	16.0					6																	170871058		1927	3786	5713	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.234G>A	6.37:g.170871058G>A		Somatic	39	3	0.0769231		WXS	Illumina HiSeq	Phase_I	48	7	0.145833	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			G|0.500;A|0.500	0.500	weak		0.577	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
SPATA22	84690	hgsc.bcm.edu	37	17	3352179	3352179	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:3352179C>T	ENST00000573128.1	-	6	1077	c.594G>A	c.(592-594)caG>caA	p.Q198Q	SPATA22_ENST00000541913.1_Silent_p.Q182Q|SPATA22_ENST00000355380.4_Silent_p.Q155Q|SPATA22_ENST00000575375.1_Silent_p.Q198Q|SPATA22_ENST00000397168.3_Silent_p.Q198Q|SPATA22_ENST00000572969.1_Silent_p.Q198Q|SPATA22_ENST00000268981.5_Silent_p.Q198Q			Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	198					fertilization (GO:0009566)|gamete generation (GO:0007276)|meiotic DNA repair synthesis (GO:0000711)|regulation of meiotic cell cycle (GO:0051445)|reproductive system development (GO:0061458)|synapsis (GO:0007129)	chromosome (GO:0005694)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)	19						GCTTAAGTGTCTGTAGTGCAC	0.353																																					p.Q198Q		Atlas-SNP	.											SPATA22,NS,carcinoma,0,1	SPATA22	49	1	0			c.G594A						scavenged	.						134.0	131.0	132.0					17																	3352179		2203	4300	6503	SO:0001819	synonymous_variant	84690	exon6			AAGTGTCTGTAGT	AY035868	CCDS11027.1, CCDS54066.1, CCDS54067.1	17p13.3	2005-12-19							30705	protein-coding gene	gene with protein product						12477932	Standard	NM_001170696		Approved	NYD-SP20	uc002fvn.3	Q8NHS9		ENST00000573128.1:c.594G>A	17.37:g.3352179C>T		Somatic	270	0	0		WXS	Illumina HiSeq	Phase_I	348	4	0.0114943	NM_032598	B4DXB1|D3DTI9|J3KN63|Q969H3|Q96JT4	Silent	SNP	ENST00000573128.1	37	CCDS11027.1																																																																																			.	.	none		0.353	SPATA22-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438067.2	NM_032598	
MUC17	140453	hgsc.bcm.edu	37	7	100680438	100680438	+	Missense_Mutation	SNP	G	G	C	rs112926140		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:100680438G>C	ENST00000306151.4	+	3	5805	c.5741G>C	c.(5740-5742)aGc>aCc	p.S1914T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1914	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCTGACGGTAGCAGCATGCCA	0.493																																					p.S1914T		Atlas-SNP	.											MUC17,right_upper_lobe,carcinoma,+1,1	MUC17	804	1	0			c.G5741C						scavenged	.						249.0	250.0	250.0					7																	100680438		2203	4300	6503	SO:0001583	missense	140453	exon3			ACGGTAGCAGCAT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5741G>C	7.37:g.100680438G>C	ENSP00000302716:p.Ser1914Thr	Somatic	80	1	0.0125		WXS	Illumina HiSeq	Phase_I	97	7	0.0721649	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.074	-1.195664	0.01594	.	.	ENSG00000169876	ENST00000306151	T	0.02498	4.27	1.18	-2.36	0.06663	.	.	.	.	.	T	0.00998	0.0033	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41610	-0.9499	9	0.02654	T	1	.	1.2251	0.01932	0.1506:0.3181:0.2997:0.2316	.	1914	Q685J3	MUC17_HUMAN	T	1914	ENSP00000302716:S1914T	ENSP00000302716:S1914T	S	+	2	0	MUC17	100467158	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	-0.876000	0.04201	-3.962000	0.00087	-1.848000	0.00571	AGC	A|0.001;G|0.999	.	strong		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
SP140	11262	hgsc.bcm.edu	37	2	231135324	231135324	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:231135324T>C	ENST00000392045.3	+	15	1582	c.1468T>C	c.(1468-1470)Tcc>Ccc	p.S490P	SP140_ENST00000350136.5_Missense_Mutation_p.S359P|SP140_ENST00000486687.2_Missense_Mutation_p.S414P|SP140_ENST00000417495.3_Missense_Mutation_p.S376P|SP140_ENST00000343805.6_Missense_Mutation_p.S430P|SP140_ENST00000420434.3_Missense_Mutation_p.S463P	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	490					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGCAAACAACTCCACTTTGGG	0.289																																					p.S490P		Atlas-SNP	.											SP140_ENST00000392045,NS,carcinoma,-1,1	SP140	121	1	0			c.T1468C						scavenged	.						70.0	64.0	66.0					2																	231135324		1796	4066	5862	SO:0001583	missense	11262	exon15			AACAACTCCACTT	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.1468T>C	2.37:g.231135324T>C	ENSP00000375899:p.Ser490Pro	Somatic	224	0	0		WXS	Illumina HiSeq	Phase_I	285	5	0.0175439	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	T	11.59	1.682894	0.29872	.	.	ENSG00000079263	ENST00000486687;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	T;T;T;T;T	0.61040	0.35;0.66;0.38;0.14;0.45	2.98	-1.27	0.09347	.	.	.	.	.	T	0.60051	0.2239	L	0.47016	1.485	0.09310	N	1	D;D;D;B	0.71674	0.998;0.967;0.981;0.447	D;D;D;B	0.75484	0.986;0.91;0.972;0.102	T	0.49762	-0.8905	9	0.56958	D	0.05	-5.8349	0.481	0.00547	0.2202:0.1327:0.2063:0.4408	.	463;376;430;490	E7EUR5;E7ESH9;E9PFJ6;Q13342	.;.;.;LY10_HUMAN	P	414;359;490;376;430;463	ENSP00000440107:S414P;ENSP00000345846:S359P;ENSP00000375899:S490P;ENSP00000342096:S430P;ENSP00000398210:S463P	ENSP00000342096:S430P	S	+	1	0	SP140	230843568	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.355000	0.20163	-0.212000	0.10109	0.529000	0.55759	TCC	.	.	none		0.289	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
TNS4	84951	hgsc.bcm.edu	37	17	38635982	38635982	+	Silent	SNP	G	G	T	rs150152835		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:38635982G>T	ENST00000254051.6	-	10	2012	c.1854C>A	c.(1852-1854)acC>acA	p.T618T		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	618	Phosphatase tensin-type.				apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			AGTGGACCACGGTGGGCGTGG	0.612																																					p.T618T		Atlas-SNP	.											TNS4,NS,carcinoma,0,1	TNS4	72	1	0			c.C1854A						scavenged	.						129.0	95.0	107.0					17																	38635982		2203	4300	6503	SO:0001819	synonymous_variant	84951	exon10			GACCACGGTGGGC	AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1854C>A	17.37:g.38635982G>T		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	112	2	0.0178571	NM_032865	A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Silent	SNP	ENST00000254051.6	37	CCDS11368.1																																																																																			G|1.000;A|0.000	.	alt		0.612	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3	NM_032865	
MAPK8	5599	hgsc.bcm.edu	37	10	49618087	49618087	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:49618087A>G	ENST00000374189.1	+	5	507	c.326A>G	c.(325-327)gAg>gGg	p.E109G	MAPK8_ENST00000395611.3_Missense_Mutation_p.E109G|MAPK8_ENST00000360332.3_Missense_Mutation_p.E109G|MAPK8_ENST00000374182.3_Missense_Mutation_p.E109G|MAPK8_ENST00000374174.1_Missense_Mutation_p.E109G			P45983	MK08_HUMAN	mitogen-activated protein kinase 8	109	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nitric oxide (GO:0071732)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|programmed necrotic cell death (GO:0097300)|regulation of histone deacetylation (GO:0031063)|regulation of protein localization (GO:0032880)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to cadmium ion (GO:0046686)|response to stress (GO:0006950)|response to UV (GO:0009411)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|JUN kinase activity (GO:0004705)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	34		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		ATAGTCATGGAGCTCATGGAT	0.358																																					p.E109G		Atlas-SNP	.											.	MAPK8	118	.	0			c.A326G						PASS	.						161.0	151.0	155.0					10																	49618087		2203	4300	6503	SO:0001583	missense	5599	exon4			TCATGGAGCTCAT	L26318	CCDS7223.1, CCDS7224.1, CCDS7225.1, CCDS7226.1, CCDS60527.1	10q11	2011-06-09			ENSG00000107643	ENSG00000107643	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6881	protein-coding gene	gene with protein product	"""JUN N-terminal kinase"""	601158		PRKM8		8137421, 8654373	Standard	NM_002750		Approved	JNK, JNK1, SAPK1	uc001jgp.3	P45983	OTTHUMG00000018172	ENST00000374189.1:c.326A>G	10.37:g.49618087A>G	ENSP00000363304:p.Glu109Gly	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	154	7	0.0454545	NM_139047	B5BTZ5|B7ZLV4|D3DX88|D3DX92|Q15709|Q15712|Q15713|Q308M2	Missense_Mutation	SNP	ENST00000374189.1	37	CCDS7224.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.747324	0.89663	.	.	ENSG00000107643	ENST00000432379;ENST00000429041;ENST00000374189;ENST00000426557;ENST00000374182;ENST00000374179;ENST00000360332;ENST00000374176;ENST00000374174;ENST00000395611	D;D;D;D;D;D;D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91	5.4	5.4	0.78164	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97056	0.9038	M	0.93763	3.455	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.98041	1.0382	10	0.72032	D	0.01	.	15.7272	0.77770	1.0:0.0:0.0:0.0	.	109;109;109;109;109	Q308M2;P45983-2;P45983;A1L4K2;P45983-3	.;.;MK08_HUMAN;.;.	G	109;26;109;109;109;109;109;109;109;109	ENSP00000387936:E109G;ENSP00000393223:E26G;ENSP00000363304:E109G;ENSP00000397729:E109G;ENSP00000363297:E109G;ENSP00000363294:E109G;ENSP00000353483:E109G;ENSP00000363291:E109G;ENSP00000363289:E109G;ENSP00000378974:E109G	ENSP00000353483:E109G	E	+	2	0	MAPK8	49288093	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	2.176000	0.68965	0.528000	0.53228	GAG	.	.	none		0.358	MAPK8-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047931.1		
TMEM63B	55362	hgsc.bcm.edu	37	6	44116674	44116674	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:44116674T>C	ENST00000259746.9	+	15	1588	c.1405T>C	c.(1405-1407)Tac>Cac	p.Y469H	TMEM63B_ENST00000323267.6_Missense_Mutation_p.Y469H			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	469					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			GCCTGTGGAGTACCTCAACGT	0.562																																					p.Y469H		Atlas-SNP	.											TMEM63B,NS,carcinoma,-1,1	TMEM63B	77	1	0			c.T1405C						scavenged	.						265.0	186.0	213.0					6																	44116674		2203	4300	6503	SO:0001583	missense	55362	exon15			GTGGAGTACCTCA	BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.1405T>C	6.37:g.44116674T>C	ENSP00000259746:p.Tyr469His	Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	177	4	0.0225989	NM_018426	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	ENST00000259746.9	37	CCDS34461.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.562061	0.45590	.	.	ENSG00000137216	ENST00000259746;ENST00000323267	T;T	0.28454	1.61;1.61	4.48	4.48	0.54585	Domain of unknown function DUF221 (1);	0.065002	0.64402	D	0.000005	T	0.36936	0.0985	M	0.72118	2.19	0.34892	D	0.745625	D;D	0.69078	0.958;0.997	P;P	0.62649	0.905;0.885	T	0.26395	-1.0104	10	0.24483	T	0.36	.	13.1166	0.59303	0.0:0.0:0.0:1.0	.	469;469	Q5T3F8;Q5T3F8-2	TM63B_HUMAN;.	H	469	ENSP00000259746:Y469H;ENSP00000327154:Y469H	ENSP00000259746:Y469H	Y	+	1	0	TMEM63B	44224652	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.681000	0.61663	1.880000	0.54463	0.482000	0.46254	TAC	.	.	none		0.562	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040712.2	XM_166410	
ACSM1	116285	hgsc.bcm.edu	37	16	20681297	20681297	+	Missense_Mutation	SNP	C	C	A	rs138822345		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:20681297C>A	ENST00000307493.4	-	5	831	c.764G>T	c.(763-765)cGg>cTg	p.R255L	ACSM1_ENST00000520010.1_Missense_Mutation_p.R255L|ACSM1_ENST00000219151.4_5'UTR	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	255					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						CTTCAGGCTCCGTAATTTCCT	0.512																																					p.R255L		Atlas-SNP	.											ACSM1,NS,malignant_melanoma,0,1	ACSM1	118	1	0			c.G764T						scavenged	.						118.0	106.0	110.0					16																	20681297		2201	4300	6501	SO:0001583	missense	116285	exon5			AGGCTCCGTAATT	AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.764G>T	16.37:g.20681297C>A	ENSP00000301956:p.Arg255Leu	Somatic	209	0	0		WXS	Illumina HiSeq	Phase_I	239	3	0.0125523	NM_052956	Q08AH2|Q96A20	Missense_Mutation	SNP	ENST00000307493.4	37	CCDS10587.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.685884	0.00101	.	.	ENSG00000166743	ENST00000307493;ENST00000520010	T;T	0.40225	1.04;1.04	5.05	2.69	0.31865	AMP-dependent synthetase/ligase (1);	0.834947	0.09773	N	0.757743	T	0.10465	0.0256	N	0.00465	-1.465	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.32534	-0.9903	10	0.02654	T	1	.	5.7897	0.18353	0.4529:0.378:0.0:0.1691	.	255	Q08AH1	ACSM1_HUMAN	L	255	ENSP00000301956:R255L;ENSP00000428047:R255L	ENSP00000301956:R255L	R	-	2	0	ACSM1	20588798	0.003000	0.15002	0.006000	0.13384	0.003000	0.03518	1.732000	0.38146	0.308000	0.22923	-0.426000	0.05927	CGG	C|1.000;T|0.000	.	alt		0.512	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254412.1	NM_052956	
LVRN	206338	hgsc.bcm.edu	37	5	115351066	115351066	+	Silent	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:115351066T>A	ENST00000357872.4	+	17	2692	c.2568T>A	c.(2566-2568)atT>atA	p.I856I	AQPEP_ENST00000515454.1_3'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		856						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										AAGAAAAGATTCAACTTGCTT	0.343																																					p.I856I		Atlas-SNP	.											FLJ90650,caecum,carcinoma,0,1	.	.	1	0			c.T2568A						scavenged	.						91.0	87.0	88.0					5																	115351066		2202	4300	6502	SO:0001819	synonymous_variant	0	exon17			AAAGATTCAACTT																												ENST00000357872.4:c.2568T>A	5.37:g.115351066T>A		Somatic	46	2	0.0434783		WXS	Illumina HiSeq	Phase_I	45	3	0.0666667	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	ENST00000357872.4	37	CCDS4124.1																																																																																			.	.	none		0.343	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
CCDC69	26112	hgsc.bcm.edu	37	5	150565026	150565026	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:150565026C>T	ENST00000355417.2	-	7	746	c.572G>A	c.(571-573)cGt>cAt	p.R191H	CCDC69_ENST00000521308.1_5'UTR	NM_015621.2	NP_056436.2	A6NI79	CCD69_HUMAN	coiled-coil domain containing 69	191										haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|stomach(1)	9		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCATGAATACGCTCATTCTT	0.557																																					p.R191H		Atlas-SNP	.											CCDC69,NS,carcinoma,0,1	CCDC69	30	1	0			c.G572A						scavenged	.						167.0	151.0	156.0					5																	150565026		2203	4300	6503	SO:0001583	missense	26112	exon7			TGAATACGCTCAT		CCDS4312.1	5q33.1	2008-02-05			ENSG00000198624	ENSG00000198624			24487	protein-coding gene	gene with protein product						12477932	Standard	NM_015621		Approved	FLJ13705, DKFZP434C171	uc011dcq.3	A6NI79	OTTHUMG00000130127	ENST00000355417.2:c.572G>A	5.37:g.150565026C>T	ENSP00000347586:p.Arg191His	Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	140	4	0.0285714	NM_015621	A8K9X6	Missense_Mutation	SNP	ENST00000355417.2	37	CCDS4312.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.714058	0.48622	.	.	ENSG00000198624	ENST00000355417	T	0.10960	2.82	4.92	4.05	0.47172	.	0.381355	0.22324	N	0.061546	T	0.08313	0.0207	N	0.21448	0.665	0.32186	N	0.579672	P	0.49559	0.925	B	0.43052	0.406	T	0.10613	-1.0622	10	0.41790	T	0.15	-8.049	9.2976	0.37824	0.0:0.828:0.0:0.172	.	191	A6NI79	CCD69_HUMAN	H	191	ENSP00000347586:R191H	ENSP00000347586:R191H	R	-	2	0	CCDC69	150545219	0.895000	0.30542	0.991000	0.47740	0.864000	0.49448	1.612000	0.36889	1.206000	0.43276	-0.379000	0.06801	CGT	.	.	none		0.557	CCDC69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252435.1	NM_015621	
DTD2	112487	hgsc.bcm.edu	37	14	31926584	31926584	+	Missense_Mutation	SNP	G	G	A	rs17097904	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr14:31926584G>A	ENST00000310850.4	-	1	132	c.16C>T	c.(16-18)Cgg>Tgg	p.R6W	DTD2_ENST00000356180.4_Missense_Mutation_p.R6W|RP11-176H8.1_ENST00000547378.1_Missense_Mutation_p.R6W	NM_080664.2	NP_542395.1	Q96FN9	DTD2_HUMAN	D-tyrosyl-tRNA deacylase 2 (putative)	6			R -> W (in dbSNP:rs17097904).		D-amino acid catabolic process (GO:0019478)	cytoplasm (GO:0005737)	hydrolase activity, acting on ester bonds (GO:0016788)	p.R6W(1)									TGAGGAATCCGGCTACCCTCA	0.697																																					p.R6W		Atlas-SNP	.											C14orf126,third_ventricle,glioma,0,2	.	.	2	1	Substitution - Missense(1)	skin(1)	c.C16T						scavenged	.						12.0	12.0	12.0					14																	31926584		2183	4278	6461	SO:0001583	missense	112487	exon1			GAATCCGGCTACC	BC010618	CCDS9643.1	14q12	2012-09-25	2012-09-25	2012-09-25	ENSG00000129480	ENSG00000129480			20277	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 126"""	C14orf126			Standard	NM_080664		Approved	MGC9912	uc001wrj.3	Q96FN9	OTTHUMG00000140205	ENST00000310850.4:c.16C>T	14.37:g.31926584G>A	ENSP00000312224:p.Arg6Trp	Somatic	96	3	0.03125		WXS	Illumina HiSeq	Phase_I	103	8	0.0776699	NM_080664	D3DS87	Missense_Mutation	SNP	ENST00000310850.4	37	CCDS9643.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758136	0.69763	.	.	ENSG00000203546;ENSG00000129480;ENSG00000129480	ENST00000547378;ENST00000310850;ENST00000356180	T;T;T	0.55052	0.54;0.71;0.71	4.84	2.97	0.34412	D-Tyr tRNAtyr deacylase-like domain (1);	0.302778	0.30901	N	0.008651	T	0.52419	0.1733	M	0.69823	2.125	0.36855	D	0.888115	D	0.67145	0.996	B	0.43623	0.425	T	0.65220	-0.6221	10	0.87932	D	0	.	11.9711	0.53063	0.0:0.0:0.5428:0.4572	rs17097904	6	Q96FN9	DTD2_HUMAN	W	6	ENSP00000447056:R6W;ENSP00000312224:R6W;ENSP00000348503:R6W	ENSP00000312224:R6W	R	-	1	2	C14orf126;RP11-176H8.1	30996335	0.001000	0.12720	0.005000	0.12908	0.004000	0.04260	0.080000	0.14802	0.618000	0.30179	0.561000	0.74099	CGG	.	.	weak		0.697	DTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276614.2	NM_080664	
MLLT3	4300	hgsc.bcm.edu	37	9	20414310	20414310	+	Silent	SNP	A	A	G	rs148318848	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:20414310A>G	ENST00000380338.4	-	5	820	c.534T>C	c.(532-534)agT>agC	p.S178S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S175S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	178	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.527			T	MLL	ALL								A|||	169	0.033746	0.0272	0.0231	5008	,	,		12860	0.0169		0.0308	False		,,,				2504	0.0706				p.S178S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,caecum,carcinoma,0,1	MLLT3	125	1	0			c.T534C						scavenged	.						25.0	33.0	30.0					9																	20414310		2142	4195	6337	SO:0001819	synonymous_variant	4300	exon5			GCTGCTACTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.534T>C	9.37:g.20414310A>G		Somatic	74	2	0.027027		WXS	Illumina HiSeq	Phase_I	82	10	0.121951	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.	.	weak		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
SPRR2D	6703	hgsc.bcm.edu	37	1	153012612	153012612	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:153012612T>C	ENST00000368757.1	-	2	491	c.211A>G	c.(211-213)Agc>Ggc	p.S71G	SPRR2D_ENST00000360379.3_Missense_Mutation_p.S71G|SPRR2D_ENST00000368756.1_Missense_Mutation_p.S71G|SPRR2D_ENST00000368758.3_Missense_Mutation_p.S71G			P22532	SPR2D_HUMAN	small proline-rich protein 2D	71					epidermis development (GO:0008544)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				endometrium(1)|skin(1)	2	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGTTACTTGCTCTTGGGTGGA	0.527																																					p.S71G		Atlas-SNP	.											SPRR2D,colon,carcinoma,+1,1	SPRR2D	9	1	0			c.A211G						scavenged	.						237.0	222.0	227.0					1																	153012612		2203	4299	6502	SO:0001583	missense	6703	exon2			ACTTGCTCTTGGG	AF333954	CCDS30864.1	1q21-q22	2008-02-05			ENSG00000163216	ENSG00000163216			11264	protein-coding gene	gene with protein product						8325635	Standard	NM_006945		Approved		uc001fbb.2	P22532	OTTHUMG00000014396	ENST00000368757.1:c.211A>G	1.37:g.153012612T>C	ENSP00000357746:p.Ser71Gly	Somatic	450	0	0		WXS	Illumina HiSeq	Phase_I	509	6	0.0117878	NM_006945	A4QN03|A8K5K2|D3DV33|Q5T523|Q96RM3	Missense_Mutation	SNP	ENST00000368757.1	37	CCDS30864.1	.	.	.	.	.	.	.	.	.	.	T	8.832	0.940118	0.18281	.	.	ENSG00000163216	ENST00000360379;ENST00000368758;ENST00000368757;ENST00000368756	T;T;T;T	0.36520	1.25;1.25;1.25;1.25	4.05	1.54	0.23209	.	0.171847	0.28307	N	0.015830	T	0.10981	0.0268	.	.	.	0.20926	N	0.999823	B	0.21606	0.058	B	0.22601	0.04	T	0.24548	-1.0157	9	0.87932	D	0	.	6.7099	0.23272	0.3809:0.0:0.0:0.6191	.	71	P22532	SPR2D_HUMAN	G	71	ENSP00000353542:S71G;ENSP00000357747:S71G;ENSP00000357746:S71G;ENSP00000357745:S71G	ENSP00000353542:S71G	S	-	1	0	SPRR2D	151279236	0.983000	0.35010	0.991000	0.47740	0.775000	0.43874	0.805000	0.27112	0.076000	0.16826	0.369000	0.22263	AGC	.	.	none		0.527	SPRR2D-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040051.1		
PSD	5662	hgsc.bcm.edu	37	10	104165236	104165236	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:104165236G>A	ENST00000020673.5	-	12	2719	c.2193C>T	c.(2191-2193)gtC>gtT	p.V731V	PSD_ENST00000406432.1_Silent_p.V731V	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	731					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		TCCGCTTGATGACCTTGGGGT	0.662																																					p.V731V		Atlas-SNP	.											PSD_ENST00000020673,NS,carcinoma,-1,2	PSD	164	2	0			c.C2193T						scavenged	.						56.0	54.0	55.0					10																	104165236		2203	4300	6503	SO:0001819	synonymous_variant	5662	exon13			CTTGATGACCTTG	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.2193C>T	10.37:g.104165236G>A		Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	105	2	0.0190476	NM_001270965	B1AKX7|D3DR87|Q15673|Q8IVG0	Silent	SNP	ENST00000020673.5	37	CCDS31272.1																																																																																			.	.	none		0.662	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
WDR64	128025	hgsc.bcm.edu	37	1	241951199	241951199	+	Silent	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:241951199A>G	ENST00000366552.2	+	23	2931	c.2724A>G	c.(2722-2724)cgA>cgG	p.R908R	WDR64_ENST00000437684.2_Silent_p.R741R	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	908										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TTGGACAGCGAAGGCTCTTTG	0.393																																					p.R908R		Atlas-SNP	.											WDR64_ENST00000366552,NS,carcinoma,+2,2	WDR64	234	2	0			c.A2724G						scavenged	.						164.0	161.0	162.0					1																	241951199		2203	4300	6503	SO:0001819	synonymous_variant	128025	exon23			ACAGCGAAGGCTC	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.2724A>G	1.37:g.241951199A>G		Somatic	321	0	0		WXS	Illumina HiSeq	Phase_I	393	4	0.0101781	NM_144625	B1ANT0|Q7Z573|Q96LY9	Silent	SNP	ENST00000366552.2	37		.	.	.	.	.	.	.	.	.	.	A	4.434	0.080215	0.08533	.	.	ENSG00000162843	ENST00000425826	.	.	.	5.96	3.67	0.42095	.	.	.	.	.	T	0.61578	0.2358	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58787	-0.7575	4	.	.	.	-4.9848	10.8092	0.46535	0.537:0.463:0.0:0.0	.	.	.	.	G	387	.	.	E	+	2	0	WDR64	240017822	0.996000	0.38824	0.996000	0.52242	0.374000	0.29953	0.301000	0.19174	1.060000	0.40578	0.523000	0.50628	GAA	.	.	none		0.393	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
AKAP11	11215	hgsc.bcm.edu	37	13	42888041	42888041	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr13:42888041A>G	ENST00000025301.2	+	11	5544	c.5369A>G	c.(5368-5370)gAt>gGt	p.D1790G		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1790					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		GATGGACCAGATGATAAAGAT	0.294																																					p.D1790G		Atlas-SNP	.											AKAP11,trunk,malignant_melanoma,+1,1	AKAP11	146	1	0			c.A5369G						scavenged	.						212.0	196.0	201.0					13																	42888041		2203	4300	6503	SO:0001583	missense	11215	exon11			GACCAGATGATAA	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5369A>G	13.37:g.42888041A>G	ENSP00000025301:p.Asp1790Gly	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	206	3	0.0145631	NM_016248	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.999310	0.74818	.	.	ENSG00000023516	ENST00000025301	T	0.14516	2.5	5.83	5.83	0.93111	.	0.067077	0.64402	D	0.000017	T	0.33235	0.0856	M	0.67953	2.075	0.44247	D	0.997092	D	0.63046	0.992	P	0.59357	0.856	T	0.02821	-1.1106	10	0.66056	D	0.02	.	16.214	0.82191	1.0:0.0:0.0:0.0	.	1790	Q9UKA4	AKA11_HUMAN	G	1790	ENSP00000025301:D1790G	ENSP00000025301:D1790G	D	+	2	0	AKAP11	41786041	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.778000	0.75043	2.224000	0.72417	0.528000	0.53228	GAT	.	.	none		0.294	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
CWH43	80157	hgsc.bcm.edu	37	4	48990495	48990495	+	Splice_Site	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:48990495A>G	ENST00000226432.4	+	2	228	c.45A>G	c.(43-45)ggA>ggG	p.G15G	CWH43_ENST00000513409.1_5'UTR	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	15					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						TTTTTGTAGGATGTGTTTCTT	0.418																																					p.G15G		Atlas-SNP	.											.	CWH43	101	.	0			c.A45G						PASS	.						77.0	79.0	78.0					4																	48990495		2203	4300	6503	SO:0001630	splice_region_variant	80157	exon2			TGTAGGATGTGTT		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.44-1A>G	4.37:g.48990495A>G		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	66	4	0.0606061	NM_025087	B2RPD7	Silent	SNP	ENST00000226432.4	37	CCDS3486.1																																																																																			.	.	none		0.418	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087	Silent
TIMP2	7077	hgsc.bcm.edu	37	17	76869909	76869909	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:76869909G>T	ENST00000262768.7	-	2	521	c.223C>A	c.(223-225)Cag>Aag	p.Q75K	TIMP2_ENST00000586057.1_5'UTR|TIMP2_ENST00000536189.2_5'UTR|TIMP2_ENST00000585421.1_5'UTR	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2	75	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)	p.Q75K(1)		central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			ACCTTTATCTGCTTGATCTCA	0.542																																					p.Q75K		Atlas-SNP	.											TIMP2_ENST00000262768,NS,neuroblastoma,0,1	TIMP2	27	1	1	Substitution - Missense(1)	autonomic_ganglia(1)	c.C223A						scavenged	.						145.0	126.0	133.0					17																	76869909		2203	4300	6503	SO:0001583	missense	7077	exon2			TTATCTGCTTGAT		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.223C>A	17.37:g.76869909G>T	ENSP00000262768:p.Gln75Lys	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	121	3	0.0247934	NM_003255	Q16121|Q93006|Q9UDF7	Missense_Mutation	SNP	ENST00000262768.7	37	CCDS11758.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.543458	0.86022	.	.	ENSG00000035862	ENST00000262768	D	0.93366	-3.21	4.92	4.92	0.64577	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);	0.000000	0.85682	D	0.000000	D	0.97142	0.9066	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97974	1.0345	10	0.72032	D	0.01	.	16.8888	0.86082	0.0:0.0:1.0:0.0	.	75	P16035	TIMP2_HUMAN	K	75	ENSP00000262768:Q75K	ENSP00000262768:Q75K	Q	-	1	0	TIMP2	74381504	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.351000	0.97073	2.270000	0.75569	0.561000	0.74099	CAG	.	.	none		0.542	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255	
CWF19L2	143884	hgsc.bcm.edu	37	11	107197725	107197725	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:107197725G>A	ENST00000282251.5	-	18	2623	c.2596C>T	c.(2596-2598)Cga>Tga	p.R866*		NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	866							catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		AAGCTTTCTCGGATGCCTTTC	0.388																																					p.R866X		Atlas-SNP	.											CWF19L2_ENST00000282251,NS,carcinoma,+2,2	CWF19L2	135	2	0			c.C2596T						scavenged	.						143.0	146.0	145.0					11																	107197725		2201	4298	6499	SO:0001587	stop_gained	143884	exon18			TTTCTCGGATGCC	AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.2596C>T	11.37:g.107197725G>A	ENSP00000282251:p.Arg866*	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	90	2	0.0222222	NM_152434	A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Nonsense_Mutation	SNP	ENST00000282251.5	37	CCDS8336.2	.	.	.	.	.	.	.	.	.	.	G	38	6.757704	0.97817	.	.	ENSG00000152404	ENST00000282251	.	.	.	5.57	3.63	0.41609	.	0.115474	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.8983	13.4239	0.61013	0.0:0.0:0.5722:0.4278	.	.	.	.	X	866	.	ENSP00000282251:R866X	R	-	1	2	CWF19L2	106702935	1.000000	0.71417	0.882000	0.34594	0.996000	0.88848	2.263000	0.43293	0.663000	0.31027	0.650000	0.86243	CGA	.	.	none		0.388	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328825.2	NM_152434	
ARHGEF5	7984	hgsc.bcm.edu	37	7	144061222	144061222	+	Missense_Mutation	SNP	A	A	G	rs1209412		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:144061222A>G	ENST00000056217.5	+	2	1634	c.1460A>G	c.(1459-1461)gAa>gGa	p.E487G	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	487				E -> G (in Ref. 2; BAD18708). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E487G(5)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					CAGCAAGAGGAATCCAGGCTG	0.537																																					p.E487G		Atlas-SNP	.											ARHGEF5,NS,carcinoma,0,5	ARHGEF5	73	5	5	Substitution - Missense(5)	kidney(5)	c.A1460G						scavenged	.						33.0	30.0	31.0					7																	144061222		1051	1888	2939	SO:0001583	missense	7984	exon2			AAGAGGAATCCAG	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.1460A>G	7.37:g.144061222A>G	ENSP00000056217:p.Glu487Gly	Somatic	189	13	0.0687831		WXS	Illumina HiSeq	Phase_I	183	19	0.103825	NM_005435	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	G	0.025	-1.380873	0.01204	.	.	ENSG00000050327	ENST00000056217	T	0.74842	-0.88	3.96	-1.85	0.07784	.	0.740232	0.11016	N	0.608952	T	0.38054	0.1026	N	0.01168	-0.975	0.36950	P	0.10716800000000004	B	0.02656	0.0	B	0.01281	0.0	T	0.33624	-0.9861	8	.	.	.	-1.3111	5.374	0.16154	0.5924:0.1606:0.247:0.0	.	487	Q12774	ARHG5_HUMAN	G	487	ENSP00000056217:E487G	.	E	+	2	0	ARHGEF5	143692155	0.000000	0.05858	0.017000	0.16124	0.097000	0.18754	-1.265000	0.02844	-0.559000	0.06110	-1.294000	0.01345	GAA	.	.	weak		0.537	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
CASP8	841	hgsc.bcm.edu	37	2	202141597	202141597	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:202141597T>A	ENST00000432109.2	+	8	897	c.708T>A	c.(706-708)tgT>tgA	p.C236*	CASP8_ENST00000358485.4_Nonsense_Mutation_p.C295*|CASP8_ENST00000264274.9_Intron|CASP8_ENST00000392259.2_Missense_Mutation_p.S215T|CASP8_ENST00000392266.3_Missense_Mutation_p.S200T|CASP8_ENST00000392258.3_Missense_Mutation_p.S215T|CASP8_ENST00000264275.5_Nonsense_Mutation_p.C253*|CASP8_ENST00000323492.7_Nonsense_Mutation_p.C221*	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	236					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						GGGGATACTGTCTGATCATCA	0.448										HNSCC(4;0.00038)																											p.C295X	Melanoma(82;831 1348 20716 36952 40159)	Atlas-SNP	.											CASP8_ENST00000358485,NS,carcinoma,+1,3	CASP8	272	3	0			c.T885A						PASS	.						91.0	84.0	86.0					2																	202141597		2203	4300	6503	SO:0001587	stop_gained	841	exon7			ATACTGTCTGATC	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.708T>A	2.37:g.202141597T>A	ENSP00000412523:p.Cys236*	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	224	16	0.0714286	NM_001080125	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Nonsense_Mutation	SNP	ENST00000432109.2	37	CCDS2342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.28|16.28	3.078350|3.078350	0.55753|0.55753	.|.	.|.	ENSG00000064012|ENSG00000064012	ENST00000392263;ENST00000432109;ENST00000264275;ENST00000450491;ENST00000358485;ENST00000392261;ENST00000323492|ENST00000392259;ENST00000392266;ENST00000392258;ENST00000447616;ENST00000424461	.|.	.|.	.|.	5.6|5.6	3.27|3.27	0.37495|0.37495	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.19446	.|0.0467	.|.	.|.	.|.	0.21256|0.21256	N|N	0.999742|0.999742	.|P;P	.|0.36249	.|0.545;0.545	.|B;B	.|0.32677	.|0.15;0.098	.|T	.|0.09975	.|-1.0650	.|7	0.02654|0.25106	T|T	1|0.35	.|.	4.4221|4.4221	0.11486|0.11486	0.0:0.3337:0.0:0.6663|0.0:0.3337:0.0:0.6663	.|.	.|200;215	.|Q14790-6;Q14790-5	.|.;.	X|T	221;236;253;118;295;221;221|215;200;215;200;63	.|.	ENSP00000264275:C253X|ENSP00000376087:S215T	C|S	+|+	3|1	2|0	CASP8|CASP8	201849842|201849842	0.964000|0.964000	0.33143|0.33143	1.000000|1.000000	0.80357|0.80357	0.254000|0.254000	0.26022|0.26022	1.912000|1.912000	0.39946|0.39946	0.954000|0.954000	0.37851|0.37851	0.459000|0.459000	0.35465|0.35465	TGT|TCT	.	.	none		0.448	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228	
ZNF845	91664	hgsc.bcm.edu	37	19	53854856	53854856	+	Silent	SNP	C	C	A	rs372054990		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:53854856C>A	ENST00000595091.1	+	5	1147	c.928C>A	c.(928-930)Cga>Aga	p.R310R	ZNF845_ENST00000458035.1_Silent_p.R310R			Q96IR2	ZN845_HUMAN	zinc finger protein 845	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						GACCTTCAGTCGAAATTCAGC	0.418																																					p.R310R		Atlas-SNP	.											ZNF845,colon,carcinoma,0,1	ZNF845	101	1	0			c.C928A						scavenged	.						99.0	85.0	89.0					19																	53854856		692	1591	2283	SO:0001819	synonymous_variant	91664	exon4			TTCAGTCGAAATT	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.928C>A	19.37:g.53854856C>A		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	73	2	0.0273973	NM_138374		Silent	SNP	ENST00000595091.1	37	CCDS46170.1																																																																																			.	.	alt		0.418	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
FAM83D	81610	hgsc.bcm.edu	37	20	37555116	37555116	+	Missense_Mutation	SNP	G	G	C	rs3752290	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:37555116G>C	ENST00000217429.4	+	1	162	c.121G>C	c.(121-123)Gtg>Ctg	p.V41L		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	11					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				CCTGGACGAGGTGCCCGCCGC	0.701													C|||	2010	0.401358	0.5076	0.3847	5008	,	,		10968	0.4157		0.3429	False		,,,				2504	0.3149				p.V41L		Atlas-SNP	.											FAM83D,NS,carcinoma,0,2	FAM83D	60	2	0			c.G121C						scavenged	.	C	LEU/VAL	1601,2097		394,813,642	8.0	11.0	10.0		121	3.4	0.9	20	dbSNP_107	10	2399,5669		370,1659,2005	no	missense	FAM83D	NM_030919.2	32	764,2472,2647	CC,CG,GG		29.7348,43.2937,33.9963	benign	41/616	37555116	4000,7766	1849	4034	5883	SO:0001583	missense	81610	exon1			GACGAGGTGCCCG	AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.121G>C	20.37:g.37555116G>C	ENSP00000217429:p.Val41Leu	Somatic	19	1	0.0526316		WXS	Illumina HiSeq	Phase_I	17	4	0.235294	NM_030919	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Missense_Mutation	SNP	ENST00000217429.4	37	CCDS42872.1	870	0.3983516483516483	269	0.5467479674796748	136	0.3756906077348066	202	0.3531468531468531	263	0.3469656992084433	C	0.704	-0.789777	0.02884	0.432937	0.297348	ENSG00000101447	ENST00000217429;ENST00000424027	T	0.10477	2.87	5.48	3.44	0.39384	.	0.490125	0.16258	N	0.222396	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38757	-0.9646	9	0.06891	T	0.86	.	7.0157	0.24887	0.0:0.4204:0.417:0.1626	rs3752290;rs17846649;rs17859744;rs3752290	11;11	Q9H4H8;Q9H4H8-2	FA83D_HUMAN;.	L	41;11	ENSP00000217429:V41L	ENSP00000217429:V41L	V	+	1	0	FAM83D	36988530	0.003000	0.15002	0.905000	0.35620	0.017000	0.09413	0.278000	0.18753	0.696000	0.31696	-0.120000	0.15030	GTG	G|0.618;C|0.382	0.382	strong		0.701	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1		
IGSF3	3321	hgsc.bcm.edu	37	1	117158772	117158772	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:117158772C>T	ENST00000369486.3	-	3	1116	c.351G>A	c.(349-351)gaG>gaA	p.E117E	IGSF3_ENST00000318837.6_Silent_p.E117E|IGSF3_ENST00000369483.1_Silent_p.E117E	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	117	Ig-like C2-type 1.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.E117E(2)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GGCATTCATACTCCCCGGCAT	0.527																																					p.E117E		Atlas-SNP	.											IGSF3_ENST00000369483,NS,carcinoma,0,2	IGSF3	294	2	2	Substitution - coding silent(2)	endometrium(2)	c.G351A						scavenged	.						56.0	51.0	53.0					1																	117158772		2203	4300	6503	SO:0001819	synonymous_variant	3321	exon3			TTCATACTCCCCG	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.351G>A	1.37:g.117158772C>T		Somatic	373	3	0.0080429		WXS	Illumina HiSeq	Phase_I	357	10	0.0280112	NM_001542	A6NJZ6|A6NMC7	Silent	SNP	ENST00000369486.3	37	CCDS30813.1																																																																																			.	.	none		0.527	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
