#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF343	79175	hgsc.bcm.edu	37	20	2473385	2473385	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr20:2473385delT	ENST00000278772.4	-	5	751	c.264delA	c.(262-264)aaafs	p.K88fs	RP4-734P14.4_ENST00000461548.1_Frame_Shift_Del_p.K88fs|ZNF343_ENST00000358413.2_Frame_Shift_Del_p.K88fs|ZNF343_ENST00000381253.1_Frame_Shift_Del_p.K88fs	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	88	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						GCATCACTTCTTTGTATAGAT	0.408																																					p.E89fs		Atlas-Indel	.											ZNF343,NS,carcinoma,0,1	ZNF343	47	1	0			c.265delG						PASS	.						234.0	216.0	222.0					20																	2473385		2203	4300	6503	SO:0001589	frameshift_variant	79175	exon5			.	AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.264delA	20.37:g.2473385delT	ENSP00000278772:p.Lys88fs	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	116	15	0.12931	NM_024325	Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Frame_Shift_Del	DEL	ENST00000278772.4	37	CCDS13028.1																																																																																			.	.	none		0.408	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077617.1	NM_024325	
KRTAP10-11	386678	hgsc.bcm.edu	37	21	46067225	46067226	+	Frame_Shift_Ins	INS	-	-	G	rs77998434|rs148239295	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:46067225_46067226insG	ENST00000334670.8	+	1	895_896	c.850_851insG	c.(850-852)cgcfs	p.R284fs	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	284						keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						CGCAAGCTCCCGCCTGGCCTGC	0.649													G|G|GG|insertion	12	0.00239617	0.0091	0.0	5008	,	,		19715	0.0		0.0	False		,,,				2504	0.0				p.R284fs		Atlas-Indel	.											.	KRTAP10-11	36	.	0			c.850_851insG						PASS	.		,	42,4180		1,40,2070					,	1.5	0.0		dbSNP_131	40	0,8174		0,0,4087	no	frameshift,intron	TSPEAR,KRTAP10-11	NM_198692.2,NM_144991.2	,	1,40,6157	A1A1,A1R,RR		0.0,0.9948,0.3388	,	,		42,12354				SO:0001589	frameshift_variant	386678	exon1			.	AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.851dupG	21.37:g.46067226_46067226dupG	ENSP00000334197:p.Arg284fs	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	137	23	0.167883	NM_198692	A2RRF9	Frame_Shift_Ins	INS	ENST00000334670.8	37	CCDS42962.1																																																																																			.	.	strong		0.649	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128029.1	NM_198692	
ZNF223	7766	hgsc.bcm.edu	37	19	44570830	44570831	+	Frame_Shift_Del	DEL	AG	AG	-	rs568496344	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:44570830_44570831delAG	ENST00000434772.3	+	5	1104_1105	c.849_850delAG	c.(847-852)acagggfs	p.G284fs	ZNF223_ENST00000591793.1_Frame_Shift_Del_p.G394fs	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	284					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				GAATTCACACAGGGGAGAAGCC	0.421														7	0.00139776	0.0	0.0	5008	,	,		22779	0.0069		0.0	False		,,,				2504	0.0				p.283_283del		Pindel,Atlas-Indel	.											.	ZNF223	61	.	0			c.848_849del						PASS	.																																			SO:0001589	frameshift_variant	7766	exon5			.	AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.849_850delAG	19.37:g.44570830_44570831delAG	ENSP00000401947:p.Gly284fs	Somatic	91	.	.		WXS	Illumina HiSeq	Phase_I	226	39	0.173	NM_013361	Q15736|Q8TBJ3|Q9HCA9	Frame_Shift_Del	DEL	ENST00000434772.3	37	CCDS12635.1																																																																																			.	.	none		0.421	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460469.2		
GAST	2520	hgsc.bcm.edu	37	17	39872062	39872064	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:39872062_39872064delGAA	ENST00000329402.3	+	3	311_313	c.244_246delGAA	c.(244-246)gaadel	p.E85del	JUP_ENST00000540235.1_Intron|RNA5SP442_ENST00000365050.1_RNA	NM_000805.4	NP_000796.1	P01350	GAST_HUMAN	gastrin	85					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			ATGGCTGGAGGAAGAAGAAGAAG	0.562																																					p.81_82del		Atlas-Indel	.											.	GAST	13	.	0			c.243_245del						PASS	.																																			SO:0001651	inframe_deletion	2520	exon3			.		CCDS11404.1	17q21.2	2013-02-26	2005-06-14	2005-06-14	ENSG00000184502	ENSG00000184502		"""Endogenous ligands"""	4164	protein-coding gene	gene with protein product	"""preprogastrin"""	137250		GAS			Standard	NM_000805		Approved		uc002hxl.3	P01350	OTTHUMG00000133496	ENST00000329402.3:c.244_246delGAA	17.37:g.39872071_39872073delGAA	ENSP00000331358:p.Glu85del	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	113	15	0.132743	NM_000805	P78463|P78464	In_Frame_Del	DEL	ENST00000329402.3	37	CCDS11404.1																																																																																			.	.	none		0.562	GAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257409.1		
NEFH	4744	hgsc.bcm.edu	37	22	29885567	29885568	+	In_Frame_Ins	INS	-	-	AAGTCCCCTGAGAAGGCC	rs147489453|rs559153194|rs75808076|rs59279731		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:29885567_29885568insAAGTCCCCTGAGAAGGCC	ENST00000310624.6	+	4	1971_1972	c.1938_1939insAAGTCCCCTGAGAAGGCC	c.(1939-1941)aag>AAGTCCCCTGAGAAGGCCaag	p.647_647K>KSPEKAK		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	653	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAGGAAGCAAAGTCCCCTGA	0.569																																					p.A646delinsAKSPEKA		Atlas-Indel	.											NEFH,rectum,carcinoma,0,1	NEFH	178	1	0			c.1938_1939insAAGTCCCCTGAGAAGGCC						PASS	.			2816,1448		937,942,253						-5.3	0.0		dbSNP_134	77	5046,3206		1537,1972,617	no	coding	NEFH	NM_021076.3		2474,2914,870	A1A1,A1R,RR		38.8512,33.9587,37.1844				7862,4654				SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1939_1956dupAAGTCCCCTGAGAAGGCC	22.37:g.29885567_29885568insAAGTCCCCTGAGAAGGCC	Exception_encountered	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	81	41	0.506173	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	strong		0.569	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
ATAD5	79915	hgsc.bcm.edu	37	17	29221631	29221635	+	Frame_Shift_Del	DEL	TCTCT	TCTCT	-			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	TCTCT	TCTCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:29221631_29221635delTCTCT	ENST00000321990.4	+	22	5725_5729	c.5347_5351delTCTCT	c.(5347-5352)tctcttfs	p.SL1783fs	TEFM_ENST00000579183.1_5'Flank	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1783					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TTCGAGTCGATCTCTTCTCTATGTG	0.341																																					p.1782_1784del		Pindel,Atlas-Indel	.											.	ATAD5	150	.	0			c.5346_5350del						PASS	.																																			SO:0001589	frameshift_variant	79915	exon22			.		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.5347_5351delTCTCT	17.37:g.29221636_29221640delTCTCT	ENSP00000313171:p.Ser1783fs	Somatic	65	.	.		WXS	Illumina HiSeq	Phase_I	55	14	0.255	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Frame_Shift_Del	DEL	ENST00000321990.4	37	CCDS11260.1																																																																																			.	.	none		0.341	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
P2RY10	27334	hgsc.bcm.edu	37	X	78216808	78216808	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chrX:78216808delT	ENST00000171757.2	+	4	1071	c.791delT	c.(790-792)attfs	p.I264fs	P2RY10_ENST00000544091.1_Frame_Shift_Del_p.I264fs	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						ATTAACTTTATTTTTTACACC	0.458																																					p.I264fs		Pindel,Atlas-Indel	.											.	P2RY10	99	.	0			c.790delA						PASS	.						145.0	137.0	140.0					X																	78216808		2203	4300	6503	SO:0001589	frameshift_variant	27334	exon2			.	AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.791delT	X.37:g.78216808delT	ENSP00000171757:p.Ile264fs	Somatic	25	.	.		WXS	Illumina HiSeq	Phase_I	36	20	0.556	NM_198333	D3DTE5|Q4VBN7|Q86V16	Frame_Shift_Del	DEL	ENST00000171757.2	37	CCDS14442.1																																																																																			.	.	none		0.458	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1		
FAM157B	100132403	hgsc.bcm.edu	37	9	141107537	141107548	+	lincRNA	DEL	GCAGCAGCAGCA	GCAGCAGCAGCA	-	rs199863448|rs370981092		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	GCAGCAGCAGCA	GCAGCAGCAGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:141107537_141107548delGCAGCAGCAGCA	ENST00000446912.2	+	0	20_31							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		Ggcagcggcggcagcagcagcagcagcagcag	0.547																																					p.73_77del		Pindel	.											.	.	.	.	0			c.218_229del						PASS	.			125,11,122,864		47,0,5,26,3,1,4,48,20,407							0.0			11	246,36,761,2189		64,0,32,86,6,3,21,223,280,901	no	codingComplex	FAM157B	NM_001145249.1		111,0,37,112,9,4,25,271,300,1308	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		32.271,22.9947,29.8806				371,47,883,3053						100132403	exon2			.			9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141107537_141107548delGCAGCAGCAGCA		Somatic	203	0	0.000		WXS	Illumina HiSeq	Phase_I	172	68	0.395	NM_001145249		In_Frame_Del	DEL	ENST00000446912.2	37																																																																																				.	.	alt		0.547	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000055378.2	NM_001145249	
RP1-274L7.1	0	hgsc.bcm.edu	37	X	129630851	129630854	+	lincRNA	DEL	AAGT	AAGT	-			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	AAGT	AAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chrX:129630851_129630854delAAGT	ENST00000458525.1	-	0	1015				FAM45B_ENST00000592932.1_RNA																							ACTATCGCAGAAGTAAGCATTTGG	0.348																																					.		Pindel	.											.	FAM45B	26	.	0			.						PASS	.																																					55855	.			.																													X.37:g.129630851_129630854delAAGT		Somatic	215	.	.		WXS	Illumina HiSeq	Phase_I	248	83	0.335	.		RNA	DEL	ENST00000458525.1	37																																																																																				.	.	none		0.348	RP1-274L7.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000058271.1		
GOLGA6L6	727832	hgsc.bcm.edu	37	15	20739938	20739943	+	In_Frame_Del	DEL	CTCCTG	CTCCTG	-	rs201222558		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	CTCCTG	CTCCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:20739938_20739943delCTCCTG	ENST00000427390.2	-	8	1897_1902	c.1807_1812delCAGGAG	c.(1807-1812)caggagdel	p.QE603del		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	603	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						acatcttctcctcctgctcctgcctc	0.553																																					p.603_605del		Pindel	.											.	GOLGA6L6	37	.	0			c.1808_1813del						PASS	.			8,1308		2,4,652							0.0			5	46,2864		5,36,1414	no	coding	GOLGA6L6	NM_001145004.1		7,40,2066	A1A1,A1R,RR		1.5808,0.6079,1.2778				54,4172				SO:0001651	inframe_deletion	727832	exon8			.	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1807_1812delCAGGAG	15.37:g.20739944_20739949delCTCCTG	ENSP00000398615:p.Gln603_Glu604del	Somatic	115	.	.		WXS	Illumina HiSeq	Phase_I	97	16	0.165	NM_001145004	D3YTC0	In_Frame_Del	DEL	ENST00000427390.2	37	CCDS45184.1																																																																																			CTCCTG|0.969;-|0.031	0.031	strong		0.553	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414660.3	NM_001145004	
NUTM2G	441457	hgsc.bcm.edu	37	9	99701229	99701231	+	In_Frame_Del	DEL	CTT	CTT	-	rs201499337|rs372223045		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:99701229_99701231delCTT	ENST00000372322.3	+	7	2045_2047	c.2024_2026delCTT	c.(2023-2028)ccttct>cct	p.S676del	NUTM2G_ENST00000354649.3_Intron|HIATL2_ENST00000506067.1_Intron	NM_001170741.1	NP_001164212.1	Q5VZR2	NTM2G_HUMAN	NUT family member 2G	676																	AGCCCATCACCTTCTCCTGCCAG	0.611																																					p.675_675del		Pindel	.											.	FAM22G	66	.	0			c.2023_2025del						PASS	.		,	59,2459		28,3,1228					,	-2.0	0.0			46	135,6387		64,7,3190	no	coding,intron	FAM22G	NM_001170741.1,NM_001045477.2	,	92,10,4418	A1A1,A1R,RR		2.0699,2.3431,2.146	,	,		194,8846				SO:0001651	inframe_deletion	441457	exon7			.		CCDS43854.1, CCDS55329.1	9q22.33	2013-05-02	2013-03-14	2013-05-02	ENSG00000188152	ENSG00000188152			23449	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member G"""	FAM22G			Standard	NM_001045477		Approved			Q5VZR2	OTTHUMG00000020305	ENST00000372322.3:c.2024_2026delCTT	9.37:g.99701229_99701231delCTT	ENSP00000361397:p.Ser676del	Somatic	198	.	.		WXS	Illumina HiSeq	Phase_I	219	36	0.164	NM_001170741	A6NNI5|Q5VZR3	In_Frame_Del	DEL	ENST00000372322.3	37	CCDS55329.1																																																																																			.	.	weak		0.611	NUTM2G-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053291.2	NM_001170741	
PCDHA4	56144	hgsc.bcm.edu	37	5	140186979	140186990	+	In_Frame_Del	DEL	GGGCCGCGGAGG	GGGCCGCGGAGG	-	rs67934344|rs200172095|rs563991668|rs3822355|rs3822354|rs17844273|rs3822351|rs3822350|rs3822353|rs3822352|rs386692888|rs543774145|rs201303975|rs386692887	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	GGGCCGCGGAGG	GGGCCGCGGAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr5:140186979_140186990delGGGCCGCGGAGG	ENST00000530339.1	+	1	207_218	c.207_218delGGGCCGCGGAGG	c.(205-219)aagggccgcggaggc>aac	p.69_73KGRGG>N	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_In_Frame_Del_p.69_73KGRGG>N|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_In_Frame_Del_p.69_73KGRGG>N	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	69	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G72R(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCGTCCAAGGGCCGCGGAGGCCTTCTGGAG	0.656																																					p.69_73del		Pindel	.											.	PCDHA4	419	.	2	Substitution - Missense(2)	lung(2)	c.206_217del						PASS	.																																			SO:0001651	inframe_deletion	56144	exon1			.	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.207_218delGGGCCGCGGAGG	5.37:g.140186979_140186990delGGGCCGCGGAGG	ENSP00000435300:p.Lys69_Gly73delinsAsn	Somatic	25	.	.		WXS	Illumina HiSeq	Phase_I	48	20	0.417	NM_031500	O75285|Q2M253	In_Frame_Del	DEL	ENST00000530339.1	37	CCDS54916.1																																																																																			.	.	none		0.656	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
PROSER3	148137	hgsc.bcm.edu	37	19	36258938	36258938	+	Frame_Shift_Del	DEL	G	G	-	rs398034467|rs5827939		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:36258938delG	ENST00000544099.1	+	9	1254	c.1191delG	c.(1189-1191)cagfs	p.Q397fs	AC002398.13_ENST00000589397.1_RNA|C19orf55_ENST00000396908.4_Splice_Site_p.Q397fs			Q2NL68	PRSR3_HUMAN		326										cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGCTTGCCCAGGGCCGCCCTG	0.731													GG|GGG|GG|insertion	5008	1.0	1.0	1.0	5008	,	,		11178	1.0		1.0	False		,,,				2504	1.0				p.Q397fs		Pindel	.											.	C19orf55	39	.	0			c.1190delA						PASS	.						1.0	1.0	1.0					19																	36258938		567	1236	1803	SO:0001589	frameshift_variant	148137	exon9			.																												ENST00000544099.1:c.1191delG	19.37:g.36258938delG	ENSP00000467267:p.Gln397fs	Somatic	8	.	.		WXS	Illumina HiSeq	Phase_I	11	10	0.909	NM_001039887	Q8NDI3|Q8WWC8|Q96NL4	Frame_Shift_Del	DEL	ENST00000544099.1	37																																																																																				G|0.000;-|1.000	1.000	strong		0.731	C19orf55-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000398160.2		
NFKBIE	4794	hgsc.bcm.edu	37	6	44229563	44229564	+	In_Frame_Ins	INS	-	-	GTACAGCCAGATGGA	rs375743668		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:44229563_44229564insGTACAGCCAGATGGA	ENST00000275015.5	-	3	906_907	c.907_908insTCCATCTGGCTGTAC	c.(907-909)cat>cTCCATCTGGCTGTACat	p.302_303insLHLAV		NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	302					cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTGGTCCAGATGTACAGCCAGA	0.614																																					p.H303delinsLHLAVH		Pindel	.											.	NFKBIE	31	.	0			c.908_909insTCCATCTGGCTGTAC						PASS	.																																			SO:0001652	inframe_insertion	4794	exon3			.	U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.893_907dupTCCATCTGGCTGTAC	6.37:g.44229563_44229564insGTACAGCCAGATGGA	ENSP00000275015:p.Leu298_Val302dup	Somatic	35	.	.		WXS	Illumina HiSeq	Phase_I	36	10	0.278	NM_004556	Q5T9V9	In_Frame_Ins	INS	ENST00000275015.5	37	CCDS34463.1																																																																																			.	.	none		0.614	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040733.2		
NR4A3	8013	hgsc.bcm.edu	37	9	102590616	102590624	+	In_Frame_Del	DEL	CACCACCAC	CACCACCAC	-	rs148637005	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	CACCACCAC	CACCACCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:102590616_102590624delCACCACCAC	ENST00000395097.2	+	3	1021_1029	c.292_300delCACCACCAC	c.(292-300)caccaccacdel	p.HHH104del	NR4A3_ENST00000338488.4_In_Frame_Del_p.HHH104del|NR4A3_ENST00000330847.1_In_Frame_Del_p.HHH115del	NM_006981.3|NM_173200.2	NP_008912.2|NP_775292.1	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	104	Poly-His.				gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)		TCF12/NR4A3(2)|TAF15/NR4A3(33)|EWSR1/NR4A3(146)|TFG/NR4A3(2)				Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				ccatcaccatcaccaccaccaccaccacc	0.612			T	EWSR1	extraskeletal myxoid chondrosarcoma																																p.108_111del		Pindel	.		Dom	yes		9	9q22	8013	"""nuclear receptor subfamily 4, group A, member 3 (NOR1)"""		M	.	NR4A3	80	.	0			c.324_332del						PASS	.																																			SO:0001651	inframe_deletion	8013	exon4			.	U12767	CCDS6742.1, CCDS6743.1, CCDS6744.1	9q22	2013-01-16			ENSG00000119508	ENSG00000119508		"""Nuclear hormone receptors"""	7982	protein-coding gene	gene with protein product		600542				8614405	Standard	NM_006981		Approved	CSMF, CHN, NOR1, MINOR	uc004baf.1	Q92570	OTTHUMG00000021030	ENST00000395097.2:c.292_300delCACCACCAC	9.37:g.102590625_102590633delCACCACCAC	ENSP00000378531:p.His104_His106del	Somatic	34	.	.		WXS	Illumina HiSeq	Phase_I	40	10	0.250	NM_173200	A2A3I7|Q12935|Q14979|Q16420|Q4VXA8|Q4VXA9|Q9UEK2|Q9UEK3	In_Frame_Del	DEL	ENST00000395097.2	37	CCDS6743.1																																																																																			.	.	none		0.612	NR4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055482.1		
GP2	2813	hgsc.bcm.edu	37	16	20329589	20329589	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr16:20329589A>C	ENST00000381362.4	-	8	1256	c.1180T>G	c.(1180-1182)Ttt>Gtt	p.F394V	GP2_ENST00000573897.1_5'Flank|GP2_ENST00000302555.5_Missense_Mutation_p.F391V|GP2_ENST00000381360.5_Missense_Mutation_p.F247V|GP2_ENST00000341642.5_Missense_Mutation_p.F244V	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	394	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						ACCAGGTTAAACCGGGAGGTG	0.498																																					p.F394V		Atlas-SNP	.											.	GP2	122	.	0			c.T1180G						PASS	.						203.0	164.0	178.0					16																	20329589		2203	4300	6503	SO:0001583	missense	2813	exon8			GGTTAAACCGGGA	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.1180T>G	16.37:g.20329589A>C	ENSP00000370767:p.Phe394Val	Somatic	199	0	0		WXS	Illumina HiSeq	Phase_I	184	37	0.201087	NM_001007240	A6NFM9|A6NJA8|Q13338|Q9UIF1	Missense_Mutation	SNP	ENST00000381362.4	37	CCDS42128.1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.246113	0.59103	.	.	ENSG00000169347	ENST00000302555;ENST00000381362;ENST00000381360;ENST00000341642;ENST00000537520	D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72	5.8	4.69	0.59074	Endoglin/CD105 antigen conserved site (1);Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	.	.	.	.	D	0.91620	0.7352	M	0.90595	3.13	0.09310	N	0.999993	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.85130	0.987;0.997;0.997;0.995	D	0.83676	0.0169	9	0.41790	T	0.15	-14.0034	10.2265	0.43229	0.9209:0.0:0.0791:0.0	.	244;372;391;394	P55259-4;B7Z1G2;P55259-3;P55259	.;.;.;GP2_HUMAN	V	391;394;247;244;372	ENSP00000304044:F391V;ENSP00000370767:F394V;ENSP00000370765:F247V;ENSP00000343861:F244V	ENSP00000304044:F391V	F	-	1	0	GP2	20237090	0.853000	0.29707	0.007000	0.13788	0.754000	0.42855	1.836000	0.39191	0.989000	0.38761	0.528000	0.53228	TTT	.	.	none		0.498	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295	
MYO18B	84700	hgsc.bcm.edu	37	22	26422889	26422889	+	Missense_Mutation	SNP	G	G	A	rs187337528		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:26422889G>A	ENST00000407587.2	+	43	7121	c.6952G>A	c.(6952-6954)Gct>Act	p.A2318T	MYO18B_ENST00000536101.1_Missense_Mutation_p.A2317T|MYO18B_ENST00000335473.7_Missense_Mutation_p.A2317T			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2317						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A2318T(2)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CGAAGGGGCCGCTGGTGGTCT	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		16066	0.001		0.0	False		,,,				2504	0.0				p.A2317T		Atlas-SNP	.											MYO18B,NS,haematopoietic_neoplasm,0,2	MYO18B	322	2	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.G6949A						PASS	.						28.0	34.0	32.0					22																	26422889		1894	4096	5990	SO:0001583	missense	84700	exon43			GGGGCCGCTGGTG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6952G>A	22.37:g.26422889G>A	ENSP00000386096:p.Ala2318Thr	Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	38	13	0.342105	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.012	-1.691334	0.00731	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.86956	-2.17;-2.17;-2.19	4.43	-7.52	0.01341	.	7739.210000	0.00166	N	0.000002	T	0.64294	0.2585	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.001;0.001;0.001;0.001	B;B;B;B;B	0.04013	0.0;0.0;0.0;0.001;0.001	T	0.58284	-0.7663	10	0.23891	T	0.37	.	0.11	0.00055	0.3104:0.2229:0.2234:0.2433	.	1830;2319;2317;2318;2317	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.;.;MY18B_HUMAN;.;.	T	2317;2317;2318	ENSP00000441229:A2317T;ENSP00000334563:A2317T;ENSP00000386096:A2318T	ENSP00000334563:A2317T	A	+	1	0	MYO18B	24752889	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-1.861000	0.01654	-1.216000	0.02607	-0.448000	0.05591	GCT	G|1.000;A|0.000	0.000	strong		0.587	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
KCNJ12	3768	hgsc.bcm.edu	37	17	21318948	21318948	+	Silent	SNP	C	C	T	rs112314728		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:21318948C>T	ENST00000583088.1	+	3	1189	c.294C>T	c.(292-294)ttC>ttT	p.F98F	KCNJ12_ENST00000331718.5_Silent_p.F98F	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	98					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.F98F(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GGCTGCTGTTCGGCATCATCT	0.632										Prostate(3;0.18)																											p.F98F		Atlas-SNP	.											KCNJ12,colon,carcinoma,0,1	.	.	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C294T						scavenged	.						126.0	81.0	96.0					17																	21318948		2203	4300	6503	SO:0001819	synonymous_variant	100134444	exon3			GCTGTTCGGCATC	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.294C>T	17.37:g.21318948C>T		Somatic	185	43	0.232432		WXS	Illumina HiSeq	Phase_I	168	33	0.196429	NM_001194958	O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	37	CCDS11219.1																																																																																			C|0.500;T|0.500	0.500	weak		0.632	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
HIVEP3	59269	hgsc.bcm.edu	37	1	41976328	41976328	+	Missense_Mutation	SNP	T	T	C	rs9439043|rs386630667	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:41976328T>C	ENST00000372583.1	-	9	7900	c.7015A>G	c.(7015-7017)Acc>Gcc	p.T2339A	HIVEP3_ENST00000247584.5_Missense_Mutation_p.T2339A|HIVEP3_ENST00000429157.2_Missense_Mutation_p.T2338A|HIVEP3_ENST00000372584.1_Missense_Mutation_p.T2338A|HIVEP3_ENST00000460604.1_5'UTR	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	2339			T -> A (in dbSNP:rs9439043). {ECO:0000269|PubMed:10997877, ECO:0000269|PubMed:11161801, ECO:0000269|PubMed:15489334}.		positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TCGGGGTTGGTCGGTGCACGC	0.746													C|||	4823	0.963059	0.8669	0.9899	5008	,	,		11687	1.0		0.998	False		,,,				2504	1.0				p.T2339A		Atlas-SNP	.											.	HIVEP3	235	.	0			c.A7015G						PASS	.	C	ALA/THR,ALA/THR	3684,344		1677,330,7	5.0	6.0	6.0		7012,7015	2.2	0.0	1	dbSNP_119	6	7782,22		3880,22,0	no	missense,missense	HIVEP3	NM_001127714.2,NM_024503.4	58,58	5557,352,7	CC,CT,TT		0.2819,8.5402,3.0933	benign,benign	2338/2406,2339/2407	41976328	11466,366	2014	3902	5916	SO:0001583	missense	59269	exon9			GGTTGGTCGGTGC	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.7015A>G	1.37:g.41976328T>C	ENSP00000361664:p.Thr2339Ala	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	37	CCDS463.1	2113	0.9674908424908425	425	0.8638211382113821	359	0.9917127071823204	572	1.0	757	0.9986807387862797	C	0.003	-2.459584	0.00171	0.914598	0.997181	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.05447	3.45;3.44;3.44;3.45	5.27	2.17	0.27698	.	0.652842	0.13380	N	0.392193	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.32798	-0.9893	9	0.02654	T	1	-1.4083	8.5616	0.33514	0.0:0.5996:0.0:0.4004	rs9439043;rs61630948	2338;2339	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	A	2338;2339;2339;2338	ENSP00000361665:T2338A;ENSP00000361664:T2339A;ENSP00000247584:T2339A;ENSP00000410828:T2338A	ENSP00000247584:T2339A	T	-	1	0	HIVEP3	41748915	0.137000	0.22531	0.000000	0.03702	0.001000	0.01503	0.034000	0.13776	0.112000	0.17975	-2.304000	0.00258	ACC	T|0.032;C|0.968	0.968	strong		0.746	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
GCC2	9648	hgsc.bcm.edu	37	2	109103005	109103005	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:109103005C>T	ENST00000309863.6	+	16	4545	c.3831C>T	c.(3829-3831)atC>atT	p.I1277I		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1277					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						AGCACAAAATCCACGAGCACC	0.458																																					p.I1277I		Atlas-SNP	.											GCC2,NS,carcinoma,+2,1	GCC2	129	1	0			c.C3831T						scavenged	.						120.0	117.0	118.0					2																	109103005		2203	4300	6503	SO:0001819	synonymous_variant	9648	exon16			CAAAATCCACGAG	BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.3831C>T	2.37:g.109103005C>T		Somatic	203	0	0		WXS	Illumina HiSeq	Phase_I	188	3	0.0159574	NM_181453	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Silent	SNP	ENST00000309863.6	37	CCDS33268.1																																																																																			.	.	none		0.458	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3	NM_014635	
HAVCR1	26762	hgsc.bcm.edu	37	5	156479523	156479523	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr5:156479523C>T	ENST00000339252.3	-	3	1054	c.522G>A	c.(520-522)acG>acA	p.T174T	HAVCR1_ENST00000522693.1_Silent_p.T174T|HAVCR1_ENST00000425854.1_Silent_p.T174T|HAVCR1_ENST00000523175.1_Silent_p.T174T|HAVCR1_ENST00000544197.1_Silent_p.T174T	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	11 X 6 AA approximate tandem repeats of V-P-T-T-T-T].|Thr-rich.			L -> P (in Ref. 1; AAC39862). {ECO:0000305}.	viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CAGTCGTTGTCGTTGGAATGC	0.473																																					p.T174T		Atlas-SNP	.											HAVCR1,NS,carcinoma,-2,1	HAVCR1	84	1	0			c.G522A						scavenged	.						674.0	657.0	662.0					5																	156479523		2126	4240	6366	SO:0001819	synonymous_variant	26762	exon4			CGTTGTCGTTGGA	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.522G>A	5.37:g.156479523C>T		Somatic	396	0	0		WXS	Illumina HiSeq	Phase_I	460	5	0.0108696	NM_001099414	O43656	Silent	SNP	ENST00000339252.3	37	CCDS43392.1																																																																																			.	.	none		0.473	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
NBEA	26960	hgsc.bcm.edu	37	13	35782857	35782857	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr13:35782857A>G	ENST00000400445.3	+	32	5921	c.5387A>G	c.(5386-5388)aAg>aGg	p.K1796R	NBEA_ENST00000379939.2_Missense_Mutation_p.K1793R|NBEA_ENST00000310336.4_Missense_Mutation_p.K1796R|NBEA_ENST00000540320.1_Missense_Mutation_p.K1796R	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1796					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GTGCCTGTAAAGAAACCACCT	0.428																																					p.K1796R		Atlas-SNP	.											.	NBEA	340	.	0			c.A5387G						PASS	.						63.0	60.0	61.0					13																	35782857		1837	4085	5922	SO:0001583	missense	26960	exon32			CTGTAAAGAAACC	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.5387A>G	13.37:g.35782857A>G	ENSP00000383295:p.Lys1796Arg	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	68	26	0.382353	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	A	18.84	3.708964	0.68615	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.60171	0.21;0.22;0.22;0.21	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.54854	0.1884	M	0.65975	2.015	0.80722	D	1	P;P	0.42409	0.779;0.666	B;B	0.34346	0.141;0.18	T	0.61768	-0.6995	10	0.52906	T	0.07	.	16.056	0.80805	1.0:0.0:0.0:0.0	.	1796;1793	Q8NFP9;Q5T321	NBEA_HUMAN;.	R	1796;1796;1793;1796;423	ENSP00000440951:K1796R;ENSP00000383295:K1796R;ENSP00000369271:K1793R;ENSP00000308534:K1796R	ENSP00000308534:K1796R	K	+	2	0	NBEA	34680857	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.855000	0.92236	2.178000	0.69098	0.533000	0.62120	AAG	.	.	none		0.428	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
CACNA1C	775	hgsc.bcm.edu	37	12	2676736	2676736	+	Splice_Site	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:2676736C>T	ENST00000347598.4	+	13	1671	c.1671C>T	c.(1669-1671)gaC>gaT	p.D557D	CACNA1C_ENST00000335762.5_Splice_Site_p.D582D|CACNA1C_ENST00000399629.1_Splice_Site_p.D557D|CACNA1C_ENST00000480911.1_Splice_Site_p.D557D|CACNA1C_ENST00000399644.1_Splice_Site_p.D557D|CACNA1C_ENST00000399606.1_Splice_Site_p.D557D|CACNA1C_ENST00000399601.1_Splice_Site_p.D557D|CACNA1C_ENST00000402845.3_Splice_Site_p.D557D|CACNA1C_ENST00000399591.1_Splice_Site_p.D557D|CACNA1C_ENST00000399649.1_Splice_Site_p.D557D|CACNA1C_ENST00000344100.3_Splice_Site_p.D557D|CACNA1C_ENST00000399655.1_Splice_Site_p.D557D|CACNA1C_ENST00000399637.1_Splice_Site_p.D557D|CACNA1C_ENST00000399595.1_Splice_Site_p.D557D|CACNA1C_ENST00000399603.1_Splice_Site_p.D557D|CACNA1C_ENST00000406454.3_Splice_Site_p.D557D|CACNA1C_ENST00000399621.1_Splice_Site_p.D557D|CACNA1C_ENST00000399638.1_Splice_Site_p.D557D|CACNA1C_ENST00000399641.1_Splice_Site_p.D557D|CACNA1C_ENST00000399617.1_Splice_Site_p.D557D|CACNA1C_ENST00000399634.1_Splice_Site_p.D557D|CACNA1C_ENST00000327702.7_Splice_Site_p.D557D|CACNA1C_ENST00000399597.1_Splice_Site_p.D557D	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	557					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCTGCCAGACACGGCAAACA	0.567																																					p.D557D		Atlas-SNP	.											.	CACNA1C	1023	.	0			c.C1671T						PASS	.						18.0	20.0	19.0					12																	2676736		2095	4247	6342	SO:0001630	splice_region_variant	775	exon13			GCCAGACACGGCA	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.1670-1C>T	12.37:g.2676736C>T		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	38	16	0.421053	NM_001129831	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	CCDS44788.1																																																																																			.	.	none		0.567	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	Silent
STAT3	6774	hgsc.bcm.edu	37	17	40474470	40474470	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:40474470T>C	ENST00000264657.5	-	21	2243	c.1931A>G	c.(1930-1932)cAg>cGg	p.Q644R	STAT3_ENST00000389272.3_Missense_Mutation_p.Q546R|STAT3_ENST00000585517.1_Missense_Mutation_p.Q644R|STAT3_ENST00000404395.3_Missense_Mutation_p.Q644R|STAT3_ENST00000588969.1_Missense_Mutation_p.Q644R	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	644	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.		Missing (in AD-HIES). {ECO:0000269|PubMed:17881745}.		acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		GTTGTTCAGCTGCTGCTTTGT	0.458									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.Q644R		Atlas-SNP	.											.	STAT3	268	.	0			c.A1931G	GRCh37	CM083172	STAT3	M		PASS	.						255.0	223.0	234.0					17																	40474470		2203	4300	6503	SO:0001583	missense	6774	exon21	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	TTCAGCTGCTGCT	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1931A>G	17.37:g.40474470T>C	ENSP00000264657:p.Gln644Arg	Somatic	237	0	0		WXS	Illumina HiSeq	Phase_I	283	137	0.484099	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	T	16.96	3.266403	0.59540	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	D;D;D	0.88354	-2.37;-2.37;-2.37	4.64	4.64	0.57946	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.87557	0.6207	N	0.11313	0.125	0.58432	D	0.999996	P;P;P	0.49559	0.908;0.925;0.925	D;D;D	0.67900	0.922;0.954;0.954	D	0.87438	0.2393	10	0.33141	T	0.24	-36.6451	14.2314	0.65895	0.0:0.0:0.0:1.0	.	644;644;644	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	R	644;546;644	ENSP00000264657:Q644R;ENSP00000373923:Q546R;ENSP00000384943:Q644R	ENSP00000264657:Q644R	Q	-	2	0	STAT3	37727996	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.128000	0.71650	1.953000	0.56701	0.460000	0.39030	CAG	.	.	none		0.458	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
KIF27	55582	hgsc.bcm.edu	37	9	86457175	86457175	+	Missense_Mutation	SNP	C	C	T	rs146464985		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:86457175C>T	ENST00000297814.2	-	17	3841	c.3698G>A	c.(3697-3699)cGg>cAg	p.R1233Q	KIF27_ENST00000413982.1_Missense_Mutation_p.R1167Q|KIF27_ENST00000334204.2_Missense_Mutation_p.R1136Q|RP11-575L7.4_ENST00000591217.1_RNA	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	1233					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TAGTTGCCGCCGAATTGCTTC	0.408																																					p.R1233Q		Atlas-SNP	.											KIF27,rectum,carcinoma,-1,1	KIF27	103	1	0			c.G3698A						scavenged	.	C	GLN/ARG	0,4406		0,0,2203	75.0	67.0	70.0		3698	2.2	0.0	9	dbSNP_134	70	2,8598	2.2+/-6.3	0,2,4298	no	missense	KIF27	NM_017576.1	43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	1233/1402	86457175	2,13004	2203	4300	6503	SO:0001583	missense	55582	exon17			TGCCGCCGAATTG	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.3698G>A	9.37:g.86457175C>T	ENSP00000297814:p.Arg1233Gln	Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	220	5	0.0227273	NM_017576	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	ENST00000297814.2	37	CCDS6665.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.511456	0.44660	0.0	2.33E-4	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204	T;T;T	0.69175	-0.38;-0.38;-0.25	4.24	2.22	0.28083	.	0.703319	0.12462	N	0.466797	T	0.43433	0.1247	N	0.16903	0.455	0.09310	N	1	B;B;B	0.16396	0.017;0.014;0.008	B;B;B	0.10450	0.005;0.001;0.001	T	0.24083	-1.0170	10	0.12766	T	0.61	.	5.5637	0.17158	0.0:0.4253:0.0:0.5747	.	1136;1167;1233	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	Q	1233;1167;1136	ENSP00000297814:R1233Q;ENSP00000401688:R1167Q;ENSP00000333928:R1136Q	ENSP00000297814:R1233Q	R	-	2	0	KIF27	85646995	0.017000	0.18338	0.030000	0.17652	0.834000	0.47266	1.187000	0.32090	0.310000	0.22990	0.465000	0.42564	CGG	C|1.000;T|0.000	0.000	weak		0.408	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	NM_017576	
C5	727	hgsc.bcm.edu	37	9	123719614	123719614	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:123719614C>T	ENST00000223642.1	-	39	4740	c.4711G>A	c.(4711-4713)Gaa>Aaa	p.E1571K		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1571	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	AAAACATTTTCTACAGTGATG	0.348																																					p.E1571K		Atlas-SNP	.											.	C5	124	.	0			c.G4711A						PASS	.						197.0	191.0	193.0					9																	123719614		2203	4300	6503	SO:0001583	missense	727	exon39			CATTTTCTACAGT	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.4711G>A	9.37:g.123719614C>T	ENSP00000223642:p.Glu1571Lys	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	83	5	0.060241	NM_001735	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.357662	0.61293	.	.	ENSG00000106804	ENST00000223642	T	0.22336	1.96	5.86	4.96	0.65561	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.150336	0.64402	D	0.000016	T	0.29061	0.0722	L	0.43923	1.385	0.38310	D	0.943213	D	0.61080	0.989	P	0.57620	0.824	T	0.09596	-1.0667	10	0.21014	T	0.42	.	10.9448	0.47294	0.0:0.9142:0.0:0.0858	.	1571	P01031	CO5_HUMAN	K	1571	ENSP00000223642:E1571K	ENSP00000223642:E1571K	E	-	1	0	C5	122759435	1.000000	0.71417	0.920000	0.36463	0.417000	0.31264	4.611000	0.61162	1.486000	0.48398	0.655000	0.94253	GAA	.	.	none		0.348	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
MUC4	4585	hgsc.bcm.edu	37	3	195505858	195505858	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:195505858G>A	ENST00000463781.3	-	2	13052	c.12593C>T	c.(12592-12594)aCt>aTt	p.T4198I	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T4198I|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGTGTCGGTGAC	0.602																																					p.T4198I		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,3	MUC4	1505	3	0			c.C12593T						scavenged	.						19.0	15.0	16.0					3																	195505858		689	1576	2265	SO:0001583	missense	4585	exon2			GAGGAAGTGTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12593C>T	3.37:g.195505858G>A	ENSP00000417498:p.Thr4198Ile	Somatic	109	1	0.00917431		WXS	Illumina HiSeq	Phase_I	122	4	0.0327869	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.623	0.115726	0.08831	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.38;1.3	.	.	.	.	.	.	.	.	T	0.19485	0.0468	N	0.14661	0.345	0.21105	N	0.999787	P	0.44090	0.826	B	0.40782	0.34	T	0.09975	-1.0650	7	.	.	.	.	6.6097	0.22745	2.0E-4:0.0:0.9998:0.0	.	4070	E7ESK3	.	I	4198	ENSP00000417498:T4198I;ENSP00000420243:T4198I	.	T	-	2	0	MUC4	196990637	0.000000	0.05858	0.017000	0.16124	0.032000	0.12392	0.289000	0.18957	0.452000	0.26830	0.074000	0.15403	ACT	.	.	none		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TCL1A	8115	hgsc.bcm.edu	37	14	96180291	96180291	+	Missense_Mutation	SNP	G	G	A	rs201228671	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr14:96180291G>A	ENST00000402399.1	-	1	242	c.113C>T	c.(112-114)aCc>aTc	p.T38I	TCL1A_ENST00000555202.1_Missense_Mutation_p.T38I|RP11-164H13.1_ENST00000556386.1_RNA|TCL1A_ENST00000554012.1_Missense_Mutation_p.T38I|TCL1A_ENST00000556450.1_Missense_Mutation_p.T38I|RP11-164H13.1_ENST00000547644.2_RNA|RP11-164H13.1_ENST00000553445.1_RNA	NM_021966.2	NP_068801.1	P56279	TCL1A_HUMAN	T-cell leukemia/lymphoma 1A	38					multicellular organismal development (GO:0007275)|stem cell maintenance (GO:0019827)	cell cortex (GO:0005938)|endoplasmic reticulum (GO:0005783)|pronucleus (GO:0045120)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		TACCTCGATGGTTAAGGGCAG	0.647			T	TRA@	T-CLL																																p.T38I	Ovarian(96;1068 2019 35393 39316)	Atlas-SNP	.		Dom	yes		14	14q32.1	8115	T-cell leukemia/lymphoma 1A		L	.	TCL1A	26	.	0			c.C113T						PASS	.						86.0	81.0	83.0					14																	96180291		2203	4300	6503	SO:0001583	missense	8115	exon1			TCGATGGTTAAGG	X82240	CCDS9941.1	14q32.1	2008-07-03				ENSG00000100721			11648	protein-coding gene	gene with protein product		186960				2783489, 7809072	Standard	NM_021966		Approved	TCL1	uc001yfb.4	P56279		ENST00000402399.1:c.113C>T	14.37:g.96180291G>A	ENSP00000385036:p.Thr38Ile	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	61	32	0.52459	NM_001098725	Q6IBK7	Missense_Mutation	SNP	ENST00000402399.1	37	CCDS9941.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.242016	0.22796	.	.	ENSG00000100721	ENST00000554012;ENST00000402399;ENST00000556450;ENST00000555202	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	3.15	-2.77	0.05877	.	1.693040	0.03527	N	0.221932	T	0.20170	0.0485	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.22487	-1.0215	10	0.31617	T	0.26	-11.297	7.6786	0.28500	0.4562:0.0:0.5438:0.0	.	38	P56279	TCL1A_HUMAN	I	38	ENSP00000451506:T38I;ENSP00000385036:T38I;ENSP00000450701:T38I;ENSP00000450496:T38I	ENSP00000385036:T38I	T	-	2	0	TCL1A	95250044	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.190000	0.03058	-0.453000	0.07076	-1.090000	0.02178	ACC	G|0.999;C|0.001	.	alt		0.647	TCL1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413246.1		
MUC4	4585	hgsc.bcm.edu	37	3	195512665	195512665	+	Missense_Mutation	SNP	G	G	A	rs79300100	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:195512665G>A	ENST00000463781.3	-	2	6245	c.5786C>T	c.(5785-5787)gCa>gTa	p.A1929V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A1929V|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A1929V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAAG	0.582																																					p.A1929V		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - Missense(1)	kidney(1)	c.C5786T						scavenged	.						37.0	33.0	34.0					3																	195512665		686	1586	2272	SO:0001583	missense	4585	exon2			GTGGATGCTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5786C>T	3.37:g.195512665G>A	ENSP00000417498:p.Ala1929Val	Somatic	293	7	0.0238908		WXS	Illumina HiSeq	Phase_I	354	6	0.0169492	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.513	0.462935	0.12402	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.26810	1.72;1.71	.	.	.	.	.	.	.	.	T	0.15478	0.0373	N	0.19112	0.55	0.09310	N	1	P	0.43392	0.805	P	0.45506	0.483	T	0.09997	-1.0649	7	.	.	.	.	5.4001	0.16291	0.2688:0.0:0.7312:0.0	.	1929	E7ESK3	.	V	1929	ENSP00000417498:A1929V;ENSP00000420243:A1929V	.	A	-	2	0	MUC4	196997060	.	.	0.001000	0.08648	0.008000	0.06430	.	.	-1.752000	0.01325	-2.092000	0.00371	GCA	G|0.993;A|0.007	0.007	strong		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
POTEE	445582	hgsc.bcm.edu	37	2	132021766	132021766	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:132021766A>C	ENST00000356920.5	+	15	2832	c.2738A>C	c.(2737-2739)aAa>aCa	p.K913T	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	913	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.K913T(1)									CGTGACATCAAAGAGAAGCTG	0.602																																					p.K913T		Atlas-SNP	.											ENSG00000188219,rectum,NS,0,1	.	.	1	1	Substitution - Missense(1)	large_intestine(1)	c.A2738C						scavenged	.						73.0	77.0	75.0					2																	132021766		1926	3862	5788	SO:0001583	missense	445582	exon15			ACATCAAAGAGAA	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2738A>C	2.37:g.132021766A>C	ENSP00000439189:p.Lys913Thr	Somatic	245	4	0.0163265		WXS	Illumina HiSeq	Phase_I	300	13	0.0433333	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	15.85	2.956333	0.53293	.	.	ENSG00000188219	ENST00000356920	D	0.97850	-4.57	.	.	.	.	.	.	.	.	D	0.99177	0.9715	H	0.99884	4.89	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96111	0.9077	8	0.87932	D	0	.	4.5487	0.12098	0.9994:0.0:6.0E-4:0.0	.	913	Q6S8J3	POTEE_HUMAN	T	913	ENSP00000439189:K913T	ENSP00000439189:K913T	K	+	2	0	AC131180.1	131738236	1.000000	0.71417	0.327000	0.25402	0.329000	0.28539	6.177000	0.71961	0.103000	0.17682	0.102000	0.15555	AAA	.	.	none		0.602	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
ARMCX5	64860	hgsc.bcm.edu	37	X	101858323	101858323	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chrX:101858323G>A	ENST00000604957.1	+	1	3876	c.1254G>A	c.(1252-1254)ggG>ggA	p.G418G	RP4-769N13.6_ENST00000476910.2_RNA|ARMCX5_ENST00000537008.1_Silent_p.G418G|ARMCX5_ENST00000536530.1_Silent_p.G418G|ARMCX5_ENST00000246174.2_Silent_p.G418G|ARMCX5_ENST00000372742.1_Silent_p.G418G|ARMCX5_ENST00000541409.1_Silent_p.G418G|RP4-769N13.7_ENST00000602441.1_RNA	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	418										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						AATTACTAGGGCACTTGAGTA	0.388																																					p.G418G		Atlas-SNP	.											.	ARMCX5	55	.	0			c.G1254A						PASS	.						53.0	53.0	53.0					X																	101858323		2203	4300	6503	SO:0001819	synonymous_variant	64860	exon3			ACTAGGGCACTTG		CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.1254G>A	X.37:g.101858323G>A		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	92	11	0.119565	NM_022838	B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Silent	SNP	ENST00000604957.1	37	CCDS14500.1																																																																																			.	.	none		0.388	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469659.1	NM_022838	
LDLRAD2	401944	hgsc.bcm.edu	37	1	22141206	22141206	+	Missense_Mutation	SNP	A	A	C	rs10917051	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:22141206A>C	ENST00000344642.2	+	2	588	c.401A>C	c.(400-402)aAc>aCc	p.N134T	LDLRAD2_ENST00000543870.1_Missense_Mutation_p.N134T	NM_001013693.2	NP_001013715.2	Q5SZI1	LRAD2_HUMAN	low density lipoprotein receptor class A domain containing 2	134			N -> T (in dbSNP:rs10917051). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(3)	6		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)		TGCGGCCTGAACATCCCGGTG	0.741													C|||	3069	0.612819	0.4697	0.7695	5008	,	,		12048	0.6319		0.6988	False		,,,				2504	0.5869				p.N134T		Atlas-SNP	.											LDLRAD2,NS,carcinoma,0,1	LDLRAD2	17	1	0			c.A401C						scavenged	.	C	THR/ASN	2072,1906		618,836,535	4.0	5.0	5.0		401	3.9	1.0	1	dbSNP_120	5	5425,2403		1990,1445,479	yes	missense	LDLRAD2	NM_001013693.2	65	2608,2281,1014	CC,CA,AA		30.6975,47.9135,36.4984	benign	134/273	22141206	7497,4309	1989	3914	5903	SO:0001583	missense	401944	exon2			GCCTGAACATCCC	AL590103	CCDS30624.1	1p36.12	2008-02-05	2005-10-07		ENSG00000187942	ENSG00000187942			32071	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 2"""				Standard	NM_001013693		Approved		uc001bfg.1	Q5SZI1	OTTHUMG00000002675	ENST00000344642.2:c.401A>C	1.37:g.22141206A>C	ENSP00000340988:p.Asn134Thr	Somatic	2	1	0.5		WXS	Illumina HiSeq	Phase_I	11	7	0.636364	NM_001013693	B9EJB3|Q6ZSN5	Missense_Mutation	SNP	ENST00000344642.2	37	CCDS30624.1	1389	0.635989010989011	215	0.4369918699186992	274	0.7569060773480663	373	0.6520979020979021	527	0.6952506596306068	C	0.596	-0.831142	0.02713	0.520865	0.693025	ENSG00000187942	ENST00000344642;ENST00000543870	T;T	0.48836	0.8;0.8	4.83	3.9	0.45041	CUB (2);	0.433746	0.19858	N	0.104491	T	0.00012	0.0000	N	0.01352	-0.895	0.47511	P	5.549999999999722E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.43734	-0.9373	9	0.02654	T	1	-7.9716	9.7096	0.40236	0.1595:0.6868:0.1536:0.0	rs10917051	134	Q5SZI1	LRAD2_HUMAN	T	134	ENSP00000340988:N134T;ENSP00000444097:N134T	ENSP00000340988:N134T	N	+	2	0	LDLRAD2	22013793	1.000000	0.71417	1.000000	0.80357	0.201000	0.24016	1.524000	0.35942	0.459000	0.27016	-0.382000	0.06688	AAC	A|0.362;C|0.638	0.638	strong		0.741	LDLRAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007601.1	NM_001013693	
OR2M5	127059	hgsc.bcm.edu	37	1	248309020	248309020	+	Missense_Mutation	SNP	G	G	A	rs139290187	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:248309020G>A	ENST00000366476.1	+	1	571	c.571G>A	c.(571-573)Gac>Aac	p.D191N		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			CTCATGCAATGACACATCAAT	0.418																																					p.D191N		Atlas-SNP	.											OR2M5,NS,carcinoma,0,2	OR2M5	117	2	0			c.G571A						scavenged	.						284.0	272.0	276.0					1																	248309020		2203	4300	6503	SO:0001583	missense	127059	exon1			TGCAATGACACAT		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.571G>A	1.37:g.248309020G>A	ENSP00000355432:p.Asp191Asn	Somatic	295	4	0.0135593		WXS	Illumina HiSeq	Phase_I	329	5	0.0151976	NM_001004690		Missense_Mutation	SNP	ENST00000366476.1	37	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	g	13.27	2.186763	0.38609	.	.	ENSG00000162727	ENST00000366476	T	0.00231	8.49	3.05	-0.584	0.11702	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33691	U	0.004660	T	0.00178	0.0005	M	0.63843	1.955	0.09310	N	1	B	0.20052	0.041	B	0.25405	0.06	T	0.40739	-0.9547	10	0.52906	T	0.07	.	6.3472	0.21355	0.2028:0.2355:0.5617:0.0	.	191	A3KFT3	OR2M5_HUMAN	N	191	ENSP00000355432:D191N	ENSP00000355432:D191N	D	+	1	0	OR2M5	246375643	0.002000	0.14202	0.001000	0.08648	0.566000	0.35808	0.608000	0.24223	-0.004000	0.14419	0.492000	0.49549	GAC	G|0.996;A|0.004	0.004	strong		0.418	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690	
UBALD2	283991	hgsc.bcm.edu	37	17	74261677	74261677	+	Silent	SNP	T	T	C	rs2585751	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:74261677T>C	ENST00000327490.6	+	1	395	c.91T>C	c.(91-93)Ttg>Ctg	p.L31L	UBALD2_ENST00000589240.1_5'Flank	NM_182565.3	NP_872371.1	Q8IYN6	UBAD2_HUMAN	UBA-like domain containing 2	31																	GGCGAAGCAGTTGCTGCAGGC	0.766													C|||	3578	0.714457	0.8843	0.6412	5008	,	,		3805	0.7024		0.5547	False		,,,				2504	0.7137				p.L31L		Atlas-SNP	.											.	.	.	.	0			c.T91C						PASS	.	C		3526,686		1494,538,74	10.0	12.0	11.0		91	2.6	1.0	17	dbSNP_100	11	4861,3485		1480,1901,792	no	coding-synonymous	FAM100B	NM_182565.3		2974,2439,866	CC,CT,TT		41.7565,16.2868,33.2139		31/165	74261677	8387,4171	2106	4173	6279	SO:0001819	synonymous_variant	283991	exon1			AAGCAGTTGCTGC		CCDS11742.1	17q25.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000185262	ENSG00000185262			28438	protein-coding gene	gene with protein product			"""family with sequence similarity 100, member B"""	FAM100B			Standard	NM_182565		Approved	MGC29814	uc010wsy.1	Q8IYN6	OTTHUMG00000132666	ENST00000327490.6:c.91T>C	17.37:g.74261677T>C		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	20	20	1	NM_182565		Silent	SNP	ENST00000327490.6	37	CCDS11742.1																																																																																			T|0.357;C|0.643	0.643	strong		0.766	UBALD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255920.1	NM_182565	
SEH1L	81929	hgsc.bcm.edu	37	18	12955467	12955467	+	Silent	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr18:12955467T>C	ENST00000262124.11	+	3	295	c.168T>C	c.(166-168)caT>caC	p.H56H	SEH1L_ENST00000399892.2_Silent_p.H56H	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)	56					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.H56H(2)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						CCCAGACACATAGTGGATCTG	0.398																																					p.H56H		Atlas-SNP	.											SEH1L,NS,carcinoma,0,3	SEH1L	33	3	2	Substitution - coding silent(2)	prostate(1)|central_nervous_system(1)	c.T168C						scavenged	.						150.0	135.0	140.0					18																	12955467		2203	4300	6503	SO:0001819	synonymous_variant	81929	exon3			GACACATAGTGGA	BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.168T>C	18.37:g.12955467T>C		Somatic	138	1	0.00724638		WXS	Illumina HiSeq	Phase_I	147	4	0.0272109	NM_001013437	A8K5B1|Q8NFU6|Q96MH3|Q9C069	Silent	SNP	ENST00000262124.11	37	CCDS45832.1																																																																																			.	.	weak		0.398	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458254.1	NM_031216	
GPR20	2843	hgsc.bcm.edu	37	8	142367400	142367400	+	Silent	SNP	G	G	A	rs11167054	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:142367400G>A	ENST00000377741.3	-	2	714	c.624C>T	c.(622-624)ccC>ccT	p.P208P	CTD-3064M3.3_ENST00000562459.1_RNA	NM_005293.2	NP_005284.2	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	208					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(3)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	15	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			TGACCAGCAGGGGCAGCAGGA	0.701													A|||	3770	0.752796	0.8533	0.8573	5008	,	,		17946	0.5099		0.8171	False		,,,				2504	0.727				p.P208P		Atlas-SNP	.											GPR20,NS,carcinoma,0,2	GPR20	43	2	0			c.C624T						scavenged	.	A		3616,550		1570,476,37	10.0	11.0	11.0		624	-8.4	0.7	8	dbSNP_120	11	6656,1574		2708,1240,167	no	coding-synonymous	GPR20	NM_005293.2		4278,1716,204	AA,AG,GG		19.1252,13.2021,17.1346		208/359	142367400	10272,2124	2083	4115	6198	SO:0001819	synonymous_variant	2843	exon2			CAGCAGGGGCAGC	U66579	CCDS34949.1	8q24.3	2012-08-21				ENSG00000204882		"""GPCR / Class A : Orphans"""	4475	protein-coding gene	gene with protein product		601908				18347022	Standard	NM_005293		Approved		uc003ywf.3	Q99678		ENST00000377741.3:c.624C>T	8.37:g.142367400G>A		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	2	2	1	NM_005293	Q17R96	Silent	SNP	ENST00000377741.3	37	CCDS34949.1																																																																																			G|0.248;A|0.752	0.752	strong		0.701	GPR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378968.1	NM_005293	
FNIP2	57600	hgsc.bcm.edu	37	4	159789387	159789387	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:159789387C>T	ENST00000264433.6	+	13	1674	c.1599C>T	c.(1597-1599)aaC>aaT	p.N533N	FNIP2_ENST00000379346.3_Silent_p.N556N	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	533					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TACAAGAGAACCAGCTGACCT	0.493																																					p.N533N		Atlas-SNP	.											.	FNIP2	90	.	0			c.C1599T						PASS	.						92.0	94.0	94.0					4																	159789387		2077	4216	6293	SO:0001819	synonymous_variant	57600	exon13			AGAGAACCAGCTG	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.1599C>T	4.37:g.159789387C>T		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	78	4	0.0512821	NM_020840	Q05DC3|Q96I31|Q9H994	Silent	SNP	ENST00000264433.6	37	CCDS47155.1																																																																																			.	.	none		0.493	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
FN1	2335	hgsc.bcm.edu	37	2	216289966	216289966	+	Missense_Mutation	SNP	G	G	A	rs145123731	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:216289966G>A	ENST00000359671.1	-	7	1152	c.887C>T	c.(886-888)cCg>cTg	p.P296L	FN1_ENST00000346544.3_Missense_Mutation_p.P296L|FN1_ENST00000421182.1_Missense_Mutation_p.P296L|FN1_ENST00000426059.1_Missense_Mutation_p.P296L|FN1_ENST00000345488.5_Missense_Mutation_p.P296L|FN1_ENST00000357867.4_Missense_Mutation_p.P296L|FN1_ENST00000446046.1_Missense_Mutation_p.P296L|FN1_ENST00000357009.2_Missense_Mutation_p.P296L|FN1_ENST00000443816.1_Missense_Mutation_p.P296L|FN1_ENST00000323926.6_Missense_Mutation_p.P296L|FN1_ENST00000336916.4_Missense_Mutation_p.P296L|FN1_ENST00000354785.4_Missense_Mutation_p.P296L|FN1_ENST00000356005.4_Missense_Mutation_p.P296L|FN1_ENST00000432072.2_Missense_Mutation_p.P296L			P02751	FINC_HUMAN	fibronectin 1	296					acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GTGAGGCTGCGGTTGGTAAAC	0.517																																					p.P296L		Atlas-SNP	.											FN1_ENST00000354785,colon,carcinoma,+1,2	FN1	521	2	0			c.C887T						PASS	.	G	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	6,4400	12.9+/-30.5	0,6,2197	122.0	119.0	120.0		887,887,887,887,887,887	5.8	1.0	2	dbSNP_134	120	0,8600		0,0,4300	yes	missense,missense,missense,missense,missense,missense	FN1	NM_002026.2,NM_054034.2,NM_212474.1,NM_212476.1,NM_212478.1,NM_212482.1	98,98,98,98,98,98	0,6,6497	AA,AG,GG		0.0,0.1362,0.0461	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	296/2356,296/658,296/2177,296/2297,296/2331,296/2478	216289966	6,13000	2203	4300	6503	SO:0001583	missense	2335	exon7			GGCTGCGGTTGGT		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.887C>T	2.37:g.216289966G>A	ENSP00000352696:p.Pro296Leu	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	96	33	0.34375	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	G	24.1	4.491508	0.84962	0.001362	0.0	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.48836	0.8;2.19;2.34;0.88;2.4;2.04;2.39;2.04;2.34;2.08;1.57;0.88;1.47;1.46	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000002	T	0.68100	0.2964	L	0.59436	1.845	0.80722	D	1	D;D;P;D;D;D;D;D;D;D;P	0.89917	0.989;1.0;0.885;0.982;1.0;1.0;1.0;1.0;1.0;1.0;0.936	P;D;P;P;D;D;D;D;D;D;B	0.91635	0.592;0.998;0.477;0.688;0.999;0.998;0.983;0.996;0.999;0.999;0.396	T	0.68108	-0.5496	10	0.72032	D	0.01	.	20.1374	0.98035	0.0:0.0:1.0:0.0	.	296;296;296;296;296;296;296;296;296;296;296	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	L	296	ENSP00000394423:P296L;ENSP00000323534:P296L;ENSP00000338200:P296L;ENSP00000350534:P296L;ENSP00000346839:P296L;ENSP00000352696:P296L;ENSP00000265312:P296L;ENSP00000273049:P296L;ENSP00000349509:P296L;ENSP00000410422:P296L;ENSP00000415018:P296L;ENSP00000399538:P296L;ENSP00000348285:P296L;ENSP00000398907:P296L	ENSP00000265313:P296L	P	-	2	0	FN1	215998211	1.000000	0.71417	0.999000	0.59377	0.682000	0.39822	2.458000	0.45014	2.763000	0.94921	0.563000	0.77884	CCG	G|1.000;A|0.000	0.000	strong		0.517	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
PLXNA2	5362	hgsc.bcm.edu	37	1	208216497	208216497	+	Missense_Mutation	SNP	C	C	T	rs572241200		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:208216497C>T	ENST00000367033.3	-	21	4683	c.3926G>A	c.(3925-3927)cGc>cAc	p.R1309H		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1309					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GATTCCTGAGCGGTCCAGGTC	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		19355	0.001		0.0	False		,,,				2504	0.0				p.R1309H		Atlas-SNP	.											PLXNA2,NS,carcinoma,0,1	PLXNA2	178	1	0			c.G3926A						PASS	.						94.0	89.0	91.0					1																	208216497		2203	4300	6503	SO:0001583	missense	5362	exon21			CCTGAGCGGTCCA	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3926G>A	1.37:g.208216497C>T	ENSP00000356000:p.Arg1309His	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	117	38	0.324786	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	36	5.774387	0.96922	.	.	ENSG00000076356	ENST00000367033	T	0.00932	5.53	5.42	5.42	0.78866	.	0.048395	0.85682	D	0.000000	T	0.01835	0.0058	N	0.24115	0.695	0.80722	D	1	D	0.67145	0.996	P	0.50970	0.655	T	0.70963	-0.4729	10	0.87932	D	0	.	19.2386	0.93873	0.0:1.0:0.0:0.0	.	1309	O75051	PLXA2_HUMAN	H	1309	ENSP00000356000:R1309H	ENSP00000356000:R1309H	R	-	2	0	PLXNA2	206283120	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.454000	0.80714	2.543000	0.85770	0.650000	0.86243	CGC	.	.	none		0.582	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
MUC4	4585	hgsc.bcm.edu	37	3	195513285	195513285	+	Silent	SNP	G	G	T	rs200293322	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:195513285G>T	ENST00000463781.3	-	2	5625	c.5166C>A	c.(5164-5166)tcC>tcA	p.S1722S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S1722S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S1722S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTCACCTGTGGATACTGAGG	0.582																																					p.S1722S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - coding silent(1)	endometrium(1)	c.C5166A						scavenged	.						22.0	24.0	23.0					3																	195513285		683	1583	2266	SO:0001819	synonymous_variant	4585	exon2			ACCTGTGGATACT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5166C>A	3.37:g.195513285G>T		Somatic	332	6	0.0180723		WXS	Illumina HiSeq	Phase_I	388	11	0.0283505	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			G|0.988;T|0.013	0.013	strong		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SLITRK5	26050	hgsc.bcm.edu	37	13	88329368	88329368	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr13:88329368G>A	ENST00000325089.6	+	2	1944	c.1725G>A	c.(1723-1725)aaG>aaA	p.K575K	SLITRK5_ENST00000400028.3_Silent_p.K334K	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	575	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TGGGCATGAAGCTGTGGGTGG	0.527																																					p.K575K		Atlas-SNP	.											SLITRK5,NS,carcinoma,+1,1	SLITRK5	192	1	0			c.G1725A						scavenged	.						152.0	139.0	143.0					13																	88329368		2203	4300	6503	SO:0001819	synonymous_variant	26050	exon2			CATGAAGCTGTGG	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1725G>A	13.37:g.88329368G>A		Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	114	2	0.0175439	NM_015567	B3KNB8|B4DSH5|Q5VT81	Silent	SNP	ENST00000325089.6	37	CCDS9465.1																																																																																			.	.	none		0.527	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
SIRT1	23411	hgsc.bcm.edu	37	10	69672431	69672431	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:69672431G>T	ENST00000212015.6	+	8	1611	c.1558G>T	c.(1558-1560)Gaa>Taa	p.E520*	SIRT1_ENST00000403579.1_Nonsense_Mutation_p.E217*|SIRT1_ENST00000406900.1_Nonsense_Mutation_p.E217*|SIRT1_ENST00000432464.1_Nonsense_Mutation_p.E225*	NM_012238.4	NP_036370.2	Q96EB6	SIR1_HUMAN	sirtuin 1	520	Interaction with CCAR2.				angiogenesis (GO:0001525)|cell aging (GO:0007569)|cellular glucose homeostasis (GO:0001678)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to starvation (GO:0009267)|cellular response to tumor necrosis factor (GO:0071356)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|chromatin organization (GO:0006325)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|establishment of chromatin silencing (GO:0006343)|fatty acid homeostasis (GO:0055089)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of chromatin silencing (GO:0006344)|methylation-dependent chromatin silencing (GO:0006346)|muscle organ development (GO:0007517)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of cell growth (GO:0030308)|negative regulation of cellular response to testosterone stimulus (GO:2000655)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of helicase activity (GO:0051097)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of neuron death (GO:1901215)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostaglandin biosynthetic process (GO:0031393)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|ovulation from ovarian follicle (GO:0001542)|peptidyl-lysine acetylation (GO:0018394)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular senescence (GO:2000774)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of chromatin silencing (GO:0031937)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of macroautophagy (GO:0016239)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deacetylation (GO:0006476)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cell proliferation (GO:0042127)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle (GO:0007346)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of smooth muscle cell apoptotic process (GO:0034391)|response to hydrogen peroxide (GO:0042542)|response to insulin (GO:0032868)|response to oxidative stress (GO:0006979)|rRNA processing (GO:0006364)|single strand break repair (GO:0000012)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|triglyceride mobilization (GO:0006642)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|rDNA heterochromatin (GO:0033553)	bHLH transcription factor binding (GO:0043425)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase activity (GO:0004407)|HLH domain binding (GO:0043398)|identical protein binding (GO:0042802)|keratin filament binding (GO:1990254)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent protein deacetylase activity (GO:0034979)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	14						AACACAAAAAGAATTGGCTTA	0.393																																					p.E520X		Atlas-SNP	.											SIRT1,NS,carcinoma,0,2	SIRT1	38	2	0			c.G1558T						scavenged	.						77.0	77.0	77.0					10																	69672431		2203	4300	6503	SO:0001587	stop_gained	23411	exon8			CAAAAAGAATTGG	AF083106	CCDS7273.1, CCDS44412.1	10q21	2010-06-25	2010-06-25		ENSG00000096717	ENSG00000096717			14929	protein-coding gene	gene with protein product		604479	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 1"", ""sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)"""			10381378	Standard	NM_012238		Approved	SIR2L1	uc001jnd.3	Q96EB6	OTTHUMG00000018340	ENST00000212015.6:c.1558G>T	10.37:g.69672431G>T	ENSP00000212015:p.Glu520*	Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	96	3	0.03125	NM_012238	Q2XNF6|Q5JVQ0|Q9GZR9|Q9Y6F0	Nonsense_Mutation	SNP	ENST00000212015.6	37	CCDS7273.1	.	.	.	.	.	.	.	.	.	.	G	40	8.277704	0.98740	.	.	ENSG00000096717	ENST00000212015;ENST00000432464;ENST00000406900;ENST00000403579	.	.	.	5.68	5.68	0.88126	.	0.420263	0.22708	N	0.056617	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-9.3149	19.4062	0.94648	0.0:0.0:1.0:0.0	.	.	.	.	X	520;225;217;217	.	ENSP00000212015:E520X	E	+	1	0	SIRT1	69342437	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.347000	0.73004	2.695000	0.91970	0.650000	0.86243	GAA	.	.	none		0.393	SIRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048296.1		
COL16A1	1307	hgsc.bcm.edu	37	1	32149326	32149326	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:32149326C>T	ENST00000373672.3	-	34	2877	c.2361G>A	c.(2359-2361)agG>agA	p.R787R	COL16A1_ENST00000373668.3_Silent_p.R787R|COL16A1_ENST00000271069.6_Silent_p.R786R	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	787	Triple-helical region 5 (COL5) with 3 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CCTGGACTCCCCTTCCTGGAG	0.602																																					p.R787R	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.G2361A						PASS	.						73.0	92.0	86.0					1																	32149326		1979	4151	6130	SO:0001819	synonymous_variant	1307	exon34			GACTCCCCTTCCT	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2361G>A	1.37:g.32149326C>T		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	73	31	0.424658	NM_001856	Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	37	CCDS41297.1																																																																																			.	.	none		0.602	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