KIAA1109	84162	hgsc.bcm.edu	37	4	123094241	123094241	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:123094241C>T	ENST00000264501.4	+	4	521	c.148C>T	c.(148-150)Cgg>Tgg	p.R50W	KIAA1109_ENST00000455637.1_Missense_Mutation_p.R50W|KIAA1109_ENST00000388738.3_Missense_Mutation_p.R50W			Q2LD37	K1109_HUMAN	KIAA1109	50					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TTATAATTCCCGGAATGTTGG	0.328																																					p.R50W		Atlas-SNP	.											KIAA1109,NS,carcinoma,-1,1	KIAA1109	424	1	0			c.C148T						scavenged	.						191.0	182.0	185.0					4																	123094241		1820	4074	5894	SO:0001583	missense	84162	exon2			AATTCCCGGAATG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.148C>T	4.37:g.123094241C>T	ENSP00000264501:p.Arg50Trp	Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	153	3	0.0196078	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.260368	0.80246	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637	T;T;T	0.37411	1.78;1.78;1.2	5.46	3.71	0.42584	.	0.316033	0.18473	U	0.140164	T	0.33323	0.0859	L	0.56199	1.76	0.58432	D	0.999999	B	0.18310	0.027	B	0.09377	0.004	T	0.11867	-1.0570	10	0.87932	D	0	.	10.0228	0.42053	0.1379:0.7896:0.0:0.0725	.	50	Q2LD37	K1109_HUMAN	W	50	ENSP00000264501:R50W;ENSP00000373390:R50W;ENSP00000389925:R50W	ENSP00000264501:R50W	R	+	1	2	KIAA1109	123313691	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.532000	0.53553	0.644000	0.30656	0.655000	0.94253	CGG	.	.	none		0.328	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
ADAM29	11086	hgsc.bcm.edu	37	4	175899088	175899088	+	Missense_Mutation	SNP	G	G	T	rs146933346	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:175899088G>T	ENST00000359240.3	+	5	3082	c.2412G>T	c.(2410-2412)agG>agT	p.R804S	ADAM29_ENST00000445694.1_Missense_Mutation_p.R804S|ADAM29_ENST00000514159.1_Missense_Mutation_p.R804S|ADAM29_ENST00000404450.4_Missense_Mutation_p.R804S|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	804	9 X 9 AA approximate repeats.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CCTCCCAGAGGCAACCTCAGT	0.572													T|||	28	0.00559105	0.0	0.0014	5008	,	,		19556	0.0099		0.0109	False		,,,				2504	0.0061				p.R804S	Ovarian(140;1727 1835 21805 25838 41440)	Atlas-SNP	.											ADAM29,NS,lymphoid_neoplasm,0,1	ADAM29	262	1	0			c.G2412T						scavenged	.						133.0	124.0	127.0					4																	175899088		2203	4300	6503	SO:0001583	missense	11086	exon4			CCAGAGGCAACCT	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2412G>T	4.37:g.175899088G>T	ENSP00000352177:p.Arg804Ser	Somatic	75	5	0.0666667		WXS	Illumina HiSeq	Phase_I	94	14	0.148936	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-2.909135	0.00056	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.01871	4.59;4.59;4.59;4.59	0.439	-0.878	0.10617	.	.	.	.	.	T	0.01124	0.0037	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47947	-0.9077	8	.	.	.	.	2.6605	0.05025	0.2447:0.0:0.4895:0.2658	.	804	Q9UKF5	ADA29_HUMAN	S	804	ENSP00000352177:R804S;ENSP00000414544:R804S;ENSP00000384229:R804S;ENSP00000423517:R804S	.	R	+	3	2	ADAM29	176135663	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-3.656000	0.00401	-1.571000	0.01663	-1.187000	0.01702	AGG	C|0.001;G|0.998;T|0.001	0.001	weak		0.572	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
TRPC4AP	26133	hgsc.bcm.edu	37	20	33645345	33645345	+	Silent	SNP	C	C	T	rs150179620		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:33645345C>T	ENST00000252015.2	-	4	533	c.444G>A	c.(442-444)acG>acA	p.T148T	TRPC4AP_ENST00000432634.2_Silent_p.T109T|TRPC4AP_ENST00000451813.2_Silent_p.T148T			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	148	Interaction with TNFRSF1A. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GGATAGAGATCGTAGGCCTCA	0.363																																					p.T148T		Atlas-SNP	.											TRPC4AP,NS,carcinoma,0,1	TRPC4AP	64	1	0			c.G444A						scavenged	.	C	,	0,4406		0,0,2203	91.0	95.0	94.0		444,444	-0.0	1.0	20	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TRPC4AP	NM_015638.2,NM_199368.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	148/798,148/790	33645345	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	26133	exon4			AGAGATCGTAGGC	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.444G>A	20.37:g.33645345C>T		Somatic	118	2	0.0169492		WXS	Illumina HiSeq	Phase_I	113	2	0.0176991	NM_199368	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Silent	SNP	ENST00000252015.2	37	CCDS13246.1																																																																																			C|1.000;T|0.000	0.000	weak		0.363	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
KRTAP5-8	57830	hgsc.bcm.edu	37	11	71249558	71249558	+	Missense_Mutation	SNP	T	T	A	rs374587723		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:71249558T>A	ENST00000398534.3	+	1	488	c.457T>A	c.(457-459)Tgc>Agc	p.C153S		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	153	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						TAAGCCCTGCTGCTGCTCTTC	0.602																																					p.C153S		Atlas-SNP	.											KRTAP5-8,NS,carcinoma,0,1	KRTAP5-8	28	1	0			c.T457A						scavenged	.						176.0	180.0	178.0					11																	71249558		2200	4294	6494	SO:0001583	missense	57830	exon1			CCCTGCTGCTGCT	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.457T>A	11.37:g.71249558T>A	ENSP00000420723:p.Cys153Ser	Somatic	122	1	0.00819672		WXS	Illumina HiSeq	Phase_I	133	5	0.037594	NM_021046	Q6L8G7|Q6UTX6	Missense_Mutation	SNP	ENST00000398534.3	37	CCDS41683.1	.	.	.	.	.	.	.	.	.	.	-	12.36	1.913624	0.33815	.	.	ENSG00000241233	ENST00000398534	T	0.01767	4.65	1.63	0.358	0.16084	.	.	.	.	.	T	0.04003	0.0112	M	0.90252	3.1	0.24313	N	0.995073	B	0.02656	0.0	B	0.06405	0.002	T	0.27434	-1.0074	9	0.52906	T	0.07	.	4.9425	0.13973	0.2691:0.0:0.0:0.7308	.	153	O75690	KRA58_HUMAN	S	153	ENSP00000420723:C153S	ENSP00000420723:C153S	C	+	1	0	KRTAP5-8	70927206	0.006000	0.16342	0.812000	0.32479	0.182000	0.23217	0.150000	0.16263	0.076000	0.16826	0.459000	0.35465	TGC	.	.	weak		0.602	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046	
TPPP	11076	hgsc.bcm.edu	37	5	678087	678087	+	Missense_Mutation	SNP	C	C	T	rs570878136	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:678087C>T	ENST00000360578.5	-	2	210	c.89G>A	c.(88-90)aGg>aAg	p.R30K	CTD-2589H19.6_ENST00000607068.1_RNA	NM_007030.2	NP_008961.1	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	30	Mediates interaction with LIMK1.				microtubule bundle formation (GO:0001578)|microtubule polymerization (GO:0046785)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein polymerization (GO:0032273)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.R30K(1)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		CAGCGACAGCCTCTTGGCTGC	0.677													C|||	15	0.00299521	0.0061	0.0	5008	,	,		16462	0.0069		0.0	False		,,,				2504	0.0				p.R30K		Atlas-SNP	.											TPPP,NS,carcinoma,0,1	TPPP	24	1	1	Substitution - Missense(1)	prostate(1)	c.G89A						scavenged	.						14.0	17.0	16.0					5																	678087		2199	4295	6494	SO:0001583	missense	11076	exon2			GACAGCCTCTTGG	AB017016	CCDS3856.1	5p15.33	2008-02-05			ENSG00000171368	ENSG00000171368			24164	protein-coding gene	gene with protein product	"""brain specific protein p25 alpha"""	608773				10083737, 12093283, 15590652, 17105200	Standard	NM_007030		Approved	p25alpha, TPPP1, p25, TPPP/p25	uc003jbh.4	O94811	OTTHUMG00000131011	ENST00000360578.5:c.89G>A	5.37:g.678087C>T	ENSP00000353785:p.Arg30Lys	Somatic	320	10	0.03125		WXS	Illumina HiSeq	Phase_I	244	6	0.0245902	NM_007030		Missense_Mutation	SNP	ENST00000360578.5	37	CCDS3856.1	.	.	.	.	.	.	.	.	.	.	c	14.67	2.605282	0.46423	.	.	ENSG00000171368	ENST00000360578	T	0.45276	0.9	5.23	5.23	0.72850	.	0.149935	0.44902	D	0.000407	T	0.29588	0.0738	L	0.29908	0.895	0.44635	D	0.997618	B	0.15141	0.012	B	0.13407	0.009	T	0.11867	-1.0570	10	0.05436	T	0.98	-54.1656	16.5545	0.84482	0.0:1.0:0.0:0.0	.	30	O94811	TPPP_HUMAN	K	30	ENSP00000353785:R30K	ENSP00000353785:R30K	R	-	2	0	TPPP	731087	1.000000	0.71417	0.998000	0.56505	0.405000	0.30901	4.081000	0.57627	2.437000	0.82529	0.491000	0.48974	AGG	.	.	none		0.677	TPPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253645.3	NM_007030	
REG3A	5068	hgsc.bcm.edu	37	2	79385481	79385481	+	Missense_Mutation	SNP	C	C	T	rs199992892	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:79385481C>T	ENST00000409839.3	-	4	340	c.304G>A	c.(304-306)Gtc>Atc	p.V102I	REG3A_ENST00000305165.2_Missense_Mutation_p.V102I|AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000393878.1_Missense_Mutation_p.V102I	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	102	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)	p.V102I(1)		breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						CCAATCCAGACGTATGAGTAG	0.577													C|||	5	0.000998403	0.0	0.0029	5008	,	,		19685	0.001		0.0	False		,,,				2504	0.002				p.V102I		Atlas-SNP	.											REG3A,colon,carcinoma,0,1	REG3A	76	1	1	Substitution - Missense(1)	large_intestine(1)	c.G304A						scavenged	.						132.0	106.0	115.0					2																	79385481		2203	4300	6503	SO:0001583	missense	5068	exon3			TCCAGACGTATGA	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.304G>A	2.37:g.79385481C>T	ENSP00000386630:p.Val102Ile	Somatic	198	3	0.0151515		WXS	Illumina HiSeq	Phase_I	235	7	0.0297872	NM_138938		Missense_Mutation	SNP	ENST00000409839.3	37	CCDS1965.1	124	0.056776556776556776	43	0.08739837398373984	29	0.08011049723756906	25	0.043706293706293704	27	0.03562005277044855	C	1.610	-0.524315	0.04141	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.17854	2.25;2.25;2.25	4.02	-6.97	0.01616	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.011050	0.07946	N	0.980151	T	0.00356	0.0011	N	0.25201	0.72	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40572	-0.9556	10	0.13853	T	0.58	.	13.264	0.60122	0.0:0.6394:0.0:0.3606	.	102	Q06141	REG3A_HUMAN	I	102	ENSP00000386630:V102I;ENSP00000377456:V102I;ENSP00000304311:V102I	ENSP00000304311:V102I	V	-	1	0	REG3A	79238989	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-2.623000	0.00876	-1.445000	0.01948	-1.155000	0.01812	GTC	C|0.943;T|0.057	0.057	strong		0.577	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580	
SYNE1	23345	hgsc.bcm.edu	37	6	152737804	152737804	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:152737804G>A	ENST00000367255.5	-	41	6369	c.5768C>T	c.(5767-5769)gCc>gTc	p.A1923V	SYNE1_ENST00000265368.4_Missense_Mutation_p.A1923V|SYNE1_ENST00000448038.1_Missense_Mutation_p.A1930V|SYNE1_ENST00000423061.1_Missense_Mutation_p.A1930V|SYNE1_ENST00000341594.5_Missense_Mutation_p.A1960V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1923					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGACTGACGGCAGCAGATTC	0.453										HNSCC(10;0.0054)																											p.A1930V		Atlas-SNP	.											SYNE1_ENST00000423061,NS,carcinoma,+1,3	SYNE1	3227	3	0			c.C5789T						scavenged	.						107.0	103.0	104.0					6																	152737804		2203	4300	6503	SO:0001583	missense	23345	exon41			CTGACGGCAGCAG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5768C>T	6.37:g.152737804G>A	ENSP00000356224:p.Ala1923Val	Somatic	251	0	0		WXS	Illumina HiSeq	Phase_I	268	3	0.011194	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449779	0.43531	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.58797	0.39;0.41;0.31;0.32;0.4	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000007	T	0.67627	0.2913	M	0.69823	2.125	0.80722	D	1	D;D;D;P	0.71674	0.998;0.966;0.966;0.708	P;B;B;B	0.59703	0.862;0.437;0.437;0.251	T	0.60850	-0.7181	10	0.30854	T	0.27	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	1906;1923;1923;1930	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	V	1923;1930;1923;1930;1960	ENSP00000356224:A1923V;ENSP00000396024:A1930V;ENSP00000265368:A1923V;ENSP00000390975:A1930V;ENSP00000341887:A1960V	ENSP00000265368:A1923V	A	-	2	0	SYNE1	152779497	1.000000	0.71417	0.288000	0.24862	0.006000	0.05464	6.539000	0.73856	2.885000	0.99019	0.655000	0.94253	GCC	.	.	none		0.453	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
PRKD3	23683	hgsc.bcm.edu	37	2	37513463	37513463	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:37513463C>T	ENST00000379066.1	-	6	1529	c.767G>A	c.(766-768)cGc>cAc	p.R256H	PRKD3_ENST00000234179.2_Missense_Mutation_p.R256H			O94806	KPCD3_HUMAN	protein kinase D3	256					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.R256H(2)		breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				CCAGATTGGGCGACCACTCCA	0.403																																					p.R256H	Melanoma(80;621 1355 8613 11814 51767)	Atlas-SNP	.											PRKD3_ENST00000379066,NS,carcinoma,0,2	PRKD3	170	2	2	Substitution - Missense(2)	lung(2)	c.G767A						scavenged	.						151.0	124.0	133.0					2																	37513463		2203	4300	6503	SO:0001583	missense	23683	exon5			ATTGGGCGACCAC	AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.767G>A	2.37:g.37513463C>T	ENSP00000368356:p.Arg256His	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	132	2	0.0151515	NM_005813	D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	ENST00000379066.1	37	CCDS1789.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962866	0.92791	.	.	ENSG00000115825	ENST00000379066;ENST00000234179;ENST00000443187	T;T;D	0.88975	-0.49;-0.49;-2.45	5.71	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.93575	0.7949	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.968	D	0.93971	0.7249	10	0.62326	D	0.03	-7.0204	14.8974	0.70654	0.0:0.9312:0.0:0.0688	.	256;256	O94806-2;O94806	.;KPCD3_HUMAN	H	256;256;152	ENSP00000368356:R256H;ENSP00000234179:R256H;ENSP00000401839:R152H	ENSP00000234179:R256H	R	-	2	0	PRKD3	37366967	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	1.428000	0.47296	0.655000	0.94253	CGC	.	.	none		0.403	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	NM_005813	
TBL3	10607	hgsc.bcm.edu	37	16	2025604	2025604	+	Missense_Mutation	SNP	G	G	C	rs8052713	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:2025604G>C	ENST00000568546.1	+	10	1008	c.880G>C	c.(880-882)Gag>Cag	p.E294Q		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	294			E -> Q (in dbSNP:rs8052713).		G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						CCCTGGGCAGGAGCTGACCCA	0.701													G|||	573	0.114417	0.0038	0.1873	5008	,	,		17024	0.0397		0.1312	False		,,,				2504	0.272				p.E294Q	Melanoma(118;616 1651 35077 38081 48633)	Atlas-SNP	.											TBL3,NS,carcinoma,0,1	TBL3	54	1	0			c.G880C						scavenged	.	G	GLN/GLU	115,4271		4,107,2082	20.0	22.0	21.0		880	5.2	0.8	16	dbSNP_116	21	1032,7554		57,918,3318	no	missense	TBL3	NM_006453.2	29	61,1025,5400	CC,CG,GG		12.0196,2.622,8.8421	benign	294/809	2025604	1147,11825	2193	4293	6486	SO:0001583	missense	10607	exon10			GGGCAGGAGCTGA	U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.880G>C	16.37:g.2025604G>C	ENSP00000454836:p.Glu294Gln	Somatic	16	3	0.1875		WXS	Illumina HiSeq	Phase_I	7	3	0.428571	NM_006453	Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	ENST00000568546.1	37	CCDS10453.1	169	0.07738095238095238	3	0.006097560975609756	50	0.13812154696132597	21	0.03671328671328671	95	0.12532981530343007	G	10.55	1.382302	0.24944	0.02622	0.120196	ENSG00000183751	ENST00000332704	.	.	.	5.17	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.607646	0.14343	N	0.325608	T	0.00356	0.0011	L	0.47716	1.5	0.27465	P	0.9530353	B;P	0.37176	0.008;0.586	B;B	0.27608	0.005;0.081	T	0.22243	-1.0222	8	0.10377	T	0.69	-13.4403	17.6351	0.88120	0.0:0.0:1.0:0.0	rs8052713	56;294	A0JLS5;Q12788	.;TBL3_HUMAN	Q	294	.	ENSP00000331815:E294Q	E	+	1	0	TBL3	1965605	1.000000	0.71417	0.809000	0.32408	0.510000	0.34073	4.016000	0.57159	2.415000	0.81967	0.655000	0.94253	GAG	G|0.921;C|0.079	0.079	strong		0.701	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250615.3	NM_006453	
ZNF484	83744	hgsc.bcm.edu	37	9	95610230	95610230	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:95610230T>C	ENST00000375495.3	-	5	987	c.839A>G	c.(838-840)gAa>gGa	p.E280G	ZNF484_ENST00000395506.3_Missense_Mutation_p.E282G|ANKRD19P_ENST00000473204.1_RNA|ZNF484_ENST00000332591.6_Missense_Mutation_p.E244G|ZNF484_ENST00000395505.2_Missense_Mutation_p.E244G	NM_031486.2	NP_113674.1	Q5JVG2	ZN484_HUMAN	zinc finger protein 484	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|kidney(8)|large_intestine(10)|lung(10)|prostate(2)	33						TTCATGGCATTCATGCTGCTT	0.433																																					p.E282G		Atlas-SNP	.											ZNF484,NS,carcinoma,-1,1	ZNF484	81	1	0			c.A845G						scavenged	.						96.0	91.0	93.0					9																	95610230		2203	4300	6503	SO:0001583	missense	83744	exon4			TGGCATTCATGCT	AK091203	CCDS35066.1, CCDS35067.1, CCDS59136.1	9q22.32	2013-01-08			ENSG00000127081	ENSG00000127081		"""Zinc fingers, C2H2-type"", ""-"""	23385	protein-coding gene	gene with protein product							Standard	NM_001007101		Approved	BA526D8.4, FLJ33884	uc004asu.2	Q5JVG2	OTTHUMG00000020236	ENST00000375495.3:c.839A>G	9.37:g.95610230T>C	ENSP00000364645:p.Glu280Gly	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	301	5	0.0166113	NM_001261458	B1AL89|B4DRI2	Missense_Mutation	SNP	ENST00000375495.3	37	CCDS35066.1	.	.	.	.	.	.	.	.	.	.	.	2.526	-0.309581	0.05458	.	.	ENSG00000127081	ENST00000395505;ENST00000395506;ENST00000375495;ENST00000332591	T;T;T;T	0.16196	2.36;2.36;2.36;2.36	2.47	-0.0298	0.13917	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15392	0.0371	M	0.67397	2.05	0.09310	N	1	B;B	0.27559	0.181;0.181	B;B	0.21708	0.036;0.022	T	0.29305	-1.0016	9	0.59425	D	0.04	.	2.8479	0.05549	0.0:0.1548:0.2666:0.5786	.	282;280	B4DRI2;Q5JVG2	.;ZN484_HUMAN	G	244;282;280;244	ENSP00000378881:E244G;ENSP00000378882:E282G;ENSP00000364645:E280G;ENSP00000364646:E244G	ENSP00000364646:E244G	E	-	2	0	ZNF484	94650051	0.000000	0.05858	0.002000	0.10522	0.026000	0.11368	-0.428000	0.06991	-0.018000	0.14079	-0.491000	0.04670	GAA	.	.	none		0.433	ZNF484-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053111.2	XM_046861	
CEP41	95681	hgsc.bcm.edu	37	7	130067800	130067800	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:130067800G>T	ENST00000223208.5	-	2	363	c.93C>A	c.(91-93)gaC>gaA	p.D31E	CEP41_ENST00000541543.1_Missense_Mutation_p.D31E|CEP41_ENST00000489512.1_Missense_Mutation_p.D31E|CEP41_ENST00000495702.1_5'UTR|CEP41_ENST00000343969.5_Missense_Mutation_p.D31E	NM_001257158.1|NM_018718.2	NP_001244087.1|NP_061188.1	Q9BYV8	CEP41_HUMAN	centrosomal protein 41kDa	31					cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein polyglutamylation (GO:0018095)|protein transport (GO:0015031)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|primary cilium (GO:0072372)											ACTCACCAGTGTCCAGTCTTG	0.303																																					p.D31E		Atlas-SNP	.											.	.	.	.	0			c.C93A						PASS	.						80.0	79.0	79.0					7																	130067800		2203	4300	6503	SO:0001583	missense	95681	exon2			ACCAGTGTCCAGT	AJ278890	CCDS5821.1, CCDS59078.1, CCDS59079.1, CCDS59080.1	7q32	2014-02-20	2011-10-04	2011-10-04	ENSG00000106477	ENSG00000106477			12370	protein-coding gene	gene with protein product		610523	"""testis specific, 14"""	TSGA14		14654843, 22246503	Standard	NM_018718		Approved	DKFZp762H1311, FLJ22445, JBTS15	uc003vpz.4	Q9BYV8	OTTHUMG00000157823	ENST00000223208.5:c.93C>A	7.37:g.130067800G>T	ENSP00000223208:p.Asp31Glu	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	64	25	0.390625	NM_001257159	A4D1M0|B4DQ35|F5H0V6|Q7Z496|Q86TM1|Q8NFU8|Q9H6A3|Q9NPV3	Missense_Mutation	SNP	ENST00000223208.5	37	CCDS5821.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.756933	0.69648	.	.	ENSG00000106477	ENST00000223208;ENST00000541543;ENST00000343969;ENST00000477003;ENST00000469826;ENST00000489512	D;D;D;D;D	0.92965	-3.14;-2.34;-3.06;-2.83;-2.61	5.68	2.79	0.32731	.	0.000000	0.85682	D	0.000000	D	0.95085	0.8408	M	0.82630	2.6	0.46901	D	0.999244	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.996;0.984;0.948	D	0.93213	0.6602	10	0.87932	D	0	-10.9368	6.9984	0.24795	0.3038:0.0:0.6962:0.0	.	31;31;31	F5H0V6;Q9BYV8-2;Q9BYV8	.;.;CEP41_HUMAN	E	31;31;31;28;18;31	ENSP00000223208:D31E;ENSP00000445888:D31E;ENSP00000342738:D31E;ENSP00000420670:D28E;ENSP00000418712:D18E	ENSP00000223208:D31E	D	-	3	2	TSGA14	129855036	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.757000	0.26433	0.282000	0.22254	0.591000	0.81541	GAC	.	.	none		0.303	CEP41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349702.2	NM_018718	
ZNF438	220929	hgsc.bcm.edu	37	10	31137635	31137635	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:31137635T>G	ENST00000361310.3	-	6	2028	c.1699A>C	c.(1699-1701)Atg>Ctg	p.M567L	ZNF438_ENST00000538351.2_Missense_Mutation_p.M518L|ZNF438_ENST00000452305.1_Missense_Mutation_p.M557L|ZNF438_ENST00000436087.2_Missense_Mutation_p.M567L|ZNF438_ENST00000413025.1_Missense_Mutation_p.M567L|ZNF438_ENST00000444692.2_Missense_Mutation_p.M557L|ZNF438_ENST00000331737.6_Missense_Mutation_p.M557L|ZNF438_ENST00000442986.1_Missense_Mutation_p.M567L|ZNF438_ENST00000375311.1_Missense_Mutation_p.M131L			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	567					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				TCACAACACATGAGTTTCTTC	0.483																																					p.M567L		Atlas-SNP	.											.	ZNF438	90	.	0			c.A1699C						PASS	.						165.0	157.0	160.0					10																	31137635		2203	4300	6503	SO:0001583	missense	220929	exon7			AACACATGAGTTT	AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.1699A>C	10.37:g.31137635T>G	ENSP00000354663:p.Met567Leu	Somatic	202	0	0		WXS	Illumina HiSeq	Phase_I	237	60	0.253165	NM_182755	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	ENST00000361310.3	37	CCDS7168.1	.	.	.	.	.	.	.	.	.	.	T	7.360	0.624731	0.14193	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351;ENST00000430896;ENST00000375311	T;T;T;T;T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55;2.55;2.55;2.55;3.22	5.4	-3.69	0.04450	Zinc finger, C2H2-like (1);	0.541309	0.20921	N	0.083263	T	0.04679	0.0127	N	0.08118	0	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.40813	-0.9543	10	0.16420	T	0.52	-2.4183	7.8113	0.29232	0.0:0.3656:0.1286:0.5057	.	567;557	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	L	557;567;567;567;567;557;557;518;286;131	ENSP00000333571:M557L;ENSP00000354663:M567L;ENSP00000406934:M567L;ENSP00000412363:M567L;ENSP00000387546:M567L;ENSP00000413060:M557L;ENSP00000410898:M557L;ENSP00000445461:M518L;ENSP00000364460:M131L	ENSP00000333571:M557L	M	-	1	0	ZNF438	31177641	0.000000	0.05858	0.053000	0.19242	0.996000	0.88848	-0.371000	0.07513	-0.355000	0.08199	0.482000	0.46254	ATG	.	.	none		0.483	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277006.1	NM_182755	
CDH19	28513	hgsc.bcm.edu	37	18	64178881	64178881	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr18:64178881T>C	ENST00000262150.2	-	10	1792	c.1500A>G	c.(1498-1500)atA>atG	p.I500M	CDH19_ENST00000540086.1_Intron	NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	1778	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				GGTGCTCTTCTATGGATTCAT	0.333																																					p.I500M		Atlas-SNP	.											CDH19,NS,carcinoma,0,1	CDH19	141	1	0			c.A1500G						scavenged	.						93.0	92.0	92.0					18																	64178881		2203	4296	6499	SO:0001583	missense	28513	exon10			CTCTTCTATGGAT	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.1500A>G	18.37:g.64178881T>C	ENSP00000262150:p.Ile500Met	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	201	3	0.0149254	NM_021153	O15098	Missense_Mutation	SNP	ENST00000262150.2	37	CCDS11994.1	.	.	.	.	.	.	.	.	.	.	T	7.537	0.659818	0.14645	.	.	ENSG00000071991	ENST00000262150	T	0.51071	0.72	5.03	-0.395	0.12431	Cadherin (4);Cadherin-like (1);	1.051630	0.07337	N	0.880064	T	0.27697	0.0681	N	0.19112	0.55	0.58432	D	0.999998	B	0.20261	0.043	B	0.24006	0.05	T	0.32268	-0.9913	10	0.36615	T	0.2	.	0.4226	0.00459	0.2514:0.2157:0.1296:0.4032	.	500	Q9H159	CAD19_HUMAN	M	500	ENSP00000262150:I500M	ENSP00000262150:I500M	I	-	3	3	CDH19	62329861	0.000000	0.05858	0.125000	0.21846	0.991000	0.79684	-0.609000	0.05635	-0.124000	0.11724	0.477000	0.44152	ATA	.	.	none		0.333	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256219.1	NM_021153	
MUC2	4583	hgsc.bcm.edu	37	11	1092910	1092910	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:1092910G>A	ENST00000441003.2	+	30	4756	c.4729G>A	c.(4729-4731)Ggc>Agc	p.G1577S	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.G1578S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.G1577S(1)|p.G1578S(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.637																																					p.G1577S		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,6	MUC2	614	6	2	Substitution - Missense(2)	prostate(2)	c.G4729A						scavenged	.						85.0	125.0	111.0					11																	1092910		1937	3603	5540	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4729G>A	11.37:g.1092910G>A	ENSP00000415183:p.Gly1577Ser	Somatic	81	6	0.0740741		WXS	Illumina HiSeq	Phase_I	100	9	0.09	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	g	2.787	-0.252217	0.05829	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11169	2.8;2.9	1.49	-2.97	0.05530	.	1.221530	0.07178	U	0.853623	T	0.04092	0.0114	.	.	.	0.09310	N	1	B	0.24882	0.113	B	0.11329	0.006	T	0.37798	-0.9690	9	0.07175	T	0.84	.	4.8921	0.13731	0.6336:0.1684:0.198:0.0	.	1577	E7EUV1	.	S	1577;1578	ENSP00000415183:G1577S;ENSP00000351956:G1578S	ENSP00000351956:G1578S	G	+	1	0	MUC2	1082910	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-1.266000	0.02842	-2.620000	0.00440	-1.713000	0.00713	GGC	.	.	none		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CHIT1	1118	hgsc.bcm.edu	37	1	203186088	203186088	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:203186088G>A	ENST00000367229.1	-	11	1364	c.1330C>T	c.(1330-1332)Cgg>Tgg	p.R444W	CHIT1_ENST00000255427.3_Missense_Mutation_p.R425W|CHIT1_ENST00000484834.1_Intron|CHIT1_ENST00000535569.1_Missense_Mutation_p.R435W	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	444	Chitin-binding type-2. {ECO:0000255|PROSITE-ProRule:PRU00144}.				chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						TGGAACAGCCGCCCCGCTGCA	0.597											OREG0014113	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R444W		Atlas-SNP	.											CHIT1,NS,carcinoma,+2,1	CHIT1	61	1	0			c.C1330T						PASS	.						87.0	92.0	90.0					1																	203186088		2203	4300	6503	SO:0001583	missense	1118	exon11			ACAGCCGCCCCGC	U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1330C>T	1.37:g.203186088G>A	ENSP00000356198:p.Arg444Trp	Somatic	55	0	0	2135	WXS	Illumina HiSeq	Phase_I	54	11	0.203704	NM_003465	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Missense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903086	0.52227	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	T;T;T	0.32272	1.46;1.46;1.46	4.81	0.807	0.18714	Chitin binding domain (5);	0.540328	0.15465	N	0.260936	T	0.42040	0.1185	M	0.72624	2.21	0.09310	N	1	B;D;B	0.76494	0.01;0.999;0.031	B;P;B	0.61800	0.003;0.894;0.007	T	0.21861	-1.0233	10	0.37606	T	0.19	-4.997	3.3947	0.07302	0.2568:0.0:0.4399:0.3033	.	415;435;444	Q13231-3;G5EA51;Q13231	.;.;CHIT1_HUMAN	W	444;425;435	ENSP00000356198:R444W;ENSP00000255427:R425W;ENSP00000438078:R435W	ENSP00000255427:R425W	R	-	1	2	CHIT1	201452711	0.000000	0.05858	0.043000	0.18650	0.768000	0.43524	-0.593000	0.05740	-0.110000	0.12022	0.650000	0.86243	CGG	.	.	none		0.597	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465	
FRG1	2483	hgsc.bcm.edu	37	4	190878658	190878658	+	Splice_Site	SNP	G	G	A	rs76810924		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:190878658G>A	ENST00000226798.4	+	6	759		c.e6+1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AATGATCAAGGTAATGATGAC	0.348																																					.		Atlas-SNP	.											FRG1,right_upper_lobe,carcinoma,0,1	FRG1	76	1	0			c.537+1G>A						scavenged	.						47.0	43.0	44.0					4																	190878658		2169	4247	6416	SO:0001630	splice_region_variant	2483	exon6			ATCAAGGTAATGA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.537+1G>A	4.37:g.190878658G>A		Somatic	482	7	0.0145228		WXS	Illumina HiSeq	Phase_I	561	15	0.026738	NM_004477	A8K775	Splice_Site	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	15.05	2.718286	0.48622	.	.	ENSG00000109536	ENST00000226798;ENST00000524583	.	.	.	3.8	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6226	0.62146	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191115652	1.000000	0.71417	1.000000	0.80357	0.557000	0.35523	9.554000	0.98121	1.860000	0.53959	0.454000	0.30748	.	G|0.875;A|0.125	0.125	weak		0.348	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
MITF	4286	hgsc.bcm.edu	37	3	69928321	69928321	+	Silent	SNP	G	G	A	rs199697494		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:69928321G>A	ENST00000448226.2	+	2	268	c.141G>A	c.(139-141)ccG>ccA	p.P47P	MITF_ENST00000328528.6_Silent_p.P46P|MITF_ENST00000472437.1_5'UTR|MITF_ENST00000394355.2_Silent_p.P22P|MITF_ENST00000352241.4_Silent_p.P47P|MITF_ENST00000314589.5_Silent_p.P31P			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	47					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CCAAGCCTCCGATAAGCTCCT	0.537			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""						G|||	1	0.000199681	0.0	0.0	5008	,	,		18415	0.001		0.0	False		,,,				2504	0.0				p.P47P	Melanoma(29;269 969 31479 41502 42961)	Atlas-SNP	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF	156	.	0			c.G141A						PASS	.						43.0	48.0	46.0					3																	69928321		2035	4202	6237	SO:0001819	synonymous_variant	4286	exon2			GCCTCCGATAAGC		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.141G>A	3.37:g.69928321G>A		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	93	30	0.322581	NM_198159	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	37																																																																																				G|1.000;A|0.000	0.000	strong		0.537	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
KIAA0430	9665	hgsc.bcm.edu	37	16	15719020	15719020	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:15719020C>T	ENST00000396368.3	-	9	2170	c.1964G>A	c.(1963-1965)cGc>cAc	p.R655H	KIAA0430_ENST00000602337.1_Missense_Mutation_p.R652H|KIAA0430_ENST00000551742.1_Missense_Mutation_p.R654H|KIAA0430_ENST00000344181.3_Intron|KIAA0430_ENST00000540441.2_Missense_Mutation_p.R512H|KIAA0430_ENST00000548025.1_Missense_Mutation_p.R652H	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	655					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R655H(1)		breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TGACTCCATGCGGCACAGCTC	0.463																																					p.R655H		Atlas-SNP	.											KIAA0430,caecum,carcinoma,0,1	KIAA0430	154	1	1	Substitution - Missense(1)	large_intestine(1)	c.G1964A						scavenged	.						53.0	54.0	53.0					16																	15719020		2002	4182	6184	SO:0001583	missense	9665	exon9			TCCATGCGGCACA	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.1964G>A	16.37:g.15719020C>T	ENSP00000379654:p.Arg655His	Somatic	102	1	0.00980392		WXS	Illumina HiSeq	Phase_I	124	4	0.0322581	NM_014647	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	37	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026658	0.54683	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000548025;ENST00000551742	.	.	.	5.87	2.89	0.33648	.	0.385135	0.29822	N	0.011113	T	0.55577	0.1929	L	0.60455	1.87	0.80722	D	1	B;B;B;B	0.20164	0.018;0.042;0.042;0.005	B;B;B;B	0.15870	0.009;0.014;0.014;0.003	T	0.53287	-0.8460	9	0.72032	D	0.01	.	9.5646	0.39391	0.0:0.7846:0.0:0.2154	.	653;652;651;654	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	H	655;512;654;652;654	.	ENSP00000315718:R654H	R	-	2	0	KIAA0430	15626521	0.058000	0.20735	0.549000	0.28204	0.993000	0.82548	0.209000	0.17435	0.401000	0.25424	0.591000	0.81541	CGC	.	.	none		0.463	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647	
OR4D1	26689	hgsc.bcm.edu	37	17	56232809	56232809	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:56232809G>A	ENST00000268912.5	+	1	316	c.295G>A	c.(295-297)Gcc>Acc	p.A99T		NM_012374.1	NP_036506.1	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D, member 1	99					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13						GGGCTGCATGGCCCAGATCTT	0.527																																					p.A99T		Atlas-SNP	.											OR4D1,NS,carcinoma,0,1	OR4D1	48	1	0			c.G295A						scavenged	.						113.0	117.0	115.0					17																	56232809		2179	4285	6464	SO:0001583	missense	26689	exon1			TGCATGGCCCAGA	X89670	CCDS42365.1	17q22	2012-08-09			ENSG00000141194	ENSG00000141194		"""GPCR / Class A : Olfactory receptors"""	8293	protein-coding gene	gene with protein product				OR4D3		9119360	Standard	NM_012374		Approved	TPCR16	uc010wno.2	Q15615		ENST00000268912.5:c.295G>A	17.37:g.56232809G>A	ENSP00000365451:p.Ala99Thr	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	94	2	0.0212766	NM_012374	B2RN14|Q8NGB1|Q96R76	Missense_Mutation	SNP	ENST00000268912.5	37	CCDS42365.1	.	.	.	.	.	.	.	.	.	.	g	3.469	-0.108395	0.06924	.	.	ENSG00000141194	ENST00000268912	T	0.03004	4.08	5.63	0.911	0.19343	GPCR, rhodopsin-like superfamily (1);	0.324668	0.26824	N	0.022302	T	0.01387	0.0045	N	0.03917	-0.325	0.25104	N	0.990768	B	0.14805	0.011	B	0.14578	0.011	T	0.49093	-0.8975	10	0.02654	T	1	-12.5484	8.2828	0.31910	0.4387:0.0:0.5613:0.0	.	99	Q15615	OR4D1_HUMAN	T	99	ENSP00000365451:A99T	ENSP00000365451:A99T	A	+	1	0	OR4D1	53587808	0.000000	0.05858	0.997000	0.53966	0.991000	0.79684	-0.638000	0.05452	0.337000	0.23665	0.543000	0.68304	GCC	.	.	none		0.527	OR4D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443364.1		
KRT4	3851	hgsc.bcm.edu	37	12	53207583	53207583	+	Missense_Mutation	SNP	C	C	G	rs76773498|rs11267392	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:53207583C>G	ENST00000551956.1	-	1	752	c.260G>C	c.(259-261)gGt>gCt	p.G87A	KRT4_ENST00000293774.4_Missense_Mutation_p.G161A|KRT4_ENST00000458244.2_Missense_Mutation_p.G67A			P19013	K2C4_HUMAN	keratin 4	87	Gly-rich.|Head.		Missing (in allele K4B). {ECO:0000269|PubMed:16541075, ECO:0000269|PubMed:7684424}.		cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CCCAAATCCACCACCAAAGCC	0.602																																					p.G87A	Pancreas(190;284 2995 41444 45903)	Atlas-SNP	.											KRT4,rectum,carcinoma,+1,2	KRT4	110	2	0			c.G260C						scavenged	.						43.0	59.0	54.0					12																	53207583		2120	4256	6376	SO:0001583	missense	3851	exon1			AATCCACCACCAA		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.260G>C	12.37:g.53207583C>G	ENSP00000448220:p.Gly87Ala	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	67	7	0.104478	NM_002272	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Missense_Mutation	SNP	ENST00000551956.1	37	CCDS41787.2	.	.	.	.	.	.	.	.	.	.	C	11.36	1.614915	0.28712	.	.	ENSG00000170477	ENST00000551956;ENST00000293774;ENST00000458244	D;T;D	0.98717	-3.14;0.68;-5.09	5.14	4.25	0.50352	.	0.974741	0.08394	N	0.952444	D	0.97123	0.9060	L	0.45581	1.43	0.29836	N	0.829633	B	0.21071	0.051	B	0.17979	0.02	D	0.93594	0.6924	10	0.31617	T	0.26	.	14.3364	0.66592	0.1484:0.8516:0.0:0.0	.	101	P19013	K2C4_HUMAN	A	87;161;67	ENSP00000448220:G87A;ENSP00000293774:G161A;ENSP00000387904:G67A	ENSP00000293774:G161A	G	-	2	0	KRT4	51493850	0.011000	0.17503	0.856000	0.33681	0.125000	0.20455	0.972000	0.29409	1.483000	0.48342	0.585000	0.79938	GGT	.	.	weak		0.602	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
SEPT5	5413	hgsc.bcm.edu	37	22	19709201	19709201	+	Silent	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:19709201G>T	ENST00000455784.2	+	9	881	c.756G>T	c.(754-756)gtG>gtT	p.V252V	SEPT5_ENST00000383045.3_Silent_p.V261V|SEPT5_ENST00000406395.1_Silent_p.V252V|GP1BB_ENST00000366425.3_5'Flank|SEPT5_ENST00000438754.2_Silent_p.V261V	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5	252	Septin-type G.				cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					GCAACACGGTGGTGGAGGCCA	0.642																																					p.V261V		Atlas-SNP	.											.	SEPT5	32	.	0			c.G783T						PASS	.						38.0	48.0	44.0					22																	19709201		2203	4299	6502	SO:0001819	synonymous_variant	5413	exon8			CACGGTGGTGGAG	Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.756G>T	22.37:g.19709201G>T		Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	108	5	0.0462963	NM_001009939	O15251|Q96MY5	Silent	SNP	ENST00000455784.2	37	CCDS13764.1																																																																																			.	.	none		0.642	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317937.1	NM_002688	
CCDC64B	146439	hgsc.bcm.edu	37	16	3078165	3078165	+	Missense_Mutation	SNP	A	A	G	rs12448103	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:3078165A>G	ENST00000572449.1	-	10	1531	c.1469T>C	c.(1468-1470)cTg>cCg	p.L490P	CCDC64B_ENST00000573514.1_Missense_Mutation_p.L283P|CCDC64B_ENST00000389347.4_Missense_Mutation_p.L490P			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	490										breast(1)|endometrium(2)|large_intestine(1)	4						GCCCAGGCGCAGCGAGAAGCG	0.716													A|||	909	0.18151	0.0492	0.2925	5008	,	,		10148	0.128		0.2356	False		,,,				2504	0.2812				p.L490P		Atlas-SNP	.											CCDC64B,NS,carcinoma,0,1	CCDC64B	19	1	0			c.T1469C						scavenged	.	A	PRO/LEU	205,3283		5,195,1544	4.0	5.0	5.0		1469	5.2	0.8	16	dbSNP_120	5	1331,6363		97,1137,2613	yes	missense	CCDC64B	NM_001103175.1	98	102,1332,4157	GG,GA,AA		17.2992,5.8773,13.7364	probably-damaging	490/509	3078165	1536,9646	1744	3847	5591	SO:0001583	missense	146439	exon9			AGGCGCAGCGAGA	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.1469T>C	16.37:g.3078165A>G	ENSP00000459043:p.Leu490Pro	Somatic	1	1	1		WXS	Illumina HiSeq	Phase_I	8	8	1	NM_001103175	Q658L9	Missense_Mutation	SNP	ENST00000572449.1	37	CCDS45393.1	382	0.1749084249084249	26	0.052845528455284556	112	0.30939226519337015	64	0.11188811188811189	180	0.23746701846965698	a	17.73	3.462111	0.63513	0.058773	0.172992	ENSG00000162069	ENST00000389347	T	0.36157	1.27	5.15	5.15	0.70609	.	0.119688	0.34879	N	0.003617	T	0.00012	0.0000	M	0.68952	2.095	0.23473	P	0.99760263	D	0.89917	1.0	D	0.91635	0.999	T	0.26018	-1.0115	9	0.30854	T	0.27	-7.2384	11.3817	0.49761	1.0:0.0:0.0:0.0	rs12448103	490	A1A5D9	BICR2_HUMAN	P	490	ENSP00000373998:L490P	ENSP00000373998:L490P	L	-	2	0	CCDC64B	3018166	0.249000	0.23941	0.820000	0.32676	0.129000	0.20672	0.546000	0.23284	1.957000	0.56846	0.454000	0.30748	CTG	A|0.823;G|0.177	0.177	strong		0.716	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436991.1		
PCBP3	54039	hgsc.bcm.edu	37	21	47319531	47319531	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr21:47319531G>A	ENST00000400314.1	+	5	522	c.184G>A	c.(184-186)Ggg>Agg	p.G62R	PCBP3_ENST00000449640.1_Missense_Mutation_p.G62R|PCBP3_ENST00000400309.1_Missense_Mutation_p.G62R|PCBP3_ENST00000400308.1_Missense_Mutation_p.G62R|PCBP3_ENST00000400304.1_Missense_Mutation_p.G30R|PCBP3_ENST00000400310.1_Missense_Mutation_p.G62R			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	62	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		AAGCATCATCGGGAAGGTAAT	0.488																																					p.G62R		Atlas-SNP	.											PCBP3_ENST00000400314,NS,carcinoma,-2,2	PCBP3	82	2	0			c.G184A						scavenged	.						134.0	124.0	127.0					21																	47319531		1898	4125	6023	SO:0001583	missense	54039	exon3			ATCATCGGGAAGG	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.184G>A	21.37:g.47319531G>A	ENSP00000383168:p.Gly62Arg	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	109	3	0.0275229	NM_001130141	A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Missense_Mutation	SNP	ENST00000400314.1	37	CCDS42974.2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369031	0.82463	.	.	ENSG00000183570	ENST00000400314;ENST00000400310;ENST00000400309;ENST00000400308;ENST00000449640;ENST00000400305;ENST00000400304	D;D;D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41	4.2	4.2	0.49525	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	.	.	.	.	D	0.96005	0.8699	H	0.94222	3.51	0.80722	D	1	P;P;D;D;P;D;D	0.89917	0.872;0.956;1.0;0.999;0.914;1.0;0.998	P;P;D;D;P;D;D	0.81914	0.703;0.808;0.995;0.974;0.555;0.991;0.968	D	0.97442	1.0022	9	0.87932	D	0	-11.7664	17.4452	0.87577	0.0:0.0:1.0:0.0	.	30;62;30;62;62;62;62	Q5MJP6;P57721-3;E9PFP8;P57721-2;P57721-4;P57721;P57721-5	.;.;.;.;.;PCBP3_HUMAN;.	R	62;62;62;62;62;38;30	ENSP00000383168:G62R;ENSP00000383165:G62R;ENSP00000383164:G62R;ENSP00000383163:G62R;ENSP00000401198:G62R;ENSP00000383160:G38R;ENSP00000383159:G30R	ENSP00000383159:G30R	G	+	1	0	PCBP3	46143959	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	7.107000	0.77047	2.288000	0.76882	0.561000	0.74099	GGG	.	.	none		0.488	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2		
ZNF443	10224	hgsc.bcm.edu	37	19	12541141	12541141	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:12541141C>T	ENST00000301547.5	-	4	2042	c.1845G>A	c.(1843-1845)ccG>ccA	p.P615P	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	615					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						TACATTCATACGGGTTCTCTC	0.403																																					p.P615P		Atlas-SNP	.											ZNF443,lower_third,carcinoma,-1,1	ZNF443	63	1	0			c.G1845A						scavenged	.						62.0	67.0	65.0					19																	12541141		2197	4290	6487	SO:0001819	synonymous_variant	10224	exon4			TTCATACGGGTTC	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1845G>A	19.37:g.12541141C>T		Somatic	193	1	0.00518135		WXS	Illumina HiSeq	Phase_I	182	4	0.021978	NM_005815		Silent	SNP	ENST00000301547.5	37	CCDS32918.1																																																																																			.	.	none		0.403	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815	
CEP170	9859	hgsc.bcm.edu	37	1	243333027	243333027	+	Silent	SNP	A	A	G	rs200644784		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:243333027A>G	ENST00000366542.1	-	12	1797	c.1746T>C	c.(1744-1746)cgT>cgC	p.R582R	RP11-261C10.4_ENST00000422938.1_RNA|CEP170_ENST00000366543.1_Silent_p.R484R|RP11-261C10.4_ENST00000437499.1_RNA|CEP170_ENST00000366544.1_Silent_p.R484R	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	582						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)		p.R582R(3)		NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GTGAAACCCAACGTTTGCTTC	0.398																																					p.R582R		Atlas-SNP	.											CEP170_ENST00000366543,NS,carcinoma,0,6	CEP170	153	6	3	Substitution - coding silent(3)	kidney(3)	c.T1746C						scavenged	.						103.0	92.0	95.0					1																	243333027		1878	4106	5984	SO:0001819	synonymous_variant	9859	exon12			AACCCAACGTTTG	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.1746T>C	1.37:g.243333027A>G		Somatic	505	2	0.0039604		WXS	Illumina HiSeq	Phase_I	595	13	0.0218487	NM_014812	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Silent	SNP	ENST00000366542.1	37	CCDS44339.1	.	.	.	.	.	.	.	.	.	.	A	9.754	1.168273	0.21621	.	.	ENSG00000143702	ENST00000336415	.	.	.	4.66	-6.75	0.01738	.	.	.	.	.	T	0.46833	0.1413	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51576	-0.8688	4	.	.	.	-8.1159	6.5973	0.22681	0.3246:0.0:0.4436:0.2317	.	.	.	.	A	546	.	.	V	-	2	0	CEP170	241399650	0.846000	0.29590	0.974000	0.42286	0.957000	0.61999	-0.087000	0.11215	-0.781000	0.04548	-0.555000	0.04198	GTT	.	.	weak		0.398	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	
ALDOB	229	hgsc.bcm.edu	37	9	104189813	104189813	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:104189813A>G	ENST00000374855.4	-	5	615	c.491T>C	c.(490-492)aTc>aCc	p.I164T	ALDOB_ENST00000468981.3_Intron	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	164					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				GTTTTCCTGGATAGCGAGGCT	0.552																																					p.I164T		Atlas-SNP	.											.	ALDOB	69	.	0			c.T491C						PASS	.						110.0	86.0	94.0					9																	104189813		2203	4300	6503	SO:0001583	missense	229	exon5			TCCTGGATAGCGA	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.491T>C	9.37:g.104189813A>G	ENSP00000363988:p.Ile164Thr	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	125	27	0.216	NM_000035	Q13741|Q13742|Q5T7D6	Missense_Mutation	SNP	ENST00000374855.4	37	CCDS6756.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.784232	0.90282	.	.	ENSG00000136872	ENST00000374855;ENST00000374853;ENST00000430164	D	0.89196	-2.48	6.17	6.17	0.99709	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.96377	0.8818	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97485	1.0050	10	0.87932	D	0	-22.1026	16.0034	0.80327	1.0:0.0:0.0:0.0	.	164	P05062	ALDOB_HUMAN	T	164;91;164	ENSP00000363988:I164T	ENSP00000363986:I91T	I	-	2	0	ALDOB	103229634	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	ATC	.	.	none		0.552	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2		
TNS1	7145	hgsc.bcm.edu	37	2	218713012	218713012	+	Missense_Mutation	SNP	C	C	T	rs199985548		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:218713012C>T	ENST00000171887.4	-	17	2305	c.1853G>A	c.(1852-1854)cGc>cAc	p.R618H	TNS1_ENST00000419504.1_Missense_Mutation_p.R618H|TNS1_ENST00000480665.1_5'Flank|TNS1_ENST00000430930.1_Missense_Mutation_p.R618H	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	618					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGATTGAGAGCGGAACATACC	0.642																																					p.R618H		Atlas-SNP	.											TNS1_ENST00000446903,NS,carcinoma,0,4	TNS1	251	4	0			c.G1853A						scavenged	.						62.0	52.0	55.0					2																	218713012		2203	4300	6503	SO:0001583	missense	7145	exon17			TGAGAGCGGAACA	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1853G>A	2.37:g.218713012C>T	ENSP00000171887:p.Arg618His	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	135	2	0.0148148	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515056	0.64634	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903	D;D;D;D	0.95342	-3.21;-3.18;-3.19;-3.68	4.57	4.57	0.56435	.	0.130152	0.50627	D	0.000107	D	0.96775	0.8947	M	0.69823	2.125	0.80722	D	1	B;B;P;D;D	0.89917	0.449;0.345;0.952;1.0;1.0	B;B;B;D;D	0.78314	0.033;0.09;0.259;0.991;0.976	D	0.96813	0.9598	10	0.51188	T	0.08	.	17.539	0.87842	0.0:1.0:0.0:0.0	.	618;672;618;618;618	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	H	618;618;618;743	ENSP00000171887:R618H;ENSP00000408724:R618H;ENSP00000406016:R618H;ENSP00000405460:R743H	ENSP00000171887:R618H	R	-	2	0	TNS1	218421257	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	3.023000	0.49666	2.370000	0.80446	0.561000	0.74099	CGC	.	.	alt		0.642	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
YTHDF1	54915	hgsc.bcm.edu	37	20	61835026	61835026	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:61835026T>C	ENST00000370339.3	-	4	607	c.266A>G	c.(265-267)tAc>tGc	p.Y89C	YTHDF1_ENST00000370333.4_Missense_Mutation_p.Y39C|YTHDF1_ENST00000370334.4_Intron	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	89							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						GAGCTGTCCGTAGGTGGTGAG	0.527																																					p.Y89C		Atlas-SNP	.											YTHDF1,NS,carcinoma,+1,1	YTHDF1	66	1	0			c.A266G						scavenged	.						109.0	112.0	111.0					20																	61835026		2203	4300	6503	SO:0001583	missense	54915	exon4			TGTCCGTAGGTGG	AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.266A>G	20.37:g.61835026T>C	ENSP00000359364:p.Tyr89Cys	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	120	3	0.025	NM_017798	Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Missense_Mutation	SNP	ENST00000370339.3	37	CCDS13511.1	.	.	.	.	.	.	.	.	.	.	T	19.18	3.777694	0.70107	.	.	ENSG00000149658	ENST00000370339;ENST00000370333	T;T	0.54279	0.58;0.58	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.72045	0.3412	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.76072	-0.3093	10	0.72032	D	0.01	-19.8411	15.1531	0.72717	0.0:0.0:0.0:1.0	.	89	Q9BYJ9	YTHD1_HUMAN	C	89;39	ENSP00000359364:Y89C;ENSP00000359358:Y39C	ENSP00000359358:Y39C	Y	-	2	0	YTHDF1	61305471	1.000000	0.71417	0.931000	0.37212	0.925000	0.55904	7.927000	0.87577	1.983000	0.57843	0.459000	0.35465	TAC	.	.	none		0.527	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080110.2	NM_017798	
PSG8	440533	hgsc.bcm.edu	37	19	43258570	43258570	+	Silent	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:43258570T>C	ENST00000306511.4	-	5	1255	c.1158A>G	c.(1156-1158)acA>acG	p.T386T	PSG8_ENST00000401467.2_Silent_p.T293T|PSG8_ENST00000406636.3_Silent_p.T264T|PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000404209.4_Silent_p.T386T	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	386	Ig-like C2-type 3.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				CGCTATGCTTTGTAGTAATTT	0.473																																					p.T386T		Atlas-SNP	.											PSG8,right_lower_lobe,carcinoma,-1,1	PSG8	101	1	0			c.A1158G						scavenged	.						204.0	219.0	214.0					19																	43258570		2203	4299	6502	SO:0001819	synonymous_variant	440533	exon5			ATGCTTTGTAGTA	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.1158A>G	19.37:g.43258570T>C		Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	153	2	0.0130719	NM_001130167	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Silent	SNP	ENST00000306511.4	37	CCDS33037.1																																																																																			.	.	none		0.473	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		
MYC	4609	hgsc.bcm.edu	37	8	128751021	128751021	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128751021C>T	ENST00000259523.6	+	2	1718	c.513C>T	c.(511-513)tgC>tgT	p.C171C	MYC_ENST00000524013.1_Silent_p.C185C|MYC_ENST00000377970.2_Silent_p.C186C			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	171				C -> S (in Ref. 5; no nucleotide entry). {ECO:0000305}.	branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACAGCGTCTGCTCCACCTCCA	0.677		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C186C		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.C558T						PASS	.						21.0	23.0	22.0					8																	128751021		2203	4298	6501	SO:0001819	synonymous_variant	4609	exon2			CGTCTGCTCCACC		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.513C>T	8.37:g.128751021C>T		Somatic	65	0	0	1567	WXS	Illumina HiSeq	Phase_I	59	16	0.271186	NM_002467	A8WFE7|P01107|Q14026	Silent	SNP	ENST00000259523.6	37																																																																																				.	.	none		0.677	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
OR1D5	8386	hgsc.bcm.edu	37	17	2966828	2966828	+	Missense_Mutation	SNP	C	C	T	rs531952330	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:2966828C>T	ENST00000575751.1	-	1	73	c.74G>A	c.(73-75)cGg>cAg	p.R25Q		NM_014566.1	NP_055381.1	P58170	OR1D5_HUMAN	olfactory receptor, family 1, subfamily D, member 5	25					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|lung(10)	11						AAACAGGATCCGCTGCTGCTC	0.522													.|||	141	0.028155	0.0151	0.036	5008	,	,		11161	0.0506		0.0358	False		,,,				2504	0.0092				p.R25Q		Atlas-SNP	.											OR1D5_ENST00000575751,NS,carcinoma,0,2	OR1D5	33	2	0			c.G74A						scavenged	.																																			SO:0001583	missense	8386	exon1			AGGATCCGCTGCT	AF087923	CCDS58499.1	17p13.3	2012-10-09			ENSG00000262628	ENSG00000262628		"""GPCR / Class A : Olfactory receptors"""	8186	protein-coding gene	gene with protein product						10673334	Standard	NM_014566		Approved	OR17-31	uc021tns.1	P58170	OTTHUMG00000177676	ENST00000575751.1:c.74G>A	17.37:g.2966828C>T	ENSP00000459028:p.Arg25Gln	Somatic	124	1	0.00806452		WXS	Illumina HiSeq	Phase_I	199	6	0.0301508	NM_014566	Q96RA6	Missense_Mutation	SNP	ENST00000575751.1	37	CCDS58499.1																																																																																			C|0.250;T|0.750	0.750	strong		0.522	OR1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438410.2	NM_014566	
RHPN2	85415	hgsc.bcm.edu	37	19	33517507	33517507	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:33517507C>T	ENST00000254260.3	-	3	252	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	RHPN2_ENST00000400226.4_De_novo_Start_OutOfFrame	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	73					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.V73M(2)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TCCAGCCGCACTTGCTCCCGC	0.552																																					p.V73M		Atlas-SNP	.											RHPN2,face,carcinoma,0,2	RHPN2	107	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.G217A						scavenged	.						84.0	83.0	83.0					19																	33517507		2203	4300	6503	SO:0001583	missense	85415	exon3			GCCGCACTTGCTC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.217G>A	19.37:g.33517507C>T	ENSP00000254260:p.Val73Met	Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	38	4	0.105263	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542997	0.65198	.	.	ENSG00000131941	ENST00000254260	T	0.39787	1.06	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71984	-0.4427	10	0.87932	D	0	11.9954	16.025	0.80536	0.0:1.0:0.0:0.0	.	73	Q8IUC4	RHPN2_HUMAN	M	73	ENSP00000254260:V73M	ENSP00000254260:V73M	V	-	1	0	RHPN2	38209347	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.267000	0.78462	2.167000	0.68274	0.557000	0.71058	GTG	.	.	none		0.552	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
PRR21	643905	hgsc.bcm.edu	37	2	240982247	240982247	+	Silent	SNP	A	A	G	rs75044548	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:240982247A>G	ENST00000408934.1	-	1	152	c.153T>C	c.(151-153)caT>caC	p.H51H		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	51	Pro-rich.							p.H51H(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						AGAGCCGTGGATGAAGGGCCA	0.577																																					p.H51H		Atlas-SNP	.											PRR21,NS,carcinoma,0,2	PRR21	53	2	2	Substitution - coding silent(2)	ovary(2)	c.T153C						scavenged	.						118.0	104.0	109.0					2																	240982247		2203	4299	6502	SO:0001819	synonymous_variant	643905	exon1			CCGTGGATGAAGG	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.153T>C	2.37:g.240982247A>G		Somatic	90	4	0.0444444		WXS	Illumina HiSeq	Phase_I	68	10	0.147059	NM_001080835		Silent	SNP	ENST00000408934.1	37	CCDS33417.1																																																																																			A|0.813;G|0.187	0.187	strong		0.577	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
FCRL3	115352	hgsc.bcm.edu	37	1	157668297	157668297	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:157668297A>G	ENST00000368184.3	-	4	466	c.175T>C	c.(175-177)Tat>Cat	p.Y59H	FCRL3_ENST00000368186.5_Missense_Mutation_p.Y59H|FCRL3_ENST00000473231.1_5'Flank|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	59	Ig-like C2-type 1.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					TCATCGTGATACCAATATGTG	0.448																																					p.Y59H		Atlas-SNP	.											FCRL3,NS,carcinoma,+2,1	FCRL3	163	1	0			c.T175C						scavenged	.						197.0	173.0	181.0					1																	157668297		2203	4300	6503	SO:0001583	missense	115352	exon4			CGTGATACCAATA	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.175T>C	1.37:g.157668297A>G	ENSP00000357167:p.Tyr59His	Somatic	316	1	0.00316456		WXS	Illumina HiSeq	Phase_I	340	6	0.0176471	NM_052939	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	ENST00000368184.3	37	CCDS1167.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.885486	0.33255	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.14766	2.48;2.48	5.46	5.46	0.80206	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.465641	0.15981	N	0.235294	T	0.30479	0.0766	M	0.84511	2.7	0.29037	N	0.885311	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.24621	-1.0155	10	0.62326	D	0.03	.	13.4854	0.61361	1.0:0.0:0.0:0.0	.	59;59	Q96P31;Q96P31-6	FCRL3_HUMAN;.	H	59	ENSP00000357169:Y59H;ENSP00000357167:Y59H	ENSP00000292392:Y59H	Y	-	1	0	FCRL3	155934921	0.983000	0.35010	0.960000	0.40013	0.020000	0.10135	2.740000	0.47418	2.064000	0.61679	0.482000	0.46254	TAT	.	.	none		0.448	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939	
RPL10L	140801	hgsc.bcm.edu	37	14	47120929	47120929	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr14:47120929C>T	ENST00000298283.3	-	1	99	c.11G>A	c.(10-12)cGt>cAt	p.R4H		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	4					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						GCGAGCTGGACGGCGCCCCAT	0.557																																					p.R4H		Atlas-SNP	.											RPL10L,NS,carcinoma,-1,2	RPL10L	64	2	0			c.G11A						scavenged	.						67.0	71.0	70.0					14																	47120929		2203	4300	6503	SO:0001583	missense	140801	exon1			GCTGGACGGCGCC	AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.11G>A	14.37:g.47120929C>T	ENSP00000298283:p.Arg4His	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	96	3	0.03125	NM_080746	Q8IUD1	Missense_Mutation	SNP	ENST00000298283.3	37	CCDS32071.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768815	0.31320	.	.	ENSG00000165496	ENST00000298283	T	0.77877	-1.13	4.32	4.32	0.51571	Ribosomal protein L10e/L16 (1);	0.060938	0.64402	D	0.000004	T	0.81749	0.4888	M	0.92691	3.335	0.58432	D	0.999999	B	0.12630	0.006	B	0.08055	0.003	T	0.82348	-0.0502	10	0.66056	D	0.02	-25.8262	12.6152	0.56573	0.0:1.0:0.0:0.0	.	4	Q96L21	RL10L_HUMAN	H	4	ENSP00000298283:R4H	ENSP00000298283:R4H	R	-	2	0	RPL10L	46190679	0.990000	0.36364	0.972000	0.41901	0.223000	0.24884	3.208000	0.51114	2.688000	0.91661	0.655000	0.94253	CGT	.	.	none		0.557	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349819.1		
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240790	39240790	+	Missense_Mutation	SNP	G	G	A	rs11650261|rs553572799	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:39240790G>A	ENST00000391417.4	+	1	332	c.332G>A	c.(331-333)cGc>cAc	p.R111H		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	136	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						acctgctgccgccccagctgc	0.657													g|||	343	0.0684904	0.0272	0.1196	5008	,	,		10689	0.0685		0.1153	False		,,,				2504	0.0399				p.R111H		Atlas-SNP	.											KRTAP4-9_ENST00000377734,NS,carcinoma,0,3	KRTAP4-7	49	3	2	Unknown(1)|Deletion - In frame(1)	NS(2)	c.G332A						scavenged	.						11.0	13.0	12.0					17																	39240790		682	1579	2261	SO:0001583	missense	100132476	exon1			GCTGCCGCCCCAG	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.332G>A	17.37:g.39240790G>A	ENSP00000375236:p.Arg111His	Somatic	29	1	0.0344828		WXS	Illumina HiSeq	Phase_I	51	10	0.196078	NM_033061	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	148	0.06776556776556776	22	0.044715447154471545	32	0.08839779005524862	22	0.038461538461538464	72	0.09498680738786279	.	6.498	0.460116	0.12342	.	.	ENSG00000240871	ENST00000391417	T	0.00612	6.22	3.95	-0.91	0.10511	.	8.977930	0.00616	U	0.000420	T	0.00039	0.0001	.	.	.	0.09310	N	1	D	0.60575	0.988	P	0.46389	0.515	T	0.44050	-0.9353	9	0.48119	T	0.1	.	3.4362	0.07446	0.2202:0.0:0.299:0.4808	rs11650261	166	Q9BYR0	KRA47_HUMAN	H	111	ENSP00000375236:R111H	ENSP00000375236:R111H	R	+	2	0	KRTAP4-7	36494316	0.000000	0.05858	0.005000	0.12908	0.119000	0.20118	0.218000	0.17622	0.230000	0.21059	-0.391000	0.06502	CGC	G|0.932;A|0.068	0.068	strong		0.657	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
GABRA2	2555	hgsc.bcm.edu	37	4	46305606	46305606	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:46305606G>A	ENST00000510861.1	-	8	900	c.727C>T	c.(727-729)Cat>Tat	p.H243Y	GABRA2_ENST00000540012.1_Missense_Mutation_p.H188Y|GABRA2_ENST00000515082.1_Missense_Mutation_p.H243Y|GABRA2_ENST00000381620.4_Missense_Mutation_p.H243Y|GABRA2_ENST00000356504.1_Missense_Mutation_p.H243Y|GABRA2_ENST00000514090.1_Missense_Mutation_p.H243Y|GABRA2_ENST00000507069.1_Missense_Mutation_p.H243Y			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	243					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	AGGTGGAAATGAGCTGTCATT	0.363																																					p.H243Y		Atlas-SNP	.											GABRA2,NS,malignant_melanoma,0,1	GABRA2	134	1	0			c.C727T						scavenged	.						92.0	94.0	93.0					4																	46305606		2203	4300	6503	SO:0001583	missense	2555	exon8			GGAAATGAGCTGT		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.727C>T	4.37:g.46305606G>A	ENSP00000421828:p.His243Tyr	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	183	3	0.0163934	NM_000807	A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	ENST00000510861.1	37	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	G	8.715	0.913002	0.17907	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082	T;T;T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15	5.41	5.41	0.78517	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.64170	0.2574	N	0.16478	0.41	0.58432	D	0.999993	B;B;B	0.23937	0.094;0.009;0.002	B;B;B	0.28011	0.085;0.024;0.007	T	0.60120	-0.7325	10	0.06099	T	0.92	.	18.5536	0.91075	0.0:0.0:1.0:0.0	.	188;243;243	B7Z1H8;G5E9Z6;P47869	.;.;GBRA2_HUMAN	Y	243;243;243;243;188;243;243	ENSP00000421828:H243Y;ENSP00000421300:H243Y;ENSP00000371033:H243Y;ENSP00000348897:H243Y;ENSP00000444409:H188Y;ENSP00000427603:H243Y;ENSP00000423840:H243Y	ENSP00000348897:H243Y	H	-	1	0	GABRA2	46000363	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.918000	0.63376	2.689000	0.91719	0.655000	0.94253	CAT	.	.	none		0.363	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2		
MACROD2	140733	hgsc.bcm.edu	37	20	16021849	16021849	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:16021849C>T	ENST00000310348.4	+	16	1157	c.1157C>T	c.(1156-1158)cCa>cTa	p.P386L	MACROD2_ENST00000378058.3_Missense_Mutation_p.P151L|MACROD2_ENST00000217246.4_Missense_Mutation_p.P386L|MACROD2_ENST00000407045.3_Missense_Mutation_p.P37L|MACROD2_ENST00000402914.1_Missense_Mutation_p.P151L			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	386	Glu-rich.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CTTCCAGCTCCAGGCGAGGAC	0.478																																					p.P386L		Atlas-SNP	.											.	MACROD2	34	.	0			c.C1157T						PASS	.						69.0	68.0	69.0					20																	16021849		2203	4299	6502	SO:0001583	missense	140733	exon16			CAGCTCCAGGCGA	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.1157C>T	20.37:g.16021849C>T	ENSP00000309809:p.Pro386Leu	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	93	4	0.0430108	NM_080676	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.409786	0.00193	.	.	ENSG00000172264	ENST00000217246;ENST00000310348;ENST00000402914;ENST00000378058;ENST00000407045	T;T;T;T	0.43688	2.54;2.55;0.94;0.94	5.37	-1.96	0.07525	.	0.458260	0.18726	N	0.132894	T	0.13670	0.0331	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.20338	-1.0278	10	0.30854	T	0.27	-3.5581	6.857	0.24046	0.3256:0.4397:0.0:0.2348	.	37;386;386	A1Z1Q3-6;A1Z1Q3;A1Z1Q3-2	.;MACD2_HUMAN;.	L	386;386;151;151;37	ENSP00000217246:P386L;ENSP00000309809:P386L;ENSP00000385290:P151L;ENSP00000367297:P151L	ENSP00000217246:P386L	P	+	2	0	MACROD2	15969849	0.197000	0.23362	0.044000	0.18714	0.188000	0.23474	-0.121000	0.10643	-0.211000	0.10124	-1.268000	0.01426	CCA	.	.	none		0.478	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	
KRTAP5-8	57830	hgsc.bcm.edu	37	11	71249545	71249545	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:71249545C>T	ENST00000398534.3	+	1	475	c.444C>T	c.(442-444)tgC>tgT	p.C148C		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	148	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						AGTCCAGCTGCTGTAAGCCCT	0.607																																					p.C148C		Atlas-SNP	.											KRTAP5-8,NS,carcinoma,0,1	KRTAP5-8	28	1	0			c.C444T						scavenged	.						173.0	178.0	177.0					11																	71249545		2200	4294	6494	SO:0001819	synonymous_variant	57830	exon1			CAGCTGCTGTAAG	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.444C>T	11.37:g.71249545C>T		Somatic	120	1	0.00833333		WXS	Illumina HiSeq	Phase_I	133	4	0.0300752	NM_021046	Q6L8G7|Q6UTX6	Silent	SNP	ENST00000398534.3	37	CCDS41683.1																																																																																			.	.	none		0.607	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046	
NEB	4703	hgsc.bcm.edu	37	2	152432215	152432215	+	Silent	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:152432215C>A	ENST00000172853.10	-	79	12051	c.11904G>T	c.(11902-11904)gtG>gtT	p.V3968V	NEB_ENST00000604864.1_Silent_p.V5669V|NEB_ENST00000427231.2_Silent_p.V5669V|NEB_ENST00000397345.3_Silent_p.V5669V|NEB_ENST00000603639.1_Silent_p.V5669V|NEB_ENST00000409198.1_Silent_p.V3968V			P20929	NEBU_HUMAN	nebulin	3968					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTACATTGCTCACATTAAGAG	0.423																																					p.V5669V		Atlas-SNP	.											.	NEB	1697	.	0			c.G17007T						PASS	.						234.0	233.0	233.0					2																	152432215		1861	4099	5960	SO:0001819	synonymous_variant	4703	exon107			ATTGCTCACATTA	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11904G>T	2.37:g.152432215C>A		Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	159	52	0.327044	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				.	.	none		0.423	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
MUC6	4588	hgsc.bcm.edu	37	11	1017974	1017974	+	Missense_Mutation	SNP	C	C	G	rs200353019		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:1017974C>G	ENST00000421673.2	-	31	4877	c.4827G>C	c.(4825-4827)caG>caC	p.Q1609H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1609	Approximate repeats.|Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.Q1609H(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GAAGTGTGGTCTGAGGGTGTG	0.547																																					p.Q1609H		Atlas-SNP	.											MUC6_ENST00000421673,colon,carcinoma,0,2	MUC6	408	2	2	Substitution - Missense(2)	large_intestine(2)	c.G4827C						scavenged	.						473.0	441.0	452.0					11																	1017974		2186	4282	6468	SO:0001583	missense	4588	exon31			TGTGGTCTGAGGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4827G>C	11.37:g.1017974C>G	ENSP00000406861:p.Gln1609His	Somatic	506	9	0.0177866		WXS	Illumina HiSeq	Phase_I	544	11	0.0202206	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	5.277	0.236564	0.10023	.	.	ENSG00000184956	ENST00000421673	T	0.35421	1.31	2.39	0.333	0.15943	.	.	.	.	.	T	0.26702	0.0653	L	0.52011	1.625	0.09310	N	1	B	0.25486	0.127	B	0.27715	0.082	T	0.28681	-1.0036	9	0.22109	T	0.4	.	3.4702	0.07565	0.0:0.5042:0.2173:0.2785	.	1609	Q6W4X9	MUC6_HUMAN	H	1609	ENSP00000406861:Q1609H	ENSP00000406861:Q1609H	Q	-	3	2	MUC6	1007974	0.000000	0.05858	0.003000	0.11579	0.027000	0.11550	-2.394000	0.01054	-0.057000	0.13199	-0.710000	0.03640	CAG	.	.	weak		0.547	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
TAF10	6881	hgsc.bcm.edu	37	11	6636488	6636488	+	5'Flank	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:6636488G>A	ENST00000299424.4	-	0	0				TPP1_ENST00000299427.6_Missense_Mutation_p.R447C|TAF10_ENST00000531760.1_5'Flank|TPP1_ENST00000534644.1_5'Flank|TPP1_ENST00000533371.1_Missense_Mutation_p.R204C	NM_006284.3	NP_006275.1	Q12962	TAF10_HUMAN	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa						chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|perinuclear region of cytoplasm (GO:0048471)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|RNA polymerase binding (GO:0070063)|transcription coactivator activity (GO:0003713)						Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.0481)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GGGTAGGCACGGCCACTGGCA	0.547																																					p.R447C		Atlas-SNP	.											TPP1,colon,carcinoma,+1,1	TPP1	71	1	0			c.C1339T						scavenged	.						123.0	123.0	123.0					11																	6636488		2201	4296	6497	SO:0001631	upstream_gene_variant	1200	exon11			AGGCACGGCCACT	U13991, U25816	CCDS7769.1	11p15.5-p15.2	2006-11-14	2002-08-29	2001-12-07	ENSG00000166337	ENSG00000166337			11543	protein-coding gene	gene with protein product		600475	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, H, 30kD"""	TAF2H, TAF2A		7923369	Standard	NM_006284		Approved	TAFII30	uc001mej.2	Q12962	OTTHUMG00000133402		11.37:g.6636488G>A	Exception_encountered	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	202	2	0.00990099	NM_000391	O00703|Q13175|Q6FH13	Missense_Mutation	SNP	ENST00000299424.4	37	CCDS7769.1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923884	0.73213	.	.	ENSG00000166340	ENST00000299427;ENST00000533371;ENST00000453338	D;D	0.96830	-4.14;-4.14	5.05	5.05	0.67936	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.98560	0.9519	M	0.94063	3.49	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99727	1.1011	10	0.87932	D	0	-23.0815	15.9083	0.79447	0.0:0.0:1.0:0.0	.	447	O14773	TPP1_HUMAN	C	447;204;230	ENSP00000299427:R447C;ENSP00000437066:R204C	ENSP00000299427:R447C	R	-	1	0	TPP1	6593064	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.503000	0.60407	2.352000	0.79861	0.561000	0.74099	CGT	.	.	none		0.547	TAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257259.2	NM_006284	
MN1	4330	hgsc.bcm.edu	37	22	28194930	28194930	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:28194930C>T	ENST00000302326.4	-	1	2556	c.1602G>A	c.(1600-1602)caG>caA	p.Q534Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	534	Poly-Gln.				intramembranous ossification (GO:0001957)			p.Q550_R551insQ(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgctgttgctgct	0.647			T	ETV6	"""AML, meningioma"""																																p.Q534Q		Atlas-SNP	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	MN1,colon,carcinoma,0,4	MN1	122	4	1	Insertion - In frame(1)	prostate(1)	c.G1602A						scavenged	.						4.0	5.0	5.0					22																	28194930		1760	3656	5416	SO:0001819	synonymous_variant	4330	exon1			CTGCTGCTGTTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1602G>A	22.37:g.28194930C>T		Somatic	41	1	0.0243902		WXS	Illumina HiSeq	Phase_I	36	3	0.0833333	NM_002430	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																			C|0.958;T|0.042	0.042	strong		0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
RFPL3	10738	hgsc.bcm.edu	37	22	32754250	32754250	+	Silent	SNP	C	C	T	rs376474772	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:32754250C>T	ENST00000249007.4	+	1	397	c.192C>T	c.(190-192)atC>atT	p.I64I	RFPL3S_ENST00000461833.1_5'Flank|RFPL3_ENST00000382088.3_Silent_p.I35I|RFPL3_ENST00000397468.1_Silent_p.I35I	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	64							zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						TCAAGTGCATCAATTCGCTGC	0.532													c|||	6	0.00119808	0.0038	0.0014	5008	,	,		19944	0.0		0.0	False		,,,				2504	0.0				p.I64I		Atlas-SNP	.											RFPL3_ENST00000249007,NS,carcinoma,+2,2	RFPL3	91	2	0			c.C192T						scavenged	.						122.0	115.0	117.0					22																	32754250		2203	4300	6503	SO:0001819	synonymous_variant	10738	exon1			GTGCATCAATTCG	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.192C>T	22.37:g.32754250C>T		Somatic	251	4	0.0159363		WXS	Illumina HiSeq	Phase_I	331	9	0.0271903	NM_001098535	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Silent	SNP	ENST00000249007.4	37	CCDS43011.1																																																																																			.	.	weak		0.532	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
FAM120B	84498	hgsc.bcm.edu	37	6	170627767	170627767	+	Missense_Mutation	SNP	A	A	G	rs6900202	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:170627767A>G	ENST00000476287.1	+	2	1397	c.1289A>G	c.(1288-1290)gAc>gGc	p.D430G	FAM120B_ENST00000252510.9_Intron|FAM120B_ENST00000537664.1_Missense_Mutation_p.D453G|FAM120B_ENST00000540480.1_Missense_Mutation_p.D442G	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	430			D -> G (in dbSNP:rs6900202).		cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		ATGTATACAGACTCTGAACCC	0.512													G|||	41	0.0081869	0.0045	0.0101	5008	,	,		20771	0.0109		0.004	False		,,,				2504	0.0133				p.D430G		Atlas-SNP	.											FAM120B,NS,carcinoma,0,1	FAM120B	108	1	0			c.A1289G						scavenged	.						184.0	201.0	195.0					6																	170627767		2203	4299	6502	SO:0001583	missense	84498	exon2			ATACAGACTCTGA	AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.1289A>G	6.37:g.170627767A>G	ENSP00000417970:p.Asp430Gly	Somatic	88	6	0.0681818		WXS	Illumina HiSeq	Phase_I	113	10	0.0884956	NM_032448	B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	ENST00000476287.1	37	CCDS5314.1	.	.	.	.	.	.	.	.	.	.	G	2.701	-0.271073	0.05716	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287	T;T;T	0.08370	3.1;3.12;3.13	3.07	-3.74	0.04385	.	1.370640	0.04162	N	0.323276	T	0.01870	0.0059	L	0.55481	1.735	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44467	-0.9326	10	0.20046	T	0.44	0.676	1.4566	0.02387	0.3827:0.1471:0.3256:0.1447	rs6900202	430;430	Q96EK7;F2Z2E1	F120B_HUMAN;.	G	442;453;430	ENSP00000444125:D442G;ENSP00000440125:D453G;ENSP00000417970:D430G	ENSP00000436640:D430G	D	+	2	0	FAM120B	170469692	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.355000	0.07671	-0.870000	0.04047	-2.164000	0.00325	GAC	A|1.000;|0.000	.	weak		0.512	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