TTK	7272	hgsc.bcm.edu	37	6	80744802	80744802	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:80744802T>A	ENST00000369798.2	+	15	1826	c.1715T>A	c.(1714-1716)aTa>aAa	p.I572K	TTK_ENST00000230510.3_Missense_Mutation_p.I571K|TTK_ENST00000509894.1_Missense_Mutation_p.I571K	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	572	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		CGGAACGAAATAGCTTATTTG	0.279																																					p.I572K		Atlas-SNP	.											.	TTK	199	.	0			c.T1715A						PASS	.						77.0	83.0	81.0					6																	80744802		2199	4288	6487	SO:0001583	missense	7272	exon15			ACGAAATAGCTTA		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.1715T>A	6.37:g.80744802T>A	ENSP00000358813:p.Ile572Lys	Somatic	190	0	0		WXS	Illumina HiSeq	Phase_I	127	49	0.385827	NM_003318	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	37	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.135303	0.77662	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.76448	-1.02;-1.02;-1.02	5.67	4.49	0.54785	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043215	0.85682	D	0.000000	T	0.76506	0.3997	L	0.39085	1.19	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.999;1.0	T	0.80013	-0.1560	10	0.66056	D	0.02	.	12.1537	0.54064	0.0:0.0:0.1433:0.8567	.	572;571	P33981;A8K8U5	TTK_HUMAN;.	K	571;571;572	ENSP00000422936:I571K;ENSP00000230510:I571K;ENSP00000358813:I572K	ENSP00000230510:I571K	I	+	2	0	TTK	80801521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	0.959000	0.37980	0.455000	0.32223	ATA	.	.	none		0.279	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2		
TRIM51	84767	hgsc.bcm.edu	37	11	55655597	55655597	+	Silent	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:55655597A>G	ENST00000449290.2	+	4	689	c.597A>G	c.(595-597)gaA>gaG	p.E199E	TRIM51_ENST00000244891.3_Silent_p.E56E	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	199						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										ATCACTTGGAAAGGCTGCGAA	0.433																																					p.E199E		Atlas-SNP	.											SPRYD5_ENST00000327733,NS,carcinoma,+2,2	.	.	2	0			c.A597G						scavenged	.						61.0	58.0	59.0					11																	55655597		2201	4296	6497	SO:0001819	synonymous_variant	84767	exon4			CTTGGAAAGGCTG	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.597A>G	11.37:g.55655597A>G		Somatic	584	30	0.0513699		WXS	Illumina HiSeq	Phase_I	545	32	0.0587156	NM_032681	A6NMG2	Silent	SNP	ENST00000449290.2	37																																																																																				.	.	none		0.433	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
OR1S2	219958	hgsc.bcm.edu	37	11	57971203	57971203	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:57971203C>G	ENST00000302592.6	-	1	450	c.451G>C	c.(451-453)Gcc>Ccc	p.A151P		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				CCGAACCTGGCCCGCATGAAA	0.473																																					p.A151P		Atlas-SNP	.											OR1S2,NS,carcinoma,0,3	OR1S2	119	3	0			c.G451C						scavenged	.						163.0	154.0	157.0					11																	57971203		2201	4296	6497	SO:0001583	missense	219958	exon1			ACCTGGCCCGCAT	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.451G>C	11.37:g.57971203C>G	ENSP00000305469:p.Ala151Pro	Somatic	204	7	0.0343137		WXS	Illumina HiSeq	Phase_I	227	10	0.0440529	NM_001004459	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.753352	0.00085	.	.	ENSG00000197887	ENST00000302592	T	0.34275	1.37	4.47	-1.08	0.09936	GPCR, rhodopsin-like superfamily (1);	0.857144	0.09920	N	0.738596	T	0.04770	0.0129	N	0.00089	-2.185	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30149	-0.9988	10	0.02654	T	1	.	0.1523	0.00094	0.2967:0.2321:0.2346:0.2366	.	151	Q8NGQ3	OR1S2_HUMAN	P	151	ENSP00000305469:A151P	ENSP00000305469:A151P	A	-	1	0	OR1S2	57727779	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.298000	0.02756	-0.572000	0.06006	-0.120000	0.15030	GCC	.	.	none		0.473	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
NLRP13	126204	hgsc.bcm.edu	37	19	56423386	56423386	+	Silent	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:56423386T>C	ENST00000342929.3	-	5	1796	c.1797A>G	c.(1795-1797)gaA>gaG	p.E599E	NLRP13_ENST00000588751.1_Silent_p.E599E	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	599							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TATCTTCCAGTTCTCTTGCTA	0.398																																					p.E599E		Atlas-SNP	.											NLRP13,NS,carcinoma,-2,3	NLRP13	220	3	0			c.A1797G						scavenged	.						83.0	85.0	84.0					19																	56423386		2203	4300	6503	SO:0001819	synonymous_variant	126204	exon5			TTCCAGTTCTCTT	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1797A>G	19.37:g.56423386T>C		Somatic	126	1	0.00793651		WXS	Illumina HiSeq	Phase_I	114	2	0.0175439	NM_176810	Q7RTR5	Silent	SNP	ENST00000342929.3	37	CCDS33119.1																																																																																			.	.	none		0.398	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810	
MCCC1	56922	hgsc.bcm.edu	37	3	182775212	182775212	+	Splice_Site	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:182775212T>C	ENST00000265594.4	-	8	908		c.e8-2		MCCC1_ENST00000492597.1_Splice_Site|MCCC1_ENST00000539926.1_Splice_Site	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)						biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	TCTACATGCCTATATAAAAGC	0.383																																					.		Atlas-SNP	.											MCCC1,NS,carcinoma,+2,1	MCCC1	87	1	0			c.762-2A>G						scavenged	.						62.0	52.0	55.0					3																	182775212		2202	4300	6502	SO:0001630	splice_region_variant	56922	exon9			CATGCCTATATAA	AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.762-2A>G	3.37:g.182775212T>C		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	88	3	0.0340909	NM_020166	Q59ES4|Q9H959|Q9NS97	Splice_Site	SNP	ENST00000265594.4	37	CCDS3241.1	.	.	.	.	.	.	.	.	.	.	T	17.52	3.411047	0.62399	.	.	ENSG00000078070	ENST00000265594;ENST00000492597;ENST00000392616;ENST00000539926;ENST00000476176;ENST00000448585;ENST00000541636	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0224	0.71640	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MCCC1	184257906	1.000000	0.71417	0.912000	0.35992	0.636000	0.38137	7.355000	0.79434	2.034000	0.60081	0.383000	0.25322	.	.	.	none		0.383	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350775.1	NM_020166	Intron
LYN	4067	hgsc.bcm.edu	37	8	56910951	56910951	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:56910951G>A	ENST00000519728.1	+	11	1393	c.1097G>A	c.(1096-1098)cGg>cAg	p.R366Q	LYN_ENST00000420292.1_3'UTR|LYN_ENST00000520220.2_Missense_Mutation_p.R345Q	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	366	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	TACATTCACCGGGACCTGCGA	0.448																																					p.R366Q		Atlas-SNP	.											.	LYN	54	.	0			c.G1097A						PASS	.						115.0	110.0	112.0					8																	56910951		2203	4300	6503	SO:0001583	missense	4067	exon11			TTCACCGGGACCT	M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1097G>A	8.37:g.56910951G>A	ENSP00000428924:p.Arg366Gln	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	187	65	0.347594	NM_002350	A0AVQ5	Missense_Mutation	SNP	ENST00000519728.1	37	CCDS6162.1	.	.	.	.	.	.	.	.	.	.	G	36	5.851905	0.97023	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	D;D	0.88354	-2.37;-2.37	5.52	5.52	0.82312	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97099	0.9052	H	0.98507	4.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	D	0.98468	1.0599	10	0.87932	D	0	.	19.4505	0.94865	0.0:0.0:1.0:0.0	.	436;366	Q6NUK7;P07948	.;LYN_HUMAN	Q	366;345	ENSP00000428924:R366Q;ENSP00000428424:R345Q	ENSP00000428924:R366Q	R	+	2	0	LYN	57073505	1.000000	0.71417	0.688000	0.30117	0.945000	0.59286	9.869000	0.99810	2.597000	0.87782	0.655000	0.94253	CGG	.	.	none		0.448	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378155.1	NM_002350	
ESCO1	114799	hgsc.bcm.edu	37	18	19153337	19153337	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr18:19153337T>C	ENST00000269214.5	-	4	2405	c.1468A>G	c.(1468-1470)Aaa>Gaa	p.K490E		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	490					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						TCAGAAGGTTTTATCTCATTG	0.318																																					p.K490E		Atlas-SNP	.											ESCO1,caecum,carcinoma,+1,2	ESCO1	89	2	0			c.A1468G						scavenged	.						85.0	82.0	83.0					18																	19153337		2203	4299	6502	SO:0001583	missense	114799	exon4			AAGGTTTTATCTC	AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.1468A>G	18.37:g.19153337T>C	ENSP00000269214:p.Lys490Glu	Somatic	188	0	0		WXS	Illumina HiSeq	Phase_I	174	3	0.0172414	NM_052911	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	ENST00000269214.5	37	CCDS32800.1	.	.	.	.	.	.	.	.	.	.	T	15.01	2.705479	0.48412	.	.	ENSG00000141446	ENST00000269214;ENST00000383276	T;T	0.63255	-0.03;1.48	5.16	3.98	0.46160	.	0.000000	0.64402	D	0.000005	T	0.52885	0.1762	M	0.64997	1.995	0.32572	N	0.5296	B	0.27823	0.19	B	0.24701	0.055	T	0.55283	-0.8165	10	0.12766	T	0.61	-22.1074	9.0532	0.36389	0.0:0.0:0.1851:0.8148	.	490	Q5FWF5	ESCO1_HUMAN	E	490	ENSP00000269214:K490E;ENSP00000372763:K490E	ENSP00000269214:K490E	K	-	1	0	ESCO1	17407335	1.000000	0.71417	0.999000	0.59377	0.935000	0.57460	1.158000	0.31737	0.962000	0.38057	0.533000	0.62120	AAA	.	.	none		0.318	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443942.1	NM_052911	
PRH1	5554	hgsc.bcm.edu	37	12	11035670	11035670	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:11035670G>A	ENST00000428168.2	-	2	127	c.90C>T	c.(88-90)ctC>ctT	p.L30L	PRR4_ENST00000536668.1_5'UTR	NM_006250.3	NP_006241.2	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 1	30	Inhibits hydroxyapatite formation, binds to hydroxyapatite and calcium.					extracellular space (GO:0005615)				endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(232;0.245)		CTGATATTACGAGGGGAACAT	0.383																																					p.L30L		Atlas-SNP	.											PRH1,colon,carcinoma,0,1	PRH1	17	1	0			c.C90T						scavenged	.						143.0	144.0	144.0					12																	11035670		2203	4300	6503	SO:0001819	synonymous_variant	5554	exon2			TATTACGAGGGGA			12p13.2	2013-05-10			ENSG00000231887	ENSG00000231887			9366	protein-coding gene	gene with protein product		168730				3009472	Standard	NM_001291314		Approved	Pa	uc021qvf.1	P02810		ENST00000428168.2:c.90C>T	12.37:g.11035670G>A		Somatic	158	1	0.00632911		WXS	Illumina HiSeq	Phase_I	129	3	0.0232558	NM_006250	A2VCM0|A3KN66|A5D902|B2RMW2|Q4VBP2|Q53XA2|Q6P2F6	Silent	SNP	ENST00000428168.2	37																																																																																				.	.	none		0.383	PRH1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006250	
ADO	84890	hgsc.bcm.edu	37	10	64565347	64565347	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:64565347C>G	ENST00000373783.1	+	1	832	c.528C>G	c.(526-528)taC>taG	p.Y176*	RP11-436D10.3_ENST00000425290.1_RNA	NM_032804.5	NP_116193.2	Q96SZ5	AEDO_HUMAN	2-aminoethanethiol (cysteamine) dioxygenase	176						mitochondrion (GO:0005739)	cysteamine dioxygenase activity (GO:0047800)|metal ion binding (GO:0046872)			lung(2)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					GGGCCGAGTACACCGAGGCCA	0.741																																					p.Y176X		Atlas-SNP	.											.	ADO	10	.	0			c.C528G						PASS	.						16.0	15.0	15.0					10																	64565347		2184	4278	6462	SO:0001587	stop_gained	84890	exon1			CGAGTACACCGAG	BC028589	CCDS7266.2	10q21.3	2007-08-28	2007-08-28	2007-08-28	ENSG00000181915	ENSG00000181915	1.13.11.19		23506	protein-coding gene	gene with protein product	"""cysteamine dioxygenase"""	611392	"""chromosome 10 open reading frame 22"""	C10orf22		17581819	Standard	NM_032804		Approved	FLJ14547	uc001jmg.3	Q96SZ5	OTTHUMG00000018306	ENST00000373783.1:c.528C>G	10.37:g.64565347C>G	ENSP00000362888:p.Tyr176*	Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	22	4	0.181818	NM_032804	B1AL29	Nonsense_Mutation	SNP	ENST00000373783.1	37	CCDS7266.2	.	.	.	.	.	.	.	.	.	.	C	40	7.980773	0.98594	.	.	ENSG00000181915	ENST00000373783	.	.	.	4.93	4.0	0.46444	.	0.396168	0.26293	N	0.025215	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.37	12.6806	0.56920	0.0:0.6815:0.3185:0.0	.	.	.	.	X	176	.	ENSP00000362888:Y176X	Y	+	3	2	ADO	64235353	1.000000	0.71417	0.929000	0.37066	0.937000	0.57800	2.542000	0.45744	1.002000	0.39104	0.655000	0.94253	TAC	.	.	none		0.741	ADO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048243.2	NM_032804	
CST2	1470	hgsc.bcm.edu	37	20	23805952	23805952	+	Silent	SNP	G	G	C	rs146039211	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr20:23805952G>C	ENST00000304725.2	-	2	307	c.237C>G	c.(235-237)ggC>ggG	p.G79G		NM_001322.2	NP_001313.1	P09228	CYTT_HUMAN	cystatin SA	79					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|cervix(1)|large_intestine(1)|liver(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	10						AATTCACCCCGCCCACGATCT	0.542																																					p.G79G	Pancreas(193;496 3017 22514 29918)	Atlas-SNP	.											CST2,NS,adenoma,-1,1	CST2	39	1	0			c.C237G						scavenged	.						226.0	176.0	193.0					20																	23805952		2203	4300	6503	SO:0001819	synonymous_variant	1470	exon2			CACCCCGCCCACG	M19671	CCDS13161.1	20p11.2	2007-11-29			ENSG00000170369	ENSG00000170369			2474	protein-coding gene	gene with protein product	"""cystatin 2"""	123856					Standard	NM_001322		Approved		uc002wtq.1	P09228	OTTHUMG00000032086	ENST00000304725.2:c.237C>G	20.37:g.23805952G>C		Somatic	109	4	0.0366972		WXS	Illumina HiSeq	Phase_I	114	5	0.0438596	NM_001322	Q9UCQ7	Silent	SNP	ENST00000304725.2	37	CCDS13161.1																																																																																			G|0.999;A|0.001	.	alt		0.542	CST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078352.2		
LLGL2	3993	hgsc.bcm.edu	37	17	73552167	73552167	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:73552167G>A	ENST00000392550.3	+	3	233	c.116G>A	c.(115-117)gGc>gAc	p.G39D	LLGL2_ENST00000578363.1_Missense_Mutation_p.G39D|LLGL2_ENST00000577200.1_Missense_Mutation_p.G39D|LLGL2_ENST00000167462.5_Missense_Mutation_p.G39D|LLGL2_ENST00000375227.4_Missense_Mutation_p.G39D	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	39					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			AGCGCCCTCGGCTACAGCCCG	0.687																																					p.G39D		Atlas-SNP	.											.	LLGL2	155	.	0			c.G116A						PASS	.						75.0	64.0	68.0					17																	73552167		2202	4300	6502	SO:0001583	missense	3993	exon3			CCCTCGGCTACAG	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.116G>A	17.37:g.73552167G>A	ENSP00000376333:p.Gly39Asp	Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	50	24	0.48	NM_001015002	Q14521|Q9BR62	Missense_Mutation	SNP	ENST00000392550.3	37	CCDS32733.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109326	0.37242	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000375227	T;T;T	0.61742	1.7;1.7;0.08	4.68	4.68	0.58851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.051374	0.85682	D	0.000000	T	0.53465	0.1798	L	0.36672	1.1	0.49687	D	0.999815	B;B;B	0.27971	0.169;0.124;0.196	B;B;B	0.33799	0.049;0.049;0.17	T	0.56649	-0.7944	10	0.56958	D	0.05	-7.1885	17.7752	0.88505	0.0:0.0:1.0:0.0	.	39;39;39	Q6P1M3-2;Q6P1M3;Q6P1M3-3	.;L2GL2_HUMAN;.	D	39	ENSP00000167462:G39D;ENSP00000376333:G39D;ENSP00000364375:G39D	ENSP00000167462:G39D	G	+	2	0	LLGL2	71063762	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	3.755000	0.55197	2.431000	0.82371	0.563000	0.77884	GGC	.	.	none		0.687	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524	
TET2	54790	hgsc.bcm.edu	37	4	106193850	106193850	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:106193850A>T	ENST00000540549.1	+	10	5172	c.4312A>T	c.(4312-4314)Aaa>Taa	p.K1438*	TET2_ENST00000545826.1_3'UTR|TET2_ENST00000380013.4_Nonsense_Mutation_p.K1438*|TET2_ENST00000513237.1_Nonsense_Mutation_p.K1459*			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1438					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TCAGGAGGAGAAAAAACGGAG	0.473			"""Mis N, F"""		MDS																																p.K1438X		Atlas-SNP	.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	1762	.	0			c.A4312T						PASS	.						161.0	152.0	155.0					4																	106193850		692	1591	2283	SO:0001587	stop_gained	54790	exon10			GAGGAGAAAAAAC	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.4312A>T	4.37:g.106193850A>T	ENSP00000442788:p.Lys1438*	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	130	108	0.830769	NM_001127208	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Nonsense_Mutation	SNP	ENST00000540549.1	37	CCDS47120.1	.	.	.	.	.	.	.	.	.	.	A	50	16.191500	0.99857	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.9501	15.5771	0.76400	1.0:0.0:0.0:0.0	.	.	.	.	X	1438;1459;1438	.	ENSP00000369351:K1438X	K	+	1	0	TET2	106413299	1.000000	0.71417	0.996000	0.52242	0.835000	0.47333	6.960000	0.76036	2.324000	0.78689	0.533000	0.62120	AAA	.	.	none		0.473	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
FAM186A	121006	hgsc.bcm.edu	37	12	50746166	50746166	+	Silent	SNP	G	G	C	rs368983791		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:50746166G>C	ENST00000327337.5	-	4	4448	c.4449C>G	c.(4447-4449)ctC>ctG	p.L1483L	FAM186A_ENST00000543111.1_Silent_p.L1483L|FAM186A_ENST00000543096.1_5'Flank	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1483								p.L1483L(2)									GCGGAGGGATGAGAGGGATCC	0.647																																					p.L1483L	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											FAM186A_ENST00000327337,NS,carcinoma,0,3	FAM186A	181	3	2	Substitution - coding silent(2)	endometrium(2)	c.C4449G						scavenged	.						22.0	21.0	21.0					12																	50746166		692	1591	2283	SO:0001819	synonymous_variant	121006	exon4			AGGGATGAGAGGG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4449C>G	12.37:g.50746166G>C		Somatic	248	4	0.016129		WXS	Illumina HiSeq	Phase_I	266	6	0.0225564	NM_001145475		Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																			.	.	weak		0.647	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643066	1643066	+	Silent	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:1643066A>G	ENST00000399682.1	-	1	302	c.258T>C	c.(256-258)ggT>ggC	p.G86G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G86G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCCCTTGGAACCCCCACAAG	0.667																																					p.G86G		Atlas-SNP	.											KRTAP5-4,NS,carcinoma,0,3	KRTAP5-4	78	3	1	Substitution - coding silent(1)	endometrium(1)	c.T258C						scavenged	.						9.0	15.0	13.0					11																	1643066		683	1577	2260	SO:0001819	synonymous_variant	387267	exon1			CTTGGAACCCCCA	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.258T>C	11.37:g.1643066A>G		Somatic	108	1	0.00925926		WXS	Illumina HiSeq	Phase_I	129	6	0.0465116	NM_001012709		Silent	SNP	ENST00000399682.1	37																																																																																				.	.	none		0.667	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
RBM14	10432	hgsc.bcm.edu	37	11	66391989	66391989	+	Silent	SNP	C	C	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:66391989C>A	ENST00000310137.4	+	2	781	c.642C>A	c.(640-642)cgC>cgA	p.R214R	RBM14-RBM4_ENST00000412278.2_Intron|RBM4_ENST00000503028.2_Intron|RBM14_ENST00000393979.3_Intron|RBM14-RBM4_ENST00000500635.2_Intron|RBM14_ENST00000409738.4_Intron|RBM14_ENST00000409372.1_3'UTR|RBM14-RBM4_ENST00000511114.1_Intron|RBM4_ENST00000514361.3_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	214					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						GTCGCGACCGCAGCCCTCTGC	0.642																																					p.R214R		Atlas-SNP	.											RBM14,rectum,carcinoma,+1,1	RBM14	59	1	0			c.C642A						scavenged	.						43.0	44.0	44.0					11																	66391989		2200	4295	6495	SO:0001819	synonymous_variant	10432	exon2			CGACCGCAGCCCT	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.642C>A	11.37:g.66391989C>A		Somatic	42	1	0.0238095		WXS	Illumina HiSeq	Phase_I	50	2	0.04	NM_006328	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Silent	SNP	ENST00000310137.4	37	CCDS8147.1																																																																																			.	.	none		0.642	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328	
KRTAP10-11	386678	hgsc.bcm.edu	37	21	46067194	46067194	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:46067194C>T	ENST00000334670.8	+	1	864	c.819C>T	c.(817-819)tgC>tgT	p.C273C	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	273						keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						CGGCCTCCTGCGTGTCCCTCC	0.677																																					p.C273C		Atlas-SNP	.											KRTAP10-11,NS,carcinoma,0,1	KRTAP10-11	36	1	0			c.C819T						scavenged	.						41.0	52.0	48.0					21																	46067194		2199	4293	6492	SO:0001819	synonymous_variant	386678	exon1			CTCCTGCGTGTCC	AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.819C>T	21.37:g.46067194C>T		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	136	5	0.0367647	NM_198692	A2RRF9	Silent	SNP	ENST00000334670.8	37	CCDS42962.1																																																																																			.	.	none		0.677	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128029.1	NM_198692	
PSG2	5670	hgsc.bcm.edu	37	19	43585253	43585253	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:43585253C>T	ENST00000406487.1	-	2	308	c.210G>A	c.(208-210)ggG>ggA	p.G70G	PSG2_ENST00000491995.1_5'Flank	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	70	Ig-like V-type.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.G70G(2)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				CCCTGATTTGCCCTTTGTACC	0.433																																					p.G70G		Atlas-SNP	.											PSG2,NS,carcinoma,0,2	PSG2	84	2	2	Substitution - coding silent(2)	prostate(2)	c.G210A						scavenged	.						92.0	96.0	94.0					19																	43585253		2201	4285	6486	SO:0001819	synonymous_variant	5670	exon2			GATTTGCCCTTTG		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.210G>A	19.37:g.43585253C>T		Somatic	189	0	0		WXS	Illumina HiSeq	Phase_I	141	5	0.035461	NM_031246	Q8TCD9|Q9UEA4|Q9UQ78	Silent	SNP	ENST00000406487.1	37	CCDS12616.1																																																																																			.	.	none		0.433	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
OR52J3	119679	hgsc.bcm.edu	37	11	5068207	5068207	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:5068207T>C	ENST00000380370.1	+	1	452	c.452T>C	c.(451-453)gTa>gCa	p.V151A		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V151A(1)		NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGTGCATTGTAATTCGTCCC	0.473																																					p.V151A		Atlas-SNP	.											OR52J3,caecum,carcinoma,0,1	OR52J3	77	1	1	Substitution - Missense(1)	large_intestine(1)	c.T452C						scavenged	.						196.0	129.0	152.0					11																	5068207		2201	4298	6499	SO:0001583	missense	119679	exon1			GCATTGTAATTCG	AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.452T>C	11.37:g.5068207T>C	ENSP00000369728:p.Val151Ala	Somatic	220	0	0		WXS	Illumina HiSeq	Phase_I	221	4	0.0180995	NM_001001916	Q6IFE4	Missense_Mutation	SNP	ENST00000380370.1	37	CCDS31370.1	.	.	.	.	.	.	.	.	.	.	T	4.283	0.051688	0.08291	.	.	ENSG00000205495	ENST00000380370	T	0.37411	1.2	4.19	3.04	0.35103	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42420	D	0.000713	T	0.33411	0.0862	L	0.53729	1.69	0.09310	N	1	B	0.10296	0.003	B	0.22880	0.042	T	0.32929	-0.9888	10	0.62326	D	0.03	.	9.8235	0.40896	0.0:0.0:0.1731:0.8269	.	151	Q8NH60	O52J3_HUMAN	A	151	ENSP00000369728:V151A	ENSP00000369728:V151A	V	+	2	0	OR52J3	5024783	0.000000	0.05858	0.002000	0.10522	0.031000	0.12232	-0.496000	0.06436	0.626000	0.30322	0.533000	0.62120	GTA	.	.	none		0.473	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142807.1	NM_001001916	
OR10G8	219869	hgsc.bcm.edu	37	11	123900411	123900411	+	Missense_Mutation	SNP	G	G	A	rs202220125	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:123900411G>A	ENST00000431524.1	+	1	115	c.82G>A	c.(82-84)Gtc>Atc	p.V28I		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CCTCTTTGGAGTCTTCCTGGT	0.572													G|||	7	0.00139776	0.0	0.0043	5008	,	,		19799	0.0		0.001	False		,,,				2504	0.0031				p.V28I		Atlas-SNP	.											OR10G8,right_upper_lobe,carcinoma,-2,2	OR10G8	132	2	0			c.G82A						scavenged	.						195.0	177.0	183.0					11																	123900411		2201	4299	6500	SO:0001583	missense	219869	exon1			TTTGGAGTCTTCC	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.82G>A	11.37:g.123900411G>A	ENSP00000389072:p.Val28Ile	Somatic	294	6	0.0204082		WXS	Illumina HiSeq	Phase_I	251	6	0.0239044	NM_001004464	B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	G	4.296	0.054107	0.08291	.	.	ENSG00000234560	ENST00000431524	T	0.02916	4.11	2.95	-4.35	0.03656	.	0.824866	0.10366	N	0.683403	T	0.01254	0.0041	N	0.16066	0.365	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48258	-0.9051	10	0.10377	T	0.69	.	1.3401	0.02153	0.2804:0.2787:0.3033:0.1376	.	28	Q8NGN5	O10G8_HUMAN	I	28	ENSP00000389072:V28I	ENSP00000389072:V28I	V	+	1	0	OR10G8	123405621	0.000000	0.05858	0.003000	0.11579	0.022000	0.10575	-3.513000	0.00446	-1.037000	0.03283	-0.324000	0.08512	GTC	G|0.999;A|0.001	0.001	weak		0.572	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
C3	718	hgsc.bcm.edu	37	19	6714453	6714453	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:6714453G>A	ENST00000245907.6	-	5	601	c.509C>T	c.(508-510)cCg>cTg	p.P170L		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	170					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	GATGCCTTCCGGGTTCTGTGG	0.567																																					p.P170L		Atlas-SNP	.											.	C3	192	.	0			c.C509T						PASS	.						57.0	48.0	51.0					19																	6714453		2203	4299	6502	SO:0001583	missense	718	exon5			CCTTCCGGGTTCT	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.509C>T	19.37:g.6714453G>A	ENSP00000245907:p.Pro170Leu	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	61	26	0.42623	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	g	16.30	3.085611	0.55861	.	.	ENSG00000125730	ENST00000245907	T	0.78481	-1.18	4.97	4.97	0.65823	Alpha-2-macroglobulin, N-terminal (1);	0.168178	0.53938	D	0.000053	D	0.91717	0.7381	H	0.96142	3.775	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94274	0.7513	10	0.87932	D	0	.	15.7294	0.77790	0.0:0.0:1.0:0.0	.	170	P01024	CO3_HUMAN	L	170	ENSP00000245907:P170L	ENSP00000245907:P170L	P	-	2	0	C3	6665453	1.000000	0.71417	0.904000	0.35570	0.061000	0.15899	6.362000	0.73077	2.297000	0.77311	0.509000	0.49947	CCG	.	.	none		0.567	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
RFX6	222546	hgsc.bcm.edu	37	6	117248414	117248414	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:117248414C>T	ENST00000332958.2	+	17	2126	c.2110C>T	c.(2110-2112)Cag>Tag	p.Q704*		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	704					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CTCTAACTACCAGACTGTGTT	0.507																																					p.Q704X		Atlas-SNP	.											.	RFX6	141	.	0			c.C2110T						PASS	.						137.0	129.0	131.0					6																	117248414		2203	4300	6503	SO:0001587	stop_gained	222546	exon17			AACTACCAGACTG	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.2110C>T	6.37:g.117248414C>T	ENSP00000332208:p.Gln704*	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	114	55	0.482456	NM_173560	Q5T6B3	Nonsense_Mutation	SNP	ENST00000332958.2	37	CCDS5113.1	.	.	.	.	.	.	.	.	.	.	C	37	6.417248	0.97550	.	.	ENSG00000185002	ENST00000332958	.	.	.	5.15	5.15	0.70609	.	0.122893	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-14.9498	13.1466	0.59465	0.0:0.9235:0.0:0.0765	.	.	.	.	X	704	.	ENSP00000332208:Q704X	Q	+	1	0	RFX6	117355107	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.039000	0.64185	2.682000	0.91365	0.655000	0.94253	CAG	.	.	none		0.507	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
PITPNM3	83394	hgsc.bcm.edu	37	17	6358850	6358850	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:6358850G>A	ENST00000262483.8	-	20	2820	c.2733C>T	c.(2731-2733)caC>caT	p.H911H	PITPNM3_ENST00000421306.3_Silent_p.H875H|PITPNM3_ENST00000576664.1_5'UTR	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	911					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CTGGCTGCGCGTGCAGCCCGA	0.697																																					p.H911H		Atlas-SNP	.											.	PITPNM3	91	.	0			c.C2733T						PASS	.						23.0	27.0	26.0					17																	6358850		2195	4299	6494	SO:0001819	synonymous_variant	83394	exon20			CTGCGCGTGCAGC	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.2733C>T	17.37:g.6358850G>A		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	42	16	0.380952	NM_031220	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	37	CCDS11076.1																																																																																			.	.	none		0.697	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220	
NUP210	23225	hgsc.bcm.edu	37	3	13379381	13379381	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:13379381C>T	ENST00000254508.5	-	26	3590	c.3508G>A	c.(3508-3510)Gtg>Atg	p.V1170M	NUP210_ENST00000485755.1_Intron	NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1170					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					CGGATCCTCACGGCCCTTAGC	0.642																																					p.V1170M		Atlas-SNP	.											.	NUP210	182	.	0			c.G3508A						PASS	.						53.0	46.0	49.0					3																	13379381		2203	4300	6503	SO:0001583	missense	23225	exon26			TCCTCACGGCCCT	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.3508G>A	3.37:g.13379381C>T	ENSP00000254508:p.Val1170Met	Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	42	18	0.428571	NM_024923	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365480	0.41902	.	.	ENSG00000132182	ENST00000254508	T	0.09163	3.01	4.86	4.86	0.63082	.	0.073766	0.56097	D	0.000034	T	0.17874	0.0429	M	0.70595	2.14	0.50313	D	0.999868	D	0.60160	0.987	P	0.45881	0.496	T	0.03051	-1.1078	10	0.30078	T	0.28	-20.1592	15.1051	0.72315	0.0:1.0:0.0:0.0	.	1170	Q8TEM1	PO210_HUMAN	M	1170	ENSP00000254508:V1170M	ENSP00000254508:V1170M	V	-	1	0	NUP210	13354381	0.987000	0.35691	0.941000	0.38009	0.017000	0.09413	2.662000	0.46766	2.408000	0.81797	0.655000	0.94253	GTG	.	.	none		0.642	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
PLXNB3	5365	hgsc.bcm.edu	37	X	153035889	153035889	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chrX:153035889A>G	ENST00000361971.5	+	9	1997	c.1883A>G	c.(1882-1884)gAg>gGg	p.E628G	PLXNB3_ENST00000538282.1_Missense_Mutation_p.E238G|PLXNB3_ENST00000538543.1_Missense_Mutation_p.E178G|PLXNB3_ENST00000538776.1_Missense_Mutation_p.E281G|PLXNB3_ENST00000538966.1_Missense_Mutation_p.E651G	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	628	PSI 2.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGGCCTTGGAGGCGGCTGCC	0.657																																					p.E651G		Atlas-SNP	.											.	PLXNB3	208	.	0			c.A1952G						PASS	.						57.0	43.0	47.0					X																	153035889		2193	4296	6489	SO:0001583	missense	5365	exon10			CCTTGGAGGCGGC	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.1883A>G	X.37:g.153035889A>G	ENSP00000355378:p.Glu628Gly	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	132	6	0.0454545	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	a	5.600	0.295469	0.10622	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538543;ENST00000538282	T;T;T;T;T	0.68624	5.21;5.17;4.6;1.91;-0.34	5.1	3.86	0.44501	.	0.274152	0.33591	N	0.004748	T	0.54631	0.1870	L	0.56769	1.78	0.23204	N	0.99813	B;B;B;B;B	0.28233	0.075;0.204;0.058;0.035;0.025	B;B;B;B;B	0.25614	0.021;0.055;0.04;0.062;0.045	T	0.39292	-0.9621	10	0.24483	T	0.36	.	4.6981	0.12813	0.6145:0.1945:0.0:0.191	.	281;310;178;651;628	B7Z3H9;B7Z9A5;F5GZZ4;F5H773;Q9ULL4	.;.;.;.;PLXB3_HUMAN	G	651;628;281;178;238	ENSP00000442736:E651G;ENSP00000355378:E628G;ENSP00000445569:E281G;ENSP00000444086:E178G;ENSP00000441919:E238G	ENSP00000355378:E628G	E	+	2	0	PLXNB3	152689083	0.004000	0.15560	0.572000	0.28498	0.065000	0.16274	0.309000	0.19332	1.683000	0.51011	0.427000	0.28365	GAG	.	.	none		0.657	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
HLA-DRB1	3123	hgsc.bcm.edu	37	6	32551948	32551948	+	Missense_Mutation	SNP	G	G	A	rs67476479|rs17886882		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:32551948G>A	ENST00000360004.5	-	2	413	c.308C>T	c.(307-309)gCg>gTg	p.A103V		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	103	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)		p.A103fs*26(2)		large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GGTGTCCACCGCGGCCCGCGC	0.682										Multiple Myeloma(14;0.17)																											p.A103V		Atlas-SNP	.											HLA-DRB1,brain,glioma,0,2	HLA-DRB1	41	2	2	Deletion - Frameshift(2)	ovary(1)|large_intestine(1)	c.C308T	GRCh37	CX045849	HLA-DRB1	X	rs17886882	scavenged	.						26.0	27.0	26.0					6																	32551948		2106	4192	6298	SO:0001583	missense	3123	exon2			TCCACCGCGGCCC	AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.308C>T	6.37:g.32551948G>A	ENSP00000353099:p.Ala103Val	Somatic	95	4	0.0421053		WXS	Illumina HiSeq	Phase_I	28	11	0.392857	NM_002124	P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	.	.	.	.	.	.	.	.	.	.	.	9.035	0.988355	0.18966	.	.	ENSG00000196126	ENST00000360004	T	0.00277	8.34	3.52	-4.93	0.03066	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (3);MHC classes I/II-like antigen recognition protein (1);	2.651270	0.02020	N	0.047686	T	0.00039	0.0001	N	0.02379	-0.575	0.09310	N	1	B	0.31274	0.317	B	0.22152	0.038	T	0.35822	-0.9773	10	0.48119	T	0.1	.	10.1847	0.42991	0.0:0.102:0.2902:0.6078	rs17886882;rs28724091	103	P01911	2B1F_HUMAN	V	103	ENSP00000353099:A103V	ENSP00000353099:A103V	A	-	2	0	HLA-DRB1	32659926	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-3.748000	0.00376	-1.340000	0.02227	-3.004000	0.00076	GCG	.	.	weak		0.682	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
B2M	567	hgsc.bcm.edu	37	15	45003779	45003779	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:45003779T>C	ENST00000558401.1	+	1	105	c.35T>C	c.(34-36)cTa>cCa	p.L12P	B2M_ENST00000544417.1_Missense_Mutation_p.L12P|B2M_ENST00000559916.1_Missense_Mutation_p.L12P|PATL2_ENST00000558573.1_5'Flank	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	12					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.A11fs*42(1)|p.L12Q(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GTGCTCGCGCTACTCTCTCTT	0.617																																					p.L12P		Atlas-SNP	.											B2M,colon,carcinoma,0,2	B2M	99	2	2	Substitution - Missense(1)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(2)	c.T35C						PASS	.						132.0	94.0	107.0					15																	45003779		2198	4298	6496	SO:0001583	missense	567	exon1			TCGCGCTACTCTC	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.35T>C	15.37:g.45003779T>C	ENSP00000452780:p.Leu12Pro	Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	99	76	0.767677	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.443926	0.63067	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01388	4.95	5.35	5.35	0.76521	.	9.011740	0.00721	U	0.000881	T	0.10809	0.0264	M	0.74647	2.275	0.29321	N	0.867335	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.17107	-1.0380	10	0.87932	D	0	.	11.9001	0.52678	0.0:0.0:0.0:1.0	.	12;12;12	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	P	12	ENSP00000437604:L12P	ENSP00000340858:L12P	L	+	2	0	B2M	42791071	0.253000	0.23982	0.051000	0.19133	0.007000	0.05969	3.556000	0.53734	2.371000	0.80710	0.533000	0.62120	CTA	.	.	none		0.617	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
LMOD1	25802	hgsc.bcm.edu	37	1	201869208	201869208	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:201869208C>T	ENST00000367288.4	-	2	1179	c.933G>A	c.(931-933)gaG>gaA	p.E311E	RP11-307B6.3_ENST00000414927.1_RNA|RP11-307B6.3_ENST00000458139.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	311					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GAGCTGCCTCCTCCTCCACCT	0.537																																					p.E311E		Atlas-SNP	.											LMOD1,caecum,carcinoma,-2,3	LMOD1	59	3	0			c.G933A						scavenged	.						68.0	68.0	68.0					1																	201869208		2053	4196	6249	SO:0001819	synonymous_variant	25802	exon2			TGCCTCCTCCTCC	X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.933G>A	1.37:g.201869208C>T		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	159	2	0.0125786	NM_012134	B1APV6|C4AMB1|Q68EN2	Silent	SNP	ENST00000367288.4	37	CCDS53457.1																																																																																			.	.	none		0.537	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087085.2		
ZNF337	26152	hgsc.bcm.edu	37	20	25656946	25656946	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr20:25656946C>T	ENST00000376436.1	-	4	1517	c.978G>A	c.(976-978)ggG>ggA	p.G326G	ZNF337_ENST00000538750.1_Silent_p.G294G|RP4-694B14.5_ENST00000439498.1_RNA|RP4-694B14.5_ENST00000428254.1_RNA|RP4-694B14.5_ENST00000421829.1_RNA|ZNF337_ENST00000252979.5_Silent_p.G326G|RP4-694B14.5_ENST00000455791.1_RNA|ZNF337_ENST00000481610.1_5'Flank|RP4-694B14.5_ENST00000414393.1_RNA			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	326					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TATAGCCTCGCCCACACTCCT	0.483																																					p.G326G		Atlas-SNP	.											.	ZNF337	65	.	0			c.G978A						PASS	.						105.0	100.0	102.0					20																	25656946		2203	4300	6503	SO:0001819	synonymous_variant	26152	exon5			GCCTCGCCCACAC		CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.978G>A	20.37:g.25656946C>T		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	106	8	0.0754717	NM_015655	B4DSM2|Q9Y3Y5	Silent	SNP	ENST00000376436.1	37	CCDS13174.1																																																																																			.	.	none		0.483	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078454.1		
PBX3	5090	hgsc.bcm.edu	37	9	128692039	128692039	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:128692039C>T	ENST00000373489.5	+	4	638	c.622C>T	c.(622-624)Cga>Tga	p.R208*	PBX3_ENST00000342287.5_Nonsense_Mutation_p.R208*|PBX3_ENST00000447726.2_Nonsense_Mutation_p.R133*|PBX3_ENST00000373483.2_Nonsense_Mutation_p.R27*|PBX3_ENST00000373487.4_Nonsense_Mutation_p.R208*|PBX3_ENST00000538998.1_3'UTR	NM_006195.5	NP_006186.1	P40426	PBX3_HUMAN	pre-B-cell leukemia homeobox 3	208					adult locomotory behavior (GO:0008344)|anterior compartment pattern formation (GO:0007387)|dorsal spinal cord development (GO:0021516)|neuron development (GO:0048666)|posterior compartment specification (GO:0007388)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R208*(1)		biliary_tract(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)	24						CATCATCCATCGAAAATTTAG	0.393																																					p.R208X		Atlas-SNP	.											PBX3,colon,carcinoma,0,1	PBX3	45	1	1	Substitution - Nonsense(1)	large_intestine(1)	c.C622T						scavenged	.						156.0	146.0	149.0					9																	128692039		2203	4300	6503	SO:0001587	stop_gained	5090	exon4			ATCCATCGAAAAT		CCDS6865.1, CCDS48021.1	9q33.3	2011-06-20	2007-01-30		ENSG00000167081	ENSG00000167081		"""Homeoboxes / TALE class"""	8634	protein-coding gene	gene with protein product		176312	"""pre-B-cell leukemia transcription factor 3"""			1682799	Standard	NM_006195		Approved		uc004bqb.3	P40426	OTTHUMG00000020684	ENST00000373489.5:c.622C>T	9.37:g.128692039C>T	ENSP00000362588:p.Arg208*	Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	144	3	0.0208333	NM_006195	E9PB27|Q5JSA0|Q5JSA1|Q5VXL3|Q96PF9|Q96PG0	Nonsense_Mutation	SNP	ENST00000373489.5	37	CCDS6865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.162828|4.162828	0.78226|0.78226	.|.	.|.	ENSG00000167081|ENSG00000167081	ENST00000373492;ENST00000373489;ENST00000342287;ENST00000373487;ENST00000373483;ENST00000373482;ENST00000447726;ENST00000538998|ENST00000428092	.|.	.|.	.|.	5.69|5.69	3.76|3.76	0.43208|0.43208	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.63977	.|0.2557	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71527	.|-0.4566	.|3	0.02654|.	T|.	1|.	.|.	13.9564|13.9564	0.64152|0.64152	0.3936:0.6064:0.0:0.0|0.3936:0.6064:0.0:0.0	.|.	.|.	.|.	.|.	X|L	27;208;208;208;27;27;133;119|128	.|.	ENSP00000341990:R208X|.	R|S	+|+	1|2	2|0	PBX3|PBX3	127731860|127731860	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.963000|2.963000	0.49184|0.49184	1.392000|1.392000	0.46585|0.46585	0.555000|0.555000	0.69702|0.69702	CGA|TCG	.	.	none		0.393	PBX3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417765.1		
RSPH1	89765	hgsc.bcm.edu	37	21	43913086	43913086	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:43913086C>G	ENST00000291536.3	-	2	325	c.158G>C	c.(157-159)aGa>aCa	p.R53T	RSPH1_ENST00000398352.3_Intron	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	53					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.R53I(1)		large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						CTGGCCATGTCTTTTACCGAA	0.488																																					p.R53T	Esophageal Squamous(23;63 706 6286 10288 12913)	Atlas-SNP	.											RSPH1,rectum,carcinoma,0,1	RSPH1	36	1	1	Substitution - Missense(1)	large_intestine(1)	c.G158C						scavenged	.						245.0	211.0	222.0					21																	43913086		2203	4300	6503	SO:0001583	missense	89765	exon2			CCATGTCTTTTAC	AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.158G>C	21.37:g.43913086C>G	ENSP00000291536:p.Arg53Thr	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	154	3	0.0194805	NM_080860	A8MWV0|B2RBN9|Q3MJA1	Missense_Mutation	SNP	ENST00000291536.3	37	CCDS13688.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.485978	0.84854	.	.	ENSG00000160188	ENST00000291536	T	0.59906	0.23	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.79335	0.4428	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79215	-0.1895	10	0.19147	T	0.46	.	17.868	0.88801	0.0:1.0:0.0:0.0	.	53	Q8WYR4	RSPH1_HUMAN	T	53	ENSP00000291536:R53T	ENSP00000291536:R53T	R	-	2	0	RSPH1	42786155	0.999000	0.42202	0.953000	0.39169	0.912000	0.54170	6.691000	0.74573	2.284000	0.76573	0.462000	0.41574	AGA	.	.	none		0.488	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195379.1		
MUC4	4585	hgsc.bcm.edu	37	3	195506974	195506974	+	Missense_Mutation	SNP	G	G	A	rs142066159	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:195506974G>A	ENST00000463781.3	-	2	11936	c.11477C>T	c.(11476-11478)cCt>cTt	p.P3826L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3826L|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P3826L(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGGGGT	0.582													.|||	246	0.0491214	0.1225	0.0144	5008	,	,		9155	0.003		0.0258	False		,,,				2504	0.046				p.P3826L		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	2	Substitution - Missense(2)	endometrium(2)	c.C11477T						scavenged	.						5.0	5.0	5.0					3																	195506974		403	1208	1611	SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11477C>T	3.37:g.195506974G>A	ENSP00000417498:p.Pro3826Leu	Somatic	60	1	0.0166667		WXS	Illumina HiSeq	Phase_I	90	9	0.1	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	5.523	0.281411	0.10458	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.56941	1.22;0.43	.	.	.	.	.	.	.	.	T	0.48205	0.1487	N	0.19112	0.55	0.20307	N	0.999915	D	0.64830	0.994	P	0.62885	0.908	T	0.36261	-0.9755	7	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	3698	E7ESK3	.	L	3826	ENSP00000417498:P3826L;ENSP00000420243:P3826L	.	P	-	2	0	MUC4	196991753	0.014000	0.17966	0.086000	0.20670	0.086000	0.17979	1.838000	0.39211	0.064000	0.16427	0.064000	0.15345	CCT	.	.	weak		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MS4A14	84689	hgsc.bcm.edu	37	11	60183214	60183214	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:60183214A>G	ENST00000300187.6	+	5	1050	c.773A>G	c.(772-774)aAg>aGg	p.K258R	MS4A14_ENST00000531783.1_Missense_Mutation_p.K291R|MS4A14_ENST00000395005.2_Missense_Mutation_p.K241R|MS4A14_ENST00000531787.1_Missense_Mutation_p.K146R|MS4A14_ENST00000395001.1_3'UTR	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	258						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						CTAGAGAAAAAGCCCTCAGAA	0.378																																					p.K291R		Atlas-SNP	.											MS4A14,NS,carcinoma,0,2	MS4A14	120	2	0			c.A872G						scavenged	.						55.0	54.0	54.0					11																	60183214		2203	4299	6502	SO:0001583	missense	84689	exon6			AGAAAAAGCCCTC	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.773A>G	11.37:g.60183214A>G	ENSP00000300187:p.Lys258Arg	Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	158	2	0.0126582	NM_001261828	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000300187.6	37	CCDS31569.1	.	.	.	.	.	.	.	.	.	.	A	8.008	0.756924	0.15846	.	.	ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000531783	T;T;T;T	0.30448	1.53;2.72;1.53;3.1	3.58	-6.7	0.01766	.	5.939230	0.00964	N	0.003146	T	0.19886	0.0478	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.12785	-1.0534	10	0.22706	T	0.39	1.1772	12.6965	0.57008	0.2198:0.0:0.7802:0.0	.	241;258	Q96JA4-2;Q96JA4	.;M4A14_HUMAN	R	146;258;241;291	ENSP00000437222:K146R;ENSP00000300187:K258R;ENSP00000378453:K241R;ENSP00000433761:K291R	ENSP00000300187:K258R	K	+	2	0	MS4A14	59939790	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.221000	0.02968	-1.670000	0.01468	-0.256000	0.11100	AAG	.	.	none		0.378	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2		
ST18	9705	hgsc.bcm.edu	37	8	53079501	53079501	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:53079501C>T	ENST00000276480.7	-	11	1798	c.1115G>A	c.(1114-1116)gGa>gAa	p.G372E		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	372					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G372E(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				GCCATCACATCCAGGGATCGG	0.532																																					p.G372E		Atlas-SNP	.											ST18,extremity,malignant_melanoma,0,1	ST18	212	1	1	Substitution - Missense(1)	skin(1)	c.G1115A						scavenged	.						135.0	138.0	137.0					8																	53079501		2203	4300	6503	SO:0001583	missense	9705	exon11			TCACATCCAGGGA	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1115G>A	8.37:g.53079501C>T	ENSP00000276480:p.Gly372Glu	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	120	4	0.0333333	NM_014682	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.908433	0.92107	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.75154	-0.35;-0.91	5.57	5.57	0.84162	.	0.108001	0.64402	D	0.000006	D	0.90638	0.7064	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92805	0.6259	10	0.87932	D	0	-17.2591	19.5372	0.95257	0.0:1.0:0.0:0.0	.	372;372	E5RHS3;O60284	.;ST18_HUMAN	E	372	ENSP00000276480:G372E;ENSP00000428521:G372E	ENSP00000276480:G372E	G	-	2	0	ST18	53242054	1.000000	0.71417	0.775000	0.31657	0.799000	0.45148	7.818000	0.86416	2.609000	0.88269	0.563000	0.77884	GGA	.	.	none		0.532	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
CPSF1	29894	hgsc.bcm.edu	37	8	145623970	145623970	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:145623970T>C	ENST00000349769.3	-	18	1791	c.1697A>G	c.(1696-1698)gAc>gGc	p.D566G	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	566					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GCCGTCGTCGTCTGCTTCAGG	0.667																																					p.D566G	NSCLC(133;1088 1848 27708 34777 35269)	Atlas-SNP	.											CPSF1,NS,carcinoma,+1,1	CPSF1	92	1	0			c.A1697G						scavenged	.						103.0	102.0	102.0					8																	145623970		2203	4300	6503	SO:0001583	missense	29894	exon18			TCGTCGTCTGCTT	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.1697A>G	8.37:g.145623970T>C	ENSP00000339353:p.Asp566Gly	Somatic	216	0	0		WXS	Illumina HiSeq	Phase_I	209	3	0.0143541	NM_013291	Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	37	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.403626	0.62288	.	.	ENSG00000071894	ENST00000349769	T	0.44881	0.91	5.84	5.84	0.93424	.	0.159462	0.53938	D	0.000047	T	0.34279	0.0892	L	0.31926	0.97	0.42819	D	0.99398	B	0.13594	0.008	B	0.20184	0.028	T	0.10428	-1.0630	10	0.30078	T	0.28	-6.9099	14.146	0.65351	0.0:0.0:0.0:1.0	.	566	Q10570	CPSF1_HUMAN	G	566	ENSP00000339353:D566G	ENSP00000339353:D566G	D	-	2	0	CPSF1	145594778	1.000000	0.71417	0.099000	0.21106	0.012000	0.07955	6.975000	0.76128	2.227000	0.72691	0.533000	0.62120	GAC	.	.	none		0.667	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291	
USH2A	7399	hgsc.bcm.edu	37	1	215972275	215972275	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:215972275T>C	ENST00000307340.3	-	50	10318	c.9932A>G	c.(9931-9933)gAa>gGa	p.E3311G	USH2A_ENST00000366943.2_Missense_Mutation_p.E3311G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3311					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CACCACTCCTTCTTCTCCACC	0.502										HNSCC(13;0.011)																											p.E3311G		Atlas-SNP	.											USH2A,NS,carcinoma,+1,1	USH2A	1168	1	0			c.A9932G						scavenged	.						177.0	150.0	159.0					1																	215972275		2203	4300	6503	SO:0001583	missense	7399	exon50			ACTCCTTCTTCTC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9932A>G	1.37:g.215972275T>C	ENSP00000305941:p.Glu3311Gly	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	144	2	0.0138889	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.846751	0.51164	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.15603	2.42;2.41	5.81	3.41	0.39046	Fibronectin, type III (2);	0.152498	0.30076	N	0.010479	T	0.27594	0.0678	M	0.72118	2.19	0.29017	N	0.886542	D	0.53619	0.961	P	0.49637	0.617	T	0.11867	-1.0570	10	0.54805	T	0.06	.	11.1989	0.48730	0.2325:0.0:0.0:0.7675	.	3311	O75445	USH2A_HUMAN	G	3311	ENSP00000305941:E3311G;ENSP00000355910:E3311G	ENSP00000305941:E3311G	E	-	2	0	USH2A	214038898	0.660000	0.27420	0.035000	0.18076	0.933000	0.57130	2.742000	0.47434	0.410000	0.25675	0.533000	0.62120	GAA	.	.	none		0.502	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
MTMR2	8898	hgsc.bcm.edu	37	11	95582866	95582866	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:95582866C>T	ENST00000346299.5	-	9	1305	c.965G>A	c.(964-966)cGg>cAg	p.R322Q	MTMR2_ENST00000484818.1_5'Flank|MTMR2_ENST00000409459.1_Missense_Mutation_p.R250Q|MTMR2_ENST00000352297.7_Missense_Mutation_p.R250Q|MTMR2_ENST00000393223.3_Missense_Mutation_p.R250Q	NM_016156.5	NP_057240.3	Q13614	MTMR2_HUMAN	myotubularin related protein 2	322	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|dendritic spine maintenance (GO:0097062)|inositol phosphate dephosphorylation (GO:0046855)|myelin assembly (GO:0032288)|negative regulation of endocytosis (GO:0045806)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of myelination (GO:0031642)|negative regulation of receptor catabolic process (GO:2000645)|negative regulation of receptor internalization (GO:0002091)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of early endosome to late endosome transport (GO:2000643)|protein dephosphorylation (GO:0006470)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endosome (GO:0005768)|neuronal postsynaptic density (GO:0097481)|nucleus (GO:0005634)|synaptic membrane (GO:0097060)|synaptic vesicle (GO:0008021)|vacuolar membrane (GO:0005774)	phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	19		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AACACTTGGCCGGGCATCAAA	0.413																																					p.R322Q		Atlas-SNP	.											MTMR2_ENST00000346299,colon,carcinoma,+1,2	MTMR2	79	2	0			c.G965A						scavenged	.						168.0	168.0	168.0					11																	95582866		2201	4298	6499	SO:0001583	missense	8898	exon9			CTTGGCCGGGCAT	U58033	CCDS8305.1, CCDS8306.1	11q22	2014-09-17			ENSG00000087053	ENSG00000087053		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7450	protein-coding gene	gene with protein product		603557		CMT4B		8640223, 9736772	Standard	NM_016156		Approved	KIAA1073	uc001pfu.3	Q13614	OTTHUMG00000153837	ENST00000346299.5:c.965G>A	11.37:g.95582866C>T	ENSP00000345752:p.Arg322Gln	Somatic	143	1	0.00699301		WXS	Illumina HiSeq	Phase_I	140	3	0.0214286	NM_016156	A6NN98|Q9UPS9	Missense_Mutation	SNP	ENST00000346299.5	37	CCDS8305.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.040876	0.93685	.	.	ENSG00000087053	ENST00000346299;ENST00000393223;ENST00000409459;ENST00000352297;ENST00000444541;ENST00000546018	D;D;D;D;D	0.94497	-3.44;-3.44;-3.44;-3.44;-3.44	5.17	4.26	0.50523	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.98321	0.9443	H	0.99525	4.61	0.80722	D	1	D;D	0.76494	0.995;0.999	P;P	0.61658	0.855;0.892	D	0.98810	1.0743	10	0.87932	D	0	.	13.854	0.63515	0.0:0.9256:0.0:0.0744	.	322;322	A8K5G2;Q13614	.;MTMR2_HUMAN	Q	322;250;250;250;250;305	ENSP00000345752:R322Q;ENSP00000376915:R250Q;ENSP00000386882:R250Q;ENSP00000343737:R250Q;ENSP00000396020:R250Q	ENSP00000345752:R322Q	R	-	2	0	MTMR2	95222514	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	7.755000	0.85180	1.169000	0.42739	0.591000	0.81541	CGG	.	.	none		0.413	MTMR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332620.1	NM_016156	
FAM83H	286077	hgsc.bcm.edu	37	8	144809804	144809804	+	Silent	SNP	G	G	A	rs13254035	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:144809804G>A	ENST00000388913.3	-	5	1952	c.1827C>T	c.(1825-1827)taC>taT	p.Y609Y		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	609					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CGTCGTCTTCGTAAGCCTCCG	0.731													G|||	4123	0.823283	0.41	0.9366	5008	,	,		8779	0.999		0.9851	False		,,,				2504	0.954				p.Y609Y		Atlas-SNP	.											.	FAM83H	68	.	0			c.C1827T						PASS	.	G		1894,1194		548,798,198	5.0	6.0	6.0		1827	-0.4	0.1	8	dbSNP_121	6	6953,177		3392,169,4	no	coding-synonymous	FAM83H	NM_198488.3		3940,967,202	AA,AG,GG		2.4825,38.6658,13.4175		609/1180	144809804	8847,1371	1544	3565	5109	SO:0001819	synonymous_variant	286077	exon5			GTCTTCGTAAGCC	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.1827C>T	8.37:g.144809804G>A		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	9	9	1	NM_198488	A0JLS2|Q8N4W0	Silent	SNP	ENST00000388913.3	37	CCDS6410.2																																																																																			G|0.132;A|0.868	0.868	strong		0.731	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
ALOX15	246	hgsc.bcm.edu	37	17	4544856	4544856	+	Missense_Mutation	SNP	C	C	T	rs145573801	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:4544856C>T	ENST00000570836.1	-	2	187	c.91G>A	c.(91-93)Ggg>Agg	p.G31R	ALOX15_ENST00000574640.1_Missense_Mutation_p.G31R|ALOX15_ENST00000545513.1_Missense_Mutation_p.G53R|ALOX15_ENST00000293761.3_Missense_Mutation_p.G31R			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	31	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		GCCGCCTCCCCGTGCTGGCCG	0.687																																					p.G31R		Atlas-SNP	.											.	ALOX15	70	.	0			c.G91A						PASS	.						23.0	23.0	23.0					17																	4544856		2194	4291	6485	SO:0001583	missense	246	exon1			CCTCCCCGTGCTG	M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.91G>A	17.37:g.4544856C>T	ENSP00000458832:p.Gly31Arg	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	95	5	0.0526316	NM_001140	A8K2P4|B7ZA11|Q8N6R7|Q99657	Missense_Mutation	SNP	ENST00000570836.1	37	CCDS11049.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.133041	0.77662	.	.	ENSG00000161905	ENST00000293761;ENST00000545513	T;T	0.73047	-0.71;-0.71	5.33	2.14	0.27477	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.071907	0.53938	D	0.000048	T	0.69486	0.3116	L	0.60904	1.88	0.37169	D	0.902979	D;P;D	0.60160	0.987;0.792;0.972	B;B;P	0.47206	0.406;0.176;0.541	T	0.72858	-0.4165	10	0.42905	T	0.14	-18.9916	13.5218	0.61572	0.0:0.5739:0.4261:0.0	.	53;31;31	F5H0G8;B7ZA11;P16050	.;.;LOX15_HUMAN	R	31;53	ENSP00000293761:G31R;ENSP00000439855:G53R	ENSP00000293761:G31R	G	-	1	0	ALOX15	4491605	0.682000	0.27624	0.783000	0.31826	0.940000	0.58332	0.928000	0.28831	0.218000	0.20820	0.655000	0.94253	GGG	C|1.000;G|0.000	.	alt		0.687	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207487.2		
TLCD1	116238	hgsc.bcm.edu	37	17	27052991	27052991	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:27052991G>A	ENST00000292090.3	-	1	235	c.125C>T	c.(124-126)aCc>aTc	p.T42I	TLCD1_ENST00000394933.3_Intron|AC010761.14_ENST00000587898.1_RNA|SNORD4B_ENST00000459083.1_RNA|SNORD42A_ENST00000459584.1_RNA|NEK8_ENST00000268766.6_5'Flank	NM_138463.3	NP_612472.1	Q96CP7	TLCD1_HUMAN	TLC domain containing 1	42	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(2)|lung(2)	7	Lung NSC(42;0.00431)					CCAGCGCCAGGTGCGCAGGGG	0.697																																					p.T42I		Atlas-SNP	.											.	TLCD1	15	.	0			c.C125T						PASS	.						22.0	23.0	22.0					17																	27052991		2201	4298	6499	SO:0001583	missense	116238	exon1			CGCCAGGTGCGCA	BC014072	CCDS11242.1, CCDS54102.1	17q11.2	2007-03-23			ENSG00000160606	ENSG00000160606			25177	protein-coding gene	gene with protein product						12151215	Standard	NM_138463		Approved		uc002hco.3	Q96CP7	OTTHUMG00000132683	ENST00000292090.3:c.125C>T	17.37:g.27052991G>A	ENSP00000292090:p.Thr42Ile	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	63	4	0.0634921	NM_138463	A8MYP9	Missense_Mutation	SNP	ENST00000292090.3	37	CCDS11242.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480642	0.84747	.	.	ENSG00000160606	ENST00000292090	.	.	.	4.6	4.6	0.57074	TRAM/LAG1/CLN8 homology domain (2);	0.205916	0.42821	D	0.000648	T	0.41465	0.1160	N	0.19112	0.55	0.80722	D	1	B	0.26744	0.158	B	0.20767	0.031	T	0.39035	-0.9633	9	0.49607	T	0.09	-2.0919	12.7767	0.57453	0.0:0.0:1.0:0.0	.	42	Q96CP7	TLCD1_HUMAN	I	42	.	ENSP00000292090:T42I	T	-	2	0	TLCD1	24077118	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.514000	0.45503	2.385000	0.81259	0.555000	0.69702	ACC	.	.	none		0.697	TLCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255973.1	NM_138463	
COL21A1	81578	hgsc.bcm.edu	37	6	55922465	55922465	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:55922465G>A	ENST00000244728.5	-	30	3261	c.2864C>T	c.(2863-2865)cCa>cTa	p.P955L	COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000370819.1_Missense_Mutation_p.P952L|COL21A1_ENST00000535941.1_Missense_Mutation_p.P955L|COL21A1_ENST00000370808.2_Missense_Mutation_p.P321L	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	955					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CTAATAGTTTGGTCCTTTTCT	0.468																																					p.P955L		Atlas-SNP	.											.	COL21A1	201	.	0			c.C2864T						PASS	.						84.0	79.0	81.0					6																	55922465		1908	4133	6041	SO:0001583	missense	81578	exon30			TAGTTTGGTCCTT	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.2864C>T	6.37:g.55922465G>A	ENSP00000244728:p.Pro955Leu	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	106	15	0.141509	NM_030820	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604681	0.46423	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811;ENST00000370808	D;D;D;D	0.91792	-2.52;-2.47;-2.51;-2.91	4.62	4.62	0.57501	.	0.000000	0.56097	D	0.000039	D	0.95736	0.8613	M	0.80616	2.505	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.997;0.997	D	0.96364	0.9268	10	0.87932	D	0	.	17.8313	0.88683	0.0:0.0:1.0:0.0	.	321;955;955;312	Q96P44-2;B7ZLK3;Q96P44;B3KU30	.;.;COLA1_HUMAN;.	L	955;952;955;952;321	ENSP00000244728:P955L;ENSP00000359855:P952L;ENSP00000444384:P955L;ENSP00000359844:P321L	ENSP00000244728:P955L	P	-	2	0	COL21A1	56030424	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.527000	0.90594	2.275000	0.75901	0.655000	0.94253	CCA	.	.	none		0.468	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
SLC17A9	63910	hgsc.bcm.edu	37	20	61594979	61594979	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr20:61594979A>G	ENST00000370351.4	+	7	900	c.769A>G	c.(769-771)Atc>Gtc	p.I257V	SLC17A9_ENST00000488738.1_3'UTR|SLC17A9_ENST00000370349.3_Missense_Mutation_p.I251V	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	257					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						CTCCTTCTTCATCCTCCTCTC	0.677																																					p.I257V		Atlas-SNP	.											.	SLC17A9	54	.	0			c.A769G						PASS	.						54.0	59.0	58.0					20																	61594979		2148	4249	6397	SO:0001583	missense	63910	exon7			TTCTTCATCCTCC	AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.769A>G	20.37:g.61594979A>G	ENSP00000359376:p.Ile257Val	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	131	63	0.480916	NM_022082	B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Missense_Mutation	SNP	ENST00000370351.4	37	CCDS42901.1	.	.	.	.	.	.	.	.	.	.	a	0.269	-0.994082	0.02145	.	.	ENSG00000101194	ENST00000370351;ENST00000370349	T;T	0.59224	0.28;0.28	4.86	2.62	0.31277	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.162450	0.52532	N	0.000066	T	0.40247	0.1109	N	0.20574	0.59	0.28715	N	0.903358	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.11329	0.006;0.005;0.005	T	0.22626	-1.0211	10	0.30078	T	0.28	.	11.9672	0.53042	0.9221:0.0:0.0779:0.0	.	277;257;251	B4DPU8;Q9BYT1;Q9BYT1-2	.;S17A9_HUMAN;.	V	257;251	ENSP00000359376:I257V;ENSP00000359374:I251V	ENSP00000359374:I251V	I	+	1	0	SLC17A9	61065424	1.000000	0.71417	0.996000	0.52242	0.054000	0.15201	2.976000	0.49289	0.231000	0.21079	-0.741000	0.03529	ATC	.	.	none		0.677	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080100.1	NM_022082	
RPGRIP1L	23322	hgsc.bcm.edu	37	16	53730084	53730084	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr16:53730084T>G	ENST00000379925.3	-	3	259	c.209A>C	c.(208-210)aAg>aCg	p.K70T	RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.K70T|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.K70T|RPGRIP1L_ENST00000566096.1_Missense_Mutation_p.K70T|RPGRIP1L_ENST00000568653.3_Missense_Mutation_p.K70T|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.K70T	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	70					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				ATCCTCCTGCTTGCGGGCATG	0.368																																					p.K70T		Atlas-SNP	.											.	RPGRIP1L	118	.	0			c.A209C						PASS	.						118.0	123.0	121.0					16																	53730084		2198	4300	6498	SO:0001583	missense	23322	exon3			TCCTGCTTGCGGG		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.209A>C	16.37:g.53730084T>G	ENSP00000369257:p.Lys70Thr	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	80	37	0.4625	NM_001127897	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.313073	0.81358	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.68765	-0.35;-0.35	5.73	5.73	0.89815	.	0.052346	0.64402	D	0.000001	T	0.78729	0.4329	L	0.58969	1.84	0.48236	D	0.999616	D;D;P;D	0.76494	0.991;0.991;0.5;0.999	P;P;B;D	0.70716	0.894;0.776;0.173;0.97	T	0.79308	-0.1857	10	0.51188	T	0.08	-19.9813	16.0142	0.80425	0.0:0.0:0.0:1.0	.	70;70;70;70	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	T	70	ENSP00000369257:K70T;ENSP00000262135:K70T	ENSP00000262135:K70T	K	-	2	0	RPGRIP1L	52287585	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.371000	0.73119	2.187000	0.69744	0.460000	0.39030	AAG	.	.	none		0.368	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
ZNF775	285971	hgsc.bcm.edu	37	7	150094853	150094853	+	Silent	SNP	G	G	A	rs7780011	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr7:150094853G>A	ENST00000329630.5	+	3	1391	c.1284G>A	c.(1282-1284)acG>acA	p.T428T		NM_173680.3	NP_775951.2	Q96BV0	ZN775_HUMAN	zinc finger protein 775	428			T -> A (in dbSNP:rs13225910).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(7)|skin(1)	11	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCCGGGACACGCTGTGGGGCC	0.751													G|||	2293	0.457867	0.5514	0.5677	5008	,	,		7268	0.3115		0.4563	False		,,,				2504	0.4059				p.T428T		Atlas-SNP	.											ZNF775,NS,carcinoma,0,1	ZNF775	34	1	0			c.G1284A						scavenged	.	G		1766,1896		496,774,561	4.0	5.0	5.0		1284	-3.5	0.0	7	dbSNP_116	5	3387,4247		854,1679,1284	no	coding-synonymous	ZNF775	NM_173680.3		1350,2453,1845	AA,AG,GG		44.3673,48.225,45.6179		428/538	150094853	5153,6143	1831	3817	5648	SO:0001819	synonymous_variant	285971	exon3			GGACACGCTGTGG	BC038111	CCDS43678.1	7q36.1	2013-01-08			ENSG00000196456	ENSG00000196456		"""Zinc fingers, C2H2-type"""	28501	protein-coding gene	gene with protein product						12477932	Standard	NM_173680		Approved	MGC33584	uc003whf.1	Q96BV0	OTTHUMG00000158324	ENST00000329630.5:c.1284G>A	7.37:g.150094853G>A		Somatic	1	1	1		WXS	Illumina HiSeq	Phase_I	3	3	1	NM_173680	Q8IY24	Silent	SNP	ENST00000329630.5	37	CCDS43678.1																																																																																			G|0.551;A|0.449	0.449	strong		0.751	ZNF775-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350679.1	NM_173680	
NBN	4683	hgsc.bcm.edu	37	8	90967770	90967770	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:90967770T>C	ENST00000265433.3	-	10	1292	c.1138A>G	c.(1138-1140)Agg>Ggg	p.R380G	NBN_ENST00000409330.1_Missense_Mutation_p.R298G	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	380	Interaction with MTOR, MAPKAP1 and RICTOR.				blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TCTTTTGGCCTTTCACTCAAA	0.338								Homologous recombination																													p.R380G		Atlas-SNP	.											.	NBN	86	.	0			c.A1138G						PASS	.						74.0	69.0	71.0					8																	90967770		2202	4298	6500	SO:0001583	missense	4683	exon10			TTGGCCTTTCACT	AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.1138A>G	8.37:g.90967770T>C	ENSP00000265433:p.Arg380Gly	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	78	4	0.0512821	NM_002485	B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Missense_Mutation	SNP	ENST00000265433.3	37	CCDS6249.1	.	.	.	.	.	.	.	.	.	.	T	8.917	0.960201	0.18507	.	.	ENSG00000104320	ENST00000265433;ENST00000409330;ENST00000452387	T;T	0.59083	1.95;0.29	5.45	5.45	0.79879	.	1.198520	0.05445	N	0.548399	T	0.54902	0.1887	L	0.51422	1.61	0.32695	N	0.513694	B;B	0.27450	0.179;0.179	B;B	0.24269	0.036;0.052	T	0.48080	-0.9066	10	0.24483	T	0.36	-0.1736	11.9007	0.52682	0.0:0.0:0.0:1.0	.	380;380	A6H8Y5;O60934	.;NBN_HUMAN	G	380;298;380	ENSP00000265433:R380G;ENSP00000386924:R298G	ENSP00000265433:R380G	R	-	1	2	NBN	91036946	0.946000	0.32159	0.941000	0.38009	0.575000	0.36095	1.542000	0.36137	2.063000	0.61619	0.528000	0.53228	AGG	.	.	none		0.338	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331583.3	NM_001024688	
STK11IP	114790	hgsc.bcm.edu	37	2	220474114	220474114	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:220474114C>T	ENST00000456909.1	+	17	2046	c.1956C>T	c.(1954-1956)acC>acT	p.T652T	STK11IP_ENST00000295641.10_Silent_p.T663T			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	663					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCCAGTCACCAATGTGGCTC	0.637																																					p.T663T		Atlas-SNP	.											.	STK11IP	152	.	0			c.C1989T						PASS	.						31.0	37.0	35.0					2																	220474114		2041	4196	6237	SO:0001819	synonymous_variant	114790	exon17			AGTCACCAATGTG	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.1956C>T	2.37:g.220474114C>T		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	77	4	0.0519481	NM_052902	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Silent	SNP	ENST00000456909.1	37																																																																																				.	.	none		0.637	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902	
RNF219	79596	hgsc.bcm.edu	37	13	79219011	79219011	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr13:79219011C>G	ENST00000282003.6	-	2	252	c.194G>C	c.(193-195)tGc>tCc	p.C65S		NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	65							zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		AATTTCTTTGCAAGGATTTTC	0.353																																					p.C65S		Atlas-SNP	.											.	RNF219	94	.	0			c.G194C						PASS	.						109.0	111.0	110.0					13																	79219011		2203	4300	6503	SO:0001583	missense	79596	exon2			TCTTTGCAAGGAT	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.194G>C	13.37:g.79219011C>G	ENSP00000282003:p.Cys65Ser	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	66	19	0.287879	NM_024546	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	ENST00000282003.6	37	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.477267	0.84640	.	.	ENSG00000152193	ENST00000282003	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.67107	0.2858	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.70197	-0.4938	9	0.59425	D	0.04	-5.6669	19.0489	0.93034	0.0:1.0:0.0:0.0	.	65	Q5W0B1	RN219_HUMAN	S	65	.	ENSP00000282003:C65S	C	-	2	0	RNF219	78117012	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.294000	0.78760	2.489000	0.83994	0.655000	0.94253	TGC	.	.	none		0.353	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546	
CLPSL1	340204	hgsc.bcm.edu	37	6	35754842	35754842	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:35754842A>G	ENST00000373861.5	+	2	261	c.167A>G	c.(166-168)aAt>aGt	p.N56S	CLPSL1_ENST00000542261.1_Missense_Mutation_p.N55S			A2RUU4	COLL1_HUMAN	colipase-like 1	56					digestion (GO:0007586)|lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	enzyme activator activity (GO:0008047)										GCTCCAGACAATTGCGAGTCG	0.657																																					p.N56S		Atlas-SNP	.											.	.	.	.	0			c.A167G						PASS	.						23.0	31.0	28.0					6																	35754842		2159	4255	6414	SO:0001583	missense	340204	exon2			CAGACAATTGCGA		CCDS43456.1	6p21.31	2014-01-28	2012-02-06	2012-02-06	ENSG00000204140	ENSG00000204140			21251	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 127"""	C6orf127			Standard	NM_001010886		Approved	dJ510O8.6	uc003old.4	A2RUU4	OTTHUMG00000014582	ENST00000373861.5:c.167A>G	6.37:g.35754842A>G	ENSP00000362968:p.Asn56Ser	Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	41	10	0.243902	NM_001010886	A7E2T6|B2RPE2|B5G4V2|B6ZDM9|Q5T9G1	Missense_Mutation	SNP	ENST00000373861.5	37	CCDS43456.1	.	.	.	.	.	.	.	.	.	.	A	0.108	-1.141934	0.01728	.	.	ENSG00000204140	ENST00000373861;ENST00000373860;ENST00000542261;ENST00000428710	T;T	0.31247	1.5;1.5	2.05	-4.09	0.03951	.	2.100700	0.03133	U	0.165408	T	0.03608	0.0103	N	0.14661	0.345	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.12477	-1.0546	10	0.33940	T	0.23	.	0.212	0.00157	0.3332:0.2323:0.2143:0.2202	.	56	A2RUU4	CF127_HUMAN	S	56;56;55;9	ENSP00000362968:N56S;ENSP00000438478:N55S	ENSP00000362967:N56S	N	+	2	0	C6orf127	35862820	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.569000	0.00915	-3.437000	0.00163	-3.063000	0.00068	AAT	.	.	none		0.657	CLPSL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040317.2	NM_001010886	
FSD1L	83856	hgsc.bcm.edu	37	9	108297595	108297595	+	Silent	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:108297595T>C	ENST00000481272.1	+	12	1493	c.1374T>C	c.(1372-1374)gaT>gaC	p.D458D	FSD1L_ENST00000374707.1_Silent_p.D239D|FSD1L_ENST00000484973.1_Silent_p.D425D|FSD1L_ENST00000394926.3_Silent_p.D437D|FSD1L_ENST00000374710.3_Silent_p.D426D|FSD1L_ENST00000539376.1_Silent_p.D311D	NM_001145313.1	NP_001138785.1	Q9BXM9	FSD1L_HUMAN	fibronectin type III and SPRY domain containing 1-like	458	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.									NS(1)|endometrium(1)	2						GTGATTTTGATGGGGGTAAGT	0.333																																					p.D458D		Atlas-SNP	.											.	FSD1L	31	.	0			c.T1374C						PASS	.						46.0	40.0	42.0					9																	108297595		692	1590	2282	SO:0001819	synonymous_variant	83856	exon12			TTTTGATGGGGGT	AF316830	CCDS6765.2, CCDS47999.1, CCDS6765.3, CCDS75870.1	9q31	2013-02-11	2006-03-10	2006-03-10	ENSG00000106701	ENSG00000106701		"""Fibronectin type III domain containing"""	13753	protein-coding gene	gene with protein product		609829	"""cystatin and DUF19 domain containing 1"", ""coiled-coil domain containing 10"""	CSDUFD1, CCDC10, FSD1NL, FSD1CL		11267680	Standard	XM_005252254		Approved		uc004bcq.2	Q9BXM9	OTTHUMG00000020426	ENST00000481272.1:c.1374T>C	9.37:g.108297595T>C		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	58	14	0.241379	NM_001145313	A2A338|A6NKH7|B7Z5S6|B7Z5W3|Q5T879|Q5T880	Silent	SNP	ENST00000481272.1	37	CCDS47999.1																																																																																			.	.	none		0.333	FSD1L-007	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349935.1	NM_207647	
KDELC2	143888	hgsc.bcm.edu	37	11	108357058	108357058	+	Silent	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:108357058A>G	ENST00000323468.5	-	3	575	c.510T>C	c.(508-510)ttT>ttC	p.F170F	KDELC2_ENST00000375648.1_Silent_p.F114F|KDELC2_ENST00000532730.1_5'Flank|KDELC2_ENST00000434945.2_Silent_p.F114F	NM_153705.4	NP_714916.3	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2	170						endoplasmic reticulum (GO:0005783)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		TGATGCTGGGAAAGGAAGCAA	0.448																																					p.F170F		Atlas-SNP	.											KDELC2,bladder,carcinoma,-2,1	KDELC2	37	1	0			c.T510C						scavenged	.						160.0	145.0	150.0					11																	108357058		1869	4104	5973	SO:0001819	synonymous_variant	143888	exon3			GCTGGGAAAGGAA	AF533708	CCDS41711.1	11q32	2010-11-18			ENSG00000178202	ENSG00000178202			28496	protein-coding gene	gene with protein product						12975309	Standard	NM_153705		Approved	MGC33424	uc001pkj.2	Q7Z4H8	OTTHUMG00000166535	ENST00000323468.5:c.510T>C	11.37:g.108357058A>G		Somatic	256	0	0		WXS	Illumina HiSeq	Phase_I	241	4	0.0165975	NM_153705	Q6UWW2|Q6ZUM9|Q8N7L8|Q8NE24	Silent	SNP	ENST00000323468.5	37	CCDS41711.1																																																																																			.	.	none		0.448	KDELC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390273.1	NM_153705	
TLX3	30012	hgsc.bcm.edu	37	5	170736474	170736474	+	Silent	SNP	G	G	A	rs2303742	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr5:170736474G>A	ENST00000296921.5	+	1	187	c.105G>A	c.(103-105)ccG>ccA	p.P35P		NM_021025.2	NP_066305.2	O43711	TLX3_HUMAN	T-cell leukemia homeobox 3	35					central nervous system development (GO:0007417)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|respiratory gaseous exchange (GO:0007585)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CACCCGCCCCGCGGGGCCCCG	0.766			T	BCL11B	T-ALL								G|||	14	0.00279553	0.0	0.0	5008	,	,		10162	0.0139		0.0	False		,,,				2504	0.0				p.P35P	Esophageal Squamous(33;43 807 3116 3348 30094)	Atlas-SNP	.		Dom	yes		5	5q35.1	30012	"""T-cell leukemia, homeobox 3 (HOX11L2)"""		L	TLX3_ENST00000296921,NS,carcinoma,+2,1	TLX3	23	1	0			c.G105A						scavenged	.						7.0	10.0	9.0					5																	170736474		2127	4181	6308	SO:0001819	synonymous_variant	30012	exon1			CGCCCCGCGGGGC	AJ223798	CCDS34288.1	5q35.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000164438	ENSG00000164438		"""Homeoboxes / ANTP class : NKL subclass"""	13532	protein-coding gene	gene with protein product		604640	"""homeo box 11-like 2"", ""T-cell leukemia, homeobox 3"""	HOX11L2		11435718, 11435716	Standard	NM_021025		Approved	RNX	uc003mbf.3	O43711	OTTHUMG00000163207	ENST00000296921.5:c.105G>A	5.37:g.170736474G>A		Somatic	4	2	0.5		WXS	Illumina HiSeq	Phase_I	14	12	0.857143	NM_021025	Q96AD3	Silent	SNP	ENST00000296921.5	37	CCDS34288.1																																																																																			G|0.995;A|0.005	0.005	strong		0.766	TLX3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372076.3		
LTK	4058	hgsc.bcm.edu	37	15	41801258	41801258	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:41801258C>T	ENST00000263800.6	-	8	1163	c.1067G>A	c.(1066-1068)aGc>aAc	p.S356N	LTK_ENST00000355166.5_Missense_Mutation_p.S295N|LTK_ENST00000561619.1_Missense_Mutation_p.S38N|LTK_ENST00000453182.2_Missense_Mutation_p.S295N	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	356					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		GAGCTCGCTGCTGGGGTGTAT	0.592										TSP Lung(18;0.14)																											p.S356N		Atlas-SNP	.											LTK_ENST00000263800,NS,carcinoma,0,2	LTK	117	2	0			c.G1067A						scavenged	.						93.0	90.0	91.0					15																	41801258		2203	4300	6503	SO:0001583	missense	4058	exon8			TCGCTGCTGGGGT	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1067G>A	15.37:g.41801258C>T	ENSP00000263800:p.Ser356Asn	Somatic	123	1	0.00813008		WXS	Illumina HiSeq	Phase_I	161	4	0.0248447	NM_002344	A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	ENST00000263800.6	37	CCDS10077.1	.	.	.	.	.	.	.	.	.	.	C	8.368	0.834726	0.16820	.	.	ENSG00000062524	ENST00000360087;ENST00000355166;ENST00000263800;ENST00000453182	T;T;T	0.77229	-1.08;0.93;-1.02	5.33	2.32	0.28847	.	0.190959	0.25472	U	0.030428	T	0.65365	0.2684	L	0.59436	1.845	0.09310	N	1	B;B;B;B	0.20887	0.008;0.001;0.049;0.019	B;B;B;B	0.19666	0.003;0.001;0.021;0.026	T	0.47548	-0.9109	10	0.17832	T	0.49	.	1.6514	0.02773	0.2786:0.4202:0.1358:0.1654	.	295;295;295;356	E9PFX4;B4DL89;P29376-4;P29376	.;.;.;LTK_HUMAN	N	356;295;356;295	ENSP00000347293:S295N;ENSP00000263800:S356N;ENSP00000392196:S295N	ENSP00000263800:S356N	S	-	2	0	LTK	39588550	0.000000	0.05858	0.020000	0.16555	0.983000	0.72400	0.212000	0.17497	0.194000	0.20326	0.491000	0.48974	AGC	.	.	none		0.592	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2		
KIF17	57576	hgsc.bcm.edu	37	1	21031010	21031010	+	Silent	SNP	G	G	A	rs76507805		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:21031010G>A	ENST00000247986.2	-	5	1363	c.1053C>T	c.(1051-1053)cgC>cgT	p.R351R	KIF17_ENST00000400463.3_Silent_p.R351R|KIF17_ENST00000375044.1_Silent_p.R251R			Q9P2E2	KIF17_HUMAN	kinesin family member 17	351					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CCTGGTACTCGCGAAGCAGCG	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		15725	0.001		0.0	False		,,,				2504	0.0				p.R351R		Atlas-SNP	.											KIF17,colon,carcinoma,0,1	KIF17	130	1	0			c.C1053T						PASS	.	G	,	1,4405	2.1+/-5.4	0,1,2202	134.0	105.0	115.0		1053,1053	-4.3	1.0	1	dbSNP_131	115	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	KIF17	NM_001122819.1,NM_020816.2	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	351/1029,351/1030	21031010	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	57576	exon5			GTACTCGCGAAGC	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1053C>T	1.37:g.21031010G>A		Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	168	53	0.315476	NM_001122819	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	ENST00000247986.2	37	CCDS213.1																																																																																			G|1.000;A|0.000	0.000	strong		0.602	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816	
OR2T35	403244	hgsc.bcm.edu	37	1	248801592	248801592	+	Missense_Mutation	SNP	C	C	T	rs78622116	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:248801592C>T	ENST00000317450.3	-	1	967	c.968G>A	c.(967-969)gGc>gAc	p.G323D		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	323						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G323D(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCCCTGCTAGCCCTTCCTGAT	0.542																																					p.G323D		Atlas-SNP	.											OR2T35,caecum,carcinoma,0,1	OR2T35	19	1	1	Substitution - Missense(1)	large_intestine(1)	c.G968A						scavenged	.						21.0	6.0	12.0					1																	248801592		1918	2711	4629	SO:0001583	missense	403244	exon1			TGCTAGCCCTTCC	BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.968G>A	1.37:g.248801592C>T	ENSP00000324369:p.Gly323Asp	Somatic	17	1	0.0588235		WXS	Illumina HiSeq	Phase_I	32	2	0.0625	NM_001001827	Q6IEY7	Missense_Mutation	SNP	ENST00000317450.3	37	CCDS31123.1	1586	0.7261904761904762	244	0.4959349593495935	286	0.7900552486187845	451	0.7884615384615384	605	0.7981530343007915	.	4.951	0.176629	0.09443	.	.	ENSG00000177151	ENST00000317450	T	0.01647	4.71	0.75	0.75	0.18387	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.03259	-1.1055	8	0.56958	D	0.05	.	2.9607	0.05891	0.0:0.3203:0.0:0.6797	.	323	Q8NGX2	O2T35_HUMAN	D	323	ENSP00000324369:G323D	ENSP00000324369:G323D	G	-	2	0	OR2T35	246868215	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	0.032000	0.13732	-0.215000	0.10063	-1.461000	0.01025	GGC	C|0.245;T|0.755	0.755	strong		0.542	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097130.1	NM_001001827	
RGPD3	653489	hgsc.bcm.edu	37	2	107052698	107052698	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:107052698C>T	ENST00000409886.3	-	12	1726	c.1639G>A	c.(1639-1641)Gga>Aga	p.G547R	RGPD3_ENST00000304514.7_Missense_Mutation_p.G547R	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	547					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						GCTGAGTTTCCAGGTCTAAAA	0.358																																					p.G547R		Atlas-SNP	.											RGPD3_ENST00000304514,NS,carcinoma,+1,2	RGPD3	316	2	0			c.G1639A						scavenged	.						45.0	31.0	35.0					2																	107052698		692	1591	2283	SO:0001583	missense	653489	exon12			AGTTTCCAGGTCT		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.1639G>A	2.37:g.107052698C>T	ENSP00000386588:p.Gly547Arg	Somatic	455	0	0		WXS	Illumina HiSeq	Phase_I	424	4	0.00943396	NM_001144013	B8ZZM4	Missense_Mutation	SNP	ENST00000409886.3	37	CCDS46379.1	.	.	.	.	.	.	.	.	.	.	.	13.43	2.234614	0.39498	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.57907	0.37;0.37	2.52	2.52	0.30459	.	.	.	.	.	T	0.63792	0.2541	L	0.59436	1.845	0.31583	N	0.654808	D	0.62365	0.991	D	0.63597	0.916	T	0.66340	-0.5948	9	0.51188	T	0.08	-24.5628	10.7924	0.46440	0.0:1.0:0.0:0.0	.	547	A6NKT7	RGPD3_HUMAN	R	547;305;547	ENSP00000386588:G547R;ENSP00000303659:G547R	ENSP00000303659:G547R	G	-	1	0	RGPD3	106419130	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	4.755000	0.62198	1.430000	0.47334	0.186000	0.17326	GGA	.	.	none		0.358	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
RIMBP2	23504	hgsc.bcm.edu	37	12	130892335	130892335	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:130892335G>A	ENST00000261655.4	-	16	3024	c.2861C>T	c.(2860-2862)aCg>aTg	p.T954M		NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	954	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CATTCTCCGCGTCGATACCGA	0.512																																					p.T954M		Atlas-SNP	.											RIMBP2,NS,carcinoma,+1,1	RIMBP2	220	1	0			c.C2861T						PASS	.						290.0	222.0	245.0					12																	130892335		2203	4300	6503	SO:0001583	missense	23504	exon16			CTCCGCGTCGATA	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2861C>T	12.37:g.130892335G>A	ENSP00000261655:p.Thr954Met	Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	121	42	0.347107	NM_015347	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.189429	0.78789	.	.	ENSG00000060709	ENST00000261655;ENST00000536632	T;T	0.29397	1.57;1.57	4.61	4.61	0.57282	Src homology-3 domain (2);	0.054336	0.64402	D	0.000001	T	0.44201	0.1282	L	0.31371	0.925	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.36504	-0.9745	10	0.40728	T	0.16	-14.8894	17.447	0.87580	0.0:0.0:1.0:0.0	.	954	O15034	RIMB2_HUMAN	M	954;91	ENSP00000261655:T954M;ENSP00000439030:T91M	ENSP00000261655:T954M	T	-	2	0	RIMBP2	129458288	1.000000	0.71417	0.018000	0.16275	0.034000	0.12701	9.767000	0.98960	2.102000	0.63906	0.555000	0.69702	ACG	.	.	none		0.512	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
DUSP2	1844	hgsc.bcm.edu	37	2	96809900	96809900	+	Silent	SNP	G	G	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:96809900G>C	ENST00000288943.4	-	3	808	c.723C>G	c.(721-723)ggC>ggG	p.G241G	AC012307.2_ENST00000449242.1_lincRNA	NM_004418.3	NP_004409.1	Q05923	DUS2_HUMAN	dual specificity phosphatase 2	241	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(1)|lung(2)|skin(1)	5		Ovarian(717;0.0228)				TACCAATGAAGCCTATGGCCT	0.592																																					p.G241G		Atlas-SNP	.											DUSP2,NS,lymphoid_neoplasm,-1,1	DUSP2	20	1	0			c.C723G						PASS	.						66.0	58.0	61.0					2																	96809900		2203	4300	6503	SO:0001819	synonymous_variant	1844	exon3			AATGAAGCCTATG	L11329	CCDS2016.1	2q11	2011-06-09			ENSG00000158050	ENSG00000158050		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3068	protein-coding gene	gene with protein product		603068				7806236, 7590752, 12673251	Standard	NM_004418		Approved	PAC-1	uc002svk.4	Q05923	OTTHUMG00000130456	ENST00000288943.4:c.723C>G	2.37:g.96809900G>C		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	60	25	0.416667	NM_004418	Q53T45	Silent	SNP	ENST00000288943.4	37	CCDS2016.1																																																																																			.	.	none		0.592	DUSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252847.1	NM_004418	
CDH13	1012	hgsc.bcm.edu	37	16	83813610	83813610	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr16:83813610A>G	ENST00000566620.1	+	12	2009	c.1719A>G	c.(1717-1719)atA>atG	p.I573M	CDH13_ENST00000428848.3_Missense_Mutation_p.I534M|CDH13_ENST00000268613.10_Missense_Mutation_p.I620M	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	573	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CTTTGCTGATAACCCTGGAGG	0.488																																					p.I620M		Atlas-SNP	.											.	CDH13	97	.	0			c.A1860G						PASS	.						92.0	86.0	88.0					16																	83813610		1936	4181	6117	SO:0001583	missense	1012	exon13			GCTGATAACCCTG	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.1719A>G	16.37:g.83813610A>G	ENSP00000454435:p.Ile573Met	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	80	17	0.2125	NM_001220488	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	ENST00000566620.1	37	CCDS58486.1	.	.	.	.	.	.	.	.	.	.	A	14.93	2.681211	0.47886	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143;ENST00000538855;ENST00000539548;ENST00000540531	T	0.61040	0.14	5.52	-11.0	0.00169	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.73690	0.3619	M	0.92077	3.27	0.80722	D	1	D;D;D	0.58970	0.971;0.971;0.984	P;P;P	0.62435	0.868;0.902;0.813	D	0.88936	0.3376	9	0.87932	D	0	.	14.1687	0.65495	0.1048:0.6952:0.0618:0.1382	.	534;620;573	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	M	620;573;534;275;132;263	ENSP00000268613:I620M	ENSP00000268613:I620M	I	+	3	3	CDH13	82371111	0.000000	0.05858	0.159000	0.22649	0.522000	0.34438	-2.440000	0.01016	-3.003000	0.00275	-1.236000	0.01555	ATA	.	.	none		0.488	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257	
SNRPD2	6633	hgsc.bcm.edu	37	19	46191649	46191649	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:46191649C>T	ENST00000342669.3	-	2	622	c.178G>A	c.(178-180)Gat>Aat	p.D60N	SNRPD2_ENST00000588599.1_Missense_Mutation_p.D50N|SNRPD2_ENST00000391932.3_Missense_Mutation_p.D50N|SNRPD2_ENST00000588301.1_Missense_Mutation_p.D60N|SNRPD2_ENST00000585392.1_5'UTR|SNRPD2_ENST00000590212.1_Missense_Mutation_p.D60N|SNRPD2_ENST00000587367.1_Missense_Mutation_p.D50N	NM_004597.5	NP_004588.1	P62316	SMD2_HUMAN	small nuclear ribonucleoprotein D2 polypeptide 16.5kDa	60					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(1)|lung(2)	4		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00546)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.194)		ACTCACCTATCGAAGGCCTTC	0.562																																					p.D60N		Atlas-SNP	.											.	SNRPD2	7	.	0			c.G178A						PASS	.						100.0	87.0	92.0					19																	46191649		2203	4300	6503	SO:0001583	missense	6633	exon2			ACCTATCGAAGGC		CCDS33053.1, CCDS54281.1	19q13.2-q13.3	2011-10-11	2002-08-29		ENSG00000125743	ENSG00000125743			11159	protein-coding gene	gene with protein product	"""snRNP core protein D2"""	601061	"""small nuclear ribonucleoprotein D2 polypeptide (16.5kD)"""	SNRPD1		7527560, 1701240	Standard	NM_004597		Approved	Sm-D2	uc002pcw.3	P62316		ENST00000342669.3:c.178G>A	19.37:g.46191649C>T	ENSP00000342374:p.Asp60Asn	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	209	80	0.382775	NM_004597	A8K797|J3KPM5|P43330	Missense_Mutation	SNP	ENST00000342669.3	37	CCDS33053.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631630	0.87660	.	.	ENSG00000125743	ENST00000342669;ENST00000391932	T;T	0.80480	-1.38;-1.38	5.85	5.85	0.93711	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	D	0.85737	0.5766	H	0.95574	3.69	0.80722	D	1	P	0.41710	0.76	B	0.33799	0.17	D	0.89638	0.3860	10	0.87932	D	0	.	17.6515	0.88165	0.0:1.0:0.0:0.0	.	60	P62316	SMD2_HUMAN	N	60;50	ENSP00000342374:D60N;ENSP00000375798:D50N	ENSP00000342374:D60N	D	-	1	0	SNRPD2	50883489	1.000000	0.71417	0.998000	0.56505	0.956000	0.61745	5.436000	0.66538	2.767000	0.95098	0.655000	0.94253	GAT	.	.	none		0.562	SNRPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459648.1	NM_004597	
RFPL1	5988	hgsc.bcm.edu	37	22	29837976	29837976	+	Silent	SNP	C	C	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:29837976C>A	ENST00000354373.2	+	2	1028	c.819C>A	c.(817-819)gtC>gtA	p.V273V	RFPL1S_ENST00000461286.3_RNA|RFPL1S_ENST00000539579.1_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1	273	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)	p.V273V(2)		endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						TCAGGAGTGTCTCTGCTGAGG	0.468																																					p.V273V		Atlas-SNP	.											RFPL1,NS,carcinoma,0,2	RFPL1	43	2	2	Substitution - coding silent(2)	lung(1)|endometrium(1)	c.C819A						scavenged	.						116.0	96.0	103.0					22																	29837976		2203	4300	6503	SO:0001819	synonymous_variant	5988	exon2			GAGTGTCTCTGCT	AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516	ENST00000354373.2:c.819C>A	22.37:g.29837976C>A		Somatic	199	4	0.0201005		WXS	Illumina HiSeq	Phase_I	239	9	0.0376569	NM_021026	Q6IC06|Q9UJ97	Silent	SNP	ENST00000354373.2	37	CCDS13857.2																																																																																			.	.	none		0.468	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318719.1	NM_021026	
HTRA2	27429	hgsc.bcm.edu	37	2	74756500	74756500	+	5'Flank	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:74756500G>A	ENST00000258080.3	+	0	0				AUP1_ENST00000377526.3_Silent_p.S59S|HTRA2_ENST00000352222.3_5'Flank	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2						adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						TGCGAAGGACGCTGTCTGGCA	0.652																																					p.S59S		Atlas-SNP	.											.	AUP1	29	.	0			c.C177T						PASS	.						21.0	28.0	26.0					2																	74756500		2101	4228	6329	SO:0001631	upstream_gene_variant	550	exon2			AAGGACGCTGTCT		CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957		2.37:g.74756500G>A	Exception_encountered	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	77	57	0.74026	NM_181575	Q9HBZ4|Q9P0Y3|Q9P0Y4	Silent	SNP	ENST00000258080.3	37	CCDS1951.1																																																																																			.	.	none		0.652	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252219.2	NM_013247	
RPS6KB2	6199	hgsc.bcm.edu	37	11	67202509	67202509	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:67202509C>T	ENST00000312629.5	+	15	1363	c.1318C>T	c.(1318-1320)Ccg>Tcg	p.P440S	AP003419.16_ENST00000535922.1_RNA	NM_003952.2	NP_003943.2	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 2	440	Pro-rich.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|signal transduction (GO:0007165)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|salivary_gland(1)|stomach(2)	25			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			CCCCAGCCTGCCGGAGCCCAC	0.672																																					p.P440S		Atlas-SNP	.											RPS6KB2_ENST00000312629,colon,carcinoma,-2,4	RPS6KB2	92	4	0			c.C1318T						scavenged	.						30.0	39.0	36.0					11																	67202509		1936	4122	6058	SO:0001583	missense	6199	exon15			AGCCTGCCGGAGC	AB019245	CCDS41677.1	11q13.1	2011-04-05	2002-08-29		ENSG00000175634	ENSG00000175634			10437	protein-coding gene	gene with protein product		608939	"""ribosomal protein S6 kinase, 70kD, polypeptide 2"""			9878560, 9804755	Standard	XM_005274164		Approved	p70S6Kb, P70-BETA, STK14B, KLS	uc001old.3	Q9UBS0	OTTHUMG00000167673	ENST00000312629.5:c.1318C>T	11.37:g.67202509C>T	ENSP00000308413:p.Pro440Ser	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	129	2	0.0155039	NM_003952	B2RMZ9|B4DML8|O94809|Q9UEC1	Missense_Mutation	SNP	ENST00000312629.5	37	CCDS41677.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.381218	0.24944	.	.	ENSG00000175634	ENST00000312629	T	0.67698	-0.28	4.41	0.0873	0.14450	.	0.856818	0.10178	N	0.706221	T	0.38081	0.1027	N	0.08118	0	0.09310	N	0.999998	B	0.12013	0.005	B	0.12156	0.007	T	0.17715	-1.0360	10	0.30854	T	0.27	.	1.2339	0.01949	0.1682:0.4416:0.1852:0.205	.	440	Q9UBS0	KS6B2_HUMAN	S	440	ENSP00000308413:P440S	ENSP00000308413:P440S	P	+	1	0	RPS6KB2	66959085	0.000000	0.05858	0.035000	0.18076	0.485000	0.33311	-0.438000	0.06905	0.142000	0.18901	-0.369000	0.07265	CCG	.	.	none		0.672	RPS6KB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395508.1	NM_003952	
XPOT	11260	hgsc.bcm.edu	37	12	64812733	64812733	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:64812733G>A	ENST00000332707.5	+	6	877	c.348G>A	c.(346-348)gaG>gaA	p.E116E		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	116	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.E116E(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		TTGTTACAGAGTATCTCACTA	0.438																																					p.E116E		Atlas-SNP	.											XPOT,bladder,carcinoma,0,5	XPOT	105	5	1	Substitution - coding silent(1)	kidney(1)	c.G348A						scavenged	.						113.0	107.0	109.0					12																	64812733		2203	4300	6503	SO:0001819	synonymous_variant	11260	exon6			TACAGAGTATCTC	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.348G>A	12.37:g.64812733G>A		Somatic	173	1	0.00578035		WXS	Illumina HiSeq	Phase_I	188	5	0.0265957	NM_007235	A6NLH1|O43784|Q8WUG2|Q9BVS7	Silent	SNP	ENST00000332707.5	37	CCDS31852.1																																																																																			.	.	none		0.438	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
PTPRQ	374462	hgsc.bcm.edu	37	12	80982059	80982059	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:80982059C>T	ENST00000266688.5	+	31	4425	c.4425C>T	c.(4423-4425)tcC>tcT	p.S1475S	RP11-272K23.3_ENST00000550634.1_RNA			Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1521	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						AATGGGAATCCGAAGAATGTG	0.338																																					p.S1307S		Atlas-SNP	.											PTPRQ,colon,carcinoma,0,1	PTPRQ	119	1	0			c.C3921T						scavenged	.						111.0	93.0	98.0					12																	80982059		692	1591	2283	SO:0001819	synonymous_variant	374462	exon23			GGAATCCGAAGAA	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4425C>T	12.37:g.80982059C>T		Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	121	3	0.0247934	NM_001145026		Silent	SNP	ENST00000266688.5	37		.	.	.	.	.	.	.	.	.	.	c	0.243	-1.012533	0.02095	.	.	ENSG00000139304	ENST00000532722	.	.	.	5.35	-4.22	0.03800	.	.	.	.	.	T	0.39358	0.1075	.	.	.	0.54753	D	0.99998	.	.	.	.	.	.	T	0.34378	-0.9831	4	.	.	.	.	3.033	0.06112	0.1723:0.1707:0.0883:0.5687	.	.	.	.	L	1176	.	.	P	+	2	0	PTPRQ	79506190	0.000000	0.05858	0.949000	0.38748	0.119000	0.20118	-1.197000	0.03038	-0.844000	0.04184	-3.330000	0.00044	CCG	.	.	none		0.338	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
DMKN	93099	hgsc.bcm.edu	37	19	36002412	36002412	+	Silent	SNP	G	G	A	rs56743379|rs111543270		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:36002412G>A	ENST00000339686.3	-	5	995	c.819C>T	c.(817-819)agC>agT	p.S273S	DMKN_ENST00000451297.2_Silent_p.S273S|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000440396.1_Silent_p.S273S|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000418261.1_Silent_p.S273S|DMKN_ENST00000424570.2_Silent_p.S273S|DMKN_ENST00000447113.2_Silent_p.S273S|DMKN_ENST00000472252.2_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	273	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			tgctgccactgctgctgccac	0.657																																					p.S273S		Atlas-SNP	.											.	DMKN	116	.	1	Deletion - In frame(1)	ovary(1)	c.C819T						PASS	.						29.0	22.0	24.0					19																	36002412		2184	4248	6432	SO:0001819	synonymous_variant	93099	exon5			GCCACTGCTGCTG	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.819C>T	19.37:g.36002412G>A		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	36	4	0.111111	NM_001126058	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Silent	SNP	ENST00000339686.3	37	CCDS12463.1																																																																																			.	.	none		0.657	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
MMP19	4327	hgsc.bcm.edu	37	12	56230903	56230903	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:56230903A>G	ENST00000322569.4	-	9	1535	c.1444T>C	c.(1444-1446)Tca>Cca	p.S482P	MMP19_ENST00000394182.1_Missense_Mutation_p.S196P|TMEM198B_ENST00000478241.1_RNA|MMP19_ENST00000548629.1_Missense_Mutation_p.S459P|MMP19_ENST00000409200.3_3'UTR	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	482					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	TTCCCACCTGATGGGGTAGTG	0.522																																					p.S482P		Atlas-SNP	.											MMP19,NS,carcinoma,0,1	MMP19	61	1	0			c.T1444C						scavenged	.						248.0	245.0	246.0					12																	56230903		2203	4300	6503	SO:0001583	missense	4327	exon9			CACCTGATGGGGT	X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.1444T>C	12.37:g.56230903A>G	ENSP00000313437:p.Ser482Pro	Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	169	3	0.0177515	NM_002429	B4E030|O15278|O95606|Q99580	Missense_Mutation	SNP	ENST00000322569.4	37	CCDS8895.1	.	.	.	.	.	.	.	.	.	.	A	12.65	2.000533	0.35320	.	.	ENSG00000123342	ENST00000394182;ENST00000322569;ENST00000548629	T;T;T	0.18338	4.48;2.39;2.22	5.71	-1.72	0.08107	.	1.775360	0.02935	N	0.139662	T	0.10078	0.0247	N	0.24115	0.695	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.14578	0.001;0.011	T	0.22871	-1.0204	10	0.25751	T	0.34	.	1.2218	0.01925	0.4167:0.284:0.1617:0.1376	.	482;196	Q99542;Q99542-3	MMP19_HUMAN;.	P	196;482;459	ENSP00000377736:S196P;ENSP00000313437:S482P;ENSP00000446979:S459P	ENSP00000313437:S482P	S	-	1	0	MMP19	54517170	0.001000	0.12720	0.000000	0.03702	0.015000	0.08874	0.380000	0.20602	-0.178000	0.10672	0.459000	0.35465	TCA	.	.	none		0.522	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408023.1	NM_002429	
ADAM17	6868	hgsc.bcm.edu	37	2	9666322	9666322	+	Missense_Mutation	SNP	G	G	A	rs548923032		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:9666322G>A	ENST00000310823.3	-	6	853	c.671C>T	c.(670-672)aCg>aTg	p.T224M	ADAM17_ENST00000497134.1_Missense_Mutation_p.T224M	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	224	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		TAATTTACACGTGTTCTTCAT	0.373																																					p.T224M		Atlas-SNP	.											ADAM17,NS,carcinoma,+1,1	ADAM17	61	1	0			c.C671T						scavenged	.						212.0	189.0	197.0					2																	9666322		2203	4300	6503	SO:0001583	missense	6868	exon6			TTACACGTGTTCT	U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.671C>T	2.37:g.9666322G>A	ENSP00000309968:p.Thr224Met	Somatic	146	2	0.0136986		WXS	Illumina HiSeq	Phase_I	149	4	0.0268456	NM_003183	O60226	Missense_Mutation	SNP	ENST00000310823.3	37	CCDS1665.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.963245	0.92791	.	.	ENSG00000151694	ENST00000310823;ENST00000497134;ENST00000538558	D;D	0.87491	-2.26;-2.26	5.46	5.46	0.80206	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (1);	0.000000	0.85682	D	0.000000	D	0.94321	0.8175	M	0.86097	2.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.94295	0.7532	10	0.59425	D	0.04	.	19.6783	0.95946	0.0:0.0:1.0:0.0	.	224;224	B2RNB2;P78536	.;ADA17_HUMAN	M	224	ENSP00000309968:T224M;ENSP00000418728:T224M	ENSP00000309968:T224M	T	-	2	0	ADAM17	9583773	1.000000	0.71417	0.985000	0.45067	0.976000	0.68499	9.306000	0.96204	2.724000	0.93272	0.585000	0.79938	ACG	.	.	none		0.373	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206857.1		
PSG3	5671	hgsc.bcm.edu	37	19	43243059	43243059	+	Missense_Mutation	SNP	C	C	T	rs202155567		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:43243059C>T	ENST00000327495.5	-	2	431	c.247G>A	c.(247-249)Gta>Ata	p.V83I	PSG3_ENST00000595140.1_Missense_Mutation_p.V83I|PSG3_ENST00000490592.1_5'UTR	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	83	Ig-like V-type.				defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.V83I(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				CCATCTACTACGTATGATGTA	0.443																																					p.V83I		Atlas-SNP	.											PSG3,NS,carcinoma,0,1	PSG3	82	1	1	Substitution - Missense(1)	endometrium(1)	c.G247A						scavenged	.						314.0	300.0	305.0					19																	43243059		2203	4300	6503	SO:0001583	missense	5671	exon2			CTACTACGTATGA		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.247G>A	19.37:g.43243059C>T	ENSP00000332215:p.Val83Ile	Somatic	168	1	0.00595238		WXS	Illumina HiSeq	Phase_I	144	3	0.0208333	NM_021016	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	ENST00000327495.5	37	CCDS12611.1	.	.	.	.	.	.	.	.	.	.	N	3.558	-0.090161	0.07053	.	.	ENSG00000221826	ENST00000327495	T	0.67345	-0.26	1.39	-2.79	0.05841	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51295	0.1666	L	0.43152	1.355	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.13407	0.003;0.009	T	0.32025	-0.9922	9	0.33940	T	0.23	.	5.5385	0.17026	0.0:0.4218:0.0:0.5782	.	61;83	Q08266;Q16557	.;PSG3_HUMAN	I	83	ENSP00000332215:V83I	ENSP00000332215:V83I	V	-	1	0	PSG3	47934899	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.686000	0.05161	-0.961000	0.03609	-0.515000	0.04445	GTA	C|0.999;T|0.001	0.001	weak		0.443	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016	
KATNAL2	83473	hgsc.bcm.edu	37	18	44580782	44580782	+	Missense_Mutation	SNP	C	C	T	rs181204080		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr18:44580782C>T	ENST00000245121.5	+	3	283	c.89C>T	c.(88-90)cCg>cTg	p.P30L	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Missense_Mutation_p.P102L	NM_031303.2	NP_112593.2			katanin p60 subunit A-like 2									p.P30L(1)		central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						AATAATTTACCGCAAAGAAGT	0.388													C|||	1	0.000199681	0.0	0.0	5008	,	,		21417	0.001		0.0	False		,,,				2504	0.0				p.P30L		Atlas-SNP	.											KATNAL2,NS,carcinoma,0,1	KATNAL2	64	1	1	Substitution - Missense(1)	lung(1)	c.C89T						scavenged	.	C	LEU/PRO	0,4406		0,0,2203	166.0	179.0	174.0		89	3.8	0.8	18		174	1,8599	1.2+/-3.3	0,1,4299	no	missense	KATNAL2	NM_031303.2	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	30/467	44580782	1,13005	2203	4300	6503	SO:0001583	missense	83473	exon3			ATTTACCGCAAAG	BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000245121.5:c.89C>T	18.37:g.44580782C>T	ENSP00000245121:p.Pro30Leu	Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	192	3	0.015625	NM_031303		Missense_Mutation	SNP	ENST00000245121.5	37	CCDS32828.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	11.38	1.621004	0.28889	0.0	1.16E-4	ENSG00000167216	ENST00000356157;ENST00000245121	D;D	0.93953	-3.32;-3.23	5.57	3.8	0.43715	.	0.824098	0.11169	N	0.592243	D	0.91226	0.7235	L	0.51422	1.61	0.22562	N	0.998988	.	.	.	.	.	.	T	0.83253	-0.0052	8	0.46703	T	0.11	-13.8033	5.1475	0.14993	0.1651:0.6634:0.0:0.1715	.	.	.	.	L	102;30	ENSP00000348478:P102L;ENSP00000245121:P30L	ENSP00000245121:P30L	P	+	2	0	KATNAL2	42834780	0.529000	0.26322	0.824000	0.32777	0.980000	0.70556	1.812000	0.38952	0.729000	0.32403	0.462000	0.41574	CCG	C|1.000;T|0.000	0.000	strong		0.388	KATNAL2-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446138.2	NM_031303	
BRDT	676	hgsc.bcm.edu	37	1	92445221	92445221	+	Silent	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:92445221T>C	ENST00000362005.3	+	9	1612	c.1194T>C	c.(1192-1194)ggT>ggC	p.G398G	BRDT_ENST00000370389.2_Silent_p.G325G|BRDT_ENST00000399546.2_Silent_p.G398G|BRDT_ENST00000402388.1_Silent_p.G398G|BRDT_ENST00000394530.3_Silent_p.G352G	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	398					cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		AAACCACTGGTAGAGAGAACA	0.418																																					p.G402G		Atlas-SNP	.											BRDT,NS,carcinoma,+1,1	BRDT	133	1	0			c.T1206C						scavenged	.						108.0	107.0	107.0					1																	92445221		2203	4300	6503	SO:0001819	synonymous_variant	676	exon8			CACTGGTAGAGAG	AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.1194T>C	1.37:g.92445221T>C		Somatic	212	0	0		WXS	Illumina HiSeq	Phase_I	205	3	0.0146341	NM_001242806	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Silent	SNP	ENST00000362005.3	37	CCDS735.1																																																																																			.	.	none		0.418	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189	
NGFR	4804	hgsc.bcm.edu	37	17	47572823	47572823	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:47572823T>C	ENST00000172229.3	+	1	169	c.44T>C	c.(43-45)cTg>cCg	p.L15P	NGFR_ENST00000504201.1_5'Flank	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	15					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GGGCCGCGCCTGCTGCTGTTG	0.711																																					p.L15P		Atlas-SNP	.											.	NGFR	46	.	0			c.T44C						PASS	.						4.0	7.0	6.0					17																	47572823		1842	3757	5599	SO:0001583	missense	4804	exon1			CGCGCCTGCTGCT	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.44T>C	17.37:g.47572823T>C	ENSP00000172229:p.Leu15Pro	Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	13	5	0.384615	NM_002507	B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	37	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.463454	0.43736	.	.	ENSG00000064300	ENST00000172229	D	0.91631	-2.88	4.54	4.54	0.55810	.	1.870110	0.02589	N	0.099734	D	0.90652	0.7068	N	0.24115	0.695	0.80722	D	1	P	0.48834	0.916	P	0.49140	0.601	T	0.80696	-0.1267	10	0.45353	T	0.12	-3.3729	10.5353	0.45000	0.0:0.0:0.0:1.0	.	15	P08138	TNR16_HUMAN	P	15	ENSP00000172229:L15P	ENSP00000172229:L15P	L	+	2	0	NGFR	44927822	1.000000	0.71417	1.000000	0.80357	0.465000	0.32709	3.325000	0.52030	1.804000	0.52760	0.443000	0.29094	CTG	.	.	none		0.711	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
MUC4	4585	hgsc.bcm.edu	37	3	195518112	195518112	+	Silent	SNP	T	T	A	rs372078184|rs71180965|rs75263205|rs142781032	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:195518112T>A	ENST00000463781.3	-	2	798	c.339A>T	c.(337-339)acA>acT	p.T113T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T113T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	113					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGGAGGAGCTGTCTCCATCA	0.468																																					p.T113T		Atlas-SNP	.											.	MUC4	1505	.	0			c.A339T						PASS	.						168.0	144.0	152.0					3																	195518112		1988	4141	6129	SO:0001819	synonymous_variant	4585	exon2			AGGAGCTGTCTCC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.339A>T	3.37:g.195518112T>A		Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	161	18	0.111801	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	strong		0.468	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
GOSR2	9570	hgsc.bcm.edu	37	17	45008492	45008492	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:45008492T>C	ENST00000393456.2	+	3	179	c.122T>C	c.(121-123)aTa>aCa	p.I41T	GOSR2_ENST00000439730.2_Missense_Mutation_p.I41T|GOSR2_ENST00000575949.1_Missense_Mutation_p.I41T|GOSR2_ENST00000576910.2_Missense_Mutation_p.I41T|GOSR2_ENST00000415811.2_Missense_Mutation_p.I41T|GOSR2_ENST00000225567.4_Missense_Mutation_p.I41T|RP11-156P1.2_ENST00000571841.1_Missense_Mutation_p.I41T	NM_004287.3	NP_004278.2	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2	41					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|skin(1)	7			BRCA - Breast invasive adenocarcinoma(9;0.102)			CAAGCAAGCATAGACCAGATA	0.388																																					p.I41T		Atlas-SNP	.											GOSR2_ENST00000415811,NS,carcinoma,+1,2	GOSR2	38	2	0			c.T122C						scavenged	.						78.0	82.0	81.0					17																	45008492		2203	4300	6503	SO:0001583	missense	9570	exon3			CAAGCATAGACCA	AF007548	CCDS11507.1, CCDS42355.1, CCDS45719.1	17q21	2006-02-10				ENSG00000108433			4431	protein-coding gene	gene with protein product		604027				9349823, 10198168	Standard	XM_005257843		Approved	GS27, Bos1	uc002ikz.3	O14653		ENST00000393456.2:c.122T>C	17.37:g.45008492T>C	ENSP00000377101:p.Ile41Thr	Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	134	3	0.0223881	NM_001012511	D3DXJ5|D3DXJ6|Q8N4B8|Q96DA5|Q9BZZ4	Missense_Mutation	SNP	ENST00000393456.2	37	CCDS42355.1	.	.	.	.	.	.	.	.	.	.	T	15.56	2.869433	0.51588	.	.	ENSG00000108433	ENST00000225567;ENST00000393456;ENST00000415811;ENST00000439730	T;T;T;T	0.47528	0.84;0.84;0.84;1.81	5.66	5.66	0.87406	.	0.041017	0.85682	D	0.000000	T	0.41396	0.1157	L	0.41710	1.295	0.58432	D	0.999999	B;B;B;B	0.32101	0.356;0.162;0.25;0.292	B;B;B;B	0.28709	0.073;0.035;0.093;0.079	T	0.38329	-0.9666	10	0.62326	D	0.03	-16.167	16.2026	0.82095	0.0:0.0:0.0:1.0	.	41;41;41;41	E7EQ34;O14653;O14653-2;Q8N4B8	.;GOSR2_HUMAN;.;.	T	41	ENSP00000225567:I41T;ENSP00000377101:I41T;ENSP00000394559:I41T;ENSP00000390577:I41T	ENSP00000225567:I41T	I	+	2	0	GOSR2	42363491	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.412000	0.52679	2.285000	0.76669	0.533000	0.62120	ATA	.	.	none		0.388	GOSR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440438.1		
ZNF837	116412	hgsc.bcm.edu	37	19	58879965	58879965	+	Silent	SNP	A	A	G	rs7255489	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:58879965A>G	ENST00000427624.2	-	3	1057	c.735T>C	c.(733-735)agT>agC	p.S245S	ZNF837_ENST00000597582.1_Silent_p.S245S|CTD-2619J13.3_ENST00000599889.1_RNA			Q96EG3	ZN837_HUMAN	zinc finger protein 837	245					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						ACACTGGGGGACTCTTGCCCG	0.706													G|||	4415	0.881589	0.8442	0.8732	5008	,	,		12279	0.9137		0.9294	False		,,,				2504	0.8558				p.S245S		Atlas-SNP	.											.	ZNF837	16	.	0			c.T735C						PASS	.						4.0	6.0	6.0					19																	58879965		661	1542	2203	SO:0001819	synonymous_variant	116412	exon3			TGGGGGACTCTTG	BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.735T>C	19.37:g.58879965A>G		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	12	12	1	NM_138466		Silent	SNP	ENST00000427624.2	37	CCDS46216.1																																																																																			A|0.094;G|0.906	0.906	strong		0.706	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466962.1	NM_138466	
BPI	671	hgsc.bcm.edu	37	20	36936026	36936026	+	Missense_Mutation	SNP	A	A	G	rs572225651		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr20:36936026A>G	ENST00000262865.4	+	2	289	c.200A>G	c.(199-201)gAc>gGc	p.D67G	CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	67					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)	p.D67G(1)		kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				AAGATTCCTGACTACTCAGAC	0.537													A|||	1	0.000199681	0.0	0.0	5008	,	,		21828	0.0		0.0	False		,,,				2504	0.001				p.D67G		Atlas-SNP	.											BPI,NS,carcinoma,0,1	BPI	67	1	1	Substitution - Missense(1)	lung(1)	c.A200G						scavenged	.						120.0	114.0	116.0					20																	36936026		2203	4300	6503	SO:0001583	missense	671	exon2			TTCCTGACTACTC	J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.200A>G	20.37:g.36936026A>G	ENSP00000262865:p.Asp67Gly	Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	192	4	0.0208333	NM_001725	B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Missense_Mutation	SNP	ENST00000262865.4	37	CCDS13303.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.451243	0.43531	.	.	ENSG00000101425	ENST00000262865	T	0.08896	3.04	4.21	0.623	0.17654	Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	1.336230	0.04656	N	0.408012	T	0.27731	0.0682	M	0.87381	2.88	0.09310	N	1	P	0.46327	0.876	P	0.52514	0.701	T	0.32798	-0.9893	10	0.72032	D	0.01	-8.6667	10.9311	0.47217	0.8134:0.1866:0.0:0.0	.	67	P17213	BPI_HUMAN	G	67	ENSP00000262865:D67G	ENSP00000262865:D67G	D	+	2	0	BPI	36369440	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.771000	0.26633	0.074000	0.16767	0.533000	0.62120	GAC	.	.	none		0.537	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2	NM_001725	
HLA-C	3107	hgsc.bcm.edu	37	6	31239613	31239613	+	Missense_Mutation	SNP	C	C	T	rs2308538	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:31239613C>T	ENST00000376228.5	-	2	120	c.106G>A	c.(106-108)Gtg>Atg	p.V36M	HLA-C_ENST00000383329.3_Missense_Mutation_p.V36M	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	36	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)	p.V36M(2)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GGCCGGGACACGGCGGTGTCG	0.721																																					p.V36M		Atlas-SNP	.											HLA-C_ENST00000383329,NS,carcinoma,0,2	HLA-C	92	2	2	Substitution - Missense(2)	prostate(2)	c.G106A						scavenged	.						19.0	19.0	19.0					6																	31239613		1490	2687	4177	SO:0001583	missense	3107	exon2			GGGACACGGCGGT	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.106G>A	6.37:g.31239613C>T	ENSP00000365402:p.Val36Met	Somatic	33	3	0.0909091		WXS	Illumina HiSeq	Phase_I	51	5	0.0980392	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	13.07|13.07	2.127655|2.127655	0.37533|0.37533	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.01092	.|5.35;5.35	2.16|2.16	2.16|2.16	0.27623|0.27623	.|MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|0.224693	.|0.20953	.|U	.|0.082710	T|T	0.01661|0.01661	0.0053|0.0053	M|M	0.63843|0.63843	1.955|1.955	0.23747|0.23747	N|N	0.996957|0.996957	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.999;0.999;1.0	T|T	0.53236|0.53236	-0.8467|-0.8467	5|10	.|0.30854	.|T	.|0.27	.|.	7.8706|7.8706	0.29563|0.29563	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|36;36;36;36	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	H|M	35|36;36;36;73	.|ENSP00000365402:V36M;ENSP00000372819:V36M	.|ENSP00000365402:V36M	R|V	-|-	2|1	0|0	HLA-C|HLA-C	31347592|31347592	0.000000|0.000000	0.05858|0.05858	0.780000|0.780000	0.31762|0.31762	0.007000|0.007000	0.05969|0.05969	0.465000|0.465000	0.22004|0.22004	1.524000|1.524000	0.49035|0.49035	0.305000|0.305000	0.20034|0.20034	CGT|GTG	T|0.155;C|0.845	0.155	strong		0.721	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
MBD5	55777	hgsc.bcm.edu	37	2	149227670	149227670	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:149227670A>G	ENST00000407073.1	+	9	3155	c.2158A>G	c.(2158-2160)Acc>Gcc	p.T720A	MBD5_ENST00000404807.1_Missense_Mutation_p.T720A	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	720					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TAGCAATAGTACCCCGGGTTG	0.458																																					p.T720A		Atlas-SNP	.											MBD5,colon,carcinoma,0,1	MBD5	164	1	0			c.A2158G						scavenged	.						85.0	85.0	85.0					2																	149227670		2203	4300	6503	SO:0001583	missense	55777	exon9			AATAGTACCCCGG	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.2158A>G	2.37:g.149227670A>G	ENSP00000386049:p.Thr720Ala	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	167	5	0.0299401	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	37	CCDS33302.1	.	.	.	.	.	.	.	.	.	.	A	4.023	0.001750	0.07819	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	T;T	0.43294	0.95;0.96	4.96	1.08	0.20341	.	0.204795	0.33980	N	0.004368	T	0.20536	0.0494	N	0.14661	0.345	0.29100	N	0.881525	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.07616	-1.0763	10	0.39692	T	0.17	-0.0162	4.7995	0.13289	0.6503:0.0:0.1498:0.1999	.	720;720	Q9P267-2;Q9P267	.;MBD5_HUMAN	A	720	ENSP00000386049:T720A;ENSP00000384672:T720A	ENSP00000384672:T720A	T	+	1	0	MBD5	148944140	0.992000	0.36948	1.000000	0.80357	0.999000	0.98932	0.293000	0.19029	0.468000	0.27243	0.533000	0.62120	ACC	.	.	none		0.458	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
PRODH2	58510	hgsc.bcm.edu	37	19	36297486	36297486	+	Missense_Mutation	SNP	G	G	A	rs201263714		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:36297486G>A	ENST00000301175.3	-	8	1092	c.1075C>T	c.(1075-1077)Cgg>Tgg	p.R359W		NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	359					proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCCCCAGCCGCTCGAATGTG	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		17163	0.001		0.0	False		,,,				2504	0.0				p.R359W		Atlas-SNP	.											PRODH2,NS,carcinoma,+2,1	PRODH2	68	1	0			c.C1075T						scavenged	.						74.0	72.0	73.0					19																	36297486		2203	4300	6503	SO:0001583	missense	58510	exon8			CCAGCCGCTCGAA	U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.1075C>T	19.37:g.36297486G>A	ENSP00000301175:p.Arg359Trp	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	54	2	0.037037	NM_021232		Missense_Mutation	SNP	ENST00000301175.3	37	CCDS12478.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	8.749	0.920903	0.17982	.	.	ENSG00000250799	ENST00000301175	T	0.34667	1.35	4.82	2.67	0.31697	Proline dehydrogenase (1);	.	.	.	.	T	0.41558	0.1164	M	0.86953	2.85	0.21740	N	0.999563	B	0.22346	0.068	B	0.17722	0.019	T	0.39396	-0.9616	9	0.46703	T	0.11	.	7.3532	0.26704	0.0894:0.0:0.7427:0.1679	.	359	Q9UF12	PROD2_HUMAN	W	359	ENSP00000301175:R359W	ENSP00000301175:R359W	R	-	1	2	PRODH2	40989326	0.305000	0.24481	0.589000	0.28718	0.095000	0.18619	1.018000	0.30002	0.620000	0.30215	0.591000	0.81541	CGG	G|1.000;A|0.000	0.000	strong		0.622	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452552.2	NM_021232	
ZFHX3	463	hgsc.bcm.edu	37	16	72830766	72830766	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr16:72830766C>T	ENST00000268489.5	-	9	6487	c.5815G>A	c.(5815-5817)Gat>Aat	p.D1939N	ZFHX3_ENST00000397992.5_Missense_Mutation_p.D1025N	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1939					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCTCTGGCATCTGAAGCAATG	0.517																																					p.D1939N		Atlas-SNP	.											ZFHX3,NS,carcinoma,0,1	ZFHX3	404	1	0			c.G5815A						PASS	.						97.0	96.0	97.0					16																	72830766		2198	4300	6498	SO:0001583	missense	463	exon9			TGGCATCTGAAGC	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.5815G>A	16.37:g.72830766C>T	ENSP00000268489:p.Asp1939Asn	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	130	49	0.376923	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.416295	0.62511	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.74632	-0.86;-0.85	5.73	5.73	0.89815	.	0.000000	0.49916	D	0.000137	T	0.78323	0.4265	L	0.39898	1.24	0.80722	D	1	D	0.60575	0.988	P	0.57204	0.815	T	0.72701	-0.4214	10	0.21014	T	0.42	.	19.9064	0.97008	0.0:1.0:0.0:0.0	.	1939	Q15911	ZFHX3_HUMAN	N	1939;1025	ENSP00000268489:D1939N;ENSP00000438926:D1025N	ENSP00000268489:D1939N	D	-	1	0	ZFHX3	71388267	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.810000	0.86072	2.693000	0.91896	0.655000	0.94253	GAT	.	.	none		0.517	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
AQR	9716	hgsc.bcm.edu	37	15	35174831	35174831	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:35174831C>T	ENST00000156471.5	-	27	3262	c.3037G>A	c.(3037-3039)Gcc>Acc	p.A1013T		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	1013					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AATTCAGAGGCTCTGAATTCC	0.383																																					p.A1013T		Atlas-SNP	.											AQR,NS,lymphoid_neoplasm,+1,1	AQR	139	1	0			c.G3037A						scavenged	.						91.0	86.0	88.0					15																	35174831		1831	4087	5918	SO:0001583	missense	9716	exon27			CAGAGGCTCTGAA	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.3037G>A	15.37:g.35174831C>T	ENSP00000156471:p.Ala1013Thr	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	104	3	0.0288462	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	C	34	5.382090	0.95967	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.82711	-1.64	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.92570	0.7640	M	0.86805	2.84	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.92560	0.6057	10	0.54805	T	0.06	-13.183	19.9019	0.96988	0.0:1.0:0.0:0.0	.	1013	O60306	AQR_HUMAN	T	1013	ENSP00000156471:A1013T	ENSP00000156471:A1013T	A	-	1	0	AQR	32962123	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.818000	0.86416	2.698000	0.92095	0.591000	0.81541	GCC	.	.	none		0.383	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
TUBGCP2	10844	hgsc.bcm.edu	37	10	135103445	135103445	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:135103445G>A	ENST00000252936.3	-	8	1282	c.1243C>T	c.(1243-1245)Cgg>Tgg	p.R415W	TUBGCP2_ENST00000543663.1_Missense_Mutation_p.R443W|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.R415W|TUBGCP2_ENST00000368562.1_Missense_Mutation_p.R8W|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.R285W			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	415					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CTCTCCTTCCGCAGCTCGTGC	0.582																																					p.R443W		Atlas-SNP	.											TUBGCP2,caecum,carcinoma,+1,1	TUBGCP2	79	1	0			c.C1327T						scavenged	.						259.0	177.0	204.0					10																	135103445		2203	4300	6503	SO:0001583	missense	10844	exon10			CCTTCCGCAGCTC	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1243C>T	10.37:g.135103445G>A	ENSP00000252936:p.Arg415Trp	Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	212	3	0.0141509	NM_001256617	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	ENST00000252936.3	37	CCDS7676.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945137	0.73672	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.32753	2.39;2.12;2.39;1.44;2.38	5.64	4.73	0.59995	.	0.053819	0.85682	D	0.000000	T	0.42653	0.1212	L	0.39245	1.2	0.45087	D	0.998109	D;D;D	0.71674	0.997;0.998;0.992	P;P;P	0.58970	0.764;0.849;0.849	T	0.39583	-0.9607	10	0.72032	D	0.01	-37.8972	15.0194	0.71617	0.0:0.0:0.8565:0.1435	.	443;443;415	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	W	415;285;415;8;443	ENSP00000252936:R415W;ENSP00000395666:R285W;ENSP00000357551:R415W;ENSP00000357550:R8W;ENSP00000446093:R443W	ENSP00000252936:R415W	R	-	1	2	TUBGCP2	134953435	1.000000	0.71417	1.000000	0.80357	0.461000	0.32589	7.601000	0.82783	1.512000	0.48834	-0.182000	0.12963	CGG	.	.	none		0.582	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
NPAS4	266743	hgsc.bcm.edu	37	11	66191694	66191694	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:66191694C>T	ENST00000311034.2	+	7	1509	c.1333C>T	c.(1333-1335)Cag>Tag	p.Q445*		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	445					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						TGAGCCCTTCCAGACCCATTT	0.562																																					p.Q445X		Atlas-SNP	.											.	NPAS4	133	.	0			c.C1333T						PASS	.						187.0	184.0	185.0					11																	66191694		2200	4295	6495	SO:0001587	stop_gained	266743	exon7			CCCTTCCAGACCC	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1333C>T	11.37:g.66191694C>T	ENSP00000311196:p.Gln445*	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	74	4	0.0540541	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Nonsense_Mutation	SNP	ENST00000311034.2	37	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	C	33	5.203210	0.95033	.	.	ENSG00000174576	ENST00000311034	.	.	.	4.71	4.71	0.59529	.	0.000000	0.47455	D	0.000227	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-8.3061	13.0275	0.58823	0.0:1.0:0.0:0.0	.	.	.	.	X	445	.	ENSP00000311196:Q445X	Q	+	1	0	NPAS4	65948270	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.401000	0.34589	2.455000	0.83008	0.563000	0.77884	CAG	.	.	none		0.562	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
LRRK2	120892	hgsc.bcm.edu	37	12	40668487	40668487	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:40668487G>A	ENST00000298910.7	+	15	1817	c.1759G>A	c.(1759-1761)Gat>Aat	p.D587N	LRRK2_ENST00000343742.2_Missense_Mutation_p.D587N	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	587					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.D587Y(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AGGTGCTATGGATTCAGTGCT	0.378																																					p.D587N		Atlas-SNP	.											LRRK2,NS,carcinoma,0,1	LRRK2	763	1	2	Substitution - Missense(2)	endometrium(2)	c.G1759A						scavenged	.						150.0	147.0	148.0					12																	40668487		2203	4300	6503	SO:0001583	missense	120892	exon15			GCTATGGATTCAG	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.1759G>A	12.37:g.40668487G>A	ENSP00000298910:p.Asp587Asn	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	130	3	0.0230769	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950919	0.73787	.	.	ENSG00000188906	ENST00000416796;ENST00000343742;ENST00000298910	T;T;T	0.69926	-0.44;-0.44;-0.44	5.97	5.97	0.96955	Armadillo-like helical (1);Armadillo-type fold (1);	0.047534	0.85682	D	0.000000	T	0.78953	0.4365	M	0.61703	1.905	0.54753	D	0.999988	D;D	0.69078	0.986;0.997	P;P	0.59546	0.859;0.798	T	0.77587	-0.2532	10	0.51188	T	0.08	.	20.4324	0.99085	0.0:0.0:1.0:0.0	.	587;587	E9PC85;Q5S007	.;LRRK2_HUMAN	N	335;587;587	ENSP00000398726:D335N;ENSP00000341930:D587N;ENSP00000298910:D587N	ENSP00000298910:D587N	D	+	1	0	LRRK2	38954754	1.000000	0.71417	0.146000	0.22360	0.445000	0.32107	8.103000	0.89550	2.833000	0.97629	0.585000	0.79938	GAT	.	.	none		0.378	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
SLC35G3	146861	hgsc.bcm.edu	37	17	33520470	33520470	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:33520470A>G	ENST00000297307.5	-	1	942	c.857T>C	c.(856-858)cTa>cCa	p.L286P	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	286	EamA 2.					integral component of membrane (GO:0016021)											CTCGGAATGTAGGACAGCGCA	0.592																																					p.L286P		Atlas-SNP	.											AMAC1,NS,carcinoma,+1,1	.	.	1	0			c.T857C						scavenged	.						206.0	183.0	191.0					17																	33520470		2203	4300	6503	SO:0001583	missense	146861	exon1			GAATGTAGGACAG	AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.857T>C	17.37:g.33520470A>G	ENSP00000297307:p.Leu286Pro	Somatic	254	0	0		WXS	Illumina HiSeq	Phase_I	250	3	0.012	NM_152462	B9EGE9	Missense_Mutation	SNP	ENST00000297307.5	37	CCDS11293.1	.	.	.	.	.	.	.	.	.	.	A	9.567	1.120069	0.20877	.	.	ENSG00000164729	ENST00000297307	T	0.54279	0.58	.	.	.	.	0.000000	0.35262	N	0.003328	T	0.47266	0.1436	N	0.19112	0.55	0.58432	D	0.99999	D	0.89917	1.0	D	0.91635	0.999	T	0.46205	-0.9208	9	0.34782	T	0.22	-3.1883	2.1364	0.03763	0.5014:2.0E-4:2.0E-4:0.4982	.	286	Q8N808	S35G3_HUMAN	P	286	ENSP00000297307:L286P	ENSP00000297307:L286P	L	-	2	0	SLC35G3	30544583	1.000000	0.71417	0.089000	0.20774	0.089000	0.18198	0.754000	0.26390	0.056000	0.16144	0.055000	0.15244	CTA	.	.	none		0.592	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256445.2	NM_152462	
ALG3	10195	hgsc.bcm.edu	37	3	183960348	183960348	+	Missense_Mutation	SNP	G	G	A	rs79144888	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:183960348G>A	ENST00000397676.3	-	9	1301	c.1271C>T	c.(1270-1272)cCg>cTg	p.P424L	ALG3_ENST00000455059.1_Missense_Mutation_p.P384L|MIR1224_ENST00000408193.1_RNA|ALG3_ENST00000445626.2_Missense_Mutation_p.P376L|ALG3_ENST00000463495.1_5'Flank|ALG3_ENST00000418734.2_Missense_Mutation_p.P368L|EIF2B5_ENST00000444495.1_Intron	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase	424					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GAAAGGCTGCGGGCCCAGCCA	0.592													G|||	17	0.00339457	0.0	0.0	5008	,	,		18276	0.0169		0.0	False		,,,				2504	0.0				p.P424L		Atlas-SNP	.											ALG3_ENST00000445626,NS,carcinoma,+1,3	ALG3	48	3	0			c.C1271T						scavenged	.						61.0	66.0	64.0					3																	183960348		2022	4191	6213	SO:0001583	missense	10195	exon9			GGCTGCGGGCCCA	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823	ENST00000397676.3:c.1271C>T	3.37:g.183960348G>A	ENSP00000380793:p.Pro424Leu	Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	270	3	0.0111111	NM_005787	A8JZZ6|Q9BT71	Missense_Mutation	SNP	ENST00000397676.3	37	CCDS46968.1	13	0.005952380952380952	0	0.0	0	0.0	13	0.022727272727272728	0	0.0	G	9.864	1.197017	0.22037	.	.	ENSG00000214160	ENST00000418734;ENST00000397676;ENST00000445626;ENST00000455059	D;D;D;D	0.86956	-1.61;-2.19;-2.02;-2.02	4.65	3.77	0.43336	.	0.240947	0.34507	N	0.003914	T	0.58623	0.2135	N	0.19112	0.55	0.48185	D	0.999607	B;P;B;B	0.35226	0.342;0.491;0.361;0.0	B;B;B;B	0.22753	0.028;0.041;0.017;0.0	T	0.62440	-0.6854	10	0.15952	T	0.53	-11.7909	11.9654	0.53031	0.0919:0.0:0.9081:0.0	.	376;368;384;424	A8JZZ6;B4DS50;C9J7S5;Q92685	.;.;.;ALG3_HUMAN	L	368;424;376;384	ENSP00000402976:P368L;ENSP00000380793:P424L;ENSP00000402744:P376L;ENSP00000397613:P384L	ENSP00000380793:P424L	P	-	2	0	ALG3	185443042	1.000000	0.71417	0.868000	0.34077	0.478000	0.33099	4.087000	0.57671	0.700000	0.31782	-1.598000	0.00824	CCG	G|0.993;A|0.007	0.007	strong		0.592	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
FLG	2312	hgsc.bcm.edu	37	1	152278049	152278049	+	Missense_Mutation	SNP	A	A	C	rs2065958	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:152278049A>C	ENST00000368799.1	-	3	9348	c.9313T>G	c.(9313-9315)Tac>Gac	p.Y3105D	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3105	Ser-rich.		Y -> D (in dbSNP:rs2065958).		establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTGACCGTATTGGGATGCT	0.597									Ichthyosis				C|||	866	0.172923	0.1589	0.1787	5008	,	,		11687	0.3294		0.0686	False		,,,				2504	0.1339				p.Y3105D		Atlas-SNP	.											FLG,NS,carcinoma,+2,1	FLG	900	1	0			c.T9313G						scavenged	.						207.0	261.0	244.0					1																	152278049		1917	4215	6132	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GACCGTATTGGGA	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9313T>G	1.37:g.152278049A>C	ENSP00000357789:p.Tyr3105Asp	Somatic	5	5	1		WXS	Illumina HiSeq	Phase_I	18	18	1	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	5.639	0.302611	0.10678	.	.	ENSG00000143631	ENST00000368799	T	0.01584	4.75	3.92	-5.83	0.02325	.	.	.	.	.	T	0.00241	0.0007	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42783	-0.9431	8	0.15066	T	0.55	.	6.4277	0.21778	0.1024:0.2853:0.5231:0.0891	rs41432453	3105	P20930	FILA_HUMAN	D	3105	ENSP00000357789:Y3105D	ENSP00000357789:Y3105D	Y	-	1	0	FLG	150544673	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.179000	0.01259	-1.367000	0.02152	-0.383000	0.06682	TAC	A|0.173;C|0.827	0.827	strong		0.597	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FSHR	2492	hgsc.bcm.edu	37	2	49190483	49190483	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:49190483C>T	ENST00000406846.2	-	10	1596	c.1477G>A	c.(1477-1479)Ggc>Agc	p.G493S	FSHR_ENST00000346173.3_Missense_Mutation_p.G431S|FSHR_ENST00000304421.4_Missense_Mutation_p.G467S|FSHR_ENST00000541117.1_Missense_Mutation_p.G229S	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	493					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	AAAATCCAGCCCATCACCATG	0.527									Gonadal Dysgenesis, 46 XX																												p.G493S		Atlas-SNP	.											FSHR,NS,carcinoma,+2,1	FSHR	164	1	0			c.G1477A						scavenged	.						63.0	51.0	55.0					2																	49190483		2203	4300	6503	SO:0001583	missense	2492	exon10	Familial Cancer Database		TCCAGCCCATCAC		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1477G>A	2.37:g.49190483C>T	ENSP00000384708:p.Gly493Ser	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	111	3	0.027027	NM_000145	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251927	0.80135	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.88945	0.6575	H	0.94886	3.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91210	0.4998	9	.	.	.	.	18.5892	0.91202	0.0:1.0:0.0:0.0	.	467;431;493	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	S	493;431;467;229	ENSP00000384708:G493S;ENSP00000333908:G431S;ENSP00000306780:G467S;ENSP00000444172:G229S	.	G	-	1	0	FSHR	49043987	1.000000	0.71417	0.982000	0.44146	0.688000	0.40055	7.609000	0.82925	2.941000	0.99782	0.655000	0.94253	GGC	.	.	none		0.527	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2		