SRSF7	6432	hgsc.bcm.edu	37	2	38976739	38976739	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:38976739G>C	ENST00000313117.6	-	3	555	c.318C>G	c.(316-318)tgC>tgG	p.C106W	SRSF7_ENST00000446327.2_Missense_Mutation_p.C106W|GEMIN6_ENST00000409011.1_5'Flank|SRSF7_ENST00000409276.1_Missense_Mutation_p.C106W	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	106					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CACACTCATAGCATCTATCAT	0.458																																					p.C106W		Atlas-SNP	.											.	SRSF7	29	.	0			c.C318G						PASS	.						147.0	139.0	141.0					2																	38976739		2203	4300	6503	SO:0001583	missense	6432	exon3			CTCATAGCATCTA	L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.318C>G	2.37:g.38976739G>C	ENSP00000325905:p.Cys106Trp	Somatic	295	0	0		WXS	Illumina HiSeq	Phase_I	280	91	0.325	NM_001195446	B4DLU6|G5E9M3|Q564D3	Missense_Mutation	SNP	ENST00000313117.6	37	CCDS33183.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.741058	0.49151	.	.	ENSG00000115875	ENST00000313117;ENST00000446327;ENST00000409276	D;D;D	0.98028	-4.67;-4.67;-4.67	5.93	1.43	0.22495	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (2);	0.000000	0.85682	D	0.000000	D	0.98582	0.9526	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98776	1.0730	10	0.87932	D	0	.	11.8039	0.52143	0.3644:0.0:0.6356:0.0	.	106;106	G5E9M3;Q16629	.;SRSF7_HUMAN	W	106	ENSP00000325905:C106W;ENSP00000402264:C106W;ENSP00000386806:C106W	ENSP00000325905:C106W	C	-	3	2	SRSF7	38830243	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.830000	0.27462	0.355000	0.24131	0.655000	0.94253	TGC	.	.	none		0.458	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2	NM_001031684	
ZMYND8	23613	hgsc.bcm.edu	37	20	45853094	45853094	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:45853094C>T	ENST00000311275.7	-	19	3325	c.3072G>A	c.(3070-3072)aaG>aaA	p.K1024K	ZMYND8_ENST00000461685.1_Silent_p.K998K|ZMYND8_ENST00000536340.1_Silent_p.K1051K|ZMYND8_ENST00000355972.4_Silent_p.K1024K|ZMYND8_ENST00000458360.2_Silent_p.K892K|ZMYND8_ENST00000446994.2_Silent_p.K915K|ZMYND8_ENST00000540497.1_Silent_p.K972K|ZMYND8_ENST00000352431.2_Silent_p.K998K|ZMYND8_ENST00000396281.4_Silent_p.K1024K|ZMYND8_ENST00000372023.3_Silent_p.K946K|ZMYND8_ENST00000262975.4_Silent_p.K978K|ZMYND8_ENST00000471951.2_Silent_p.K1044K|ZMYND8_ENST00000360911.3_Silent_p.K973K	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	1024					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			ACCACTGCTTCTTCTTGGTCT	0.592																																					p.K998K		Atlas-SNP	.											ZMYND8,NS,carcinoma,-2,1	ZMYND8	166	1	0			c.G2994A						scavenged	.						241.0	194.0	210.0					20																	45853094		2203	4300	6503	SO:0001819	synonymous_variant	23613	exon19			CTGCTTCTTCTTG	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.3072G>A	20.37:g.45853094C>T		Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	149	2	0.0134228	NM_183047	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Silent	SNP	ENST00000311275.7	37		.	.	.	.	.	.	.	.	.	.	C	9.153	1.016789	0.19355	.	.	ENSG00000101040	ENST00000467200	.	.	.	5.45	4.52	0.55395	.	.	.	.	.	T	0.69806	0.3152	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68934	-0.5278	4	.	.	.	-14.8364	14.1844	0.65595	0.0:0.9283:0.0:0.0717	.	.	.	.	K	906	.	.	E	-	1	0	ZMYND8	45286501	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.018000	0.70811	1.300000	0.44818	-0.136000	0.14681	GAA	.	.	none		0.592	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047	
KRTAP26-1	388818	hgsc.bcm.edu	37	21	31692282	31692282	+	Silent	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr21:31692282G>T	ENST00000360542.3	-	1	325	c.72C>A	c.(70-72)ctC>ctA	p.L24L		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	24						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						CGATGGAGGTGAGAGGAATAT	0.537																																					p.L24L		Atlas-SNP	.											KRTAP26-1,NS,carcinoma,0,1	KRTAP26-1	58	1	0			c.C72A						PASS	.						61.0	64.0	63.0					21																	31692282		2203	4300	6503	SO:0001819	synonymous_variant	388818	exon1			GGAGGTGAGAGGA	AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.72C>A	21.37:g.31692282G>T		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	157	57	0.363057	NM_203405	B0RZD3	Silent	SNP	ENST00000360542.3	37	CCDS13588.1																																																																																			.	.	none		0.537	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128218.1	NM_203405	
REG3A	5068	hgsc.bcm.edu	37	2	79385499	79385499	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:79385499C>T	ENST00000409839.3	-	4	322	c.286G>A	c.(286-288)Ggt>Agt	p.G96S	REG3A_ENST00000305165.2_Missense_Mutation_p.G96S|AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000393878.1_Missense_Mutation_p.G96S	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	96	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						TAGCTGTTACCAATGCTCTTC	0.567																																					p.G96S		Atlas-SNP	.											REG3A,NS,carcinoma,+1,1	REG3A	76	1	0			c.G286A						scavenged	.						140.0	113.0	122.0					2																	79385499		2203	4300	6503	SO:0001583	missense	5068	exon3			TGTTACCAATGCT	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.286G>A	2.37:g.79385499C>T	ENSP00000386630:p.Gly96Ser	Somatic	217	3	0.0138249		WXS	Illumina HiSeq	Phase_I	263	10	0.0380228	NM_138938		Missense_Mutation	SNP	ENST00000409839.3	37	CCDS1965.1	.	.	.	.	.	.	.	.	.	.	c	1.622	-0.521320	0.04171	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.15139	2.45;2.45;2.45	4.02	-7.53	0.01336	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	11.951000	0.00166	N	0.000007	T	0.08935	0.0221	N	0.25245	0.725	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.31081	-0.9956	10	0.07325	T	0.83	.	7.5006	0.27516	0.2706:0.5668:0.0:0.1626	.	96	Q06141	REG3A_HUMAN	S	96	ENSP00000386630:G96S;ENSP00000377456:G96S;ENSP00000304311:G96S	ENSP00000304311:G96S	G	-	1	0	REG3A	79239007	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.261000	0.02855	-1.541000	0.01727	-2.019000	0.00433	GGT	.	.	none		0.567	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580	
DYNC1I2	1781	hgsc.bcm.edu	37	2	172585298	172585298	+	Silent	SNP	T	T	C	rs62184168		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:172585298T>C	ENST00000397119.3	+	14	1496	c.1329T>C	c.(1327-1329)gaT>gaC	p.D443D	DYNC1I2_ENST00000358002.6_Silent_p.D435D|DYNC1I2_ENST00000409317.1_Silent_p.D437D|DYNC1I2_ENST00000340296.4_Silent_p.D417D|DYNC1I2_ENST00000534253.2_Silent_p.D443D|DYNC1I2_ENST00000410079.3_Silent_p.D435D|DYNC1I2_ENST00000409773.1_Silent_p.D443D|DYNC1I2_ENST00000409453.1_Silent_p.D443D|DYNC1I2_ENST00000263811.4_Silent_p.D437D|DYNC1I2_ENST00000409197.1_Silent_p.D417D|DYNC1I2_ENST00000508530.1_Silent_p.D417D	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	443					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			CTGTTGGAGATGTCAACAACT	0.398																																					p.D443D		Atlas-SNP	.											DYNC1I2,NS,carcinoma,0,1	DYNC1I2	43	1	0			c.T1329C						scavenged	.						67.0	65.0	65.0					2																	172585298		1866	4092	5958	SO:0001819	synonymous_variant	1781	exon14			TGGAGATGTCAAC	AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.1329T>C	2.37:g.172585298T>C		Somatic	344	6	0.0174419		WXS	Illumina HiSeq	Phase_I	427	14	0.0327869	NM_001378	B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Silent	SNP	ENST00000397119.3	37	CCDS46450.1																																																																																			T|0.333;C|0.667	0.667	strong		0.398	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333683.2	NM_001378	
SCN8A	6334	hgsc.bcm.edu	37	12	52200868	52200868	+	Silent	SNP	G	G	T	rs530351787		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:52200868G>T	ENST00000354534.6	+	27	5776	c.5598G>T	c.(5596-5598)cgG>cgT	p.R1866R	AC068987.1_ENST00000599343.1_5'Flank|SCN8A_ENST00000545061.1_Silent_p.R1825R|RP11-923I11.3_ENST00000565518.1_lincRNA	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1866					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	ACATCCTGCGGCAGCAGATGG	0.562																																					p.R1866R		Atlas-SNP	.											SCN8A_ENST00000354534,NS,carcinoma,+2,4	SCN8A	331	4	0			c.G5598T						scavenged	.						100.0	108.0	105.0					12																	52200868		2084	4226	6310	SO:0001819	synonymous_variant	6334	exon27			CCTGCGGCAGCAG	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5598G>T	12.37:g.52200868G>T		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	105	2	0.0190476	NM_014191	B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	ENST00000354534.6	37	CCDS44891.1																																																																																			.	.	none		0.562	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
MUC6	4588	hgsc.bcm.edu	37	11	1017316	1017316	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:1017316G>T	ENST00000421673.2	-	31	5535	c.5485C>A	c.(5485-5487)Cca>Aca	p.P1829T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1829	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGTGTGATGGGGTTGGATAG	0.547																																					p.P1829T		Atlas-SNP	.											MUC6_ENST00000421673,right_upper_lobe,carcinoma,+1,2	MUC6	408	2	0			c.C5485A						scavenged	.																																			SO:0001583	missense	4588	exon31			GTGATGGGGTTGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5485C>A	11.37:g.1017316G>T	ENSP00000406861:p.Pro1829Thr	Somatic	742	23	0.0309973		WXS	Illumina HiSeq	Phase_I	783	29	0.037037	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.335327	0.24253	.	.	ENSG00000184956	ENST00000421673	T	0.24723	1.84	3.21	-0.343	0.12632	.	.	.	.	.	T	0.30355	0.0762	L	0.52126	1.63	0.09310	N	1	D	0.54964	0.969	P	0.61477	0.889	T	0.17531	-1.0366	9	0.02654	T	1	.	7.2552	0.26173	0.0:0.2939:0.4065:0.2996	.	1829	Q6W4X9	MUC6_HUMAN	T	1829	ENSP00000406861:P1829T	ENSP00000406861:P1829T	P	-	1	0	MUC6	1007316	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-0.664000	0.05292	-0.177000	0.10690	0.313000	0.20887	CCA	.	.	none		0.547	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
ITPR1	3708	hgsc.bcm.edu	37	3	4681129	4681129	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:4681129T>C	ENST00000443694.2	+	4	341	c.341T>C	c.(340-342)gTa>gCa	p.V114A	ITPR1_ENST00000456211.2_Missense_Mutation_p.V114A|ITPR1_ENST00000302640.8_Missense_Mutation_p.V114A|ITPR1_ENST00000354582.6_Missense_Mutation_p.V114A|ITPR1_ENST00000357086.4_Missense_Mutation_p.V114A|ITPR1_ENST00000423119.2_Missense_Mutation_p.V114A|ITPR1_ENST00000544951.1_Missense_Mutation_p.V114A			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	114	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CTGGGGACCGTAATCCAGTAT	0.453																																					p.V114A		Atlas-SNP	.											.	ITPR1	659	.	0			c.T341C						PASS	.						82.0	85.0	84.0					3																	4681129		1986	4151	6137	SO:0001583	missense	3708	exon6			GGACCGTAATCCA	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.341T>C	3.37:g.4681129T>C	ENSP00000401671:p.Val114Ala	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	93	25	0.268817	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.610731	0.87258	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000544951;ENST00000443694	D;D;D;D;D;D;D	0.98947	-5.26;-5.26;-5.26;-5.26;-5.26;-5.26;-5.26	5.32	5.32	0.75619	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);MIR motif (2);MIR (1);	0.116894	0.64402	D	0.000020	D	0.98469	0.9490	M	0.81341	2.54	0.40494	D	0.980576	B;P;P;P;P	0.43633	0.353;0.722;0.576;0.512;0.813	B;P;P;P;B	0.50162	0.17;0.633;0.45;0.45;0.432	D	0.99915	1.1220	10	0.22109	T	0.4	.	15.608	0.76689	0.0:0.0:0.0:1.0	.	114;114;114;114;114	B7ZMI3;E7EPX7;Q14643;E7EVP7;G5E9P1	.;.;ITPR1_HUMAN;.;.	A	114	ENSP00000306253:V114A;ENSP00000346595:V114A;ENSP00000405934:V114A;ENSP00000349597:V114A;ENSP00000397885:V114A;ENSP00000440564:V114A;ENSP00000401671:V114A	ENSP00000306253:V114A	V	+	2	0	ITPR1	4656129	1.000000	0.71417	0.050000	0.19076	0.964000	0.63967	7.908000	0.87438	2.141000	0.66446	0.528000	0.53228	GTA	.	.	none		0.453	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
OR11H4	390442	hgsc.bcm.edu	37	14	20711205	20711205	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr14:20711205C>T	ENST00000315409.2	+	1	308	c.255C>T	c.(253-255)tcC>tcT	p.S85S		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S85S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		GGTATGTGTCCTCCACTATTC	0.453																																					p.S85S		Atlas-SNP	.											OR11H4,rectum,carcinoma,0,7	OR11H4	63	7	1	Substitution - coding silent(1)	ovary(1)	c.C255T						scavenged	.						168.0	162.0	164.0					14																	20711205		2203	4300	6503	SO:0001819	synonymous_variant	390442	exon1			TGTGTCCTCCACT		CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.255C>T	14.37:g.20711205C>T		Somatic	309	0	0		WXS	Illumina HiSeq	Phase_I	296	3	0.0101351	NM_001004479	B2RNQ4|Q6IF07	Silent	SNP	ENST00000315409.2	37	CCDS32034.1																																																																																			.	.	none		0.453	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410678.1		
FRMD3	257019	hgsc.bcm.edu	37	9	85863362	85863362	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:85863362C>T	ENST00000304195.3	-	14	1471	c.1265G>A	c.(1264-1266)cGg>cAg	p.R422Q	FRMD3_ENST00000376438.1_Missense_Mutation_p.R422Q|FRMD3_ENST00000328788.1_Missense_Mutation_p.R79Q|FRMD3_ENST00000465485.1_5'UTR|FRMD3_ENST00000376434.1_Missense_Mutation_p.R228Q	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	422						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						TTCATACTCCCGGGCTGCCTT	0.443																																					p.R422Q		Atlas-SNP	.											FRMD3,NS,carcinoma,+1,1	FRMD3	96	1	0			c.G1265A						PASS	.						72.0	72.0	72.0					9																	85863362		1847	4100	5947	SO:0001583	missense	257019	exon14			TACTCCCGGGCTG	AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.1265G>A	9.37:g.85863362C>T	ENSP00000303508:p.Arg422Gln	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	68	25	0.367647	NM_174938	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Missense_Mutation	SNP	ENST00000304195.3	37	CCDS43840.1	.	.	.	.	.	.	.	.	.	.	C	5.988	0.366206	0.11352	.	.	ENSG00000172159	ENST00000376438;ENST00000376434;ENST00000328788;ENST00000304195	D;D;T;D	0.85411	-1.57;-1.98;0.97;-1.59	5.38	-0.87	0.10646	.	1.075110	0.07080	N	0.836929	T	0.73171	0.3553	N	0.21448	0.665	0.09310	N	1	B;B;B	0.20261	0.0;0.0;0.043	B;B;B	0.09377	0.0;0.001;0.004	T	0.52609	-0.8553	10	0.13470	T	0.59	.	10.6066	0.45398	0.0:0.5266:0.0:0.4734	.	422;422;79	A2A2Y4;A2A2Y4-2;A2A2Y4-4	FRMD3_HUMAN;.;.	Q	422;228;79;422	ENSP00000365621:R422Q;ENSP00000365617:R228Q;ENSP00000328615:R79Q;ENSP00000303508:R422Q	ENSP00000303508:R422Q	R	-	2	0	FRMD3	85053182	0.000000	0.05858	0.897000	0.35233	0.991000	0.79684	-0.925000	0.03992	-0.358000	0.08162	-0.131000	0.14894	CGG	.	.	none		0.443	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157355.1	NM_174938	
ADAM29	11086	hgsc.bcm.edu	37	4	175899079	175899079	+	Silent	SNP	C	C	T	rs151310201	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:175899079C>T	ENST00000359240.3	+	5	3073	c.2403C>T	c.(2401-2403)ccC>ccT	p.P801P	ADAM29_ENST00000445694.1_Silent_p.P801P|ADAM29_ENST00000514159.1_Silent_p.P801P|ADAM29_ENST00000404450.4_Silent_p.P801P|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	801	9 X 9 AA approximate repeats.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CTGTGACACCCTCCCAGAGGC	0.567																																					p.P801P	Ovarian(140;1727 1835 21805 25838 41440)	Atlas-SNP	.											ADAM29,NS,carcinoma,0,1	ADAM29	262	1	0			c.C2403T						scavenged	.						138.0	128.0	131.0					4																	175899079		2203	4300	6503	SO:0001819	synonymous_variant	11086	exon4			GACACCCTCCCAG	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2403C>T	4.37:g.175899079C>T		Somatic	82	7	0.0853659		WXS	Illumina HiSeq	Phase_I	97	14	0.14433	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Silent	SNP	ENST00000359240.3	37	CCDS3823.1																																																																																			C|0.986;T|0.013	0.013	strong		0.567	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
HAVCR1	26762	hgsc.bcm.edu	37	5	156479583	156479583	+	Silent	SNP	C	C	G	rs192652646	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:156479583C>G	ENST00000339252.3	-	3	994	c.462G>C	c.(460-462)acG>acC	p.T154T	HAVCR1_ENST00000522693.1_Silent_p.T154T|HAVCR1_ENST00000425854.1_Silent_p.T154T|HAVCR1_ENST00000544197.1_Silent_p.T154T|HAVCR1_ENST00000523175.1_Silent_p.T154T	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	11 X 6 AA approximate tandem repeats of V-P-T-T-T-T].|Thr-rich.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTGGAACAGTCGTTGTCGTTG	0.473																																					p.T154T		Atlas-SNP	.											HAVCR1,colon,carcinoma,-1,2	HAVCR1	84	2	0			c.G462C						scavenged	.						511.0	502.0	505.0					5																	156479583		2137	4231	6368	SO:0001819	synonymous_variant	26762	exon4			AACAGTCGTTGTC	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.462G>C	5.37:g.156479583C>G		Somatic	375	11	0.0293333		WXS	Illumina HiSeq	Phase_I	444	15	0.0337838	NM_001099414	O43656	Silent	SNP	ENST00000339252.3	37	CCDS43392.1																																																																																			C|0.981;G|0.019	0.019	strong		0.473	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
TMEM30A	55754	hgsc.bcm.edu	37	6	75969072	75969072	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:75969072G>A	ENST00000230461.6	-	5	1005	c.676C>T	c.(676-678)Cga>Tga	p.R226*	TMEM30A_ENST00000475111.2_Nonsense_Mutation_p.R190*|TMEM30A_ENST00000370050.5_Nonsense_Mutation_p.R107*	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	226					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R226*(1)		NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCTTTAAATCGTTCTTCCAGG	0.308																																					p.R226X		Atlas-SNP	.											TMEM30A,caecum,carcinoma,0,2	TMEM30A	40	2	1	Substitution - Nonsense(1)	lung(1)	c.C676T						PASS	.						74.0	79.0	77.0					6																	75969072		2203	4298	6501	SO:0001587	stop_gained	55754	exon5			TAAATCGTTCTTC	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.676C>T	6.37:g.75969072G>A	ENSP00000230461:p.Arg226*	Somatic	199	0	0		WXS	Illumina HiSeq	Phase_I	140	51	0.364286	NM_018247	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Nonsense_Mutation	SNP	ENST00000230461.6	37	CCDS4983.1	.	.	.	.	.	.	.	.	.	.	G	39	7.311733	0.98203	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111	.	.	.	5.51	2.43	0.29744	.	0.572479	0.17857	N	0.159668	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	10.4926	0.44760	0.0:0.1178:0.5054:0.3768	.	.	.	.	X	226;210;107;190	.	ENSP00000230461:R226X	R	-	1	2	TMEM30A	76025792	0.004000	0.15560	1.000000	0.80357	0.933000	0.57130	0.839000	0.27586	0.724000	0.32296	0.655000	0.94253	CGA	.	.	none		0.308	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	NM_018247	
INSR	3643	hgsc.bcm.edu	37	19	7117070	7117070	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:7117070G>A	ENST00000302850.5	-	22	4288	c.4146C>T	c.(4144-4146)tcC>tcT	p.S1382S	INSR_ENST00000341500.5_Silent_p.S1370S	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	1382					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GGCACTGTTAGGAAGGATTGG	0.542																																					p.S1382S		Atlas-SNP	.											INSR_ENST00000302850,right_upper_lobe,carcinoma,0,4	INSR	265	4	0			c.C4146T						scavenged	.						107.0	95.0	99.0					19																	7117070		2203	4300	6503	SO:0001819	synonymous_variant	3643	exon22			CTGTTAGGAAGGA	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.4146C>T	19.37:g.7117070G>A		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	57	2	0.0350877	NM_000208	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	ENST00000302850.5	37	CCDS12176.1																																																																																			.	.	none		0.542	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
CASP8	841	hgsc.bcm.edu	37	2	202141586	202141586	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:202141586C>T	ENST00000432109.2	+	8	886	c.697C>T	c.(697-699)Cgg>Tgg	p.R233W	CASP8_ENST00000358485.4_Missense_Mutation_p.R292W|CASP8_ENST00000264274.9_Intron|CASP8_ENST00000392259.2_Missense_Mutation_p.S211L|CASP8_ENST00000392266.3_Missense_Mutation_p.S196L|CASP8_ENST00000392258.3_Missense_Mutation_p.S211L|CASP8_ENST00000264275.5_Missense_Mutation_p.R250W|CASP8_ENST00000323492.7_Missense_Mutation_p.R218W	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	233					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						AAGCAAACCTCGGGGATACTG	0.428										HNSCC(4;0.00038)																											p.R292W	Melanoma(82;831 1348 20716 36952 40159)	Atlas-SNP	.											CASP8_ENST00000358485,NS,carcinoma,0,6	CASP8	272	6	0			c.C874T						PASS	.						79.0	76.0	77.0					2																	202141586		2203	4300	6503	SO:0001583	missense	841	exon7			AAACCTCGGGGAT	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.697C>T	2.37:g.202141586C>T	ENSP00000412523:p.Arg233Trp	Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	230	19	0.0826087	NM_001080125	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	ENST00000432109.2	37	CCDS2342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.43|16.43	3.120327|3.120327	0.56613|0.56613	.|.	.|.	ENSG00000064012|ENSG00000064012	ENST00000392263;ENST00000432109;ENST00000264275;ENST00000450491;ENST00000358485;ENST00000392261;ENST00000323492|ENST00000392259;ENST00000392266;ENST00000392258;ENST00000447616;ENST00000424461	D;D;D;D;D;D|.	0.84223|.	-1.53;-1.53;-1.82;-1.82;-1.53;-1.53|.	5.6|5.6	5.6|5.6	0.85130|0.85130	Peptidase C14, caspase precursor p45, core (2);DEATH-like (1);Peptidase C14, ICE, catalytic subunit p20 (1);|.	0.194920|.	0.44097|.	D|.	0.000497|.	T|T	0.29458|0.29458	0.0734|0.0734	N|N	0.24115|0.24115	0.695|0.695	0.24514|0.24514	N|N	0.994191|0.994191	D;D;D;D;D;D|D;P	0.89917|0.62365	1.0;1.0;1.0;1.0;1.0;1.0|0.991;0.931	D;D;D;D;D;D|P;B	0.91635|0.45753	0.994;0.987;0.997;0.998;0.999;0.997|0.492;0.356	T|T	0.10428|0.10428	-1.0630|-1.0630	10|8	0.66056|0.33141	D|T	0.02|0.24	.|.	12.1349|12.1349	0.53966|0.53966	0.0:0.9188:0.0:0.0812|0.0:0.9188:0.0:0.0812	.|.	233;218;292;233;218;250|196;211	Q14790-7;A8MU92;Q14790-9;Q14790;Q14790-2;Q14790-4|Q14790-6;Q14790-5	.;.;.;CASP8_HUMAN;.;.|.;.	W|L	218;233;250;115;292;218;218|211;196;211;196;59	ENSP00000376091:R218W;ENSP00000412523:R233W;ENSP00000264275:R250W;ENSP00000391709:R115W;ENSP00000351273:R292W;ENSP00000325722:R218W|.	ENSP00000264275:R250W|ENSP00000376087:S211L	R|S	+|+	1|2	2|0	CASP8|CASP8	201849831|201849831	0.984000|0.984000	0.35163|0.35163	1.000000|1.000000	0.80357|0.80357	0.328000|0.328000	0.28507|0.28507	1.051000|1.051000	0.30417|0.30417	2.624000|2.624000	0.88883|0.88883	0.561000|0.561000	0.74099|0.74099	CGG|TCG	.	.	none		0.428	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228	
DLG2	1740	hgsc.bcm.edu	37	11	84027956	84027956	+	Missense_Mutation	SNP	C	C	T	rs569088235		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:84027956C>T	ENST00000398301.2	-	1	426	c.233G>A	c.(232-234)cGg>cAg	p.R78Q	DLG2_ENST00000543673.1_Intron|DLG2_ENST00000524982.1_Intron|DLG2_ENST00000376104.2_Intron|DLG2_ENST00000398309.2_Intron|DLG2_ENST00000280241.8_Missense_Mutation_p.R78Q|DLG2_ENST00000532653.1_Intron			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GGGGCTTTTCCGCACACTGTC	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		17533	0.0		0.001	False		,,,				2504	0.0				p.R78Q		Atlas-SNP	.											.	DLG2	448	.	0			c.G233A						PASS	.						88.0	86.0	87.0					11																	84027956		876	1990	2866	SO:0001583	missense	1740	exon1			CTTTTCCGCACAC	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000398301.2:c.233G>A	11.37:g.84027956C>T	ENSP00000381346:p.Arg78Gln	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	73	23	0.315068	NM_001206769	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000398301.2	37		.	.	.	.	.	.	.	.	.	.	C	17.43	3.388124	0.61956	.	.	ENSG00000150672	ENST00000280241;ENST00000398301	T;T	0.42131	0.98;0.98	5.86	4.89	0.63831	.	.	.	.	.	T	0.23410	0.0566	L	0.27053	0.805	0.80722	D	1	P	0.52463	0.953	B	0.36845	0.234	T	0.01397	-1.1365	8	.	.	.	.	6.9773	0.24683	0.0:0.7033:0.1505:0.1462	.	78	Q6ZSU2	.	Q	78	ENSP00000280241:R78Q;ENSP00000381346:R78Q	.	R	-	2	0	DLG2	83705604	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.176000	0.42500	2.774000	0.95407	0.585000	0.79938	CGG	.	.	none		0.597	DLG2-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000259244.2	NM_001364	
HYAL4	23553	hgsc.bcm.edu	37	7	123516863	123516863	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:123516863C>T	ENST00000223026.4	+	5	1738	c.1100C>T	c.(1099-1101)gCc>gTc	p.A367V	HYAL4_ENST00000476325.1_Missense_Mutation_p.A367V	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	367					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						AGCTACATAGCCAATGTGACC	0.468																																					p.A367V		Atlas-SNP	.											HYAL4,right_upper_lobe,carcinoma,-1,1	HYAL4	65	1	0			c.C1100T						scavenged	.						157.0	147.0	150.0					7																	123516863		2203	4300	6503	SO:0001583	missense	23553	exon5			ACATAGCCAATGT	AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.1100C>T	7.37:g.123516863C>T	ENSP00000223026:p.Ala367Val	Somatic	185	2	0.0108108		WXS	Illumina HiSeq	Phase_I	175	3	0.0171429	NM_012269	D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	ENST00000223026.4	37	CCDS5789.1	.	.	.	.	.	.	.	.	.	.	C	1.321	-0.599373	0.03744	.	.	ENSG00000106302	ENST00000223026;ENST00000476325	T;T	0.17054	2.3;2.3	5.62	3.12	0.35913	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.306342	0.33217	N	0.005150	T	0.03520	0.0101	N	0.00525	-1.395	0.23421	N	0.997718	B	0.02656	0.0	B	0.01281	0.0	T	0.43653	-0.9378	10	0.02654	T	1	-5.3432	8.3489	0.32290	0.0:0.0705:0.1405:0.7889	.	367	Q2M3T9	HYAL4_HUMAN	V	367	ENSP00000223026:A367V;ENSP00000417186:A367V	ENSP00000223026:A367V	A	+	2	0	HYAL4	123304099	0.142000	0.22610	1.000000	0.80357	0.478000	0.33099	1.077000	0.30741	0.493000	0.27837	-0.300000	0.09419	GCC	.	.	none		0.468	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348545.1	NM_012269	
FLG	2312	hgsc.bcm.edu	37	1	152286033	152286033	+	Silent	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:152286033A>G	ENST00000368799.1	-	3	1364	c.1329T>C	c.(1327-1329)gcT>gcC	p.A443A	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	443	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCTCAGCCCAGCCTTTCCGT	0.587									Ichthyosis																												p.A443A		Atlas-SNP	.											FLG,NS,carcinoma,0,1	FLG	900	1	0			c.T1329C						scavenged	.						202.0	197.0	199.0					1																	152286033		2203	4300	6503	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CAGCCCAGCCTTT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1329T>C	1.37:g.152286033A>G		Somatic	249	0	0		WXS	Illumina HiSeq	Phase_I	323	7	0.0216718	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			.	.	none		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
SV2B	9899	hgsc.bcm.edu	37	15	91835648	91835648	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:91835648C>T	ENST00000394232.1	+	13	2388	c.1918C>T	c.(1918-1920)Ctg>Ttg	p.L640L	SV2B_ENST00000330276.4_Silent_p.L640L|SV2B_ENST00000545111.2_Silent_p.L489L	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	640					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			TGGCGCCATCCTGGGAAACAC	0.468																																					p.L640L		Atlas-SNP	.											SV2B,colon,carcinoma,-1,1	SV2B	98	1	0			c.C1918T						scavenged	.						150.0	138.0	142.0					15																	91835648		2198	4298	6496	SO:0001819	synonymous_variant	9899	exon14			GCCATCCTGGGAA	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.1918C>T	15.37:g.91835648C>T		Somatic	157	1	0.00636943		WXS	Illumina HiSeq	Phase_I	247	3	0.0121457	NM_014848	B4DH30|C6G489|O94840|Q6IAR8	Silent	SNP	ENST00000394232.1	37	CCDS10370.1																																																																																			.	.	none		0.468	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848	
TMEM184A	202915	hgsc.bcm.edu	37	7	1590488	1590488	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:1590488T>C	ENST00000297477.5	-	3	666	c.350A>G	c.(349-351)tAc>tGc	p.Y117C		NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	117					germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		GAAGTAGACGTAGTACTGGTG	0.647																																					p.Y117C		Atlas-SNP	.											.	TMEM184A	35	.	0			c.A350G						PASS	.						82.0	89.0	87.0					7																	1590488		2203	4300	6503	SO:0001583	missense	202915	exon3			TAGACGTAGTACT		CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.350A>G	7.37:g.1590488T>C	ENSP00000297477:p.Tyr117Cys	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	62	4	0.0645161	NM_001097620	Q8TBQ6	Missense_Mutation	SNP	ENST00000297477.5	37	CCDS43537.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.114546	0.77210	.	.	ENSG00000164855	ENST00000297477;ENST00000319010;ENST00000414730;ENST00000441933;ENST00000431208	T;T;T;T;T	0.49139	1.42;0.84;0.79;0.81;0.81	5.03	5.03	0.67393	.	0.000000	0.85682	U	0.000000	T	0.73466	0.3590	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.79240	-0.1885	10	0.54805	T	0.06	0.0726	14.7478	0.69501	0.0:0.0:0.0:1.0	.	117	Q6ZMB5	T184A_HUMAN	C	117	ENSP00000297477:Y117C;ENSP00000325945:Y117C;ENSP00000398382:Y117C;ENSP00000389092:Y117C;ENSP00000403499:Y117C	ENSP00000297477:Y117C	Y	-	2	0	TMEM184A	1557014	1.000000	0.71417	0.939000	0.37840	0.784000	0.44337	7.869000	0.87170	1.891000	0.54761	0.334000	0.21626	TAC	.	.	none		0.647	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239229.4	NM_152689	
OR2L3	391192	hgsc.bcm.edu	37	1	248224819	248224819	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:248224819C>T	ENST00000359959.3	+	1	836	c.836C>T	c.(835-837)aCc>aTc	p.T279I	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TTCTACACCACCCTCACTCCA	0.493																																					p.T279I		Atlas-SNP	.											OR2L3,NS,carcinoma,0,1	OR2L3	97	1	0			c.C836T						scavenged	.						101.0	92.0	95.0					1																	248224819		2203	4300	6503	SO:0001583	missense	391192	exon1			ACACCACCCTCAC	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.836C>T	1.37:g.248224819C>T	ENSP00000353044:p.Thr279Ile	Somatic	121	1	0.00826446		WXS	Illumina HiSeq	Phase_I	184	7	0.0380435	NM_001004687	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.647043	0.00111	.	.	ENSG00000198128	ENST00000359959	T	0.00042	8.84	2.01	0.771	0.18504	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31821	N	0.007016	T	0.00039	0.0001	N	0.00197	-1.87	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41556	-0.9502	10	0.02654	T	1	.	6.3461	0.21351	0.0:0.2447:0.0:0.7553	.	279	Q8NG85	OR2L3_HUMAN	I	279	ENSP00000353044:T279I	ENSP00000353044:T279I	T	+	2	0	OR2L3	246291442	0.000000	0.05858	0.070000	0.20053	0.405000	0.30901	0.295000	0.19065	-0.357000	0.08175	-0.535000	0.04281	ACC	.	.	none		0.493	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240805	39240805	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:39240805G>T	ENST00000391417.4	+	1	347	c.347G>T	c.(346-348)cGc>cTc	p.R116L		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	141	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						agctgctgccgcccctgctgc	0.672																																					p.R116L		Atlas-SNP	.											KRTAP4-7,caecum,carcinoma,+1,1	KRTAP4-7	49	1	0			c.G347T						scavenged	.						18.0	18.0	18.0					17																	39240805		692	1587	2279	SO:0001583	missense	100132476	exon1			GCTGCCGCCCCTG	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.347G>T	17.37:g.39240805G>T	ENSP00000375236:p.Arg116Leu	Somatic	33	4	0.121212		WXS	Illumina HiSeq	Phase_I	44	7	0.159091	NM_033061	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	6.805	0.517638	0.13005	.	.	ENSG00000240871	ENST00000391417	T	0.00606	6.26	3.15	2.13	0.27403	.	0.163808	0.19966	U	0.102091	T	0.00496	0.0016	.	.	.	0.09310	N	1	B	0.18461	0.028	B	0.15052	0.012	T	0.45804	-0.9236	9	0.28530	T	0.3	.	9.2621	0.37619	0.0:0.0:0.7821:0.2179	.	171	Q9BYR0	KRA47_HUMAN	L	116	ENSP00000375236:R116L	ENSP00000375236:R116L	R	+	2	0	KRTAP4-7	36494331	0.000000	0.05858	0.028000	0.17463	0.502000	0.33828	-0.081000	0.11321	0.603000	0.29913	0.289000	0.19496	CGC	.	.	none		0.672	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
DNAH10	196385	hgsc.bcm.edu	37	12	124398985	124398985	+	Missense_Mutation	SNP	C	C	T	rs369076491		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:124398985C>T	ENST00000409039.3	+	60	10133	c.10108C>T	c.(10108-10110)Cgt>Tgt	p.R3370C		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3370					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTGGGAGTTCCGTGACGAGAT	0.607																																					p.R3370C		Atlas-SNP	.											DNAH10_same_name,NS,carcinoma,-1,2	DNAH10	888	2	0			c.C10108T						scavenged	.	C	CYS/ARG	0,4084		0,0,2042	61.0	68.0	65.0		10108	5.3	1.0	12		65	1,8391		0,1,4195	no	missense	DNAH10	NM_207437.3	180	0,1,6237	TT,TC,CC		0.0119,0.0,0.0080	probably-damaging	3370/4472	124398985	1,12475	2042	4196	6238	SO:0001583	missense	196385	exon60			GAGTTCCGTGACG	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.10108C>T	12.37:g.124398985C>T	ENSP00000386770:p.Arg3370Cys	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	99	2	0.020202	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.101676	0.76983	0.0	1.19E-4	ENSG00000197653	ENST00000409039	T	0.81163	-1.46	5.28	5.28	0.74379	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.94029	0.8087	H	0.98068	4.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96221	0.9160	10	0.87932	D	0	.	18.9088	0.92474	0.0:1.0:0.0:0.0	.	3370	Q8IVF4	DYH10_HUMAN	C	3370	ENSP00000386770:R3370C	ENSP00000386770:R3370C	R	+	1	0	DNAH10	122964938	1.000000	0.71417	0.997000	0.53966	0.542000	0.35054	6.147000	0.71783	2.449000	0.82847	0.561000	0.74099	CGT	.	.	weak		0.607	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
MICAL2	9645	hgsc.bcm.edu	37	11	12281376	12281376	+	Missense_Mutation	SNP	G	G	A	rs2270515	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:12281376G>A	ENST00000256194.4	+	26	3554	c.3266G>A	c.(3265-3267)cGg>cAg	p.R1089Q	MICAL2_ENST00000537344.1_Missense_Mutation_p.R899Q|RP11-265D17.2_ENST00000527288.1_RNA|MICAL2_ENST00000342902.5_Missense_Mutation_p.R1068Q|MICAL2_ENST00000527546.1_Missense_Mutation_p.R899Q|MICAL2_ENST00000379612.3_Missense_Mutation_p.R863Q	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	1089			R -> Q (in dbSNP:rs2270515).		actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GAAGCCCCTCGGAGAGACACT	0.552													G|||	8	0.00159744	0.0	0.0	5008	,	,		17690	0.0079		0.0	False		,,,				2504	0.0				p.R1089Q		Atlas-SNP	.											MICAL2,NS,carcinoma,+1,1	MICAL2	114	1	0			c.G3266A						PASS	.						54.0	54.0	54.0					11																	12281376		2201	4294	6495	SO:0001583	missense	9645	exon26			CCCCTCGGAGAGA	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.3266G>A	11.37:g.12281376G>A	ENSP00000256194:p.Arg1089Gln	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	161	56	0.347826	NM_014632	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	37	CCDS7809.1	7	0.003205128205128205	0	0.0	0	0.0	7	0.012237762237762238	0	0.0	G	1.895	-0.454548	0.04540	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.26	5.26	-3.4	0.04853	.	1.374950	0.04696	N	0.414963	T	0.23611	0.0571	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B;B	0.32128	0.002;0.03;0.0;0.0;0.001;0.357	B;B;B;B;B;B	0.18871	0.001;0.005;0.0;0.0;0.001;0.023	T	0.06058	-1.0848	10	0.13470	T	0.59	.	3.761	0.08604	0.2276:0.3179:0.3678:0.0867	rs2270515;rs52826400;rs2270515	432;1068;899;842;863;1089	B4DYS3;G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;.;MICA2_HUMAN	Q	899;432;1089;899;1068;863	ENSP00000441689:R899Q;ENSP00000256194:R1089Q;ENSP00000433965:R899Q;ENSP00000344894:R1068Q;ENSP00000368932:R863Q	ENSP00000256194:R1089Q	R	+	2	0	MICAL2	12237952	0.000000	0.05858	0.016000	0.15963	0.370000	0.29829	-0.913000	0.04042	-0.723000	0.04915	-1.378000	0.01179	CGG	G|0.994;A|0.006	0.006	strong		0.552	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632	
ATP10D	57205	hgsc.bcm.edu	37	4	47514734	47514734	+	Silent	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:47514734C>A	ENST00000273859.3	+	2	446	c.177C>A	c.(175-177)ccC>ccA	p.P59P	ATP10D_ENST00000504445.1_Silent_p.P59P	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	59					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						ACATCCAGCCCTTCAAGGATG	0.473																																					p.P59P		Atlas-SNP	.											ATP10D,right_upper_lobe,carcinoma,+1,1	ATP10D	168	1	0			c.C177A						scavenged	.						87.0	85.0	86.0					4																	47514734		2203	4300	6503	SO:0001819	synonymous_variant	57205	exon2			CCAGCCCTTCAAG	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.177C>A	4.37:g.47514734C>A		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	127	4	0.0314961	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Silent	SNP	ENST00000273859.3	37	CCDS3476.1																																																																																			.	.	none		0.473	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