CROCC	9696	hgsc.bcm.edu	37	1	17272075	17272075	+	Missense_Mutation	SNP	G	G	A	rs2781608		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:17272075G>A	ENST00000375541.5	+	15	2179	c.2110G>A	c.(2110-2112)Gcc>Acc	p.A704T	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.A704T(11)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGCCGAGAAGGCCGAGGTGGC	0.657																																					p.A704T		Atlas-SNP	.											CROCC,NS,carcinoma,0,10	CROCC	185	10	11	Substitution - Missense(11)	kidney(7)|endometrium(1)|prostate(1)|lung(1)|central_nervous_system(1)	c.G2110A						scavenged	.						20.0	18.0	19.0					1																	17272075		2199	4291	6490	SO:0001583	missense	9696	exon15			GAGAAGGCCGAGG	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2110G>A	1.37:g.17272075G>A	ENSP00000364691:p.Ala704Thr	Somatic	166	7	0.0421687		WXS	Illumina HiSeq	Phase_I	164	9	0.054878	NM_014675		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	202	0.0924908424908425	54	0.10975609756097561	27	0.07458563535911603	41	0.07167832167832168	80	0.10554089709762533	g	7.919	0.738064	0.15574	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.10668	2.85	5.01	4.1	0.47936	.	.	.	.	.	T	0.00300	0.0009	L	0.47716	1.5	0.30387	N	0.781339	D;P;P	0.57899	0.981;0.952;0.873	P;P;B	0.52554	0.702;0.579;0.439	T	0.02477	-1.1153	9	0.16420	T	0.52	.	13.1749	0.59621	0.0795:0.0:0.9205:0.0	rs2781608;rs3871256;rs3872330	567;7;704	A1L0S8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	T	704;585	ENSP00000364691:A704T	ENSP00000364691:A704T	A	+	1	0	CROCC	17144662	0.999000	0.42202	0.970000	0.41538	0.013000	0.08279	2.720000	0.47252	1.448000	0.47680	-0.215000	0.12644	GCC	G|0.934;A|0.066	0.066	strong		0.657	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
ADAMTS2	9509	hgsc.bcm.edu	37	5	178552090	178552090	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr5:178552090C>T	ENST00000251582.7	-	19	2943	c.2842G>A	c.(2842-2844)Gac>Aac	p.D948N		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	948	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GTGGTGTTGTCGTGTAGCGGC	0.692																																					p.D948N		Atlas-SNP	.											ADAMTS2,caecum,carcinoma,0,2	ADAMTS2	190	2	0			c.G2842A						scavenged	.						112.0	113.0	113.0					5																	178552090		2203	4300	6503	SO:0001583	missense	9509	exon19			TGTTGTCGTGTAG	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2842G>A	5.37:g.178552090C>T	ENSP00000251582:p.Asp948Asn	Somatic	74	1	0.0135135		WXS	Illumina HiSeq	Phase_I	121	5	0.0413223	NM_014244		Missense_Mutation	SNP	ENST00000251582.7	37	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	C	0.743	-0.775731	0.02951	.	.	ENSG00000087116	ENST00000251582	T	0.53857	0.6	5.31	2.0	0.26442	.	0.301971	0.27792	N	0.017833	T	0.26774	0.0655	N	0.12422	0.21	0.80722	D	1	B	0.24317	0.101	B	0.22601	0.04	T	0.10730	-1.0617	10	0.06757	T	0.87	.	8.4694	0.32975	0.0:0.7177:0.0:0.2823	.	948	O95450	ATS2_HUMAN	N	948	ENSP00000251582:D948N	ENSP00000251582:D948N	D	-	1	0	ADAMTS2	178484696	0.966000	0.33281	0.957000	0.39632	0.030000	0.12068	1.550000	0.36223	0.026000	0.15269	-1.140000	0.01884	GAC	.	.	none		0.692	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
TP73	7161	hgsc.bcm.edu	37	1	3649562	3649562	+	Silent	SNP	G	G	A	rs9662633	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:3649562G>A	ENST00000378295.4	+	14	1985	c.1830G>A	c.(1828-1830)gcG>gcA	p.A610A	TP73_ENST00000604479.1_Silent_p.A514A|TP73-AS1_ENST00000452079.1_RNA|TP73_ENST00000357733.3_Silent_p.A529A|TP73_ENST00000378285.1_3'UTR|TP73_ENST00000603362.1_Silent_p.A529A|TP73-AS1_ENST00000418088.1_RNA|TP73_ENST00000378280.1_3'UTR|TP73_ENST00000346387.4_Silent_p.A514A|TP73_ENST00000604074.1_3'UTR|TP73_ENST00000354437.4_3'UTR|TP73_ENST00000378288.4_Silent_p.A561A|TP73_ENST00000378290.4_Silent_p.A539A	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	610					activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		ACGAGTGGGCGGACTTCGGCT	0.701													g|||	540	0.107827	0.1694	0.0245	5008	,	,		13381	0.2123		0.0308	False		,,,				2504	0.0552				p.A610A		Atlas-SNP	.											.	TP73	54	.	0			c.G1830A						PASS	.	A	,,,,,,,,,,,,	642,3678		43,556,1561	14.0	18.0	17.0		1683,,,,,,1587,1542,,1440,1395,1617,1830	-8.8	0.3	1	dbSNP_119	17	329,8159		5,319,3920	no	coding-synonymous,utr-3,utr-3,utr-3,utr-3,utr-3,coding-synonymous,coding-synonymous,utr-3,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TP73	NM_001126240.2,NM_001126241.2,NM_001126242.2,NM_001204184.1,NM_001204185.1,NM_001204186.1,NM_001204187.1,NM_001204188.1,NM_001204189.1,NM_001204190.1,NM_001204191.1,NM_001204192.1,NM_005427.3	,,,,,,,,,,,,	48,875,5481	AA,AG,GG	http://www.ncbi.nlm.nih.gov/pubmed?term	3.8761,14.8611,7.5812	,,,,,,,,,,,,	561/588,,,,,,529/556,514/541,,480/507,465/492,539/566,610/637	3649562	971,11837	2160	4244	6404	SO:0001819	synonymous_variant	7161	exon14			GTGGGCGGACTTC	AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.1830G>A	1.37:g.3649562G>A		Somatic	3	0	0		WXS	Illumina HiSeq	Phase_I	15	12	0.8	NM_005427	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Silent	SNP	ENST00000378295.4	37	CCDS49.1																																																																																			G|0.903;A|0.097	0.097	strong		0.701	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001468.4	NM_005427	
PDS5B	23047	hgsc.bcm.edu	37	13	33316792	33316792	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr13:33316792G>A	ENST00000315596.10	+	23	2725	c.2539G>A	c.(2539-2541)Gga>Aga	p.G847R		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	847					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		CAGTAAATCAGGAACTTCTAC	0.338																																					p.G847R		Atlas-SNP	.											.	PDS5B	141	.	0			c.G2539A						PASS	.						136.0	127.0	129.0					13																	33316792		1863	4106	5969	SO:0001583	missense	23047	exon23			AAATCAGGAACTT	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.2539G>A	13.37:g.33316792G>A	ENSP00000313851:p.Gly847Arg	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	123	38	0.308943	NM_015032	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	37	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	G	33	5.204381	0.95033	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.84	5.84	0.93424	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72614	0.3482	L	0.43152	1.355	0.80722	D	1	D	0.61697	0.99	P	0.60949	0.881	T	0.72283	-0.4339	9	0.56958	D	0.05	-8.6067	20.1294	0.97995	0.0:0.0:1.0:0.0	.	847	Q9NTI5	PDS5B_HUMAN	R	847	.	ENSP00000313851:G847R	G	+	1	0	PDS5B	32214792	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.756000	0.98918	2.758000	0.94735	0.591000	0.81541	GGA	.	.	none		0.338	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032	
ADAMTS5	11096	hgsc.bcm.edu	37	21	28327094	28327094	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:28327094C>T	ENST00000284987.5	-	2	1322	c.1201G>A	c.(1201-1203)Ggc>Agc	p.G401S	MIR4759_ENST00000584048.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	401	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						GCGTGGAGGCCATCGTCTTCA	0.512																																					p.G401S	Esophageal Squamous(53;683 1080 10100 14424 45938)	Atlas-SNP	.											.	ADAMTS5	184	.	0			c.G1201A						PASS	.						123.0	112.0	116.0					21																	28327094		2203	4300	6503	SO:0001583	missense	11096	exon2			GGAGGCCATCGTC	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1201G>A	21.37:g.28327094C>T	ENSP00000284987:p.Gly401Ser	Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	58	14	0.241379	NM_007038	Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	C	35	5.419488	0.96111	.	.	ENSG00000154736	ENST00000284987	D	0.86694	-2.16	5.05	5.05	0.67936	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.93119	0.7809	M	0.72624	2.21	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93653	0.6975	10	0.87932	D	0	.	18.5978	0.91235	0.0:1.0:0.0:0.0	.	401	Q9UNA0	ATS5_HUMAN	S	401	ENSP00000284987:G401S	ENSP00000284987:G401S	G	-	1	0	ADAMTS5	27248965	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.651000	0.83577	2.641000	0.89580	0.557000	0.71058	GGC	.	.	none		0.512	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1		
CNPPD1	27013	hgsc.bcm.edu	37	2	220041491	220041491	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:220041491C>T	ENST00000409789.1	-	2	487	c.60G>A	c.(58-60)caG>caA	p.Q20Q	FAM134A_ENST00000430297.2_5'Flank|CNPPD1_ENST00000360507.5_Silent_p.Q20Q			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	20					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						CCGTGAAGTCCTGGAAGCCGG	0.726																																					p.Q20Q		Atlas-SNP	.											.	CNPPD1	22	.	0			c.G60A						PASS	.						18.0	19.0	18.0					2																	220041491		2167	4262	6429	SO:0001819	synonymous_variant	27013	exon1			GAAGTCCTGGAAG	AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.60G>A	2.37:g.220041491C>T		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	75	4	0.0533333	NM_015680	B2RC77|O75548|Q9H4N0|Q9UQN0	Silent	SNP	ENST00000409789.1	37	CCDS2433.1																																																																																			.	.	none		0.726	CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336220.1	NM_015680	
PLCH1	23007	hgsc.bcm.edu	37	3	155205862	155205862	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:155205862T>G	ENST00000340059.7	-	20	2537	c.2538A>C	c.(2536-2538)gaA>gaC	p.E846D	PLCH1_ENST00000460012.1_Missense_Mutation_p.E828D|PLCH1_ENST00000494598.1_Missense_Mutation_p.E846D|PLCH1_ENST00000414191.1_Missense_Mutation_p.E828D|PLCH1_ENST00000334686.6_Missense_Mutation_p.E828D|PLCH1-AS2_ENST00000472913.1_RNA|PLCH1_ENST00000447496.2_Missense_Mutation_p.E846D	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	846					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			ATATGGATGCTTCTGTCAGTC	0.363																																					p.E846D		Atlas-SNP	.											.	PLCH1	406	.	0			c.A2538C						PASS	.						132.0	130.0	130.0					3																	155205862		2203	4300	6503	SO:0001583	missense	23007	exon20			GGATGCTTCTGTC	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.2538A>C	3.37:g.155205862T>G	ENSP00000345988:p.Glu846Asp	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	84	7	0.0833333	NM_001130960	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	T	18.56	3.650690	0.67472	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.12984	2.63;2.63;2.63;2.63;2.63;2.63	5.18	1.45	0.22620	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.30448	0.0765	M	0.73962	2.25	0.54753	D	0.999989	D;D;D	0.71674	0.996;0.998;0.984	D;D;P	0.69824	0.966;0.926;0.888	T	0.00953	-1.1502	10	0.36615	T	0.2	.	8.9787	0.35953	0.0:0.2141:0.0:0.7859	.	828;846;846	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	D	846;828;846;846;828;828	ENSP00000419100:E846D;ENSP00000417502:E828D;ENSP00000402759:E846D;ENSP00000345988:E846D;ENSP00000335469:E828D;ENSP00000412977:E828D	ENSP00000335469:E828D	E	-	3	2	PLCH1	156688556	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	1.763000	0.38461	0.013000	0.14918	-0.250000	0.11733	GAA	.	.	none		0.363	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
MUC4	4585	hgsc.bcm.edu	37	3	195510910	195510910	+	Missense_Mutation	SNP	G	G	T	rs576459717		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:195510910G>T	ENST00000463781.3	-	2	8000	c.7541C>A	c.(7540-7542)cCt>cAt	p.P2514H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P2514H|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGTAGAGGGGT	0.562																																					p.P2514H		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	0			c.C7541A						scavenged	.						90.0	72.0	77.0					3																	195510910		661	1591	2252	SO:0001583	missense	4585	exon2			GTGACAGGTAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7541C>A	3.37:g.195510910G>T	ENSP00000417498:p.Pro2514His	Somatic	398	8	0.0201005		WXS	Illumina HiSeq	Phase_I	440	14	0.0318182	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.532	0.466443	0.12402	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.3;1.37	.	.	.	.	.	.	.	.	T	0.29524	0.0736	N	0.19112	0.55	0.20489	N	0.999893	D	0.54964	0.969	P	0.52710	0.707	T	0.18840	-1.0324	7	.	.	.	.	6.8646	0.24086	1.0E-4:0.0:0.9999:0.0	.	2514	E7ESK3	.	H	2514	ENSP00000417498:P2514H;ENSP00000420243:P2514H	.	P	-	2	0	MUC4	196995305	0.082000	0.21442	0.000000	0.03702	0.000000	0.00434	0.551000	0.23361	-0.000000	0.14550	0.000000	0.15137	CCT	.	.	none		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
AKAP9	10142	hgsc.bcm.edu	37	7	91625060	91625060	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr7:91625060A>C	ENST00000359028.2	+	8	1137	c.912A>C	c.(910-912)gaA>gaC	p.E304D	AKAP9_ENST00000356239.3_Missense_Mutation_p.E292D|AKAP9_ENST00000394564.1_Missense_Mutation_p.E292D|AKAP9_ENST00000358100.2_Missense_Mutation_p.E304D			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	304					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AAAAGAAAGAAGACTTCACAA	0.343			T	BRAF	papillary thyroid																																p.E292D		Atlas-SNP	.		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	AKAP9_ENST00000356239,NS,carcinoma,+2,2	AKAP9	788	2	0			c.A876C						PASS	.						67.0	63.0	64.0					7																	91625060		2203	4300	6503	SO:0001583	missense	10142	exon7			GAAAGAAGACTTC	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.912A>C	7.37:g.91625060A>C	ENSP00000351922:p.Glu304Asp	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	38	15	0.394737	NM_005751	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	A	13.26	2.183510	0.38609	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565;ENST00000394564	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.1	2.75	0.32379	.	0.000000	0.42682	D	0.000674	T	0.50000	0.1590	L	0.59436	1.845	0.36863	D	0.888493	B;B;D;B	0.69078	0.42;0.42;0.997;0.011	B;B;D;B	0.69654	0.087;0.087;0.965;0.009	T	0.54268	-0.8319	10	0.56958	D	0.05	.	8.6538	0.34051	0.8413:0.0:0.1587:0.0	.	292;292;304;292	Q99996-2;Q99996-3;A4D1E4;Q6PJH3	.;.;.;.	D	292;304;304;304;304;292	ENSP00000348573:E292D;ENSP00000351922:E304D;ENSP00000350813:E304D;ENSP00000378065:E292D	ENSP00000348573:E292D	E	+	3	2	AKAP9	91462996	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.124000	0.42006	0.384000	0.24942	0.533000	0.62120	GAA	.	.	none		0.343	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
OR7A5	26659	hgsc.bcm.edu	37	19	14938184	14938184	+	Silent	SNP	A	A	G	rs200531878		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:14938184A>G	ENST00000322301.3	-	2	957	c.870T>C	c.(868-870)taT>taC	p.Y290Y	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Silent_p.Y290Y			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	290					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y290Y(2)		breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						TCCTCAGACTATAGATAAAGG	0.478																																					p.Y290Y		Atlas-SNP	.											OR7A5,NS,carcinoma,0,1	OR7A5	43	1	2	Substitution - coding silent(2)	kidney(2)	c.T870C						scavenged	.						74.0	72.0	72.0					19																	14938184		2203	4300	6503	SO:0001819	synonymous_variant	26659	exon1			CAGACTATAGATA	X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.870T>C	19.37:g.14938184A>G		Somatic	62	1	0.016129		WXS	Illumina HiSeq	Phase_I	96	4	0.0416667	NM_017506	B2R682|Q6IFP1|Q96R96	Silent	SNP	ENST00000322301.3	37	CCDS12318.1																																																																																			A|0.999;G|0.001	0.001	weak		0.478	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506	
RBM20	282996	hgsc.bcm.edu	37	10	112404302	112404302	+	Silent	SNP	G	G	A	rs35141404	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:112404302G>A	ENST00000369519.3	+	1	148	c.90G>A	c.(88-90)cgG>cgA	p.R30R	Y_RNA_ENST00000411370.1_RNA	NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	30	Pro-rich.				heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CTGGTGCCCGGGCGTCCCCGG	0.746													G|||	1113	0.222244	0.4206	0.1354	5008	,	,		7996	0.1617		0.1392	False		,,,				2504	0.1636				p.R30R		Atlas-SNP	.											.	RBM20	50	.	0			c.G90A						PASS	.						4.0	9.0	7.0					10																	112404302		625	1495	2120	SO:0001819	synonymous_variant	282996	exon1			TGCCCGGGCGTCC	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.90G>A	10.37:g.112404302G>A		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_001134363	A6NIP5|B5A868|Q5JVI1	Silent	SNP	ENST00000369519.3	37	CCDS44477.1																																																																																			G|0.808;A|0.192	0.192	strong		0.746	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39324348	39324348	+	Missense_Mutation	SNP	C	C	T	rs201948308		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:39324348C>T	ENST00000391356.2	-	1	76	c.77G>A	c.(76-78)cGc>cAc	p.R26H		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	26					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGCTGGGGCGGCAGCAGCT	0.642																																					p.R26H		Atlas-SNP	.											.	KRTAP4-3	40	.	0			c.G77A						PASS	.						28.0	31.0	30.0					17																	39324348		2198	4294	6492	SO:0001583	missense	85290	exon1			CTGGGGCGGCAGC	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.77G>A	17.37:g.39324348C>T	ENSP00000375151:p.Arg26His	Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	152	30	0.197368	NM_033187		Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	9.870	1.198680	0.22121	.	.	ENSG00000196156	ENST00000391356	T	0.01495	4.83	4.65	-8.84	0.00803	.	.	.	.	.	T	0.01523	0.0049	L	0.49778	1.585	0.09310	N	1	B	0.19583	0.037	B	0.13407	0.009	T	0.47923	-0.9079	9	0.44086	T	0.13	.	2.0531	0.03575	0.1031:0.2606:0.2577:0.3786	.	26	Q9BYR4	KRA43_HUMAN	H	26	ENSP00000375151:R26H	ENSP00000375151:R26H	R	-	2	0	KRTAP4-3	36577874	0.428000	0.25522	0.000000	0.03702	0.015000	0.08874	0.180000	0.16860	-0.993000	0.03467	0.467000	0.42956	CGC	.	.	weak		0.642	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
LMOD3	56203	hgsc.bcm.edu	37	3	69171353	69171353	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:69171353G>A	ENST00000420581.2	-	1	364	c.185C>T	c.(184-186)cCg>cTg	p.P62L	LMOD3_ENST00000475434.1_Missense_Mutation_p.P62L|LMOD3_ENST00000489031.1_Missense_Mutation_p.P62L	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	62						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		GTTTCCTGTCGGTGGCTTGTC	0.473																																					p.P62L		Atlas-SNP	.											LMOD3_ENST00000420581,NS,carcinoma,+1,2	LMOD3	92	2	0			c.C185T						scavenged	.						91.0	85.0	87.0					3																	69171353		1858	4101	5959	SO:0001583	missense	56203	exon1			CCTGTCGGTGGCT	AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.185C>T	3.37:g.69171353G>A	ENSP00000414670:p.Pro62Leu	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	158	3	0.0189873	NM_198271	B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Missense_Mutation	SNP	ENST00000420581.2	37	CCDS46862.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692351	0.88735	.	.	ENSG00000163380	ENST00000420581;ENST00000489031;ENST00000475434	T;T;T	0.34472	1.36;1.36;1.36	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.65883	0.2734	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70802	-0.4773	10	0.87932	D	0	-15.6816	19.2242	0.93812	0.0:0.0:1.0:0.0	.	62	Q0VAK6	LMOD3_HUMAN	L	62	ENSP00000414670:P62L;ENSP00000417210:P62L;ENSP00000418645:P62L	ENSP00000414670:P62L	P	-	2	0	LMOD3	69254043	1.000000	0.71417	0.871000	0.34182	0.720000	0.41350	9.869000	0.99810	2.553000	0.86117	0.591000	0.81541	CCG	.	.	none		0.473	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352138.1	XM_067529	
GRID2	2895	hgsc.bcm.edu	37	4	94376883	94376883	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:94376883G>A	ENST00000282020.4	+	11	1874	c.1616G>A	c.(1615-1617)cGt>cAt	p.R539H	GRID2_ENST00000510992.1_Missense_Mutation_p.R444H	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	539					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TTTACGACACGTTACATGGAC	0.443																																					p.R539H		Atlas-SNP	.											GRID2,NS,carcinoma,+1,1	GRID2	233	1	0			c.G1616A						PASS	.						160.0	144.0	149.0					4																	94376883		2203	4300	6503	SO:0001583	missense	2895	exon11			CGACACGTTACAT	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1616G>A	4.37:g.94376883G>A	ENSP00000282020:p.Arg539His	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	180	62	0.344444	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	G	31	5.086141	0.94100	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.27402	1.67;1.67	5.97	5.97	0.96955	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.59851	0.2224	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.59198	-0.7499	10	0.66056	D	0.02	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	444;539	E9PH24;O43424	.;GRID2_HUMAN	H	539;444	ENSP00000282020:R539H;ENSP00000421257:R444H	ENSP00000282020:R539H	R	+	2	0	GRID2	94595906	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.869000	0.99810	2.836000	0.97738	0.655000	0.94253	CGT	.	.	none		0.443	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
PRKCB	5579	hgsc.bcm.edu	37	16	24183630	24183630	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr16:24183630G>A	ENST00000321728.7	+	11	1454	c.1279G>A	c.(1279-1281)Gac>Aac	p.D427N	PRKCB_ENST00000303531.7_Missense_Mutation_p.D427N	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	427	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	GAATGGGGGCGACCTCATGTA	0.527																																					p.D427N		Atlas-SNP	.											PRKCB_ENST00000321728,caecum,carcinoma,0,3	PRKCB	383	3	0			c.G1279A						scavenged	.						125.0	103.0	110.0					16																	24183630		2197	4300	6497	SO:0001583	missense	5579	exon11			GGGGGCGACCTCA	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1279G>A	16.37:g.24183630G>A	ENSP00000318315:p.Asp427Asn	Somatic	193	1	0.00518135		WXS	Illumina HiSeq	Phase_I	170	59	0.347059	NM_212535	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	37	CCDS10618.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795660	0.90453	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.27402	1.67;1.67	5.25	5.25	0.73442	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56093	0.1962	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.58521	-0.7622	10	0.87932	D	0	.	18.1787	0.89769	0.0:0.0:1.0:0.0	.	427;427	P05771-2;P05771	.;KPCB_HUMAN	N	427	ENSP00000318315:D427N;ENSP00000305355:D427N	ENSP00000305355:D427N	D	+	1	0	PRKCB	24091131	1.000000	0.71417	0.958000	0.39756	0.462000	0.32619	9.768000	0.98965	2.606000	0.88127	0.557000	0.71058	GAC	.	.	none		0.527	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535	
GGH	8836	hgsc.bcm.edu	37	8	63951312	63951312	+	Missense_Mutation	SNP	A	A	G	rs1800909	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:63951312A>G	ENST00000260118.6	-	1	418	c.16T>C	c.(16-18)Tgc>Cgc	p.C6R		NM_003878.2	NP_003869.1	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)	6			C -> R (in dbSNP:rs1800909).		glutamine metabolic process (GO:0006541)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	exopeptidase activity (GO:0008238)|gamma-glutamyl-peptidase activity (GO:0034722)|omega peptidase activity (GO:0008242)			breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(6)|stomach(1)	11	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|Methotrexate(DB00563)	CACAGCAGGCAGCCCGGACTG	0.716													G|||	1161	0.231829	0.1672	0.2277	5008	,	,		10294	0.2192		0.2793	False		,,,				2504	0.2863				p.C6R		Atlas-SNP	.											.	GGH	32	.	0			c.T16C						PASS	.	G	ARG/CYS	752,3574		76,600,1487	10.0	10.0	10.0		16	1.1	0.0	8	dbSNP_89	10	2198,6302		290,1618,2342	no	missense	GGH	NM_003878.2	180	366,2218,3829	GG,GA,AA		25.8588,17.3833,23.0002	benign	6/319	63951312	2950,9876	2163	4250	6413	SO:0001583	missense	8836	exon1			GCAGGCAGCCCGG	U55206	CCDS6177.1	8q12.3	2008-02-05			ENSG00000137563	ENSG00000137563	3.4.19.9		4248	protein-coding gene	gene with protein product		601509				8816764, 10570974	Standard	NM_003878		Approved		uc003xuw.3	Q92820	OTTHUMG00000164365	ENST00000260118.6:c.16T>C	8.37:g.63951312A>G	ENSP00000260118:p.Cys6Arg	Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	13	9	0.692308	NM_003878		Missense_Mutation	SNP	ENST00000260118.6	37	CCDS6177.1	512	0.23443223443223443	88	0.17886178861788618	83	0.2292817679558011	127	0.22202797202797203	214	0.28232189973614774	G	6.061	0.379536	0.11466	0.173833	0.258588	ENSG00000137563	ENST00000260118	T	0.21191	2.02	4.12	1.06	0.20224	.	1.412970	0.04201	N	0.329979	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42258	-0.9462	9	0.24483	T	0.36	-3.9473	1.5309	0.02535	0.1969:0.1633:0.4721:0.1677	rs1800909	6	Q92820	GGH_HUMAN	R	6	ENSP00000260118:C6R	ENSP00000260118:C6R	C	-	1	0	GGH	64113866	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.797000	0.26999	-0.133000	0.11537	-0.684000	0.03749	TGC	A|0.769;G|0.231	0.231	strong		0.716	GGH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378453.1		
FRG1	2483	hgsc.bcm.edu	37	4	190873379	190873379	+	Missense_Mutation	SNP	A	A	G	rs112612436		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:190873379A>G	ENST00000226798.4	+	3	418	c.196A>G	c.(196-198)Aag>Gag	p.K66E	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	66			K -> E (in dbSNP:rs17406826).		mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K66E(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGAAATGGATAAGGGAACCTA	0.383																																					p.K66E		Atlas-SNP	.											FRG1,arm,malignant_melanoma,0,1	FRG1	76	1	1	Substitution - Missense(1)	skin(1)	c.A196G						scavenged	.						101.0	115.0	110.0					4																	190873379		2203	4298	6501	SO:0001583	missense	2483	exon3			ATGGATAAGGGAA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.196A>G	4.37:g.190873379A>G	ENSP00000226798:p.Lys66Glu	Somatic	90	10	0.111111		WXS	Illumina HiSeq	Phase_I	106	17	0.160377	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	11.33	1.608104	0.28623	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.44083	2.07;0.93	3.47	2.23	0.28157	Actin cross-linking (1);	0.148940	0.64402	D	0.000013	T	0.29288	0.0729	L	0.52011	1.625	0.42341	D	0.992332	B	0.02656	0.0	B	0.04013	0.001	T	0.10314	-1.0635	10	0.06757	T	0.87	-8.6418	8.2577	0.31766	0.7983:0.2017:0.0:0.0	rs17406826	66	Q14331	FRG1_HUMAN	E	66;3	ENSP00000226798:K66E;ENSP00000435943:K3E	ENSP00000226798:K66E	K	+	1	0	FRG1	191110373	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.931000	0.48932	0.668000	0.31126	0.441000	0.28932	AAG	.	.	weak		0.383	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
NEB	4703	hgsc.bcm.edu	37	2	152470904	152470904	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:152470904C>T	ENST00000172853.10	-	73	10905	c.10758G>A	c.(10756-10758)aaG>aaA	p.K3586K	NEB_ENST00000427231.2_Silent_p.K3829K|NEB_ENST00000603639.1_Silent_p.K3829K|NEB_ENST00000409198.1_Silent_p.K3586K|NEB_ENST00000604864.1_Silent_p.K3829K|NEB_ENST00000397345.3_Silent_p.K3829K			P20929	NEBU_HUMAN	nebulin	3586					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GGATCTGACACTTCTTGGCCA	0.527																																					p.K3829K		Atlas-SNP	.											.	NEB	1697	.	0			c.G11487A						PASS	.						242.0	237.0	239.0					2																	152470904		2063	4213	6276	SO:0001819	synonymous_variant	4703	exon77			CTGACACTTCTTG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.10758G>A	2.37:g.152470904C>T		Somatic	210	0	0		WXS	Illumina HiSeq	Phase_I	237	94	0.396624	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				.	.	none		0.527	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
SYCE2	256126	hgsc.bcm.edu	37	19	13010850	13010850	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:13010850A>G	ENST00000293695.7	-	5	598	c.580T>C	c.(580-582)Ttc>Ctc	p.F194L	GCDH_ENST00000588242.2_3'UTR	NM_001105578.1	NP_001099048.1	Q6PIF2	SYCE2_HUMAN	synaptonemal complex central element protein 2	194					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8						GAAGAAACGAACACGTCTGGG	0.532																																					p.F194L		Atlas-SNP	.											.	SYCE2	19	.	0			c.T580C						PASS	.						56.0	63.0	61.0					19																	13010850		1915	4123	6038	SO:0001583	missense	256126	exon5			AAACGAACACGTC	AK097443	CCDS42509.1	19p13.13	2008-02-05				ENSG00000161860			27411	protein-coding gene	gene with protein product	"""central element synaptonemal complex 1"""	611487				15944401	Standard	NM_001105578		Approved	CESC1	uc002mvr.2	Q6PIF2		ENST00000293695.7:c.580T>C	19.37:g.13010850A>G	ENSP00000293695:p.Phe194Leu	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	84	5	0.0595238	NM_001105578	B4DYD3	Missense_Mutation	SNP	ENST00000293695.7	37	CCDS42509.1	.	.	.	.	.	.	.	.	.	.	A	11.35	1.612603	0.28712	.	.	ENSG00000161860	ENST00000293695	D	0.85629	-2.01	3.46	-3.27	0.05048	.	.	.	.	.	T	0.71160	0.3307	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.56757	-0.7926	9	0.87932	D	0	.	5.1896	0.15203	0.2862:0.0:0.5364:0.1775	.	194	Q6PIF2	SYCE2_HUMAN	L	194	ENSP00000293695:F194L	ENSP00000293695:F194L	F	-	1	0	SYCE2	12871850	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-1.037000	0.03557	-0.830000	0.04262	-0.464000	0.05259	TTC	.	.	none		0.532	SYCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451913.1	XM_497609	
C2orf81	388963	hgsc.bcm.edu	37	2	74642265	74642265	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:74642265A>C	ENST00000517883.1	-	1	1445	c.754T>G	c.(754-756)Tcc>Gcc	p.S252A	C2orf81_ENST00000290390.5_Missense_Mutation_p.S320A			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	313										endometrium(3)|kidney(1)	4						TGCTGGCAGGACGCGGAGGGG	0.721																																					p.S320A		Atlas-SNP	.											C2orf81,colon,carcinoma,0,1	C2orf81	23	1	0			c.T958G						scavenged	.						4.0	8.0	6.0					2																	74642265		638	1532	2170	SO:0001583	missense	388963	exon4			GGCAGGACGCGGA	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.754T>G	2.37:g.74642265A>C	ENSP00000431103:p.Ser252Ala	Somatic	7	0	0		WXS	Illumina HiSeq	Phase_I	5	3	0.6	NM_001145054		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	a	12.67	2.008342	0.35415	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	5.0	-4.83	0.03161	.	2.205130	0.02226	N	0.064447	T	0.21674	0.0522	L	0.36672	1.1	0.09310	N	1	B	0.28291	0.206	B	0.28011	0.085	T	0.07966	-1.0745	9	0.12430	T	0.62	0.3431	1.4608	0.02395	0.3364:0.2747:0.268:0.1209	.	320	G3XAA6	.	A	252;320	.	ENSP00000290390:S320A	S	-	1	0	C2orf81	74495773	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.495000	0.06443	-0.580000	0.05944	0.454000	0.30748	TCC	.	.	none		0.721	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
CST2	1470	hgsc.bcm.edu	37	20	23805955	23805955	+	Silent	SNP	C	C	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr20:23805955C>A	ENST00000304725.2	-	2	304	c.234G>T	c.(232-234)gtG>gtT	p.V78V		NM_001322.2	NP_001313.1	P09228	CYTT_HUMAN	cystatin SA	78					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|cervix(1)|large_intestine(1)|liver(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	10						TCACCCCGCCCACGATCTACA	0.537																																					p.V78V	Pancreas(193;496 3017 22514 29918)	Atlas-SNP	.											CST2,colon,carcinoma,-2,1	CST2	39	1	0			c.G234T						scavenged	.						221.0	172.0	189.0					20																	23805955		2203	4300	6503	SO:0001819	synonymous_variant	1470	exon2			CCCGCCCACGATC	M19671	CCDS13161.1	20p11.2	2007-11-29			ENSG00000170369	ENSG00000170369			2474	protein-coding gene	gene with protein product	"""cystatin 2"""	123856					Standard	NM_001322		Approved		uc002wtq.1	P09228	OTTHUMG00000032086	ENST00000304725.2:c.234G>T	20.37:g.23805955C>A		Somatic	110	3	0.0272727		WXS	Illumina HiSeq	Phase_I	110	4	0.0363636	NM_001322	Q9UCQ7	Silent	SNP	ENST00000304725.2	37	CCDS13161.1																																																																																			.	.	none		0.537	CST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078352.2		
GRIN3A	116443	hgsc.bcm.edu	37	9	104448968	104448968	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:104448968A>G	ENST00000361820.3	-	2	1814	c.1214T>C	c.(1213-1215)aTg>aCg	p.M405T		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	405					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TGGTTGGATCATGGTGGCTGT	0.463																																					p.M405T		Atlas-SNP	.											GRIN3A,NS,malignant_melanoma,+1,1	GRIN3A	186	1	0			c.T1214C						scavenged	.						139.0	109.0	119.0					9																	104448968		2203	4300	6503	SO:0001583	missense	116443	exon2			TGGATCATGGTGG		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1214T>C	9.37:g.104448968A>G	ENSP00000355155:p.Met405Thr	Somatic	141	1	0.0070922		WXS	Illumina HiSeq	Phase_I	159	3	0.0188679	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	A	9.158	1.018037	0.19355	.	.	ENSG00000198785	ENST00000361820	D	0.85339	-1.97	5.83	5.83	0.93111	.	0.105466	0.64402	D	0.000003	T	0.78110	0.4232	L	0.27053	0.805	0.48135	D	0.999593	B	0.02656	0.0	B	0.06405	0.002	T	0.72087	-0.4396	10	0.32370	T	0.25	.	16.2147	0.82198	1.0:0.0:0.0:0.0	.	405	Q8TCU5	NMD3A_HUMAN	T	405	ENSP00000355155:M405T	ENSP00000355155:M405T	M	-	2	0	GRIN3A	103488789	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.394000	0.44450	2.231000	0.72958	0.460000	0.39030	ATG	.	.	none		0.463	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
OVGP1	5016	hgsc.bcm.edu	37	1	111957523	111957523	+	Missense_Mutation	SNP	G	G	T	rs3767608|rs201350653		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:111957523G>T	ENST00000369732.3	-	11	1655	c.1600C>A	c.(1600-1602)Cct>Act	p.P534T		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	534					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)	p.T597_V604delTPVSHQSV(2)|p.T533_V540delTPVSHQSV(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		TGACTCACAGGGGTCACAGAC	0.537																																					p.P534T		Atlas-SNP	.											OVGP1_ENST00000369728,NS,carcinoma,0,2	OVGP1	177	2	4	Deletion - In frame(4)	haematopoietic_and_lymphoid_tissue(2)|stomach(2)	c.C1600A						PASS	.																																			SO:0001583	missense	5016	exon11			TCACAGGGGTCAC	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1600C>A	1.37:g.111957523G>T	ENSP00000358747:p.Pro534Thr	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	144	22	0.152778	NM_002557	A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	ENST00000369732.3	37	CCDS834.1	.	.	.	.	.	.	.	.	.	.	G	9.491	1.100669	0.20552	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000434331	T	0.19105	2.17	2.35	-0.421	0.12332	.	.	.	.	.	T	0.03608	0.0103	N	0.22421	0.69	0.09310	N	1	B;B	0.13145	0.007;0.0	B;B	0.06405	0.002;0.0	T	0.42999	-0.9418	9	0.36615	T	0.2	9.8099	5.0173	0.14343	0.4538:0.0:0.5462:0.0	.	534;598	Q12889;Q59HH5	OVGP1_HUMAN;.	T	534;598;342	ENSP00000358747:P534T	ENSP00000358743:P598T	P	-	1	0	OVGP1	111759046	0.000000	0.05858	0.001000	0.08648	0.112000	0.19704	-1.483000	0.02318	-0.296000	0.08947	0.460000	0.39030	CCT	G|1.000;A|0.000	.	alt		0.537	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557	
KANK1	23189	hgsc.bcm.edu	37	9	731215	731215	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:731215A>G	ENST00000382303.1	+	9	3606	c.2954A>G	c.(2953-2955)aAa>aGa	p.K985R	KANK1_ENST00000382293.3_Missense_Mutation_p.K827R|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Missense_Mutation_p.K985R	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	985	Nuclear localization signal 2 (NLS 2).				negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GATGGTAACAAAGATTCAAAT	0.378																																					p.K985R		Atlas-SNP	.											.	KANK1	231	.	0			c.A2954G						PASS	.						142.0	127.0	132.0					9																	731215		2203	4300	6503	SO:0001583	missense	23189	exon9			GTAACAAAGATTC	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2954A>G	9.37:g.731215A>G	ENSP00000371740:p.Lys985Arg	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	153	69	0.45098	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	37	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.804544	0.31869	.	.	ENSG00000107104	ENST00000382303;ENST00000397976;ENST00000382297;ENST00000382293	T;T;T	0.17528	2.27;2.27;2.27	5.76	-2.74	0.05932	.	0.345964	0.24791	N	0.035577	T	0.12433	0.0302	L	0.57536	1.79	0.09310	N	0.999999	B	0.10296	0.003	B	0.09377	0.004	T	0.29731	-1.0002	10	0.21540	T	0.41	.	6.4346	0.21817	0.5965:0.0:0.2984:0.1051	.	985	Q14678	KANK1_HUMAN	R	985;8;985;827	ENSP00000371740:K985R;ENSP00000371734:K985R;ENSP00000371730:K827R	ENSP00000371730:K827R	K	+	2	0	KANK1	721215	0.072000	0.21174	0.004000	0.12327	0.888000	0.51559	1.007000	0.29860	-0.570000	0.06022	0.528000	0.53228	AAA	.	.	none		0.378	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
STPG2	285555	hgsc.bcm.edu	37	4	98893436	98893436	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:98893436A>C	ENST00000295268.3	-	7	1017	c.928T>G	c.(928-930)Tat>Gat	p.Y310D		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	310																	ATTACCTGATAATCAGCAGGT	0.353																																					p.Y310D		Atlas-SNP	.											.	.	.	.	0			c.T928G						PASS	.						72.0	74.0	73.0					4																	98893436		2203	4300	6503	SO:0001583	missense	285555	exon7			CCTGATAATCAGC	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.928T>G	4.37:g.98893436A>C	ENSP00000295268:p.Tyr310Asp	Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	175	66	0.377143	NM_174952		Missense_Mutation	SNP	ENST00000295268.3	37	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.828153	0.50845	.	.	ENSG00000163116	ENST00000522676;ENST00000295268	T;T	0.77877	-1.13;1.39	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000001	D	0.82879	0.5133	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84923	0.0855	10	0.87932	D	0	-16.3241	14.4978	0.67700	1.0:0.0:0.0:0.0	.	310	Q8N412	CD037_HUMAN	D	24;310	ENSP00000428346:Y24D;ENSP00000295268:Y310D	ENSP00000295268:Y310D	Y	-	1	0	C4orf37	99112459	1.000000	0.71417	0.985000	0.45067	0.357000	0.29423	5.252000	0.65445	2.066000	0.61787	0.455000	0.32223	TAT	.	.	none		0.353	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
CALCR	799	hgsc.bcm.edu	37	7	93108736	93108736	+	Silent	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr7:93108736T>C	ENST00000394441.1	-	3	450	c.135A>G	c.(133-135)cgA>cgG	p.R45R	CALCR_ENST00000421592.1_Silent_p.R45R|CALCR_ENST00000359558.2_Silent_p.R63R|CALCR_ENST00000360249.4_Silent_p.R45R|CALCR_ENST00000426151.1_Silent_p.R45R	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	63					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	TCATCTTCTTTCGTCCTACGA	0.403																																					p.R63R		Atlas-SNP	.											CALCR_ENST00000359558,rectum,carcinoma,-1,7	CALCR	200	7	0			c.A189G						scavenged	.						250.0	231.0	238.0					7																	93108736		2203	4300	6503	SO:0001819	synonymous_variant	799	exon5			CTTCTTTCGTCCT	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.135A>G	7.37:g.93108736T>C		Somatic	282	0	0		WXS	Illumina HiSeq	Phase_I	283	4	0.0141343	NM_001164737	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Silent	SNP	ENST00000394441.1	37	CCDS5631.1																																																																																			.	.	none		0.403	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	
DOCK1	1793	hgsc.bcm.edu	37	10	128769016	128769016	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:128769016G>T	ENST00000280333.6	+	2	206	c.97G>T	c.(97-99)Gga>Tga	p.G33*		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	33	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TTTACAGATCGGAGACACTGT	0.393																																					p.G33X		Atlas-SNP	.											DOCK1,NS,carcinoma,-2,1	DOCK1	188	1	0			c.G97T						scavenged	.						147.0	132.0	137.0					10																	128769016		1934	4122	6056	SO:0001587	stop_gained	1793	exon2			CAGATCGGAGACA	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.97G>T	10.37:g.128769016G>T	ENSP00000280333:p.Gly33*	Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	170	2	0.0117647	NM_001380	A9Z1Z5	Nonsense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	G	37	6.336575	0.97485	.	.	ENSG00000150760	ENST00000280333	.	.	.	4.26	4.26	0.50523	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.1717	0.86832	0.0:0.0:1.0:0.0	.	.	.	.	X	33	.	ENSP00000280333:G33X	G	+	1	0	DOCK1	128659006	1.000000	0.71417	0.960000	0.40013	0.955000	0.61496	7.457000	0.80775	2.319000	0.78375	0.563000	0.77884	GGA	.	.	none		0.393	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
SLC39A3	29985	hgsc.bcm.edu	37	19	2732986	2732986	+	Silent	SNP	T	T	C	rs759073	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:2732986T>C	ENST00000269740.4	-	3	1037	c.708A>G	c.(706-708)gtA>gtG	p.V236V	SLC39A3_ENST00000545664.1_Silent_p.V236V|AC006538.4_ENST00000586572.1_Intron	NM_144564.4	NP_653165.2	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter), member 3	236					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCATGGCGCTTACGGTGACCG	0.736													C|||	3132	0.625399	0.907	0.3905	5008	,	,		14002	0.6468		0.4414	False		,,,				2504	0.5787				p.V236V		Atlas-SNP	.											SLC39A3,NS,carcinoma,0,1	SLC39A3	20	1	0			c.A708G						scavenged	.	C		3669,719		1542,585,67	19.0	22.0	21.0		708	2.4	1.0	19	dbSNP_86	21	3873,4701		921,2031,1335	no	coding-synonymous	SLC39A3	NM_144564.4		2463,2616,1402	CC,CT,TT		45.1714,16.3856,41.8145		236/315	2732986	7542,5420	2194	4287	6481	SO:0001819	synonymous_variant	29985	exon3			GGCGCTTACGGTG	AF052125	CCDS12093.1, CCDS45909.1	19p13.3	2013-05-22			ENSG00000141873	ENSG00000141873		"""Solute carriers"""	17128	protein-coding gene	gene with protein product		612168				10681536	Standard	NM_144564		Approved	ZIP3	uc002lwg.3	Q9BRY0		ENST00000269740.4:c.708A>G	19.37:g.2732986T>C		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	5	5	1	NM_144564	B3KMJ3|Q8WUG1	Silent	SNP	ENST00000269740.4	37	CCDS12093.1																																																																																			T|0.411;C|0.589	0.589	strong		0.736	SLC39A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451354.2		
CDH11	1009	hgsc.bcm.edu	37	16	65022114	65022114	+	Silent	SNP	C	C	T	rs28216	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr16:65022114C>T	ENST00000268603.4	-	7	1560	c.945G>A	c.(943-945)tcG>tcA	p.S315S	CDH11_ENST00000394156.3_Silent_p.S315S|CDH11_ENST00000566827.1_Silent_p.S189S	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	315	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TGATTTCAAACGATTCCATAC	0.443			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			C|||	1120	0.223642	0.0734	0.255	5008	,	,		19686	0.2054		0.4066	False		,,,				2504	0.2352				p.S315S		Atlas-SNP	.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	CDH11_ENST00000394156,NS,carcinoma,-1,2	CDH11	260	2	0			c.G945A						scavenged	.	C		530,3876	241.2+/-251.7	31,468,1704	368.0	309.0	329.0		945	5.7	1.0	16	dbSNP_76	329	3660,4940	527.1+/-381.1	774,2112,1414	no	coding-synonymous	CDH11	NM_001797.2		805,2580,3118	TT,TC,CC		42.5581,12.0291,32.2159		315/797	65022114	4190,8816	2203	4300	6503	SO:0001819	synonymous_variant	1009	exon7			TTCAAACGATTCC	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.945G>A	16.37:g.65022114C>T		Somatic	276	2	0.00724638		WXS	Illumina HiSeq	Phase_I	260	3	0.0115385	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	ENST00000268603.4	37	CCDS10803.1																																																																																			C|0.715;T|0.285	0.285	strong		0.443	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
NPY2R	4887	hgsc.bcm.edu	37	4	156135863	156135863	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:156135863C>T	ENST00000329476.3	+	2	1261	c.772C>T	c.(772-774)Cac>Tac	p.H258Y	NPY2R_ENST00000506608.1_Missense_Mutation_p.H258Y	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	258					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	TGCAAATGACCACTACCATCA	0.483																																					p.H258Y		Atlas-SNP	.											.	NPY2R	87	.	0			c.C772T						PASS	.						105.0	106.0	106.0					4																	156135863		2203	4300	6503	SO:0001583	missense	4887	exon2			AATGACCACTACC	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.772C>T	4.37:g.156135863C>T	ENSP00000332591:p.His258Tyr	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	96	41	0.427083	NM_000910	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	37	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077872	0.36662	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.37058	1.22;1.22	5.8	5.8	0.92144	GPCR, rhodopsin-like superfamily (1);	0.295033	0.37577	N	0.002031	T	0.34571	0.0902	L	0.39085	1.19	0.42996	D	0.994507	B	0.32939	0.391	B	0.34590	0.186	T	0.06197	-1.0840	10	0.36615	T	0.2	.	19.0326	0.92963	0.0:1.0:0.0:0.0	.	258	P49146	NPY2R_HUMAN	Y	258	ENSP00000332591:H258Y;ENSP00000426366:H258Y	ENSP00000332591:H258Y	H	+	1	0	NPY2R	156355313	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	2.361000	0.44160	2.742000	0.94016	0.643000	0.83706	CAC	.	.	none		0.483	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910	
SLC14A2	8170	hgsc.bcm.edu	37	18	43262359	43262359	+	Missense_Mutation	SNP	G	G	A	rs3745009	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr18:43262359G>A	ENST00000255226.6	+	20	3454	c.2638G>A	c.(2638-2640)Gcc>Acc	p.A880T	RP11-116O18.3_ENST00000589510.1_RNA|SLC14A2_ENST00000589658.1_Missense_Mutation_p.A357T|SLC14A2_ENST00000586448.1_Missense_Mutation_p.A880T	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	880			A -> T (in dbSNP:rs3745009). {ECO:0000269|PubMed:15489334}.		transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)	p.A880T(1)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CAATAACCCCGCCATCTACAA	0.527													G|||	2142	0.427716	0.4024	0.3761	5008	,	,		19225	0.3869		0.4404	False		,,,				2504	0.5276				p.A880T		Atlas-SNP	.											SLC14A2,NS,carcinoma,0,2	SLC14A2	121	2	1	Substitution - Missense(1)	prostate(1)	c.G2638A	GRCh37	CM013794	SLC14A2	M	rs3745009	scavenged	.	G	THR/ALA,THR/ALA	1720,2686	517.8+/-369.5	354,1012,837	271.0	262.0	265.0		2638,2638	5.1	1.0	18	dbSNP_107	265	3870,4730	544.3+/-384.6	862,2146,1292	yes	missense,missense	SLC14A2	NM_001242692.1,NM_007163.3	58,58	1216,3158,2129	AA,AG,GG		45.0,39.0377,42.9802	benign,benign	880/921,880/921	43262359	5590,7416	2203	4300	6503	SO:0001583	missense	8170	exon21			AACCCCGCCATCT	X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.2638G>A	18.37:g.43262359G>A	ENSP00000255226:p.Ala880Thr	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	234	4	0.017094	NM_001242692	A8K8Q7|Q2TBD6|Q96PH5	Missense_Mutation	SNP	ENST00000255226.6	37	CCDS11924.1	880	0.40293040293040294	196	0.3983739837398374	127	0.35082872928176795	223	0.38986013986013984	334	0.44063324538258575	G	15.21	2.766981	0.49574	0.390377	0.45	ENSG00000132874	ENST00000255226	T	0.51071	0.72	5.14	5.14	0.70334	.	0.110360	0.39687	N	0.001291	T	0.00012	0.0000	L	0.48877	1.53	0.09310	P	0.9999999999999103	B	0.16396	0.017	B	0.19148	0.024	T	0.43360	-0.9396	9	0.23302	T	0.38	-11.6177	18.2166	0.89887	0.0:0.0:1.0:0.0	rs3745009;rs52819242;rs58066525;rs3745009	880	Q15849	UT2_HUMAN	T	880	ENSP00000255226:A880T	ENSP00000255226:A880T	A	+	1	0	SLC14A2	41516357	0.978000	0.34361	0.967000	0.41034	0.993000	0.82548	1.970000	0.40520	2.390000	0.81377	0.561000	0.74099	GCC	G|0.573;A|0.427	0.427	strong		0.527	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1		
IGLL5	100423062	hgsc.bcm.edu	37	22	23230315	23230315	+	Silent	SNP	C	C	T	rs148489860	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:23230315C>T	ENST00000526893.1	+	1	356	c.82C>T	c.(82-84)Ctg>Ttg	p.L28L	IGLL5_ENST00000532223.2_Silent_p.L28L|IGLL5_ENST00000531372.1_Silent_p.L28L|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	28						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GCCCCTGCTGCTGCTGGGTCT	0.662													C|||	11	0.00219649	0.0045	0.0	5008	,	,		12566	0.003		0.001	False		,,,				2504	0.001				p.L28L		Atlas-SNP	.											.	IGLL5	26	.	0			c.C82T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			CTGCTGCTGCTGG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.82C>T	22.37:g.23230315C>T		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	140	60	0.428571	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			C|1.000;T|0.000	0.000	strong		0.662	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
CLVS1	157807	hgsc.bcm.edu	37	8	62289218	62289218	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:62289218C>T	ENST00000519846.1	+	4	982	c.510C>T	c.(508-510)atC>atT	p.I170I	CLVS1_ENST00000325897.4_Silent_p.I170I|CLVS1_ENST00000518592.1_5'UTR			Q8IUQ0	CLVS1_HUMAN	clavesin 1	170	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						AAGTCCTAATCGAAGATCCGG	0.438																																					p.I170I		Atlas-SNP	.											CLVS1,NS,carcinoma,+2,1	CLVS1	74	1	0			c.C510T						PASS	.						112.0	106.0	108.0					8																	62289218		2203	4300	6503	SO:0001819	synonymous_variant	157807	exon3			CCTAATCGAAGAT	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.510C>T	8.37:g.62289218C>T		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	89	32	0.359551	NM_173519	B2R7M5|C8UZT3|Q8NB32	Silent	SNP	ENST00000519846.1	37	CCDS6176.1																																																																																			.	.	none		0.438	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519	
ZNF799	90576	hgsc.bcm.edu	37	19	12501620	12501620	+	Missense_Mutation	SNP	G	G	T	rs370276871		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:12501620G>T	ENST00000430385.3	-	4	1792	c.1592C>A	c.(1591-1593)cCg>cAg	p.P531Q	CTD-3105H18.14_ENST00000435033.1_Intron|ZNF799_ENST00000419318.1_Missense_Mutation_p.P499Q	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						ACATTCATACGGCTTCTCTCC	0.393																																					p.P531Q		Atlas-SNP	.											ZNF799_ENST00000430385,NS,carcinoma,+1,2	ZNF799	111	2	0			c.C1592A						scavenged	.						84.0	86.0	85.0					19																	12501620		2197	4296	6493	SO:0001583	missense	90576	exon4			TCATACGGCTTCT	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1592C>A	19.37:g.12501620G>T	ENSP00000411084:p.Pro531Gln	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	127	2	0.015748	NM_001080821		Missense_Mutation	SNP	ENST00000430385.3	37	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.141289	0.37825	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.28454	1.61;1.61	1.31	0.225	0.15325	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53722	0.1814	M	0.85099	2.735	0.27211	N	0.959925	D	0.89917	1.0	D	0.87578	0.998	T	0.40997	-0.9533	9	0.87932	D	0	.	6.8533	0.24026	0.1719:0.0:0.8281:0.0	.	531	Q96GE5	ZN799_HUMAN	Q	499;531	ENSP00000415278:P499Q;ENSP00000411084:P531Q	ENSP00000415278:P499Q	P	-	2	0	ZNF799	12362620	0.215000	0.23574	0.004000	0.12327	0.023000	0.10783	0.888000	0.28268	0.116000	0.18110	-0.450000	0.05554	CCG	.	.	alt		0.393	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
DGKZ	8525	hgsc.bcm.edu	37	11	46388920	46388920	+	Missense_Mutation	SNP	C	C	T	rs375162900		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:46388920C>T	ENST00000454345.1	+	3	933	c.808C>T	c.(808-810)Cgg>Tgg	p.R270W	DGKZ_ENST00000421244.2_Missense_Mutation_p.R81W|DGKZ_ENST00000395574.3_Missense_Mutation_p.R47W|DGKZ_ENST00000525434.1_3'UTR|DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000532868.2_Missense_Mutation_p.R86W|DGKZ_ENST00000456247.2_Missense_Mutation_p.R81W|DGKZ_ENST00000527911.1_Missense_Mutation_p.R81W|DGKZ_ENST00000343674.6_Missense_Mutation_p.R98W|DGKZ_ENST00000528615.1_Intron|DGKZ_ENST00000318201.8_Missense_Mutation_p.R81W	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	270					blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CGAGTCAGAGCGGCAGATCCG	0.677																																					p.R270W		Atlas-SNP	.											DGKZ_ENST00000454345,right_upper_lobe,carcinoma,0,3	DGKZ	199	3	0			c.C808T						scavenged	.	C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4394		0,0,2197	32.0	34.0	33.0		808,241,241,241,241,292,256	-1.0	1.0	11		33	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense,missense,missense,missense,missense,missense	DGKZ	NM_001105540.1,NM_001199266.1,NM_001199267.1,NM_001199268.1,NM_003646.3,NM_201532.2,NM_201533.3	101,101,101,101,101,101,101	0,1,6494	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	270/1118,81/935,81/929,81/907,81/930,98/946,86/934	46388920	1,12989	2197	4298	6495	SO:0001583	missense	8525	exon3			TCAGAGCGGCAGA	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.808C>T	11.37:g.46388920C>T	ENSP00000412178:p.Arg270Trp	Somatic	228	1	0.00438596		WXS	Illumina HiSeq	Phase_I	241	4	0.0165975	NM_001105540	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	CCDS41640.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916105	0.73098	0.0	1.16E-4	ENSG00000149091	ENST00000343674;ENST00000395574;ENST00000532868;ENST00000527911;ENST00000456247;ENST00000421244;ENST00000318201;ENST00000454345	T;T;T;T;T;T;T;T	0.26660	2.17;2.4;2.53;3.38;2.2;2.27;2.4;1.72	5.04	-0.961	0.10337	.	0.746320	0.12845	N	0.434428	T	0.43322	0.1242	L	0.58810	1.83	0.33310	D	0.566017	D;D;D;D;D;D;D;D;D;D	0.89917	0.998;0.999;0.995;0.998;0.986;1.0;0.999;0.998;1.0;0.994	P;P;P;P;P;D;P;P;D;P	0.74674	0.677;0.836;0.654;0.676;0.733;0.921;0.827;0.676;0.984;0.822	T	0.57585	-0.7786	10	0.87932	D	0	.	12.2389	0.54532	0.5489:0.3618:0.0893:0.0	.	81;47;47;81;270;81;81;47;47;98	B7Z2M9;B7Z6M3;B7Z8F6;E9PPW4;Q13574;Q13574-2;G3V0F6;A8MVN1;Q6ZWA5;Q6ZVG7	.;.;.;.;DGKZ_HUMAN;.;.;.;.;.	W	98;47;47;81;81;81;81;270	ENSP00000343065:R98W;ENSP00000378941:R47W;ENSP00000436273:R47W;ENSP00000436291:R81W;ENSP00000395684:R81W;ENSP00000391021:R81W;ENSP00000320340:R81W;ENSP00000412178:R270W	ENSP00000320340:R81W	R	+	1	2	DGKZ	46345496	0.990000	0.36364	0.985000	0.45067	0.975000	0.68041	0.504000	0.22626	-0.040000	0.13580	-0.276000	0.10085	CGG	.	.	weak		0.677	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540	
SCN9A	6335	hgsc.bcm.edu	37	2	167094711	167094711	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:167094711T>C	ENST00000409435.1	-	19	3693	c.3694A>G	c.(3694-3696)Atc>Gtc	p.I1232V	SCN9A_ENST00000409672.1_Missense_Mutation_p.I1221V|SCN9A_ENST00000375387.4_Missense_Mutation_p.I1233V|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.I1233V			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1232					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TAAGTGAAGATCTTGTCTGCA	0.333																																					p.I1221V		Atlas-SNP	.											SCN9A,NS,carcinoma,+2,1	SCN9A	296	1	0			c.A3661G						scavenged	.						49.0	49.0	49.0					2																	167094711		2138	4283	6421	SO:0001583	missense	6335	exon20			TGAAGATCTTGTC	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.3694A>G	2.37:g.167094711T>C	ENSP00000386330:p.Ile1232Val	Somatic	293	0	0		WXS	Illumina HiSeq	Phase_I	244	3	0.0122951	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	T	3.059	-0.193687	0.06259	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.98192	-4.78;-4.78;-4.78;-4.78	5.25	4.08	0.47627	.	0.000000	0.64402	D	0.000003	D	0.89670	0.6782	N	0.01493	-0.835	0.35593	D	0.807252	B	0.13594	0.008	B	0.19666	0.026	D	0.86667	0.1908	10	0.02654	T	1	.	8.0533	0.30591	0.0:0.2192:0.0:0.7808	.	1221	E7EUN6	.	V	1221;1233;1233;1232	ENSP00000386306:I1221V;ENSP00000364536:I1233V;ENSP00000304748:I1233V;ENSP00000386330:I1232V	ENSP00000304748:I1233V	I	-	1	0	SCN9A	166802957	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.300000	0.51834	1.987000	0.57996	0.533000	0.62120	ATC	.	.	none		0.333	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
GTF2E1	2960	hgsc.bcm.edu	37	3	120500292	120500292	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:120500292G>A	ENST00000283875.5	+	5	1388	c.1295G>A	c.(1294-1296)cGc>cAc	p.R432H		NM_005513.2	NP_005504.2	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1, alpha 56kDa	432					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)	22				GBM - Glioblastoma multiforme(114;0.159)		ATGGGACAACGCATGTTTGAG	0.448																																					p.R432H		Atlas-SNP	.											GTF2E1,colon,carcinoma,0,3	GTF2E1	52	3	0			c.G1295A						scavenged	.						150.0	151.0	151.0					3																	120500292		2203	4300	6503	SO:0001583	missense	2960	exon5			GACAACGCATGTT	S67859	CCDS3002.1	3q21-q24	2010-03-23	2002-08-29		ENSG00000153767	ENSG00000153767		"""General transcription factors"""	4650	protein-coding gene	gene with protein product		189962	"""general transcription factor IIE, polypeptide 1 (alpha subunit, 56kD)"""			1454543, 8162052	Standard	NM_005513		Approved	TFIIE-A, FE	uc003edz.4	P29083	OTTHUMG00000159667	ENST00000283875.5:c.1295G>A	3.37:g.120500292G>A	ENSP00000283875:p.Arg432His	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	204	3	0.0147059	NM_005513	Q16103	Missense_Mutation	SNP	ENST00000283875.5	37	CCDS3002.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183499	0.78677	.	.	ENSG00000153767	ENST00000283875	T	0.44482	0.92	5.39	5.39	0.77823	.	0.214467	0.47852	D	0.000219	T	0.45013	0.1321	L	0.51422	1.61	0.43021	D	0.994571	D	0.63046	0.992	P	0.49192	0.602	T	0.43909	-0.9362	10	0.66056	D	0.02	-47.8026	11.6981	0.51554	0.0797:0.0:0.9203:0.0	.	432	P29083	T2EA_HUMAN	H	432	ENSP00000283875:R432H	ENSP00000283875:R432H	R	+	2	0	GTF2E1	121982982	1.000000	0.71417	0.976000	0.42696	0.996000	0.88848	5.969000	0.70422	2.814000	0.96858	0.650000	0.86243	CGC	.	.	none		0.448	GTF2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356770.1	NM_005513	
POTEE	445582	hgsc.bcm.edu	37	2	132021475	132021475	+	Missense_Mutation	SNP	G	G	A	rs11546936		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:132021475G>A	ENST00000356920.5	+	15	2541	c.2447G>A	c.(2446-2448)cGc>cAc	p.R816H	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	816	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											AAGGCCAACCGCGAGAAGATG	0.607																																					p.R816H		Atlas-SNP	.											ENSG00000188219,NS,carcinoma,+1,2	.	.	2	0			c.G2447A						scavenged	.						78.0	80.0	79.0					2																	132021475		2127	4190	6317	SO:0001583	missense	445582	exon15			CCAACCGCGAGAA	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2447G>A	2.37:g.132021475G>A	ENSP00000439189:p.Arg816His	Somatic	162	7	0.0432099		WXS	Illumina HiSeq	Phase_I	152	14	0.0921053	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	18.42	3.621132	0.66787	.	.	ENSG00000188219	ENST00000356920	D	0.97066	-4.23	.	.	.	Actin/actin-like conserved site (1);	.	.	.	.	D	0.98817	0.9601	H	0.99261	4.49	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.96667	0.9493	8	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	rs11546936	816	Q6S8J3	POTEE_HUMAN	H	816	ENSP00000439189:R816H	ENSP00000439189:R816H	R	+	2	0	AC131180.1	131737945	1.000000	0.71417	0.216000	0.23742	0.219000	0.24729	6.504000	0.73704	0.119000	0.18210	0.121000	0.15741	CGC	.	.	weak		0.607	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
GPX5	2880	hgsc.bcm.edu	37	6	28500106	28500106	+	Missense_Mutation	SNP	G	G	A	rs138279209		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:28500106G>A	ENST00000412168.2	+	4	457	c.368G>A	c.(367-369)cGt>cAt	p.R123H	GPX5_ENST00000442674.2_3'UTR|GPX5_ENST00000469384.1_Missense_Mutation_p.V84I	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	123					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	AGGTATGTCCGTCCAGGGGGA	0.423																																					p.R123H		Atlas-SNP	.											.	GPX5	42	.	0			c.G368A						PASS	.	G	HIS/ARG,ILE/VAL	0,4406		0,0,2203	139.0	126.0	130.0		368,250	4.2	1.0	6	dbSNP_134	130	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GPX5	NM_001509.2,NM_003996.3	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	123/222,84/101	28500106	1,13005	2203	4300	6503	SO:0001583	missense	2880	exon4			ATGTCCGTCCAGG	AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.368G>A	6.37:g.28500106G>A	ENSP00000392398:p.Arg123His	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	121	95	0.785124	NM_001509	A1A4Y0	Missense_Mutation	SNP	ENST00000412168.2	37	CCDS4652.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.91|17.91	3.503579|3.503579	0.64298|0.64298	0.0|0.0	1.16E-4|1.16E-4	ENSG00000224586|ENSG00000224586	ENST00000412168|ENST00000469384	T|T	0.04156|0.10192	3.69|2.9	4.16|4.16	4.16|4.16	0.48862|0.48862	Thioredoxin-like fold (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.03564|0.03564	0.0102|0.0102	.|.	.|.	.|.	0.22581|0.22581	N|N	0.998967|0.998967	D|P	0.89917|0.39847	1.0|0.691	D|B	0.80764|0.28465	0.994|0.09	T|T	0.26744|0.26744	-1.0094|-1.0094	9|8	0.87932|0.66056	D|D	0|0.02	-14.4515|-14.4515	14.7712|14.7712	0.69679|0.69679	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	123|84	O75715|A1A4Y0	GPX5_HUMAN|.	H|I	123|84	ENSP00000392398:R123H|ENSP00000419935:V84I	ENSP00000392398:R123H|ENSP00000419935:V84I	R|V	+|+	2|1	0|0	GPX5|GPX5	28608085|28608085	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.996000|0.996000	0.88848|0.88848	8.310000|8.310000	0.89971|0.89971	2.597000|2.597000	0.87782|0.87782	0.655000|0.655000	0.94253|0.94253	CGT|GTC	G|1.000;A|0.000	0.000	weak		0.423	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043672.2		
CACNA1G	8913	hgsc.bcm.edu	37	17	48684317	48684317	+	Silent	SNP	C	C	T	rs372261823		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:48684317C>T	ENST00000359106.5	+	24	4479	c.4479C>T	c.(4477-4479)taC>taT	p.Y1493Y	CACNA1G_ENST00000360761.4_Silent_p.Y1470Y|CACNA1G_ENST00000510366.1_Silent_p.Y1493Y|CACNA1G_ENST00000429973.2_Silent_p.Y1493Y|CACNA1G_ENST00000515165.1_Silent_p.Y1493Y|CACNA1G_ENST00000515765.1_Silent_p.Y1493Y|CACNA1G_ENST00000442258.2_Silent_p.Y1470Y|CACNA1G_ENST00000507609.1_Silent_p.Y1493Y|CACNA1G_ENST00000352832.5_Silent_p.Y1470Y|CACNA1G_ENST00000514079.1_Silent_p.Y1493Y|CACNA1G_ENST00000513689.2_Silent_p.Y1493Y|CACNA1G_ENST00000505165.1_Silent_p.Y1493Y|CACNA1G_ENST00000502264.1_Silent_p.Y1470Y|CACNA1G_ENST00000507336.1_Silent_p.Y1493Y|CACNA1G_ENST00000507510.2_Silent_p.Y1493Y|CACNA1G_ENST00000514181.1_Silent_p.Y1493Y|CACNA1G_ENST00000503485.1_Silent_p.Y1493Y|CACNA1G_ENST00000515411.1_Silent_p.Y1493Y|CACNA1G_ENST00000513964.1_Silent_p.Y1493Y|CACNA1G_ENST00000358244.5_Silent_p.Y1470Y|CACNA1G_ENST00000512389.1_Silent_p.Y1493Y|CACNA1G_ENST00000514717.1_Silent_p.Y1470Y|CACNA1G_ENST00000510115.1_Silent_p.Y1470Y|CACNA1G_ENST00000507896.1_Silent_p.Y1493Y|CACNA1G_ENST00000354983.4_Silent_p.Y1470Y	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1493					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	ACATCATGTACGATGGGCTGG	0.572																																					p.Y1493Y		Atlas-SNP	.											CACNA1G_ENST00000359106,NS,carcinoma,0,3	CACNA1G	659	3	0			c.C4479T						scavenged	.	C	,,,,,,,,,,,,,	0,4274		0,0,2137	132.0	126.0	128.0		4479,4410,4410,4479,4410,4479,4410,4410,4479,4479,4479,4410,4410,4410	-6.8	0.5	17		128	1,8459		0,1,4229	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CACNA1G	NM_018896.3,NM_198376.1,NM_198377.1,NM_198378.1,NM_198379.1,NM_198380.1,NM_198382.1,NM_198383.1,NM_198384.1,NM_198385.1,NM_198386.1,NM_198387.1,NM_198388.1,NM_198396.1	,,,,,,,,,,,,,	0,1,6366	TT,TC,CC		0.0118,0.0,0.0079	,,,,,,,,,,,,,	1493/2378,1470/2172,1470/2355,1493/2274,1470/2299,1493/2322,1470/2262,1470/2307,1493/2285,1493/2333,1493/2267,1470/2251,1470/2244,1470/2344	48684317	1,12733	2137	4230	6367	SO:0001819	synonymous_variant	8913	exon24			CATGTACGATGGG	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.4479C>T	17.37:g.48684317C>T		Somatic	150	1	0.00666667		WXS	Illumina HiSeq	Phase_I	168	3	0.0178571	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	ENST00000359106.5	37	CCDS45730.1																																																																																			.	.	weak		0.572	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
KALRN	8997	hgsc.bcm.edu	37	3	124415065	124415065	+	Silent	SNP	C	C	T	rs199791998		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:124415065C>T	ENST00000291478.5	+	21	2734	c.2571C>T	c.(2569-2571)caC>caT	p.H857H	KALRN_ENST00000360013.3_Silent_p.H2554H|AC080008.1_ENST00000584173.1_RNA|KALRN_ENST00000428018.2_Silent_p.H825H	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2553					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H857H(1)|p.H2554H(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CAAATGACCACGGGACCACAT	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		18520	0.0		0.001	False		,,,				2504	0.0				p.H2554H		Atlas-SNP	.											TRAD,colon,carcinoma,0,2	KALRN	556	2	2	Substitution - coding silent(2)	large_intestine(2)	c.C7662T						scavenged	.						127.0	122.0	124.0					3																	124415065		2203	4300	6503	SO:0001819	synonymous_variant	8997	exon54			TGACCACGGGACC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.2571C>T	3.37:g.124415065C>T		Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	151	3	0.0198676	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000291478.5	37	CCDS3028.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	6.502	0.460875	0.12342	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.71	-2.75	0.05914	.	.	.	.	.	T	0.47967	0.1474	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37934	-0.9684	4	.	.	.	.	5.434	0.16469	0.0896:0.3118:0.088:0.5106	.	.	.	.	M	2523	.	.	T	+	2	0	KALRN	125897755	0.000000	0.05858	0.783000	0.31826	0.890000	0.51754	-3.236000	0.00546	-0.637000	0.05516	-0.150000	0.13652	ACG	C|1.000;T|0.000	0.000	strong		0.413	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
TBP	6908	hgsc.bcm.edu	37	6	170871043	170871043	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:170871043G>A	ENST00000392092.2	+	3	498	c.219G>A	c.(217-219)caG>caA	p.Q73Q	TBP_ENST00000540980.1_Silent_p.Q53Q|TBP_ENST00000230354.6_Silent_p.Q73Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	73	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q73Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcaacagcaacagcagc	0.562																																					p.Q73Q		Atlas-SNP	.											TBP,NS,carcinoma,0,1	TBP	58	1	1	Substitution - coding silent(1)	endometrium(1)	c.G219A						scavenged	.						17.0	21.0	20.0					6																	170871043		1987	3877	5864	SO:0001819	synonymous_variant	6908	exon3			GCAACAGCAACAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.219G>A	6.37:g.170871043G>A		Somatic	49	2	0.0408163		WXS	Illumina HiSeq	Phase_I	41	2	0.0487805	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.	.	none		0.562	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
ZNF804A	91752	hgsc.bcm.edu	37	2	185463692	185463692	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:185463692G>A	ENST00000302277.6	+	1	600	c.6G>A	c.(4-6)gaG>gaA	p.E2E		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	2							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						gcCCCATGGAGTGTTACTACA	0.657																																					p.E2E		Atlas-SNP	.											.	ZNF804A	322	.	0			c.G6A						PASS	.						61.0	60.0	60.0					2																	185463692		2203	4300	6503	SO:0001819	synonymous_variant	91752	exon1			CATGGAGTGTTAC	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.6G>A	2.37:g.185463692G>A		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	45	19	0.422222	NM_194250	A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	37	CCDS2291.1																																																																																			.	.	none		0.657	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
BTG1	694	hgsc.bcm.edu	37	12	92539304	92539304	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:92539304G>C	ENST00000256015.3	-	1	369	c.8C>G	c.(7-9)cCc>cGc	p.P3R	C12orf79_ENST00000546975.1_5'Flank|C12orf79_ENST00000549802.1_5'Flank|C12orf79_ENST00000551563.2_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|RP11-796E2.4_ENST00000499685.2_RNA	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	3					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				GGTGTAGAAGGGATGCATggg	0.746			T	MYC	BCLL																																p.P3R		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	.	BTG1	30	.	0			c.C8G						PASS	.						25.0	29.0	28.0					12																	92539304		2199	4292	6491	SO:0001583	missense	694	exon1			TAGAAGGGATGCA		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.8C>G	12.37:g.92539304G>C	ENSP00000256015:p.Pro3Arg	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	83	39	0.46988	NM_001731	P31607	Missense_Mutation	SNP	ENST00000256015.3	37	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.465474	0.63513	.	.	ENSG00000133639	ENST00000256015	T	0.21361	2.01	3.71	3.71	0.42584	.	0.119071	0.56097	D	0.000026	T	0.15219	0.0367	L	0.29908	0.895	0.45718	D	0.998629	B	0.33694	0.421	B	0.24541	0.054	T	0.09707	-1.0662	10	0.51188	T	0.08	-4.5437	15.638	0.76970	0.0:0.0:1.0:0.0	.	3	P62324	BTG1_HUMAN	R	3	ENSP00000256015:P3R	ENSP00000256015:P3R	P	-	2	0	BTG1	91063435	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.824000	0.86668	1.883000	0.54544	0.455000	0.32223	CCC	.	.	none		0.746	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
ELN	2006	hgsc.bcm.edu	37	7	73474235	73474235	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr7:73474235C>T	ENST00000252034.7	+	23	1833	c.1434C>T	c.(1432-1434)ggC>ggT	p.G478G	ELN_ENST00000380584.4_Silent_p.G445G|ELN_ENST00000357036.5_Silent_p.G483G|ELN_ENST00000429192.1_Silent_p.G464G|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000358929.4_Silent_p.G513G|ELN_ENST00000320399.6_Silent_p.G478G|ELN_ENST00000380553.4_Silent_p.G342G|ELN_ENST00000380575.4_Silent_p.G449G|ELN_ENST00000380562.4_Silent_p.G484G|ELN_ENST00000380576.5_Silent_p.G459G|ELN_ENST00000414324.1_Silent_p.G454G|ELN_ENST00000320492.7_Silent_p.G397G|ELN_ENST00000458204.1_Silent_p.G468G|ELN_ENST00000445912.1_Silent_p.G478G	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CTGGTGTCGGCGTGGCTCCTG	0.572			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.G483G		Atlas-SNP	.		Dom	yes		7	7q11.23	2006	elastin	yes	L	ELN,NS,carcinoma,+2,2	ELN	81	2	0			c.C1449T						scavenged	.						247.0	236.0	239.0					7																	73474235		2203	4300	6503	SO:0001819	synonymous_variant	2006	exon23			TGTCGGCGTGGCT		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1434C>T	7.37:g.73474235C>T		Somatic	122	2	0.0163934		WXS	Illumina HiSeq	Phase_I	155	3	0.0193548	NM_001081754	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	ENST00000252034.7	37	CCDS5562.2																																																																																			.	.	none		0.572	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
CEMIP	57214	hgsc.bcm.edu	37	15	81201536	81201536	+	Silent	SNP	C	C	T	rs547252245		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:81201536C>T	ENST00000394685.3	+	14	2105	c.1686C>T	c.(1684-1686)gcC>gcT	p.A562A	KIAA1199_ENST00000356249.5_Silent_p.A562A|RP11-351M8.2_ENST00000560873.1_RNA|RP11-351M8.1_ENST00000560560.1_Intron|KIAA1199_ENST00000220244.3_Silent_p.A562A			Q8WUJ3	CEMIP_HUMAN		562	Necessary for its endoplasmic reticulum (ER) retention and interaction with HSPA5.			HFHLAGD -> TRPPTRP (in Ref. 6; CAB94391). {ECO:0000305}.	hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.A562A(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TCCACCTGGCCGGTGATGTAG	0.547													c|||	1	0.000199681	0.0008	0.0	5008	,	,		20278	0.0		0.0	False		,,,				2504	0.0				p.A562A		Atlas-SNP	.											KIAA1199,NS,lymphoid_neoplasm,0,1	KIAA1199	118	1	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1686T						scavenged	.						158.0	113.0	129.0					15																	81201536		2203	4300	6503	SO:0001819	synonymous_variant	57214	exon13			CCTGGCCGGTGAT																												ENST00000394685.3:c.1686C>T	15.37:g.81201536C>T		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	187	2	0.0106952	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	ENST00000394685.3	37	CCDS10315.1																																																																																			.	.	none		0.547	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
LPHN1	22859	hgsc.bcm.edu	37	19	14261777	14261777	+	Missense_Mutation	SNP	G	G	A	rs375528213		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:14261777G>A	ENST00000340736.6	-	24	4630	c.4333C>T	c.(4333-4335)Cgt>Tgt	p.R1445C	CTB-55O6.12_ENST00000588658.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.R1440C|CTB-55O6.12_ENST00000588387.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1445					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TGGCTAGGACGCCGCACCTGG	0.711																																					p.R1445C		Atlas-SNP	.											.	LPHN1	107	.	0			c.C4333T						PASS	.	G	CYS/ARG,CYS/ARG	0,4282		0,0,2141	9.0	10.0	10.0		4333,4318	0.2	1.0	19		10	1,8383		0,1,4191	no	missense,missense	LPHN1	NM_001008701.2,NM_014921.4	180,180	0,1,6332	AA,AG,GG		0.0119,0.0,0.0079	probably-damaging,probably-damaging	1445/1475,1440/1470	14261777	1,12665	2141	4192	6333	SO:0001583	missense	22859	exon24			TAGGACGCCGCAC	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.4333C>T	19.37:g.14261777G>A	ENSP00000340688:p.Arg1445Cys	Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	110	41	0.372727	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.806701	0.50421	0.0	1.19E-4	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.79454	-1.27;-1.27	3.94	0.249	0.15531	GPCR, family 2, latrophilin, C-terminal (1);	0.194324	0.31450	N	0.007633	D	0.82568	0.5065	M	0.65975	2.015	0.43913	D	0.996557	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.969	T	0.78700	-0.2102	10	0.87932	D	0	.	5.6925	0.17837	0.1007:0.0:0.5742:0.3251	.	1440;1445	O94910-2;O94910	.;LPHN1_HUMAN	C	1445;1440	ENSP00000340688:R1445C;ENSP00000355328:R1440C	ENSP00000340688:R1445C	R	-	1	0	LPHN1	14122777	0.997000	0.39634	0.996000	0.52242	0.857000	0.48899	0.527000	0.22987	-0.153000	0.11137	0.205000	0.17691	CGT	.	.	weak		0.711	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
ZNF223	7766	hgsc.bcm.edu	37	19	44571010	44571010	+	Silent	SNP	A	A	G	rs141349301		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:44571010A>G	ENST00000434772.3	+	5	1284	c.1029A>G	c.(1027-1029)ccA>ccG	p.P343P	ZNF223_ENST00000591793.1_Silent_p.P453P	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	343					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				GAGAGAAACCATATAATTGTA	0.438																																					p.P343P		Atlas-SNP	.											.	ZNF223	61	.	0			c.A1029G						PASS	.						102.0	106.0	105.0					19																	44571010		2203	4300	6503	SO:0001819	synonymous_variant	7766	exon5			GAAACCATATAAT	AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.1029A>G	19.37:g.44571010A>G		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	68	15	0.220588	NM_013361	Q15736|Q8TBJ3|Q9HCA9	Silent	SNP	ENST00000434772.3	37	CCDS12635.1																																																																																			A|1.000;T|0.000	.	alt		0.438	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460469.2		
SGK1	6446	hgsc.bcm.edu	37	6	134494230	134494230	+	Silent	SNP	C	C	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:134494230C>A	ENST00000237305.7	-	6	568	c.480G>T	c.(478-480)gtG>gtT	p.V160V	SGK1_ENST00000528577.1_Silent_p.V188V|SGK1_ENST00000413996.3_Silent_p.V174V|SGK1_ENST00000367857.5_Silent_p.V150V|SGK1_ENST00000367858.5_Silent_p.V255V|SGK1_ENST00000475719.2_Intron|SGK1_ENST00000489458.2_5'UTR	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	160	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		AGTGAAGGCCCACCAGGAAAG	0.443																																					p.V255V		Atlas-SNP	.											.	SGK1	387	.	0			c.G765T						PASS	.						96.0	96.0	96.0					6																	134494230		2203	4300	6503	SO:0001819	synonymous_variant	6446	exon8			AAGGCCCACCAGG	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.480G>T	6.37:g.134494230C>A		Somatic	188	0	0		WXS	Illumina HiSeq	Phase_I	212	28	0.132075	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Silent	SNP	ENST00000237305.7	37	CCDS5170.1																																																																																			.	.	none		0.443	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
FCAMR	83953	hgsc.bcm.edu	37	1	207140994	207140994	+	Silent	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:207140994T>C	ENST00000324852.4	-	2	516	c.42A>G	c.(40-42)gaA>gaG	p.E14E	FCAMR_ENST00000400962.3_Silent_p.E14E|FCAMR_ENST00000450945.2_Silent_p.E14E	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	315					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						TCCTCACCACTTCCTGTTTGC	0.428																																					p.E14E	Ovarian(199;1883 2142 16966 44409 45154)	Atlas-SNP	.											.	FCAMR	125	.	0			c.A42G						PASS	.						169.0	143.0	151.0					1																	207140994		1568	3582	5150	SO:0001819	synonymous_variant	83953	exon2			CACCACTTCCTGT	AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.42A>G	1.37:g.207140994T>C		Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	139	6	0.0431655	NM_001170631	Q32M82|Q8WWV5|Q96SA2	Silent	SNP	ENST00000324852.4	37	CCDS53468.1																																																																																			.	.	none		0.428	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088969.2	NM_032029	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230333	23230333	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:23230333G>A	ENST00000526893.1	+	1	374	c.100G>A	c.(100-102)Gtc>Atc	p.V34I	IGLL5_ENST00000532223.2_Missense_Mutation_p.V34I|IGLL5_ENST00000531372.1_Missense_Mutation_p.V34I|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	34						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						TCTGGCCATGGTCGCCCATGG	0.667																																					p.V34I		Atlas-SNP	.											.	IGLL5	26	.	0			c.G100A						PASS	.																																			SO:0001583	missense	100423062	exon1			GCCATGGTCGCCC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.100G>A	22.37:g.23230333G>A	ENSP00000431254:p.Val34Ile	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	126	50	0.396825	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	10.08	1.252980	0.22965	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00581	6.42;6.42	3.55	1.39	0.22231	.	.	.	.	.	T	0.00384	0.0012	N	0.19112	0.55	0.09310	N	1	B	0.34061	0.436	B	0.21708	0.036	T	0.45160	-0.9280	9	0.28530	T	0.3	.	4.2734	0.10797	0.121:0.0:0.654:0.225	.	34	B9A064	IGLL5_HUMAN	I	34	ENSP00000436353:V34I;ENSP00000431254:V34I	ENSP00000431254:V34I	V	+	1	0	IGLL5	21560333	0.005000	0.15991	0.001000	0.08648	0.001000	0.01503	0.741000	0.26202	0.464000	0.27142	-0.196000	0.12772	GTC	.	.	none		0.667	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
DNAH8	1769	hgsc.bcm.edu	37	6	38840382	38840382	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:38840382T>C	ENST00000359357.3	+	48	6664	c.6410T>C	c.(6409-6411)gTt>gCt	p.V2137A	DNAH8_ENST00000449981.2_Missense_Mutation_p.V2354A|DNAH8_ENST00000441566.1_Missense_Mutation_p.V2101A			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2137	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AAGACAACCGTTATCACGATT	0.428																																					p.V2354A		Atlas-SNP	.											DNAH8_ENST00000359357,NS,carcinoma,+1,2	DNAH8	1239	2	0			c.T7061C						scavenged	.						111.0	107.0	108.0					6																	38840382		2203	4300	6503	SO:0001583	missense	1769	exon50			CAACCGTTATCAC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.6410T>C	6.37:g.38840382T>C	ENSP00000352312:p.Val2137Ala	Somatic	76	2	0.0263158		WXS	Illumina HiSeq	Phase_I	52	2	0.0384615	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	T	10.88	1.475490	0.26511	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.57436	0.4;0.4;0.4	5.62	5.62	0.85841	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.284759	0.32719	N	0.005726	T	0.19446	0.0467	N	0.04387	-0.21	0.26201	N	0.979443	P	0.37466	0.596	B	0.40256	0.324	T	0.18209	-1.0344	10	0.31617	T	0.26	.	16.1067	0.81230	0.0:0.0:0.0:1.0	.	2137	Q96JB1	DYH8_HUMAN	A	2342;2342;2137;2101	ENSP00000333363:V2342A;ENSP00000352312:V2137A;ENSP00000402294:V2101A	ENSP00000333363:V2342A	V	+	2	0	DNAH8	38948360	0.048000	0.20356	0.547000	0.28179	0.018000	0.09664	0.859000	0.27858	2.255000	0.74692	0.533000	0.62120	GTT	.	.	none		0.428	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
PLCH2	9651	hgsc.bcm.edu	37	1	2429995	2429995	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:2429995C>T	ENST00000419816.2	+	17	2532	c.2258C>T	c.(2257-2259)cCc>cTc	p.P753L	PLCH2_ENST00000449969.1_Missense_Mutation_p.P726L|PLCH2_ENST00000378488.3_Missense_Mutation_p.P717L|PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000378486.3_Missense_Mutation_p.P753L			O75038	PLCH2_HUMAN	phospholipase C, eta 2	753	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		GACCCCCTGCCCGGGCAGCTC	0.692																																					p.P753L		Atlas-SNP	.											PLCH2_ENST00000378486,right_lower_lobe,carcinoma,-1,2	PLCH2	131	2	0			c.C2258T						scavenged	.						15.0	18.0	17.0					1																	2429995		1906	4108	6014	SO:0001583	missense	9651	exon17			CCCTGCCCGGGCA	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.2258C>T	1.37:g.2429995C>T	ENSP00000389803:p.Pro753Leu	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	121	4	0.0330578	NM_014638	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.567966|5.567966	0.96540|0.96540	.|.	.|.	ENSG00000149527|ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000343889;ENST00000278878|ENST00000419816	T;T;T|.	0.29142|.	1.79;1.76;1.58|.	4.84|4.84	4.84|4.84	0.62591|0.62591	C2 membrane targeting protein (1);PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);|.	0.054667|0.054667	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.77377|0.77377	0.4121|0.4121	M|M	0.78285|0.78285	2.405|2.405	0.80722|0.80722	D|D	1|1	P;D;B;P|.	0.54207|.	0.598;0.965;0.406;0.751|.	B;P;B;P|.	0.59643|.	0.325;0.861;0.125;0.473|.	T|T	0.81127|0.81127	-0.1074|-0.1074	10|7	0.66056|0.72032	D|D	0.02|0.01	.|.	16.9045|16.9045	0.86123|0.86123	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	600;505;726;753|.	B9DI81;B9DI82;O75038-2;O75038|.	.;.;.;PLCH2_HUMAN|.	L|S	726;753;717;600;505|48	ENSP00000397289:P726L;ENSP00000367747:P753L;ENSP00000367749:P717L|.	ENSP00000278878:P505L|ENSP00000389803:P48S	P|P	+|+	2|1	0|0	PLCH2|PLCH2	2419855|2419855	0.998000|0.998000	0.40836|0.40836	0.986000|0.986000	0.45419|0.45419	0.983000|0.983000	0.72400|0.72400	3.756000|3.756000	0.55205|0.55205	2.224000|2.224000	0.72417|0.72417	0.561000|0.561000	0.74099|0.74099	CCC|CCG	.	.	none		0.692	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
HIST1H1B	3009	hgsc.bcm.edu	37	6	27834991	27834991	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:27834991C>G	ENST00000331442.3	-	1	368	c.317G>C	c.(316-318)gGc>gCc	p.G106A		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	106	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						TTTAAAGGAGCCAGAAGCACC	0.602																																					p.G106A		Atlas-SNP	.											.	HIST1H1B	54	.	0			c.G317C						PASS	.						113.0	126.0	121.0					6																	27834991		2203	4300	6503	SO:0001583	missense	3009	exon1			AAGGAGCCAGAAG	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.317G>C	6.37:g.27834991C>G	ENSP00000330074:p.Gly106Ala	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	99	43	0.434343	NM_005322	Q14529|Q3MJ42	Missense_Mutation	SNP	ENST00000331442.3	37	CCDS4635.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578219	0.86645	.	.	ENSG00000184357	ENST00000331442	T	0.58060	0.36	5.3	4.42	0.53409	Histone H1/H5 (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.71576	0.3356	M	0.90977	3.165	0.80722	D	1	D	0.60575	0.988	D	0.67725	0.953	T	0.80647	-0.1289	10	0.87932	D	0	-16.951	15.3154	0.74074	0.0:0.8595:0.1405:0.0	.	106	P16401	H15_HUMAN	A	106	ENSP00000330074:G106A	ENSP00000330074:G106A	G	-	2	0	HIST1H1B	27942970	1.000000	0.71417	0.993000	0.49108	0.886000	0.51366	5.792000	0.69052	1.353000	0.45828	0.563000	0.77884	GGC	.	.	none		0.602	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322	
CYP4A11	1579	hgsc.bcm.edu	37	1	47395874	47395874	+	Missense_Mutation	SNP	A	A	C	rs148507594	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:47395874A>C	ENST00000310638.4	-	12	1504	c.1473T>G	c.(1471-1473)atT>atG	p.I491M	CYP4A11_ENST00000371904.4_Missense_Mutation_p.I492M|CYP4A11_ENST00000462347.1_Missense_Mutation_p.I393M	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	491					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)	p.I491M(1)		endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	CAAGTCGTGCAATGGGGATGG	0.562													N|||	7	0.00139776	0.0015	0.0	5008	,	,		21860	0.0		0.001	False		,,,				2504	0.0041				p.I491M		Atlas-SNP	.											CYP4A11,NS,carcinoma,0,1	CYP4A11	77	1	1	Substitution - Missense(1)	endometrium(1)	c.T1473G						scavenged	.						124.0	109.0	114.0					1																	47395874		2203	4300	6503	SO:0001583	missense	1579	exon12			TCGTGCAATGGGG	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.1473T>G	1.37:g.47395874A>C	ENSP00000311095:p.Ile491Met	Somatic	206	2	0.00970874		WXS	Illumina HiSeq	Phase_I	212	3	0.0141509	NM_000778	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	37	CCDS543.1	.	.	.	.	.	.	.	.	.	.	A	5.139	0.211298	0.09757	.	.	ENSG00000187048	ENST00000310638;ENST00000371904	T;T	0.70164	-0.46;-0.46	4.41	-8.82	0.00810	.	1.064920	0.07281	N	0.870735	T	0.37237	0.0996	N	0.17564	0.495	0.09310	N	1	B	0.09022	0.002	B	0.23018	0.043	T	0.24799	-1.0150	10	0.13108	T	0.6	.	2.0606	0.03591	0.2182:0.3451:0.2706:0.166	.	491	Q02928	CP4AB_HUMAN	M	491;492	ENSP00000311095:I491M;ENSP00000360971:I492M	ENSP00000311095:I491M	I	-	3	3	CYP4A11	47168461	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-2.724000	0.00809	-2.209000	0.00739	-1.524000	0.00929	ATT	.	.	weak		0.562	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778	
TRIOBP	11078	hgsc.bcm.edu	37	22	38120300	38120300	+	Silent	SNP	T	T	C	rs58793439		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:38120300T>C	ENST00000406386.3	+	7	1992	c.1737T>C	c.(1735-1737)tgT>tgC	p.C579C		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	579					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.C579C(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GAACATCCTGTGCCCAGCGGG	0.587																																					p.C579C		Atlas-SNP	.											TRIOBP_ENST00000344404,NS,carcinoma,0,1	TRIOBP	262	1	1	Substitution - coding silent(1)	prostate(1)	c.T1737C						scavenged	.						79.0	127.0	112.0					22																	38120300		1930	4159	6089	SO:0001819	synonymous_variant	11078	exon7			ATCCTGTGCCCAG	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1737T>C	22.37:g.38120300T>C		Somatic	302	6	0.0198676		WXS	Illumina HiSeq	Phase_I	373	19	0.0509383	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	CCDS43015.1																																																																																			T|0.500;C|0.500	0.500	weak		0.587	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
KRTAP10-11	386678	hgsc.bcm.edu	37	21	46067104	46067104	+	Silent	SNP	C	C	T	rs75548048	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:46067104C>T	ENST00000334670.8	+	1	774	c.729C>T	c.(727-729)ccC>ccT	p.P243P	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	243	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						TCTGCCACCCCGTGTGCAGGT	0.687													C|||	125	0.0249601	0.0915	0.0058	5008	,	,		20784	0.0		0.0	False		,,,				2504	0.0				p.P243P		Atlas-SNP	.											.	KRTAP10-11	36	.	0			c.C729T						PASS	.	C	,	313,4093	167.3+/-198.3	16,281,1906	94.0	104.0	101.0		,729	-0.6	0.7	21	dbSNP_131	101	1,8599		0,1,4299	no	intron,coding-synonymous	TSPEAR,KRTAP10-11	NM_144991.2,NM_198692.2	,	16,282,6205	TT,TC,CC		0.0116,7.1039,2.4143	,	,243/299	46067104	314,12692	2203	4300	6503	SO:0001819	synonymous_variant	386678	exon1			CCACCCCGTGTGC	AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.729C>T	21.37:g.46067104C>T		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	111	10	0.0900901	NM_198692	A2RRF9	Silent	SNP	ENST00000334670.8	37	CCDS42962.1																																																																																			C|0.980;T|0.020	0.020	strong		0.687	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128029.1	NM_198692	
LRRC32	2615	hgsc.bcm.edu	37	11	76371849	76371849	+	Missense_Mutation	SNP	G	G	A	rs201402758		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:76371849G>A	ENST00000407242.2	-	3	1030	c.788C>T	c.(787-789)gCg>gTg	p.A263V	AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000404995.1_Missense_Mutation_p.A263V|LRRC32_ENST00000260061.5_Missense_Mutation_p.A263V|LRRC32_ENST00000464145.1_Intron	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	263					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						TCTCGGGAGCGCGGCCAGGTC	0.632																																					p.A263V		Atlas-SNP	.											.	LRRC32	74	.	0			c.C788T						PASS	.						59.0	59.0	59.0					11																	76371849		2200	4292	6492	SO:0001583	missense	2615	exon3			GGGAGCGCGGCCA	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.788C>T	11.37:g.76371849G>A	ENSP00000384126:p.Ala263Val	Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	174	59	0.33908	NM_005512	Q86V06	Missense_Mutation	SNP	ENST00000407242.2	37	CCDS8245.1	.	.	.	.	.	.	.	.	.	.	G	1.050	-0.676017	0.03378	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.79653	-1.29;-1.29;-1.29	4.55	1.48	0.22813	.	0.688404	0.14657	N	0.306188	T	0.60792	0.2296	L	0.28274	0.84	0.09310	N	1	B	0.15719	0.014	B	0.04013	0.001	T	0.34129	-0.9841	10	0.16420	T	0.52	.	2.0366	0.03541	0.102:0.2514:0.3483:0.2982	.	263	Q14392	LRC32_HUMAN	V	263	ENSP00000260061:A263V;ENSP00000384126:A263V;ENSP00000385766:A263V	ENSP00000260061:A263V	A	-	2	0	LRRC32	76049497	0.000000	0.05858	0.133000	0.22050	0.150000	0.21749	0.012000	0.13287	1.116000	0.41820	0.555000	0.69702	GCG	.	.	weak		0.632	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512	
SYNE1	23345	hgsc.bcm.edu	37	6	152679666	152679666	+	Missense_Mutation	SNP	C	C	T	rs550088683		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:152679666C>T	ENST00000367255.5	-	66	11051	c.10450G>A	c.(10450-10452)Gta>Ata	p.V3484I	SYNE1_ENST00000265368.4_Missense_Mutation_p.V3484I|SYNE1_ENST00000423061.1_Missense_Mutation_p.V3491I|SYNE1_ENST00000341594.5_Missense_Mutation_p.V3455I|SYNE1_ENST00000448038.1_Missense_Mutation_p.V3491I	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3484					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GACTTGGTTACGGCTTCCTAT	0.363										HNSCC(10;0.0054)			C|||	1	0.000199681	0.0	0.0	5008	,	,		16527	0.0		0.0	False		,,,				2504	0.001				p.V3491I		Atlas-SNP	.											SYNE1_ENST00000423061,NS,carcinoma,0,3	SYNE1	3227	3	0			c.G10471A						scavenged	.						95.0	88.0	90.0					6																	152679666		2203	4300	6503	SO:0001583	missense	23345	exon66			TGGTTACGGCTTC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10450G>A	6.37:g.152679666C>T	ENSP00000356224:p.Val3484Ile	Somatic	135	1	0.00740741		WXS	Illumina HiSeq	Phase_I	127	39	0.307087	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	11.39	1.624999	0.28889	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.53423	0.72;1.37;0.62;1.37;0.64	5.35	3.57	0.40892	.	0.254853	0.27544	N	0.018893	T	0.20536	0.0494	L	0.52364	1.645	0.80722	D	1	B;B;B;B	0.26577	0.04;0.04;0.04;0.153	B;B;B;B	0.22152	0.017;0.017;0.017;0.038	T	0.04216	-1.0968	10	0.28530	T	0.3	.	7.9553	0.30038	0.0:0.6903:0.0:0.3097	.	3484;3484;3484;3491	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	I	3484;3491;3484;3491;3455	ENSP00000356224:V3484I;ENSP00000396024:V3491I;ENSP00000265368:V3484I;ENSP00000390975:V3491I;ENSP00000341887:V3455I	ENSP00000265368:V3484I	V	-	1	0	SYNE1	152721359	1.000000	0.71417	0.457000	0.27056	0.881000	0.50899	2.800000	0.47900	0.647000	0.30713	0.561000	0.74099	GTA	.	.	none		0.363	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
BNIPL	149428	hgsc.bcm.edu	37	1	151018347	151018347	+	Missense_Mutation	SNP	G	G	T	rs200161296		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:151018347G>T	ENST00000368931.3	+	8	1082	c.926G>T	c.(925-927)cGg>cTg	p.R309L	C1orf56_ENST00000368926.5_5'Flank|BNIPL_ENST00000295294.7_Missense_Mutation_p.R227L|BNIPL_ENST00000491386.1_3'UTR	NM_138278.3	NP_612122.2	Q7Z465	BNIPL_HUMAN	BCL2/adenovirus E1B 19kD interacting protein like	309	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|regulation of growth rate (GO:0040009)	cytosol (GO:0005829)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.R309Q(1)|p.R227Q(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(1)|lung(4)|skin(1)	10	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCACTGCTTCGGCCCTTCATC	0.443																																					p.R309L		Atlas-SNP	.											BNIPL_ENST00000368931,NS,carcinoma,0,2	BNIPL	45	2	2	Substitution - Missense(2)	endometrium(2)	c.G926T						scavenged	.						156.0	142.0	147.0					1																	151018347		2203	4300	6503	SO:0001583	missense	149428	exon8			TGCTTCGGCCCTT	AF193056	CCDS978.2, CCDS53362.1	1q21.2	2008-02-05			ENSG00000163141	ENSG00000163141			16976	protein-coding gene	gene with protein product		611275				12681488, 11741952	Standard	NM_138278		Approved	BNIPl-1, BNIPL-2, PP753	uc001ewl.2	Q7Z465	OTTHUMG00000035157	ENST00000368931.3:c.926G>T	1.37:g.151018347G>T	ENSP00000357927:p.Arg309Leu	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	137	3	0.0218978	NM_138278	Q6DK43|Q8TCY7|Q8WYG2	Missense_Mutation	SNP	ENST00000368931.3	37	CCDS978.2	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089564	0.55968	.	.	ENSG00000163141	ENST00000368931;ENST00000361277;ENST00000295294	T;T;T	0.25579	1.79;1.79;1.79	5.08	5.08	0.68730	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.134965	0.49916	D	0.000125	T	0.21921	0.0528	M	0.73962	2.25	0.47476	D	0.999439	B	0.21905	0.062	B	0.24006	0.05	T	0.05402	-1.0887	10	0.62326	D	0.03	.	16.0182	0.80460	0.0:0.0:1.0:0.0	.	309	Q7Z465	BNIPL_HUMAN	L	309;307;227	ENSP00000357927:R309L;ENSP00000355333:R307L;ENSP00000295294:R227L	ENSP00000295294:R227L	R	+	2	0	BNIPL	149284971	0.277000	0.24220	1.000000	0.80357	0.997000	0.91878	1.319000	0.33655	2.634000	0.89283	0.561000	0.74099	CGG	G|1.000;A|0.000	.	alt		0.443	BNIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085092.1	NM_138279	
PTCH1	5727	hgsc.bcm.edu	37	9	98241360	98241360	+	Silent	SNP	G	G	A	rs587780690		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:98241360G>A	ENST00000331920.6	-	8	1436	c.1137C>T	c.(1135-1137)taC>taT	p.Y379Y	PTCH1_ENST00000421141.1_Silent_p.Y228Y|PTCH1_ENST00000548379.1_5'Flank|PTCH1_ENST00000437951.1_Silent_p.Y313Y|PTCH1_ENST00000375274.2_Silent_p.Y378Y|PTCH1_ENST00000430669.2_Silent_p.Y313Y|PTCH1_ENST00000418258.1_Silent_p.Y228Y|PTCH1_ENST00000429896.2_Silent_p.Y228Y	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	379					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.Y379Y(3)|p.Y378Y(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AGACATACTCGTACCCCTTGA	0.542																																					p.Y379Y		Atlas-SNP	.											PTCH1_ENST00000430669,colon,carcinoma,-1,8	PTCH1	1850	8	4	Substitution - coding silent(4)	breast(3)|oesophagus(1)	c.C1137T						scavenged	.						208.0	152.0	171.0					9																	98241360		2203	4300	6503	SO:0001819	synonymous_variant	5727	exon8			ATACTCGTACCCC	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.1137C>T	9.37:g.98241360G>A		Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	153	4	0.0261438	NM_000264	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	37	CCDS6714.1																																																																																			.	.	none		0.542	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
C21orf2	755	hgsc.bcm.edu	37	21	45753031	45753031	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:45753031C>T	ENST00000339818.4	-	4	465	c.258G>A	c.(256-258)ctG>ctA	p.L86L	C21orf2_ENST00000397956.3_Silent_p.L86L|C21orf2_ENST00000325223.7_Silent_p.L86L|C21orf2_ENST00000496321.1_5'UTR|AP001062.7_ENST00000448927.1_RNA	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	O43822	CU002_HUMAN	chromosome 21 open reading frame 2	86					cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				endometrium(2)	2				Colorectal(79;0.0806)		GCAGACGCGGCAGCCCCTTCA	0.697																																					p.L86L		Atlas-SNP	.											.	C21orf2	10	.	0			c.G258A						PASS	.						18.0	20.0	20.0					21																	45753031		2201	4295	6496	SO:0001819	synonymous_variant	755	exon4			ACGCGGCAGCCCC	Y11392	CCDS13709.1, CCDS59444.1, CCDS59445.1	21q22.3	2014-03-24			ENSG00000160226	ENSG00000160226			1260	protein-coding gene	gene with protein product	"""nuclear encoded mitochondrial protein"", ""leucine rich repeat containing 76"""	603191				9465297	Standard	NM_004928		Approved	YF5, A2, LRRC76	uc002zeq.2	O43822	OTTHUMG00000086909	ENST00000339818.4:c.258G>A	21.37:g.45753031C>T		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	100	4	0.04	NM_004928	A8MPS9|O14993|Q8N5X6|Q99837|Q99838	Silent	SNP	ENST00000339818.4	37	CCDS13709.1																																																																																			.	.	none		0.697	C21orf2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195799.1	NM_004928	
MYO1D	4642	hgsc.bcm.edu	37	17	30932257	30932257	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:30932257C>A	ENST00000318217.5	-	21	3016	c.2712G>T	c.(2710-2712)ttG>ttT	p.L904F	MYO1D_ENST00000394649.4_Missense_Mutation_p.L816F|MYO1D_ENST00000579584.1_Missense_Mutation_p.L904F	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	904	Myosin tail. {ECO:0000255}.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			TCAGACCAGTCAACTGCAAAG	0.418																																					p.L904F		Atlas-SNP	.											.	MYO1D	93	.	0			c.G2712T						PASS	.						92.0	81.0	85.0					17																	30932257		2203	4300	6503	SO:0001583	missense	4642	exon21			ACCAGTCAACTGC	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.2712G>T	17.37:g.30932257C>A	ENSP00000324527:p.Leu904Phe	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	103	43	0.417476	NM_015194	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	37	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	C	12.32	1.903118	0.33628	.	.	ENSG00000176658	ENST00000318217;ENST00000394649	T	0.41400	1.0	4.94	3.92	0.45320	Myosin tail 2 (1);	0.000000	0.32503	U	0.006009	T	0.35537	0.0935	L	0.43923	1.385	0.80722	D	1	B;B	0.17852	0.014;0.024	B;B	0.19666	0.026;0.026	T	0.23511	-1.0186	10	0.87932	D	0	.	10.4809	0.44693	0.0:0.8966:0.0:0.1034	.	815;904	Q7Z3N6;O94832	.;MYO1D_HUMAN	F	904;96	ENSP00000324527:L904F	ENSP00000324527:L904F	L	-	3	2	MYO1D	27956370	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	1.952000	0.40343	1.124000	0.41980	-0.345000	0.07892	TTG	.	.	none		0.418	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1		
ZNF749	388567	hgsc.bcm.edu	37	19	57955884	57955884	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:57955884C>T	ENST00000334181.4	+	3	1618	c.1368C>T	c.(1366-1368)caC>caT	p.H456H	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	456					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H369H(1)|p.H456H(1)		breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		TAGTTCAGCACCAGAAAATCC	0.423																																					p.H456H		Atlas-SNP	.											ZNF749,NS,carcinoma,0,2	ZNF749	75	2	2	Substitution - coding silent(2)	endometrium(2)	c.C1368T						scavenged	.						93.0	89.0	91.0					19																	57955884		2203	4300	6503	SO:0001819	synonymous_variant	388567	exon3			TCAGCACCAGAAA	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.1368C>T	19.37:g.57955884C>T		Somatic	189	0	0		WXS	Illumina HiSeq	Phase_I	172	5	0.0290698	NM_001023561		Silent	SNP	ENST00000334181.4	37	CCDS33132.2																																																																																			.	.	none		0.423	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
NPSR1	387129	hgsc.bcm.edu	37	7	34917701	34917701	+	Missense_Mutation	SNP	C	C	T	rs370072027		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr7:34917701C>T	ENST00000359791.1	+	9	1167	c.1039C>T	c.(1039-1041)Cgt>Tgt	p.R347C	NPSR1_ENST00000531252.1_Missense_Mutation_p.R336C	NM_207173.1	NP_997056.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	127						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)	p.R347C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	CATCCGTCTCCGTCAGCTCCA	0.517																																					p.R347C		Atlas-SNP	.											NPSR1_ENST00000359791,caecum,carcinoma,0,1	NPSR1	134	1	1	Substitution - Missense(1)	large_intestine(1)	c.C1039T						scavenged	.	C	CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	54.0	45.0	48.0		1039	-4.4	0.0	7		48	0,8600		0,0,4300	no	missense	NPSR1	NM_207173.1	180	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		347/378	34917701	2,13004	2203	4300	6503	SO:0001583	missense	387129	exon9			CGTCTCCGTCAGC	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000359791.1:c.1039C>T	7.37:g.34917701C>T	ENSP00000352839:p.Arg347Cys	Somatic	229	0	0		WXS	Illumina HiSeq	Phase_I	209	3	0.0143541	NM_207173	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	ENST00000359791.1	37	CCDS5443.1	.	.	.	.	.	.	.	.	.	.	c	6.798	0.516333	0.12944	4.54E-4	0.0	ENSG00000187258	ENST00000359791;ENST00000531252	T;T	0.74106	-0.81;-0.43	2.39	-4.45	0.03546	.	.	.	.	.	T	0.46600	0.1401	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.19353	-1.0308	9	0.38643	T	0.18	.	3.8588	0.08986	0.0:0.2351:0.3846:0.3803	.	281;336;347	B7ZMA2;Q6W5P4-5;Q6W5P4-4	.;.;.	C	347;336	ENSP00000352839:R347C;ENSP00000433258:R336C	ENSP00000352839:R347C	R	+	1	0	NPSR1	34884226	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.980000	0.01492	-0.981000	0.03520	-0.192000	0.12808	CGT	.	.	weak		0.517	NPSR1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000216838.1	NM_207173	
PRKACA	5566	hgsc.bcm.edu	37	19	14204559	14204559	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:14204559G>A	ENST00000308677.4	-	9	1007	c.811C>T	c.(811-813)Cgg>Tgg	p.R271W	PRKACA_ENST00000350356.3_5'UTR|PRKACA_ENST00000590853.1_Intron|SAMD1_ENST00000541938.1_5'Flank|PRKACA_ENST00000589994.1_Missense_Mutation_p.R263W	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	271	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						AGGAGGTTCCGCAGCAGGTCC	0.547																																					p.R271W		Atlas-SNP	.											.	PRKACA	65	.	0			c.C811T						PASS	.						97.0	88.0	91.0					19																	14204559		2203	4300	6503	SO:0001583	missense	5566	exon9			GGTTCCGCAGCAG		CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.811C>T	19.37:g.14204559G>A	ENSP00000309591:p.Arg271Trp	Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	162	67	0.41358	NM_002730	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	ENST00000308677.4	37	CCDS12304.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850706	0.71719	.	.	ENSG00000072062	ENST00000308677;ENST00000350356;ENST00000535695	T	0.66815	-0.23	4.89	4.89	0.63831	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48286	D	0.000193	T	0.82190	0.4983	M	0.88906	2.99	0.42130	D	0.991466	D;D	0.67145	0.995;0.996	D;D	0.69307	0.963;0.918	D	0.85403	0.1132	10	0.87932	D	0	.	10.785	0.46401	0.0:0.0:0.8106:0.1894	.	271;263	P17612;P17612-2	KAPCA_HUMAN;.	W	271;263;271	ENSP00000309591:R271W	ENSP00000309591:R271W	R	-	1	2	PRKACA	14065559	0.994000	0.37717	1.000000	0.80357	0.989000	0.77384	2.068000	0.41471	2.271000	0.75665	0.491000	0.48974	CGG	.	.	none		0.547	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459004.1	NM_002730	
RTP2	344892	hgsc.bcm.edu	37	3	187416659	187416659	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:187416659G>A	ENST00000358241.1	-	2	733	c.305C>T	c.(304-306)gCg>gTg	p.A102V		NM_001004312.2	NP_001004312.2	Q5QGT7	RTP2_HUMAN	receptor (chemosensory) transporter protein 2	102					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)			large_intestine(3)|lung(14)|skin(1)	18	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		GTCCAGCCGCGCCGTGCCGCA	0.647																																					p.A102V		Atlas-SNP	.											RTP2,colon,carcinoma,+1,1	RTP2	38	1	0			c.C305T						scavenged	.						24.0	22.0	23.0					3																	187416659		2200	4273	6473	SO:0001583	missense	344892	exon2			AGCCGCGCCGTGC	AY562236	CCDS33911.1	3q27.3	2014-02-20	2006-11-21		ENSG00000198471	ENSG00000198471		"""Receptor transporter proteins"""	32486	protein-coding gene	gene with protein product	"""receptor transporting protein 2"", ""zinc finger, 3CxxC-type 2"""	609138	"""receptor transporter protein 2"""			16271481, 15550249, 16720576	Standard	NM_001004312		Approved	MGC78665, Z3CXXC2	uc003fro.1	Q5QGT7	OTTHUMG00000156458	ENST00000358241.1:c.305C>T	3.37:g.187416659G>A	ENSP00000350976:p.Ala102Val	Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	247	2	0.00809717	NM_001004312	Q6NVH4	Missense_Mutation	SNP	ENST00000358241.1	37	CCDS33911.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051447	0.55218	.	.	ENSG00000198471	ENST00000358241	T	0.23147	1.92	4.17	4.17	0.49024	.	0.286088	0.37857	N	0.001907	T	0.23688	0.0573	L	0.42245	1.32	0.26185	N	0.979661	P	0.42248	0.774	B	0.40901	0.343	T	0.14035	-1.0487	10	0.49607	T	0.09	-16.6618	12.2956	0.54844	0.0:0.0:1.0:0.0	.	102	Q5QGT7	RTP2_HUMAN	V	102	ENSP00000350976:A102V	ENSP00000350976:A102V	A	-	2	0	RTP2	188899353	0.420000	0.25457	0.999000	0.59377	0.346000	0.29079	2.897000	0.48664	2.621000	0.88768	0.563000	0.77884	GCG	.	.	none		0.647	RTP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344259.1	NM_001004312	
WSCD2	9671	hgsc.bcm.edu	37	12	108620920	108620920	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:108620920G>A	ENST00000332082.4	+	7	1776	c.958G>A	c.(958-960)Gtg>Atg	p.V320M	WSCD2_ENST00000549903.1_Missense_Mutation_p.V320M|WSCD2_ENST00000547525.1_Missense_Mutation_p.V320M|WSCD2_ENST00000261400.3_Missense_Mutation_p.V320M			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	320	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						TTACTTCATTGTGTACCAGAC	0.587																																					p.V320M		Atlas-SNP	.											.	WSCD2	125	.	0			c.G958A						PASS	.						59.0	63.0	61.0					12																	108620920		2041	4193	6234	SO:0001583	missense	9671	exon6			TTCATTGTGTACC		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.958G>A	12.37:g.108620920G>A	ENSP00000331933:p.Val320Met	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	102	17	0.166667	NM_014653	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.899521	0.72754	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.38401	1.14;4.62;1.14;4.62	5.22	5.22	0.72569	Carbohydrate-binding WSC (1);Carbohydrate-binding WSC, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.60599	0.2281	M	0.72894	2.215	0.80722	D	1	P;D	0.71674	0.587;0.998	B;D	0.78314	0.146;0.991	T	0.60692	-0.7213	10	0.52906	T	0.07	-25.5959	17.9638	0.89093	0.0:0.0:1.0:0.0	.	320;320	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	M	320	ENSP00000448047:V320M;ENSP00000261400:V320M;ENSP00000331933:V320M;ENSP00000447272:V320M	ENSP00000261400:V320M	V	+	1	0	WSCD2	107145050	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.078000	0.71282	2.725000	0.93324	0.655000	0.94253	GTG	.	.	none		0.587	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
MUC2	4583	hgsc.bcm.edu	37	11	1092890	1092890	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:1092890C>T	ENST00000441003.2	+	30	4736	c.4709C>T	c.(4708-4710)aCc>aTc	p.T1570I	MUC2_ENST00000359061.5_Missense_Mutation_p.T1571I|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCACGGTGaccccaacccca	0.637																																					p.T1570I		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,-1,2	MUC2	614	2	0			c.C4709T						scavenged	.						119.0	156.0	143.0					11																	1092890		1961	3652	5613	SO:0001583	missense	4583	exon30			CGGTGACCCCAAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4709C>T	11.37:g.1092890C>T	ENSP00000415183:p.Thr1570Ile	Somatic	79	5	0.0632911		WXS	Illumina HiSeq	Phase_I	96	7	0.0729167	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	1.561	-0.536608	0.04082	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15487	2.42;3.24	1.3	-2.33	0.06724	.	0.589600	0.12692	U	0.447130	T	0.07548	0.0190	.	.	.	0.09310	N	1	P	0.34699	0.464	B	0.21546	0.035	T	0.24799	-1.0150	9	0.38643	T	0.18	.	4.395	0.11358	0.3284:0.4793:0.1923:0.0	.	1570	E7EUV1	.	I	1570;1571	ENSP00000415183:T1570I;ENSP00000351956:T1571I	ENSP00000351956:T1571I	T	+	2	0	MUC2	1082890	0.002000	0.14202	0.000000	0.03702	0.033000	0.12548	0.404000	0.20999	-0.107000	0.12088	0.064000	0.15345	ACC	.	.	none		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MT-ND3	4537	hgsc.bcm.edu	37	M	10310	10310	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chrM:10310G>A	ENST00000361227.2	+	1	252	c.252G>A	c.(250-252)ctG>ctA	p.L84L	MT-ND4L_ENST00000361335.1_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TS1_ENST00000387416.2_RNA			P03897	NU3M_HUMAN	mitochondrially encoded NADH dehydrogenase 3	84					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)										ACAACTAACCTGCCACTAATA	0.383																																					p.L84L		Atlas-SNP	.											.	.	.	.	0			c.G252A						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			TAACCTGCCACTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198840	ENSG00000198840	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7458	protein-coding gene	gene with protein product	"""complex I ND3 subunit"", ""NADH-ubiquinone oxidoreductase chain 3"""	516002	"""NADH dehydrogenase 3"""	MTND3			Standard			Approved	ND3, NAD3		P03897		ENST00000361227.2:c.252G>A	M.37:g.10310G>A		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	ENST00000361227		Silent	SNP	ENST00000361227.2	37																																																																																				.	.	none		0.383	MT-ND3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024033	
MPDZ	8777	hgsc.bcm.edu	37	9	13138056	13138056	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:13138056T>C	ENST00000319217.7	-	29	4347	c.4100A>G	c.(4099-4101)aAc>aGc	p.N1367S	MPDZ_ENST00000546205.1_Missense_Mutation_p.N1381S|MPDZ_ENST00000381015.4_Missense_Mutation_p.N1367S|MPDZ_ENST00000447879.1_Missense_Mutation_p.N1334S|MPDZ_ENST00000536827.1_Missense_Mutation_p.N1334S|MPDZ_ENST00000538841.1_Missense_Mutation_p.N226S|MPDZ_ENST00000540202.1_5'UTR|MPDZ_ENST00000541093.1_5'Flank|MPDZ_ENST00000381022.2_Missense_Mutation_p.N1367S|MPDZ_ENST00000541718.1_Missense_Mutation_p.N1367S	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1367	PDZ 8. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TCGGTCTTTGTTCCCAGCAAG	0.458																																					p.N1367S		Atlas-SNP	.											MPDZ_ENST00000541718,colon,carcinoma,0,2	MPDZ	324	2	0			c.A4100G						scavenged	.						94.0	88.0	90.0					9																	13138056		1891	4136	6027	SO:0001583	missense	8777	exon29			TCTTTGTTCCCAG	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.4100A>G	9.37:g.13138056T>C	ENSP00000320006:p.Asn1367Ser	Somatic	206	0	0		WXS	Illumina HiSeq	Phase_I	195	4	0.0205128	NM_003829	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	T	29.2	4.986398	0.93044	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205;ENST00000433359	T;T;T;T;T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13	5.72	5.72	0.89469	.	0.000000	0.51477	D	0.000093	T	0.62925	0.2468	M	0.62088	1.915	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.986;0.995;1.0;0.998;1.0	D;D;D;D;D;D	0.91635	0.999;0.974;0.983;0.998;0.998;0.998	T	0.65360	-0.6187	10	0.66056	D	0.02	.	15.999	0.80275	0.0:0.0:0.0:1.0	.	1334;226;72;1334;1247;1367	B7ZMI4;B7ZB24;B4DGX5;O75970-3;E7EPZ1;O75970-2	.;.;.;.;.;.	S	1367;1367;1367;303;226;1334;1334;1367;1247;1381;189	ENSP00000320006:N1367S;ENSP00000439807:N1367S;ENSP00000370410:N1367S;ENSP00000444230:N303S;ENSP00000444717:N226S;ENSP00000444151:N1334S;ENSP00000415208:N1334S;ENSP00000370403:N1367S;ENSP00000446358:N1381S;ENSP00000389705:N189S	ENSP00000320006:N1367S	N	-	2	0	MPDZ	13128056	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.008000	0.88588	2.176000	0.68965	0.528000	0.53228	AAC	.	.	none		0.458	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
LAMA5	3911	hgsc.bcm.edu	37	20	60887468	60887468	+	Silent	SNP	G	G	A	rs16985970	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr20:60887468G>A	ENST00000252999.3	-	68	9414	c.9348C>T	c.(9346-9348)acC>acT	p.T3116T		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3116					angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCAGGTCGGCGGTGCAGCCGG	0.697													.|||	433	0.0864617	0.0204	0.0331	5008	,	,		15056	0.2054		0.0775	False		,,,				2504	0.1002				p.T3116T		Atlas-SNP	.											.	LAMA5	268	.	0			c.C9348T						PASS	.			104,4266		0,104,2081	26.0	26.0	26.0		9348	-8.5	0.0	20	dbSNP_123	26	681,7891		33,615,3638	no	coding-synonymous	LAMA5	NM_005560.3		33,719,5719	AA,AG,GG		7.9445,2.3799,6.0655		3116/3696	60887468	785,12157	2185	4286	6471	SO:0001819	synonymous_variant	3911	exon68			GTCGGCGGTGCAG	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.9348C>T	20.37:g.60887468G>A		Somatic	1	0	0		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	CCDS33502.1																																																																																			G|0.928;A|0.072	0.072	strong		0.697	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230364	23230364	+	Missense_Mutation	SNP	C	C	A	rs538723125	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:23230364C>A	ENST00000526893.1	+	1	405	c.131C>A	c.(130-132)gCa>gAa	p.A44E	IGLL5_ENST00000532223.2_Missense_Mutation_p.A44E|IGLL5_ENST00000531372.1_Missense_Mutation_p.A44E|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	44						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCAATGGTTGCACCGCAAAGC	0.682																																					p.A44E		Atlas-SNP	.											.	IGLL5	26	.	0			c.C131A						PASS	.																																			SO:0001583	missense	100423062	exon1			TGGTTGCACCGCA	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.131C>A	22.37:g.23230364C>A	ENSP00000431254:p.Ala44Glu	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	142	58	0.408451	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.592719	0.46214	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00686	5.85;5.86	3.92	-0.956	0.10353	.	.	.	.	.	T	0.00580	0.0019	L	0.29908	0.895	0.09310	N	1	P	0.44877	0.845	B	0.38655	0.278	T	0.48091	-0.9065	9	0.15952	T	0.53	.	4.4817	0.11771	0.0:0.4301:0.3576:0.2123	.	44	B9A064	IGLL5_HUMAN	E	44	ENSP00000436353:A44E;ENSP00000431254:A44E	ENSP00000431254:A44E	A	+	2	0	IGLL5	21560364	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.266000	0.18534	-0.052000	0.13311	0.643000	0.83706	GCA	.	.	none		0.682	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
DEK	7913	hgsc.bcm.edu	37	6	18249894	18249894	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:18249894T>G	ENST00000397239.3	-	7	1197	c.750A>C	c.(748-750)gaA>gaC	p.E250D	DEK_ENST00000244776.7_Missense_Mutation_p.E216D	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	250	Asp/Glu-rich (acidic).				chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			CCTCTTCACTTTCTTTATCTT	0.328			T	NUP214	AML																																p.E250D		Atlas-SNP	.		Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	DEK,NS,carcinoma,0,1	DEK	31	1	0			c.A750C						PASS	.						67.0	63.0	64.0					6																	18249894		2201	4298	6499	SO:0001583	missense	7913	exon7			TTCACTTTCTTTA	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.750A>C	6.37:g.18249894T>G	ENSP00000380414:p.Glu250Asp	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	89	33	0.370787	NM_003472	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	37	CCDS34344.1	.	.	.	.	.	.	.	.	.	.	T	15.14	2.745676	0.49151	.	.	ENSG00000124795	ENST00000397239;ENST00000244776;ENST00000507591	T;T	0.52754	0.68;0.65	6.17	3.8	0.43715	.	0.698644	0.14633	N	0.307696	T	0.21307	0.0513	L	0.44542	1.39	0.37002	D	0.895305	P;P	0.50443	0.935;0.935	B;B	0.42462	0.388;0.388	T	0.03945	-1.0990	10	0.14252	T	0.57	-0.8892	10.6274	0.45516	0.0:0.1285:0.0:0.8715	.	216;250	B4DN37;P35659	.;DEK_HUMAN	D	250;216;26	ENSP00000380414:E250D;ENSP00000244776:E216D	ENSP00000244776:E216D	E	-	3	2	DEK	18357873	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.118000	0.31246	0.572000	0.29383	-0.256000	0.11100	GAA	.	.	none		0.328	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039962.4		
CYP2A6	1548	hgsc.bcm.edu	37	19	41355765	41355765	+	Nonsense_Mutation	SNP	G	G	A	rs199545200		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:41355765G>A	ENST00000301141.5	-	2	321	c.301C>T	c.(301-303)Cga>Tga	p.R101*	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	101					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TGCTCGCCTCGCCCGCTGAAC	0.632													.|||	1	0.000199681	0.0	0.0	5008	,	,		18422	0.001		0.0	False		,,,				2504	0.0				p.R101X		Atlas-SNP	.											CYP2A6,brain,primitive_neuroectodermal_tumour-medulloblastoma,+1,1	CYP2A6	69	1	0			c.C301T	GRCh37	CM057912	CYP2A6	M		scavenged	.						68.0	65.0	66.0					19																	41355765		2203	4297	6500	SO:0001587	stop_gained	1548	exon2			CGCCTCGCCCGCT	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.301C>T	19.37:g.41355765G>A	ENSP00000301141:p.Arg101*	Somatic	306	4	0.0130719		WXS	Illumina HiSeq	Phase_I	344	5	0.0145349	NM_000762	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Nonsense_Mutation	SNP	ENST00000301141.5	37	CCDS12568.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	-	20.8	4.055138	0.75960	.	.	ENSG00000255974	ENST00000301141	.	.	.	2.72	1.61	0.23674	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0179	0.30391	0.0:0.0:0.396:0.604	.	.	.	.	X	101	.	ENSP00000301141:R101X	R	-	1	2	CYP2A6	46047605	0.004000	0.15560	0.122000	0.21767	0.368000	0.29767	-0.012000	0.12699	0.289000	0.22422	0.185000	0.17295	CGA	G|1.000;A|0.000	0.000	strong		0.632	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
LRP12	29967	hgsc.bcm.edu	37	8	105509255	105509255	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:105509255C>T	ENST00000276654.5	-	5	1633	c.1525G>A	c.(1525-1527)Gtc>Atc	p.V509I	LRP12_ENST00000518375.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.V490I	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	509					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AATGCTATGACGAGTAACAGG	0.463																																					p.V509I		Atlas-SNP	.											LRP12,NS,adenocarcinoma,0,1	LRP12	124	1	0			c.G1525A						scavenged	.						119.0	102.0	108.0					8																	105509255		2203	4300	6503	SO:0001583	missense	29967	exon5			CTATGACGAGTAA	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1525G>A	8.37:g.105509255C>T	ENSP00000276654:p.Val509Ile	Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	153	3	0.0196078	NM_013437	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	C	32	5.113913	0.94339	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000523007	D;D;D	0.94457	-2.11;-2.06;-3.43	5.79	5.79	0.91817	.	0.053779	0.64402	D	0.000001	D	0.94551	0.8245	M	0.71581	2.175	0.80722	D	1	P;P	0.49635	0.926;0.88	B;B	0.43225	0.412;0.234	D	0.94830	0.7995	10	0.66056	D	0.02	-18.8391	20.0498	0.97621	0.0:1.0:0.0:0.0	.	490;509	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	I	490;509;98	ENSP00000399148:V490I;ENSP00000276654:V509I;ENSP00000429305:V98I	ENSP00000276654:V509I	V	-	1	0	LRP12	105578431	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.818000	0.86416	2.753000	0.94483	0.557000	0.71058	GTC	.	.	none		0.463	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
RNF133	168433	hgsc.bcm.edu	37	7	122338692	122338692	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr7:122338692C>T	ENST00000340112.2	-	1	518	c.281G>A	c.(280-282)cGa>cAa	p.R94Q	CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000449022.2_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	94	PA.				protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						GTACTTTGATCGGCTGAAAAT	0.458																																					p.R94Q	Colon(198;1778 2057 7449 19869 45985)	Atlas-SNP	.											.	RNF133	41	.	0			c.G281A						PASS	.						157.0	168.0	164.0					7																	122338692		2203	4299	6502	SO:0001583	missense	168433	exon1			TTTGATCGGCTGA	AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.281G>A	7.37:g.122338692C>T	ENSP00000344489:p.Arg94Gln	Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	73	26	0.356164	NM_139175	A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	37	CCDS5784.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.656505	0.29425	.	.	ENSG00000188050	ENST00000340112	T	0.14516	2.5	5.79	-5.14	0.02875	.	1.811660	0.03352	N	0.196336	T	0.13200	0.0320	M	0.66939	2.045	0.09310	N	1	P	0.50943	0.94	B	0.43867	0.434	T	0.39820	-0.9595	10	0.14252	T	0.57	.	2.5082	0.04650	0.1832:0.2353:0.0878:0.4937	.	94	Q8WVZ7	RN133_HUMAN	Q	94	ENSP00000344489:R94Q	ENSP00000344489:R94Q	R	-	2	0	RNF133	122125928	0.000000	0.05858	0.000000	0.03702	0.956000	0.61745	-0.849000	0.04322	-1.082000	0.03101	0.655000	0.94253	CGA	.	.	none		0.458	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175	
GPR32	2854	hgsc.bcm.edu	37	19	51274851	51274851	+	Missense_Mutation	SNP	A	A	C	rs201404376		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:51274851A>C	ENST00000270590.4	+	1	1131	c.994A>C	c.(994-996)Act>Cct	p.T332P		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CCAGTCTTTGACTTCTGCCCT	0.552																																					p.T332P	Esophageal Squamous(113;152 1581 5732 15840 44398)	Atlas-SNP	.											GPR32,NS,carcinoma,0,5	GPR32	68	5	0			c.A994C						scavenged	.						66.0	71.0	69.0					19																	51274851		2203	4298	6501	SO:0001583	missense	2854	exon1			TCTTTGACTTCTG	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.994A>C	19.37:g.51274851A>C	ENSP00000270590:p.Thr332Pro	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	106	9	0.0849057	NM_001506	Q502U7|Q6NWS5	Missense_Mutation	SNP	ENST00000270590.4	37	CCDS12801.1	.	.	.	.	.	.	.	.	.	.	a	0.006	-2.066505	0.00382	.	.	ENSG00000142511	ENST00000270590	T	0.36699	1.24	2.71	-0.781	0.10965	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	9	0.02654	T	1	.	3.6506	0.08202	0.205:0.5623:0.0:0.2327	.	332	O75388	GPR32_HUMAN	P	332	ENSP00000270590:T332P	ENSP00000270590:T332P	T	+	1	0	GPR32	55966663	0.000000	0.05858	0.025000	0.17156	0.653000	0.38743	0.089000	0.15002	-0.262000	0.09392	-0.755000	0.03482	ACT	.	.	weak		0.552	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
TECRL	253017	hgsc.bcm.edu	37	4	65188493	65188493	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:65188493C>T	ENST00000381210.3	-	4	459	c.349G>A	c.(349-351)Gac>Aac	p.D117N	TECRL_ENST00000513125.1_5'Flank|TECRL_ENST00000507440.1_Missense_Mutation_p.D117N	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	117					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						GTAATGTAGTCCTTCAAAAAA	0.323																																					p.D117N		Atlas-SNP	.											.	TECRL	106	.	0			c.G349A						PASS	.						58.0	58.0	58.0					4																	65188493		2203	4300	6503	SO:0001583	missense	253017	exon4			TGTAGTCCTTCAA	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.349G>A	4.37:g.65188493C>T	ENSP00000370607:p.Asp117Asn	Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	98	4	0.0408163	NM_001010874		Missense_Mutation	SNP	ENST00000381210.3	37	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.005165	0.35415	.	.	ENSG00000205678	ENST00000507440;ENST00000381210;ENST00000509536	T;T;T	0.48522	0.81;0.81;0.81	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.68100	0.2964	M	0.73962	2.25	0.53005	D	0.999963	D;D	0.89917	1.0;0.993	D;D	0.87578	0.998;0.984	T	0.65861	-0.6065	10	0.37606	T	0.19	0.1933	15.4919	0.75611	0.0:1.0:0.0:0.0	.	117;117	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	N	117	ENSP00000426043:D117N;ENSP00000370607:D117N;ENSP00000422497:D117N	ENSP00000370607:D117N	D	-	1	0	TECRL	64871088	1.000000	0.71417	0.996000	0.52242	0.018000	0.09664	4.729000	0.62008	2.728000	0.93425	0.585000	0.79938	GAC	.	.	none		0.323	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874	
CADM2	253559	hgsc.bcm.edu	37	3	85932591	85932591	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:85932591T>G	ENST00000407528.2	+	3	424	c.362T>G	c.(361-363)cTg>cGg	p.L121R	CADM2_ENST00000405615.2_Missense_Mutation_p.L123R|CADM2_ENST00000383699.3_Missense_Mutation_p.L130R	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	121					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		CTCACCGTTCTGGGTAAGTGC	0.353																																					p.L130R		Atlas-SNP	.											.	CADM2	195	.	0			c.T389G						PASS	.						78.0	66.0	70.0					3																	85932591		2203	4300	6503	SO:0001583	missense	253559	exon4			CCGTTCTGGGTAA	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.362T>G	3.37:g.85932591T>G	ENSP00000384575:p.Leu121Arg	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	59	22	0.372881	NM_001167675	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.262776	0.59431	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.29142	1.58;1.58;1.58	5.54	5.54	0.83059	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.62889	0.2465	M	0.89414	3.03	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.995;0.997;0.998	T	0.70684	-0.4804	10	0.72032	D	0.01	.	15.9801	0.80102	0.0:0.0:0.0:1.0	.	123;130;121	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	R	130;121;123	ENSP00000373200:L130R;ENSP00000384575:L121R;ENSP00000384193:L123R	ENSP00000373200:L130R	L	+	2	0	CADM2	86015281	1.000000	0.71417	1.000000	0.80357	0.251000	0.25915	7.655000	0.83696	2.230000	0.72887	0.528000	0.53228	CTG	.	.	none		0.353	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	
HTR7	3363	hgsc.bcm.edu	37	10	92509323	92509323	+	Missense_Mutation	SNP	A	A	G	rs560218001		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:92509323A>G	ENST00000336152.3	-	2	594	c.568T>C	c.(568-570)Tac>Cac	p.Y190H	HTR7_ENST00000371721.3_Missense_Mutation_p.Y190H|HTR7_ENST00000277874.6_Missense_Mutation_p.Y190H|HTR7_ENST00000371719.2_Missense_Mutation_p.Y190H	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	190					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	CTCACAGGGTATGTGAGGGGC	0.517																																					p.Y190H		Atlas-SNP	.											.	HTR7	122	.	0			c.T568C						PASS	.						104.0	106.0	106.0					10																	92509323		2203	4300	6503	SO:0001583	missense	3363	exon2			CAGGGTATGTGAG	BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.568T>C	10.37:g.92509323A>G	ENSP00000337949:p.Tyr190His	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	87	4	0.045977	NM_019860	B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Missense_Mutation	SNP	ENST00000336152.3	37	CCDS7408.1	.	.	.	.	.	.	.	.	.	.	A	18.25	3.581537	0.65992	.	.	ENSG00000148680	ENST00000336152;ENST00000277874;ENST00000371719;ENST00000371721	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61540	0.2355	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68119	-0.5493	10	0.62326	D	0.03	.	15.6519	0.77104	1.0:0.0:0.0:0.0	.	190;190	P34969;P34969-2	5HT7R_HUMAN;.	H	190	ENSP00000337949:Y190H;ENSP00000277874:Y190H;ENSP00000360784:Y190H;ENSP00000360786:Y190H	ENSP00000277874:Y190H	Y	-	1	0	HTR7	92499303	1.000000	0.71417	0.969000	0.41365	0.409000	0.31022	9.139000	0.94554	2.285000	0.76669	0.528000	0.53228	TAC	.	.	none		0.517	HTR7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049343.1	NM_000872	
MYO18B	84700	hgsc.bcm.edu	37	22	26165124	26165124	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:26165124A>G	ENST00000407587.2	+	4	1410	c.1241A>G	c.(1240-1242)aAg>aGg	p.K414R	MYO18B_ENST00000536101.1_Missense_Mutation_p.K414R|MYO18B_ENST00000335473.7_Missense_Mutation_p.K414R			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	414						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.K414M(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CAGACAGAGAAGGGCTGTGAA	0.607																																					p.K414R		Atlas-SNP	.											MYO18B,NS,carcinoma,0,1	MYO18B	322	1	1	Substitution - Missense(1)	lung(1)	c.A1241G						scavenged	.						29.0	36.0	34.0					22																	26165124		2162	4264	6426	SO:0001583	missense	84700	exon4			CAGAGAAGGGCTG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.1241A>G	22.37:g.26165124A>G	ENSP00000386096:p.Lys414Arg	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	86	2	0.0232558	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	A	14.50	2.553587	0.45487	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.87571	-2.25;-2.25;-2.27	4.73	3.67	0.42095	.	.	.	.	.	D	0.83529	0.5274	L	0.57536	1.79	0.09310	N	1	B;B;B	0.17268	0.012;0.021;0.021	B;B;B	0.21917	0.016;0.037;0.037	T	0.73867	-0.3847	9	0.52906	T	0.07	.	6.6611	0.23014	0.6894:0.1583:0.0:0.1523	.	414;414;414	Q8IUG5;F5GXR6;F5GYU7	MY18B_HUMAN;.;.	R	414	ENSP00000441229:K414R;ENSP00000334563:K414R;ENSP00000386096:K414R	ENSP00000334563:K414R	K	+	2	0	MYO18B	24495124	0.033000	0.19621	0.001000	0.08648	0.039000	0.13416	1.479000	0.35453	0.727000	0.32360	0.402000	0.26972	AAG	.	.	none		0.607	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
ITSN1	6453	hgsc.bcm.edu	37	21	35190669	35190669	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:35190669C>T	ENST00000381318.3	+	23	3114	c.2826C>T	c.(2824-2826)gtC>gtT	p.V942V	ITSN1_ENST00000399355.2_Silent_p.V942V|ITSN1_ENST00000381291.4_Silent_p.V942V|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399353.1_Silent_p.V900V|ITSN1_ENST00000399349.1_Silent_p.V937V|ITSN1_ENST00000399352.1_Silent_p.V937V|ITSN1_ENST00000379960.5_Intron|ITSN1_ENST00000399326.3_Silent_p.V937V|ITSN1_ENST00000399367.3_Silent_p.V937V|ITSN1_ENST00000381285.4_Silent_p.V942V|ITSN1_ENST00000437442.2_Silent_p.V937V	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	942	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						TCATCACCGTCCTGGAACAGC	0.453																																					p.V942V		Atlas-SNP	.											.	ITSN1	166	.	0			c.C2826T						PASS	.						176.0	169.0	171.0					21																	35190669		2203	4300	6503	SO:0001819	synonymous_variant	6453	exon23			CACCGTCCTGGAA	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.2826C>T	21.37:g.35190669C>T		Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	142	60	0.422535	NM_001001132	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Silent	SNP	ENST00000381318.3	37	CCDS33545.1																																																																																			.	.	none		0.453	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