KRTAP27-1	643812	hgsc.bcm.edu	37	21	31709734	31709734	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr21:31709734C>A	ENST00000382835.2	-	1	278	c.253G>T	c.(253-255)Gtc>Ttc	p.V85F		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	85						intermediate filament (GO:0005882)				endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						GTAGTTTGGACAACTCCGGGG	0.488																																					p.V85F		Atlas-SNP	.											KRTAP27-1,colon,carcinoma,0,1	KRTAP27-1	53	1	0			c.G253T						scavenged	.						154.0	149.0	150.0					21																	31709734		2203	4300	6503	SO:0001583	missense	643812	exon1			TTTGGACAACTCC	AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.253G>T	21.37:g.31709734C>A	ENSP00000372286:p.Val85Phe	Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	221	3	0.0135747	NM_001077711		Missense_Mutation	SNP	ENST00000382835.2	37	CCDS33532.1	.	.	.	.	.	.	.	.	.	.	C	10.83	1.461406	0.26248	.	.	ENSG00000206107	ENST00000382835	T	0.32988	1.43	4.12	1.19	0.21007	.	1.300600	0.05823	N	0.616050	T	0.31606	0.0802	M	0.62723	1.935	0.09310	N	1	B	0.22146	0.065	B	0.25759	0.063	T	0.37244	-0.9714	10	0.59425	D	0.04	0.0818	4.7009	0.12827	0.3854:0.5098:0.0:0.1048	.	85	Q3LI81	KR271_HUMAN	F	85	ENSP00000372286:V85F	ENSP00000372286:V85F	V	-	1	0	KRTAP27-1	30631605	0.000000	0.05858	0.002000	0.10522	0.093000	0.18481	-0.807000	0.04520	0.257000	0.21650	0.591000	0.81541	GTC	.	.	none		0.488	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711	
BCO1	53630	hgsc.bcm.edu	37	16	81303828	81303828	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:81303828C>T	ENST00000258168.2	+	7	1369	c.908C>T	c.(907-909)gCc>gTc	p.A303V	BCMO1_ENST00000425577.2_Missense_Mutation_p.A234V	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						TACACAGACGCCATGGTGGTC	0.517																																					p.A303V		Atlas-SNP	.											BCMO1,colon,carcinoma,+1,1	BCMO1	53	1	0			c.C908T						scavenged	.						184.0	148.0	160.0					16																	81303828		2202	4300	6502	SO:0001583	missense	53630	exon7			CAGACGCCATGGT																												ENST00000258168.2:c.908C>T	16.37:g.81303828C>T	ENSP00000258168:p.Ala303Val	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	114	2	0.0175439	NM_017429		Missense_Mutation	SNP	ENST00000258168.2	37	CCDS10934.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876367	0.91664	.	.	ENSG00000135697	ENST00000258168;ENST00000425577	D;D	0.95447	-3.71;-3.71	5.62	5.62	0.85841	.	0.623507	0.17742	N	0.163534	D	0.97241	0.9098	M	0.69358	2.11	0.43936	D	0.996594	D;P	0.56968	0.978;0.909	P;P	0.62491	0.903;0.771	D	0.97476	1.0044	10	0.72032	D	0.01	-8.8846	19.7208	0.96143	0.0:1.0:0.0:0.0	.	234;303	E7EM88;Q9HAY6	.;BCDO1_HUMAN	V	303;234	ENSP00000258168:A303V;ENSP00000400586:A234V	ENSP00000258168:A303V	A	+	2	0	BCMO1	79861329	0.455000	0.25736	0.997000	0.53966	0.372000	0.29890	5.491000	0.66887	2.651000	0.90000	0.650000	0.86243	GCC	.	.	none		0.517	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269056.1		
NANOG	79923	hgsc.bcm.edu	37	12	7947105	7947105	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:7947105A>G	ENST00000229307.4	+	3	686	c.467A>G	c.(466-468)aAc>aGc	p.N156S	NANOG_ENST00000526286.1_Missense_Mutation_p.N156S	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	156					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		TGGCAGAAAAACAACTGGCCG	0.393																																					p.N156S		Atlas-SNP	.											NANOG,colon,carcinoma,0,1	NANOG	30	1	0			c.A467G						scavenged	.						64.0	72.0	70.0					12																	7947105		2203	4300	6503	SO:0001583	missense	79923	exon3			AGAAAAACAACTG	AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		ENST00000229307.4:c.467A>G	12.37:g.7947105A>G	ENSP00000229307:p.Asn156Ser	Somatic	478	0	0		WXS	Illumina HiSeq	Phase_I	488	6	0.0122951	NM_024865	D3DUU4|Q2TTG0|Q6JZS5	Missense_Mutation	SNP	ENST00000229307.4	37	CCDS31736.1	.	.	.	.	.	.	.	.	.	.	.	11.02	1.515301	0.27123	.	.	ENSG00000111704	ENST00000541267;ENST00000229307;ENST00000526286	D;D;D	0.91521	-2.82;-2.85;-2.86	4.21	1.72	0.24424	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.755127	0.12545	N	0.459592	D	0.84065	0.5390	L	0.52759	1.655	0.21184	N	0.999765	B	0.16802	0.019	B	0.19666	0.026	T	0.65882	-0.6060	10	0.14252	T	0.57	-5.4456	4.3062	0.10947	0.6859:0.204:0.1101:0.0	.	156	Q9H9S0	NANOG_HUMAN	S	132;156;156	ENSP00000444434:N132S;ENSP00000229307:N156S;ENSP00000435288:N156S	ENSP00000229307:N156S	N	+	2	0	NANOG	7838372	0.674000	0.27549	0.969000	0.41365	0.904000	0.53231	1.319000	0.33655	0.125000	0.18397	0.454000	0.30748	AAC	.	.	none		0.393	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387480.2	NM_024865	
MUC4	4585	hgsc.bcm.edu	37	3	195507062	195507062	+	Missense_Mutation	SNP	C	C	T	rs199822551	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:195507062C>T	ENST00000463781.3	-	2	11848	c.11389G>A	c.(11389-11391)Gac>Aac	p.D3797N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D3797N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.607													.|||	549	0.109625	0.0575	0.1239	5008	,	,		9468	0.0556		0.2028	False		,,,				2504	0.1299				p.D3797N		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.G11389A						scavenged	.						7.0	7.0	7.0					3																	195507062		641	1482	2123	SO:0001583	missense	4585	exon2			AAGTGTCGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11389G>A	3.37:g.195507062C>T	ENSP00000417498:p.Asp3797Asn	Somatic	76	11	0.144737		WXS	Illumina HiSeq	Phase_I	82	8	0.097561	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	8.329	0.826143	0.16749	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31247	1.51;1.5	.	.	.	.	0.282130	0.14041	U	0.345384	T	0.13586	0.0329	N	0.19112	0.55	0.09310	N	0.999991	B	0.26975	0.165	B	0.06405	0.002	T	0.19516	-1.0303	8	.	.	.	.	3.5985	0.08016	2.0E-4:0.5013:0.4982:2.0E-4	.	3669	E7ESK3	.	N	3797	ENSP00000417498:D3797N;ENSP00000420243:D3797N	.	D	-	1	0	MUC4	196991841	0.000000	0.05858	0.054000	0.19295	0.055000	0.15305	0.157000	0.16402	0.064000	0.16427	0.064000	0.15345	GAC	.	.	weak		0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LGALS9B	284194	hgsc.bcm.edu	37	17	20354849	20354849	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:20354849G>A	ENST00000423676.3	-	10	932	c.869C>T	c.(868-870)tCt>tTt	p.S290F	LGALS9B_ENST00000324290.5_Missense_Mutation_p.S289F			Q3B8N2	LEG9B_HUMAN	lectin, galactoside-binding, soluble, 9B	290	Beta-galactoside binding 2. {ECO:0000250}.|Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	10						TCGCTCCTCAGACCCCCAAGA	0.572																																					p.S289F		Atlas-SNP	.											LGALS9B,NS,carcinoma,0,1	LGALS9B	24	1	0			c.C866T						scavenged	.						8.0	14.0	12.0					17																	20354849		2117	4225	6342	SO:0001583	missense	284194	exon10			TCCTCAGACCCCC		CCDS42283.1	17p11.2	2011-08-04			ENSG00000170298	ENSG00000170298		"""Lectins, galactoside-binding"""	24842	protein-coding gene	gene with protein product						11997339	Standard	NM_001042685		Approved		uc002gwz.1	Q3B8N2	OTTHUMG00000130730	ENST00000423676.3:c.869C>T	17.37:g.20354849G>A	ENSP00000388841:p.Ser290Phe	Somatic	425	1	0.00235294		WXS	Illumina HiSeq	Phase_I	482	2	0.00414938	NM_001042685	A6NLF8|A8K2J8	Missense_Mutation	SNP	ENST00000423676.3	37		.	.	.	.	.	.	.	.	.	.	G	11.46	1.645169	0.29246	.	.	ENSG00000170298	ENST00000423676;ENST00000324290	.	.	.	1.97	0.927	0.19437	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	1.209440	0.05787	N	0.609606	T	0.66268	0.2772	M	0.81341	2.54	0.09310	N	0.999995	D;D	0.62365	0.991;0.988	D;P	0.64506	0.926;0.879	T	0.45731	-0.9241	9	0.59425	D	0.04	.	6.4868	0.22093	0.0:0.0:0.4877:0.5123	.	290;289	Q3B8N2;Q3B8N2-2	LEG9B_HUMAN;.	F	289;290	.	ENSP00000315564:S290F	S	-	2	0	LGALS9B	20295441	0.000000	0.05858	0.936000	0.37596	0.623000	0.37688	0.048000	0.14078	0.371000	0.24564	0.194000	0.17425	TCT	.	.	none		0.572	LGALS9B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000253230.2	NM_001042685	
SEMA6D	80031	hgsc.bcm.edu	37	15	48052516	48052516	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:48052516C>T	ENST00000316364.5	+	3	564	c.125C>T	c.(124-126)cCg>cTg	p.P42L	SEMA6D_ENST00000558014.1_Missense_Mutation_p.P42L|SEMA6D_ENST00000355997.3_Missense_Mutation_p.P42L|SEMA6D_ENST00000536845.2_Missense_Mutation_p.P42L|SEMA6D_ENST00000389433.2_Missense_Mutation_p.P42L|SEMA6D_ENST00000389428.3_Missense_Mutation_p.P42L|SEMA6D_ENST00000389432.2_Missense_Mutation_p.P42L|SEMA6D_ENST00000358066.4_Missense_Mutation_p.P42L|SEMA6D_ENST00000354744.4_Missense_Mutation_p.P42L|SEMA6D_ENST00000537942.1_Missense_Mutation_p.P42L|SEMA6D_ENST00000558816.1_Missense_Mutation_p.P42L|SEMA6D_ENST00000389425.3_Missense_Mutation_p.P42L	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	42	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.P42L(1)		biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AGGCAATATCCGGTTTTTAGA	0.418																																					p.P42L		Atlas-SNP	.											SEMA6D,colon,NS,0,1	SEMA6D	322	1	1	Substitution - Missense(1)	large_intestine(1)	c.C125T						scavenged	.						100.0	91.0	94.0					15																	48052516		2198	4297	6495	SO:0001583	missense	80031	exon3			AATATCCGGTTTT	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.125C>T	15.37:g.48052516C>T	ENSP00000324857:p.Pro42Leu	Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	245	4	0.0163265	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369794	0.82573	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.27104	2.27;2.04;2.04;2.08;2.27;2.27;2.27;2.26;2.22;1.69	5.76	5.76	0.90799	Semaphorin/CD100 antigen (2);	0.000000	0.85682	D	0.000000	T	0.57036	0.2026	M	0.80422	2.495	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;P;D;D;D	0.83275	0.993;0.889;0.993;0.996;0.948	T	0.59456	-0.7451	10	0.72032	D	0.01	.	19.9813	0.97326	0.0:1.0:0.0:0.0	.	42;42;42;42;42	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	L	42	ENSP00000442040:P42L;ENSP00000446152:P42L;ENSP00000324857:P42L;ENSP00000374084:P42L;ENSP00000374083:P42L;ENSP00000346786:P42L;ENSP00000350770:P42L;ENSP00000374079:P42L;ENSP00000348276:P42L;ENSP00000374076:P42L	ENSP00000324857:P42L	P	+	2	0	SEMA6D	45839808	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.726000	0.93360	0.655000	0.94253	CCG	.	.	none		0.418	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
CSPG4	1464	hgsc.bcm.edu	37	15	75980270	75980270	+	Missense_Mutation	SNP	C	C	T	rs552897521		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:75980270C>T	ENST00000308508.5	-	3	3228	c.3136G>A	c.(3136-3138)Gat>Aat	p.D1046N		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1046	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GAGTCAGCATCGCTGAAGGCC	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		19833	0.001		0.0	False		,,,				2504	0.0				p.D1046N		Atlas-SNP	.											.	CSPG4	175	.	0			c.G3136A						PASS	.																																			SO:0001583	missense	1464	exon3			CAGCATCGCTGAA	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.3136G>A	15.37:g.75980270C>T	ENSP00000312506:p.Asp1046Asn	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	203	101	0.497537	NM_001897	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	26.0	4.692443	0.88735	.	.	ENSG00000173546	ENST00000308508	T	0.51071	0.72	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000002	T	0.69975	0.3171	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73839	-0.3856	10	0.56958	D	0.05	.	17.0533	0.86525	0.0:1.0:0.0:0.0	.	1046	Q6UVK1	CSPG4_HUMAN	N	1046	ENSP00000312506:D1046N	ENSP00000312506:D1046N	D	-	1	0	CSPG4	73767325	1.000000	0.71417	0.708000	0.30435	0.809000	0.45718	7.817000	0.86213	2.253000	0.74438	0.555000	0.69702	GAT	.	.	none		0.642	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
ARID3C	138715	hgsc.bcm.edu	37	9	34623464	34623464	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:34623464C>T	ENST00000378909.2	-	4	915	c.823G>A	c.(823-825)Gcg>Acg	p.A275T	DCTN3_ENST00000447983.2_5'Flank|DCTN3_ENST00000378913.2_5'Flank|DCTN3_ENST00000259632.7_5'Flank|DCTN3_ENST00000341694.2_5'Flank|DCTN3_ENST00000378916.4_5'Flank|DCTN3_ENST00000477738.2_5'Flank	NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	275	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		CATGCATGCGCTGGCAGGCCG	0.667																																					p.A275T		Atlas-SNP	.											ARID3C,NS,carcinoma,+1,1	ARID3C	33	1	0			c.G823A						scavenged	.						50.0	56.0	54.0					9																	34623464		2200	4291	6491	SO:0001583	missense	138715	exon4			CATGCGCTGGCAG		CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.823G>A	9.37:g.34623464C>T	ENSP00000368189:p.Ala275Thr	Somatic	181	1	0.00552486		WXS	Illumina HiSeq	Phase_I	143	4	0.027972	NM_001017363		Missense_Mutation	SNP	ENST00000378909.2	37	CCDS35006.1	.	.	.	.	.	.	.	.	.	.	C	12.89	2.074183	0.36566	.	.	ENSG00000205143	ENST00000378909	T	0.45276	0.9	5.09	4.18	0.49190	.	2.020920	0.03270	N	0.184570	T	0.34571	0.0902	L	0.39397	1.21	0.09310	N	1	P	0.46064	0.872	B	0.37731	0.257	T	0.16541	-1.0399	10	0.13853	T	0.58	-2.4795	9.995	0.41893	0.0:0.9029:0.0:0.0971	.	275	A6NKF2	ARI3C_HUMAN	T	275	ENSP00000368189:A275T	ENSP00000368189:A275T	A	-	1	0	ARID3C	34613464	0.013000	0.17824	0.032000	0.17829	0.322000	0.28314	2.661000	0.46758	2.357000	0.79964	0.448000	0.29417	GCG	.	.	none		0.667	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348265.1	XM_071061	
CCDC6	8030	hgsc.bcm.edu	37	10	61566690	61566690	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:61566690C>T	ENST00000263102.6	-	6	1225	c.994G>A	c.(994-996)Gac>Aac	p.D332N		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	332						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		CTTTCGTCGTCCATTTCTAAG	0.453			T	RET	NSCLC																																p.D332N		Atlas-SNP	.		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	CCDC6,colon,carcinoma,+2,1	CCDC6	44	1	0			c.G994A						scavenged	.						103.0	93.0	96.0					10																	61566690		2203	4300	6503	SO:0001583	missense	8030	exon6			CGTCGTCCATTTC	S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.994G>A	10.37:g.61566690C>T	ENSP00000263102:p.Asp332Asn	Somatic	115	1	0.00869565		WXS	Illumina HiSeq	Phase_I	139	2	0.0143885	NM_005436	Q15250|Q6GSG7	Missense_Mutation	SNP	ENST00000263102.6	37	CCDS7257.1	.	.	.	.	.	.	.	.	.	.	C	36	5.636261	0.96693	.	.	ENSG00000108091	ENST00000263102	T	0.53640	0.61	5.33	5.33	0.75918	.	0.137546	0.64402	D	0.000004	T	0.60983	0.2311	L	0.52573	1.65	0.80722	D	1	P	0.51449	0.945	P	0.57468	0.821	T	0.61662	-0.7017	10	0.56958	D	0.05	-19.7769	19.0058	0.92851	0.0:1.0:0.0:0.0	.	332	Q16204	CCDC6_HUMAN	N	332	ENSP00000263102:D332N	ENSP00000263102:D332N	D	-	1	0	CCDC6	61236696	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.735000	0.84939	2.514000	0.84764	0.467000	0.42956	GAC	.	.	none		0.453	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436	
IFITM3	10410	hgsc.bcm.edu	37	11	320723	320723	+	Missense_Mutation	SNP	C	C	T	rs199582787	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:320723C>T	ENST00000399808.4	-	1	327	c.91G>A	c.(91-93)Gtg>Atg	p.V31M	RP11-326C3.11_ENST00000602429.1_RNA|RP11-326C3.14_ENST00000602809.1_lincRNA|RP11-326C3.10_ENST00000534271.1_RNA|RP11-326C3.11_ENST00000602756.1_RNA|IFITM3_ENST00000602735.1_Missense_Mutation_p.V10M|RP11-326C3.11_ENST00000508004.2_RNA|IFITM3_ENST00000526811.1_Missense_Mutation_p.V10M	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	31					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCCCCAGCACAGCCACCTCG	0.612																																					p.V31M		Atlas-SNP	.											IFITM3,brain,glioma,0,1	IFITM3	132	1	0			c.G91A						scavenged	.						87.0	98.0	95.0					11																	320723		1967	4140	6107	SO:0001583	missense	10410	exon1			CCAGCACAGCCAC	X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.91G>A	11.37:g.320723C>T	ENSP00000382707:p.Val31Met	Somatic	78	2	0.025641		WXS	Illumina HiSeq	Phase_I	116	12	0.103448	NM_021034	Q53Y76|Q96HK8|Q96J15	Missense_Mutation	SNP	ENST00000399808.4	37	CCDS41585.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526447	0.27299	.	.	ENSG00000142089	ENST00000399808;ENST00000270031;ENST00000526811	T;T	0.79454	-1.03;-1.27	4.61	-4.91	0.03085	.	11.488500	0.02440	N	0.084490	T	0.64516	0.2605	L	0.39147	1.195	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.46400	-0.9194	10	0.13108	T	0.6	0.9022	6.4601	0.21952	0.1231:0.361:0.0:0.5159	.	31	Q01628	IFM3_HUMAN	M	31;15;10	ENSP00000382707:V31M;ENSP00000432108:V10M	ENSP00000372047:V15M	V	-	1	0	IFITM3	310723	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.638000	0.02013	-0.562000	0.06086	-1.790000	0.00627	GTG	.	.	weak		0.612	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384765.1	NM_021034	
ZNF768	79724	hgsc.bcm.edu	37	16	30537049	30537049	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:30537049G>A	ENST00000380412.5	-	2	587	c.412C>T	c.(412-414)Cgg>Tgg	p.R138W	ZNF768_ENST00000562803.1_Missense_Mutation_p.R107W	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	138	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						CCAGGGCTCCGGGGTTCATAC	0.507																																					p.R138W		Atlas-SNP	.											ZNF768,colon,carcinoma,0,1	ZNF768	28	1	0			c.C412T						scavenged	.						52.0	58.0	56.0					16																	30537049		2197	4299	6496	SO:0001583	missense	79724	exon2			GGCTCCGGGGTTC	BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.412C>T	16.37:g.30537049G>A	ENSP00000369777:p.Arg138Trp	Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	213	4	0.0187793	NM_024671	Q569L7|Q96CX4	Missense_Mutation	SNP	ENST00000380412.5	37	CCDS10681.2	.	.	.	.	.	.	.	.	.	.	G	6.397	0.441291	0.12164	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	T	0.07216	3.21	4.16	-5.08	0.02929	.	2.573600	0.01887	N	0.038306	T	0.06781	0.0173	N	0.19112	0.55	0.09310	N	1	P	0.48640	0.913	B	0.40329	0.326	T	0.42882	-0.9425	10	0.66056	D	0.02	2.4763	11.6417	0.51237	0.0:0.1858:0.1363:0.6779	.	138	Q9H5H4	ZN768_HUMAN	W	138;107	ENSP00000369777:R138W	ENSP00000369777:R138W	R	-	1	2	ZNF768	30444550	0.000000	0.05858	0.001000	0.08648	0.066000	0.16364	-1.601000	0.02081	-0.883000	0.03982	-0.397000	0.06425	CGG	.	.	none		0.507	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255522.2	NM_024671	
PRDM15	63977	hgsc.bcm.edu	37	21	43248563	43248563	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr21:43248563C>T	ENST00000269844.3	-	19	2701	c.2591G>A	c.(2590-2592)cGc>cAc	p.R864H	PRDM15_ENST00000538201.1_Missense_Mutation_p.R518H|PRDM15_ENST00000422911.1_Missense_Mutation_p.R555H|PRDM15_ENST00000447207.2_Missense_Mutation_p.R498H|PRDM15_ENST00000398548.1_Missense_Mutation_p.R535H	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	864					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R864L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						GACGTCCTTGCGGTAGAACAT	0.612																																					p.R864H		Atlas-SNP	.											PRDM15,NS,carcinoma,0,1	PRDM15	110	1	1	Substitution - Missense(1)	lung(1)	c.G2591A						scavenged	.						294.0	248.0	264.0					21																	43248563		2203	4300	6503	SO:0001583	missense	63977	exon19			TCCTTGCGGTAGA	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.2591G>A	21.37:g.43248563C>T	ENSP00000269844:p.Arg864His	Somatic	148	1	0.00675676		WXS	Illumina HiSeq	Phase_I	146	4	0.0273973	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	CCDS13676.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	32|32	5.140128|5.140128	0.94560|0.94560	.|.	.|.	ENSG00000141956|ENSG00000141956	ENST00000380489|ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	.|T;T;T;T;T	.|0.29397	.|1.57;1.57;1.57;1.57;1.57	4.46|4.46	4.46|4.46	0.54185|0.54185	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	T|T	0.45155|0.45155	0.1328|0.1328	L|L	0.35414|0.35414	1.06|1.06	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.998;0.999	T|T	0.41662|0.41662	-0.9496|-0.9496	6|9	0.12766|0.49607	T|T	0.61|0.09	-10.3847|-10.3847	16.4845|16.4845	0.84181|0.84181	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|864;555;535	.|P57071;E9PDJ6;E9PF37	.|PRD15_HUMAN;.;.	T|H	501|555;535;518;498;864	.|ENSP00000408592:R555H;ENSP00000381556:R535H;ENSP00000444044:R518H;ENSP00000390245:R498H;ENSP00000269844:R864H	ENSP00000369856:A501T|ENSP00000269844:R864H	A|R	-|-	1|2	0|0	PRDM15|PRDM15	42121632|42121632	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.251000|7.251000	0.78297|0.78297	2.186000|2.186000	0.69663|0.69663	0.556000|0.556000	0.70494|0.70494	GCA|CGC	.	.	none		0.612	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
UGT2B28	54490	hgsc.bcm.edu	37	4	70152481	70152481	+	Silent	SNP	A	A	G	rs141618560	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:70152481A>G	ENST00000335568.5	+	3	884	c.882A>G	c.(880-882)gaA>gaG	p.E294E	UGT2B28_ENST00000511240.1_Silent_p.E294E	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	294					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.E294E(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						AAATGGAGGAATTTGTACAGA	0.393													a|||	49	0.00978435	0.0159	0.0043	5008	,	,		10804	0.004		0.005	False		,,,				2504	0.0164				p.E294E		Atlas-SNP	.											UGT2B28,NS,carcinoma,0,4	UGT2B28	101	4	1	Substitution - coding silent(1)	kidney(1)	c.A882G						PASS	.	G	,	12,4124		0,12,2056	125.0	143.0	138.0		882,882	-1.6	0.9	4	dbSNP_134	138	9,8499		0,9,4245	no	coding-synonymous,coding-synonymous	UGT2B28	NM_001207004.1,NM_053039.1	,	0,21,6301	GG,GA,AA		0.1058,0.2901,0.1661	,	294/336,294/530	70152481	21,12623	2068	4254	6322	SO:0001819	synonymous_variant	54490	exon3			GGAGGAATTTGTA	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.882A>G	4.37:g.70152481A>G		Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	175	7	0.04	NM_053039	B5BUM0|Q9BY62|Q9BY63	Silent	SNP	ENST00000335568.5	37	CCDS3528.1																																																																																			A|1.000;G|0.000	0.000	weak		0.393	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	
RANBP2	5903	hgsc.bcm.edu	37	2	109382170	109382170	+	Silent	SNP	A	A	G	rs535428027		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:109382170A>G	ENST00000283195.6	+	20	5301	c.5175A>G	c.(5173-5175)gaA>gaG	p.E1725E		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1725					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E1725E(9)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CTAAGAAGGAAGGACAGTGGG	0.418													A|||	1	0.000199681	0.0	0.0014	5008	,	,		23860	0.0		0.0	False		,,,				2504	0.0				p.E1725E		Atlas-SNP	.											RANBP2_ENST00000283195,NS,carcinoma,0,6	RANBP2	488	6	9	Substitution - coding silent(9)	prostate(9)	c.A5175G						scavenged	.						182.0	173.0	176.0					2																	109382170		2203	4300	6503	SO:0001819	synonymous_variant	5903	exon20			GAAGGAAGGACAG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.5175A>G	2.37:g.109382170A>G		Somatic	500	4	0.008		WXS	Illumina HiSeq	Phase_I	597	10	0.0167504	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	ENST00000283195.6	37	CCDS2079.1																																																																																			.	.	none		0.418	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
MUC4	4585	hgsc.bcm.edu	37	3	195505774	195505774	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:195505774G>T	ENST00000463781.3	-	2	13136	c.12677C>A	c.(12676-12678)cCt>cAt	p.P4226H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P4226H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	983					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P4226H(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGGTGACAGGAAGAGGGGT	0.587																																					p.P4226H		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	1	Substitution - Missense(1)	kidney(1)	c.C12677A						scavenged	.						35.0	35.0	35.0					3																	195505774		2091	4190	6281	SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12677C>A	3.37:g.195505774G>T	ENSP00000417498:p.Pro4226His	Somatic	113	2	0.0176991		WXS	Illumina HiSeq	Phase_I	143	8	0.0559441	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	10.38	1.335266	0.24253	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.43294	1.33;0.95	1.57	1.57	0.23409	.	.	.	.	.	T	0.40448	0.1117	N	0.14661	0.345	0.26065	N	0.981307	D	0.89917	1.0	D	0.72982	0.979	T	0.18840	-1.0324	8	.	.	.	.	6.711	0.23276	0.0:0.0:1.0:0.0	.	4098	E7ESK3	.	H	4226	ENSP00000417498:P4226H;ENSP00000420243:P4226H	.	P	-	2	0	MUC4	196990553	0.000000	0.05858	0.040000	0.18447	0.017000	0.09413	-0.298000	0.08265	1.213000	0.43380	0.484000	0.47621	CCT	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
FZR1	51343	hgsc.bcm.edu	37	19	3532490	3532490	+	Missense_Mutation	SNP	G	G	A	rs371550562		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:3532490G>A	ENST00000395095.3	+	10	1084	c.1084G>A	c.(1084-1086)Gcc>Acc	p.A362T	FZR1_ENST00000313639.8_Missense_Mutation_p.A273T|FZR1_ENST00000441788.2_Missense_Mutation_p.A362T	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	362					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		GAAGGCCATCGCCTGGTCCCC	0.672																																					p.A362T		Atlas-SNP	.											.	FZR1	42	.	0			c.G1084A						PASS	.		THR/ALA,THR/ALA,THR/ALA	0,4398		0,0,2199	29.0	31.0	30.0		817,1084,1084	5.4	1.0	19		30	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense,missense	FZR1	NM_001136197.1,NM_001136198.1,NM_016263.3	58,58,58	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	273/405,362/497,362/494	3532490	1,12993	2199	4298	6497	SO:0001583	missense	51343	exon10			GCCATCGCCTGGT	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.1084G>A	19.37:g.3532490G>A	ENSP00000378529:p.Ala362Thr	Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	83	4	0.0481928	NM_001136198	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	ENST00000395095.3	37	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	g	36	5.780530	0.96929	0.0	1.16E-4	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.63744	-0.06;-0.06;-0.06	5.39	5.39	0.77823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047137	0.85682	D	0.000000	T	0.81749	0.4888	M	0.84773	2.715	0.80722	D	1	P;D;D	0.89917	0.889;0.999;1.0	P;D;D	0.91635	0.723;0.968;0.999	D	0.84022	0.0354	10	0.59425	D	0.04	-45.9139	17.7131	0.88327	0.0:0.0:1.0:0.0	.	362;273;362	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	T	362;362;273	ENSP00000410369:A362T;ENSP00000378529:A362T;ENSP00000321800:A273T	ENSP00000321800:A273T	A	+	1	0	FZR1	3483490	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.420000	0.97426	2.531000	0.85337	0.543000	0.68304	GCC	.	.	weak		0.672	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
FZD3	7976	hgsc.bcm.edu	37	8	28385109	28385109	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:28385109A>G	ENST00000240093.3	+	5	1310	c.832A>G	c.(832-834)Aca>Gca	p.T278A	RNA5SP259_ENST00000365541.1_RNA|FZD3_ENST00000537916.1_Missense_Mutation_p.T278A	NM_017412.3	NP_059108.1	Q9NPG1	FZD3_HUMAN	frizzled class receptor 3	278					canonical Wnt signaling pathway (GO:0060070)|cell proliferation in midbrain (GO:0033278)|commissural neuron axon guidance (GO:0071679)|establishment of planar polarity (GO:0001736)|facial nucleus development (GO:0021754)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|post-anal tail morphogenesis (GO:0036342)|vasculature development (GO:0001944)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|neuron projection membrane (GO:0032589)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(15)|ovary(1)|prostate(1)|skin(1)	41		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		TTCCACAGTGACACAAGGATC	0.388																																					p.T278A		Atlas-SNP	.											FZD3,NS,carcinoma,-2,1	FZD3	65	1	0			c.A832G						scavenged	.						89.0	90.0	90.0					8																	28385109		2203	4300	6503	SO:0001583	missense	7976	exon5			ACAGTGACACAAG	AJ272427	CCDS6069.1	8p21	2014-06-27	2014-01-29		ENSG00000104290	ENSG00000104290		"""GPCR / Class F : Frizzled receptors"""	4041	protein-coding gene	gene with protein product		606143	"""frizzled (Drosophila) homolog 3"", ""frizzled homolog 3 (Drosophila)"", ""frizzled 3, seven transmembrane spanning receptor"", ""frizzled family receptor 3"""			10777673, 10873558	Standard	NM_145866		Approved		uc010lvb.3	Q9NPG1	OTTHUMG00000102145	ENST00000240093.3:c.832A>G	8.37:g.28385109A>G	ENSP00000240093:p.Thr278Ala	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	108	2	0.0185185	NM_017412	A8K615	Missense_Mutation	SNP	ENST00000240093.3	37	CCDS6069.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.084038	0.55861	.	.	ENSG00000104290	ENST00000537916;ENST00000240093	D;D	0.81579	-1.51;-1.51	5.11	5.11	0.69529	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.80783	0.4689	L	0.39514	1.22	0.80722	D	1	P	0.50819	0.939	P	0.54664	0.758	T	0.77210	-0.2671	10	0.20046	T	0.44	.	14.0951	0.65016	1.0:0.0:0.0:0.0	.	278	Q9NPG1	FZD3_HUMAN	A	278	ENSP00000437489:T278A;ENSP00000240093:T278A	ENSP00000240093:T278A	T	+	1	0	FZD3	28441028	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.303000	0.72794	1.919000	0.55581	0.460000	0.39030	ACA	.	.	none		0.388	FZD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219986.2	NM_145866	
RBM27	54439	hgsc.bcm.edu	37	5	145631422	145631422	+	Silent	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:145631422T>C	ENST00000265271.5	+	9	1594	c.1428T>C	c.(1426-1428)ccT>ccC	p.P476P	RBM27_ENST00000506502.1_Intron	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	476					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTCCAGCCCTACCCCTCTGG	0.547																																					p.P476P		Atlas-SNP	.											.	RBM27	119	.	0			c.T1428C						PASS	.						246.0	226.0	232.0					5																	145631422		1568	3582	5150	SO:0001819	synonymous_variant	54439	exon9			CAGCCCTACCCCT	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.1428T>C	5.37:g.145631422T>C		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	82	4	0.0487805	NM_018989	Q8IYW9	Silent	SNP	ENST00000265271.5	37	CCDS43378.1																																																																																			.	.	none		0.547	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
ADIPOR2	79602	hgsc.bcm.edu	37	12	1895203	1895203	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:1895203A>G	ENST00000357103.4	+	8	1377	c.1126A>G	c.(1126-1128)Atc>Gtc	p.I376V		NM_024551.2	NP_078827.2	Q86V24	ADR2_HUMAN	adiponectin receptor 2	376					adiponectin-activated signaling pathway (GO:0033211)|fatty acid oxidation (GO:0019395)|female pregnancy (GO:0007565)|heart development (GO:0007507)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of cell growth (GO:0030308)|positive regulation of glucose import (GO:0046326)|response to nutrient (GO:0007584)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|receptor activity (GO:0004872)			endometrium(1)|large_intestine(3)|lung(7)|stomach(1)	12	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			TCGTTTCATGATCGGCGGGGG	0.537																																					p.I376V		Atlas-SNP	.											ADIPOR2,bladder,carcinoma,-2,1	ADIPOR2	30	1	0			c.A1126G						scavenged	.						130.0	127.0	128.0					12																	1895203		2203	4300	6503	SO:0001583	missense	79602	exon8			TTCATGATCGGCG	AY424280	CCDS8511.1	12p13	2012-08-22			ENSG00000006831	ENSG00000006831		"""GPCR / Unclassified : Adiponectin receptors"""	24041	protein-coding gene	gene with protein product		607946				12802337	Standard	NM_024551		Approved	PAQR2, ACDCR2	uc001qjm.3	Q86V24	OTTHUMG00000130139	ENST00000357103.4:c.1126A>G	12.37:g.1895203A>G	ENSP00000349616:p.Ile376Val	Somatic	178	1	0.00561798		WXS	Illumina HiSeq	Phase_I	188	3	0.0159574	NM_024551	Q53YY5|Q9H737	Missense_Mutation	SNP	ENST00000357103.4	37	CCDS8511.1	.	.	.	.	.	.	.	.	.	.	A	6.869	0.529748	0.13127	.	.	ENSG00000006831	ENST00000357103	T	0.16196	2.36	5.29	1.64	0.23874	.	0.216525	0.46758	N	0.000262	T	0.05686	0.0149	N	0.02266	-0.62	0.26149	N	0.98016	B	0.02656	0.0	B	0.01281	0.0	T	0.40403	-0.9565	10	0.17832	T	0.49	-6.3274	8.6202	0.33855	0.5235:0.0:0.4765:0.0	.	376	Q86V24	ADR2_HUMAN	V	376	ENSP00000349616:I376V	ENSP00000349616:I376V	I	+	1	0	ADIPOR2	1765464	1.000000	0.71417	0.837000	0.33122	0.997000	0.91878	2.871000	0.48459	0.035000	0.15519	0.533000	0.62120	ATC	.	.	none		0.537	ADIPOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252447.2	NM_024551	
NAP1L3	4675	hgsc.bcm.edu	37	X	92928071	92928071	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chrX:92928071T>G	ENST00000373079.3	-	1	496	c.233A>C	c.(232-234)aAg>aCg	p.K78T	FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000332647.4_5'Flank|FAM133A_ENST00000322139.4_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.K71T	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	78					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						AGGTACCCTCTTCTTTCTATA	0.612																																					p.K78T		Atlas-SNP	.											.	NAP1L3	81	.	0			c.A233C						PASS	.						16.0	17.0	16.0					X																	92928071		2201	4286	6487	SO:0001583	missense	4675	exon1			ACCCTCTTCTTTC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.233A>C	X.37:g.92928071T>G	ENSP00000362171:p.Lys78Thr	Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	40	10	0.25	NM_004538	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	T	5.105	0.204991	0.09704	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.32988	1.43	3.53	-3.32	0.04973	.	0.287732	0.37348	N	0.002124	T	0.12902	0.0313	N	0.24115	0.695	0.28377	N	0.919728	P	0.34522	0.455	B	0.33568	0.166	T	0.33904	-0.9850	10	0.15066	T	0.55	.	4.8148	0.13362	0.153:0.4055:0.0:0.4415	.	78	Q99457	NP1L3_HUMAN	T	78;71	ENSP00000362171:K78T	ENSP00000362171:K78T	K	-	2	0	NAP1L3	92814727	0.157000	0.22836	0.689000	0.30133	0.173000	0.22820	-0.320000	0.08028	-0.886000	0.03966	-0.509000	0.04479	AAG	.	.	none		0.612	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
ZNF568	374900	hgsc.bcm.edu	37	19	37487723	37487723	+	Missense_Mutation	SNP	G	G	A	rs935707	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:37487723G>A	ENST00000455427.2	+	9	1267	c.938G>A	c.(937-939)cGt>cAt	p.R313H		NM_001204839.1	NP_001191768.1	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAGCCTTTCGTTCCAGCTCA	0.423													A|||	2488	0.496805	0.6006	0.5346	5008	,	,		21469	0.251		0.5109	False		,,,				2504	0.5685				p.R377H		Atlas-SNP	.											ZNF568_ENST00000455427,NS,carcinoma,0,1	ZNF568	106	1	0			c.G1130A						scavenged	.																																			SO:0001583	missense	374900	exon10			CCTTTCGTTCCAG	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000455427.2:c.938G>A	19.37:g.37487723G>A	ENSP00000413396:p.Arg313His	Somatic	2	1	0.5		WXS	Illumina HiSeq	Phase_I	11	7	0.636364	NM_001204838	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000455427.2	37	CCDS56093.1	1029	0.47115384615384615	300	0.6097560975609756	189	0.5220994475138122	148	0.25874125874125875	392	0.5171503957783641	A	13.79	2.340877	0.41498	.	.	ENSG00000198453	ENST00000444991;ENST00000455427;ENST00000433993	T;T;T	0.36520	1.25;3.13;2.24	3.77	-3.09	0.05331	.	.	.	.	.	T	0.00012	0.0000	L	0.39397	1.21	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43893	-0.9363	8	0.49607	T	0.09	.	2.1577	0.03816	0.2269:0.135:0.4165:0.2216	rs935707;rs17272408;rs52828606;rs61607318;rs935707	313;313	E7ER33;B4DS92	.;.	H	377;313;245	ENSP00000389794:R377H;ENSP00000413396:R313H;ENSP00000399643:R245H	ENSP00000399643:R245H	R	+	2	0	ZNF568	42179563	0.000000	0.05858	0.000000	0.03702	0.899000	0.52679	-4.503000	0.00224	-1.433000	0.01977	-0.334000	0.08254	CGT	A|0.476;C|0.009	0.476	strong		0.423	ZNF568-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000457465.1	NM_198539	