MYOF	26509	hgsc.bcm.edu	37	10	95089487	95089487	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:95089487A>G	ENST00000359263.4	-	44	4915	c.4916T>C	c.(4915-4917)aTt>aCt	p.I1639T	MYOF_ENST00000358334.5_Missense_Mutation_p.I1626T|MYOF_ENST00000371501.4_Missense_Mutation_p.I1639T|MYOF_ENST00000485212.1_5'UTR|MYOF_ENST00000371502.4_Missense_Mutation_p.I1658T	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1639					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TTCCAGATCAATAATTGTTTC	0.433																																					p.I1639T		Atlas-SNP	.											.	MYOF	177	.	0			c.T4916C						PASS	.						127.0	123.0	124.0					10																	95089487		1858	4102	5960	SO:0001583	missense	26509	exon44			AGATCAATAATTG	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4916T>C	10.37:g.95089487A>G	ENSP00000352208:p.Ile1639Thr	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	143	63	0.440559	NM_013451	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.166718	0.78339	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.3	5.3	0.74995	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.097327	0.64402	D	0.000002	T	0.74183	0.3683	M	0.92923	3.36	0.80722	D	1	D;P	0.57571	0.98;0.954	D;P	0.63957	0.92;0.701	T	0.81597	-0.0860	10	0.87932	D	0	-7.8203	15.4031	0.74858	1.0:0.0:0.0:0.0	.	1626;1639	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	T	1626;1639;1639;1658	ENSP00000351094:I1626T;ENSP00000352208:I1639T;ENSP00000360556:I1639T;ENSP00000360557:I1658T	ENSP00000351094:I1626T	I	-	2	0	MYOF	95079477	1.000000	0.71417	0.794000	0.32065	0.854000	0.48673	8.723000	0.91458	2.232000	0.73038	0.454000	0.30748	ATT	.	.	none		0.433	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
PARD6G	84552	hgsc.bcm.edu	37	18	77960661	77960661	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr18:77960661T>C	ENST00000353265.3	-	2	424	c.227A>G	c.(226-228)aAt>aGt	p.N76S	AC139100.3_ENST00000588950.1_RNA|PARD6G_ENST00000470488.2_Missense_Mutation_p.N76S	NM_032510.3	NP_115899.1	Q9BYG4	PAR6G_HUMAN	par-6 family cell polarity regulator gamma	76	OPR.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	8		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)		GTTGTCATCATTGTTGATGGG	0.498																																					p.N76S		Atlas-SNP	.											.	PARD6G	20	.	0			c.A227G						PASS	.						108.0	100.0	103.0					18																	77960661		2203	4300	6503	SO:0001583	missense	84552	exon2			TCATCATTGTTGA		CCDS12022.1	18q23	2013-08-28	2013-08-28		ENSG00000178184	ENSG00000178184			16076	protein-coding gene	gene with protein product		608976	"""par-6 (partitioning defective 6, C.elegans) homolog gamma"", ""par-6 partitioning defective 6 homolog gamma (C. elegans)"""			11260256	Standard	NM_032510		Approved	PAR-6G, PAR6gamma	uc002lny.3	Q9BYG4	OTTHUMG00000132922	ENST00000353265.3:c.227A>G	18.37:g.77960661T>C	ENSP00000343144:p.Asn76Ser	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	91	42	0.461538	NM_032510	A8QM57	Missense_Mutation	SNP	ENST00000353265.3	37	CCDS12022.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.311065	0.81358	.	.	ENSG00000178184	ENST00000353265	T	0.16324	2.35	5.43	5.43	0.79202	Phox/Bem1p (2);	0.000000	0.85682	D	0.000000	T	0.46464	0.1394	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	0.992;1.0	P;D	0.91635	0.829;0.999	T	0.50355	-0.8838	9	.	.	.	-32.4304	14.5927	0.68378	0.0:0.0:0.0:1.0	.	76;76	A8QM57;Q9BYG4	.;PAR6G_HUMAN	S	76	ENSP00000343144:N76S	.	N	-	2	0	PARD6G	76061652	1.000000	0.71417	0.931000	0.37212	0.850000	0.48378	6.824000	0.75288	2.282000	0.76494	0.533000	0.62120	AAT	.	.	none		0.498	PARD6G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256435.2	NM_032510	
AHNAK2	113146	hgsc.bcm.edu	37	14	105411852	105411852	+	Silent	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr14:105411852T>C	ENST00000333244.5	-	7	10055	c.9936A>G	c.(9934-9936)aaA>aaG	p.K3312K	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3312						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCATCTTGAATTTGGGCATTT	0.622																																					p.K3312K		Atlas-SNP	.											AHNAK2_ENST00000333244,NS,carcinoma,-1,1	AHNAK2	719	1	0			c.A9936G						scavenged	.						205.0	199.0	201.0					14																	105411852		2003	4164	6167	SO:0001819	synonymous_variant	113146	exon7			CTTGAATTTGGGC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9936A>G	14.37:g.105411852T>C		Somatic	196	1	0.00510204		WXS	Illumina HiSeq	Phase_I	222	5	0.0225225	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.	.	none		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
HLA-DRB5	3127	hgsc.bcm.edu	37	6	32487265	32487265	+	Missense_Mutation	SNP	C	C	G	rs139485758	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:32487265C>G	ENST00000374975.3	-	3	596	c.534G>C	c.(532-534)caG>caC	p.Q178H		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5									p.Q178H(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						AGTCTCCATTCTGAATCAGGC	0.552													C|||	836	0.166933	0.2224	0.1326	5008	,	,		15097	0.1667		0.1531	False		,,,				2504	0.1309				p.Q178H		Atlas-SNP	.											HLA-DRB5,NS,NS,0,1	HLA-DRB5	31	1	1	Substitution - Missense(1)	NS(1)	c.G534C						scavenged	.						61.0	68.0	65.0					6																	32487265		1933	3889	5822	SO:0001583	missense	3127	exon3			TCCATTCTGAATC		CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.534G>C	6.37:g.32487265C>G	ENSP00000364114:p.Gln178His	Somatic	104	5	0.0480769		WXS	Illumina HiSeq	Phase_I	47	24	0.510638	NM_002125		Missense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	.	.	.	.	.	.	.	.	.	.	.	2.451	-0.326294	0.05350	.	.	ENSG00000198502	ENST00000374975	T	0.14391	2.51	4.6	-9.19	0.00685	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	1.115120	0.06656	N	0.763651	T	0.02193	0.0068	L	0.35487	1.065	0.80722	P	0.0	B;B	0.19445	0.036;0.003	B;B	0.33690	0.168;0.014	T	0.35871	-0.9771	9	0.35671	T	0.21	.	1.7649	0.03000	0.2235:0.402:0.1926:0.1818	.	105;178	Q29973;Q30154	.;DRB5_HUMAN	H	178	ENSP00000364114:Q178H	ENSP00000364114:Q178H	Q	-	3	2	HLA-DRB5	32595243	0.000000	0.05858	0.000000	0.03702	0.495000	0.33615	-4.437000	0.00234	-3.808000	0.00104	-0.273000	0.10243	CAG	A|0.003;C|0.930;G|0.067	0.067	strong		0.552	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
DENND4B	9909	hgsc.bcm.edu	37	1	153907303	153907303	+	Silent	SNP	C	C	T	rs557071025	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:153907303C>T	ENST00000361217.4	-	18	3124	c.2706G>A	c.(2704-2706)caG>caA	p.Q902Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	902	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgttgctgct	0.642																																					p.Q902Q		Atlas-SNP	.											DENND4B_ENST00000361217,bladder,carcinoma,0,2	DENND4B	210	2	0			c.G2706A						scavenged	.						30.0	39.0	36.0					1																	153907303		2184	4281	6465	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGTTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2706G>A	1.37:g.153907303C>T		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	83	2	0.0240964	NM_014856	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																			.	.	none		0.642	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
MUC4	4585	hgsc.bcm.edu	37	3	195506555	195506555	+	Missense_Mutation	SNP	C	C	T	rs368695884	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:195506555C>T	ENST00000463781.3	-	2	12355	c.11896G>A	c.(11896-11898)Gcc>Acc	p.A3966T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3966T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A3966T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGAGGTGGCGTGACCTGTG	0.592													.|||	176	0.0351438	0.0083	0.0677	5008	,	,		7977	0.0119		0.0915	False		,,,				2504	0.0143				p.A3966T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	c.G11896A						scavenged	.						15.0	10.0	11.0					3																	195506555		666	1488	2154	SO:0001583	missense	4585	exon2			AGGTGGCGTGACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11896G>A	3.37:g.195506555C>T	ENSP00000417498:p.Ala3966Thr	Somatic	31	1	0.0322581		WXS	Illumina HiSeq	Phase_I	33	6	0.181818	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.905	-0.721125	0.03182	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.48522	1.23;0.81	.	.	.	.	.	.	.	.	T	0.22551	0.0544	N	0.19112	0.55	0.09310	N	1	B	0.18741	0.03	B	0.06405	0.002	T	0.12915	-1.0529	7	.	.	.	-3.1782	2.1866	0.03888	0.0:0.3341:0.3337:0.3322	.	3838	E7ESK3	.	T	3966	ENSP00000417498:A3966T;ENSP00000420243:A3966T	.	A	-	1	0	MUC4	196991334	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.202000	0.09451	-2.037000	0.00920	-2.088000	0.00374	GCC	.	.	weak		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CEP170B	283638	hgsc.bcm.edu	37	14	105354293	105354293	+	Silent	SNP	A	A	G	rs2582548	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr14:105354293A>G	ENST00000414716.3	+	12	3945	c.3717A>G	c.(3715-3717)tcA>tcG	p.S1239S	CEP170B_ENST00000418279.1_Silent_p.S1169S|CEP170B_ENST00000453495.1_Silent_p.S1240S|CEP170B_ENST00000556508.1_Silent_p.S1169S	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	1239						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.S1170S(1)|p.S1169S(1)|p.S1239S(1)									GGGCCCGCTCAGGCAGTGCCC	0.682													g|||	2823	0.563698	0.5454	0.6527	5008	,	,		15507	0.2272		0.7753	False		,,,				2504	0.6544				p.S1239S		Atlas-SNP	.											KIAA0284_ENST00000414716,NS,carcinoma,0,2	.	.	2	3	Substitution - coding silent(3)	prostate(3)	c.A3717G						PASS	.		,	2278,1490		703,872,309	4.0	5.0	4.0		3717,3507	-2.0	0.9	14	dbSNP_100	4	6255,1709		2492,1271,219	no	coding-synonymous,coding-synonymous	KIAA0284	NM_001112726.2,NM_015005.2	,	3195,2143,528	GG,GA,AA		21.4591,39.5435,27.2673	,	1239/1555,1169/1520	105354293	8533,3199	1884	3982	5866	SO:0001819	synonymous_variant	283638	exon12			CCGCTCAGGCAGT	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.3717A>G	14.37:g.105354293A>G		Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	11	6	0.545455	NM_001112726	Q2KHR7|Q86TI7	Silent	SNP	ENST00000414716.3	37	CCDS45175.1																																																																																			A|0.444;G|0.556	0.556	strong		0.682	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
LCP2	3937	hgsc.bcm.edu	37	5	169695446	169695446	+	Silent	SNP	C	C	T	rs2292254	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr5:169695446C>T	ENST00000046794.5	-	8	1179	c.564G>A	c.(562-564)gtG>gtA	p.V188V	LCP2_ENST00000521416.1_5'Flank	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	188					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		TCTGGGGGGGCACAGGAGGCT	0.627											OREG0017023	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2279	0.455072	0.2927	0.4856	5008	,	,		6718	0.6538		0.4245	False		,,,				2504	0.4796				p.V188V		Atlas-SNP	.											LCP2_ENST00000046794,NS,carcinoma,0,2	LCP2	133	2	0			c.G564A						scavenged	.	C		775,2241		158,459,891	2.0	3.0	2.0		564	3.3	0.8	5	dbSNP_100	2	2547,4561		602,1343,1609	no	coding-synonymous	LCP2	NM_005565.3		760,1802,2500	TT,TC,CC		35.8329,25.6963,32.8131		188/534	169695446	3322,6802	1508	3554	5062	SO:0001819	synonymous_variant	3937	exon8			GGGGGGCACAGGA		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.564G>A	5.37:g.169695446C>T		Somatic	6	4	0.666667	1879	WXS	Illumina HiSeq	Phase_I	5	4	0.8	NM_005565	A8KA25|Q53XV4	Silent	SNP	ENST00000046794.5	37	CCDS47339.1																																																																																			C|0.530;T|0.470	0.470	strong		0.627	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	
ZNF653	115950	hgsc.bcm.edu	37	19	11598600	11598600	+	Silent	SNP	C	C	T	rs184960221	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:11598600C>T	ENST00000293771.5	-	4	814	c.678G>A	c.(676-678)acG>acA	p.T226T	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						GGCTGGTGGGCGTCGCTGCCG	0.672													C|||	240	0.0479233	0.0393	0.0994	5008	,	,		9045	0.0397		0.0408	False		,,,				2504	0.0389				p.T226T	Pancreas(83;980 1446 4542 6441 43352)	Atlas-SNP	.											ZNF653,NS,carcinoma,0,1	ZNF653	48	1	0			c.G678A						scavenged	.						25.0	24.0	24.0					19																	11598600		2175	4227	6402	SO:0001819	synonymous_variant	115950	exon4			GGTGGGCGTCGCT	AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.678G>A	19.37:g.11598600C>T		Somatic	36	1	0.0277778		WXS	Illumina HiSeq	Phase_I	57	5	0.0877193	NM_138783	Q96AS7	Silent	SNP	ENST00000293771.5	37	CCDS12261.1																																																																																			C|0.959;T|0.041	0.041	strong		0.672	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458836.2	NM_138783	
ARHGAP5	394	hgsc.bcm.edu	37	14	32560563	32560563	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr14:32560563C>T	ENST00000345122.3	+	2	1003	c.688C>T	c.(688-690)Cga>Tga	p.R230*	ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000432921.1_Nonsense_Mutation_p.R230*|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Nonsense_Mutation_p.R230*|ARHGAP5_ENST00000556611.1_Nonsense_Mutation_p.R230*	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	230					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.R230*(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AACATCAGCACGATTTAATGT	0.348																																					p.R230X	NSCLC(9;77 350 3443 29227 41353)	Atlas-SNP	.											ARHGAP5,colon,NS,0,1	ARHGAP5	166	1	1	Substitution - Nonsense(1)	large_intestine(1)	c.C688T						scavenged	.						91.0	97.0	95.0					14																	32560563		2202	4300	6502	SO:0001587	stop_gained	394	exon2			TCAGCACGATTTA	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.688C>T	14.37:g.32560563C>T	ENSP00000371897:p.Arg230*	Somatic	254	0	0		WXS	Illumina HiSeq	Phase_I	200	3	0.015	NM_001173	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Nonsense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	C	32	5.189990	0.94923	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	.	.	.	5.78	4.84	0.62591	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1227	0.65201	0.2214:0.7786:0.0:0.0	.	.	.	.	X	230	.	ENSP00000371897:R230X	R	+	1	2	ARHGAP5	31630314	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.232000	0.51302	2.717000	0.92951	0.655000	0.94253	CGA	.	.	none		0.348	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
MGARP	84709	hgsc.bcm.edu	37	4	140187819	140187819	+	Silent	SNP	G	G	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:140187819G>T	ENST00000398955.1	-	4	836	c.657C>A	c.(655-657)tcC>tcA	p.S219S		NM_032623.3	NP_116012.2	Q8TDB4	HUMMR_HUMAN	mitochondria-localized glutamic acid-rich protein	219					anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to hypoxia (GO:0071456)|cellular response to steroid hormone stimulus (GO:0071383)|positive regulation of mitochondrion organization (GO:0010822)|protein targeting to mitochondrion (GO:0006626)|retrograde axon cargo transport (GO:0008090)	integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)											CTCCAGCAGAGGACTCTGACT	0.453																																					p.S219S		Atlas-SNP	.											C4orf49,NS,carcinoma,0,1	.	.	1	0			c.C657A						scavenged	.						88.0	82.0	84.0					4																	140187819		1921	4139	6060	SO:0001819	synonymous_variant	84709	exon4			AGCAGAGGACTCT	AF484960	CCDS43269.1	4q31.1	2014-02-19	2014-02-19	2012-04-17	ENSG00000137463	ENSG00000137463			29969	protein-coding gene	gene with protein product	"""ovary-specific acidic protein"", ""corneal endothelium-specific protein 1"", ""hypoxia up-regulated mitochondrial movement regulator"""		"""chromosome 4 open reading frame 49"""	C4orf49			Standard	NM_032623		Approved	OSAP, CESP-1, HUMMR	uc003ihr.1	Q8TDB4	OTTHUMG00000161325	ENST00000398955.1:c.657C>A	4.37:g.140187819G>T		Somatic	98	1	0.0102041		WXS	Illumina HiSeq	Phase_I	124	2	0.016129	NM_032623	Q9BZC3	Silent	SNP	ENST00000398955.1	37	CCDS43269.1																																																																																			.	.	none		0.453	MGARP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364536.1	NM_032623	
POLR3C	10623	hgsc.bcm.edu	37	1	145601603	145601603	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:145601603C>T	ENST00000334163.3	-	7	963	c.803G>A	c.(802-804)cGa>cAa	p.R268Q	POLR3C_ENST00000369294.1_Missense_Mutation_p.R268Q|POLR3C_ENST00000471254.1_5'UTR	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	268					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.R268Q(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			GAGCATGGTTCGCACAATCTC	0.448																																					p.R268Q		Atlas-SNP	.											POLR3C,caecum,carcinoma,0,1	POLR3C	41	1	1	Substitution - Missense(1)	large_intestine(1)	c.G803A						scavenged	.						178.0	162.0	168.0					1																	145601603		2203	4300	6503	SO:0001583	missense	10623	exon7			ATGGTTCGCACAA	AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.803G>A	1.37:g.145601603C>T	ENSP00000334564:p.Arg268Gln	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	191	3	0.0157068	NM_006468	O15317|Q9Y3R6	Missense_Mutation	SNP	ENST00000334163.3	37	CCDS921.1	.	.	.	.	.	.	.	.	.	.	C	32	5.141992	0.94560	.	.	ENSG00000186141	ENST00000334163;ENST00000369294	T;T	0.47869	0.83;0.83	5.79	4.87	0.63330	RNA polymerase III Rpc82, C -terminal (1);	0.000000	0.85682	D	0.000000	T	0.47078	0.1426	L	0.56769	1.78	0.54753	D	0.999988	D;D;D	0.64830	0.994;0.968;0.988	P;P;P	0.54664	0.493;0.619;0.758	T	0.40270	-0.9572	10	0.44086	T	0.13	-16.2475	13.1249	0.59349	0.0:0.9204:0.0:0.0796	.	268;268;268	E9PHH9;Q9BUI4;Q53F76	.;RPC3_HUMAN;.	Q	268	ENSP00000334564:R268Q;ENSP00000358300:R268Q	ENSP00000334564:R268Q	R	-	2	0	POLR3C	144312960	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.706000	0.68362	2.728000	0.93425	0.561000	0.74099	CGA	.	.	none		0.448	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038542.1	NM_006468	
MUC6	4588	hgsc.bcm.edu	37	11	1017575	1017575	+	Silent	SNP	C	C	T	rs76222533		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:1017575C>T	ENST00000421673.2	-	31	5276	c.5226G>A	c.(5224-5226)acG>acA	p.T1742T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1742	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGTTTTGGCCGTGCTAAATG	0.537													-|||	1	0.000199681	0.0	0.0014	5008	,	,		39036	0.0		0.0	False		,,,				2504	0.0				p.T1742T		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	0			c.G5226A						scavenged	.						697.0	677.0	684.0					11																	1017575		2190	4282	6472	SO:0001819	synonymous_variant	4588	exon31			TTTGGCCGTGCTA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5226G>A	11.37:g.1017575C>T		Somatic	854	72	0.0843091		WXS	Illumina HiSeq	Phase_I	985	100	0.101523	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			C|0.500;T|0.500	0.500	strong		0.537	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
L3HYPDH	112849	hgsc.bcm.edu	37	14	59950587	59950587	+	Missense_Mutation	SNP	C	C	T	rs548137663		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr14:59950587C>T	ENST00000247194.4	-	1	561	c.448G>A	c.(448-450)Gac>Aac	p.D150N	L3HYPDH_ENST00000487285.1_5'Flank|JKAMP_ENST00000554271.1_5'Flank|JKAMP_ENST00000556985.1_5'Flank|JKAMP_ENST00000356057.5_5'Flank|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000261247.9_5'Flank|JKAMP_ENST00000425728.2_5'Flank	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)	150					metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)									L-Proline(DB00172)	CTGCGGCCGTCCTCGCATGCC	0.711											OREG0022712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		14809	0.001		0.0	False		,,,				2504	0.0				p.D150N		Atlas-SNP	.											.	.	.	.	0			c.G448A						PASS	.						6.0	7.0	7.0					14																	59950587		2110	4104	6214	SO:0001583	missense	112849	exon1			GGCCGTCCTCGCA	AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941	ENST00000247194.4:c.448G>A	14.37:g.59950587C>T	ENSP00000247194:p.Asp150Asn	Somatic	9	0	0	1042	WXS	Illumina HiSeq	Phase_I	16	8	0.5	NM_144581	Q96LJ5	Missense_Mutation	SNP	ENST00000247194.4	37	CCDS9739.1	.	.	.	.	.	.	.	.	.	.	C	13.37	2.216802	0.39201	.	.	ENSG00000126790	ENST00000247194	T	0.17370	2.28	5.58	3.77	0.43336	.	0.421261	0.27227	N	0.020326	T	0.12178	0.0296	L	0.28458	0.855	0.58432	D	0.999993	B;B	0.16166	0.016;0.001	B;B	0.18263	0.021;0.003	T	0.09443	-1.0674	10	0.15952	T	0.53	.	11.8035	0.52141	0.0:0.8581:0.0:0.1419	.	150;150	B4DGY8;Q96EM0	.;PRCM_HUMAN	N	150	ENSP00000247194:D150N	ENSP00000247194:D150N	D	-	1	0	C14orf149	59020340	0.816000	0.29132	0.851000	0.33527	0.692000	0.40212	1.630000	0.37081	0.726000	0.32339	0.561000	0.74099	GAC	.	.	none		0.711	L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072254.5	NM_144581	
BAI1	575	hgsc.bcm.edu	37	8	143625724	143625724	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:143625724C>T	ENST00000517894.1	+	31	5595	c.4701C>T	c.(4699-4701)ggC>ggT	p.G1567G	BAI1_ENST00000323289.5_Silent_p.G1567G			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1567	Necessary for interaction with MAGI1.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					AGAGGTCGGGCGCCACGATCC	0.706																																					p.G1567G		Atlas-SNP	.											.	BAI1	146	.	0			c.C4701T						PASS	.						13.0	23.0	19.0					8																	143625724		1749	3389	5138	SO:0001819	synonymous_variant	575	exon30			GTCGGGCGCCACG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.4701C>T	8.37:g.143625724C>T		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	43	20	0.465116	NM_001702		Silent	SNP	ENST00000517894.1	37																																																																																				.	.	none		0.706	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
BRIP1	83990	hgsc.bcm.edu	37	17	59853911	59853911	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:59853911T>C	ENST00000259008.2	-	14	2215	c.1948A>G	c.(1948-1950)Acc>Gcc	p.T650A	BRIP1_ENST00000583837.1_5'UTR|BRIP1_ENST00000577598.1_Missense_Mutation_p.T650A	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	650					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						GACCCAATGGTACCAACCCAA	0.383			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																													p.T650A		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	BRIP1_ENST00000259008,caecum,carcinoma,+2,3	BRIP1	237	3	0			c.A1948G						scavenged	.						112.0	110.0	111.0					17																	59853911		2203	4300	6503	SO:0001583	missense	83990	exon14			CAATGGTACCAAC	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.1948A>G	17.37:g.59853911T>C	ENSP00000259008:p.Thr650Ala	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	77	3	0.038961	NM_032043	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000259008.2	37	CCDS11631.1	.	.	.	.	.	.	.	.	.	.	T	19.59	3.855272	0.71719	.	.	ENSG00000136492	ENST00000259008	T	0.75154	-0.91	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.78929	0.4361	L	0.28649	0.875	0.58432	D	0.999994	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.77584	-0.2533	9	.	.	.	-9.7187	15.1372	0.72576	0.0:0.0:0.0:1.0	.	650;650	C9JGZ0;Q9BX63	.;FANCJ_HUMAN	A	650	ENSP00000259008:T650A	.	T	-	1	0	BRIP1	57208693	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.198000	0.77823	2.167000	0.68274	0.533000	0.62120	ACC	.	.	none		0.383	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043	
CYP2D6	1565	hgsc.bcm.edu	37	22	42523539	42523539	+	Silent	SNP	A	A	G	rs28371726	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:42523539A>G	ENST00000360608.5	-	7	1197	c.1083T>C	c.(1081-1083)caT>caC	p.H361H	NDUFA6-AS1_ENST00000416037.2_RNA|CYP2D6_ENST00000359033.4_Silent_p.H310H|NDUFA6-AS1_ENST00000439129.1_RNA|NDUFA6-AS1_ENST00000417327.1_RNA|NDUFA6-AS1_ENST00000451451.1_RNA|NDUFA6-AS1_ENST00000595777.1_RNA|NDUFA6-AS1_ENST00000434834.1_RNA|NDUFA6-AS1_ENST00000600968.1_RNA|CYP2D6_ENST00000389970.3_Silent_p.H361H|NDUFA6-AS1_ENST00000536447.2_RNA|NDUFA6-AS1_ENST00000610250.1_RNA	NM_000106.5	NP_000097	P10635	CP2D6_HUMAN	cytochrome P450, family 2, subfamily D, polypeptide 6	361					alkaloid catabolic process (GO:0009822)|alkaloid metabolic process (GO:0009820)|coumarin metabolic process (GO:0009804)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|isoquinoline alkaloid metabolic process (GO:0033076)|monoterpenoid metabolic process (GO:0016098)|negative regulation of binding (GO:0051100)|negative regulation of cellular organofluorine metabolic process (GO:0090350)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(4)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21					Abiraterone(DB05812)|Acebutolol(DB01193)|Acetaminophen(DB00316)|Ajmaline(DB01426)|Almotriptan(DB00918)|Alogliptin(DB06203)|Alprenolol(DB00866)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amoxapine(DB00543)|Amphetamine(DB00182)|Amprenavir(DB00701)|Amsacrine(DB00276)|Antipyrine(DB01435)|Aprindine(DB01429)|Arformoterol(DB01274)|Aripiprazole(DB01238)|Artemether(DB06697)|Asenapine(DB06216)|Astemizole(DB00637)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzatropine(DB00245)|Benzyl alcohol(DB06770)|Bepridil(DB01244)|Betaxolol(DB00195)|Bicalutamide(DB01128)|Biperiden(DB00810)|Bisoprolol(DB00612)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Buspirone(DB00490)|Caffeine(DB00201)|Captopril(DB01197)|Carbinoxamine(DB00748)|Carteolol(DB00521)|Carvedilol(DB01136)|Celecoxib(DB00482)|Cephalexin(DB00567)|Cevimeline(DB00185)|Chlordiazepoxide(DB00475)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Cisapride(DB00604)|Citalopram(DB00215)|Clemastine(DB00283)|Clevidipine(DB04920)|Clomipramine(DB01242)|Clonidine(DB00575)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Codeine(DB00318)|Cyclobenzaprine(DB00924)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Darifenacin(DB00496)|Debrisoquin(DB04840)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dihydrocodeine(DB01551)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronedarone(DB04855)|Duloxetine(DB00476)|Efavirenz(DB00625)|Eletriptan(DB00216)|Encainide(DB01228)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erlotinib(DB00530)|Escitalopram(DB01175)|Ethylmorphine(DB01466)|Etoricoxib(DB01628)|Felodipine(DB01023)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fingolimod(DB08868)|Flecainide(DB01195)|Flunarizine(DB04841)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Galantamine(DB00674)|Gefitinib(DB00317)|Glutethimide(DB01437)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Halothane(DB01159)|Histamine Phosphate(DB00667)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Hydroxychloroquine(DB01611)|Hydroxyurea(DB01005)|Hydroxyzine(DB00557)|Idarubicin(DB01177)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Ipratropium bromide(DB00332)|Irbesartan(DB01029)|Isoniazid(DB00951)|Itraconazole(DB01167)|Ketoconazole(DB01026)|L-DOPA(DB01235)|Labetalol(DB00598)|Lansoprazole(DB00448)|Lercanidipine(DB00528)|Levomilnacipran(DB08918)|Lidocaine(DB00281)|Lisuride(DB00589)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Lovastatin(DB00227)|Lumefantrine(DB06708)|Maprotiline(DB00934)|Mefloquine(DB00358)|Mepyramine(DB06691)|Mequitazine(DB01071)|Mesoridazine(DB00933)|Methadone(DB00333)|Methamphetamine(DB01577)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Methylnaltrexone(DB06800)|Methylphenidate(DB00422)|Methyprylon(DB01107)|Metoclopramide(DB01233)|Metoprolol(DB00264)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midodrine(DB00211)|Mifepristone(DB00834)|Minaprine(DB00805)|Mirabegron(DB08893)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Morphine(DB00295)|Nateglinide(DB00731)|Nebivolol(DB04861)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niacin(DB00627)|Nicardipine(DB00622)|Nicergoline(DB00699)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitrofural(DB00336)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxamniquine(DB01096)|Oxprenolol(DB01580)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Paliperidone(DB01267)|Palonosetron(DB00377)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Pergolide(DB01186)|Perhexiline(DB01074)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenformin(DB00914)|Phentermine(DB00191)|Pimozide(DB01100)|Pindolol(DB00960)|Pioglitazone(DB01132)|Piperazine(DB00592)|Pipotiazine(DB01621)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Primaquine(DB01087)|Procainamide(DB01035)|Prochlorperazine(DB00433)|Progesterone(DB00396)|Proguanil(DB01131)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Pyrimethamine(DB00205)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ranolazine(DB00243)|Reboxetine(DB00234)|Remoxipride(DB00409)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivastigmine(DB00989)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertindole(DB06144)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tamsulosin(DB00706)|Tapentadol(DB06204)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Terbinafine(DB00857)|Tetrabenazine(DB04844)|Theophylline(DB00277)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Timolol(DB00373)|Tiotropium(DB01409)|Tipranavir(DB00932)|Tolterodine(DB01036)|Trabectedin(DB05109)|Tramadol(DB00193)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Trimipramine(DB00726)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Trospium(DB00209)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)|Vinblastine(DB00570)|Vinorelbine(DB00361)|Yohimbine(DB01392)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Ziprasidone(DB00246)|Zolpidem(DB00425)	GCTGCACCTCATGAATCACGG	0.602																																					p.H361H		Atlas-SNP	.											CYP2D6_ENST00000360608,NS,carcinoma,0,4	CYP2D6	104	4	0			c.T1083C						scavenged	.						119.0	93.0	102.0					22																	42523539		2202	4299	6501	SO:0001819	synonymous_variant	1565	exon7			CACCTCATGAATC	M20403	CCDS33657.1, CCDS46721.1	22q13.1	2014-09-17	2003-01-14		ENSG00000100197	ENSG00000100197		"""Cytochrome P450s"""	2625	protein-coding gene	gene with protein product		124030	"""cytochrome P450, subfamily IID (debrisoquine, sparteine, etc., -metabolizing), polypeptide 6"", ""cytochrome P450, family 2, subfamily D, polypeptide 7 pseudogene 2"", ""cytochrome P450, subfamily II (debrisoquine, sparteine, etc., -metabolising), polypeptide 7 pseudogene 2"", ""cytochrome P450, family 2, subfamily D, polypeptide 8 pseudogene 2"", ""cytochrome P450, subfamily IID (debrisoquine, sparteine, etc., -metabolising), polypeptide 8 pseudogene 2"""	CYP2DL1, CYP2D7P2, CYP2D7BP, CYP2D8P2, CYP2D7AP		8449513	Standard	NM_000106		Approved	CPD6, P450-DB1, CYP2D, P450C2D	uc003bce.3	P10635	OTTHUMG00000150918	ENST00000360608.5:c.1083T>C	22.37:g.42523539A>G		Somatic	230	2	0.00869565		WXS	Illumina HiSeq	Phase_I	260	8	0.0307692	NM_000106	Q16752|Q2XND6|Q2XND7|Q2XNE0|Q6B012|Q6NXU8	Silent	SNP	ENST00000360608.5	37	CCDS46721.1																																																																																			A|0.959;G|0.041	0.041	strong		0.602	CYP2D6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320525.1		
ATP2B4	493	hgsc.bcm.edu	37	1	203680025	203680025	+	Missense_Mutation	SNP	G	G	A	rs200815867		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:203680025G>A	ENST00000357681.5	+	12	2943	c.1820G>A	c.(1819-1821)cGg>cAg	p.R607Q	ATP2B4_ENST00000341360.2_Missense_Mutation_p.R607Q|ATP2B4_ENST00000367218.3_Missense_Mutation_p.R607Q|ATP2B4_ENST00000391954.2_Missense_Mutation_p.R607Q|ATP2B4_ENST00000367219.3_Missense_Mutation_p.R595Q	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	607					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ATCCTGGACCGGAAAGGGGAA	0.498																																					p.R607Q		Atlas-SNP	.											ATP2B4_ENST00000367218,bladder,carcinoma,-1,2	ATP2B4	226	2	0			c.G1820A						scavenged	.	G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	61.0	49.0	53.0		1820,1820	1.6	0.8	1		53	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ATP2B4	NM_001684.4,NM_001001396.2	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	607/1206,607/1171	203680025	1,13005	2203	4300	6503	SO:0001583	missense	493	exon12			TGGACCGGAAAGG	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.1820G>A	1.37:g.203680025G>A	ENSP00000350310:p.Arg607Gln	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	137	3	0.0218978	NM_001001396	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	ENST00000357681.5	37	CCDS1440.1	.	.	.	.	.	.	.	.	.	.	G	12.93	2.084608	0.36758	0.0	1.16E-4	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	D;D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.09;-3.11	5.33	1.6	0.23607	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.749574	0.12240	N	0.486657	T	0.81692	0.4876	N	0.12182	0.205	0.21861	N	0.999508	B;B;B	0.29270	0.24;0.006;0.016	B;B;B	0.28232	0.087;0.011;0.009	T	0.66701	-0.5857	10	0.14252	T	0.57	-10.6071	9.9321	0.41528	0.8019:0.0:0.1981:0.0	.	607;607;607	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	Q	607;607;595;607;607	ENSP00000350310:R607Q;ENSP00000356187:R607Q;ENSP00000356188:R595Q;ENSP00000375816:R607Q;ENSP00000340930:R607Q	ENSP00000340930:R607Q	R	+	2	0	ATP2B4	201946648	0.899000	0.30636	0.837000	0.33122	0.759000	0.43091	2.024000	0.41049	0.416000	0.25844	-1.040000	0.02373	CGG	G|0.999;A|0.001	0.001	weak		0.498	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396	
OR4D9	390199	hgsc.bcm.edu	37	11	59282709	59282709	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:59282709G>A	ENST00000329328.3	+	1	324	c.324G>A	c.(322-324)ggG>ggA	p.G108G		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						ACCTTCTGGGGGGAGCAGACG	0.488																																					p.G108G		Atlas-SNP	.											OR4D9,brain,glioma,+2,1	OR4D9	47	1	0			c.G324A						scavenged	.						88.0	86.0	86.0					11																	59282709		2201	4295	6496	SO:0001819	synonymous_variant	390199	exon1			TCTGGGGGGAGCA	AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.324G>A	11.37:g.59282709G>A		Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	119	2	0.0168067	NM_001004711	Q6IFF3	Silent	SNP	ENST00000329328.3	37	CCDS31564.1																																																																																			.	.	none		0.488	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394237.1	NM_001004711	
KIAA1377	57562	hgsc.bcm.edu	37	11	101834043	101834043	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:101834043A>C	ENST00000263468.8	+	6	2547	c.2277A>C	c.(2275-2277)aaA>aaC	p.K759N	KIAA1377_ENST00000537689.1_Missense_Mutation_p.K560N	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	759										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TAATTAGAAAACCAGGATCTG	0.378																																					p.K759N		Atlas-SNP	.											.	KIAA1377	111	.	0			c.A2277C						PASS	.						65.0	72.0	70.0					11																	101834043		2203	4299	6502	SO:0001583	missense	57562	exon6			TAGAAAACCAGGA	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.2277A>C	11.37:g.101834043A>C	ENSP00000263468:p.Lys759Asn	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	80	9	0.1125	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	A	8.638	0.895225	0.17613	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.07327	3.2;3.2	5.23	5.23	0.72850	.	0.157535	0.45867	D	0.000338	T	0.06645	0.0170	N	0.22421	0.69	0.27731	N	0.944796	B	0.32467	0.372	B	0.29077	0.098	T	0.18903	-1.0322	10	0.72032	D	0.01	-14.8212	11.7668	0.51935	0.8685:0.0:0.0:0.1315	.	759	Q9P2H0	K1377_HUMAN	N	759;560	ENSP00000263468:K759N;ENSP00000443184:K560N	ENSP00000263468:K759N	K	+	3	2	KIAA1377	101339253	0.995000	0.38212	0.714000	0.30535	0.134000	0.20937	3.343000	0.52167	2.093000	0.63338	0.533000	0.62120	AAA	.	.	none		0.378	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
COL16A1	1307	hgsc.bcm.edu	37	1	32164126	32164126	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:32164126C>T	ENST00000373672.3	-	5	864	c.348G>A	c.(346-348)acG>acA	p.T116T	COL16A1_ENST00000373668.3_Silent_p.T116T|COL16A1_ENST00000271069.6_Silent_p.T116T	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	116	Laminin G-like.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		ACAGATACCACGTCTTCTGGT	0.557																																					p.T116T	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.G348A						PASS	.						122.0	128.0	126.0					1																	32164126		2023	4176	6199	SO:0001819	synonymous_variant	1307	exon5			ATACCACGTCTTC	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.348G>A	1.37:g.32164126C>T		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	83	7	0.0843373	NM_001856	Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	37	CCDS41297.1																																																																																			.	.	none		0.557	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
HIST2H2BE	8349	hgsc.bcm.edu	37	1	149857830	149857830	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:149857830T>C	ENST00000369155.2	-	1	402	c.361A>G	c.(361-363)Aag>Gag	p.K121E	HIST2H2AC_ENST00000331380.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003528.2	NP_003519.1	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	121					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	14	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CTGGTGTACTTGGTGACCGCC	0.667																																					p.K121E		Atlas-SNP	.											.	HIST2H2BE	33	.	0			c.A361G						PASS	.						30.0	35.0	33.0					1																	149857830		2202	4299	6501	SO:0001583	missense	8349	exon1			TGTACTTGGTGAC	AY131979	CCDS936.1	1q21.2	2011-01-27	2006-10-11	2003-03-07	ENSG00000184678	ENSG00000184678		"""Histones / Replication-dependent"""	4760	protein-coding gene	gene with protein product		601831	"""H2B histone family, member Q"", ""histone 2, H2be"""	H2B, H2BFQ		1469070, 12408966	Standard	NM_003528		Approved	H2B/q, H2B.1	uc001etc.3	Q16778	OTTHUMG00000012095	ENST00000369155.2:c.361A>G	1.37:g.149857830T>C	ENSP00000358151:p.Lys121Glu	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	117	38	0.324786	NM_003528	A3KMC7|A8K110|Q4KMY1|Q5QNX0|Q9UE88	Missense_Mutation	SNP	ENST00000369155.2	37	CCDS936.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.909008	0.92107	.	.	ENSG00000184678	ENST00000369155	T	0.46063	0.88	6.07	6.07	0.98685	Histone-fold (2);	0.000000	0.85682	D	0.000000	T	0.54078	0.1836	H	0.98664	4.295	0.38928	D	0.957879	P	0.52842	0.956	B	0.40329	0.326	T	0.76302	-0.3009	10	0.87932	D	0	.	15.47	0.75434	0.0:0.0:0.0:1.0	.	121	Q16778	H2B2E_HUMAN	E	121	ENSP00000358151:K121E	ENSP00000358151:K121E	K	-	1	0	HIST2H2BE	148124454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.924000	0.87555	2.330000	0.79161	0.477000	0.44152	AAG	.	.	none		0.667	HIST2H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033455.1	NM_003528	
FAM171A1	221061	hgsc.bcm.edu	37	10	15255321	15255321	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:15255321T>C	ENST00000378116.4	-	8	2272	c.2266A>G	c.(2266-2268)Agg>Ggg	p.R756G	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	756						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GCATCTCCCCTTCCCTTCCGG	0.532																																					p.R756G		Atlas-SNP	.											FAM171A1_ENST00000378116,colon,carcinoma,+1,2	FAM171A1	252	2	0			c.A2266G						scavenged	.						121.0	84.0	97.0					10																	15255321		2203	4300	6503	SO:0001583	missense	221061	exon8			CTCCCCTTCCCTT	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2266A>G	10.37:g.15255321T>C	ENSP00000367356:p.Arg756Gly	Somatic	148	1	0.00675676		WXS	Illumina HiSeq	Phase_I	171	3	0.0175439	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	T	13.23	2.174889	0.38413	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.35789	1.29	5.25	2.74	0.32292	.	0.049878	0.85682	D	0.000000	T	0.54013	0.1832	M	0.63428	1.95	0.58432	D	0.999992	D	0.89917	1.0	D	0.87578	0.998	T	0.55673	-0.8104	10	0.54805	T	0.06	-26.3492	12.0944	0.53747	0.0:0.0:0.2711:0.7289	.	756	Q5VUB5	F1711_HUMAN	G	756;755	ENSP00000367356:R756G	ENSP00000367356:R756G	R	-	1	2	FAM171A1	15295327	0.859000	0.29813	1.000000	0.80357	0.356000	0.29392	1.191000	0.32138	0.980000	0.38523	0.460000	0.39030	AGG	.	.	none		0.532	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
PCDHA10	56139	hgsc.bcm.edu	37	5	140236835	140236835	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr5:140236835A>G	ENST00000307360.5	+	1	1202	c.1202A>G	c.(1201-1203)aAg>aGg	p.K401R	PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.K401R|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	401	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCACCTACAAGAATTACTAC	0.597																																					p.K401R		Atlas-SNP	.											.	PCDHA10	358	.	0			c.A1202G						PASS	.						144.0	129.0	134.0					5																	140236835		2197	4275	6472	SO:0001583	missense	56139	exon1			CCTACAAGAATTA	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1202A>G	5.37:g.140236835A>G	ENSP00000304234:p.Lys401Arg	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	189	77	0.407407	NM_031859	A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	37	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	A	9.832	1.188630	0.21954	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.51817	4.64;0.69	4.0	1.57	0.23409	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.39036	0.1063	L	0.46819	1.47	0.21325	N	0.999726	B;B;B	0.26809	0.086;0.029;0.16	B;B;B	0.32928	0.085;0.03;0.155	T	0.34976	-0.9807	9	0.39692	T	0.17	.	5.0725	0.14613	0.6033:0.1492:0.2475:0.0	.	401;401;401	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	R	401	ENSP00000421030:K401R;ENSP00000304234:K401R	ENSP00000304234:K401R	K	+	2	0	PCDHA10	140217019	0.000000	0.05858	0.999000	0.59377	0.741000	0.42261	0.427000	0.21379	0.653000	0.30826	0.459000	0.35465	AAG	.	.	none		0.597	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
MUC16	94025	hgsc.bcm.edu	37	19	9012826	9012826	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:9012826T>C	ENST00000397910.4	-	34	38821	c.38618A>G	c.(38617-38619)cAt>cGt	p.H12873R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12875	SEA 6. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCCTGGGTGATGCATGTCCTC	0.587																																					p.H12873R		Atlas-SNP	.											MUC16_ENST00000397910,NS,lymphoid_neoplasm,0,2	MUC16	4315	2	0			c.A38618G						scavenged	.						225.0	191.0	202.0					19																	9012826		2025	4191	6216	SO:0001583	missense	94025	exon34			GGGTGATGCATGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38618A>G	19.37:g.9012826T>C	ENSP00000381008:p.His12873Arg	Somatic	174	1	0.00574713		WXS	Illumina HiSeq	Phase_I	220	4	0.0181818	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	0.961	-0.703220	0.03255	.	.	ENSG00000181143	ENST00000397910;ENST00000441155	T	0.28666	1.6	1.74	-3.49	0.04724	.	.	.	.	.	T	0.23094	0.0558	.	.	.	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.04737	-1.0930	7	0.87932	D	0	2.498	9.967	0.41730	0.0:0.6375:0.0:0.3625	.	12873	B5ME49	.	R	12873;26	ENSP00000381008:H12873R	ENSP00000381008:H12873R	H	-	2	0	MUC16	8873826	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-6.071000	0.00082	-2.450000	0.00543	-2.166000	0.00325	CAT	.	.	none		0.587	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF285	26974	hgsc.bcm.edu	37	19	44891010	44891010	+	Missense_Mutation	SNP	G	G	C	rs150792548	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:44891010G>C	ENST00000330997.4	-	4	1461	c.1397C>G	c.(1396-1398)gCg>gGg	p.A466G	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000544719.2_Missense_Mutation_p.A466G|ZNF285_ENST00000591679.1_Missense_Mutation_p.A473G	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A466G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						AGAGCTATACGCAAAATCCTT	0.418																																					p.A466G		Atlas-SNP	.											ZNF285,NS,carcinoma,+1,2	ZNF285	86	2	1	Substitution - Missense(1)	skin(1)	c.C1397G						scavenged	.						83.0	84.0	83.0					19																	44891010		2203	4300	6503	SO:0001583	missense	26974	exon4			CTATACGCAAAAT	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1397C>G	19.37:g.44891010G>C	ENSP00000333595:p.Ala466Gly	Somatic	128	1	0.0078125		WXS	Illumina HiSeq	Phase_I	119	7	0.0588235	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	G	9.126	1.010205	0.19277	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.08008	3.14	3.46	0.829	0.18847	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08714	0.0216	L	0.45744	1.44	0.09310	N	1	B;B	0.34399	0.452;0.0	B;B	0.36666	0.23;0.001	T	0.29488	-1.0010	9	0.56958	D	0.05	.	6.4144	0.21708	0.1094:0.3586:0.532:0.0	.	490;466	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	G	489;466	ENSP00000333595:A466G	ENSP00000333595:A466G	A	-	2	0	ZNF285	49582850	0.000000	0.05858	0.002000	0.10522	0.860000	0.49131	-6.159000	0.00078	0.511000	0.28236	0.298000	0.19748	GCG	A|0.002;C|0.002;G|0.995	0.002	strong		0.418	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
P2RY8	286530	hgsc.bcm.edu	37	X	1585217	1585217	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chrX:1585217G>T	ENST00000381297.4	-	2	445	c.235C>A	c.(235-237)Caa>Aaa	p.Q79K	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TAGTAGATTTGGAAAGGCAAC	0.572			T	CRLF2	"""B-ALL, Downs associated ALL"""																																p.Q79K		Atlas-SNP	.		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	.	P2RY8	53	.	0			c.C235A						PASS	.						141.0	127.0	132.0					X																	1585217		2203	4296	6499	SO:0001583	missense	286530	exon2			AGATTTGGAAAGG	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.235C>A	X.37:g.1585217G>T	ENSP00000370697:p.Gln79Lys	Somatic	218	0	0		WXS	Illumina HiSeq	Phase_I	260	105	0.403846	NM_178129		Missense_Mutation	SNP	ENST00000381297.4	37	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	g	3.768	-0.048128	0.07407	.	.	ENSG00000182162	ENST00000381297	T	0.71461	-0.57	2.1	2.1	0.27182	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000002	T	0.65015	0.2651	N	0.16066	0.365	0.09310	N	0.999999	D	0.76494	0.999	D	0.87578	0.998	T	0.58244	-0.7670	10	0.02654	T	1	.	12.2776	0.54744	0.0:0.0:1.0:0.0	.	79	Q86VZ1	P2RY8_HUMAN	K	79	ENSP00000370697:Q79K	ENSP00000370697:Q79K	Q	-	1	0	P2RY8	1545217	1.000000	0.71417	0.577000	0.28562	0.017000	0.09413	5.642000	0.67888	0.637000	0.30526	0.279000	0.19357	CAA	.	.	none		0.572	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	NM_178129	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230312	23230312	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:23230312C>G	ENST00000526893.1	+	1	353	c.79C>G	c.(79-81)Ctg>Gtg	p.L27V	IGLL5_ENST00000532223.2_Missense_Mutation_p.L27V|IGLL5_ENST00000531372.1_Missense_Mutation_p.L27V|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	27						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CTGGCCCCTGCTGCTGCTGGG	0.667																																					p.L27V		Atlas-SNP	.											IGLL5,NS,lymphoid_neoplasm,-2,1	IGLL5	26	1	0			c.C79G						PASS	.																																			SO:0001583	missense	100423062	exon1			CCCCTGCTGCTGC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.79C>G	22.37:g.23230312C>G	ENSP00000431254:p.Leu27Val	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	142	61	0.429577	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	C	10.18	1.278851	0.23307	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00626	6.13;6.14	3.81	-2.69	0.06022	.	.	.	.	.	T	0.00524	0.0017	L	0.29908	0.895	0.09310	N	1	P	0.37061	0.58	B	0.28232	0.087	T	0.47032	-0.9148	9	0.72032	D	0.01	.	7.0435	0.25033	0.3778:0.5232:0.0:0.099	.	27	B9A064	IGLL5_HUMAN	V	27	ENSP00000436353:L27V;ENSP00000431254:L27V	ENSP00000431254:L27V	L	+	1	2	IGLL5	21560312	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-1.733000	0.01850	-0.440000	0.07211	-0.165000	0.13383	CTG	.	.	none		0.667	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
OR5B3	441608	hgsc.bcm.edu	37	11	58170412	58170412	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:58170412G>A	ENST00000309403.2	-	1	470	c.471C>T	c.(469-471)caC>caT	p.H157H		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TGTCCCCAGTGTGGATGGAGG	0.468																																					p.H157H		Atlas-SNP	.											OR5B3,right_upper_lobe,carcinoma,-2,1	OR5B3	65	1	0			c.C471T						PASS	.						114.0	106.0	109.0					11																	58170412		2201	4295	6496	SO:0001819	synonymous_variant	441608	exon1			CCCAGTGTGGATG	AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.471C>T	11.37:g.58170412G>A		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	100	4	0.04	NM_001005469	Q6IEV6	Silent	SNP	ENST00000309403.2	37	CCDS31549.1																																																																																			.	.	none		0.468	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394886.1	NM_001005469	
PGM3	5238	hgsc.bcm.edu	37	6	83898451	83898451	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:83898451C>T	ENST00000283977.4	-	2	154	c.28G>A	c.(28-30)Gcc>Acc	p.A10T	PGM3_ENST00000512866.1_Missense_Mutation_p.A91T|PGM3_ENST00000513973.1_Missense_Mutation_p.A91T|PGM3_ENST00000506587.1_Missense_Mutation_p.A119T					phosphoglucomutase 3											NS(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	18		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		AAACAGGTGGCATGTTCCTCC	0.413																																					p.A119T		Atlas-SNP	.											.	PGM3	39	.	0			c.G355A						PASS	.						148.0	120.0	129.0					6																	83898451		2203	4300	6503	SO:0001583	missense	5238	exon4			AGGTGGCATGTTC	BC001258	CCDS4997.1, CCDS56435.1, CCDS56436.1, CCDS75487.1	6q14.1-q15	2012-10-02			ENSG00000013375	ENSG00000013375	5.4.2.3		8907	protein-coding gene	gene with protein product	"""acetylglucosamine phosphomutase"""	172100				12174217, 10721701	Standard	NM_001199917		Approved	AGM1, DKFZP434B187, PAGM	uc011dyz.2	O95394	OTTHUMG00000015110	ENST00000283977.4:c.28G>A	6.37:g.83898451C>T	ENSP00000283977:p.Ala10Thr	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	90	34	0.377778	NM_001199917		Missense_Mutation	SNP	ENST00000283977.4	37		.	.	.	.	.	.	.	.	.	.	C	32	5.185099	0.94885	.	.	ENSG00000013375	ENST00000513973;ENST00000512866;ENST00000283977;ENST00000506587;ENST00000510258;ENST00000507554;ENST00000508748	T;T;T;T;T;T	0.63096	-0.02;-0.02;0.59;-0.02;-0.02;-0.02	5.82	5.82	0.92795	Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (1);Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.000000	0.85682	D	0.000000	D	0.84083	0.5394	H	0.94582	3.555	0.80722	D	1	D;D;D	0.76494	0.999;0.99;0.999	D;D;D	0.74348	0.983;0.955;0.974	D	0.87601	0.2497	10	0.87932	D	0	-9.7285	20.0851	0.97797	0.0:1.0:0.0:0.0	.	119;119;91	E9PF86;B4DX94;O95394	.;.;AGM1_HUMAN	T	91;91;10;119;10;91;119	ENSP00000424874:A91T;ENSP00000421565:A91T;ENSP00000283977:A10T;ENSP00000425809:A119T;ENSP00000425558:A91T;ENSP00000424865:A119T	ENSP00000283977:A10T	A	-	1	0	PGM3	83955170	1.000000	0.71417	0.811000	0.32455	0.624000	0.37722	7.487000	0.81328	2.758000	0.94735	0.650000	0.86243	GCC	.	.	none		0.413	PGM3-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000366385.2	NM_015599	
RIMS2	9699	hgsc.bcm.edu	37	8	104513174	104513174	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:104513174G>A	ENST00000406091.3	+	1	60	c.60G>A	c.(58-60)ccG>ccA	p.P20P	RP11-1C8.4_ENST00000523422.1_RNA|RP11-1C8.4_ENST00000517376.1_RNA	NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	20					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCTCTCAGCCGCCTCTGCAGC	0.647										HNSCC(12;0.0054)																											p.P20P		Atlas-SNP	.											.	RIMS2	1357	.	0			c.G60A						PASS	.						22.0	25.0	24.0					8																	104513174		1877	4089	5966	SO:0001819	synonymous_variant	9699	exon1			TCAGCCGCCTCTG	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.60G>A	8.37:g.104513174G>A		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	93	6	0.0645161	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000406091.3	37	CCDS55269.1																																																																																			.	.	none		0.647	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001100117	
PPP2R5B	5526	hgsc.bcm.edu	37	11	64700699	64700699	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:64700699T>C	ENST00000164133.2	+	13	1949	c.1327T>C	c.(1327-1329)Tac>Cac	p.Y443H		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	443					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						CACAGCCTCCTACAAGCTGGA	0.552																																					p.Y443H		Atlas-SNP	.											.	PPP2R5B	47	.	0			c.T1327C						PASS	.						96.0	81.0	87.0					11																	64700699		2201	4297	6498	SO:0001583	missense	5526	exon13			GCCTCCTACAAGC	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.1327T>C	11.37:g.64700699T>C	ENSP00000164133:p.Tyr443His	Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	64	4	0.0625	NM_006244	Q13853	Missense_Mutation	SNP	ENST00000164133.2	37	CCDS8085.1	.	.	.	.	.	.	.	.	.	.	T	18.88	3.717126	0.68844	.	.	ENSG00000068971	ENST00000164133;ENST00000527441	.	.	.	4.04	4.04	0.47022	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71316	0.3325	M	0.70108	2.13	0.58432	D	0.999999	P	0.44195	0.828	P	0.53912	0.737	T	0.74878	-0.3514	9	0.66056	D	0.02	-16.1599	11.5916	0.50949	0.0:0.0:0.0:1.0	.	443	Q15173	2A5B_HUMAN	H	443	.	ENSP00000164133:Y443H	Y	+	1	0	PPP2R5B	64457275	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.508000	0.81686	2.054000	0.61138	0.459000	0.35465	TAC	.	.	none		0.552	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230402	23230402	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:23230402G>A	ENST00000526893.1	+	1	443	c.169G>A	c.(169-171)Gga>Aga	p.G57R	IGLL5_ENST00000532223.2_Missense_Mutation_p.G57R|IGLL5_ENST00000531372.1_Missense_Mutation_p.G57R|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	57						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						AGCCTCAGTTGGAAGCAGCCG	0.662																																					p.G57R		Atlas-SNP	.											.	IGLL5	26	.	0			c.G169A						PASS	.																																			SO:0001583	missense	100423062	exon1			TCAGTTGGAAGCA	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.169G>A	22.37:g.23230402G>A	ENSP00000431254:p.Gly57Arg	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	146	61	0.417808	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.690900	0.48097	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00587	6.39;6.38	3.92	-1.17	0.09648	.	.	.	.	.	T	0.00496	0.0016	L	0.32530	0.975	0.09310	N	1	B	0.15719	0.014	B	0.11329	0.006	T	0.40079	-0.9582	9	0.37606	T	0.19	.	5.1199	0.14854	0.2033:0.4108:0.3859:0.0	.	57	B9A064	IGLL5_HUMAN	R	57	ENSP00000436353:G57R;ENSP00000431254:G57R	ENSP00000431254:G57R	G	+	1	0	IGLL5	21560402	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.250000	0.08830	-0.072000	0.12864	-0.189000	0.12847	GGA	.	.	none		0.662	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
BTBD10	84280	hgsc.bcm.edu	37	11	13410601	13410601	+	Missense_Mutation	SNP	C	C	T	rs75019394		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:13410601C>T	ENST00000278174.5	-	9	1450	c.1205G>A	c.(1204-1206)cGa>cAa	p.R402Q	BTBD10_ENST00000528120.1_Missense_Mutation_p.R354Q|BTBD10_ENST00000530907.1_Missense_Mutation_p.R410Q	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	402	Interaction with AKT family members. {ECO:0000250|UniProtKB:Q80X66}.					nucleus (GO:0005634)		p.R402Q(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		CCAGGACATTCGAATAAAGGG	0.428																																					p.R402Q		Atlas-SNP	.											BTBD10,NS,carcinoma,0,1	BTBD10	43	1	1	Substitution - Missense(1)	cervix(1)	c.G1205A						scavenged	.						117.0	116.0	117.0					11																	13410601		2200	4294	6494	SO:0001583	missense	84280	exon9			GACATTCGAATAA	AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.1205G>A	11.37:g.13410601C>T	ENSP00000278174:p.Arg402Gln	Somatic	201	0	0		WXS	Illumina HiSeq	Phase_I	186	2	0.0107527	NM_032320	B7Z228|Q86WG1	Missense_Mutation	SNP	ENST00000278174.5	37	CCDS7811.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.665486	0.47677	.	.	ENSG00000148925	ENST00000278174;ENST00000530907;ENST00000528120	T;T;T	0.79247	-1.25;-1.25;-1.25	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.55433	0.1920	N	0.08118	0	0.80722	D	1	P;P;P	0.40794	0.729;0.729;0.729	B;B;B	0.28553	0.091;0.091;0.091	T	0.60120	-0.7325	10	0.22109	T	0.4	-22.28	18.0877	0.89463	0.0:1.0:0.0:0.0	.	410;402;402	B7Z228;D3DQW7;Q9BSF8	.;.;BTBDA_HUMAN	Q	402;410;354	ENSP00000278174:R402Q;ENSP00000431186:R410Q;ENSP00000435257:R354Q	ENSP00000278174:R402Q	R	-	2	0	BTBD10	13367177	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.895000	0.69814	2.664000	0.90586	0.555000	0.69702	CGA	.	.	weak		0.428	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386200.1	NM_032320	
CARD11	84433	hgsc.bcm.edu	37	7	2977605	2977605	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr7:2977605A>G	ENST00000396946.4	-	8	1482	c.1079T>C	c.(1078-1080)aTg>aCg	p.M360T		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	360					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.M353T(1)|p.M353K(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GTGCTTGTACATTTCACAGTC	0.592			Mis		DLBCL																																p.M360T		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	CARD11,colon,carcinoma,-1,4	CARD11	339	4	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.T1079C						PASS	.						143.0	116.0	125.0					7																	2977605		2203	4300	6503	SO:0001583	missense	84433	exon8			TTGTACATTTCAC	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1079T>C	7.37:g.2977605A>G	ENSP00000380150:p.Met360Thr	Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	69	33	0.478261	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	A	18.62	3.663818	0.67700	.	.	ENSG00000198286	ENST00000396946	T	0.32988	1.43	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.32406	0.0828	L	0.54323	1.7	0.58432	D	0.999999	B	0.24823	0.112	B	0.27715	0.082	T	0.12578	-1.0542	10	0.54805	T	0.06	-50.9525	13.8813	0.63684	1.0:0.0:0.0:0.0	.	360	Q9BXL7	CAR11_HUMAN	T	360	ENSP00000380150:M360T	ENSP00000380150:M360T	M	-	2	0	CARD11	2944131	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.048000	0.93830	1.878000	0.54408	0.482000	0.46254	ATG	.	.	none		0.592	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
GDPD4	220032	hgsc.bcm.edu	37	11	76996151	76996151	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:76996151C>T	ENST00000376217.2	-	2	282	c.32G>A	c.(31-33)aGt>aAt	p.S11N	GDPD4_ENST00000527489.1_5'UTR|GDPD4_ENST00000315938.4_Missense_Mutation_p.S11N			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	11					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						AAAGTATTCACTGGATGTTTC	0.383																																					p.S11N		Atlas-SNP	.											.	GDPD4	49	.	0			c.G32A						PASS	.						76.0	67.0	70.0					11																	76996151		2200	4292	6492	SO:0001583	missense	220032	exon2			TATTCACTGGATG	AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.32G>A	11.37:g.76996151C>T	ENSP00000365390:p.Ser11Asn	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	88	26	0.295455	NM_182833	Q7Z5B0	Missense_Mutation	SNP	ENST00000376217.2	37		.	.	.	.	.	.	.	.	.	.	c	0.018	-1.481167	0.01027	.	.	ENSG00000178795	ENST00000376217;ENST00000315938	T;T	0.19669	2.13;2.13	3.94	2.82	0.32997	.	0.095444	0.64402	N	0.000002	T	0.02727	0.0082	N	0.00056	-2.365	0.19775	N	0.99995	B	0.02656	0.0	B	0.01281	0.0	T	0.42085	-0.9472	10	0.02654	T	1	-15.0283	6.3686	0.21469	0.0:0.111:0.0:0.889	.	11	Q6W3E5-2	.	N	11	ENSP00000365390:S11N;ENSP00000320815:S11N	ENSP00000320815:S11N	S	-	2	0	GDPD4	76673799	0.998000	0.40836	1.000000	0.80357	0.434000	0.31775	1.836000	0.39191	0.855000	0.35359	-0.374000	0.07098	AGT	.	.	none		0.383	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382075.1	NM_182833	
PDGFC	56034	hgsc.bcm.edu	37	4	157689051	157689051	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:157689051T>A	ENST00000502773.1	-	5	1285	c.795A>T	c.(793-795)agA>agT	p.R265S	PDGFC_ENST00000541126.1_Missense_Mutation_p.R102S|PDGFC_ENST00000422544.2_Intron|PDGFC_ENST00000542208.1_Missense_Mutation_p.R110S|PDGFC_ENST00000504672.1_Intron	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	265					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		TGGTATCGGTTCTCTTTAGTT	0.453																																					p.R265S		Atlas-SNP	.											.	PDGFC	46	.	0			c.A795T						PASS	.						187.0	171.0	176.0					4																	157689051		2203	4299	6502	SO:0001583	missense	56034	exon5			ATCGGTTCTCTTT	AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.795A>T	4.37:g.157689051T>A	ENSP00000422464:p.Arg265Ser	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	94	38	0.404255	NM_016205	B4DU34|B9EGR8|Q4W5M9|Q9UL22	Missense_Mutation	SNP	ENST00000502773.1	37	CCDS3795.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.076337	0.76415	.	.	ENSG00000145431	ENST00000502773;ENST00000541126;ENST00000542208	T;T;T	0.42131	2.56;1.0;0.98	5.35	1.63	0.23807	Platelet-derived growth factor (PDGF) (3);	0.098787	0.64402	D	0.000003	T	0.51398	0.1672	M	0.63428	1.95	0.48087	D	0.999582	D;B	0.57571	0.98;0.124	P;B	0.57846	0.828;0.247	T	0.50154	-0.8861	10	0.56958	D	0.05	-15.9159	9.5005	0.39015	0.0:0.4019:0.0:0.5981	.	110;265	B4E3A5;Q9NRA1	.;PDGFC_HUMAN	S	265;102;110	ENSP00000422464:R265S;ENSP00000442943:R102S;ENSP00000439728:R110S	ENSP00000422464:R265S	R	-	3	2	PDGFC	157908501	0.987000	0.35691	1.000000	0.80357	0.999000	0.98932	0.193000	0.17116	0.369000	0.24510	0.533000	0.62120	AGA	.	.	none		0.453	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366123.1		
USH2A	7399	hgsc.bcm.edu	37	1	216495278	216495278	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:216495278T>G	ENST00000307340.3	-	9	1977	c.1591A>C	c.(1591-1593)Agc>Cgc	p.S531R	USH2A_ENST00000366943.2_Missense_Mutation_p.S531R|USH2A_ENST00000366942.3_Missense_Mutation_p.S531R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	531	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TATGGCTGGCTTGTTGTGTCG	0.413										HNSCC(13;0.011)																											p.S531R		Atlas-SNP	.											.	USH2A	1168	.	0			c.A1591C						PASS	.						145.0	133.0	137.0					1																	216495278		2203	4300	6503	SO:0001583	missense	7399	exon9			GCTGGCTTGTTGT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1591A>C	1.37:g.216495278T>G	ENSP00000305941:p.Ser531Arg	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	151	9	0.0596026	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	6.897	0.535088	0.13188	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.63913	-0.07;-0.07;-0.07	5.65	2.07	0.26955	EGF-like, laminin (3);	0.596017	0.14863	N	0.293961	T	0.45994	0.1370	L	0.33189	0.99	0.09310	N	1	B;B	0.15473	0.012;0.013	B;B	0.17433	0.005;0.018	T	0.27872	-1.0061	10	0.15952	T	0.53	.	8.4255	0.32727	0.0:0.2872:0.0:0.7128	.	531;531	O75445-2;O75445	.;USH2A_HUMAN	R	531	ENSP00000305941:S531R;ENSP00000355910:S531R;ENSP00000355909:S531R	ENSP00000305941:S531R	S	-	1	0	USH2A	214561901	0.000000	0.05858	0.024000	0.17045	0.041000	0.13682	0.201000	0.17276	0.097000	0.17492	0.455000	0.32223	AGC	.	.	none		0.413	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
TXK	7294	hgsc.bcm.edu	37	4	48096117	48096117	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:48096117C>T	ENST00000264316.4	-	8	771	c.686G>A	c.(685-687)tGg>tAg	p.W229*	TXK_ENST00000510457.1_5'UTR	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	229	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						CTGGTGATACCAGATTAACTC	0.483																																					p.W229X		Atlas-SNP	.											TXK,rectum,carcinoma,+1,1	TXK	58	1	0			c.G686A						scavenged	.						150.0	145.0	147.0					4																	48096117		2203	4300	6503	SO:0001587	stop_gained	7294	exon8			TGATACCAGATTA	L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.686G>A	4.37:g.48096117C>T	ENSP00000264316:p.Trp229*	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	86	2	0.0232558	NM_003328	Q14220	Nonsense_Mutation	SNP	ENST00000264316.4	37	CCDS3480.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.509801	0.85282	.	.	ENSG00000074966	ENST00000264316	.	.	.	5.23	1.21	0.21127	.	0.801655	0.11137	N	0.595713	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	1.0612	0.01600	0.1533:0.3522:0.1505:0.3441	.	.	.	.	X	229	.	ENSP00000264316:W229X	W	-	2	0	TXK	47790874	0.149000	0.22717	0.973000	0.42090	0.954000	0.61252	1.105000	0.31086	0.284000	0.22305	0.650000	0.86243	TGG	.	.	none		0.483	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219869.7	NM_003328	
MUC4	4585	hgsc.bcm.edu	37	3	195518110	195518110	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:195518110G>A	ENST00000463781.3	-	2	800	c.341C>T	c.(340-342)gCt>gTt	p.A114V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A114V|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	119					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ATCTGGAGGAGCTGTCTCCAT	0.468																																					p.A114V		Atlas-SNP	.											MUC4_ENST00000463781,caecum,adenoma,0,1	MUC4	1505	1	0			c.C341T						PASS	.						169.0	145.0	153.0					3																	195518110		1992	4142	6134	SO:0001583	missense	4585	exon2			GGAGGAGCTGTCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.341C>T	3.37:g.195518110G>A	ENSP00000417498:p.Ala114Val	Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	156	11	0.0705128	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.679	0.493843	0.12702	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.32272	1.46;1.47	3.46	1.61	0.23674	.	4.057260	0.00950	N	0.002944	T	0.20007	0.0481	N	0.19112	0.55	0.09310	N	1	B	0.34015	0.435	B	0.29353	0.101	T	0.16041	-1.0416	10	0.35671	T	0.21	-0.1442	5.2629	0.15584	0.277:0.0:0.723:0.0	.	114	E7ESK3	.	V	114;114;88	ENSP00000417498:A114V;ENSP00000420243:A114V	ENSP00000376209:A88V	A	-	2	0	MUC4	197002505	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.806000	0.00758	0.455000	0.26910	-0.302000	0.09304	GCT	.	.	none		0.468	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
KRTAP1-1	81851	hgsc.bcm.edu	37	17	39197304	39197304	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:39197304T>C	ENST00000306271.4	-	1	409	c.346A>G	c.(346-348)Atc>Gtc	p.I116V		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	116						keratin filament (GO:0045095)		p.I116V(1)		NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CACCACCTGATACGGGTGCTC	0.662																																					p.I116V		Atlas-SNP	.											KRTAP1-1,NS,malignant_melanoma,0,1	KRTAP1-1	23	1	1	Substitution - Missense(1)	NS(1)	c.A346G						scavenged	.						22.0	27.0	25.0					17																	39197304		2019	4148	6167	SO:0001583	missense	81851	exon1			ACCTGATACGGGT	AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.346A>G	17.37:g.39197304T>C	ENSP00000305975:p.Ile116Val	Somatic	71	3	0.0422535		WXS	Illumina HiSeq	Phase_I	120	7	0.0583333	NM_030967	A6NC32|Q96S60|Q96S67	Missense_Mutation	SNP	ENST00000306271.4	37	CCDS42324.1	.	.	.	.	.	.	.	.	.	.	T	8.173	0.792133	0.16258	.	.	ENSG00000188581	ENST00000306271;ENST00000543328	T	0.29655	1.56	4.28	-1.23	0.09465	.	.	.	.	.	T	0.12135	0.0295	N	0.03253	-0.375	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.34079	-0.9843	9	0.20046	T	0.44	.	9.4726	0.38851	0.0:0.573:0.0:0.427	.	116	Q07627	KRA11_HUMAN	V	116;106	ENSP00000305975:I116V	ENSP00000305975:I116V	I	-	1	0	KRTAP1-1	36450830	0.132000	0.22450	0.024000	0.17045	0.516000	0.34256	0.017000	0.13399	-0.199000	0.10317	0.529000	0.55759	ATC	.	.	none		0.662	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1	NM_030967	
OR2W5	441932	hgsc.bcm.edu	37	1	247654916	247654916	+	RNA	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:247654916A>G	ENST00000522351.1	+	0	547							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GTGTCCTCAGACGATGCAGCT	0.562																																					p.T163A		Atlas-SNP	.											OR2W5,NS,adenocarcinoma,-2,1	OR2W5	97	1	0			c.A487G						scavenged	.						119.0	94.0	103.0					1																	247654916		2203	4300	6503			441932	exon1			CCTCAGACGATGC			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247654916A>G		Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	124	4	0.0322581	NM_001004698	B9EH85	Missense_Mutation	SNP	ENST00000522351.1	37																																																																																				.	.	none		0.562	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698	
FAM86C1	55199	hgsc.bcm.edu	37	11	71498601	71498601	+	Missense_Mutation	SNP	G	G	T	rs12283300	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:71498601G>T	ENST00000359244.4	+	1	42	c.19G>T	c.(19-21)Gcg>Tcg	p.A7S	FAM86C1_ENST00000426628.2_Missense_Mutation_p.A7S|FAM86C1_ENST00000346333.6_Missense_Mutation_p.A7S	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	7			A -> S (in dbSNP:rs12283300). {ECO:0000269|PubMed:14702039}.							lung(1)	1						CGAGGAGAACGCGGGGAGCGA	0.736													.|||	2243	0.447883	0.3328	0.3458	5008	,	,		9168	0.3423		0.5646	False		,,,				2504	0.6646				p.A7S		Atlas-SNP	.											FAM86C1_ENST00000426628,rectum,carcinoma,0,2	FAM86C1	27	2	0			c.G19T						scavenged	.						5.0	5.0	5.0					11																	71498601		2022	3792	5814	SO:0001583	missense	55199	exon1			GAGAACGCGGGGA	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.19G>T	11.37:g.71498601G>T	ENSP00000352182:p.Ala7Ser	Somatic	8	1	0.125		WXS	Illumina HiSeq	Phase_I	11	3	0.272727	NM_152563	Q8N5D3	Missense_Mutation	SNP	ENST00000359244.4	37	CCDS41686.1	838	0.3836996336996337	160	0.3252032520325203	130	0.35911602209944754	166	0.2902097902097902	382	0.503957783641161	.	11.43	1.635370	0.29068	.	.	ENSG00000158483	ENST00000346333;ENST00000359244;ENST00000426628;ENST00000528685	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	1.78	0.792	0.18625	.	.	.	.	.	T	0.00012	0.0000	L	0.43152	1.355	0.80722	P	0.0	D;D;P	0.61080	0.961;0.989;0.561	P;D;B	0.74674	0.537;0.984;0.053	T	0.47611	-0.9104	8	0.72032	D	0.01	.	3.6282	0.08121	0.2602:0.0:0.7398:0.0	rs12283300;rs12283300	7;7;7	G3V0F7;Q9NVL1-2;Q9NVL1	.;.;FA86C_HUMAN	S	7	ENSP00000325662:A7S;ENSP00000352182:A7S;ENSP00000391329:A7S;ENSP00000436598:A7S	ENSP00000325662:A7S	A	+	1	0	FAM86C1	71176249	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	0.154000	0.16343	0.968000	0.38212	0.184000	0.17185	GCG	T|1.000;|0.000	1.000	weak		0.736	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
GUCY1A3	2982	hgsc.bcm.edu	37	4	156634257	156634257	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:156634257A>G	ENST00000296518.7	+	7	1303	c.1094A>G	c.(1093-1095)gAc>gGc	p.D365G	GUCY1A3_ENST00000455639.2_Missense_Mutation_p.D365G|GUCY1A3_ENST00000513574.1_Missense_Mutation_p.D365G|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.D365G|GUCY1A3_ENST00000511507.1_Missense_Mutation_p.D365G|GUCY1A3_ENST00000506455.1_Missense_Mutation_p.D365G|GUCY1A3_ENST00000393832.3_Missense_Mutation_p.D107G			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	365					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TAGGTTATGGACCTCAAAGGC	0.408																																					p.D365G		Atlas-SNP	.											.	GUCY1A3	133	.	0			c.A1094G						PASS	.						63.0	61.0	61.0					4																	156634257		2203	4300	6503	SO:0001583	missense	2982	exon7			TTATGGACCTCAA		CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1094A>G	4.37:g.156634257A>G	ENSP00000296518:p.Asp365Gly	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	113	39	0.345133	NM_001130687	D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	37	CCDS34085.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.681155	0.88542	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000393832;ENST00000296518;ENST00000513574	D;D;D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37;-2.37;-2.37	6.03	6.03	0.97812	Haem NO binding associated (1);	0.000000	0.64402	D	0.000003	D	0.90546	0.7037	L	0.40543	1.245	0.80722	D	1	P;P	0.46142	0.873;0.873	P;P	0.56088	0.791;0.791	D	0.90068	0.4161	10	0.42905	T	0.14	.	16.5582	0.84512	1.0:0.0:0.0:0.0	.	365;365	B3KU69;Q02108	.;GCYA3_HUMAN	G	365;365;365;365;107;365;365	ENSP00000424361:D365G;ENSP00000421493:D365G;ENSP00000426968:D365G;ENSP00000412201:D365G;ENSP00000377418:D107G;ENSP00000296518:D365G;ENSP00000426040:D365G	ENSP00000296518:D365G	D	+	2	0	GUCY1A3	156853707	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.930000	0.92872	2.308000	0.77769	0.533000	0.62120	GAC	.	.	none		0.408	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2		
PIM1	5292	hgsc.bcm.edu	37	6	37138355	37138355	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:37138355C>T	ENST00000373509.5	+	1	377	c.4C>T	c.(4-6)Ctc>Ttc	p.L2F		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	93					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.L2V(1)|p.L2F(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GGTTGGGATGCTCTTGTCCAA	0.701			T	BCL6	NHL																																p.L93F		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,3	PIM1	71	3	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.C277T						PASS	.						30.0	30.0	30.0					6																	37138355		2201	4298	6499	SO:0001583	missense	5292	exon1			GGGATGCTCTTGT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.4C>T	6.37:g.37138355C>T	ENSP00000362608:p.Leu2Phe	Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	33	10	0.30303	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.693535	0.88735	.	.	ENSG00000137193	ENST00000373509	T	0.71222	-0.55	4.05	4.05	0.47172	.	0.000000	0.32147	N	0.006517	T	0.61899	0.2384	N	0.08118	0	0.48830	D	0.999711	D	0.76494	0.999	D	0.66196	0.942	T	0.73933	-0.3826	10	0.72032	D	0.01	.	16.7252	0.85419	0.0:1.0:0.0:0.0	.	93	P11309	PIM1_HUMAN	F	2	ENSP00000362608:L2F	ENSP00000362608:L2F	L	+	1	0	PIM1	37246333	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.672000	0.61597	2.211000	0.71520	0.542000	0.68232	CTC	.	.	none		0.701	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
OR5C1	392391	hgsc.bcm.edu	37	9	125551542	125551542	+	Silent	SNP	C	C	T	rs201755571		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:125551542C>T	ENST00000373680.2	+	1	393	c.331C>T	c.(331-333)Ctg>Ttg	p.L111L		NM_001001923.1	NP_001001923.1	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C, member 1	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(5)|skin(1)	20						CTTTGCAGGTCTGGCTGATAC	0.567																																					p.L111L		Atlas-SNP	.											.	OR5C1	45	.	0			c.C331T						PASS	.						136.0	121.0	126.0					9																	125551542		2203	4300	6503	SO:0001819	synonymous_variant	392391	exon1			GCAGGTCTGGCTG	AF399514	CCDS35131.1	9q34.2	2012-08-09			ENSG00000148215	ENSG00000148215		"""GPCR / Class A : Olfactory receptors"""	8331	protein-coding gene	gene with protein product				OR5C2P			Standard	NM_001001923		Approved	OR9-F, hRPK-465_F_21	uc011lzd.2	Q8NGR4	OTTHUMG00000020622	ENST00000373680.2:c.331C>T	9.37:g.125551542C>T		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	81	4	0.0493827	NM_001001923	B2RN54|B9EGT0|Q96RC4	Silent	SNP	ENST00000373680.2	37	CCDS35131.1																																																																																			C|1.000;A|0.000	.	alt		0.567	OR5C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053953.1		
KIR3DL1	3811	hgsc.bcm.edu	37	19	55324635	55324635	+	Intron	SNP	T	T	C	rs649216	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:55324635T>C	ENST00000538269.1	+	2	61				KIR2DL4_ENST00000359085.4_Silent_p.F254F|KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000396293.1_Intron|KIR2DL4_ENST00000396284.2_Silent_p.F252F|KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000346587.4_Intron|KIR2DL4_ENST00000345540.5_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000357494.4_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.F254F(2)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		TCATCCTCTTTACCATCCTTC	0.502													c|||	2958	0.590655	0.6528	0.5605	5008	,	,		6076	0.8056		0.4871	False		,,,				2504	0.4131				p.F254F		Atlas-SNP	.											KIR2DL4,NS,carcinoma,0,2	KIR2DL4	62	2	2	Substitution - coding silent(2)	prostate(2)	c.C762C						scavenged	.						121.0	187.0	166.0					19																	55324635		1991	4152	6143	SO:0001627	intron_variant	3805	exon6			CCTCTTTACCATC	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-4354T>C	19.37:g.55324635T>C		Somatic	2	2	1		WXS	Illumina HiSeq	Phase_I	14	14	1	NM_001080772	O43473|Q14946|Q16541	Silent	SNP	ENST00000538269.1	37																																																																																				T|0.315;C|0.685	0.685	strong		0.502	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289	
DUSP2	1844	hgsc.bcm.edu	37	2	96810590	96810590	+	Silent	SNP	G	G	C	rs187607778		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:96810590G>C	ENST00000288943.4	-	2	505	c.420C>G	c.(418-420)ccC>ccG	p.P140P	AC012307.2_ENST00000449242.1_lincRNA	NM_004418.3	NP_004409.1	Q05923	DUS2_HUMAN	dual specificity phosphatase 2	140	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(1)|lung(2)|skin(1)	5		Ovarian(717;0.0228)				AGCACAGATCGGGACAGCAGC	0.672													G|||	1	0.000199681	0.0	0.0014	5008	,	,		10971	0.0		0.0	False		,,,				2504	0.0				p.P140P		Atlas-SNP	.											DUSP2,NS,carcinoma,0,1	DUSP2	20	1	0			c.C420G						PASS	.						15.0	20.0	18.0					2																	96810590		2129	4223	6352	SO:0001819	synonymous_variant	1844	exon2			CAGATCGGGACAG	L11329	CCDS2016.1	2q11	2011-06-09			ENSG00000158050	ENSG00000158050		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3068	protein-coding gene	gene with protein product		603068				7806236, 7590752, 12673251	Standard	NM_004418		Approved	PAC-1	uc002svk.4	Q05923	OTTHUMG00000130456	ENST00000288943.4:c.420C>G	2.37:g.96810590G>C		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	97	48	0.494845	NM_004418	Q53T45	Silent	SNP	ENST00000288943.4	37	CCDS2016.1																																																																																			C|0.000;G|1.000	0.000	strong		0.672	DUSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252847.1	NM_004418	
ARHGAP18	93663	hgsc.bcm.edu	37	6	129939832	129939832	+	Splice_Site	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:129939832C>T	ENST00000368149.2	-	6	1040	c.952G>A	c.(952-954)Gat>Aat	p.D318N		NM_033515.2	NP_277050.2			Rho GTPase activating protein 18											NS(2)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(3)	18				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		TCATGATTACCTTTTGTTTTG	0.373																																					p.D318N		Atlas-SNP	.											ARHGAP18,NS,carcinoma,0,1	ARHGAP18	52	1	0			c.G952A						scavenged	.						76.0	65.0	69.0					6																	129939832		2199	4294	6493	SO:0001630	splice_region_variant	93663	exon6			GATTACCTTTTGT	AB053293	CCDS34535.1	6q23.1	2011-06-29			ENSG00000146376	ENSG00000146376		"""Rho GTPase activating proteins"""	21035	protein-coding gene	gene with protein product		613351					Standard	NM_033515		Approved	MacGAP, bA307O14.2	uc003qbr.3	Q8N392	OTTHUMG00000015547	ENST00000368149.2:c.952+1G>A	6.37:g.129939832C>T		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	106	2	0.0188679	NM_033515		Missense_Mutation	SNP	ENST00000368149.2	37	CCDS34535.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551461	0.65311	.	.	ENSG00000146376	ENST00000368149;ENST00000275189	.	.	.	5.36	4.5	0.54988	Rho GTPase-activating protein domain (1);Rho GTPase activation protein (1);	0.154524	0.64402	N	0.000014	T	0.57858	0.2082	M	0.70275	2.135	0.44825	D	0.997837	P;P	0.48911	0.917;0.914	P;P	0.52823	0.584;0.71	T	0.61407	-0.7069	8	.	.	.	.	14.1828	0.65586	0.0:0.9287:0.0:0.0713	.	318;318	A9UK01;Q8N392	.;RHG18_HUMAN	N	273;318	.	.	D	-	1	0	ARHGAP18	129981525	1.000000	0.71417	1.000000	0.80357	0.366000	0.29705	6.238000	0.72350	1.492000	0.48499	0.643000	0.83706	GAT	.	.	none		0.373	ARHGAP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042185.2	NM_033515	Missense_Mutation
CNTNAP4	85445	hgsc.bcm.edu	37	16	76555939	76555939	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr16:76555939C>T	ENST00000476707.1	+	16	2688	c.2549C>T	c.(2548-2550)cCg>cTg	p.P850L	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.P846L|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.P774L|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.P798L			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	847	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TTTCCAGCTCCGACAGTAGTG	0.458																																					p.P774L		Atlas-SNP	.											CNTNAP4_ENST00000478060,NS,carcinoma,0,2	CNTNAP4	600	2	0			c.C2321T						scavenged	.						172.0	168.0	169.0					16																	76555939		1951	4163	6114	SO:0001583	missense	85445	exon16			CAGCTCCGACAGT	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.2549C>T	16.37:g.76555939C>T	ENSP00000417628:p.Pro850Leu	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	95	2	0.0210526	NM_138994	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	C	17.32	3.360903	0.61403	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22	4.87	4.87	0.63330	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.41097	D	0.000946	D	0.88819	0.6540	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.994;0.984;1.0	D	0.90109	0.4190	9	0.87932	D	0	.	18.5518	0.91068	0.0:1.0:0.0:0.0	.	774;850;847	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	L	846;798;774;850	ENSP00000306893:P846L;ENSP00000439733:P798L;ENSP00000418741:P774L;ENSP00000417628:P850L	ENSP00000306893:P846L	P	+	2	0	CNTNAP4	75113440	1.000000	0.71417	0.956000	0.39512	0.053000	0.15095	7.559000	0.82265	2.678000	0.91216	0.655000	0.94253	CCG	.	.	none		0.458	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
CBX3	11335	hgsc.bcm.edu	37	7	26245986	26245986	+	Splice_Site	SNP	A	A	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr7:26245986A>T	ENST00000337620.4	+	3	452		c.e3-1		CBX3_ENST00000497498.1_Splice_Site|CBX3_ENST00000396386.2_Splice_Site|CBX3_ENST00000409747.1_Splice_Site	NM_007276.4	NP_009207.2	Q13185	CBX3_HUMAN	chromobox homolog 3						chromatin remodeling (GO:0006338)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome, centromeric region (GO:0000779)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nuclear pericentric heterochromatin (GO:0031618)|nucleus (GO:0005634)|spindle (GO:0005819)	enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)|identical protein binding (GO:0042802)|protein domain specific binding (GO:0019904)			endometrium(4)|large_intestine(2)|lung(2)|ovary(1)	9						GTTTTATTTTAGCAAAAAATG	0.308																																					.		Atlas-SNP	.											CBX3,colon,adenoma,0,1	CBX3	25	1	0			c.25-2A>T						scavenged	.						32.0	33.0	32.0					7																	26245986		2200	4300	6500	SO:0001630	splice_region_variant	11335	exon3			TATTTTAGCAAAA	U26312	CCDS5398.1	7p15.2	2010-07-06	2010-06-24		ENSG00000122565	ENSG00000122565			1553	protein-coding gene	gene with protein product	"""HP1 gamma homolog (Drosophila)"""	604477	"""chromobox homolog 3 (Drosophila HP1 gamma)"""			8663349	Standard	NM_016587		Approved	HP1Hs-gamma	uc003sxu.3	Q13185	OTTHUMG00000022911	ENST00000337620.4:c.25-1A>T	7.37:g.26245986A>T		Somatic	20	1	0.05		WXS	Illumina HiSeq	Phase_I	40	5	0.125	NM_007276	Q96CD7|Q99409|Q9BVS3|Q9P0Z6	Splice_Site	SNP	ENST00000337620.4	37	CCDS5398.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.999549	0.54147	.	.	ENSG00000122565	ENST00000337620;ENST00000396386;ENST00000456948;ENST00000409747	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2344	0.54508	0.8582:0.1418:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBX3	26212511	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	3.092000	0.50207	2.323000	0.78572	0.533000	0.62120	.	.	.	none		0.308	CBX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214117.1	NM_007276	Intron
UGT1A3	54659	hgsc.bcm.edu	37	2	234638445	234638445	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:234638445C>T	ENST00000482026.1	+	1	692	c.673C>T	c.(673-675)Cat>Tat	p.H225Y	UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000609767.1_Missense_Mutation_p.H225Y|UGT1A5_ENST00000373414.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A1_ENST00000608381.1_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	225					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)	p.H225Y(4)		breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	CTACATTTGCCATGCTTTTTC	0.463																																					p.H225Y		Atlas-SNP	.											UGT1A3,NS,carcinoma,0,4	UGT1A3	91	4	4	Substitution - Missense(4)	kidney(4)	c.C673T						scavenged	.						256.0	243.0	248.0					2																	234638445		2203	4300	6503	SO:0001583	missense	54659	exon1			ATTTGCCATGCTT	M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.673C>T	2.37:g.234638445C>T	ENSP00000418532:p.His225Tyr	Somatic	268	2	0.00746269		WXS	Illumina HiSeq	Phase_I	328	6	0.0182927	NM_019093	B8K287	Missense_Mutation	SNP	ENST00000482026.1	37	CCDS2509.1	.	.	.	.	.	.	.	.	.	.	c	3.832	-0.035541	0.07497	.	.	ENSG00000243135	ENST00000482026	T	0.59906	0.23	4.0	-4.48	0.03515	.	.	.	.	.	T	0.30166	0.0756	N	0.12502	0.225	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.008	T	0.13629	-1.0502	9	0.25106	T	0.35	.	4.339	0.11101	0.3718:0.1529:0.3968:0.0785	.	225;225	Q5DT01;P35503	.;UD13_HUMAN	Y	225	ENSP00000418532:H225Y	ENSP00000418532:H225Y	H	+	1	0	UGT1A3	234303184	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-4.869000	0.00176	-1.017000	0.03367	-0.455000	0.05494	CAT	.	.	none		0.463	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130983.1	NM_019093	
NPAS4	266743	hgsc.bcm.edu	37	11	66191437	66191437	+	Missense_Mutation	SNP	C	C	A	rs145746289		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:66191437C>A	ENST00000311034.2	+	7	1252	c.1076C>A	c.(1075-1077)aCt>aAt	p.T359N		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	359					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						TGCTCCAGCACTAACCCACTC	0.557																																					p.T359N		Atlas-SNP	.											.	NPAS4	133	.	0			c.C1076A						PASS	.						148.0	153.0	152.0					11																	66191437		2200	4295	6495	SO:0001583	missense	266743	exon7			CCAGCACTAACCC	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1076C>A	11.37:g.66191437C>A	ENSP00000311196:p.Thr359Asn	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	49	17	0.346939	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	37	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720846	0.30503	.	.	ENSG00000174576	ENST00000311034	T	0.43688	0.94	4.81	3.88	0.44766	.	0.870088	0.09718	N	0.764833	T	0.25494	0.0620	N	0.08118	0	0.22468	N	0.999071	B	0.14438	0.01	B	0.13407	0.009	T	0.16482	-1.0401	10	0.23302	T	0.38	0.8502	12.7895	0.57526	0.0:0.8339:0.1661:0.0	.	359	Q8IUM7	NPAS4_HUMAN	N	359	ENSP00000311196:T359N	ENSP00000311196:T359N	T	+	2	0	NPAS4	65948013	0.994000	0.37717	0.903000	0.35520	0.977000	0.68977	3.604000	0.54081	1.219000	0.43474	0.563000	0.77884	ACT	C|1.000;T|0.000	.	alt		0.557	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
DNAH6	1768	hgsc.bcm.edu	37	2	84785000	84785000	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:84785000A>G	ENST00000237449.6	+	10	1752	c.1744A>G	c.(1744-1746)Agt>Ggt	p.S582G	DNAH6_ENST00000389394.3_Missense_Mutation_p.S582G|DNAH6_ENST00000398278.2_Missense_Mutation_p.S582G			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	582	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AACTGGGCCAAGTTTAGCAGC	0.338																																					p.S582G		Atlas-SNP	.											.	DNAH6	194	.	0			c.A1744G						PASS	.						90.0	89.0	89.0					2																	84785000		2203	4300	6503	SO:0001583	missense	1768	exon11			GGGCCAAGTTTAG	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1744A>G	2.37:g.84785000A>G	ENSP00000237449:p.Ser582Gly	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	51	18	0.352941	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	11.56	1.675857	0.29783	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.25749	1.78;1.91;1.78	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000007	T	0.30479	0.0766	M	0.61703	1.905	0.23920	N	0.996469	B;P	0.38827	0.0;0.649	B;B	0.41510	0.0;0.359	T	0.16837	-1.0389	10	0.25106	T	0.35	.	13.8456	0.63466	1.0:0.0:0.0:0.0	.	582;161	Q9C0G6;Q9C0G6-3	DYH6_HUMAN;.	G	582	ENSP00000374045:S582G;ENSP00000381326:S582G;ENSP00000237449:S582G	ENSP00000237449:S582G	S	+	1	0	DNAH6	84638511	1.000000	0.71417	0.627000	0.29227	0.457000	0.32468	5.904000	0.69886	1.914000	0.55421	0.459000	0.35465	AGT	.	.	none		0.338	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DTD2	112487	hgsc.bcm.edu	37	14	31926584	31926584	+	Missense_Mutation	SNP	G	G	A	rs17097904	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr14:31926584G>A	ENST00000310850.4	-	1	132	c.16C>T	c.(16-18)Cgg>Tgg	p.R6W	RP11-176H8.1_ENST00000547378.1_Missense_Mutation_p.R6W|DTD2_ENST00000356180.4_Missense_Mutation_p.R6W	NM_080664.2	NP_542395.1	Q96FN9	DTD2_HUMAN	D-tyrosyl-tRNA deacylase 2 (putative)	6			R -> W (in dbSNP:rs17097904).		D-amino acid catabolic process (GO:0019478)	cytoplasm (GO:0005737)	hydrolase activity, acting on ester bonds (GO:0016788)	p.R6W(1)									TGAGGAATCCGGCTACCCTCA	0.697																																					p.R6W		Atlas-SNP	.											C14orf126,third_ventricle,glioma,0,2	.	.	2	1	Substitution - Missense(1)	skin(1)	c.C16T						scavenged	.						12.0	12.0	12.0					14																	31926584		2183	4278	6461	SO:0001583	missense	112487	exon1			GAATCCGGCTACC	BC010618	CCDS9643.1	14q12	2012-09-25	2012-09-25	2012-09-25	ENSG00000129480	ENSG00000129480			20277	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 126"""	C14orf126			Standard	NM_080664		Approved	MGC9912	uc001wrj.3	Q96FN9	OTTHUMG00000140205	ENST00000310850.4:c.16C>T	14.37:g.31926584G>A	ENSP00000312224:p.Arg6Trp	Somatic	71	3	0.0422535		WXS	Illumina HiSeq	Phase_I	116	12	0.103448	NM_080664	D3DS87	Missense_Mutation	SNP	ENST00000310850.4	37	CCDS9643.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758136	0.69763	.	.	ENSG00000203546;ENSG00000129480;ENSG00000129480	ENST00000547378;ENST00000310850;ENST00000356180	T;T;T	0.55052	0.54;0.71;0.71	4.84	2.97	0.34412	D-Tyr tRNAtyr deacylase-like domain (1);	0.302778	0.30901	N	0.008651	T	0.52419	0.1733	M	0.69823	2.125	0.36855	D	0.888115	D	0.67145	0.996	B	0.43623	0.425	T	0.65220	-0.6221	10	0.87932	D	0	.	11.9711	0.53063	0.0:0.0:0.5428:0.4572	rs17097904	6	Q96FN9	DTD2_HUMAN	W	6	ENSP00000447056:R6W;ENSP00000312224:R6W;ENSP00000348503:R6W	ENSP00000312224:R6W	R	-	1	2	C14orf126;RP11-176H8.1	30996335	0.001000	0.12720	0.005000	0.12908	0.004000	0.04260	0.080000	0.14802	0.618000	0.30179	0.561000	0.74099	CGG	.	.	weak		0.697	DTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276614.2	NM_080664	
CLIP1	6249	hgsc.bcm.edu	37	12	122839024	122839024	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:122839024A>G	ENST00000540338.1	-	6	1324	c.1283T>C	c.(1282-1284)cTc>cCc	p.L428P	CLIP1_ENST00000361654.4_Missense_Mutation_p.L428P|CLIP1_ENST00000545889.1_Missense_Mutation_p.L129P|CLIP1_ENST00000537178.1_Missense_Mutation_p.L428P|CLIP1_ENST00000302528.7_Missense_Mutation_p.L428P|CLIP1_ENST00000358808.2_Missense_Mutation_p.L428P			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	428					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		AAGCTGGTTGAGAAGCTCCAC	0.502																																					p.L428P		Atlas-SNP	.											CLIP1,pharynx,carcinoma,+1,1	CLIP1	126	1	0			c.T1283C						scavenged	.						136.0	109.0	118.0					12																	122839024		2203	4300	6503	SO:0001583	missense	6249	exon7			TGGTTGAGAAGCT		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.1283T>C	12.37:g.122839024A>G	ENSP00000439093:p.Leu428Pro	Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	125	4	0.032	NM_002956	A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	37	CCDS58285.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.719672	0.89205	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338;ENST00000540304;ENST00000450731;ENST00000537004	T;T;T;T;T;T;T	0.70399	2.59;0.46;0.46;0.48;0.51;-0.06;-0.48	5.84	5.84	0.93424	.	0.062472	0.64402	D	0.000003	T	0.80959	0.4724	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.988;0.991;0.997;0.997;0.993	T	0.79300	-0.1860	10	0.35671	T	0.21	-6.8179	16.2108	0.82158	1.0:0.0:0.0:0.0	.	362;129;428;428;428	F6VGP8;F5H0N7;P30622-2;P30622-1;P30622	.;.;.;.;CLIP1_HUMAN	P	129;428;428;273;428;428;362;13;362	ENSP00000438743:L129P;ENSP00000303585:L428P;ENSP00000351665:L428P;ENSP00000445531:L428P;ENSP00000439093:L428P;ENSP00000437786:L362P;ENSP00000441409:L362P	ENSP00000303585:L428P	L	-	2	0	CLIP1	121404977	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.339000	0.96797	2.232000	0.73038	0.533000	0.62120	CTC	.	.	none		0.502	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
BOD1L1	259282	hgsc.bcm.edu	37	4	13602085	13602085	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:13602085T>C	ENST00000040738.5	-	10	6574	c.6439A>G	c.(6439-6441)Agc>Ggc	p.S2147G		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2147						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S2147G(1)									TCCCCTATGCTTGTGGAAATC	0.502																																					p.S2147G		Atlas-SNP	.											BOD1L,NS,carcinoma,0,1	.	.	1	1	Substitution - Missense(1)	kidney(1)	c.A6439G						scavenged	.						83.0	73.0	77.0					4																	13602085		2203	4300	6503	SO:0001583	missense	259282	exon10			CTATGCTTGTGGA	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6439A>G	4.37:g.13602085T>C	ENSP00000040738:p.Ser2147Gly	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	65	3	0.0461538	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	20.9	4.072314	0.76415	.	.	ENSG00000038219	ENST00000040738	T	0.16457	2.34	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000001	T	0.43411	0.1246	M	0.78456	2.415	0.40176	D	0.977236	D	0.76494	0.999	D	0.78314	0.991	T	0.47368	-0.9123	10	0.87932	D	0	-5.3309	14.1665	0.65480	0.0:0.0:0.0:1.0	.	2147	Q8NFC6	BOD1L_HUMAN	G	2147	ENSP00000040738:S2147G	ENSP00000040738:S2147G	S	-	1	0	BOD1L	13211183	1.000000	0.71417	0.997000	0.53966	0.856000	0.48823	4.896000	0.63222	2.083000	0.62718	0.454000	0.30748	AGC	.	.	none		0.502	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
RNF123	63891	hgsc.bcm.edu	37	3	49757994	49757994	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:49757994G>A	ENST00000327697.6	+	36	3695	c.3551G>A	c.(3550-3552)cGc>cAc	p.R1184H	RNF123_ENST00000433785.1_Missense_Mutation_p.R296H|GMPPB_ENST00000480687.1_3'UTR|RNF123_ENST00000497099.1_3'UTR|AMIGO3_ENST00000320431.7_5'Flank|AMIGO3_ENST00000535833.1_5'UTR|GMPPB_ENST00000308375.6_3'UTR	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	1184					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		TTCCAGCTACGCTCAATATGC	0.617																																					p.R1184H		Atlas-SNP	.											.	RNF123	100	.	0			c.G3551A						PASS	.						56.0	50.0	52.0					3																	49757994		2203	4300	6503	SO:0001583	missense	63891	exon36			AGCTACGCTCAAT	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.3551G>A	3.37:g.49757994G>A	ENSP00000328287:p.Arg1184His	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	105	42	0.4	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877886	0.51801	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000433785	T	0.72725	-0.68	5.29	5.29	0.74685	.	0.059077	0.64402	D	0.000001	T	0.65207	0.2669	L	0.40543	1.245	0.53688	D	0.999979	B	0.15473	0.013	B	0.08055	0.003	T	0.61734	-0.7002	10	0.59425	D	0.04	-23.7591	18.1046	0.89516	0.0:0.0:1.0:0.0	.	1184	Q5XPI4	RN123_HUMAN	H	1184;1184;296	ENSP00000328287:R1184H	ENSP00000328287:R1184H	R	+	2	0	RNF123	49732998	0.990000	0.36364	0.988000	0.46212	0.910000	0.53928	3.769000	0.55303	2.756000	0.94617	0.561000	0.74099	CGC	.	.	none		0.617	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
DCHS2	54798	hgsc.bcm.edu	37	4	155225950	155225950	+	Missense_Mutation	SNP	C	C	T	rs140326799		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:155225950C>T	ENST00000357232.4	-	17	4110	c.4111G>A	c.(4111-4113)Gca>Aca	p.A1371T		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1371	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A1371T(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AACTCTGGTGCGTGATCGTTT	0.448																																					p.A1371T		Atlas-SNP	.											DCHS2,colon,carcinoma,0,1	DCHS2	594	1	1	Substitution - Missense(1)	large_intestine(1)	c.G4111A						scavenged	.	C	THR/ALA	0,4406		0,0,2203	83.0	76.0	79.0		4111	2.7	0.0	4	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	no	missense	DCHS2	NM_017639.3	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1371/2917	155225950	1,13005	2203	4300	6503	SO:0001583	missense	54798	exon17			CTGGTGCGTGATC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.4111G>A	4.37:g.155225950C>T	ENSP00000349768:p.Ala1371Thr	Somatic	213	0	0		WXS	Illumina HiSeq	Phase_I	232	3	0.012931	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	8.813	0.935752	0.18206	0.0	1.16E-4	ENSG00000197410	ENST00000357232	T	0.61627	0.09	5.67	2.65	0.31530	Cadherin (3);Cadherin-like (1);	0.469001	0.20009	N	0.101161	T	0.39627	0.1085	L	0.58669	1.825	0.40099	D	0.976346	B	0.31968	0.349	B	0.17722	0.019	T	0.29027	-1.0025	10	0.06099	T	0.92	.	4.7129	0.12880	0.1495:0.4321:0.0:0.4184	.	1371	Q6V1P9	PCD23_HUMAN	T	1371	ENSP00000349768:A1371T	ENSP00000349768:A1371T	A	-	1	0	DCHS2	155445400	0.000000	0.05858	0.013000	0.15412	0.679000	0.39708	-0.256000	0.08757	0.182000	0.20032	0.655000	0.94253	GCA	C|1.000;T|0.000	0.000	weak		0.448	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
SIGLEC10	89790	hgsc.bcm.edu	37	19	51920119	51920119	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:51920119G>A	ENST00000339313.5	-	3	623	c.507C>T	c.(505-507)gcC>gcT	p.A169A	CTD-2616J11.2_ENST00000526996.1_RNA|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000441969.3_Intron|SIGLEC10_ENST00000436984.2_Intron|SIGLEC10_ENST00000432469.2_Intron|SIGLEC10_ENST00000439889.2_Intron|SIGLEC10_ENST00000525998.1_Silent_p.A169A|SIGLEC10_ENST00000353836.5_Silent_p.A169A|SIGLEC10_ENST00000356298.5_Silent_p.A169A|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000442846.3_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	169	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		ATTCCTCAAAGGCCCAGTTAA	0.597																																					p.A169A		Atlas-SNP	.											SIGLEC10,NS,carcinoma,-1,1	SIGLEC10	112	1	0			c.C507T						scavenged	.						98.0	99.0	98.0					19																	51920119		2203	4300	6503	SO:0001819	synonymous_variant	89790	exon3			CTCAAAGGCCCAG	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.507C>T	19.37:g.51920119G>A		Somatic	202	1	0.00495049		WXS	Illumina HiSeq	Phase_I	198	8	0.040404	NM_001171157	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Silent	SNP	ENST00000339313.5	37	CCDS12832.1																																																																																			.	.	none		0.597	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
BAG1	573	hgsc.bcm.edu	37	9	33256814	33256814	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:33256814C>T	ENST00000379704.2	-	5	958	c.525G>A	c.(523-525)gaG>gaA	p.E175E	BAG1_ENST00000472232.3_Silent_p.E290E|BAG1_ENST00000467389.2_5'UTR			Q99933	BAG1_HUMAN	BCL2-associated athanogene	290	Interaction with HSPA8.|Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|chaperone cofactor-dependent protein refolding (GO:0070389)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00506)			TGTCAATCTCCTCCAAGATCT	0.398																																					p.E290E	GBM(77;1066 1502 5858 12192)	Atlas-SNP	.											BAG1,NS,carcinoma,-2,1	BAG1	24	1	0			c.G870A						scavenged	.						162.0	143.0	150.0					9																	33256814		2203	4300	6503	SO:0001819	synonymous_variant	573	exon5			AATCTCCTCCAAG	AF022224	CCDS35004.1, CCDS55301.1	9p12	2010-12-09			ENSG00000107262	ENSG00000107262			937	protein-coding gene	gene with protein product		601497				7834747	Standard	NM_004323		Approved		uc003zsj.3	Q99933	OTTHUMG00000019766	ENST00000379704.2:c.525G>A	9.37:g.33256814C>T		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	98	3	0.0306122	NM_004323	O75315|Q14414|Q53H32|Q5VZE8|Q5VZE9|Q5VZF0|Q96TG2|Q9Y2V4	Silent	SNP	ENST00000379704.2	37	CCDS55301.1																																																																																			.	.	none		0.398	BAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052042.3	NM_004323	
RHPN2	85415	hgsc.bcm.edu	37	19	33517507	33517507	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:33517507C>T	ENST00000254260.3	-	3	252	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	RHPN2_ENST00000400226.4_De_novo_Start_OutOfFrame	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	73					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.V73M(2)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TCCAGCCGCACTTGCTCCCGC	0.552																																					p.V73M		Atlas-SNP	.											RHPN2,face,carcinoma,0,2	RHPN2	107	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.G217A						scavenged	.						84.0	83.0	83.0					19																	33517507		2203	4300	6503	SO:0001583	missense	85415	exon3			GCCGCACTTGCTC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.217G>A	19.37:g.33517507C>T	ENSP00000254260:p.Val73Met	Somatic	34	1	0.0294118		WXS	Illumina HiSeq	Phase_I	37	3	0.0810811	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542997	0.65198	.	.	ENSG00000131941	ENST00000254260	T	0.39787	1.06	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71984	-0.4427	10	0.87932	D	0	11.9954	16.025	0.80536	0.0:1.0:0.0:0.0	.	73	Q8IUC4	RHPN2_HUMAN	M	73	ENSP00000254260:V73M	ENSP00000254260:V73M	V	-	1	0	RHPN2	38209347	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.267000	0.78462	2.167000	0.68274	0.557000	0.71058	GTG	.	.	none		0.552	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
NFKBIE	4794	hgsc.bcm.edu	37	6	44229533	44229533	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:44229533A>T	ENST00000275015.5	-	3	937	c.938T>A	c.(937-939)cTg>cAg	p.L313Q		NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	313					cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTTCAGCACCAGTGCCCGAAC	0.647																																					p.L313Q		Atlas-SNP	.											.	NFKBIE	31	.	0			c.T938A						PASS	.						30.0	30.0	30.0					6																	44229533		2203	4300	6503	SO:0001583	missense	4794	exon3			AGCACCAGTGCCC	U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.938T>A	6.37:g.44229533A>T	ENSP00000275015:p.Leu313Gln	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	56	24	0.428571	NM_004556	Q5T9V9	Missense_Mutation	SNP	ENST00000275015.5	37	CCDS34463.1	.	.	.	.	.	.	.	.	.	.	A	14.62	2.589276	0.46214	.	.	ENSG00000146232	ENST00000275015	T	0.71579	-0.58	5.28	5.28	0.74379	Ankyrin repeat-containing domain (3);	0.083592	0.49916	D	0.000132	D	0.88934	0.6572	H	0.98629	4.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93185	0.6578	10	0.87932	D	0	-19.4802	14.894	0.70630	1.0:0.0:0.0:0.0	.	313	O00221	IKBE_HUMAN	Q	313	ENSP00000275015:L313Q	ENSP00000275015:L313Q	L	-	2	0	NFKBIE	44337511	1.000000	0.71417	0.985000	0.45067	0.980000	0.70556	9.339000	0.96797	2.000000	0.58554	0.533000	0.62120	CTG	.	.	none		0.647	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040733.2		
GFM2	84340	hgsc.bcm.edu	37	5	74021852	74021852	+	Missense_Mutation	SNP	A	A	T	rs5868753|rs76339998	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr5:74021852A>T	ENST00000296805.3	-	18	2283	c.1826T>A	c.(1825-1827)tTt>tAt	p.F609Y	GFM2_ENST00000515125.1_5'UTR|RNU6-658P_ENST00000384606.1_RNA|GFM2_ENST00000345239.2_Missense_Mutation_p.F562Y|GFM2_ENST00000509430.1_Missense_Mutation_p.F609Y	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2									p.F609Y(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		AGCATACTCAAACTCAATCAC	0.413																																					p.F609Y		Atlas-SNP	.											GFM2,NS,carcinoma,0,1	GFM2	38	1	1	Substitution - Missense(1)	lung(1)	c.T1826A						PASS	.						58.0	107.0	90.0					5																	74021852		2163	4289	6452	SO:0001583	missense	84340	exon18			TACTCAAACTCAA	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.1826T>A	5.37:g.74021852A>T	ENSP00000296805:p.Phe609Tyr	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	66	6	0.0909091	NM_032380		Missense_Mutation	SNP	ENST00000296805.3	37	CCDS4023.1	63	0.028846153846153848	54	0.10975609756097561	4	0.011049723756906077	1	0.0017482517482517483	4	0.005277044854881266	-	1.721	-0.496544	0.04291	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000509430	T;T;T	0.29142	1.58;1.58;1.58	5.7	3.31	0.37934	Ribosomal protein S5 domain 2-type fold (1);Translation elongation factor EFG/EF2, domain IV (2);Ribosomal protein S5 domain 2-type fold, subgroup (1);	.	.	.	.	T	0.00271	0.0008	N	0.19112	0.55	0.21984	N	0.999437	.;P	0.46457	.;0.878	.;B	0.33690	.;0.168	T	0.07809	-1.0753	9	0.02654	T	1	.	9.8843	0.41253	0.8619:0.0:0.1381:0.0	.	562;609	Q969S9-2;Q969S9	.;RRF2M_HUMAN	Y	609;562;609	ENSP00000296805:F609Y;ENSP00000296804:F562Y;ENSP00000427004:F609Y	ENSP00000296805:F609Y	F	-	2	0	GFM2	74057608	0.863000	0.29885	0.002000	0.10522	0.043000	0.13939	3.787000	0.55439	0.442000	0.26555	0.460000	0.39030	TTT	A|0.971;T|0.029	0.029	strong		0.413	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380	
LAMA2	3908	hgsc.bcm.edu	37	6	129636794	129636794	+	Silent	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:129636794A>G	ENST00000421865.2	+	25	3778	c.3729A>G	c.(3727-3729)ggA>ggG	p.G1243G		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1243	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AATTTGAAGGAAAGAAGGTAA	0.348																																					p.G1243G		Atlas-SNP	.											.	LAMA2	481	.	0			c.A3729G						PASS	.						97.0	94.0	95.0					6																	129636794		2203	4300	6503	SO:0001819	synonymous_variant	3908	exon25			TGAAGGAAAGAAG	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.3729A>G	6.37:g.129636794A>G		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	95	4	0.0421053	NM_000426	Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	37	CCDS5138.1																																																																																			.	.	none		0.348	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
NSMAF	8439	hgsc.bcm.edu	37	8	59571856	59571856	+	Intron	SNP	A	A	C	rs59606339	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:59571856A>C	ENST00000038176.3	-	1	272				NSMAF_ENST00000427130.2_Missense_Mutation_p.I17S|snoU13_ENST00000459488.1_RNA	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor						ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				GCACTGCCGGATAGCTCGGCA	0.761													C|||	1348	0.269169	0.4697	0.1037	5008	,	,		10863	0.497		0.0467	False		,,,				2504	0.1094				p.I17S		Atlas-SNP	.											NSMAF_ENST00000427130,NS,carcinoma,0,2	NSMAF	156	2	0			c.T50G						PASS	.						4.0	7.0	6.0					8																	59571856		613	1513	2126	SO:0001627	intron_variant	8439	exon1			TGCCGGATAGCTC	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.59+275T>G	8.37:g.59571856A>C		Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	7	4	0.571429	NM_001144772	B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	37	CCDS6173.1	496	0.2271062271062271	186	0.3780487804878049	31	0.0856353591160221	244	0.42657342657342656	35	0.04617414248021108	C	0.151	-1.090991	0.01858	.	.	ENSG00000035681	ENST00000427130	T	0.55413	0.52	1.89	-0.128	0.13506	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45308	-0.9270	6	.	.	.	.	0.796	0.01066	0.2394:0.3623:0.2355:0.1628	rs59606339	17	Q92636-2	.	S	17	ENSP00000411012:I17S	.	I	-	2	0	NSMAF	59734410	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.459000	0.21908	-0.396000	0.07703	-0.358000	0.07595	ATC	A|0.754;C|0.246	0.246	strong		0.761	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580	
PHF20L1	51105	hgsc.bcm.edu	37	8	133844572	133844572	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:133844572A>G	ENST00000395386.2	+	15	2136	c.1837A>G	c.(1837-1839)Agc>Ggc	p.S613G	PHF20L1_ENST00000395390.2_Missense_Mutation_p.S588G|PHF20L1_ENST00000220847.7_5'UTR	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	613							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GGCTTCACGAAGCATGTTTAC	0.423																																					p.S613G		Atlas-SNP	.											Q86U89_HUMAN,NS,carcinoma,-2,2	PHF20L1	129	2	0			c.A1837G						scavenged	.						173.0	159.0	163.0					8																	133844572		1865	4102	5967	SO:0001583	missense	51105	exon15			TCACGAAGCATGT	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.1837A>G	8.37:g.133844572A>G	ENSP00000378784:p.Ser613Gly	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	101	3	0.029703	NM_016018	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	37	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	A	15.56	2.868283	0.51588	.	.	ENSG00000129292	ENST00000395386;ENST00000395390	T;T	0.32753	1.45;1.44	5.56	5.56	0.83823	.	0.240370	0.32593	N	0.005887	T	0.30541	0.0768	L	0.47716	1.5	0.80722	D	1	B;B	0.32101	0.356;0.243	B;B	0.33454	0.164;0.079	T	0.05484	-1.0882	10	0.40728	T	0.16	-37.066	15.1885	0.73023	1.0:0.0:0.0:0.0	.	588;613	F8W9L8;A8MW92	.;P20L1_HUMAN	G	613;588	ENSP00000378784:S613G;ENSP00000378788:S588G	ENSP00000378784:S613G	S	+	1	0	PHF20L1	133913754	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	7.059000	0.76684	2.244000	0.73946	0.528000	0.53228	AGC	.	.	none		0.423	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018	
DHRS12	79758	hgsc.bcm.edu	37	13	52345982	52345982	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr13:52345982C>T	ENST00000444610.2	-	8	694	c.681G>A	c.(679-681)atG>atA	p.M227I	DHRS12_ENST00000490949.1_5'UTR|DHRS12_ENST00000280056.2_Missense_Mutation_p.M178I|DHRS12_ENST00000218981.1_Missense_Mutation_p.M178I	NM_001270424.1	NP_001257353.1	A0PJE2	DHR12_HUMAN	dehydrogenase/reductase (SDR family) member 12	227							oxidoreductase activity (GO:0016491)			cervix(1)|large_intestine(1)|lung(2)|skin(2)|urinary_tract(1)	7		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		AGCCAGGATGCATGGAAGAAA	0.557																																					p.M227I		Atlas-SNP	.											.	DHRS12	28	.	0			c.G681A						PASS	.						93.0	101.0	99.0					13																	52345982		2203	4300	6503	SO:0001583	missense	79758	exon8			AGGATGCATGGAA	AK023701	CCDS9430.1, CCDS31976.1, CCDS58292.1	13q14.3	2013-10-11			ENSG00000102796	ENSG00000102796		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	25832	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 40C, member 1"""					19027726	Standard	NM_001031719		Approved	FLJ13639, SDR40C1	uc001vfq.4	A0PJE2	OTTHUMG00000016952	ENST00000444610.2:c.681G>A	13.37:g.52345982C>T	ENSP00000411565:p.Met227Ile	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	142	34	0.239437	NM_001270424	Q96GB2|Q9H8H1	Missense_Mutation	SNP	ENST00000444610.2	37	CCDS58292.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286334	0.59867	.	.	ENSG00000102796	ENST00000444610;ENST00000218981;ENST00000280056	T;T;T	0.17054	2.3;2.3;3.33	4.57	0.634	0.17718	NAD(P)-binding domain (1);	0.046421	0.85682	D	0.000000	T	0.26810	0.0656	L	0.55213	1.73	0.30247	N	0.794416	B;D;D	0.69078	0.34;0.997;0.997	B;D;D	0.66847	0.171;0.947;0.932	T	0.07404	-1.0774	10	0.62326	D	0.03	.	4.3567	0.11181	0.1627:0.541:0.0:0.2963	.	178;178;227	A0PJE2-3;A0PJE2-2;A0PJE2	.;.;DHR12_HUMAN	I	227;178;178	ENSP00000411565:M227I;ENSP00000218981:M178I;ENSP00000280056:M178I	ENSP00000218981:M178I	M	-	3	0	DHRS12	51243983	1.000000	0.71417	0.007000	0.13788	0.080000	0.17528	1.538000	0.36094	0.539000	0.28788	-0.262000	0.10625	ATG	.	.	none		0.557	DHRS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045036.3	NM_024705	
TMTC4	84899	hgsc.bcm.edu	37	13	101287349	101287349	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr13:101287349G>A	ENST00000376234.3	-	10	1435	c.1246C>T	c.(1246-1248)Ctc>Ttc	p.L416F	TMTC4_ENST00000462211.1_5'UTR|TMTC4_ENST00000328767.5_Missense_Mutation_p.L305F|TMTC4_ENST00000342624.5_Missense_Mutation_p.L435F	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	416						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ACGCTGGGGAGGTAGAGGACA	0.537																																					p.L435F		Atlas-SNP	.											.	TMTC4	103	.	0			c.C1303T						PASS	.						77.0	71.0	73.0					13																	101287349		2203	4300	6503	SO:0001583	missense	84899	exon11			TGGGGAGGTAGAG		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1246C>T	13.37:g.101287349G>A	ENSP00000365408:p.Leu416Phe	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	108	37	0.342593	NM_032813	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	ENST00000376234.3	37	CCDS41904.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015661	0.54468	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.69175	-0.38;-0.38;-0.38	5.5	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.81403	0.4815	M	0.83692	2.655	0.58432	D	0.999998	P;D;D;D	0.89917	0.908;0.999;0.999;1.0	P;D;D;D	0.78314	0.692;0.991;0.98;0.991	D	0.83482	0.0065	10	0.72032	D	0.01	.	11.3755	0.49726	0.1445:0.0:0.8555:0.0	.	305;416;416;435	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	F	416;435;305	ENSP00000365408:L416F;ENSP00000343871:L435F;ENSP00000365409:L305F	ENSP00000365409:L305F	L	-	1	0	TMTC4	100085350	1.000000	0.71417	1.000000	0.80357	0.283000	0.27025	3.246000	0.51414	1.332000	0.45431	-0.251000	0.11542	CTC	.	.	none		0.537	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813	
DROSHA	29102	hgsc.bcm.edu	37	5	31521306	31521306	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr5:31521306T>C	ENST00000511367.2	-	5	1115	c.871A>G	c.(871-873)Aga>Gga	p.R291G	DROSHA_ENST00000513349.1_Missense_Mutation_p.R291G|DROSHA_ENST00000442743.1_Missense_Mutation_p.R291G|DROSHA_ENST00000344624.3_Missense_Mutation_p.R291G	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	291	Arg-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TGCCTGTGTCTCTCCCGTTCT	0.398																																					p.R291G		Atlas-SNP	.											.	DROSHA	130	.	0			c.A871G						PASS	.						256.0	236.0	242.0					5																	31521306		1899	4117	6016	SO:0001583	missense	29102	exon5			TGTGTCTCTCCCG	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.871A>G	5.37:g.31521306T>C	ENSP00000425979:p.Arg291Gly	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	107	5	0.046729	NM_013235	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	ENST00000511367.2	37	CCDS47195.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.179709	0.57800	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000382188	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.95	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.55513	0.1925	N	0.24115	0.695	0.58432	D	0.999999	D;D	0.54601	0.967;0.967	D;D	0.63597	0.916;0.916	T	0.56117	-0.8032	10	0.44086	T	0.13	-20.9464	12.9148	0.58200	0.0:0.0:0.1352:0.8648	.	291;291	E7EMP9;Q9NRR4	.;RNC_HUMAN	G	291;291;291;291;284	ENSP00000425979:R291G;ENSP00000339845:R291G;ENSP00000409335:R291G;ENSP00000424161:R291G	ENSP00000339845:R291G	R	-	1	2	DROSHA	31557063	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.481000	0.53179	2.279000	0.76181	0.533000	0.62120	AGA	.	.	none		0.398	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235	
TUBA3C	7278	hgsc.bcm.edu	37	13	19751463	19751463	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr13:19751463C>T	ENST00000400113.3	-	4	764	c.660G>A	c.(658-660)gaG>gaA	p.E220E		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	220					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		ACGTGGGACGCTCGATGTCCA	0.567																																					p.E220E		Atlas-SNP	.											TUBA3C,NS,carcinoma,-2,1	TUBA3C	166	1	0			c.G660A						scavenged	.						229.0	192.0	205.0					13																	19751463		2203	4300	6503	SO:0001819	synonymous_variant	7278	exon4			GGGACGCTCGATG	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.660G>A	13.37:g.19751463C>T		Somatic	278	0	0		WXS	Illumina HiSeq	Phase_I	280	3	0.0107143	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																			.	.	none		0.567	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
SERPINB10	5273	hgsc.bcm.edu	37	18	61600364	61600364	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr18:61600364T>G	ENST00000238508.3	+	7	775	c.716T>G	c.(715-717)cTt>cGt	p.L239R		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	239					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				GCAGTGGGCCTTCAACTCTAC	0.383																																					p.L239R		Atlas-SNP	.											.	SERPINB10	53	.	0			c.T716G						PASS	.						118.0	130.0	126.0					18																	61600364		2203	4300	6503	SO:0001583	missense	5273	exon6			TGGGCCTTCAACT	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.716T>G	18.37:g.61600364T>G	ENSP00000238508:p.Leu239Arg	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	61	12	0.196721	NM_005024	Q4VAX4|Q4VAX7	Missense_Mutation	SNP	ENST00000238508.3	37	CCDS11990.1	.	.	.	.	.	.	.	.	.	.	T	16.41	3.116431	0.56505	.	.	ENSG00000242550	ENST00000238508	D	0.86694	-2.16	5.95	5.95	0.96441	Serpin domain (3);	0.219993	0.40385	N	0.001119	D	0.96175	0.8753	H	0.98646	4.29	0.47153	D	0.999333	D	0.89917	1.0	D	0.69824	0.966	D	0.97755	1.0217	10	0.87932	D	0	.	15.61	0.76707	0.0:0.0:0.0:1.0	.	239	P48595	SPB10_HUMAN	R	239	ENSP00000238508:L239R	ENSP00000238508:L239R	L	+	2	0	SERPINB10	59751344	0.981000	0.34729	0.564000	0.28396	0.115000	0.19883	5.005000	0.63972	2.282000	0.76494	0.533000	0.62120	CTT	.	.	none		0.383	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	NM_005024	
ZNF837	116412	hgsc.bcm.edu	37	19	58879976	58879976	+	Missense_Mutation	SNP	C	C	T	rs7255596	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:58879976C>T	ENST00000427624.2	-	3	1046	c.724G>A	c.(724-726)Gcg>Acg	p.A242T	ZNF837_ENST00000597582.1_Missense_Mutation_p.A242T|CTD-2619J13.3_ENST00000599889.1_RNA			Q96EG3	ZN837_HUMAN	zinc finger protein 837	242			A -> T (in dbSNP:rs7255596).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						CTCTTGCCCGCCTGCTGCTGC	0.711													T|||	4415	0.881589	0.8442	0.8732	5008	,	,		12184	0.9137		0.9294	False		,,,				2504	0.8558				p.A242T		Atlas-SNP	.											.	ZNF837	16	.	0			c.G724A						PASS	.	T	THR/ALA,THR/ALA	1154,140		514,126,7	4.0	6.0	5.0		724,724	-0.7	0.0	19	dbSNP_116	5	2885,147		1376,133,7	yes	missense,missense	ZNF837	NM_001129730.1,NM_138466.1	58,58	1890,259,14	TT,TC,CC		4.8483,10.8192,6.6343	benign,benign	242/532,242/532	58879976	4039,287	647	1516	2163	SO:0001583	missense	116412	exon3			TGCCCGCCTGCTG	BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.724G>A	19.37:g.58879976C>T	ENSP00000405699:p.Ala242Thr	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	8	8	1	NM_138466		Missense_Mutation	SNP	ENST00000427624.2	37	CCDS46216.1	1978	0.9056776556776557	417	0.8475609756097561	332	0.9171270718232044	527	0.9213286713286714	702	0.9261213720316622	T	0.022	-1.408572	0.01155	0.891808	0.951517	ENSG00000152475	ENST00000427624	T	0.06768	3.26	1.16	-0.744	0.11101	.	.	.	.	.	T	0.00012	0.0000	N	0.01464	-0.85	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.23833	-1.0177	8	0.02654	T	1	.	4.7945	0.13265	0.1945:0.5625:0.0:0.243	rs7255596	242	Q96EG3	ZN837_HUMAN	T	242	ENSP00000405699:A242T	ENSP00000405699:A242T	A	-	1	0	ZNF837	63571788	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-2.118000	0.01325	-0.927000	0.03766	-0.439000	0.05793	GCG	C|0.095;T|0.905	0.905	strong		0.711	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466962.1	NM_138466	
TRIOBP	11078	hgsc.bcm.edu	37	22	38120282	38120282	+	Silent	SNP	C	C	T	rs368233775	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:38120282C>T	ENST00000406386.3	+	7	1974	c.1719C>T	c.(1717-1719)gaC>gaT	p.D573D		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	573					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CCACACGAGACAACCCCAGAA	0.587													-|||	10	0.00199681	0.0061	0.0	5008	,	,		27740	0.001		0.001	False		,,,				2504	0.0				p.D573D		Atlas-SNP	.											TRIOBP_ENST00000344404,NS,carcinoma,0,3	TRIOBP	262	3	0			c.C1719T						scavenged	.	C		7,3759		0,7,1876	56.0	91.0	80.0		1719	-4.7	0.0	22		80	3,8255		0,3,4126	no	coding-synonymous	TRIOBP	NM_001039141.2		0,10,6002	TT,TC,CC		0.0363,0.1859,0.0832		573/2366	38120282	10,12014	1883	4129	6012	SO:0001819	synonymous_variant	11078	exon7			ACGAGACAACCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1719C>T	22.37:g.38120282C>T		Somatic	308	2	0.00649351		WXS	Illumina HiSeq	Phase_I	382	4	0.0104712	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	CCDS43015.1																																																																																			.	.	weak		0.587	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
PFDN2	5202	hgsc.bcm.edu	37	1	161071920	161071920	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:161071920T>G	ENST00000368010.3	-	3	290	c.206A>C	c.(205-207)aAg>aCg	p.K69T	PFDN2_ENST00000468311.1_Intron	NM_012394.3	NP_036526.2	Q9UHV9	PFD2_HUMAN	prefoldin subunit 2	69					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	unfolded protein binding (GO:0051082)			lung(1)|skin(1)	2	all_cancers(52;1.84e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCGGTAGCACTTACGAGTTTC	0.517																																					p.K69T		Atlas-SNP	.											.	PFDN2	10	.	0			c.A206C						PASS	.						134.0	116.0	122.0					1																	161071920		2203	4300	6503	SO:0001583	missense	5202	exon3			TAGCACTTACGAG	AF165883	CCDS1217.1	1q23.3	2008-02-05	2006-02-24		ENSG00000143256	ENSG00000143256			8867	protein-coding gene	gene with protein product		613466	"""prefoldin 2"""			10051400	Standard	NM_012394		Approved		uc001fxu.3	Q9UHV9	OTTHUMG00000031481	ENST00000368010.3:c.206A>C	1.37:g.161071920T>G	ENSP00000356989:p.Lys69Thr	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	123	9	0.0731707	NM_012394	Q9P0P7|Q9UN05	Missense_Mutation	SNP	ENST00000368010.3	37	CCDS1217.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.994360	0.74703	.	.	ENSG00000143256	ENST00000368010	T	0.48522	0.81	5.15	2.82	0.32997	Prefoldin beta-like (1);Prefoldin (1);	0.088219	0.85682	D	0.000000	T	0.53190	0.1781	M	0.79011	2.435	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	T	0.56571	-0.7957	10	0.59425	D	0.04	-14.807	8.0692	0.30678	0.0:0.1676:0.0:0.8324	.	69	Q9UHV9	PFD2_HUMAN	T	69	ENSP00000356989:K69T	ENSP00000356989:K69T	K	-	2	0	PFDN2	159338544	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.467000	0.35321	0.423000	0.26033	0.459000	0.35465	AAG	.	.	none		0.517	PFDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077100.1	NM_012394	
FAM135B	51059	hgsc.bcm.edu	37	8	139163898	139163898	+	Silent	SNP	C	C	T	rs529502221		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:139163898C>T	ENST00000395297.1	-	13	2990	c.2820G>A	c.(2818-2820)acG>acA	p.T940T		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	940										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CAGCAGCTGACGTACAGCTCA	0.483										HNSCC(54;0.14)			C|||	1	0.000199681	0.0	0.0	5008	,	,		19898	0.0		0.0	False		,,,				2504	0.001				p.T940T		Atlas-SNP	.											LOC51059,NS,carcinoma,-1,6	FAM135B	423	6	0			c.G2820A						scavenged	.						142.0	120.0	127.0					8																	139163898		2203	4300	6503	SO:0001819	synonymous_variant	51059	exon13			AGCTGACGTACAG	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.2820G>A	8.37:g.139163898C>T		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	149	3	0.0201342	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	CCDS6375.2																																																																																			.	.	none		0.483	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
ATP10A	57194	hgsc.bcm.edu	37	15	25969147	25969147	+	Missense_Mutation	SNP	C	C	T	rs144743073	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:25969147C>T	ENST00000356865.6	-	6	1112	c.1001G>A	c.(1000-1002)cGg>cAg	p.R334Q		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	334					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CTCTTGATACCGCCATATCCA	0.358													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19965	0.0		0.0	False		,,,				2504	0.0				p.R334Q		Atlas-SNP	.											.	ATP10A	270	.	0			c.G1001A						PASS	.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	136.0	136.0	136.0		1001	2.4	0.0	15	dbSNP_134	136	0,8600		0,0,4300	no	missense	ATP10A	NM_024490.3	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	334/1500	25969147	1,13005	2203	4300	6503	SO:0001583	missense	57194	exon6			TGATACCGCCATA	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.1001G>A	15.37:g.25969147C>T	ENSP00000349325:p.Arg334Gln	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	83	31	0.373494	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	4.862	0.160142	0.09287	2.27E-4	0.0	ENSG00000206190	ENST00000356865	T	0.45668	0.89	5.3	2.36	0.29203	ATPase, P-type, ATPase-associated domain (1);	0.118743	0.56097	D	0.000021	T	0.20129	0.0484	N	0.12637	0.245	0.35235	D	0.777281	B	0.21520	0.057	B	0.18561	0.022	T	0.14755	-1.0461	10	0.18710	T	0.47	-27.5818	7.1544	0.25628	0.0:0.5527:0.0:0.4473	.	334	O60312	AT10A_HUMAN	Q	334	ENSP00000349325:R334Q	ENSP00000349325:R334Q	R	-	2	0	ATP10A	23520240	1.000000	0.71417	0.035000	0.18076	0.036000	0.12997	4.520000	0.60524	0.748000	0.32831	-0.251000	0.11542	CGG	C|1.000;T|0.000	0.000	weak		0.358	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
CFH	3075	hgsc.bcm.edu	37	1	196648799	196648799	+	Silent	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:196648799T>C	ENST00000359637.2	+	5	536	c.474T>C	c.(472-474)tcT>tcC	p.S158S	CFH_ENST00000367429.4_Silent_p.S222S|CFH_ENST00000439155.2_Silent_p.S222S			P08603	CFAH_HUMAN	complement factor H	222	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CTCCTATATCTCAGAAGATTA	0.308																																					p.S222S		Atlas-SNP	.											.	CFH	251	.	0			c.T666C						PASS	.						54.0	58.0	57.0					1																	196648799		2203	4297	6500	SO:0001819	synonymous_variant	3075	exon6			TATATCTCAGAAG	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.474T>C	1.37:g.196648799T>C		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	88	29	0.329545	NM_001014975	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	ENST00000359637.2	37																																																																																				.	.	none		0.308	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000087502.1	NM_000186	
ZAP70	7535	hgsc.bcm.edu	37	2	98340878	98340878	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:98340878G>A	ENST00000264972.5	+	3	594	c.379G>A	c.(379-381)Gtg>Atg	p.V127M	ZAP70_ENST00000442208.1_5'Flank	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	127	Interdomain A.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						GCGTGACTACGTGCGCCAGAC	0.706																																					p.V127M		Atlas-SNP	.											.	ZAP70	77	.	0			c.G379A						PASS	.						5.0	6.0	6.0					2																	98340878		2020	4011	6031	SO:0001583	missense	7535	exon3			GACTACGTGCGCC	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.379G>A	2.37:g.98340878G>A	ENSP00000264972:p.Val127Met	Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	30	16	0.533333	NM_001079	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	37	CCDS33254.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.687188	0.88639	.	.	ENSG00000115085	ENST00000264972	T	0.26660	1.72	4.9	4.9	0.64082	Tyrosine-protein kinase SYK/ZAP-70, inter-SH2 domain (1);	0.308316	0.22701	N	0.056684	T	0.43765	0.1262	L	0.57536	1.79	0.80722	D	1	D;D	0.76494	0.997;0.999	P;P	0.58928	0.848;0.836	T	0.38178	-0.9673	10	0.72032	D	0.01	.	15.9444	0.79782	0.0:0.0:1.0:0.0	.	127;127	B4E0E2;P43403	.;ZAP70_HUMAN	M	127	ENSP00000264972:V127M	ENSP00000264972:V127M	V	+	1	0	ZAP70	97707310	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.289000	0.72696	2.449000	0.82847	0.467000	0.42956	GTG	.	.	none		0.706	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1		
PLEC	5339	hgsc.bcm.edu	37	8	144996751	144996751	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:144996751C>T	ENST00000322810.4	-	31	7926	c.7757G>A	c.(7756-7758)cGg>cAg	p.R2586Q	PLEC_ENST00000356346.3_Missense_Mutation_p.R2435Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R2472Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R2449Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R2453Q|PLEC_ENST00000398774.2_Missense_Mutation_p.R2417Q|PLEC_ENST00000354958.2_Missense_Mutation_p.R2427Q|PLEC_ENST00000354589.3_Missense_Mutation_p.R2449Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R2476Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2586	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GATGGCCTCCCGCAGGCGCTC	0.632																																					p.R2586Q		Atlas-SNP	.											PLEC_ENST00000436759,colon,carcinoma,-1,3	PLEC	1144	3	0			c.G7757A						scavenged	.						36.0	39.0	38.0					8																	144996751		2141	4249	6390	SO:0001583	missense	5339	exon31			GCCTCCCGCAGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7757G>A	8.37:g.144996751C>T	ENSP00000323856:p.Arg2586Gln	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	110	3	0.0272727	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450298	0.43531	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.72942	-0.67;-0.67;-0.7;-0.7;-0.69;-0.67;-0.68;-0.67;-0.67	4.56	3.59	0.41128	.	0.235070	0.21623	U	0.071616	T	0.47838	0.1467	N	0.24115	0.695	0.34146	D	0.666958	P;P;P;P;P;P;P;P	0.48230	0.907;0.846;0.846;0.85;0.846;0.846;0.907;0.907	B;B;B;B;B;B;B;B	0.37198	0.131;0.243;0.243;0.123;0.243;0.243;0.243;0.243	T	0.56715	-0.7933	10	0.25106	T	0.35	.	6.9463	0.24520	0.0:0.7403:0.0:0.2597	.	2476;2435;2427;2586;2417;2449;2453;2449	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	2449;2453;2449;2417;2586;2427;2435;2476;2472	ENSP00000344848:R2449Q;ENSP00000350277:R2453Q;ENSP00000346602:R2449Q;ENSP00000381756:R2417Q;ENSP00000323856:R2586Q;ENSP00000347044:R2427Q;ENSP00000348702:R2435Q;ENSP00000388180:R2476Q;ENSP00000434583:R2472Q	ENSP00000323856:R2586Q	R	-	2	0	PLEC	145068739	0.004000	0.15560	1.000000	0.80357	0.862000	0.49288	0.435000	0.21510	2.379000	0.81126	0.549000	0.68633	CGG	.	.	none		0.632	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ZSWIM5	57643	hgsc.bcm.edu	37	1	45506070	45506070	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:45506070T>C	ENST00000359600.5	-	7	1955	c.1750A>G	c.(1750-1752)Aag>Gag	p.K584E		NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	584						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)	p.K584*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					ATACCTTTCTTCTGATGCTTG	0.488																																					p.K584E		Atlas-SNP	.											ZSWIM5,NS,carcinoma,0,1	ZSWIM5	72	1	1	Substitution - Nonsense(1)	lung(1)	c.A1750G						scavenged	.						106.0	97.0	100.0					1																	45506070		1872	4112	5984	SO:0001583	missense	57643	exon7			CTTTCTTCTGATG	AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.1750A>G	1.37:g.45506070T>C	ENSP00000352614:p.Lys584Glu	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	178	3	0.0168539	NM_020883	Q5SXQ9	Missense_Mutation	SNP	ENST00000359600.5	37	CCDS41319.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.108825	0.77096	.	.	ENSG00000162415	ENST00000359600	T	0.46451	0.87	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.38321	0.1036	L	0.45228	1.405	0.80722	D	1	B	0.31227	0.314	B	0.35240	0.198	T	0.18272	-1.0342	10	0.26408	T	0.33	-15.4875	14.7949	0.69870	0.0:0.0:0.0:1.0	.	584	Q9P217	ZSWM5_HUMAN	E	584	ENSP00000352614:K584E	ENSP00000352614:K584E	K	-	1	0	ZSWIM5	45278657	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.655000	0.83696	2.042000	0.60477	0.533000	0.62120	AAG	.	.	none		0.488	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024823.2	XM_046581	