ZNF649	65251	hgsc.bcm.edu	37	19	52403358	52403358	+	Start_Codon_SNP	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:52403358C>T	ENST00000354957.3	-	2	287	c.3G>A	c.(1-3)atG>atA	p.M1I	CTC-429C10.2_ENST00000600329.1_RNA|ZNF649_ENST00000600738.1_Start_Codon_SNP_p.M1I	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M1I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		GGGCCTTTGTCATTTTCTTCT	0.373																																					p.M1I		Atlas-SNP	.											ZNF649,colon,carcinoma,0,1	ZNF649	72	1	1	Substitution - Missense(1)	large_intestine(1)	c.G3A						scavenged	.						113.0	109.0	110.0					19																	52403358		2203	4300	6503	SO:0001582	initiator_codon_variant	65251	exon2			CTTTGTCATTTTC	BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.3G>A	19.37:g.52403358C>T	ENSP00000347043:p.Met1Ile	Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	212	3	0.0141509	NM_023074	A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	ENST00000354957.3	37	CCDS12843.1	.	.	.	.	.	.	.	.	.	.	C	9.094	1.002556	0.19121	.	.	ENSG00000198093	ENST00000354957	T	0.06528	3.29	2.07	2.07	0.26955	Krueppel-associated box (1);	.	.	.	.	T	0.17066	0.0410	.	.	.	0.80722	D	1	P	0.51653	0.947	D	0.65140	0.932	T	0.01045	-1.1470	8	0.51188	T	0.08	.	7.6783	0.28499	0.0:1.0:0.0:0.0	.	1	Q9BS31	ZN649_HUMAN	I	1	ENSP00000347043:M1I	ENSP00000347043:M1I	M	-	3	0	ZNF649	57095170	0.974000	0.33945	0.785000	0.31869	0.295000	0.27426	2.928000	0.48908	1.480000	0.48289	0.411000	0.27672	ATG	.	.	none		0.373	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074	Missense_Mutation
SEC14L3	266629	hgsc.bcm.edu	37	22	30867895	30867895	+	Silent	SNP	G	G	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:30867895G>C	ENST00000215812.4	-	1	141	c.51C>G	c.(49-51)gcC>gcG	p.A17A	SEC14L3_ENST00000415957.2_5'Flank|SEC14L3_ENST00000401751.1_5'UTR|SEC14L3_ENST00000403066.1_5'UTR|SEC14L3_ENST00000402286.1_5'UTR|SEC14L3_ENST00000539629.1_5'UTR|SEC14L3_ENST00000540910.1_5'Flank	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	17						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	CTCTCACCTTGGCCAGGGTCT	0.622																																					p.A17A	Esophageal Squamous(108;290 1516 3584 23771 37333)	Atlas-SNP	.											.	SEC14L3	46	.	0			c.C51G						PASS	.						63.0	65.0	64.0					22																	30867895		2203	4300	6503	SO:0001819	synonymous_variant	266629	exon1			CACCTTGGCCAGG	AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.51C>G	22.37:g.30867895G>C		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	44	12	0.272727	NM_174975	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Silent	SNP	ENST00000215812.4	37	CCDS13877.1																																																																																			.	.	none		0.622	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975	
CELA3A	10136	hgsc.bcm.edu	37	1	22333419	22333419	+	Silent	SNP	T	T	C	rs138658162	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:22333419T>C	ENST00000290122.3	+	5	430	c.411T>C	c.(409-411)gaT>gaC	p.D137D		NM_005747.4	NP_005738.4	P09093	CEL3A_HUMAN	chymotrypsin-like elastase family, member 3A	137	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|digestion (GO:0007586)|proteolysis (GO:0006508)		serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						AGCTGGGAGATGCCGTCCAGC	0.637													C|||	16	0.00319489	0.0098	0.0029	5008	,	,		17200	0.0		0.001	False		,,,				2504	0.0				p.D137D		Atlas-SNP	.											CELA3A,NS,carcinoma,0,1	CELA3A	35	1	0			c.T411C						scavenged	.						115.0	101.0	106.0					1																	22333419		2198	4300	6498	SO:0001819	synonymous_variant	10136	exon5			GGGAGATGCCGTC	D00306	CCDS220.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000142789	ENSG00000142789			15944	protein-coding gene	gene with protein product	"""protease E"""		"""elastase 3A, pancreatic (protease E)"", ""elastase 3A, pancreatic"""	ELA3A		2826474, 2460440	Standard	NM_005747		Approved	ELA3		P09093	OTTHUMG00000002755	ENST00000290122.3:c.411T>C	1.37:g.22333419T>C		Somatic	416	9	0.0216346		WXS	Illumina HiSeq	Phase_I	440	25	0.0568182	NM_005747	B1AQ53|Q9BRW4	Silent	SNP	ENST00000290122.3	37	CCDS220.1																																																																																			T|0.991;C|0.009	0.009	strong		0.637	CELA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007791.1	NM_005747	
ZNF385D	79750	hgsc.bcm.edu	37	3	21552504	21552504	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:21552504C>T	ENST00000281523.2	-	4	806	c.288G>A	c.(286-288)gcG>gcA	p.A96A	ZNF385D_ENST00000494118.1_5'UTR	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	96						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						TGTAGTGGGCCGCAGCCTGGC	0.443																																					p.A96A		Atlas-SNP	.											ZNF385D,NS,carcinoma,-1,2	ZNF385D	93	2	0			c.G288A						scavenged	.						175.0	146.0	156.0					3																	21552504		2203	4300	6503	SO:0001819	synonymous_variant	79750	exon4			GTGGGCCGCAGCC	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.288G>A	3.37:g.21552504C>T		Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	165	3	0.0181818	NM_024697		Silent	SNP	ENST00000281523.2	37	CCDS2636.1																																																																																			.	.	none		0.443	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697	
MUC4	4585	hgsc.bcm.edu	37	3	195515078	195515078	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:195515078C>T	ENST00000463781.3	-	2	3832	c.3373G>A	c.(3373-3375)Gac>Aac	p.D1125N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D1125N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	564					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D1125N(3)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.562																																					p.D1125N		Atlas-SNP	.											MUC4_ENST00000463781,bladder,carcinoma,+1,5	MUC4	1505	5	3	Substitution - Missense(3)	endometrium(3)	c.G3373A						scavenged	.																																			SO:0001583	missense	4585	exon2			AAGTGTCGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3373G>A	3.37:g.195515078C>T	ENSP00000417498:p.Asp1125Asn	Somatic	86	1	0.0116279		WXS	Illumina HiSeq	Phase_I	113	3	0.0265487	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.951	0.359409	0.11239	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30182	1.56;1.54	0.814	-1.63	0.08345	.	.	.	.	.	T	0.18676	0.0448	N	0.19112	0.55	0.09310	N	1	D	0.59357	0.985	P	0.48738	0.588	T	0.05971	-1.0853	8	.	.	.	.	0.3671	0.00373	0.2014:0.3069:0.2014:0.2903	.	1125	E7ESK3	.	N	1125	ENSP00000417498:D1125N;ENSP00000420243:D1125N	.	D	-	1	0	MUC4	196999473	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	-3.293000	0.00523	-1.645000	0.01515	0.064000	0.15345	GAC	.	.	none		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SMC1B	27127	hgsc.bcm.edu	37	22	45802439	45802439	+	Silent	SNP	T	T	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:45802439T>G	ENST00000357450.4	-	4	516	c.517A>C	c.(517-519)Aga>Cga	p.R173R	SMC1B_ENST00000404354.3_Silent_p.R173R	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	173					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TGTAACTTTCTTTTCTTTTCT	0.368																																					p.R173R		Atlas-SNP	.											.	SMC1B	215	.	0			c.A517C						PASS	.						85.0	77.0	80.0					22																	45802439		1809	4072	5881	SO:0001819	synonymous_variant	27127	exon4			ACTTTCTTTTCTT	AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.517A>C	22.37:g.45802439T>G		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	70	28	0.4	NM_148674	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Silent	SNP	ENST00000357450.4	37	CCDS43027.1																																																																																			.	.	none		0.368	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674	
FAM120B	84498	hgsc.bcm.edu	37	6	170627769	170627769	+	Missense_Mutation	SNP	T	T	C	rs6905610	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:170627769T>C	ENST00000476287.1	+	2	1399	c.1291T>C	c.(1291-1293)Tct>Cct	p.S431P	FAM120B_ENST00000252510.9_Intron|FAM120B_ENST00000537664.1_Missense_Mutation_p.S454P|FAM120B_ENST00000540480.1_Missense_Mutation_p.S443P	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	431			S -> P (in dbSNP:rs6905610).		cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		GTATACAGACTCTGAACCCAG	0.507													C|||	41	0.0081869	0.0045	0.0101	5008	,	,		20133	0.0109		0.004	False		,,,				2504	0.0133				p.S431P		Atlas-SNP	.											FAM120B,colon,carcinoma,0,1	FAM120B	108	1	0			c.T1291C						scavenged	.						184.0	201.0	195.0					6																	170627769		2203	4299	6502	SO:0001583	missense	84498	exon2			ACAGACTCTGAAC	AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.1291T>C	6.37:g.170627769T>C	ENSP00000417970:p.Ser431Pro	Somatic	86	5	0.0581395		WXS	Illumina HiSeq	Phase_I	112	9	0.0803571	NM_032448	B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	ENST00000476287.1	37	CCDS5314.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.780159	0.00634	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287	T;T;T	0.09630	3.01;2.96;2.96	3.07	-3.94	0.04130	.	0.566372	0.19678	N	0.108600	T	0.00384	0.0012	N	0.00159	-1.955	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20009	-1.0288	10	0.02654	T	1	-0.3731	6.5921	0.22651	0.0:0.5063:0.2428:0.2509	rs6905610	431;431	Q96EK7;F2Z2E1	F120B_HUMAN;.	P	443;454;431	ENSP00000444125:S443P;ENSP00000440125:S454P;ENSP00000417970:S431P	ENSP00000436640:S431P	S	+	1	0	FAM120B	170469694	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.160000	0.01279	-1.079000	0.03113	-0.734000	0.03567	TCT	T|0.985;C|0.015	0.015	weak		0.507	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
POTEC	388468	hgsc.bcm.edu	37	18	14513764	14513764	+	Missense_Mutation	SNP	C	C	T	rs201788045		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr18:14513764C>T	ENST00000358970.5	-	10	1429	c.1430G>A	c.(1429-1431)cGg>cAg	p.R477Q		NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	477								p.R477Q(12)		NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						AAGTTGTTTCCGGGTATCATT	0.358																																					p.R477Q		Atlas-SNP	.											POTEC,NS,carcinoma,0,17	POTEC	129	17	12	Substitution - Missense(12)	endometrium(4)|kidney(3)|urinary_tract(2)|prostate(2)|soft_tissue(1)	c.G1430A						scavenged	.						13.0	9.0	10.0					18																	14513764		683	1543	2226	SO:0001583	missense	388468	exon10			TGTTTCCGGGTAT	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.1430G>A	18.37:g.14513764C>T	ENSP00000351856:p.Arg477Gln	Somatic	400	3	0.0075		WXS	Illumina HiSeq	Phase_I	382	10	0.026178	NM_001137671		Missense_Mutation	SNP	ENST00000358970.5	37	CCDS45835.1	492	0.22527472527472528	61	0.12398373983739837	82	0.2265193370165746	187	0.3269230769230769	162	0.21372031662269128	c	0.001	-3.539655	0.00009	.	.	ENSG00000183206	ENST00000358970	T	0.20881	2.04	1.34	0.0657	0.14358	.	.	.	.	.	T	0.00012	0.0000	N	0.00116	-2.08	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42430	-0.9452	9	0.06757	T	0.87	.	3.4153	0.07373	0.0:0.2473:0.0:0.7527	.	477	B2RU33	POTEC_HUMAN	Q	477	ENSP00000351856:R477Q	ENSP00000351856:R477Q	R	-	2	0	POTEC	14503764	0.885000	0.30320	0.063000	0.19743	0.005000	0.04900	1.581000	0.36558	0.005000	0.14708	-1.615000	0.00797	CGG	.	.	weak		0.358	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
MUC4	4585	hgsc.bcm.edu	37	3	195511523	195511523	+	Missense_Mutation	SNP	C	C	T	rs142766505	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:195511523C>T	ENST00000463781.3	-	2	7387	c.6928G>A	c.(6928-6930)Gct>Act	p.A2310T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2310T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGCGTCGGTGACA	0.582													.|||	33	0.00658946	0.0166	0.0014	5008	,	,		11074	0.0079		0.002	False		,,,				2504	0.0				p.A2310T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	3	0			c.G6928A						scavenged	.						4.0	5.0	5.0					3																	195511523		472	1216	1688	SO:0001583	missense	4585	exon2			AGGAAGCGTCGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6928G>A	3.37:g.195511523C>T	ENSP00000417498:p.Ala2310Thr	Somatic	94	9	0.0957447		WXS	Illumina HiSeq	Phase_I	105	9	0.0857143	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	6.846	0.525410	0.13066	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35789	1.29;1.33	.	.	.	.	0.000000	0.25517	N	0.030134	T	0.15132	0.0365	N	0.19112	0.55	0.09310	N	1	B	0.28350	0.208	B	0.11329	0.006	T	0.14980	-1.0453	8	.	.	.	.	4.7077	0.12858	0.3536:0.6463:0.0:1.0E-4	.	2310	E7ESK3	.	T	2310	ENSP00000417498:A2310T;ENSP00000420243:A2310T	.	A	-	1	0	MUC4	196995918	0.000000	0.05858	0.002000	0.10522	0.072000	0.16883	-1.461000	0.02366	-0.833000	0.04245	0.064000	0.15345	GCT	C|0.703;G|0.137;T|0.159	0.159	strong		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TMTC4	84899	hgsc.bcm.edu	37	13	101287335	101287335	+	Silent	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr13:101287335C>A	ENST00000376234.3	-	10	1449	c.1260G>T	c.(1258-1260)ggG>ggT	p.G420G	TMTC4_ENST00000462211.1_5'UTR|TMTC4_ENST00000328767.5_Silent_p.G309G|TMTC4_ENST00000342624.5_Silent_p.G439G	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	420						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCACACAGTACCCAACGCTGG	0.537																																					p.G439G		Atlas-SNP	.											.	TMTC4	103	.	0			c.G1317T						PASS	.						84.0	77.0	79.0					13																	101287335		2203	4300	6503	SO:0001819	synonymous_variant	84899	exon11			ACAGTACCCAACG		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1260G>T	13.37:g.101287335C>A		Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	216	12	0.0555556	NM_032813	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Silent	SNP	ENST00000376234.3	37	CCDS41904.1																																																																																			.	.	none		0.537	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813	
ZPLD1	131368	hgsc.bcm.edu	37	3	102187821	102187821	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:102187821C>T	ENST00000491959.1	+	15	1657	c.775C>T	c.(775-777)Cct>Tct	p.P259S	ZPLD1_ENST00000466937.1_Missense_Mutation_p.P259S|ZPLD1_ENST00000306176.1_Missense_Mutation_p.P275S			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	259	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)		p.P275T(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						TGACAAGGACCCTCAGACCAC	0.438																																					p.P275S		Atlas-SNP	.											ZPLD1,rectum,carcinoma,-2,3	ZPLD1	82	3	1	Substitution - Missense(1)	ovary(1)	c.C823T						scavenged	.						64.0	65.0	65.0					3																	102187821		2203	4300	6503	SO:0001583	missense	131368	exon8			AAGGACCCTCAGA	AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.775C>T	3.37:g.102187821C>T	ENSP00000420265:p.Pro259Ser	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	131	5	0.0381679	NM_175056	Q49AS1|Q8WU36	Missense_Mutation	SNP	ENST00000491959.1	37		.	.	.	.	.	.	.	.	.	.	C	18.39	3.613661	0.66672	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	T;T;T	0.81078	-1.45;-1.45;-1.45	5.47	5.47	0.80525	Zona pellucida sperm-binding protein (3);	0.047572	0.85682	D	0.000000	T	0.79251	0.4414	L	0.31476	0.935	0.80722	D	1	D;P	0.58620	0.983;0.503	P;B	0.50825	0.651;0.238	T	0.77019	-0.2743	10	0.29301	T	0.29	-13.8774	19.3006	0.94143	0.0:1.0:0.0:0.0	.	275;259	Q8TCW7-2;Q8TCW7	.;ZPLD1_HUMAN	S	259;275;259	ENSP00000420265:P259S;ENSP00000307801:P275S;ENSP00000418253:P259S	ENSP00000307801:P275S	P	+	1	0	ZPLD1	103670511	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.042000	0.70996	2.571000	0.86741	0.462000	0.41574	CCT	.	.	none		0.438	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056	
AQP7	364	hgsc.bcm.edu	37	9	33395103	33395103	+	Silent	SNP	G	G	A	rs148012859		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:33395103G>A	ENST00000539936.1	-	3	355	c.117C>T	c.(115-117)gcC>gcT	p.A39A	AQP7_ENST00000537089.1_5'UTR|AQP7_ENST00000377425.4_Intron|AQP7_ENST00000541274.1_5'UTR			O14520	AQP7_HUMAN	aquaporin 7	39					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)	p.A39A(1)		NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TCATGAACTCGGCCAGGAACT	0.582																																					p.A39A		Atlas-SNP	.											AQP7,NS,carcinoma,0,1	AQP7	58	1	1	Substitution - coding silent(1)	prostate(1)	c.C117T						scavenged	.						126.0	85.0	99.0					9																	33395103		2203	4300	6503	SO:0001819	synonymous_variant	364	exon3			GAACTCGGCCAGG	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000539936.1:c.117C>T	9.37:g.33395103G>A		Somatic	270	4	0.0148148		WXS	Illumina HiSeq	Phase_I	257	5	0.0194553	NM_001170	Q08E94|Q5T5L9|Q8NHM3	Silent	SNP	ENST00000539936.1	37																																																																																				A|0.002;G|0.998;T|0.000	0.002	strong		0.582	AQP7-203	KNOWN	basic	protein_coding	protein_coding		NM_001170	
SLC29A1	2030	hgsc.bcm.edu	37	6	44197393	44197393	+	Missense_Mutation	SNP	C	C	T	rs201335180		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:44197393C>T	ENST00000393841.1	+	5	670	c.179C>T	c.(178-180)gCc>gTc	p.A60V	SLC29A1_ENST00000313248.7_Missense_Mutation_p.A139V|SLC29A1_ENST00000371755.3_Missense_Mutation_p.A60V|SLC29A1_ENST00000371713.1_Missense_Mutation_p.A60V|SLC29A1_ENST00000427851.2_Missense_Mutation_p.A60V|SLC29A1_ENST00000371724.1_Missense_Mutation_p.A60V|SLC29A1_ENST00000371731.1_Missense_Mutation_p.A60V|SLC29A1_ENST00000371708.1_Missense_Mutation_p.A60V|SLC29A1_ENST00000371740.5_Missense_Mutation_p.A60V|SLC29A1_ENST00000393844.1_Missense_Mutation_p.A60V|SLC29A1_ENST00000472176.1_3'UTR	NM_001078177.1	NP_001071645.1	Q99808	S29A1_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 1	60					cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|lactation (GO:0007595)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sleep (GO:0030431)|transmembrane transport (GO:0055085)|uridine transport (GO:0015862)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	17	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Cytarabine(DB00987)|Didanosine(DB00900)|Fludarabine(DB01073)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Pemetrexed(DB00642)|Ribavirin(DB00811)|Zalcitabine(DB00943)	AGCAAGGACGCCCAGGCGTCA	0.562																																					p.A60V		Atlas-SNP	.											SLC29A1,NS,carcinoma,+1,1	SLC29A1	45	1	0			c.C179T						scavenged	.						122.0	117.0	119.0					6																	44197393		2203	4300	6503	SO:0001583	missense	2030	exon4			AGGACGCCCAGGC	U81375	CCDS4908.1	6p21.1	2013-07-17	2013-07-17		ENSG00000112759	ENSG00000112759		"""Solute carriers"""	11003	protein-coding gene	gene with protein product		602193	"""solute carrier family 29 (nucleoside transporters), member 1"""	ENT1		8986748, 9344680	Standard	NM_004955		Approved		uc003owy.2	Q99808	OTTHUMG00000014759	ENST00000393841.1:c.179C>T	6.37:g.44197393C>T	ENSP00000377424:p.Ala60Val	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	143	2	0.013986	NM_004955	B3KQV7|B3KQY5|Q5T9W9|Q9UJY2	Missense_Mutation	SNP	ENST00000393841.1	37	CCDS4908.1	.	.	.	.	.	.	.	.	.	.	C	8.603	0.887316	0.17540	.	.	ENSG00000112759	ENST00000544345;ENST00000393844;ENST00000313248;ENST00000427851;ENST00000371755;ENST00000371740;ENST00000371731;ENST00000393841;ENST00000371724;ENST00000371713;ENST00000371708	T;T;T;T;T;T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05;2.05;2.05;2.05;2.05;2.05	4.95	-5.52	0.02560	.	.	.	.	.	T	0.02848	0.0085	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.13594	0.0;0.008;0.0;0.0	B;B;B;B	0.06405	0.0;0.002;0.0;0.0	T	0.45877	-0.9231	9	0.13853	T	0.58	-27.6775	8.719	0.34430	0.1383:0.6105:0.0:0.2512	.	60;79;139;60	B7Z1J8;B7Z914;B3KQV7;Q99808	.;.;.;S29A1_HUMAN	V	79;60;139;60;60;60;60;60;60;60;60	ENSP00000377427:A60V;ENSP00000319152:A139V;ENSP00000392668:A60V;ENSP00000360820:A60V;ENSP00000360805:A60V;ENSP00000360796:A60V;ENSP00000377424:A60V;ENSP00000360789:A60V;ENSP00000360778:A60V;ENSP00000360773:A60V	ENSP00000319152:A139V	A	+	2	0	SLC29A1	44305371	0.000000	0.05858	0.000000	0.03702	0.125000	0.20455	-0.215000	0.09279	-0.707000	0.05022	-0.471000	0.05019	GCC	C|0.999;T|0.001	0.001	weak		0.562	SLC29A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040721.1		
LRP1B	53353	hgsc.bcm.edu	37	2	141294279	141294279	+	Splice_Site	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:141294279C>A	ENST00000389484.3	-	46	8485		c.e46-1			NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B						protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAATTTTTAGCTGCAAGAAAA	0.328										TSP Lung(27;0.18)																											.	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.7514-1G>T						PASS	.						49.0	48.0	48.0					2																	141294279		2203	4300	6503	SO:0001630	splice_region_variant	53353	exon47			TTTTAGCTGCAAG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7514-1G>T	2.37:g.141294279C>A		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	94	27	0.287234	NM_018557	Q8WY29|Q8WY30|Q8WY31	Splice_Site	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.970286	0.74246	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9639	0.92687	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP1B	141010749	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	7.726000	0.84824	2.490000	0.84030	0.650000	0.86243	.	.	.	none		0.328	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Intron
TRIM48	79097	hgsc.bcm.edu	37	11	55032663	55032663	+	Missense_Mutation	SNP	T	T	C	rs200778682	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:55032663T>C	ENST00000417545.2	+	2	418	c.332T>C	c.(331-333)aTt>aCt	p.I111T		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	95						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ATGTGTGGCATTCACAGGGAG	0.498																																					p.I111T		Atlas-SNP	.											TRIM48_ENST00000417545,NS,carcinoma,0,4	TRIM48	149	4	0			c.T332C						scavenged	.						98.0	90.0	93.0					11																	55032663		2188	4256	6444	SO:0001583	missense	79097	exon2			GTGGCATTCACAG	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.332T>C	11.37:g.55032663T>C	ENSP00000402414:p.Ile111Thr	Somatic	624	13	0.0208333		WXS	Illumina HiSeq	Phase_I	752	14	0.018617	NM_024114	Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	c	0	-2.612529	0.00120	.	.	ENSG00000150244	ENST00000417545	T	0.40476	1.03	0.596	0.596	0.17496	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, B-box (3);	.	.	.	.	T	0.13114	0.0318	N	0.03324	-0.35	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28038	-1.0056	9	0.02654	T	1	.	1.7225	0.02915	0.3221:0.4182:0.0:0.2597	.	95	Q8IWZ4	TRI48_HUMAN	T	111	ENSP00000402414:I111T	ENSP00000402414:I111T	I	+	2	0	TRIM48	54789239	0.000000	0.05858	0.154000	0.22540	0.130000	0.20726	-4.117000	0.00292	-0.174000	0.10743	-1.141000	0.01876	ATT	T|0.996;C|0.004	0.004	strong		0.498	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1		
TTN	7273	hgsc.bcm.edu	37	2	179600638	179600638	+	Silent	SNP	G	G	A	rs184307461	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:179600638G>A	ENST00000591111.1	-	48	13808	c.13584C>T	c.(13582-13584)gaC>gaT	p.D4528D	TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Silent_p.D3601D|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000589042.1_Silent_p.D4845D|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12284	Ig-like 25.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTTTTCTGCGTCGGAAATCC	0.443													G|||	3	0.000599042	0.0	0.0043	5008	,	,		20196	0.0		0.0	False		,,,				2504	0.0				p.D4845D		Atlas-SNP	.											TTN_ENST00000356127,NS,carcinoma,-2,2	TTN	18412	2	0			c.C14535T						PASS	.	G	,,,	0,3874		0,0,1937	135.0	131.0	132.0		,10803,,	-0.5	0.5	2		132	2,8284		0,2,4141	no	intron,coding-synonymous,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,2,6078	AA,AG,GG		0.0241,0.0,0.0164	,,,	,3601/33424,,	179600638	2,12158	1937	4143	6080	SO:0001819	synonymous_variant	7273	exon50			TTCTGCGTCGGAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.13584C>T	2.37:g.179600638G>A		Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	205	43	0.209756	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				G|1.000;A|0.000	0.000	strong		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ADAM29	11086	hgsc.bcm.edu	37	4	175899130	175899130	+	Silent	SNP	G	G	A	rs376108430	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:175899130G>A	ENST00000359240.3	+	5	3124	c.2454G>A	c.(2452-2454)acG>acA	p.T818T	ADAM29_ENST00000445694.1_Silent_p.T818T|ADAM29_ENST00000514159.1_Silent_p.T818T|ADAM29_ENST00000404450.4_Silent_p.T818T|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	818	9 X 9 AA approximate repeats.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T818T(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CTCCTGTGACGCCCTCCTAGA	0.587													G|||	9	0.00179712	0.0	0.0	5008	,	,		17825	0.0069		0.0	False		,,,				2504	0.002				p.T818T	Ovarian(140;1727 1835 21805 25838 41440)	Atlas-SNP	.											ADAM29,NS,carcinoma,0,1	ADAM29	262	1	1	Substitution - coding silent(1)	lung(1)	c.G2454A						scavenged	.	G	,,,	2,4404	4.2+/-10.8	0,2,2201	107.0	105.0	106.0		2454,2454,2454,2454	-1.3	0.0	4		106	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ADAM29	NM_001130703.1,NM_001130704.1,NM_001130705.1,NM_014269.4	,,,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,,,	818/821,818/821,818/821,818/821	175899130	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	11086	exon4			TGTGACGCCCTCC	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2454G>A	4.37:g.175899130G>A		Somatic	63	2	0.031746		WXS	Illumina HiSeq	Phase_I	75	9	0.12	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Silent	SNP	ENST00000359240.3	37	CCDS3823.1																																																																																			.	.	weak		0.587	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
MYC	4609	hgsc.bcm.edu	37	8	128750536	128750536	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128750536A>G	ENST00000259523.6	+	2	1233	c.28A>G	c.(28-30)Agg>Ggg	p.R10G	MYC_ENST00000524013.1_Missense_Mutation_p.R24G|MYC_ENST00000377970.2_Missense_Mutation_p.R25G			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	10				R -> K (in Ref. 5; no nucleotide entry). {ECO:0000305}.	branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	CTTCACCAACAGGAACTATGA	0.597		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R25G		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.A73G						PASS	.						74.0	74.0	74.0					8																	128750536		2203	4300	6503	SO:0001583	missense	4609	exon2			ACCAACAGGAACT		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.28A>G	8.37:g.128750536A>G	ENSP00000259523:p.Arg10Gly	Somatic	75	0	0	1567	WXS	Illumina HiSeq	Phase_I	88	31	0.352273	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000259523.6	37		.	.	.	.	.	.	.	.	.	.	A	18.41	3.617613	0.66787	.	.	ENSG00000136997	ENST00000259523;ENST00000517291;ENST00000377970;ENST00000524013;ENST00000454617	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	5.08	5.08	0.68730	Transcription regulator Myc, N-terminal (1);	0.194195	0.53938	D	0.000047	T	0.19565	0.0470	L	0.40543	1.245	0.30828	N	0.737012	B	0.31459	0.324	B	0.30716	0.119	T	0.11036	-1.0604	10	0.46703	T	0.11	-13.7167	14.1763	0.65544	1.0:0.0:0.0:0.0	.	10	P01106	MYC_HUMAN	G	10;24;25;24;10	ENSP00000259523:R10G;ENSP00000429441:R24G;ENSP00000367207:R25G;ENSP00000430235:R24G	ENSP00000259523:R10G	R	+	1	2	MYC	128819718	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	6.799000	0.75160	2.144000	0.66660	0.459000	0.35465	AGG	.	.	none		0.597	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
GRM4	2914	hgsc.bcm.edu	37	6	34004150	34004150	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:34004150G>C	ENST00000538487.2	-	9	2180	c.1737C>G	c.(1735-1737)atC>atG	p.I579M	GRM4_ENST00000609222.1_Missense_Mutation_p.I446M|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000535756.1_Missense_Mutation_p.I446M|GRM4_ENST00000544773.2_Missense_Mutation_p.I410M|GRM4_ENST00000455714.2_Missense_Mutation_p.I439M|GRM4_ENST00000374181.4_Missense_Mutation_p.I579M|GRM4_ENST00000374177.3_Missense_Mutation_p.I463M	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	579					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						ACTCAAGCTTGATGATGGGGA	0.632																																					p.I579M		Atlas-SNP	.											.	GRM4	317	.	0			c.C1737G						PASS	.						47.0	45.0	46.0					6																	34004150		2203	4300	6503	SO:0001583	missense	2914	exon9			AAGCTTGATGATG	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.1737C>G	6.37:g.34004150G>C	ENSP00000440556:p.Ile579Met	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	79	15	0.189873	NM_000841	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376436	0.24857	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.88201	-2.35;-2.34;-2.1;-2.14;-2.17;-2.35;-2.18	4.81	2.11	0.27256	.	0.230082	0.44483	D	0.000446	D	0.84880	0.5570	M	0.76328	2.33	0.29060	N	0.883982	B;P;P;P;P	0.44344	0.447;0.58;0.773;0.664;0.833	B;B;P;B;B	0.48840	0.326;0.39;0.592;0.216;0.438	T	0.78899	-0.2022	10	0.49607	T	0.09	.	9.8402	0.40993	0.2272:0.0:0.7728:0.0	.	532;410;439;579;446	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	M	579;463;271;446;410;579;439	ENSP00000363296:I579M;ENSP00000363292:I463M;ENSP00000445533:I271M;ENSP00000437925:I446M;ENSP00000437730:I410M;ENSP00000440556:I579M;ENSP00000398456:I439M	ENSP00000363292:I463M	I	-	3	3	GRM4	34112128	1.000000	0.71417	1.000000	0.80357	0.380000	0.30137	1.355000	0.34068	0.259000	0.21709	-0.480000	0.04831	ATC	.	.	none		0.632	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
PDE3A	5139	hgsc.bcm.edu	37	12	20787945	20787945	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:20787945A>T	ENST00000359062.3	+	8	1996	c.1956A>T	c.(1954-1956)aaA>aaT	p.K652N	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	652					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CTCTGAGGAAAGCATCGGCTT	0.433																																					p.K652N		Atlas-SNP	.											.	PDE3A	184	.	0			c.A1956T						PASS	.						135.0	114.0	121.0					12																	20787945		2203	4300	6503	SO:0001583	missense	5139	exon8			GAGGAAAGCATCG		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1956A>T	12.37:g.20787945A>T	ENSP00000351957:p.Lys652Asn	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	111	7	0.0630631	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	A	7.711	0.695201	0.15039	.	.	ENSG00000172572	ENST00000359062	T	0.62105	0.05	5.64	-0.807	0.10872	.	7739.210000	0.00166	N	0.000000	T	0.50565	0.1623	L	0.36672	1.1	0.09310	N	1	B	0.16396	0.017	B	0.06405	0.002	T	0.17501	-1.0367	10	0.27785	T	0.31	.	6.338	0.21306	0.4635:0.1377:0.3988:0.0	.	652	Q14432	PDE3A_HUMAN	N	652	ENSP00000351957:K652N	ENSP00000351957:K652N	K	+	3	2	PDE3A	20679212	0.993000	0.37304	0.091000	0.20842	0.139000	0.21198	1.258000	0.32944	-0.134000	0.11516	0.528000	0.53228	AAA	.	.	none		0.433	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
IKZF2	22807	hgsc.bcm.edu	37	2	213872244	213872244	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:213872244T>C	ENST00000434687.1	-	9	1730	c.1421A>G	c.(1420-1422)gAg>gGg	p.E474G	IKZF2_ENST00000374319.4_Missense_Mutation_p.E448G|IKZF2_ENST00000451136.2_Missense_Mutation_p.E402G|IKZF2_ENST00000413091.3_3'UTR|IKZF2_ENST00000457361.1_Missense_Mutation_p.E474G|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000421754.2_Missense_Mutation_p.E400G|IKZF2_ENST00000374327.4_Missense_Mutation_p.E329G|IKZF2_ENST00000342002.2_Missense_Mutation_p.E480G			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	474					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		TCGGCAGTGCTCACACTTGAA	0.498																																					p.E474G		Atlas-SNP	.											IKZF2,bladder,carcinoma,-1,1	IKZF2	71	1	0			c.A1421G						scavenged	.						182.0	172.0	175.0					2																	213872244		2203	4300	6503	SO:0001583	missense	22807	exon8			CAGTGCTCACACT	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.1421A>G	2.37:g.213872244T>C	ENSP00000412869:p.Glu474Gly	Somatic	280	1	0.00357143		WXS	Illumina HiSeq	Phase_I	368	6	0.0163043	NM_016260	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	ENST00000434687.1	37	CCDS2395.1	.	.	.	.	.	.	.	.	.	.	T	14.70	2.614878	0.46631	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327;ENST00000542010	T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99	5.83	5.83	0.93111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.64402	D	0.000002	T	0.60314	0.2259	L	0.50993	1.605	0.80722	D	1	D;D;D;B;D;D	0.89917	0.998;1.0;1.0;0.311;1.0;0.999	D;D;D;B;D;D	0.87578	0.969;0.994;0.998;0.276;0.993;0.947	T	0.62329	-0.6877	10	0.72032	D	0.01	-8.8486	16.1926	0.82004	0.0:0.0:0.0:1.0	.	402;400;329;448;474;252	C9JCG7;C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7;Q96LD7	.;.;.;.;IKZF2_HUMAN;.	G	474;480;474;448;402;400;329;178	ENSP00000410447:E474G;ENSP00000342876:E480G;ENSP00000412869:E474G;ENSP00000363439:E448G;ENSP00000395203:E402G;ENSP00000399574:E400G;ENSP00000363447:E329G	ENSP00000342876:E480G	E	-	2	0	IKZF2	213580489	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.906000	0.56340	2.219000	0.72066	0.533000	0.62120	GAG	.	.	none		0.498	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	NM_016260	
PTPRO	5800	hgsc.bcm.edu	37	12	15637161	15637161	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:15637161G>A	ENST00000281171.4	+	2	659	c.329G>A	c.(328-330)aGa>aAa	p.R110K	PTPRO_ENST00000543886.1_Missense_Mutation_p.R110K|PTPRO_ENST00000348962.2_Missense_Mutation_p.R110K	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	110	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				AAGCCATCCAGATCAATCACT	0.413																																					p.R110K		Atlas-SNP	.											.	PTPRO	148	.	0			c.G329A						PASS	.						95.0	95.0	95.0					12																	15637161		2203	4300	6503	SO:0001583	missense	5800	exon2			CATCCAGATCAAT	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.329G>A	12.37:g.15637161G>A	ENSP00000281171:p.Arg110Lys	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	145	6	0.0413793	NM_002848	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	37	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.606381	0.46527	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T	0.03889	3.78;3.77	5.58	4.69	0.59074	Fibronectin, type III (1);	0.000000	0.56097	D	0.000029	T	0.03564	0.0102	N	0.14661	0.345	0.80722	D	1	B;B;B	0.24963	0.049;0.029;0.115	B;B;B	0.24848	0.008;0.004;0.056	T	0.48843	-0.8999	10	0.48119	T	0.1	.	10.1372	0.42715	0.1479:0.0:0.8521:0.0	.	110;110;110	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	K	110	ENSP00000281171:R110K;ENSP00000343434:R110K	ENSP00000281171:R110K	R	+	2	0	PTPRO	15528428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.889000	0.56212	2.630000	0.89119	0.655000	0.94253	AGA	.	.	none		0.413	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1		
SPAG5	10615	hgsc.bcm.edu	37	17	26919654	26919654	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:26919654T>C	ENST00000321765.5	-	3	940	c.608A>G	c.(607-609)gAg>gGg	p.E203G		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	203					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					TGGAGACTCCTCTAAGAGATG	0.493																																					p.E203G		Atlas-SNP	.											.	SPAG5	92	.	0			c.A608G						PASS	.						103.0	102.0	103.0					17																	26919654		2203	4300	6503	SO:0001583	missense	10615	exon3			GACTCCTCTAAGA	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.608A>G	17.37:g.26919654T>C	ENSP00000323300:p.Glu203Gly	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	134	48	0.358209	NM_006461	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	T	1.807	-0.475729	0.04414	.	.	ENSG00000076382	ENST00000321765	T	0.43688	0.94	5.33	2.99	0.34606	.	0.841403	0.10417	N	0.677155	T	0.22437	0.0541	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.18335	-1.0340	10	0.87932	D	0	-0.7221	4.8055	0.13317	0.0:0.0969:0.1906:0.7125	.	203	Q96R06	SPAG5_HUMAN	G	203	ENSP00000323300:E203G	ENSP00000323300:E203G	E	-	2	0	SPAG5	23943781	0.008000	0.16893	0.003000	0.11579	0.058000	0.15608	1.333000	0.33816	0.857000	0.35407	0.533000	0.62120	GAG	.	.	none		0.493	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
ALDH3B2	222	hgsc.bcm.edu	37	11	67432799	67432799	+	Silent	SNP	G	G	A	rs80147122		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:67432799G>A	ENST00000349015.3	-	7	1101	c.663C>T	c.(661-663)cgC>cgT	p.R221R	ALDH3B2_ENST00000530069.1_Silent_p.R221R|ALDH3B2_ENST00000531881.1_5'Flank	NM_000695.3	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3 family, member B2	221					alcohol metabolic process (GO:0006066)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)		3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	18						CAATGGCCACGCGGCTGCAGC	0.632																																					p.R221R		Atlas-SNP	.											ALDH3B2,NS,haematopoietic_neoplasm,0,2	ALDH3B2	46	2	0			c.C663T						scavenged	.						52.0	59.0	57.0					11																	67432799		2200	4293	6493	SO:0001819	synonymous_variant	222	exon7			GGCCACGCGGCTG	U37519	CCDS31622.1	11q13.2	2014-09-04			ENSG00000132746	ENSG00000132746	1.2.1.5	"""Aldehyde dehydrogenases"""	411	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 8"", ""acetaldehyde dehydrogenase 8"""	601917		ALDH8		8890755, 9161417	Standard	NM_000695		Approved		uc001oms.3	P48448	OTTHUMG00000167284	ENST00000349015.3:c.663C>T	11.37:g.67432799G>A		Somatic	271	2	0.00738007		WXS	Illumina HiSeq	Phase_I	271	7	0.0258303	NM_001031615	Q53Y98|Q8NAL5|Q96IB2	Silent	SNP	ENST00000349015.3	37	CCDS31622.1																																																																																			.	.	strong		0.632	ALDH3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394004.1	NM_000695	
IKBKB	3551	hgsc.bcm.edu	37	8	42166458	42166458	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:42166458G>A	ENST00000520810.1	+	8	793	c.607G>A	c.(607-609)Gtc>Atc	p.V203I	IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000520835.1_Missense_Mutation_p.V201I|IKBKB_ENST00000416505.2_Missense_Mutation_p.V144I|IKBKB_ENST00000519735.1_Missense_Mutation_p.V203I|IKBKB_ENST00000379708.3_Intron	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	203	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CACAGTGACCGTCGACTACTG	0.657																																					p.V203I		Atlas-SNP	.											.	IKBKB	88	.	0			c.G607A						PASS	.						149.0	129.0	136.0					8																	42166458		2203	4300	6503	SO:0001583	missense	3551	exon8			GTGACCGTCGACT	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.607G>A	8.37:g.42166458G>A	ENSP00000430684:p.Val203Ile	Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	91	36	0.395604	NM_001556	B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	37	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	G	34	5.373729	0.95923	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000519735;ENST00000520835	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	4.92	4.92	0.64577	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62392	0.2424	M	0.62209	1.925	0.80722	D	1	P;D;D;D;D	0.76494	0.947;0.994;0.998;0.999;0.986	B;P;D;D;P	0.68621	0.4;0.864;0.959;0.915;0.834	T	0.64630	-0.6362	10	0.56958	D	0.05	.	18.4904	0.90844	0.0:0.0:1.0:0.0	.	144;201;154;203;203	B4E0U4;O14920-2;Q59GL9;O14920;Q32ND9	.;.;.;IKKB_HUMAN;.	I	203;144;203;201	ENSP00000430684:V203I;ENSP00000404920:V144I;ENSP00000430483:V203I;ENSP00000430868:V201I	ENSP00000404920:V144I	V	+	1	0	IKBKB	42285615	1.000000	0.71417	0.833000	0.33012	0.967000	0.64934	9.743000	0.98849	2.437000	0.82529	0.563000	0.77884	GTC	.	.	none		0.657	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1		
MITF	4286	hgsc.bcm.edu	37	3	70008463	70008463	+	Silent	SNP	C	C	T	rs149086403		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:70008463C>T	ENST00000448226.2	+	9	1198	c.1071C>T	c.(1069-1071)tcC>tcT	p.S357S	MITF_ENST00000328528.6_Silent_p.S350S|MITF_ENST00000314557.6_Silent_p.S244S|MITF_ENST00000472437.1_Silent_p.S299S|MITF_ENST00000394351.3_Silent_p.S250S|MITF_ENST00000394355.2_Silent_p.S326S|MITF_ENST00000352241.4_Silent_p.S351S|MITF_ENST00000531774.1_Silent_p.S188S|MITF_ENST00000314589.5_Silent_p.S335S			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	357	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.		S -> P (in WS2A). {ECO:0000269|PubMed:8589691}.		bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		TAAAAGCATCCGTGGACTATA	0.433			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.S351S	Melanoma(29;269 969 31479 41502 42961)	Atlas-SNP	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	MITF_ENST00000352241,colon,carcinoma,+1,2	MITF	156	2	0			c.C1053T						scavenged	.	C	,,,,,,	0,4406		0,0,2203	88.0	79.0	82.0		750,897,1050,732,1053,1005,564	-5.0	0.5	3	dbSNP_134	82	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MITF	NM_000248.3,NM_001184967.1,NM_006722.2,NM_198158.2,NM_198159.2,NM_198177.2,NM_198178.2	,,,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,,,	250/420,299/469,350/520,244/414,351/521,335/505,188/358	70008463	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4286	exon9			AGCATCCGTGGAC		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.1071C>T	3.37:g.70008463C>T		Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	103	3	0.0291262	NM_198159	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	37																																																																																				C|1.000;T|0.000	0.000	weak		0.433	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
FANCF	2188	hgsc.bcm.edu	37	11	22646551	22646551	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:22646551G>A	ENST00000327470.3	-	1	836	c.806C>T	c.(805-807)gCg>gTg	p.A269V	AC103801.2_ENST00000428556.2_5'Flank	NM_022725.3	NP_073562.1	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	269					DNA repair (GO:0006281)|ovarian follicle development (GO:0001541)|spermatogenesis (GO:0007283)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			kidney(3)|large_intestine(3)|lung(6)|skin(1)	13						AGGAGACAGCGCTGGGTGGCG	0.542			"""N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A269V		Atlas-SNP	.	yes	Rec		Fanconi anaemia F	11	11p15	2188	"""Fanconi anemia, complementation group F"""		L	FANCF,colon,carcinoma,+1,1	FANCF	24	1	0			c.C806T						scavenged	.						51.0	59.0	57.0					11																	22646551		2203	4300	6503	SO:0001583	missense	2188	exon1	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GACAGCGCTGGGT		CCDS7857.1	11p15	2014-09-17				ENSG00000183161		"""Fanconi anemia, complementation groups"""	3587	protein-coding gene	gene with protein product		613897				9382107	Standard	NM_022725		Approved	FAF	uc001mql.1	Q9NPI8		ENST00000327470.3:c.806C>T	11.37:g.22646551G>A	ENSP00000330875:p.Ala269Val	Somatic	53	0	0	757	WXS	Illumina HiSeq	Phase_I	62	2	0.0322581	NM_022725	Q52LM0	Missense_Mutation	SNP	ENST00000327470.3	37	CCDS7857.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.385953	0.42308	.	.	ENSG00000183161	ENST00000327470	T	0.30981	1.51	5.34	-1.63	0.08345	.	0.677816	0.14310	U	0.327714	T	0.22975	0.0555	N	0.24115	0.695	0.09310	N	1	D	0.53885	0.963	P	0.50825	0.651	T	0.20405	-1.0276	10	0.30078	T	0.28	-4.8245	6.9838	0.24718	0.0656:0.0856:0.2961:0.5527	.	269	Q9NPI8	FANCF_HUMAN	V	269	ENSP00000330875:A269V	ENSP00000330875:A269V	A	-	2	0	FANCF	22603127	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.376000	0.07465	-0.478000	0.06823	-0.310000	0.09108	GCG	.	.	none		0.542	FANCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387712.2	NM_022725	
PCLO	27445	hgsc.bcm.edu	37	7	82584184	82584184	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:82584184T>C	ENST00000333891.9	-	5	6422	c.6085A>G	c.(6085-6087)Att>Gtt	p.I2029V	PCLO_ENST00000423517.2_Missense_Mutation_p.I2029V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTTGAAACAATATCTTCCTGA	0.378																																					p.I2029V		Atlas-SNP	.											Q9Y6V0-3,colon,carcinoma,+1,3	PCLO	1506	3	0			c.A6085G						scavenged	.						69.0	67.0	67.0					7																	82584184		1845	4091	5936	SO:0001583	missense	27445	exon5			AAACAATATCTTC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6085A>G	7.37:g.82584184T>C	ENSP00000334319:p.Ile2029Val	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	180	3	0.0166667	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	8.220	0.802250	0.16397	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16324	2.35;2.35	5.64	4.49	0.54785	.	.	.	.	.	T	0.18087	0.0434	L	0.51422	1.61	0.80722	D	1	B;B	0.11235	0.004;0.004	B;B	0.15484	0.013;0.013	T	0.02208	-1.1195	9	0.87932	D	0	.	11.4939	0.50398	0.0:0.0703:0.0:0.9297	.	2029;2029	Q9Y6V0-5;Q9Y6V0-6	.;.	V	1960;2029;2029	ENSP00000334319:I2029V;ENSP00000388393:I2029V	ENSP00000334319:I2029V	I	-	1	0	PCLO	82422120	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	3.444000	0.52914	0.971000	0.38288	0.459000	0.35465	ATT	.	.	none		0.378	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
MYC	4609	hgsc.bcm.edu	37	8	128750613	128750613	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128750613G>A	ENST00000259523.6	+	2	1310	c.105G>A	c.(103-105)caG>caA	p.Q35Q	MYC_ENST00000524013.1_Silent_p.Q49Q|MYC_ENST00000377970.2_Silent_p.Q50Q			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	35	Poly-Gln.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACCAGCAGCAGCAGCAGAGCG	0.622		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q50Q		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	MYC_ENST00000377970,NS,lymphoid_neoplasm,0,4	MYC	168	4	0			c.G150A						PASS	.						42.0	44.0	44.0					8																	128750613		2203	4300	6503	SO:0001819	synonymous_variant	4609	exon2			GCAGCAGCAGCAG		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.105G>A	8.37:g.128750613G>A		Somatic	75	0	0	1567	WXS	Illumina HiSeq	Phase_I	88	29	0.329545	NM_002467	A8WFE7|P01107|Q14026	Silent	SNP	ENST00000259523.6	37		.	.	.	.	.	.	.	.	.	.	G	9.434	1.086417	0.20390	.	.	ENSG00000136997	ENST00000520751	.	.	.	5.08	2.26	0.28386	.	.	.	.	.	T	0.65964	0.2742	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64812	-0.6319	5	0.87932	D	0	-22.7786	9.9515	0.41642	0.3084:0.0:0.6916:0.0	.	.	.	.	N	24	.	ENSP00000430226:S24N	S	+	2	0	MYC	128819795	1.000000	0.71417	0.998000	0.56505	0.774000	0.43823	1.221000	0.32503	0.054000	0.16065	-1.134000	0.01955	AGC	.	.	none		0.622	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
FRG1	2483	hgsc.bcm.edu	37	4	190878562	190878562	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:190878562G>C	ENST00000226798.4	+	6	664	c.442G>C	c.(442-444)Gct>Cct	p.A148P	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	148					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GGGGAAAATGGCTTTGTTGGC	0.363																																					p.A148P		Atlas-SNP	.											FRG1,NS,carcinoma,0,2	FRG1	76	2	0			c.G442C						scavenged	.						12.0	17.0	16.0					4																	190878562		2131	4254	6385	SO:0001583	missense	2483	exon6			AAAATGGCTTTGT	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.442G>C	4.37:g.190878562G>C	ENSP00000226798:p.Ala148Pro	Somatic	159	2	0.0125786		WXS	Illumina HiSeq	Phase_I	240	5	0.0208333	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	19.12	3.766684	0.69878	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.58506	1.64;0.33	4.19	4.19	0.49359	Actin cross-linking (1);	0.049541	0.85682	D	0.000000	T	0.79545	0.4464	M	0.90369	3.11	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.84484	0.0607	10	0.72032	D	0.01	9.1062	14.4711	0.67517	0.0:0.0:1.0:0.0	.	148	Q14331	FRG1_HUMAN	P	148;20;85	ENSP00000226798:A148P;ENSP00000435943:A85P	ENSP00000226798:A148P	A	+	1	0	FRG1	191115556	1.000000	0.71417	1.000000	0.80357	0.516000	0.34256	9.545000	0.98095	2.063000	0.61619	0.454000	0.30748	GCT	.	.	none		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
MSH3	4437	hgsc.bcm.edu	37	5	79950717	79950717	+	Silent	SNP	C	C	T	rs201874762|rs201906899	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:79950717C>T	ENST00000265081.6	+	1	251	c.171C>T	c.(169-171)gcC>gcT	p.A57A	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000505337.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	57	Poly-Ala.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8942985}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ctgcagcggccgcagcggccg	0.701								Mismatch excision repair (MMR)					-|||	1025	0.204673	0.2602	0.1715	5008	,	,		6102	0.0466		0.2048	False		,,,				2504	0.316				p.A57A	Melanoma(88;1010 1399 13793 26548 36275)	Atlas-SNP	.											MSH3_ENST00000265081,NS,carcinoma,+2,1	MSH3	129	1	0			c.C171T						scavenged	.						6.0	7.0	7.0					5																	79950717		2068	4046	6114	SO:0001819	synonymous_variant	4437	exon1			AGCGGCCGCAGCG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.171C>T	5.37:g.79950717C>T		Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	12	3	0.25	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	ENST00000265081.6	37	CCDS34195.1																																																																																			C|0.979;T|0.021	0.021	strong		0.701	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
HAVCR1	26762	hgsc.bcm.edu	37	5	156479571	156479571	+	Missense_Mutation	SNP	C	C	T	rs6149307|rs386693994|rs183130208|rs141023871	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:156479571C>T	ENST00000339252.3	-	3	1006	c.474G>A	c.(472-474)atG>atA	p.M158I	HAVCR1_ENST00000522693.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000425854.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000544197.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000523175.1_Missense_Mutation_p.M158I	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	11 X 6 AA approximate tandem repeats of V-P-T-T-T-T].|Thr-rich.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAACAGTCGTCATTGGAACAG	0.488																																					p.M158I		Atlas-SNP	.											.	HAVCR1	84	.	0			c.G474A						PASS	.						413.0	302.0	340.0					5																	156479571		2079	3991	6070	SO:0001583	missense	26762	exon4			AGTCGTCATTGGA	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.474G>A	5.37:g.156479571C>T	ENSP00000344844:p.Met158Ile	Somatic	342	0	0		WXS	Illumina HiSeq	Phase_I	437	23	0.0526316	NM_001099414	O43656	Missense_Mutation	SNP	ENST00000339252.3	37	CCDS43392.1	.	.	.	.	.	.	.	.	.	.	C	2.575	-0.298775	0.05532	.	.	ENSG00000113249	ENST00000522693;ENST00000523175;ENST00000339252;ENST00000425854;ENST00000544197;ENST00000518745	T;T;T;T;T;T	0.13901	2.55;2.6;2.6;2.55;2.6;2.57	1.56	-3.12	0.05282	.	.	.	.	.	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.31392	-0.9945	7	0.62326	D	0.03	.	0.1239	0.00067	0.2901:0.1916:0.1631:0.3551	.	.	.	.	I	158	ENSP00000428524:M158I;ENSP00000427898:M158I;ENSP00000344844:M158I;ENSP00000403333:M158I;ENSP00000440258:M158I;ENSP00000428422:M158I	ENSP00000344844:M158I	M	-	3	0	HAVCR1	156412149	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.878000	0.28126	-1.479000	0.01867	-0.507000	0.04495	ATG	.	.	weak		0.488	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
CNIH3	149111	hgsc.bcm.edu	37	1	224804946	224804946	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:224804946G>T	ENST00000272133.3	+	1	952	c.70G>T	c.(70-72)Gcc>Tcc	p.A24S	RP11-100E13.1_ENST00000437416.1_RNA	NM_152495.1	NP_689708.1	Q8TBE1	CNIH3_HUMAN	cornichon family AMPA receptor auxiliary protein 3	24					intracellular signal transduction (GO:0035556)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|postsynaptic membrane (GO:0045211)	channel regulator activity (GO:0016247)			large_intestine(5)|lung(4)	9	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		CATCTTCTTCGCCATCTGGCA	0.567																																					p.A24S		Atlas-SNP	.											CNIH3,NS,carcinoma,0,1	CNIH3	23	1	0			c.G70T						scavenged	.						292.0	273.0	280.0					1																	224804946		2203	4300	6503	SO:0001583	missense	149111	exon1			TTCTTCGCCATCT	AF070524	CCDS1544.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143786	ENSG00000143786			26802	protein-coding gene	gene with protein product			"""cornichon homolog 3 (Drosophila)"""			8619474, 9110174	Standard	NM_152495		Approved	FLJ38993, CNIH-3	uc001hos.1	Q8TBE1	OTTHUMG00000037634	ENST00000272133.3:c.70G>T	1.37:g.224804946G>T	ENSP00000272133:p.Ala24Ser	Somatic	207	0	0		WXS	Illumina HiSeq	Phase_I	206	3	0.0145631	NM_152495		Missense_Mutation	SNP	ENST00000272133.3	37	CCDS1544.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.408411	0.83340	.	.	ENSG00000143786	ENST00000272133	T	0.42131	0.98	4.85	3.93	0.45458	.	0.000000	0.85682	D	0.000000	T	0.28234	0.0697	N	0.25789	0.76	0.58432	D	0.999998	P	0.44946	0.846	B	0.39379	0.298	T	0.02450	-1.1157	10	0.24483	T	0.36	-0.2858	11.9949	0.53196	0.0857:0.0:0.9142:0.0	.	24	Q8TBE1	CNIH3_HUMAN	S	24	ENSP00000272133:A24S	ENSP00000272133:A24S	A	+	1	0	CNIH3	222871569	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.054000	0.93866	1.037000	0.40024	-0.136000	0.14681	GCC	.	.	none		0.567	CNIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091752.2	NM_152495	
TRIM17	51127	hgsc.bcm.edu	37	1	228598862	228598862	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:228598862G>A	ENST00000366697.2	-	3	1497	c.541C>T	c.(541-543)Cgg>Tgg	p.R181W	TRIM17_ENST00000295033.3_Missense_Mutation_p.R181W|TRIM17_ENST00000366698.2_Missense_Mutation_p.R181W|TRIM17_ENST00000456946.2_Missense_Mutation_p.R181W|RP11-245P10.4_ENST00000436779.1_RNA			Q9Y577	TRI17_HUMAN	tripartite motif containing 17	181					protein autoubiquitination (GO:0051865)	intracellular (GO:0005622)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	10		Prostate(94;0.0724)				CGTTCTCTCCGCTCCTTCACC	0.597																																					p.R181W		Atlas-SNP	.											TRIM17_ENST00000456946,colon,carcinoma,+1,2	TRIM17	66	2	0			c.C541T						scavenged	.						89.0	91.0	91.0					1																	228598862		2203	4300	6503	SO:0001583	missense	51127	exon4			CTCTCCGCTCCTT	AF156271	CCDS1571.1, CCDS44327.1	1q42	2013-01-09	2011-01-25	2001-11-30	ENSG00000162931	ENSG00000162931		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13430	protein-coding gene	gene with protein product	"""ring finger protein 16"", ""RING finger protein terf"", ""testis RING finger protein"""	606123	"""tripartite motif-containing 17"""	RNF16		9792805, 10894938	Standard	NM_016102		Approved	terf, RBCC	uc001hsv.3	Q9Y577	OTTHUMG00000039974	ENST00000366697.2:c.541C>T	1.37:g.228598862G>A	ENSP00000355658:p.Arg181Trp	Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	184	4	0.0217391	NM_001024940	B4DVJ2|Q5VST8	Missense_Mutation	SNP	ENST00000366697.2	37	CCDS1571.1	.	.	.	.	.	.	.	.	.	.	g	11.06	1.527563	0.27299	.	.	ENSG00000162931	ENST00000366697;ENST00000366698;ENST00000295033;ENST00000456946;ENST00000479800	T;T;T;T;T	0.10477	2.87;2.87;2.87;2.87;2.87	4.08	0.902	0.19290	.	0.561882	0.13727	N	0.366935	T	0.20333	0.0489	L	0.58583	1.82	0.09310	N	0.999999	D;D	0.76494	0.998;0.999	P;P	0.61275	0.886;0.549	T	0.06180	-1.0841	10	0.59425	D	0.04	.	5.6096	0.17398	0.1021:0.0:0.5226:0.3754	.	181;181	Q9Y577-2;Q9Y577	.;TRI17_HUMAN	W	181;181;181;181;154	ENSP00000355658:R181W;ENSP00000355659:R181W;ENSP00000295033:R181W;ENSP00000403312:R181W;ENSP00000430468:R154W	ENSP00000295033:R181W	R	-	1	2	TRIM17	226665485	0.000000	0.05858	0.003000	0.11579	0.033000	0.12548	-0.449000	0.06812	0.366000	0.24427	0.443000	0.29094	CGG	.	.	none		0.597	TRIM17-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096439.2	NM_016102	
FOXO3	2309	hgsc.bcm.edu	37	6	108985269	108985269	+	Silent	SNP	C	C	T	rs34079373		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:108985269C>T	ENST00000343882.6	+	3	1537	c.1233C>T	c.(1231-1233)agC>agT	p.S411S	FOXO3_ENST00000406360.1_Silent_p.S411S|FOXO3_ENST00000540898.1_Silent_p.S191S	NM_201559.2	NP_963853.1	O43524	FOXO3_HUMAN	forkhead box O3	411					antral ovarian follicle growth (GO:0001547)|cellular response to oxidative stress (GO:0034599)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|initiation of primordial ovarian follicle growth (GO:0001544)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|ovulation from ovarian follicle (GO:0001542)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S411S(1)		central_nervous_system(5)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		TGCAGCGGAGCTCTAGCTTCC	0.592																																					p.S411S		Atlas-SNP	.											FOXO3,NS,carcinoma,0,1	FOXO3	67	1	1	Substitution - coding silent(1)	prostate(1)	c.C1233T						scavenged	.						57.0	60.0	59.0					6																	108985269		2203	4300	6503	SO:0001819	synonymous_variant	2309	exon2			GCGGAGCTCTAGC	AF032886	CCDS5068.1	6q21	2008-09-08	2007-05-02	2007-05-02	ENSG00000118689	ENSG00000118689		"""Forkhead boxes"""	3821	protein-coding gene	gene with protein product		602681		FKHRL1, FOXO3A		9479491	Standard	NM_001455		Approved	AF6q21, FOXO2	uc003psm.2	O43524	OTTHUMG00000015327	ENST00000343882.6:c.1233C>T	6.37:g.108985269C>T		Somatic	90	1	0.0111111		WXS	Illumina HiSeq	Phase_I	113	3	0.0265487	NM_001455	B4DVZ6|E1P5E6|O15171|Q5T2I7|Q9BZ04	Silent	SNP	ENST00000343882.6	37	CCDS5068.1																																																																																			.	.	weak		0.592	FOXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041722.2		
POTEC	388468	hgsc.bcm.edu	37	18	14542916	14542916	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr18:14542916G>T	ENST00000358970.5	-	1	229	c.230C>A	c.(229-231)aCg>aAg	p.T77K	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	77										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CACGTTGCTCGTGCCGCTCCC	0.577																																					p.T77K		Atlas-SNP	.											POTEC,NS,carcinoma,+1,1	POTEC	129	1	0			c.C230A						scavenged	.						42.0	51.0	48.0					18																	14542916		692	1591	2283	SO:0001583	missense	388468	exon1			TTGCTCGTGCCGC	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.230C>A	18.37:g.14542916G>T	ENSP00000351856:p.Thr77Lys	Somatic	329	4	0.0121581		WXS	Illumina HiSeq	Phase_I	385	13	0.0337662	NM_001137671		Missense_Mutation	SNP	ENST00000358970.5	37	CCDS45835.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.707401	0.00096	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.22743	1.94	0.429	-0.857	0.10693	.	.	.	.	.	T	0.03827	0.0108	N	0.00841	-1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19614	-1.0300	8	0.02654	T	1	.	.	.	.	.	77	B2RU33	POTEC_HUMAN	K	77	ENSP00000351856:T77K	ENSP00000351856:T77K	T	-	2	0	POTEC	14532916	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.710000	0.01888	-2.489000	0.00518	-1.883000	0.00544	ACG	G|1.000;|0.000	.	weak		0.577	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
SYDE1	85360	hgsc.bcm.edu	37	19	15224520	15224520	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:15224520G>A	ENST00000342784.2	+	8	1985	c.1954G>A	c.(1954-1956)Gcc>Acc	p.A652T	SYDE1_ENST00000600252.1_Missense_Mutation_p.A309T|SYDE1_ENST00000600440.1_Missense_Mutation_p.A585T	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	652					activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)			endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						CAACCGCTACGCCGGCGACTG	0.692																																					p.A652T		Atlas-SNP	.											.	SYDE1	44	.	0			c.G1954A						PASS	.						43.0	53.0	50.0					19																	15224520		2203	4298	6501	SO:0001583	missense	85360	exon8			CGCTACGCCGGCG	BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.1954G>A	19.37:g.15224520G>A	ENSP00000341489:p.Ala652Thr	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	34	8	0.235294	NM_033025	Q7L2I8|Q8N6J2|Q9H8K4	Missense_Mutation	SNP	ENST00000342784.2	37	CCDS12324.1	.	.	.	.	.	.	.	.	.	.	G	35	5.533392	0.96460	.	.	ENSG00000105137	ENST00000342784	T	0.55930	0.49	5.52	5.52	0.82312	.	0.134668	0.48767	D	0.000170	T	0.73916	0.3648	M	0.79123	2.44	0.54753	D	0.99998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.76995	-0.2752	10	0.87932	D	0	.	16.928	0.86182	0.0:0.0:1.0:0.0	.	585;585;652	B2RD93;Q6ZW31-2;Q6ZW31	.;.;SYDE1_HUMAN	T	652	ENSP00000341489:A652T	ENSP00000341489:A652T	A	+	1	0	SYDE1	15085520	1.000000	0.71417	0.979000	0.43373	0.968000	0.65278	9.146000	0.94640	2.604000	0.88044	0.491000	0.48974	GCC	.	.	none		0.692	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465666.1	NM_033025	
ZNF208	7757	hgsc.bcm.edu	37	19	22155696	22155696	+	Missense_Mutation	SNP	T	T	C	rs201427226		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:22155696T>C	ENST00000397126.4	-	4	2288	c.2140A>G	c.(2140-2142)Att>Gtt	p.I714V	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	714					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCAGTATGAATTCTCTTATGT	0.363																																					p.I714V		Atlas-SNP	.											ZNF208_ENST00000428290,caecum,carcinoma,0,3	ZNF208	817	3	0			c.A2140G						scavenged	.						34.0	36.0	35.0					19																	22155696		1994	4182	6176	SO:0001583	missense	7757	exon4			TATGAATTCTCTT	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2140A>G	19.37:g.22155696T>C	ENSP00000380315:p.Ile714Val	Somatic	21	1	0.047619		WXS	Illumina HiSeq	Phase_I	20	4	0.2	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	T	10.16	1.273186	0.23221	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.00986	5.47	1.9	-0.727	0.11166	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02119	0.0066	.	.	.	0.22001	N	0.999425	D	0.67145	0.996	D	0.63877	0.919	T	0.45673	-0.9245	8	0.36615	T	0.2	.	2.6811	0.05094	0.3914:0.1391:0.0:0.4695	.	614	O43345	ZN208_HUMAN	V	714;614	ENSP00000380315:I714V	ENSP00000380315:I714V	I	-	1	0	ZNF208	21947536	0.000000	0.05858	0.002000	0.10522	0.258000	0.26162	0.170000	0.16663	-0.730000	0.04869	0.232000	0.17820	ATT	.	.	weak		0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
TATDN2	9797	hgsc.bcm.edu	37	3	10318158	10318158	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:10318158C>T	ENST00000287652.4	+	5	2998	c.1947C>T	c.(1945-1947)gaC>gaT	p.D649D	RP11-438J1.1_ENST00000450534.1_3'UTR|TATDN2_ENST00000448281.2_Silent_p.D649D|TATDN2_ENST00000496355.1_3'UTR	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	649					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						TGCCCCCTGACTACAAGATCC	0.458																																					p.D649D		Atlas-SNP	.											.	TATDN2	59	.	0			c.C1947T						PASS	.						72.0	65.0	68.0					3																	10318158		2203	4300	6503	SO:0001819	synonymous_variant	9797	exon5			CCCTGACTACAAG	D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.1947C>T	3.37:g.10318158C>T		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	52	4	0.0769231	NM_014760	Q3MIL9|Q5BKU0	Silent	SNP	ENST00000287652.4	37	CCDS33698.1																																																																																			.	.	none		0.458	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	XM_376203	
ABLIM1	3983	hgsc.bcm.edu	37	10	116225565	116225565	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:116225565G>A	ENST00000277895.5	-	12	1430	c.1333C>T	c.(1333-1335)Cgg>Tgg	p.R445W	ABLIM1_ENST00000392952.3_Missense_Mutation_p.R157W|ABLIM1_ENST00000369252.4_Missense_Mutation_p.R385W|ABLIM1_ENST00000369253.2_Missense_Mutation_p.R103W|ABLIM1_ENST00000369266.3_Missense_Mutation_p.R157W|ABLIM1_ENST00000533213.2_Missense_Mutation_p.R385W	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	445					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		TGGATCATCCGATCCCGAACA	0.557																																					p.R445W		Atlas-SNP	.											ABLIM1_ENST00000392952,rectum,carcinoma,+1,6	ABLIM1	131	6	0			c.C1333T						scavenged	.						202.0	182.0	189.0					10																	116225565		2203	4300	6503	SO:0001583	missense	3983	exon12			TCATCCGATCCCG	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.1333C>T	10.37:g.116225565G>A	ENSP00000277895:p.Arg445Trp	Somatic	109	1	0.00917431		WXS	Illumina HiSeq	Phase_I	135	2	0.0148148	NM_002313	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	ENST00000277895.5	37	CCDS7590.1	.	.	.	.	.	.	.	.	.	.	G	33	5.219819	0.95139	.	.	ENSG00000099204	ENST00000336585;ENST00000369252;ENST00000392952;ENST00000369257;ENST00000369267;ENST00000533213;ENST00000369262;ENST00000369263;ENST00000369266;ENST00000369256;ENST00000369260;ENST00000277895;ENST00000369253;ENST00000440467;ENST00000428430	T;T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71;-0.71	5.41	5.41	0.78517	.	0.246709	0.41500	D	0.000864	D	0.82323	0.5012	M	0.63428	1.95	0.53688	D	0.999979	D;P;D;D;D;D;D;D;D	0.89917	1.0;0.622;1.0;1.0;1.0;1.0;1.0;1.0;1.0	P;B;D;D;P;D;D;P;D	0.91635	0.899;0.043;0.999;0.96;0.872;0.983;0.994;0.872;0.997	T	0.80774	-0.1232	10	0.40728	T	0.16	.	17.7392	0.88403	0.0:0.0:1.0:0.0	.	369;129;385;413;445;157;413;369;103	B7Z4H1;B4DQA3;F8W8M4;A6NKJ2;O14639;O14639-5;B3KVH2;C9K0X4;O14639-4	.;.;.;.;ABLM1_HUMAN;.;.;.;.	W	445;385;157;103;413;385;473;369;157;369;369;473;157;110;129	ENSP00000358256:R385W;ENSP00000376679:R157W;ENSP00000433629:R385W;ENSP00000358270:R157W;ENSP00000414154:R110W;ENSP00000400934:R129W	ENSP00000277895:R473W	R	-	1	2	ABLIM1	116215555	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.737000	0.98831	2.706000	0.92434	0.650000	0.86243	CGG	.	.	none		0.557	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3		
STK32B	55351	hgsc.bcm.edu	37	4	5418579	5418579	+	Silent	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:5418579T>C	ENST00000282908.5	+	6	902	c.480T>C	c.(478-480)gtT>gtC	p.V160V	STK32B_ENST00000512636.1_Intron|STK32B_ENST00000510398.1_Silent_p.V113V	NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						CAGGACATGTTCACATTACAG	0.507																																					p.V160V		Atlas-SNP	.											STK32B,NS,carcinoma,+2,1	STK32B	87	1	0			c.T480C						scavenged	.						90.0	75.0	80.0					4																	5418579		2203	4300	6503	SO:0001819	synonymous_variant	55351	exon6			ACATGTTCACATT	AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.480T>C	4.37:g.5418579T>C		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	84	3	0.0357143	NM_018401		Silent	SNP	ENST00000282908.5	37	CCDS3380.1																																																																																			.	.	none		0.507	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
TULP4	56995	hgsc.bcm.edu	37	6	158922767	158922767	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:158922767T>C	ENST00000367097.3	+	13	3429	c.2072T>C	c.(2071-2073)aTt>aCt	p.I691T	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	691					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		AACATCCCTATTGCACCGATC	0.522																																					p.I691T		Atlas-SNP	.											TULP4,NS,carcinoma,0,1	TULP4	137	1	0			c.T2072C						scavenged	.						130.0	114.0	119.0					6																	158922767		2203	4300	6503	SO:0001583	missense	56995	exon13			TCCCTATTGCACC		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.2072T>C	6.37:g.158922767T>C	ENSP00000356064:p.Ile691Thr	Somatic	185	1	0.00540541		WXS	Illumina HiSeq	Phase_I	237	3	0.0126582	NM_020245	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.854335	0.91355	.	.	ENSG00000130338	ENST00000367097	T	0.69175	-0.38	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.75606	0.3872	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.79242	-0.1884	10	0.87932	D	0	-26.7153	16.0357	0.80628	0.0:0.0:0.0:1.0	.	691	Q9NRJ4	TULP4_HUMAN	T	691	ENSP00000356064:I691T	ENSP00000356064:I691T	I	+	2	0	TULP4	158842755	1.000000	0.71417	0.983000	0.44433	0.993000	0.82548	7.476000	0.81055	2.192000	0.70111	0.528000	0.53228	ATT	.	.	none		0.522	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	
ZNF33A	7581	hgsc.bcm.edu	37	10	38343345	38343345	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:38343345A>C	ENST00000458705.2	+	5	448	c.290A>C	c.(289-291)aAc>aCc	p.N97T	ZNF33A_ENST00000432900.2_Missense_Mutation_p.N104T|ZNF33A_ENST00000374618.3_Missense_Mutation_p.N98T|ZNF33A_ENST00000469037.2_Missense_Mutation_p.N98T|ZNF33A_ENST00000307441.9_Missense_Mutation_p.N97T			Q06730	ZN33A_HUMAN	zinc finger protein 33A	97					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						AGCCAAGAAAACCAATCTAAA	0.348																																					p.N98T		Atlas-SNP	.											.	ZNF33A	103	.	0			c.A293C						PASS	.						90.0	91.0	90.0					10																	38343345		2203	4300	6503	SO:0001583	missense	7581	exon5			AAGAAAACCAATC	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.290A>C	10.37:g.38343345A>C	ENSP00000387713:p.Asn97Thr	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	122	24	0.196721	NM_006954	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	ENST00000458705.2	37	CCDS31182.1	.	.	.	.	.	.	.	.	.	.	A	10.12	1.263115	0.23051	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000277672;ENST00000307441	T;T;T;T	0.06218	3.34;3.34;3.33;3.33	1.46	1.46	0.22682	.	0.192021	0.25487	N	0.030322	T	0.09247	0.0228	L	0.45228	1.405	0.25885	N	0.983546	D;B;P;D	0.55385	0.971;0.031;0.952;0.971	P;B;P;P	0.52554	0.691;0.012;0.494;0.702	T	0.09552	-1.0669	10	0.51188	T	0.08	.	6.9664	0.24625	1.0:0.0:0.0:0.0	.	104;98;97;98	F6TH33;Q9H5I4;Q06730;F8WAJ5	.;.;ZN33A_HUMAN;.	T	98;104;97;98;97	ENSP00000363747:N98T;ENSP00000402467:N104T;ENSP00000387713:N97T;ENSP00000304268:N97T	ENSP00000277672:N98T	N	+	2	0	ZNF33A	38383351	0.912000	0.30974	0.296000	0.24974	0.924000	0.55760	1.642000	0.37207	0.918000	0.36919	0.377000	0.23210	AAC	.	.	none		0.348	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974	
DEFB119	245932	hgsc.bcm.edu	37	20	29976828	29976828	+	Intron	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:29976828C>T	ENST00000376321.3	-	1	181				DEFB119_ENST00000376315.2_Silent_p.*89*|DEFB119_ENST00000492344.1_Intron|DEFB119_ENST00000339144.3_Intron	NM_153289.3	NP_695021.2	Q8N690	DB119_HUMAN	defensin, beta 119						defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				large_intestine(2)|lung(1)|prostate(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			AAAGTCATTTCTATCTATTAG	0.363																																					p.X89X		Atlas-SNP	.											DEFB119_ENST00000376315,NS,carcinoma,0,1	DEFB119	37	1	0			c.G267A						scavenged	.						78.0	71.0	74.0					20																	29976828		2203	4300	6503	SO:0001627	intron_variant	245932	exon2			TCATTTCTATCTA	AA939044	CCDS13178.1, CCDS33455.1	20q11.21	2007-02-19	2003-10-06		ENSG00000180483	ENSG00000180483		"""Defensins, beta"""	18099	protein-coding gene	gene with protein product			"""defensin, beta 120"""	DEFB120		11854508	Standard	NM_153289		Approved	DEFB-19, DEFB-20	uc002wvu.2	Q8N690	OTTHUMG00000032172	ENST00000376321.3:c.61+1397G>A	20.37:g.29976828C>T		Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	99	2	0.020202	NM_153323	Q5GRG1|Q5JWP1|Q5TH42|Q8N689	Silent	SNP	ENST00000376321.3	37	CCDS13178.1																																																																																			.	.	none		0.363	DEFB119-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078514.1	NM_153289	
ARRDC4	91947	hgsc.bcm.edu	37	15	98512603	98512603	+	Silent	SNP	C	C	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:98512603C>G	ENST00000268042.6	+	5	1040	c.876C>G	c.(874-876)tcC>tcG	p.S292S	ARRDC4_ENST00000538249.1_Silent_p.S205S	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	292					positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			TGGACTATTCCTTAGCTGTAA	0.398																																					p.S292S		Atlas-SNP	.											.	ARRDC4	30	.	0			c.C876G						PASS	.						86.0	78.0	81.0					15																	98512603		2197	4298	6495	SO:0001819	synonymous_variant	91947	exon5			CTATTCCTTAGCT	BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.876C>G	15.37:g.98512603C>G		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	95	36	0.378947	NM_183376	Q6NSI9	Silent	SNP	ENST00000268042.6	37	CCDS10377.1																																																																																			.	.	none		0.398	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313535.1	NM_183376	
STK10	6793	hgsc.bcm.edu	37	5	171482633	171482633	+	Missense_Mutation	SNP	C	C	T	rs115040416	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:171482633C>T	ENST00000176763.5	-	16	2828	c.2485G>A	c.(2485-2487)Ggc>Agc	p.G829S		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	829	Gln-rich.				cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.G829S(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTGCCCCCGCCGTTGATGTGG	0.642													C|||	3	0.000599042	0.0	0.0	5008	,	,		15696	0.003		0.0	False		,,,				2504	0.0				p.G829S		Atlas-SNP	.											STK10,NS,carcinoma,0,1	STK10	100	1	1	Substitution - Missense(1)	lung(1)	c.G2485A						scavenged	.						36.0	30.0	32.0					5																	171482633		2203	4300	6503	SO:0001583	missense	6793	exon16			CCCCGCCGTTGAT	AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.2485G>A	5.37:g.171482633C>T	ENSP00000176763:p.Gly829Ser	Somatic	281	1	0.00355872		WXS	Illumina HiSeq	Phase_I	303	3	0.00990099	NM_005990	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	ENST00000176763.5	37	CCDS34290.1	.	.	.	.	.	.	.	.	.	.	C	0.138	-1.105396	0.01828	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.27402	1.67	5.23	5.23	0.72850	.	0.196000	0.44097	D	0.000485	T	0.11623	0.0283	N	0.02368	-0.58	0.24492	N	0.99429	B	0.24186	0.099	B	0.27380	0.079	T	0.20672	-1.0268	10	0.02654	T	1	.	12.084	0.53688	0.0:0.8265:0.1735:0.0	.	829	O94804	STK10_HUMAN	S	829	ENSP00000176763:G829S	ENSP00000176763:G829S	G	-	1	0	STK10	171415238	0.409000	0.25368	0.167000	0.22817	0.109000	0.19521	1.104000	0.31074	2.455000	0.83008	0.561000	0.74099	GGC	C|0.990;T|0.010	0.010	strong		0.642	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990	
ZNF880	400713	hgsc.bcm.edu	37	19	52888042	52888042	+	Silent	SNP	G	G	T	rs75507701	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:52888042G>T	ENST00000422689.2	+	4	1224	c.1209G>T	c.(1207-1209)acG>acT	p.T403T		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	403					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						GAATGCACACGGGAGAGCAAC	0.403																																					p.T403T		Atlas-SNP	.											ZNF880,caecum,carcinoma,0,1	ZNF880	45	1	0			c.G1209T						scavenged	.						65.0	59.0	61.0					19																	52888042		1568	3582	5150	SO:0001819	synonymous_variant	400713	exon4			GCACACGGGAGAG	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1209G>T	19.37:g.52888042G>T		Somatic	28	2	0.0714286		WXS	Illumina HiSeq	Phase_I	37	9	0.243243	NM_001145434	B4DNA6	Silent	SNP	ENST00000422689.2	37	CCDS46164.1																																																																																			G|0.910;T|0.090	0.090	strong		0.403	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
ERCC5	2073	hgsc.bcm.edu	37	13	103504506	103504506	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr13:103504506C>G	ENST00000355739.4	+	2	1550	c.127C>G	c.(127-129)Cgg>Ggg	p.R43G	BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.P468R|ERCC5_ENST00000535557.1_Missense_Mutation_p.R43G	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	43	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TAAAGGAGTCCGGGATCGCCA	0.378			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.R497G		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	.	.	.	0			c.C1489G						PASS	.						128.0	131.0	130.0					13																	103504506		2203	4300	6503	SO:0001583	missense	0	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GGAGTCCGGGATC	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.127C>G	13.37:g.103504506C>G	ENSP00000347978:p.Arg43Gly	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	180	47	0.261111	NM_001204425	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136257	0.37728	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000535557	T;T	0.69435	-0.4;-0.4	5.39	3.47	0.39725	XPG N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.77025	0.4070	M	0.79258	2.445	0.53005	D	0.999964	P;P;D	0.64830	0.933;0.954;0.994	D;P;P	0.63033	0.91;0.765;0.903	T	0.77948	-0.2396	10	0.62326	D	0.03	-16.4647	8.4298	0.32750	0.2594:0.6527:0.0:0.0879	.	43;43;468	B4DSI5;P28715;Q59FZ7	.;ERCC5_HUMAN;.	G	468;43;43	ENSP00000347978:R43G;ENSP00000442117:R43G	ENSP00000347978:R43G	R	+	1	2	ERCC5	102302507	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	2.390000	0.44416	1.269000	0.44280	-0.233000	0.12211	CGG	.	.	none		0.378	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
COL22A1	169044	hgsc.bcm.edu	37	8	139626110	139626110	+	Splice_Site	SNP	C	C	T	rs139816222		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:139626110C>T	ENST00000303045.6	-	56	4424	c.3978G>A	c.(3976-3978)ccG>ccA	p.P1326P	COL22A1_ENST00000341807.4_5'UTR|COL22A1_ENST00000435777.1_Splice_Site_p.P1306P	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1326	Collagen-like 13.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CAAAACTCACCGGTGGGCCCC	0.478										HNSCC(7;0.00092)																											p.P1326P		Atlas-SNP	.											COL22A1,rectum,carcinoma,-1,1	COL22A1	390	1	0			c.G3978A						PASS	.	C		1,4405	2.1+/-5.4	0,1,2202	131.0	139.0	137.0		3978	3.8	1.0	8	dbSNP_134	137	0,8600		0,0,4300	no	coding-synonymous-near-splice	COL22A1	NM_152888.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1326/1627	139626110	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	169044	exon56			ACTCACCGGTGGG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3978+1G>A	8.37:g.139626110C>T		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	142	35	0.246479	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																			C|1.000;T|0.000	0.000	weak		0.478	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	Silent
RASGRF1	5923	hgsc.bcm.edu	37	15	79339155	79339155	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:79339155G>A	ENST00000419573.3	-	5	1085	c.811C>T	c.(811-813)Cgg>Tgg	p.R271W	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.R271W	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	271	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GCGGCCATCCGCAGCGGGCGC	0.587																																					p.R271W		Atlas-SNP	.											RASGRF1,NS,carcinoma,+2,1	RASGRF1	168	1	0			c.C811T						scavenged	.						143.0	117.0	126.0					15																	79339155		2196	4293	6489	SO:0001583	missense	5923	exon5			CCATCCGCAGCGG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.811C>T	15.37:g.79339155G>A	ENSP00000405963:p.Arg271Trp	Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	192	3	0.015625	NM_001145648	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829688	0.71258	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.66280	-0.2	4.03	3.03	0.35002	Dbl homology (DH) domain (5);	0.000000	0.64402	D	0.000003	T	0.72875	0.3515	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.75020	0.985;0.979;0.954;0.944	T	0.75534	-0.3284	10	0.87932	D	0	.	10.5563	0.45118	0.0:0.0:0.7946:0.2054	.	271;271;271;271	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	W	271	ENSP00000405963:R271W	ENSP00000378224:R271W	R	-	1	2	RASGRF1	77126210	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.512000	0.53407	2.072000	0.62099	0.655000	0.94253	CGG	.	.	none		0.587	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
NUP153	9972	hgsc.bcm.edu	37	6	17706506	17706506	+	Splice_Site	SNP	A	A	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:17706506A>T	ENST00000262077.2	-	1	111		c.e1+1		NUP153_ENST00000537253.1_Splice_Site|RP11-500C11.3_ENST00000606771.1_RNA	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			GGGGTCCCATACCTGATGCTG	0.716																																					.		Atlas-SNP	.											.	NUP153	116	.	0			c.111+2T>A						PASS	.						59.0	49.0	52.0					6																	17706506		2200	4299	6499	SO:0001630	splice_region_variant	9972	exon2			TCCCATACCTGAT	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.111+1T>A	6.37:g.17706506A>T		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	37	11	0.297297	NM_005124	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Splice_Site	SNP	ENST00000262077.2	37	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	A	12.30	1.898108	0.33535	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	.	.	.	3.91	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4521	0.38731	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NUP153	17814485	1.000000	0.71417	0.977000	0.42913	0.328000	0.28507	2.201000	0.42734	2.006000	0.58801	0.482000	0.46254	.	.	.	none		0.716	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		Intron
SLC29A3	55315	hgsc.bcm.edu	37	10	73111474	73111474	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:73111474C>T	ENST00000373189.5	+	4	591	c.539C>T	c.(538-540)aCt>aTt	p.T180I	SLC29A3_ENST00000469204.1_3'UTR	NM_001174098.1|NM_018344.5	NP_001167569.1|NP_060814.4	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 3	180					transmembrane transport (GO:0055085)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	15						GGTGCCTCCACTGTCTTCAGC	0.567																																					p.T180I	Esophageal Squamous(200;1319 2142 18949 31248 39672)	Atlas-SNP	.											.	SLC29A3	51	.	0			c.C539T						PASS	.						129.0	97.0	108.0					10																	73111474		2203	4300	6503	SO:0001583	missense	55315	exon4			CCTCCACTGTCTT	AF326987	CCDS7310.1	10q22.2	2013-07-17	2013-07-17		ENSG00000198246	ENSG00000198246		"""Solute carriers"""	23096	protein-coding gene	gene with protein product		612373	"""solute carrier family 29 (nucleoside transporters), member 3"""			11396612	Standard	NM_018344		Approved	ENT3, FLJ11160	uc001jrr.4	Q9BZD2	OTTHUMG00000018424	ENST00000373189.5:c.539C>T	10.37:g.73111474C>T	ENSP00000362285:p.Thr180Ile	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	91	4	0.043956	NM_018344	B2RB50|B4E2Z9|B7ZA37|Q0VAM9|Q5T465|Q7RTT8|Q8IVZ0|Q9BWI2|Q9NUS9	Missense_Mutation	SNP	ENST00000373189.5	37	CCDS7310.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964306	0.34659	.	.	ENSG00000198246	ENST00000373189	T	0.63580	-0.05	5.83	2.91	0.33838	.	0.231809	0.45606	N	0.000358	T	0.62221	0.2410	M	0.78916	2.43	0.35689	D	0.814676	B	0.18013	0.025	B	0.27076	0.076	T	0.66404	-0.5932	9	0.72032	D	0.01	-22.0043	8.8699	0.35309	0.0:0.7627:0.0:0.2373	.	180	Q9BZD2	S29A3_HUMAN	I	180	ENSP00000362285:T180I	ENSP00000362285:T180I	T	+	2	0	SLC29A3	72781480	0.977000	0.34250	0.048000	0.18961	0.667000	0.39255	2.530000	0.45641	0.345000	0.23873	0.555000	0.69702	ACT	.	.	none		0.567	SLC29A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048544.1	NM_018344	
PCK2	5106	hgsc.bcm.edu	37	14	24573041	24573041	+	Silent	SNP	C	C	T	rs544648134		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr14:24573041C>T	ENST00000216780.4	+	10	2059	c.1791C>T	c.(1789-1791)tcC>tcT	p.S597S	PCK2_ENST00000561286.1_Silent_p.S463S|PCK2_ENST00000558096.1_Silent_p.S431S|PCK2_ENST00000545054.2_Silent_p.S463S|PCK2_ENST00000559250.1_Intron|NRL_ENST00000561028.1_Intron	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	597					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		AGCTGTTCTCCCTCCCCAAGG	0.577																																					p.S597S		Atlas-SNP	.											PCK2,NS,carcinoma,+1,1	PCK2	66	1	0			c.C1791T						scavenged	.						95.0	93.0	94.0					14																	24573041		2203	4300	6503	SO:0001819	synonymous_variant	5106	exon10			GTTCTCCCTCCCC	AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.1791C>T	14.37:g.24573041C>T		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	187	3	0.0160428	NM_004563	O43253|Q86U01|Q9BV62	Silent	SNP	ENST00000216780.4	37	CCDS9609.1																																																																																			.	.	none		0.577	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071900.3	NM_001018073	
MYC	4609	hgsc.bcm.edu	37	8	128750559	128750559	+	Missense_Mutation	SNP	C	C	G	rs146504683	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128750559C>G	ENST00000259523.6	+	2	1256	c.51C>G	c.(49-51)gaC>gaG	p.D17E	MYC_ENST00000524013.1_Missense_Mutation_p.D31E|MYC_ENST00000377970.2_Missense_Mutation_p.D32E			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	17					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	TCGACTACGACTCGGTGCAGC	0.612		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D32E		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.C96G						PASS	.						59.0	61.0	60.0					8																	128750559		2203	4300	6503	SO:0001583	missense	4609	exon2			CTACGACTCGGTG		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.51C>G	8.37:g.128750559C>G	ENSP00000259523:p.Asp17Glu	Somatic	82	0	0	1567	WXS	Illumina HiSeq	Phase_I	94	31	0.329787	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000259523.6	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.62|12.62	1.991184|1.991184	0.35131|0.35131	.|.	.|.	ENSG00000136997|ENSG00000136997	ENST00000259523;ENST00000517291;ENST00000377970;ENST00000524013;ENST00000454617|ENST00000520751	T;T;T;T|.	0.34072|.	1.38;1.38;1.38;1.38|.	5.08|5.08	2.27|2.27	0.28462|0.28462	Transcription regulator Myc, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71771|0.71771	0.3379|0.3379	M|M	0.79011|0.79011	2.435|2.435	0.53688|0.53688	D|D	0.999977|0.999977	D|.	0.69078|.	0.997|.	D|.	0.79108|.	0.992|.	T|T	0.73569|0.73569	-0.3941|-0.3941	10|6	0.56958|0.87932	D|D	0.05|0	-39.7262|-39.7262	9.824|9.824	0.40901|0.40901	0.0:0.7719:0.0:0.2281|0.0:0.7719:0.0:0.2281	.|.	17|.	P01106|.	MYC_HUMAN|.	E|S	17;31;32;31;17|6	ENSP00000259523:D17E;ENSP00000429441:D31E;ENSP00000367207:D32E;ENSP00000430235:D31E|.	ENSP00000259523:D17E|ENSP00000430226:T6S	D|T	+|+	3|2	2|0	MYC|MYC	128819741|128819741	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.519000|1.519000	0.35888|0.35888	0.742000|0.742000	0.32697|0.32697	0.561000|0.561000	0.74099|0.74099	GAC|ACT	C|0.999;T|0.001	.	alt		0.612	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
DDX3X	1654	hgsc.bcm.edu	37	X	41204802	41204802	+	Splice_Site	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chrX:41204802G>T	ENST00000399959.2	+	12	2170		c.e12+1		DDX3X_ENST00000457138.2_Splice_Site|DDX3X_ENST00000478993.1_Splice_Site|DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000542215.1_Splice_Site|RN7SL15P_ENST00000582825.1_RNA	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked						ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						AATGCAACAGGTAACATTATG	0.418										HNSCC(61;0.18)																											.		Atlas-SNP	.											.	DDX3X	138	.	0			c.1267+1G>T						PASS	.						77.0	70.0	72.0					X																	41204802		1990	4159	6149	SO:0001630	splice_region_variant	1654	exon11			CAACAGGTAACAT	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1315+1G>T	X.37:g.41204802G>T		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	129	68	0.527132	NM_001193417	A8K538|B4E3E8|O15536	Splice_Site	SNP	ENST00000399959.2	37	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	g	19.49	3.837914	0.71373	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0725	0.89415	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DDX3X	41089746	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.737000	0.98831	2.203000	0.70933	0.522000	0.50473	.	.	.	none		0.418	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005	Intron
ABCA8	10351	hgsc.bcm.edu	37	17	66918384	66918384	+	Splice_Site	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:66918384T>C	ENST00000269080.2	-	11	1637	c.1500A>G	c.(1498-1500)aaA>aaG	p.K500K	ABCA8_ENST00000430352.2_Splice_Site_p.K500K|ABCA8_ENST00000586539.1_Splice_Site_p.K500K	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	500	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					tttttttACCTTTCAAGGCTT	0.209																																					p.K500K		Atlas-SNP	.											.	ABCA8	213	.	0			c.A1500G						PASS	.						18.0	18.0	18.0					17																	66918384		2152	4259	6411	SO:0001630	splice_region_variant	10351	exon11			TTTACCTTTCAAG	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1501+1A>G	17.37:g.66918384T>C		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	60	20	0.333333	NM_007168	A1L3U3|C9JQE6|Q86WW0	Silent	SNP	ENST00000269080.2	37	CCDS11680.1																																																																																			.	.	none		0.209	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	Silent
RBMXL1	494115	hgsc.bcm.edu	37	1	89448812	89448812	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:89448812T>G	ENST00000321792.5	-	2	1125	c.698A>C	c.(697-699)gAt>gCt	p.D233A	CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000446900.2_Intron|CCBL2_ENST00000370491.3_Intron|RBMXL1_ENST00000413769.1_5'Flank|RBMXL1_ENST00000399794.2_Missense_Mutation_p.D233A	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	233					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.D233A(3)									TGGTGCATAATCTCTTGTATC	0.423																																					p.D233A		Atlas-SNP	.											CCBL2,NS,carcinoma,0,3	.	.	3	3	Substitution - Missense(3)	kidney(3)	c.A698C						scavenged	.						205.0	178.0	187.0					1																	89448812		2203	4300	6503	SO:0001583	missense	494115	exon3			GCATAATCTCTTG	BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.698A>C	1.37:g.89448812T>G	ENSP00000318415:p.Asp233Ala	Somatic	295	4	0.0135593		WXS	Illumina HiSeq	Phase_I	345	10	0.0289855	NM_001162536		Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.084835	0.76642	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	D;D	0.83163	-1.69;-1.69	1.53	1.53	0.23141	.	0.000000	0.85682	D	0.000000	T	0.79100	0.4389	M	0.71036	2.16	0.46499	D	0.999078	D	0.59357	0.985	P	0.53102	0.718	T	0.78889	-0.2026	10	0.66056	D	0.02	.	6.8078	0.23786	0.0:0.0:0.0:1.0	.	233	Q96E39	RBMXL_HUMAN	A	233	ENSP00000318415:D233A;ENSP00000446099:D233A	ENSP00000318415:D233A	D	-	2	0	RBMXL1	89221400	1.000000	0.71417	0.996000	0.52242	0.787000	0.44495	5.062000	0.64326	0.706000	0.31912	0.254000	0.18369	GAT	.	.	none		0.423	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
FKBP9	11328	hgsc.bcm.edu	37	7	33014897	33014897	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:33014897G>A	ENST00000242209.4	+	3	640	c.471G>A	c.(469-471)ccG>ccA	p.P157P	FKBP9_ENST00000538336.1_Silent_p.P210P|AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000538443.1_Silent_p.P19P	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	157					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			TCAAGCCCCCGAGTTGCCCTC	0.483																																					p.P157P		Atlas-SNP	.											FKBP9,brain,glioma,+1,9	FKBP9	335	9	0			c.G471A						scavenged	.						100.0	90.0	93.0					7																	33014897		2203	4300	6503	SO:0001819	synonymous_variant	11328	exon3			GCCCCCGAGTTGC	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.471G>A	7.37:g.33014897G>A		Somatic	138	1	0.00724638		WXS	Illumina HiSeq	Phase_I	135	43	0.318519	NM_007270	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Silent	SNP	ENST00000242209.4	37	CCDS5439.1																																																																																			.	.	none		0.483	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
POTEB2	100287399	hgsc.bcm.edu	37	15	21071492	21071492	+	Missense_Mutation	SNP	G	G	T	rs536533463	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:21071492G>T	ENST00000454856.4	-	1	151	c.119C>A	c.(118-120)aCg>aAg	p.T40K		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	40																	CACATTGCTCGTGCCGCTCCC	0.582													G|||	2239	0.447085	0.4206	0.513	5008	,	,		15782	0.4742		0.4274	False		,,,				2504	0.4284				p.T40K		Atlas-SNP	.											ENSG00000230031,NS,carcinoid-endocrine_tumour,0,1	POTEB	22	1	0			c.C119A						scavenged	.																																			SO:0001583	missense	339010	exon1			TTGCTCGTGCCGC		CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.119C>A	15.37:g.21071492G>T	ENSP00000456953:p.Thr40Lys	Somatic	224	119	0.53125		WXS	Illumina HiSeq	Phase_I	339	157	0.463127	NM_207355		Missense_Mutation	SNP	ENST00000454856.4	37	CCDS59248.1																																																																																			.	.	weak		0.582	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471435.1		
SNTB2	6645	hgsc.bcm.edu	37	16	69294165	69294165	+	Splice_Site	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:69294165T>C	ENST00000336278.4	+	3	1043		c.e3+2		SNTB2_ENST00000528525.1_Splice_Site	NM_006750.3	NP_006741.1	Q13425	SNTB2_HUMAN	syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)							cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|microtubule (GO:0005874)|protein complex (GO:0043234)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)	p.?(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	13		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.208)		GCAGAACAGGTAGGCTGGGAG	0.517																																					.	NSCLC(58;1458 1722 3262 39967)|Melanoma(111;1698 2173 25379 28738)	Atlas-SNP	.											SNTB2,NS,carcinoma,0,1	SNTB2	22	1	1	Unknown(1)	kidney(1)	c.1005+2T>C						scavenged	.						91.0	73.0	79.0					16																	69294165		2198	4300	6498	SO:0001630	splice_region_variant	6645	exon3			AACAGGTAGGCTG	U40572	CCDS10873.1	16q22.1	2008-05-14	2002-08-29		ENSG00000168807	ENSG00000168807			11169	protein-coding gene	gene with protein product		600027	"""syntrophin, beta 2 (dystrophin-associated protein A1, 59kD, basic component 2)"""	SNT2B2, SNTL, D16S2531E		8576247, 8183929	Standard	NM_006750		Approved	EST25263, SNT3	uc002ewu.3	Q13425	OTTHUMG00000137567	ENST00000336278.4:c.1005+2T>C	16.37:g.69294165T>C		Somatic	113	1	0.00884956		WXS	Illumina HiSeq	Phase_I	126	3	0.0238095	NM_006750	Q9BY09	Splice_Site	SNP	ENST00000336278.4	37	CCDS10873.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.504083	0.85176	.	.	ENSG00000168807	ENST00000336278	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8806	0.70531	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SNTB2	67851666	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.177000	0.77650	2.043000	0.60533	0.533000	0.62120	.	.	.	none		0.517	SNTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268945.1		Intron
TACC1	6867	hgsc.bcm.edu	37	8	38677553	38677553	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:38677553A>G	ENST00000317827.4	+	3	1170	c.791A>G	c.(790-792)tAt>tGt	p.Y264C	TACC1_ENST00000520973.1_Missense_Mutation_p.Y69C|TACC1_ENST00000518415.1_Missense_Mutation_p.Y219C|TACC1_ENST00000379931.3_Missense_Mutation_p.Y264C|TACC1_ENST00000522752.1_Intron|TACC1_ENST00000348567.4_Intron|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000519416.1_Missense_Mutation_p.Y69C|TACC1_ENST00000443286.2_Missense_Mutation_p.Y280C|TACC1_ENST00000520615.1_Missense_Mutation_p.Y69C|TACC1_ENST00000520611.1_5'Flank|TACC1_ENST00000520340.1_Missense_Mutation_p.Y228C	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	264	Interaction with YEATS4.|SPAZ 1.				cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			AAGGCATCCTATCACTTCAGT	0.532																																					p.Y264C		Atlas-SNP	.											.	TACC1	98	.	0			c.A791G						PASS	.						40.0	41.0	40.0					8																	38677553		2203	4300	6503	SO:0001583	missense	6867	exon3			CATCCTATCACTT	AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.791A>G	8.37:g.38677553A>G	ENSP00000321703:p.Tyr264Cys	Somatic	16	0	0		WXS	Illumina HiSeq	Phase_I	22	7	0.318182	NM_006283	B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Missense_Mutation	SNP	ENST00000317827.4	37	CCDS6109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.514|0.514	-0.865152|-0.865152	0.02590|0.02590	.|.	.|.	ENSG00000147526|ENSG00000147526	ENST00000521866|ENST00000519416;ENST00000520615;ENST00000443388;ENST00000443286;ENST00000518415;ENST00000522904;ENST00000317827;ENST00000379931;ENST00000520973;ENST00000521935	.|T;T;T;T;T;T;T;T;T	.|0.45668	.|2.63;2.63;2.74;2.71;2.56;2.78;2.77;2.58;0.89	4.93|4.93	-1.26|-1.26	0.09376|0.09376	.|.	.|0.676508	.|0.14325	.|N	.|0.326751	T|T	0.26159|0.26159	0.0638|0.0638	L|L	0.33485|0.33485	1.01|1.01	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B;B;B	.|0.17667	.|0.023;0.009;0.009;0.004;0.004;0.004;0.002;0.02	.|B;B;B;B;B;B;B;B	.|0.18871	.|0.015;0.007;0.005;0.005;0.006;0.003;0.001;0.023	T|T	0.13818|0.13818	-1.0495|-1.0495	5|10	.|0.42905	.|T	.|0.14	1.732|1.732	4.9397|4.9397	0.13960|0.13960	0.4702:0.2082:0.3216:0.0|0.4702:0.2082:0.3216:0.0	.|.	.|69;69;69;280;264;264;69;219	.|B7Z3G3;E7EVI4;B4DH49;B4E302;O75410-2;O75410;E7ET87;O75410-7	.|.;.;.;.;.;TACC1_HUMAN;.;.	V|C	39|69;69;69;280;219;236;264;264;69;69	.|ENSP00000428687:Y69C;ENSP00000428450:Y69C;ENSP00000393647:Y280C;ENSP00000428706:Y219C;ENSP00000430355:Y236C;ENSP00000321703:Y264C;ENSP00000369263:Y264C;ENSP00000430959:Y69C;ENSP00000428175:Y69C	.|ENSP00000321703:Y264C	I|Y	+|+	1|2	0|0	TACC1|TACC1	38796710|38796710	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.044000|0.044000	0.14063|0.14063	0.935000|0.935000	0.28924|0.28924	-0.540000|-0.540000	0.06265|0.06265	-0.376000|-0.376000	0.06991|0.06991	ATC|TAT	.	.	none		0.532	TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376768.1	NM_006283	
NBPF10	100132406	hgsc.bcm.edu	37	1	145296403	145296403	+	Silent	SNP	C	C	T	rs4996269	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:145296403C>T	ENST00000342960.5	+	3	360	c.325C>T	c.(325-327)Cta>Tta	p.L109L	RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	109						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GCTGACCCAGCTAAGGGAGAA	0.517																																					p.L109L		Atlas-SNP	.											NBPF10,NS,carcinoma,0,1	NBPF10	221	1	0			c.C325T						scavenged	.																																			SO:0001819	synonymous_variant	100132406	exon3			ACCCAGCTAAGGG	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.325C>T	1.37:g.145296403C>T		Somatic	56	2	0.0357143		WXS	Illumina HiSeq	Phase_I	65	6	0.0923077	NM_001039703	Q5RHC0|Q9NWN6	Silent	SNP	ENST00000342960.5	37	CCDS53355.1																																																																																			T|0.001;G|0.956	0.001	strong		0.517	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
BCHE	590	hgsc.bcm.edu	37	3	165547891	165547891	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:165547891C>T	ENST00000264381.3	-	2	1097	c.931G>A	c.(931-933)Ggg>Agg	p.G311R	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	311					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	AAAGGAGTCCCATAGGGGACA	0.393																																					p.G311R		Atlas-SNP	.											BCHE,rectum,carcinoma,0,2	BCHE	136	2	0			c.G931A						scavenged	.						45.0	49.0	48.0					3																	165547891		2202	4295	6497	SO:0001583	missense	590	exon2			GAGTCCCATAGGG	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.931G>A	3.37:g.165547891C>T	ENSP00000264381:p.Gly311Arg	Somatic	247	0	0		WXS	Illumina HiSeq	Phase_I	275	3	0.0109091	NM_000055	A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	37	CCDS3198.1	.	.	.	.	.	.	.	.	.	.	C	0.077	-1.190568	0.01607	.	.	ENSG00000114200	ENST00000264381	D	0.95238	-3.65	5.42	4.54	0.55810	Carboxylesterase, type B (1);	0.752409	0.13633	N	0.373588	D	0.84710	0.5532	N	0.04387	-0.21	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.73081	-0.4095	10	0.23302	T	0.38	.	7.6275	0.28220	0.2946:0.6292:0.0:0.0762	.	311	P06276	CHLE_HUMAN	R	311	ENSP00000264381:G311R	ENSP00000264381:G311R	G	-	1	0	BCHE	167030585	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	-0.052000	0.11865	1.269000	0.44280	-0.182000	0.12963	GGG	.	.	none		0.393	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1		
CDC27	996	hgsc.bcm.edu	37	17	45234367	45234367	+	Missense_Mutation	SNP	A	A	T	rs200148949		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:45234367A>T	ENST00000066544.3	-	7	847	c.754T>A	c.(754-756)Tcc>Acc	p.S252T	CDC27_ENST00000531206.1_Missense_Mutation_p.S252T|CDC27_ENST00000527547.1_Missense_Mutation_p.S252T|CDC27_ENST00000446365.2_Missense_Mutation_p.S191T|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	252					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.S252T(3)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						GATAATATGGAAGTTCCTGTT	0.383																																					p.S252T		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,0,4	CDC27	337	4	3	Substitution - Missense(3)	prostate(3)	c.T754A						scavenged	.						54.0	60.0	58.0					17																	45234367		2197	4295	6492	SO:0001583	missense	996	exon7			ATATGGAAGTTCC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.754T>A	17.37:g.45234367A>T	ENSP00000066544:p.Ser252Thr	Somatic	48	2	0.0416667		WXS	Illumina HiSeq	Phase_I	52	3	0.0576923	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	11.88	1.770710	0.31320	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68181	-0.31;-0.26;0.01;-0.31;0.83	5.44	2.92	0.33932	.	0.295461	0.32687	N	0.005769	T	0.46425	0.1392	N	0.24115	0.695	0.34835	D	0.740078	B;B;B;B	0.09022	0.002;0.001;0.001;0.0	B;B;B;B	0.08055	0.001;0.003;0.002;0.001	T	0.45702	-0.9243	10	0.19590	T	0.45	-13.824	7.977	0.30161	0.7316:0.1283:0.0:0.1401	.	191;252;252;252	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	T	252;252;191;252;252	ENSP00000066544:S252T;ENSP00000434614:S252T;ENSP00000392802:S191T;ENSP00000437339:S252T;ENSP00000432105:S252T	ENSP00000066544:S252T	S	-	1	0	CDC27	42589366	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.784000	0.47774	0.864000	0.35578	0.377000	0.23210	TCC	.	.	weak		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
FAM35A	54537	hgsc.bcm.edu	37	10	88911830	88911830	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:88911830C>A	ENST00000298784.1	+	3	833	c.719C>A	c.(718-720)aCa>aAa	p.T240K	FAM35A_ENST00000298786.4_Missense_Mutation_p.T240K|RN7SL733P_ENST00000582253.1_RNA	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	240								p.T240K(2)		endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						TCAACTGATACAGAATTTCTC	0.388																																					p.T240K	Ovarian(175;703 2004 25460 32514 43441)	Atlas-SNP	.											FAM35A,NS,carcinoma,0,3	FAM35A	48	3	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C719A						scavenged	.						30.0	30.0	30.0					10																	88911830		2203	4295	6498	SO:0001583	missense	54537	exon3			CTGATACAGAATT	BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.719C>A	10.37:g.88911830C>A	ENSP00000298784:p.Thr240Lys	Somatic	116	1	0.00862069		WXS	Illumina HiSeq	Phase_I	158	4	0.0253165	NM_019054	O95885|Q9H991	Missense_Mutation	SNP	ENST00000298784.1	37	CCDS7383.1	.	.	.	.	.	.	.	.	.	.	c	16.25	3.071539	0.55646	.	.	ENSG00000122376	ENST00000298786;ENST00000298784;ENST00000358313	T;T;T	0.27104	1.7;1.69;1.69	4.09	3.09	0.35607	.	0.289768	0.25801	N	0.028214	T	0.45716	0.1356	.	.	.	0.34044	D	0.655393	D	0.63046	0.992	D	0.65573	0.936	T	0.61700	-0.7009	9	0.59425	D	0.04	-9.6069	12.3445	0.55114	0.0:0.9021:0.0:0.0979	.	240	Q86V20	FA35A_HUMAN	K	240	ENSP00000298786:T240K;ENSP00000298784:T240K;ENSP00000351064:T240K	ENSP00000298784:T240K	T	+	2	0	FAM35A	88901810	1.000000	0.71417	0.665000	0.29768	0.884000	0.51177	2.667000	0.46808	2.134000	0.65973	0.537000	0.68136	ACA	.	.	weak		0.388	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049196.2	NM_019054	
PRAMEF2	65122	hgsc.bcm.edu	37	1	12921137	12921137	+	Missense_Mutation	SNP	T	T	A	rs17039283	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:12921137T>A	ENST00000240189.2	+	4	1015	c.928T>A	c.(928-930)Ttg>Atg	p.L310M		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	310			L -> M (in dbSNP:rs17039283).		negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGAAGAGGACTTGAAGTGTCT	0.493																																					p.L310M		Atlas-SNP	.											PRAMEF2,NS,carcinoma,0,1	PRAMEF2	85	1	0			c.T928A						scavenged	.						132.0	134.0	133.0					1																	12921137		2202	4297	6499	SO:0001583	missense	65122	exon4			GAGGACTTGAAGT		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.928T>A	1.37:g.12921137T>A	ENSP00000240189:p.Leu310Met	Somatic	198	1	0.00505051		WXS	Illumina HiSeq	Phase_I	180	8	0.0444444	NM_023014		Missense_Mutation	SNP	ENST00000240189.2	37	CCDS149.1	.	.	.	.	.	.	.	.	.	.	G	2.970	-0.212708	0.06140	.	.	ENSG00000120952	ENST00000240189	T	0.01076	5.37	0.824	-1.65	0.08291	.	0.471727	0.17963	N	0.156117	T	0.00936	0.0031	N	0.25825	0.765	0.09310	N	1	B	0.06786	0.001	B	0.21360	0.034	T	0.44742	-0.9308	10	0.38643	T	0.18	.	5.2047	0.15285	0.0:0.0:0.2907:0.7093	rs17039283	310	O60811	PRAM2_HUMAN	M	310	ENSP00000240189:L310M	ENSP00000240189:L310M	L	+	1	2	PRAMEF2	12843724	0.011000	0.17503	0.001000	0.08648	0.011000	0.07611	-0.072000	0.11486	-1.430000	0.01985	-1.205000	0.01647	TTG	T|1.000;|0.000	.	weak		0.493	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
FAM120B	84498	hgsc.bcm.edu	37	6	170627775	170627775	+	Missense_Mutation	SNP	C	C	G	rs6934830	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:170627775C>G	ENST00000476287.1	+	2	1405	c.1297C>G	c.(1297-1299)Ccc>Gcc	p.P433A	FAM120B_ENST00000252510.9_Intron|FAM120B_ENST00000537664.1_Missense_Mutation_p.P456A|FAM120B_ENST00000540480.1_Missense_Mutation_p.P445A	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	433			P -> A (in dbSNP:rs6934830).		cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		AGACTCTGAACCCAGGCAAGA	0.498																																					p.P433A		Atlas-SNP	.											FAM120B,colon,carcinoma,0,1	FAM120B	108	1	0			c.C1297G						scavenged	.						182.0	201.0	194.0					6																	170627775		2203	4299	6502	SO:0001583	missense	84498	exon2			TCTGAACCCAGGC	AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.1297C>G	6.37:g.170627775C>G	ENSP00000417970:p.Pro433Ala	Somatic	81	2	0.0246914		WXS	Illumina HiSeq	Phase_I	112	4	0.0357143	NM_032448	B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	ENST00000476287.1	37	CCDS5314.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.794388	0.00077	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287	T;T;T	0.08720	3.06;3.09;3.1	3.07	-6.14	0.02111	.	2.097720	0.01397	N	0.013442	T	0.01353	0.0044	L	0.29908	0.895	0.09310	N	1	B;B	0.15930	0.015;0.015	B;B	0.12156	0.007;0.007	T	0.35251	-0.9796	10	0.24483	T	0.36	1.0923	4.696	0.12804	0.3085:0.3177:0.0:0.3738	rs6934830	433;433	Q96EK7;F2Z2E1	F120B_HUMAN;.	A	445;456;433	ENSP00000444125:P445A;ENSP00000440125:P456A;ENSP00000417970:P433A	ENSP00000436640:P433A	P	+	1	0	FAM120B	170469700	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.335000	0.00508	-2.968000	0.00287	-2.448000	0.00209	CCC	C|0.712;G|0.288	0.288	strong		0.498	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
C1orf27	54953	hgsc.bcm.edu	37	1	186357578	186357578	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:186357578T>A	ENST00000287859.6	+	5	460	c.335T>A	c.(334-336)aTg>aAg	p.M112K	C1orf27_ENST00000367470.3_Missense_Mutation_p.M112K|C1orf27_ENST00000419367.3_Missense_Mutation_p.M80K|C1orf27_ENST00000432021.3_Missense_Mutation_p.M112K	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	112						integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						TTTCAGCTAATGTTTGCTGTG	0.333																																					p.M112K		Atlas-SNP	.											C1orf27_ENST00000287859,NS,carcinoma,-1,2	C1orf27	41	2	0			c.T335A						PASS	.						32.0	31.0	31.0					1																	186357578		1807	4068	5875	SO:0001583	missense	54953	exon5			AGCTAATGTTTGC	BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.335T>A	1.37:g.186357578T>A	ENSP00000287859:p.Met112Lys	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	120	38	0.316667	NM_001164245	B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Missense_Mutation	SNP	ENST00000287859.6	37	CCDS53448.1	.	.	.	.	.	.	.	.	.	.	T	11.70	1.717373	0.30413	.	.	ENSG00000157181	ENST00000367470;ENST00000419367;ENST00000432021;ENST00000287859	T;T;T;T	0.42900	1.03;0.96;1.03;1.03	5.3	4.15	0.48705	.	0.545614	0.20190	N	0.097330	T	0.26122	0.0637	N	0.08118	0	0.28249	N	0.925366	B;B;B	0.20459	0.045;0.014;0.014	B;B;B	0.24848	0.056;0.006;0.006	T	0.22906	-1.0203	10	0.66056	D	0.02	-17.5983	12.025	0.53365	0.0:0.0:0.1449:0.8551	.	80;112;112	E9PFR7;Q5SWX8-2;Q5SWX8	.;.;ODR4_HUMAN	K	112;80;112;112	ENSP00000356440:M112K;ENSP00000395084:M80K;ENSP00000402029:M112K;ENSP00000287859:M112K	ENSP00000287859:M112K	M	+	2	0	C1orf27	184624201	0.988000	0.35896	0.998000	0.56505	0.369000	0.29798	6.000000	0.70678	0.817000	0.34445	0.460000	0.39030	ATG	.	.	none		0.333	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086352.2	NM_017847	
PRDM9	56979	hgsc.bcm.edu	37	5	23527721	23527721	+	Missense_Mutation	SNP	C	C	A	rs201643800		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:23527721C>A	ENST00000296682.3	+	11	2706	c.2524C>A	c.(2524-2526)Cgc>Agc	p.R842S		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	842					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GCGGGGCTTTCGCAATAAGTC	0.587										HNSCC(3;0.000094)																											p.R842S		Atlas-SNP	.											PRDM9,brain,primitive_neuroectodermal_tumour-medulloblastoma,-1,1	PRDM9	344	1	0			c.C2524A						scavenged	.						64.0	74.0	71.0					5																	23527721		2182	4295	6477	SO:0001583	missense	56979	exon11			GGCTTTCGCAATA	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2524C>A	5.37:g.23527721C>A	ENSP00000296682:p.Arg842Ser	Somatic	149	3	0.0201342		WXS	Illumina HiSeq	Phase_I	130	11	0.0846154	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.150552	0.00029	.	.	ENSG00000164256	ENST00000296682	T	0.07567	3.18	2.67	1.45	0.22620	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01940	0.0061	N	0.01438	-0.865	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.44483	-0.9325	9	0.02654	T	1	0.1175	0.5976	0.00739	0.4516:0.2128:0.1287:0.207	.	842	Q9NQV7	PRDM9_HUMAN	S	842	ENSP00000296682:R842S	ENSP00000296682:R842S	R	+	1	0	PRDM9	23563478	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	-0.822000	0.04448	0.037000	0.15575	-0.566000	0.04163	CGC	.	.	weak		0.587	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
INTS4	92105	hgsc.bcm.edu	37	11	77614592	77614592	+	Silent	SNP	C	C	T	rs565544206	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:77614592C>T	ENST00000534064.1	-	17	2125	c.2091G>A	c.(2089-2091)gcG>gcA	p.A697A	INTS4_ENST00000535943.1_Silent_p.A72A|AAMDC_ENST00000532481.1_Intron	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	697					snRNA processing (GO:0016180)	integrator complex (GO:0032039)		p.A697A(1)	INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			TTACCTGTTTCGCTGCTGCTG	0.483													C|||	7	0.00139776	0.0045	0.0	5008	,	,		22683	0.001		0.0	False		,,,				2504	0.0				p.A697A		Atlas-SNP	.											INTS4,NS,carcinoma,0,2	INTS4	89	2	1	Substitution - coding silent(1)	prostate(1)	c.G2091A						scavenged	.						63.0	54.0	57.0					11																	77614592		2200	4292	6492	SO:0001819	synonymous_variant	92105	exon17			CTGTTTCGCTGCT	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.2091G>A	11.37:g.77614592C>T		Somatic	200	5	0.025		WXS	Illumina HiSeq	Phase_I	228	10	0.0438596	NM_033547	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Silent	SNP	ENST00000534064.1	37	CCDS31644.1																																																																																			.	.	weak		0.483	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547	