MUC6	4588	hgsc.bcm.edu	37	11	1017566	1017566	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:1017566G>A	ENST00000421673.2	-	31	5285	c.5235C>T	c.(5233-5235)acC>acT	p.T1745T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1745	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGATGTAGAGGTTTTGGCCG	0.547																																					p.T1745T		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,-2,2	MUC6	408	2	0			c.C5235T						scavenged	.						769.0	740.0	750.0					11																	1017566		2199	4287	6486	SO:0001819	synonymous_variant	4588	exon31			TGTAGAGGTTTTG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5235C>T	11.37:g.1017566G>A		Somatic	898	34	0.0378619		WXS	Illumina HiSeq	Phase_I	1017	41	0.0403147	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			.	.	none		0.547	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
PRB3	5544	hgsc.bcm.edu	37	12	11420773	11420773	+	Missense_Mutation	SNP	C	C	T	rs200940772		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:11420773C>T	ENST00000279573.7	-	3	545	c.410G>A	c.(409-411)cGt>cAt	p.R137H	PRB3_ENST00000538488.1_Intron|PRB3_ENST00000440870.3_Intron|PRB3_ENST00000381842.3_Missense_Mutation_p.R137H			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	137	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.			R -> H (in Ref. 1; CAA30728). {ECO:0000305}.	defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			CTTTCCCGGACGAGGCGGGGG	0.642																																					p.R137H		Atlas-SNP	.											PRB3,NS,carcinoma,0,2	PRB3	84	2	0			c.G410A						scavenged	.						26.0	28.0	27.0					12																	11420773		1477	3379	4856	SO:0001583	missense	5544	exon3			CCCGGACGAGGCG			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.410G>A	12.37:g.11420773C>T	ENSP00000279573:p.Arg137His	Somatic	156	10	0.0641026		WXS	Illumina HiSeq	Phase_I	154	15	0.0974026	NM_006249	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	ENST00000279573.7	37		.	.	.	.	.	.	.	.	.	.	.	0.011	-1.697568	0.00725	.	.	ENSG00000197870	ENST00000381842	T	0.04917	3.53	0.707	-1.41	0.08941	.	21.670500	0.01603	N	0.022149	T	0.05547	0.0146	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.38650	-0.9651	9	0.41790	T	0.15	.	4.061	0.09839	0.0:0.1851:0.2048:0.6101	.	137	Q04118	PRB3_HUMAN	H	137	ENSP00000371264:R137H	ENSP00000279573:R137H	R	-	2	0	PRB3	11312040	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.782000	0.04643	-2.300000	0.00658	-1.404000	0.01136	CGT	C|0.998;T|0.002	0.002	weak		0.642	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5	NM_006249	
GPR65	8477	hgsc.bcm.edu	37	14	88477518	88477518	+	Silent	SNP	C	C	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr14:88477518C>A	ENST00000267549.3	+	2	885	c.327C>A	c.(325-327)gcC>gcA	p.A109A	RP11-300J18.2_ENST00000554433.1_RNA	NM_003608.3	NP_003599.2	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	109					actin cytoskeleton reorganization (GO:0031532)|activation of Rho GTPase activity (GO:0032862)|apoptotic process (GO:0006915)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of stress fiber assembly (GO:0051496)|response to acidic pH (GO:0010447)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)	16						CCTGCATTGCCGTTGATCGGT	0.428																																					p.A109A		Atlas-SNP	.											GPR65,brain,atypical_teratoid-rhabdoid_tumour,+1,1	GPR65	48	1	0			c.C327A						scavenged	.						212.0	202.0	205.0					14																	88477518		2203	4300	6503	SO:0001819	synonymous_variant	8477	exon2			CATTGCCGTTGAT	U95218	CCDS9879.1	14q31-q32.1	2012-08-21			ENSG00000140030	ENSG00000140030		"""GPCR / Class A : Orphans"""	4517	protein-coding gene	gene with protein product		604620				9655242	Standard	NM_003608		Approved	hTDAG8, TDAG8	uc001xvv.3	Q8IYL9	OTTHUMG00000028648	ENST00000267549.3:c.327C>A	14.37:g.88477518C>A		Somatic	51	1	0.0196078		WXS	Illumina HiSeq	Phase_I	61	2	0.0327869	NM_003608	O75819	Silent	SNP	ENST00000267549.3	37	CCDS9879.1																																																																																			.	.	none		0.428	GPR65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071564.4		
CPLX3	594855	hgsc.bcm.edu	37	15	75119053	75119053	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:75119053C>A	ENST00000395018.4	+	1	166	c.9C>A	c.(7-9)ttC>ttA	p.F3L	RP11-414J4.2_ENST00000564823.1_RNA	NM_001030005.2	NP_001025176.1	Q8WVH0	CPLX3_HUMAN	complexin 3	3					insulin secretion (GO:0030073)|regulation of neurotransmitter secretion (GO:0046928)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)	neurotransmitter transporter activity (GO:0005326)			large_intestine(2)|lung(2)	4						CCATGGCGTTCATGGTGAAGA	0.672																																					p.F3L		Atlas-SNP	.											.	CPLX3	12	.	0			c.C9A						PASS	.						36.0	40.0	39.0					15																	75119053		2197	4295	6492	SO:0001583	missense	594855	exon1			GGCGTTCATGGTG	BC018026	CCDS32294.1	15q24.1	2005-08-09			ENSG00000213578	ENSG00000213578			27652	protein-coding gene	gene with protein product		609585				15911881	Standard	NM_001030005		Approved	CPX-III	uc002ayu.1	Q8WVH0	OTTHUMG00000142816	ENST00000395018.4:c.9C>A	15.37:g.75119053C>A	ENSP00000378464:p.Phe3Leu	Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	55	45	0.818182	NM_001030005	D3DW66|Q8TEM6|Q9H818	Missense_Mutation	SNP	ENST00000395018.4	37	CCDS32294.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225855	0.79576	.	.	ENSG00000213578	ENST00000395018	.	.	.	4.3	3.38	0.38709	.	0.000000	0.64402	U	0.000001	T	0.75057	0.3798	M	0.71036	2.16	0.41174	D	0.986185	D	0.57257	0.979	D	0.71414	0.973	T	0.75227	-0.3392	9	0.66056	D	0.02	-10.3249	10.8632	0.46839	0.0:0.8306:0.0:0.1694	.	3	Q8WVH0	CPLX3_HUMAN	L	3	.	ENSP00000378464:F3L	F	+	3	2	CPLX3	72906106	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.306000	0.33505	0.461000	0.27071	-1.164000	0.01763	TTC	.	.	none		0.672	CPLX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286402.2	NM_001030005	
TSPYL2	64061	hgsc.bcm.edu	37	X	53112146	53112146	+	Missense_Mutation	SNP	C	C	T	rs144264921	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chrX:53112146C>T	ENST00000375442.4	+	1	598	c.466C>T	c.(466-468)Ccc>Tcc	p.P156S		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	156					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						GGGGTGGGCGCCCCAGAGGTT	0.587													C|||	3	0.000794702	0.0015	0.0	3775	,	,		10753	0.0		0.001	False		,,,				2504	0.0				p.P156S		Atlas-SNP	.											.	TSPYL2	53	.	0			c.C466T						PASS	.		SER/PRO	6,3828		0,6,0,1626,570	25.0	24.0	24.0		466	-0.7	0.4	X	dbSNP_134	24	3,6724		0,1,2,2427,1869	yes	missense	TSPYL2	NM_022117.3	74	0,7,2,4053,2439	TT,TC,T,CC,C		0.0446,0.1565,0.0852	benign	156/694	53112146	9,10552	2202	4299	6501	SO:0001583	missense	64061	exon1			TGGGCGCCCCAGA	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.466C>T	X.37:g.53112146C>T	ENSP00000364591:p.Pro156Ser	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	85	4	0.0470588	NM_022117	O94799|Q96DG7|Q9BZW6	Missense_Mutation	SNP	ENST00000375442.4	37	CCDS14350.1	.	.	.	.	.	.	.	.	.	.	C	1.215	-0.628646	0.03610	0.001565	4.46E-4	ENSG00000184205	ENST00000375442	T	0.19532	2.14	3.48	-0.742	0.11108	.	1.020780	0.07854	N	0.965098	T	0.07234	0.0183	N	0.02916	-0.46	0.20821	N	0.999844	B;B	0.14438	0.01;0.01	B;B	0.08055	0.003;0.003	T	0.40251	-0.9573	10	0.09590	T	0.72	-10.5495	6.56	0.22481	0.0:0.5958:0.0:0.4042	.	156;156	Q9H2G4;A8K8U7	TSYL2_HUMAN;.	S	156	ENSP00000364591:P156S	ENSP00000364591:P156S	P	+	1	0	TSPYL2	53128871	0.006000	0.16342	0.447000	0.26932	0.809000	0.45718	-0.888000	0.04148	-0.236000	0.09753	0.519000	0.50382	CCC	C|0.998;T|0.002	0.002	strong		0.587	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117	
KRTAP6-3	337968	hgsc.bcm.edu	37	21	31964914	31964914	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:31964914C>T	ENST00000391624.1	+	1	156	c.129C>T	c.(127-129)ggC>ggT	p.G43G	KRTAP22-2_ENST00000382830.2_5'Flank	NM_181605.3	NP_853636.3	Q3LI67	KRA63_HUMAN	keratin associated protein 6-3	43						intermediate filament (GO:0005882)		p.G43G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(7)	10						tgggctttggctatggaggcc	0.627																																					p.G50G		Atlas-SNP	.											KRTAP6-3,NS,carcinoma,0,1	KRTAP6-3	30	1	1	Substitution - coding silent(1)	lung(1)	c.C150T						scavenged	.						84.0	94.0	91.0					21																	31964914		2203	4300	6503	SO:0001819	synonymous_variant	337968	exon1			CTTTGGCTATGGA	AP001708		21q22.1	2012-04-19			ENSG00000212938	ENSG00000212938		"""Keratin associated proteins"""	18933	protein-coding gene	gene with protein product						12359730	Standard	NM_181605		Approved	KAP6.3	uc002yom.3	Q3LI67	OTTHUMG00000057791	ENST00000391624.1:c.129C>T	21.37:g.31964914C>T		Somatic	155	2	0.0129032		WXS	Illumina HiSeq	Phase_I	169	4	0.0236686	NM_181605	A4IF26	Silent	SNP	ENST00000391624.1	37																																																																																				.	.	none		0.627	KRTAP6-3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128243.2	NM_181605	
BTG2	7832	hgsc.bcm.edu	37	1	203276256	203276256	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:203276256C>T	ENST00000290551.4	+	2	238	c.167C>T	c.(166-168)cCc>cTc	p.P56L	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	56					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			CACTGGTTTCCCGAAAAGCCG	0.592																																					p.P56L		Atlas-SNP	.											.	BTG2	16	.	0			c.C167T						PASS	.						41.0	43.0	43.0					1																	203276256		2203	4300	6503	SO:0001583	missense	7832	exon2			GGTTTCCCGAAAA		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.167C>T	1.37:g.203276256C>T	ENSP00000290551:p.Pro56Leu	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	106	40	0.377358	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.836232	0.71373	.	.	ENSG00000159388	ENST00000290551	T	0.31510	1.49	4.53	2.64	0.31445	Anti-proliferative protein (4);	0.073067	0.53938	D	0.000041	T	0.58047	0.2095	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61004	-0.7150	10	0.87932	D	0	-46.4298	8.7979	0.34890	0.0:0.7636:0.1512:0.0852	.	56	P78543	BTG2_HUMAN	L	56	ENSP00000290551:P56L	ENSP00000290551:P56L	P	+	2	0	BTG2	201542879	1.000000	0.71417	0.819000	0.32651	0.843000	0.47879	5.614000	0.67695	0.527000	0.28560	0.313000	0.20887	CCC	.	.	none		0.592	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
MUC2	4583	hgsc.bcm.edu	37	11	1093368	1093368	+	Silent	SNP	G	G	A	rs111440994		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:1093368G>A	ENST00000441003.2	+	30	5214	c.5187G>A	c.(5185-5187)acG>acA	p.T1729T	MUC2_ENST00000359061.5_Silent_p.T1696T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.T17T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1696T(3)|p.T1729T(3)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccactacggtgaccccaa	0.647																																					p.T1729T		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,8	MUC2	614	8	6	Substitution - coding silent(6)	prostate(6)	c.G5187A						scavenged	.						175.0	224.0	207.0					11																	1093368		1971	3826	5797	SO:0001819	synonymous_variant	4583	exon30			CACTACGGTGACC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5187G>A	11.37:g.1093368G>A		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	67	4	0.0597015	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.	.	weak		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CRMP1	1400	hgsc.bcm.edu	37	4	5868477	5868477	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:5868477G>A	ENST00000397890.2	-	2	260	c.46C>T	c.(46-48)Cga>Tga	p.R16*	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000512574.1_Nonsense_Mutation_p.R14*|CRMP1_ENST00000324989.7_Nonsense_Mutation_p.R130*	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	16					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		ATGAGGAGTCGGTCACTCTGC	0.383																																					p.R130X		Atlas-SNP	.											CRMP1,NS,carcinoma,+1,1	CRMP1	118	1	0			c.C388T						scavenged	.						102.0	88.0	93.0					4																	5868477		2203	4300	6503	SO:0001587	stop_gained	1400	exon2			GGAGTCGGTCACT	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.46C>T	4.37:g.5868477G>A	ENSP00000380987:p.Arg16*	Somatic	100	1	0.01		WXS	Illumina HiSeq	Phase_I	83	24	0.289157	NM_001014809	A0EJG6|Q13024|Q4W5F1|Q96TC8	Nonsense_Mutation	SNP	ENST00000397890.2	37	CCDS43207.1	.	.	.	.	.	.	.	.	.	.	G	41	8.922703	0.99004	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	.	.	.	4.26	4.26	0.50523	.	0.237948	0.33772	N	0.004567	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.8303	15.8244	0.78686	0.0:0.0:1.0:0.0	.	.	.	.	X	130;16;16;14	.	ENSP00000321606:R130X	R	-	1	2	CRMP1	5919378	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.469000	0.60169	2.194000	0.70268	0.563000	0.77884	CGA	.	.	none		0.383	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313	
CIT	11113	hgsc.bcm.edu	37	12	120295436	120295436	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:120295436A>G	ENST00000261833.7	-	4	357	c.305T>C	c.(304-306)cTt>cCt	p.L102P	CIT_ENST00000392521.2_Missense_Mutation_p.L102P	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	102	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		ACAACCTACAAGACTTCTGAC	0.473																																					p.L102P		Atlas-SNP	.											.	CIT	535	.	0			c.T305C						PASS	.						190.0	190.0	190.0					12																	120295436		2203	4300	6503	SO:0001583	missense	11113	exon4			CCTACAAGACTTC	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.305T>C	12.37:g.120295436A>G	ENSP00000261833:p.Leu102Pro	Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	110	33	0.3	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	A	16.83	3.231625	0.58777	.	.	ENSG00000122966	ENST00000392521;ENST00000261833;ENST00000536325	T;T;T	0.42513	0.97;0.97;3.04	5.4	5.4	0.78164	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.089941	0.42294	D	0.000735	T	0.38772	0.1053	L	0.44542	1.39	0.80722	D	1	P;B	0.40107	0.703;0.0	B;B	0.37650	0.255;0.014	T	0.39663	-0.9603	10	0.87932	D	0	.	15.7159	0.77667	1.0:0.0:0.0:0.0	.	102;102	Q2M5E1;O14578	.;CTRO_HUMAN	P	102;102;19	ENSP00000376306:L102P;ENSP00000261833:L102P;ENSP00000443199:L19P	ENSP00000261833:L102P	L	-	2	0	CIT	118779819	1.000000	0.71417	0.975000	0.42487	0.992000	0.81027	9.027000	0.93706	2.170000	0.68504	0.482000	0.46254	CTT	.	.	none		0.473	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
ZNF749	388567	hgsc.bcm.edu	37	19	57955885	57955885	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:57955885C>G	ENST00000334181.4	+	3	1619	c.1369C>G	c.(1369-1371)Cag>Gag	p.Q457E	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q457E(1)|p.Q370E(1)		breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		AGTTCAGCACCAGAAAATCCA	0.423																																					p.Q457E		Atlas-SNP	.											ZNF749,right_upper_lobe,carcinoma,0,14	ZNF749	75	14	2	Substitution - Missense(2)	endometrium(2)	c.C1369G						scavenged	.						92.0	89.0	90.0					19																	57955885		2203	4300	6503	SO:0001583	missense	388567	exon3			CAGCACCAGAAAA	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.1369C>G	19.37:g.57955885C>G	ENSP00000333980:p.Gln457Glu	Somatic	191	0	0		WXS	Illumina HiSeq	Phase_I	174	5	0.0287356	NM_001023561		Missense_Mutation	SNP	ENST00000334181.4	37	CCDS33132.2	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410685	0.25465	.	.	ENSG00000186230	ENST00000334181	T	0.07327	3.2	1.62	0.523	0.17060	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06826	0.0174	L	0.38649	1.16	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.33904	-0.9850	9	0.52906	T	0.07	.	5.9852	0.19430	0.5886:0.4114:0.0:0.0	.	457	O43361	ZN749_HUMAN	E	457	ENSP00000333980:Q457E	ENSP00000333980:Q457E	Q	+	1	0	ZNF749	62647697	.	.	0.001000	0.08648	0.750000	0.42670	.	.	0.202000	0.20498	0.650000	0.86243	CAG	.	.	none		0.423	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
PPA1	5464	hgsc.bcm.edu	37	10	71969338	71969338	+	Silent	SNP	C	C	A	rs79719906	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:71969338C>A	ENST00000373232.3	-	7	714	c.615G>T	c.(613-615)gcG>gcT	p.A205A		NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	205					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						CTGCATTAAACGCAAACTCAT	0.358																																					p.A205A		Atlas-SNP	.											PPA1,NS,carcinoma,-1,2	PPA1	24	2	0			c.G615T						scavenged	.						113.0	110.0	111.0					10																	71969338		2203	4300	6503	SO:0001819	synonymous_variant	5464	exon7			ATTAAACGCAAAC	AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.615G>T	10.37:g.71969338C>A		Somatic	161	1	0.00621118		WXS	Illumina HiSeq	Phase_I	155	3	0.0193548	NM_021129	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Silent	SNP	ENST00000373232.3	37	CCDS7299.1																																																																																			C|0.987;A|0.013	0.013	strong		0.358	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048490.2	NM_021129	
VDAC3	7419	hgsc.bcm.edu	37	8	42259311	42259311	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr8:42259311A>G	ENST00000022615.4	+	7	397	c.329A>G	c.(328-330)aAg>aGg	p.K110R	VDAC3_ENST00000522572.1_Missense_Mutation_p.K111R|VDAC3_ENST00000521158.1_Missense_Mutation_p.K111R|VDAC3_ENST00000392935.3_Missense_Mutation_p.K111R			Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3	110					adenine transport (GO:0015853)	extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	TGCAGAAAGAAGAGTGGGAAA	0.373																																					p.K111R		Atlas-SNP	.											VDAC3,colon,carcinoma,-1,1	VDAC3	17	1	0			c.A332G						scavenged	.						103.0	103.0	103.0					8																	42259311		2203	4300	6503	SO:0001583	missense	7419	exon7			GAAAGAAGAGTGG	AF038962	CCDS6131.1, CCDS47850.1	8p11.21	2011-11-15			ENSG00000078668	ENSG00000078668		"""Voltage-dependent anion channels"""	12674	protein-coding gene	gene with protein product		610029				9653160, 9781040	Standard	NM_001135694		Approved	HD-VDAC3	uc003xpc.3	Q9Y277	OTTHUMG00000164168	ENST00000022615.4:c.329A>G	8.37:g.42259311A>G	ENSP00000022615:p.Lys110Arg	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	176	2	0.0113636	NM_001135694	Q9UIS0	Missense_Mutation	SNP	ENST00000022615.4	37	CCDS6131.1	.	.	.	.	.	.	.	.	.	.	A	19.74	3.883090	0.72410	.	.	ENSG00000078668	ENST00000518563;ENST00000392935;ENST00000520115;ENST00000522069;ENST00000522572;ENST00000521158;ENST00000022615	T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.64	5.64	0.86602	.	0.042971	0.85682	D	0.000000	T	0.59362	0.2188	M	0.80332	2.49	0.80722	D	1	P	0.41313	0.745	P	0.46389	0.515	T	0.63501	-0.6623	10	0.51188	T	0.08	-6.3726	14.1449	0.65344	1.0:0.0:0.0:0.0	.	110	Q9Y277	VDAC3_HUMAN	R	78;111;110;110;111;111;110	ENSP00000428977:K78R;ENSP00000442811:K111R;ENSP00000428519:K110R;ENSP00000429006:K110R;ENSP00000428029:K111R;ENSP00000428845:K111R;ENSP00000022615:K110R	ENSP00000022615:K110R	K	+	2	0	VDAC3	42378468	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.287000	0.95975	2.284000	0.76573	0.529000	0.55759	AAG	.	.	none		0.373	VDAC3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377574.1		
ECE2	9718	hgsc.bcm.edu	37	3	184009972	184009972	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:184009972C>T	ENST00000402825.3	+	19	2598	c.2598C>T	c.(2596-2598)ttC>ttT	p.F866F	ECE2_ENST00000404464.3_Silent_p.F748F|ECE2_ENST00000359140.4_Silent_p.F719F|ECE2_ENST00000357474.5_Silent_p.F794F|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	866	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)	p.F866F(1)|p.F719F(1)|p.F794F(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGCGGCACTTCGGCTGCCCTG	0.657																																					p.F866F		Atlas-SNP	.											ECE2_ENST00000402825,bladder,carcinoma,0,6	ECE2	303	6	3	Substitution - coding silent(3)	urinary_tract(3)	c.C2598T						scavenged	.						45.0	46.0	46.0					3																	184009972		2203	4300	6503	SO:0001819	synonymous_variant	9718	exon19			GCACTTCGGCTGC	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.2598C>T	3.37:g.184009972C>T		Somatic	127	1	0.00787402		WXS	Illumina HiSeq	Phase_I	184	3	0.0163043	NM_014693	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Silent	SNP	ENST00000402825.3	37	CCDS3256.2																																																																																			.	.	none		0.657	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	
HRCT1	646962	hgsc.bcm.edu	37	9	35906583	35906583	+	Missense_Mutation	SNP	T	T	A	rs112821450|rs143611048|rs79156963	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:35906583T>A	ENST00000354323.2	+	1	395	c.299T>A	c.(298-300)cTc>cAc	p.L100H	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	100	His-rich.					integral component of membrane (GO:0016021)		p.L100H(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						cctcaccacctccaccaccac	0.667																																					p.L100H		Atlas-SNP	.											HRCT1,NS,malignant_melanoma,0,1	HRCT1	14	1	1	Substitution - Missense(1)	NS(1)	c.T299A						scavenged	.						13.0	10.0	11.0					9																	35906583		1961	3863	5824	SO:0001583	missense	646962	exon1			ACCACCTCCACCA		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.299T>A	9.37:g.35906583T>A	ENSP00000346283:p.Leu100His	Somatic	25	1	0.04		WXS	Illumina HiSeq	Phase_I	31	3	0.0967742	NM_001039792	B7ZBJ1	Missense_Mutation	SNP	ENST00000354323.2	37	CCDS35012.1	.	.	.	.	.	.	.	.	.	.	T	9.866	1.197686	0.22037	.	.	ENSG00000196196	ENST00000354323	.	.	.	3.43	-0.386	0.12466	.	.	.	.	.	T	0.09730	0.0239	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25117	-1.0141	8	0.87932	D	0	-5.7925	0.5802	0.00711	0.4571:0.1878:0.1238:0.2312	.	100	Q6UXD1	HRCT1_HUMAN	H	100	.	ENSP00000346283:L100H	L	+	2	0	HRCT1	35896583	0.000000	0.05858	0.107000	0.21349	0.466000	0.32739	-0.309000	0.08145	-0.078000	0.12730	-0.376000	0.06991	CTC	T|0.500;A|0.500	0.500	weak		0.667	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334099.1	NM_001039792	
FAM161A	84140	hgsc.bcm.edu	37	2	62066790	62066790	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:62066790A>G	ENST00000405894.3	-	3	1450	c.1349T>C	c.(1348-1350)cTc>cCc	p.L450P	FAM161A_ENST00000404929.1_Missense_Mutation_p.L450P	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	450					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CACTGTTAAGAGTTTTGGAGA	0.383																																					p.L450P		Atlas-SNP	.											FAM161A_ENST00000405894,NS,carcinoma,0,3	FAM161A	200	3	0			c.T1349C						scavenged	.						130.0	114.0	119.0					2																	62066790		1853	4101	5954	SO:0001583	missense	84140	exon3			GTTAAGAGTTTTG		CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.1349T>C	2.37:g.62066790A>G	ENSP00000385893:p.Leu450Pro	Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	244	3	0.0122951	NM_032180	B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	37	CCDS42687.2	.	.	.	.	.	.	.	.	.	.	A	9.607	1.130264	0.21041	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.20200	2.09;2.09	5.19	-3.94	0.04130	.	1.201580	0.05653	N	0.585606	T	0.10852	0.0265	N	0.25144	0.715	0.20563	N	0.999888	B;B	0.09022	0.002;0.001	B;B	0.12156	0.007;0.002	T	0.31971	-0.9924	10	0.22706	T	0.39	-18.0229	2.5132	0.04661	0.1689:0.141:0.4287:0.2614	.	450;450	Q3B820;Q3B820-3	F161A_HUMAN;.	P	450	ENSP00000385158:L450P;ENSP00000385893:L450P	ENSP00000385158:L450P	L	-	2	0	FAM161A	61920294	0.001000	0.12720	0.000000	0.03702	0.034000	0.12701	0.028000	0.13644	-0.499000	0.06623	0.519000	0.50382	CTC	.	.	none		0.383	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180	
CDRT1	374286	hgsc.bcm.edu	37	17	15519066	15519066	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:15519066T>G	ENST00000395906.3	-	2	562	c.563A>C	c.(562-564)aAg>aCg	p.K188T	RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.K498T	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	188										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		GGTCGCAGACTTGGAGCTGTG	0.483																																					p.K188T		Atlas-SNP	.											.	CDRT1	83	.	0			c.A563C						PASS	.						55.0	56.0	56.0					17																	15519066		2200	4278	6478	SO:0001583	missense	374286	exon2			GCAGACTTGGAGC	U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.563A>C	17.37:g.15519066T>G	ENSP00000379242:p.Lys188Thr	Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	231	18	0.0779221	NM_006382	O43848|O95611	Missense_Mutation	SNP	ENST00000395906.3	37	CCDS45619.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.808|4.808	0.150194|0.150194	0.09185|0.09185	.|.	.|.	ENSG00000251537|ENSG00000251537	ENST00000261644;ENST00000395906|ENST00000455584	T|.	0.23950|.	1.88|.	3.68|3.68	-5.28|-5.28	0.02755|0.02755	.|.	0.556354|.	0.17795|.	N|.	0.161741|.	T|T	0.12008|0.12008	0.0292|0.0292	N|N	0.03115|0.03115	-0.41|-0.41	0.09310|0.09310	N|N	1|1	B;B|.	0.12013|.	0.005;0.002|.	B;B|.	0.08055|.	0.003;0.001|.	T|T	0.30679|0.30679	-0.9970|-0.9970	10|5	0.27082|.	T|.	0.32|.	.|.	7.1977|7.1977	0.25862|0.25862	0.2497:0.0:0.5367:0.2136|0.2497:0.0:0.5367:0.2136	.|.	188;512|.	O95170;Q59EB2|.	CDRT1_HUMAN;.|.	T|R	188|513	ENSP00000379242:K188T|.	ENSP00000261644:K188T|.	K|S	-|-	2|1	0|0	RP11-385D13.1|RP11-385D13.1	15459791|15459791	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	0.192000|0.192000	0.17096|0.17096	-1.167000|-1.167000	0.02779|0.02779	-0.501000|-0.501000	0.04562|0.04562	AAG|AGT	.	.	none		0.483	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448127.1	NM_006382	
ESF1	51575	hgsc.bcm.edu	37	20	13756715	13756715	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr20:13756715T>C	ENST00000202816.1	-	3	946	c.839A>G	c.(838-840)gAa>gGa	p.E280G		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	280	Asp-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						ctcttcatcttcatcctcctc	0.403																																					p.E280G		Atlas-SNP	.											ESF1,NS,carcinoma,+1,1	ESF1	77	1	0			c.A839G						scavenged	.						255.0	196.0	216.0					20																	13756715		2203	4300	6503	SO:0001583	missense	51575	exon3			TCATCTTCATCCT		CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.839A>G	20.37:g.13756715T>C	ENSP00000202816:p.Glu280Gly	Somatic	213	0	0		WXS	Illumina HiSeq	Phase_I	194	4	0.0206186	NM_001276380	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	ENST00000202816.1	37	CCDS13117.1	.	.	.	.	.	.	.	.	.	.	T	7.974	0.749628	0.15778	.	.	ENSG00000089048	ENST00000202816	T	0.27104	1.69	2.56	1.45	0.22620	.	1.082220	0.07098	N	0.839908	T	0.12092	0.0294	N	0.08118	0	0.25110	N	0.990722	B	0.02656	0.0	B	0.04013	0.001	T	0.32214	-0.9915	10	0.27785	T	0.31	.	4.2752	0.10806	0.0:0.166:0.0:0.834	.	280	Q9H501	ESF1_HUMAN	G	280	ENSP00000202816:E280G	ENSP00000202816:E280G	E	-	2	0	ESF1	13704715	0.129000	0.22400	0.003000	0.11579	0.323000	0.28346	1.185000	0.32065	0.433000	0.26313	0.172000	0.16884	GAA	.	.	none		0.403	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078049.1	NM_016649	
PGM5	5239	hgsc.bcm.edu	37	9	71114185	71114185	+	Missense_Mutation	SNP	C	C	T	rs142494212		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:71114185C>T	ENST00000396396.1	+	10	1751	c.1522C>T	c.(1522-1524)Cgg>Tgg	p.R508W		NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	508					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						GCTCATCTTCCGGCTCAGTTC	0.532																																					p.R508W		Atlas-SNP	.											PGM5,NS,carcinoma,-1,1	PGM5	80	1	0			c.C1522T						scavenged	.	C	TRP/ARG	0,4406		0,0,2203	163.0	142.0	149.0		1522	3.8	1.0	9	dbSNP_134	149	1,8599	1.2+/-3.3	0,1,4299	no	missense	PGM5	NM_021965.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	508/568	71114185	1,13005	2203	4300	6503	SO:0001583	missense	5239	exon10			ATCTTCCGGCTCA	L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1522C>T	9.37:g.71114185C>T	ENSP00000379678:p.Arg508Trp	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	97	3	0.0309278	NM_021965	B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	ENST00000396396.1	37	CCDS6622.2	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448973	0.84101	0.0	1.16E-4	ENSG00000154330	ENST00000396396	D	0.86956	-2.19	5.83	3.82	0.43975	.	0.000000	0.85682	D	0.000000	D	0.95033	0.8392	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96029	0.9015	10	0.87932	D	0	.	13.0458	0.58925	0.3732:0.6268:0.0:0.0	.	508	Q15124	PGM5_HUMAN	W	508	ENSP00000379678:R508W	ENSP00000379678:R508W	R	+	1	2	PGM5	70304005	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.627000	0.37050	1.455000	0.47813	0.655000	0.94253	CGG	C|1.000;T|0.000	0.000	weak		0.532	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052548.2	NM_021965	
TLN2	83660	hgsc.bcm.edu	37	15	63017221	63017221	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:63017221C>T	ENST00000561311.1	+	26	3403	c.3173C>T	c.(3172-3174)aCg>aTg	p.T1058M	TLN2_ENST00000306829.6_Missense_Mutation_p.T1058M			Q9Y4G6	TLN2_HUMAN	talin 2	1058	Ala-rich.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GCTCTGAATACGGTGCAGACG	0.527																																					p.T1058M		Atlas-SNP	.											.	TLN2	253	.	0			c.C3173T						PASS	.						72.0	68.0	69.0					15																	63017221		2203	4300	6503	SO:0001583	missense	83660	exon24			TGAATACGGTGCA	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3173C>T	15.37:g.63017221C>T	ENSP00000453508:p.Thr1058Met	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	37	31	0.837838	NM_015059	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	37	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.501273	0.26861	.	.	ENSG00000171914	ENST00000306829	T	0.67865	-0.29	5.54	5.54	0.83059	.	0.136037	0.64402	D	0.000002	T	0.54208	0.1844	N	0.17082	0.46	0.39663	D	0.970632	B	0.22746	0.074	B	0.14578	0.011	T	0.50285	-0.8846	10	0.40728	T	0.16	-16.3734	19.8379	0.96666	0.0:1.0:0.0:0.0	.	1058	Q9Y4G6	TLN2_HUMAN	M	1058	ENSP00000303476:T1058M	ENSP00000303476:T1058M	T	+	2	0	TLN2	60804513	0.998000	0.40836	0.927000	0.36925	0.015000	0.08874	4.850000	0.62889	2.765000	0.95021	0.655000	0.94253	ACG	.	.	none		0.527	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
CEP162	22832	hgsc.bcm.edu	37	6	84895037	84895037	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:84895037T>C	ENST00000403245.3	-	13	1645	c.1531A>G	c.(1531-1533)Agg>Ggg	p.R511G	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Missense_Mutation_p.R435G	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		CCTGAGCTCCTAACTGACGCA	0.418																																					p.R511G		Atlas-SNP	.											KIAA1009,NS,carcinoma,+2,1	KIAA1009	119	1	0			c.A1531G						scavenged	.						162.0	162.0	162.0					6																	84895037		2203	4300	6503	SO:0001583	missense	22832	exon13			AGCTCCTAACTGA																												ENST00000403245.3:c.1531A>G	6.37:g.84895037T>C	ENSP00000385215:p.Arg511Gly	Somatic	255	0	0		WXS	Illumina HiSeq	Phase_I	233	6	0.0257511	NM_014895		Missense_Mutation	SNP	ENST00000403245.3	37	CCDS34494.2	.	.	.	.	.	.	.	.	.	.	T	15.25	2.777378	0.49786	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.28255	1.62;1.62	5.34	2.85	0.33270	.	0.075344	0.56097	D	0.000029	T	0.38852	0.1056	M	0.74881	2.28	0.29335	N	0.866441	D;D	0.89917	0.972;1.0	P;D	0.85130	0.797;0.997	T	0.33189	-0.9878	10	0.87932	D	0	-12.1305	10.3772	0.44090	0.0:0.0:0.3305:0.6695	.	511;511	Q5TB80;C9JFM9	QN1_HUMAN;.	G	435;511	ENSP00000257766:R435G;ENSP00000385215:R511G	ENSP00000257766:R435G	R	-	1	2	KIAA1009	84951756	1.000000	0.71417	0.994000	0.49952	0.327000	0.28475	2.221000	0.42917	0.390000	0.25115	-0.340000	0.08031	AGG	.	.	none		0.418	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1		
ZNF112	7771	hgsc.bcm.edu	37	19	44832010	44832010	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:44832010C>T	ENST00000337401.4	-	5	2406	c.2318G>A	c.(2317-2319)gGa>gAa	p.G773E	ZNF112_ENST00000354340.4_Missense_Mutation_p.G767E|ZNF112_ENST00000536500.1_Missense_Mutation_p.G790E	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	773					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TGGTTTCCCTCCTGTGTGAAC	0.483																																					p.G773E		Atlas-SNP	.											ZFP112_ENST00000337401,NS,carcinoma,+1,2	ZFP112	219	2	0			c.G2318A						scavenged	.						225.0	212.0	216.0					19																	44832010		2203	4300	6503	SO:0001583	missense	7771	exon5			TTCCCTCCTGTGT	AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.2318G>A	19.37:g.44832010C>T	ENSP00000337081:p.Gly773Glu	Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	243	3	0.0123457	NM_001083335	A4FU53|Q9HCA7	Missense_Mutation	SNP	ENST00000337401.4	37	CCDS54276.1	.	.	.	.	.	.	.	.	.	.	C	17.86	3.492433	0.64074	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.25749	1.78;1.78;1.78	5.18	4.12	0.48240	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33364	N	0.004987	T	0.42675	0.1213	L	0.48362	1.52	0.31843	N	0.623278	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.68621	0.959;0.931;0.959	T	0.53486	-0.8432	10	0.56958	D	0.05	-16.2857	14.7597	0.69596	0.0:0.854:0.146:0.0	.	772;790;773	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	E	773;773;767;790;772	ENSP00000337081:G773E;ENSP00000346305:G767E;ENSP00000441990:G790E	ENSP00000253426:G772E	G	-	2	0	ZNF285	49523850	0.070000	0.21116	0.938000	0.37757	0.994000	0.84299	1.896000	0.39789	1.282000	0.44496	0.563000	0.77884	GGA	.	.	none		0.483	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380	
MUC2	4583	hgsc.bcm.edu	37	11	1093245	1093245	+	Silent	SNP	A	A	T	rs200003195		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:1093245A>T	ENST00000441003.2	+	30	5091	c.5064A>T	c.(5062-5064)ccA>ccT	p.P1688P	MUC2_ENST00000359061.5_Silent_p.P1655P|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccaacacccaccg	0.632																																					p.P1688P		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,2	MUC2	614	2	0			c.A5064T						scavenged	.						88.0	139.0	121.0					11																	1093245		1819	3301	5120	SO:0001819	synonymous_variant	4583	exon30			AACCCCAACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5064A>T	11.37:g.1093245A>T		Somatic	44	3	0.0681818		WXS	Illumina HiSeq	Phase_I	45	6	0.133333	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.	.	weak		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230412	23230412	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:23230412G>C	ENST00000526893.1	+	1	453	c.179G>C	c.(178-180)cGa>cCa	p.R60P	IGLL5_ENST00000532223.2_Missense_Mutation_p.R60P|IGLL5_ENST00000531372.1_Missense_Mutation_p.R60P|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	60						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GGAAGCAGCCGATCCAGCCTG	0.652																																					p.R60P		Atlas-SNP	.											.	IGLL5	26	.	0			c.G179C						PASS	.																																			SO:0001583	missense	100423062	exon1			GCAGCCGATCCAG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.179G>C	22.37:g.23230412G>C	ENSP00000431254:p.Arg60Pro	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	148	64	0.432432	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.919402	0.33908	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00622	6.17;6.16	3.92	-7.84	0.01196	.	.	.	.	.	T	0.00496	0.0016	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47341	-0.9125	9	0.62326	D	0.03	.	2.9625	0.05897	0.0917:0.3589:0.1664:0.3831	.	60	B9A064	IGLL5_HUMAN	P	60	ENSP00000436353:R60P;ENSP00000431254:R60P	ENSP00000431254:R60P	R	+	2	0	IGLL5	21560412	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.219000	0.00553	-1.485000	0.01854	0.643000	0.83706	CGA	.	.	none		0.652	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
MUC4	4585	hgsc.bcm.edu	37	3	195511925	195511925	+	Missense_Mutation	SNP	A	A	G	rs78031084	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:195511925A>G	ENST00000463781.3	-	2	6985	c.6526T>C	c.(6526-6528)Tct>Cct	p.S2176P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2176P|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S2176P(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGAGGTGGCGTGA	0.587													.|||	274	0.0547125	0.0189	0.0288	5008	,	,		15474	0.122		0.0805	False		,,,				2504	0.0256				p.S2176P		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	3	1	Substitution - Missense(1)	kidney(1)	c.T6526C						scavenged	.																																			SO:0001583	missense	4585	exon2			GAAGAGAGGTGGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6526T>C	3.37:g.195511925A>G	ENSP00000417498:p.Ser2176Pro	Somatic	223	19	0.0852018		WXS	Illumina HiSeq	Phase_I	215	20	0.0930233	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	3.373	-0.127914	0.06753	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.44881	0.91;0.97	.	.	.	.	.	.	.	.	T	0.12390	0.0301	N	0.02539	-0.55	0.09310	N	0.999998	B	0.19817	0.039	B	0.23018	0.043	T	0.16129	-1.0413	7	.	.	.	.	2.133	0.03754	0.2597:0.0:0.2591:0.4812	.	2176	E7ESK3	.	P	2176	ENSP00000417498:S2176P;ENSP00000420243:S2176P	.	S	-	1	0	MUC4	196996320	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-2.972000	0.00667	-2.644000	0.00427	-2.094000	0.00368	TCT	A|0.993;G|0.007	0.007	strong		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
VPS35	55737	hgsc.bcm.edu	37	16	46696260	46696260	+	Silent	SNP	G	G	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr16:46696260G>T	ENST00000299138.7	-	15	2020	c.1962C>A	c.(1960-1962)gcC>gcA	p.A654A	RP11-93O14.2_ENST00000569353.1_RNA	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	654					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				ATGCAGCAAGGGCACACTGAG	0.498																																					p.A654A		Atlas-SNP	.											VPS35,NS,carcinoma,-2,1	VPS35	49	1	0			c.C1962A						scavenged	.						101.0	88.0	93.0					16																	46696260		2203	4300	6503	SO:0001819	synonymous_variant	55737	exon15			AGCAAGGGCACAC	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.1962C>A	16.37:g.46696260G>T		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	135	2	0.0148148	NM_018206	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Silent	SNP	ENST00000299138.7	37	CCDS10721.1																																																																																			.	.	none		0.498	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
PLEKHM2	23207	hgsc.bcm.edu	37	1	16051840	16051840	+	Silent	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:16051840T>C	ENST00000375799.3	+	8	968	c.741T>C	c.(739-741)ggT>ggC	p.G247G	PLEKHM2_ENST00000375793.2_Silent_p.G227G|RP11-288I21.1_ENST00000453804.1_RNA	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	247	Interaction with KIF5B.				Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CGGTCAGTGGTCCCCGCTCCA	0.662																																					p.G247G		Atlas-SNP	.											.	PLEKHM2	94	.	0			c.T741C						PASS	.						23.0	31.0	28.0					1																	16051840		1874	3784	5658	SO:0001819	synonymous_variant	23207	exon8			CAGTGGTCCCCGC	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.741T>C	1.37:g.16051840T>C		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	95	4	0.0421053	NM_015164	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Silent	SNP	ENST00000375799.3	37	CCDS44063.1																																																																																			.	.	none		0.662	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008463.1	NM_015164	
MKNK2	2872	hgsc.bcm.edu	37	19	2041911	2041911	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:2041911G>A	ENST00000591601.1	-	10	908	c.873C>T	c.(871-873)ggC>ggT	p.G291G	MKNK2_ENST00000541165.1_Silent_p.G160G|MKNK2_ENST00000591142.1_Silent_p.G35G|MKNK2_ENST00000591588.1_Silent_p.G35G|MKNK2_ENST00000309340.7_Silent_p.G291G|MKNK2_ENST00000588014.1_Silent_p.G35G|MKNK2_ENST00000250896.3_Silent_p.G291G			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	291	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGCGGGTAGCCGCTGAGTA	0.697																																					p.G291G		Atlas-SNP	.											.	MKNK2	56	.	0			c.C873T						PASS	.						24.0	20.0	22.0					19																	2041911		2102	4136	6238	SO:0001819	synonymous_variant	2872	exon11			CGGGTAGCCGCTG	AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.873C>T	19.37:g.2041911G>A		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	38	5	0.131579	NM_017572	Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Silent	SNP	ENST00000591601.1	37	CCDS12080.1																																																																																			.	.	none		0.697	MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449312.1	NM_199054	
NOSIP	51070	hgsc.bcm.edu	37	19	50063941	50063941	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:50063941C>T	ENST00000596358.1	-	2	66	c.8G>A	c.(7-9)cGg>cAg	p.R3Q	NOSIP_ENST00000391853.3_Missense_Mutation_p.R3Q|NOSIP_ENST00000339093.3_Missense_Mutation_p.R3Q	NM_001270960.1	NP_001257889.1	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein	3					negative regulation of catalytic activity (GO:0043086)|negative regulation of nitric-oxide synthase activity (GO:0051001)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|skin(2)|urinary_tract(1)	11		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		CTTGCCATGCCGCGTCATCCT	0.632																																					p.R3Q		Atlas-SNP	.											.	NOSIP	28	.	0			c.G8A						PASS	.						85.0	60.0	68.0					19																	50063941		2203	4299	6502	SO:0001583	missense	51070	exon3			CCATGCCGCGTCA	AF132959	CCDS12772.1	19q13.3	2008-02-05				ENSG00000142546			17946	protein-coding gene	gene with protein product						11149895, 10810093	Standard	NM_015953		Approved	CGI-25	uc002pol.4	Q9Y314		ENST00000596358.1:c.8G>A	19.37:g.50063941C>T	ENSP00000470034:p.Arg3Gln	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	59	18	0.305085	NM_015953	Q96FD2	Missense_Mutation	SNP	ENST00000596358.1	37	CCDS12772.1	.	.	.	.	.	.	.	.	.	.	C	34	5.315578	0.95655	.	.	ENSG00000142546	ENST00000339093;ENST00000391853	T;T	0.78595	-1.19;-1.19	5.41	2.1	0.27182	.	0.000000	0.85682	D	0.000000	D	0.87006	0.6070	M	0.86805	2.84	0.45718	D	0.998623	D	0.89917	1.0	D	0.85130	0.997	D	0.85312	0.1079	10	0.87932	D	0	-23.987	7.983	0.30194	0.0:0.7195:0.1321:0.1484	.	3	Q9Y314	NOSIP_HUMAN	Q	3	ENSP00000343497:R3Q;ENSP00000375726:R3Q	ENSP00000343497:R3Q	R	-	2	0	NOSIP	54755753	1.000000	0.71417	0.003000	0.11579	0.601000	0.36947	6.534000	0.73833	0.268000	0.21939	0.655000	0.94253	CGG	.	.	none		0.632	NOSIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465423.1		
TPM3P9	147804	hgsc.bcm.edu	37	19	53950528	53950528	+	RNA	SNP	T	T	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:53950528T>G	ENST00000424846.3	+	0	2920				ZNF761_ENST00000454407.1_RNA	NR_003148.3				tropomyosin 3 pseudogene 9																		AGGGATGGCTTTTTCTCAGGT	0.443																																					p.F3V		Atlas-SNP	.											.	ZNF761	104	.	0			c.T7G						PASS	.						131.0	125.0	127.0					19																	53950528		876	1991	2867			388561	exon4			ATGGCTTTTTCTC			19q13.42	2012-07-04			ENSG00000241015	ENSG00000241015			44142	pseudogene	pseudogene							Standard	NR_003148		Approved				OTTHUMG00000157312		19.37:g.53950528T>G		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	34	12	0.352941	NM_001008401		Missense_Mutation	SNP	ENST00000424846.3	37																																																																																				.	.	none		0.443	TPM3P9-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347070.1	NR_003148	
UHRF2	115426	hgsc.bcm.edu	37	9	6413558	6413558	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr9:6413558C>G	ENST00000276893.5	+	1	236	c.68C>G	c.(67-69)gCc>gGc	p.A23G	RP11-307L3.4_ENST00000411561.1_RNA|UHRF2_ENST00000381373.3_Missense_Mutation_p.A23G	NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase	23	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		TCTCGCAAAGCCACGATTGAG	0.632																																					p.A23G		Atlas-SNP	.											.	UHRF2	50	.	0			c.C68G						PASS	.						52.0	52.0	52.0					9																	6413558		2203	4300	6503	SO:0001583	missense	115426	exon1			GCAAAGCCACGAT	AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.68C>G	9.37:g.6413558C>G	ENSP00000276893:p.Ala23Gly	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	108	28	0.259259	NM_152896	Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	Missense_Mutation	SNP	ENST00000276893.5	37	CCDS6469.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045016	0.75846	.	.	ENSG00000147854	ENST00000276893;ENST00000381373	T;T	0.73575	-0.76;-0.76	4.83	3.0	0.34707	Ubiquitin supergroup (1);Ubiquitin (2);	0.198751	0.42964	D	0.000626	T	0.67683	0.2919	L	0.31476	0.935	0.36395	D	0.86274	B	0.32893	0.389	B	0.41894	0.369	T	0.72520	-0.4268	10	0.87932	D	0	-7.1406	10.6553	0.45671	0.0:0.8436:0.0:0.1564	.	23	Q96PU4	UHRF2_HUMAN	G	23	ENSP00000276893:A23G;ENSP00000370778:A23G	ENSP00000276893:A23G	A	+	2	0	UHRF2	6403558	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.968000	0.76086	0.645000	0.30675	-0.258000	0.10820	GCC	.	.	none		0.632	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051665.3	NM_152306	
PPP1R36	145376	hgsc.bcm.edu	37	14	65053990	65053990	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr14:65053990G>A	ENST00000298705.1	+	10	886	c.790G>A	c.(790-792)Ggg>Agg	p.G264R	RP11-973N13.3_ENST00000554454.1_RNA|RP11-973N13.3_ENST00000556634.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	264					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										AGAAGAAGTAGGGAGACTCTT	0.413																																					p.G264R		Atlas-SNP	.											.	.	.	.	0			c.G790A						PASS	.						153.0	144.0	147.0					14																	65053990		2203	4300	6503	SO:0001583	missense	145376	exon10			GAAGTAGGGAGAC		CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.790G>A	14.37:g.65053990G>A	ENSP00000298705:p.Gly264Arg	Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	154	72	0.467532	NM_172365	Q6NTH6	Missense_Mutation	SNP	ENST00000298705.1	37	CCDS9767.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.356036	0.82243	.	.	ENSG00000165807	ENST00000298705	T	0.30981	1.51	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000005	T	0.57359	0.2048	M	0.79475	2.455	0.43708	D	0.996177	D	0.89917	1.0	D	0.97110	1.0	T	0.61083	-0.7134	10	0.87932	D	0	-21.7724	15.0284	0.71687	0.0:0.0:1.0:0.0	.	264	Q96LQ0	PPR36_HUMAN	R	264	ENSP00000298705:G264R	ENSP00000298705:G264R	G	+	1	0	C14orf50	64123743	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.068000	0.64364	2.596000	0.87737	0.655000	0.94253	GGG	.	.	none		0.413	PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280667.1	NM_172365	
RUFY3	22902	hgsc.bcm.edu	37	4	71640926	71640926	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:71640926T>C	ENST00000226328.4	+	7	1363	c.800T>C	c.(799-801)gTa>gCa	p.V267A	RUFY3_ENST00000417478.2_Missense_Mutation_p.V327A|RUFY3_ENST00000536664.1_Missense_Mutation_p.V251A|RUFY3_ENST00000381006.3_Missense_Mutation_p.V267A|RUFY3_ENST00000502653.1_Missense_Mutation_p.V214A	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	267					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			AAGAACTATGTAGAAGAACTG	0.358																																					p.V327A		Atlas-SNP	.											RUFY3,NS,carcinoma,-1,1	RUFY3	61	1	0			c.T980C						scavenged	.						63.0	66.0	65.0					4																	71640926		2203	4300	6503	SO:0001583	missense	22902	exon7			ACTATGTAGAAGA	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.800T>C	4.37:g.71640926T>C	ENSP00000226328:p.Val267Ala	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	129	2	0.0155039	NM_001130709	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	ENST00000226328.4	37	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	T	33	5.278045	0.95459	.	.	ENSG00000018189	ENST00000417478;ENST00000381006;ENST00000226328;ENST00000536664;ENST00000502653	T;T;T;T;T	0.15487	2.42;2.79;2.49;2.5;2.8	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.36026	0.0952	M	0.73217	2.22	0.80722	D	1	D;D;P;P	0.54964	0.969;0.961;0.93;0.934	P;P;P;P	0.56042	0.74;0.721;0.504;0.79	T	0.07731	-1.0757	10	0.52906	T	0.07	-22.3735	15.7225	0.77724	0.0:0.0:0.0:1.0	.	251;267;267;327	B4DKC2;Q7L099-3;Q7L099;Q7L099-2	.;.;RUFY3_HUMAN;.	A	327;267;267;251;214	ENSP00000399771:V327A;ENSP00000370394:V267A;ENSP00000226328:V267A;ENSP00000443652:V251A;ENSP00000425400:V214A	ENSP00000226328:V267A	V	+	2	0	RUFY3	71859790	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.604000	0.82830	2.250000	0.74265	0.477000	0.44152	GTA	.	.	none		0.358	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
SLITRK3	22865	hgsc.bcm.edu	37	3	164907346	164907346	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:164907346G>T	ENST00000475390.1	-	2	1716	c.1273C>A	c.(1273-1275)Cgt>Agt	p.R425S	SLITRK3_ENST00000241274.3_Missense_Mutation_p.R425S			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	425					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						AAATCAGAACGGTATATTTTC	0.398										HNSCC(40;0.11)																											p.R425S		Atlas-SNP	.											SLITRK3,NS,carcinoma,+1,1	SLITRK3	263	1	0			c.C1273A						scavenged	.						54.0	56.0	55.0					3																	164907346		2203	4300	6503	SO:0001583	missense	22865	exon2			CAGAACGGTATAT	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.1273C>A	3.37:g.164907346G>T	ENSP00000420091:p.Arg425Ser	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	49	3	0.0612245	NM_014926	Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429477	0.43122	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.53206	0.63;0.63	5.58	5.58	0.84498	.	0.000000	0.38436	N	0.001696	T	0.42517	0.1206	L	0.44542	1.39	0.51012	D	0.999905	P	0.48998	0.918	P	0.44477	0.451	T	0.10660	-1.0620	10	0.17369	T	0.5	-15.343	14.2462	0.65990	0.0:0.0:0.851:0.149	.	425	O94933	SLIK3_HUMAN	S	425	ENSP00000420091:R425S;ENSP00000241274:R425S	ENSP00000241274:R425S	R	-	1	0	SLITRK3	166390040	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.906000	0.69900	2.906000	0.99361	0.655000	0.94253	CGT	.	.	none		0.398	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
ALDH3B2	222	hgsc.bcm.edu	37	11	67432799	67432799	+	Silent	SNP	G	G	A	rs80147122		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:67432799G>A	ENST00000349015.3	-	7	1101	c.663C>T	c.(661-663)cgC>cgT	p.R221R	ALDH3B2_ENST00000530069.1_Silent_p.R221R|ALDH3B2_ENST00000531881.1_5'Flank	NM_000695.3	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3 family, member B2	221					alcohol metabolic process (GO:0006066)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)		3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	18						CAATGGCCACGCGGCTGCAGC	0.632																																					p.R221R		Atlas-SNP	.											ALDH3B2,NS,haematopoietic_neoplasm,0,2	ALDH3B2	46	2	0			c.C663T						scavenged	.						52.0	59.0	57.0					11																	67432799		2200	4293	6493	SO:0001819	synonymous_variant	222	exon7			GGCCACGCGGCTG	U37519	CCDS31622.1	11q13.2	2014-09-04			ENSG00000132746	ENSG00000132746	1.2.1.5	"""Aldehyde dehydrogenases"""	411	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 8"", ""acetaldehyde dehydrogenase 8"""	601917		ALDH8		8890755, 9161417	Standard	NM_000695		Approved		uc001oms.3	P48448	OTTHUMG00000167284	ENST00000349015.3:c.663C>T	11.37:g.67432799G>A		Somatic	223	1	0.00448431		WXS	Illumina HiSeq	Phase_I	253	5	0.0197628	NM_001031615	Q53Y98|Q8NAL5|Q96IB2	Silent	SNP	ENST00000349015.3	37	CCDS31622.1																																																																																			.	.	strong		0.632	ALDH3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394004.1	NM_000695	
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39324347	39324347	+	Silent	SNP	G	G	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:39324347G>T	ENST00000391356.2	-	1	77	c.78C>A	c.(76-78)cgC>cgA	p.R26R		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	26					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			AGCAGCTGGGGCGGCAGCAGC	0.637																																					p.R26R		Atlas-SNP	.											.	KRTAP4-3	40	.	0			c.C78A						PASS	.						28.0	31.0	30.0					17																	39324347		2198	4295	6493	SO:0001819	synonymous_variant	85290	exon1			GCTGGGGCGGCAG	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.78C>A	17.37:g.39324347G>T		Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	154	30	0.194805	NM_033187		Silent	SNP	ENST00000391356.2	37	CCDS42331.1																																																																																			.	.	none		0.637	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
TBX18	9096	hgsc.bcm.edu	37	6	85446456	85446456	+	Missense_Mutation	SNP	T	T	C	rs145795174		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:85446456T>C	ENST00000369663.5	-	8	2108	c.1771A>G	c.(1771-1773)Acc>Gcc	p.T591A	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	591					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		CTTCCTAGGGTCCTAGAGTCA	0.473																																					p.T591A		Atlas-SNP	.											TBX18,NS,carcinoma,+2,1	TBX18	131	1	0			c.A1771G						scavenged	.						60.0	60.0	60.0					6																	85446456		2203	4300	6503	SO:0001583	missense	9096	exon8			CTAGGGTCCTAGA	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1771A>G	6.37:g.85446456T>C	ENSP00000358677:p.Thr591Ala	Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	91	3	0.032967	NM_001080508	A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	ENST00000369663.5	37	CCDS34495.1	.	.	.	.	.	.	.	.	.	.	T	13.46	2.244057	0.39697	.	.	ENSG00000112837	ENST00000369663	D	0.87809	-2.3	5.41	4.26	0.50523	.	0.214197	0.40385	N	0.001101	T	0.66548	0.2800	N	0.19112	0.55	0.49915	D	0.999832	B	0.06786	0.001	B	0.06405	0.002	T	0.66945	-0.5795	10	0.40728	T	0.16	.	10.6663	0.45732	0.0:0.075:0.0:0.925	.	591	O95935	TBX18_HUMAN	A	591	ENSP00000358677:T591A	ENSP00000358677:T591A	T	-	1	0	TBX18	85503175	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.642000	0.67888	2.046000	0.60703	0.477000	0.44152	ACC	T|1.000;A|0.000	.	alt		0.473	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508	
HERC2	8924	hgsc.bcm.edu	37	15	28483809	28483809	+	Silent	SNP	G	G	A	rs149204675	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:28483809G>A	ENST00000261609.7	-	24	3795	c.3687C>T	c.(3685-3687)gaC>gaT	p.D1229D		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACACCTTCCCGTCAATCACAG	0.373													G|||	26	0.00519169	0.0129	0.0	5008	,	,		17942	0.0		0.004	False		,,,				2504	0.0051				p.D1229D		Atlas-SNP	.											HERC2,NS,carcinoma,0,1	HERC2	501	1	0			c.C3687T						scavenged	.						73.0	68.0	70.0					15																	28483809		2203	4300	6503	SO:0001819	synonymous_variant	8924	exon24			CTTCCCGTCAATC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.3687C>T	15.37:g.28483809G>A		Somatic	385	3	0.00779221		WXS	Illumina HiSeq	Phase_I	346	5	0.0144509	NM_004667		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																			G|0.998;A|0.002	0.002	strong		0.373	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
ADAMTSL5	339366	hgsc.bcm.edu	37	19	1510692	1510692	+	Missense_Mutation	SNP	C	C	T	rs550092054		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:1510692C>T	ENST00000413997.2	-	3	166	c.167G>A	c.(166-168)cGc>cAc	p.R56H	ADAMTSL5_ENST00000330475.4_Missense_Mutation_p.R46H|ADAMTSL5_ENST00000590562.1_5'UTR|CTB-25B13.9_ENST00000590252.1_RNA|ADAMTSL5_ENST00000395467.2_5'UTR			Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5	56	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGGAGCAGCGGGTCCAGGA	0.741																																					p.R46H		Atlas-SNP	.											.	ADAMTSL5	24	.	0			c.G137A						PASS	.						4.0	4.0	4.0					19																	1510692		1835	3619	5454	SO:0001583	missense	339366	exon3			GAGCAGCGGGTCC	BC040620	CCDS12071.1	19p13.3	2008-02-05	2006-02-07	2006-02-07		ENSG00000185761			27912	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain containing 6"""	THSD6			Standard	NM_213604		Approved		uc002ltd.2	Q6ZMM2		ENST00000413997.2:c.167G>A	19.37:g.1510692C>T	ENSP00000399364:p.Arg56His	Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	43	16	0.372093	NM_213604	B4DXK7|Q8IW95	Missense_Mutation	SNP	ENST00000413997.2	37		.	.	.	.	.	.	.	.	.	.	C	16.83	3.230248	0.58777	.	.	ENSG00000185761	ENST00000413997;ENST00000330475	T;T	0.53206	0.63;0.63	3.43	1.08	0.20341	.	0.329393	0.27206	N	0.020425	T	0.30916	0.0780	N	0.11698	0.16	0.80722	D	1	D;D	0.63046	0.992;0.992	P;P	0.51918	0.684;0.594	T	0.14980	-1.0453	10	0.44086	T	0.13	.	2.1487	0.03794	0.1977:0.4922:0.1932:0.1169	.	56;46	B4DXK7;Q6ZMM2	.;ATL5_HUMAN	H	56;46	ENSP00000399364:R56H;ENSP00000327608:R46H	ENSP00000327608:R46H	R	-	2	0	ADAMTSL5	1461692	0.015000	0.18098	0.987000	0.45799	0.871000	0.50021	0.129000	0.15830	0.129000	0.18514	0.456000	0.33151	CGC	.	.	none		0.741	ADAMTSL5-202	KNOWN	basic	protein_coding	protein_coding		XM_294919	
DENND4B	9909	hgsc.bcm.edu	37	1	153907306	153907306	+	Silent	SNP	T	T	C	rs2275483|rs375088543|rs557071025	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:153907306T>C	ENST00000361217.4	-	18	3121	c.2703A>G	c.(2701-2703)caA>caG	p.Q901Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	901	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.Q789Q(2)		NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgttgctgctgct	0.647													T|||	552	0.110224	0.0582	0.1441	5008	,	,		16993	0.1627		0.0378	False		,,,				2504	0.1769				p.Q901Q		Atlas-SNP	.											DENND4B,NS,carcinoma,0,2	DENND4B	210	2	2	Substitution - coding silent(2)	prostate(2)	c.A2703G						scavenged	.	T		25,4345		2,21,2162	31.0	40.0	37.0		2703	2.1	1.0	1	dbSNP_120	37	106,8456		7,92,4182	no	coding-synonymous	DENND4B	NM_014856.2		9,113,6344	CC,CT,TT		1.238,0.5721,1.013		901/1497	153907306	131,12801	2185	4281	6466	SO:0001819	synonymous_variant	9909	exon18			CTGCTGTTGCTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2703A>G	1.37:g.153907306T>C		Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	83	4	0.0481928	NM_014856	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																			.	.	none		0.647	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
CLEC18B	497190	hgsc.bcm.edu	37	16	74451961	74451961	+	Missense_Mutation	SNP	G	G	A	rs151079980	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr16:74451961G>A	ENST00000339953.5	-	3	573	c.452C>T	c.(451-453)aCg>aTg	p.T151M		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	151	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.T151K(1)		endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						ACTCACCTGCGTGTAGTGGGT	0.592																																					p.T151M		Atlas-SNP	.											CLEC18B,NS,carcinoma,0,4	CLEC18B	45	4	1	Substitution - Missense(1)	lung(1)	c.C452T						scavenged	.						9.0	10.0	9.0					16																	74451961		1775	3623	5398	SO:0001583	missense	497190	exon3			ACCTGCGTGTAGT	AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.452C>T	16.37:g.74451961G>A	ENSP00000341051:p.Thr151Met	Somatic	98	1	0.0102041		WXS	Illumina HiSeq	Phase_I	118	6	0.0508475	NM_001011880	B4DF90	Missense_Mutation	SNP	ENST00000339953.5	37	CCDS32484.1	91	0.041666666666666664	5	0.01016260162601626	17	0.04696132596685083	20	0.03496503496503497	49	0.06464379947229551	g	16.79	3.221692	0.58560	.	.	ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492	T	0.16073	2.37	3.57	3.57	0.40892	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.09686	0.0238	H	0.95982	3.75	0.46113	D	0.998879	D;D	0.89917	0.999;1.0	D;D	0.66716	0.943;0.946	T	0.45920	-0.9228	10	0.66056	D	0.02	.	10.55	0.45083	0.0:0.0:1.0:0.0	.	151;151	C9JSV1;Q6UXF7	.;CL18B_HUMAN	M	151	ENSP00000341051:T151M	ENSP00000268492:T151M	T	-	2	0	CLEC18B	73009462	1.000000	0.71417	0.986000	0.45419	0.699000	0.40488	5.199000	0.65152	1.821000	0.53095	0.531000	0.56144	ACG	G|0.968;A|0.032	0.032	strong		0.592	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434697.1	NM_001011880	
POTEF	728378	hgsc.bcm.edu	37	2	130877802	130877802	+	Missense_Mutation	SNP	T	T	C	rs574377005		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:130877802T>C	ENST00000409914.2	-	3	686	c.287A>G	c.(286-288)aAc>aGc	p.N96S	POTEF_ENST00000361163.4_Missense_Mutation_p.N96S|POTEF_ENST00000360967.5_Missense_Mutation_p.N96S|POTEF_ENST00000357462.5_Missense_Mutation_p.N96S	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	96					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GCCCATCTTGTTCCTGAGTGT	0.607													.|||	1	0.000199681	0.0008	0.0	5008	,	,		22288	0.0		0.0	False		,,,				2504	0.0				p.N96S		Atlas-SNP	.											POTEF,NS,carcinoma,0,6	POTEF	140	6	0			c.A287G						scavenged	.						105.0	129.0	120.0					2																	130877802		2203	4296	6499	SO:0001583	missense	728378	exon3			ATCTTGTTCCTGA	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.287A>G	2.37:g.130877802T>C	ENSP00000386786:p.Asn96Ser	Somatic	226	3	0.0132743		WXS	Illumina HiSeq	Phase_I	238	5	0.0210084	NM_001099771	A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.487228	0.00161	.	.	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.75154	-0.91;-0.91;1.92;1.97	0.562	-1.07	0.09968	.	.	.	.	.	T	0.28896	0.0717	N	0.00268	-1.735	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.40270	-0.9572	8	0.02654	T	1	.	.	.	.	.	96	A5A3E0	POTEF_HUMAN	S	96	ENSP00000350052:N96S;ENSP00000386786:N96S;ENSP00000354232:N96S;ENSP00000355012:N96S	ENSP00000350052:N96S	N	-	2	0	POTEF	130594272	0.003000	0.15002	0.082000	0.20525	0.089000	0.18198	0.016000	0.13377	-0.316000	0.08690	0.063000	0.15292	AAC	.	.	none		0.607	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
ZNF488	118738	hgsc.bcm.edu	37	10	48371094	48371094	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:48371094G>A	ENST00000395702.2	+	2	789	c.562G>A	c.(562-564)Gcc>Acc	p.A188T	ZNF488_ENST00000494156.1_3'UTR|ZNF488_ENST00000586537.1_Missense_Mutation_p.A81T			Q96MN9	ZN488_HUMAN	zinc finger protein 488	188					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						ATCTGCAGATGCCCTGGGGGA	0.537																																					p.A188T		Atlas-SNP	.											ZNF488,middle_lobe,carcinoma,-2,1	ZNF488	38	1	0			c.G562A						scavenged	.						91.0	88.0	89.0					10																	48371094		2203	4300	6503	SO:0001583	missense	118738	exon2			GCAGATGCCCTGG	AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.562G>A	10.37:g.48371094G>A	ENSP00000379054:p.Ala188Thr	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	75	2	0.0266667	NM_153034	Q05CE0	Missense_Mutation	SNP	ENST00000395702.2	37	CCDS7217.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.366095	0.24684	.	.	ENSG00000165388	ENST00000395702	T	0.22945	1.93	5.55	-7.46	0.01369	.	0.871380	0.10121	N	0.713347	T	0.12263	0.0298	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.28459	-1.0043	10	0.17369	T	0.5	.	6.2216	0.20685	0.428:0.0:0.3022:0.2699	.	188	Q96MN9	ZN488_HUMAN	T	188	ENSP00000379054:A188T	ENSP00000379054:A188T	A	+	1	0	ZNF488	47991100	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.440000	0.06888	-1.875000	0.01132	-1.267000	0.01435	GCC	.	.	none		0.537	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314632.1	NM_153034	
DOCK7	85440	hgsc.bcm.edu	37	1	63003701	63003701	+	Missense_Mutation	SNP	G	G	T	rs188530601		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:63003701G>T	ENST00000340370.5	-	27	3256	c.3239C>A	c.(3238-3240)cCc>cAc	p.P1080H	DOCK7_ENST00000251157.5_Missense_Mutation_p.P1111H	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1111					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CAGAACACTGGGATTCGGTAA	0.378																																					p.P1111H		Atlas-SNP	.											DOCK7,NS,malignant_melanoma,-1,1	DOCK7	184	1	0			c.C3332A						scavenged	.						132.0	118.0	122.0					1																	63003701		2203	4300	6503	SO:0001583	missense	85440	exon28			ACACTGGGATTCG		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.3239C>A	1.37:g.63003701G>T	ENSP00000340742:p.Pro1080His	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	112	3	0.0267857	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	CCDS30734.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	13.99	2.400940	0.42613	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370	T;T	0.47528	0.84;0.84	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	N	0.19112	0.55	0.80722	D	1	B;D;D;D;D	0.76494	0.359;0.998;0.999;0.958;0.99	B;D;D;P;P	0.69824	0.134;0.938;0.966;0.862;0.904	T	0.55088	-0.8195	10	0.40728	T	0.16	.	19.0168	0.92897	0.0:0.0:1.0:0.0	.	1111;1080;1080;1080;1111	Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.;.;.;.;.	H	1111;1111;1080	ENSP00000251157:P1111H;ENSP00000340742:P1080H	ENSP00000251157:P1111H	P	-	2	0	DOCK7	62776289	1.000000	0.71417	1.000000	0.80357	0.092000	0.18411	9.578000	0.98200	2.737000	0.93849	0.561000	0.74099	CCC	G|1.000;T|0.000	0.000	strong		0.378	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056233	26056233	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:26056233C>T	ENST00000343677.2	-	1	466	c.424G>A	c.(424-426)Gct>Act	p.A142T		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	142					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						GCGCCGCCAGCCGCCTTCTTG	0.577																																					p.A142T		Atlas-SNP	.											.	HIST1H1C	80	.	0			c.G424A						PASS	.						61.0	74.0	69.0					6																	26056233		2197	4295	6492	SO:0001583	missense	3006	exon1			CGCCAGCCGCCTT	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.424G>A	6.37:g.26056233C>T	ENSP00000339566:p.Ala142Thr	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	152	9	0.0592105	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	C	0.704	-0.789557	0.02884	.	.	ENSG00000187837	ENST00000343677	T	0.14022	2.54	5.54	-9.61	0.00550	.	0.479745	0.21639	N	0.071371	T	0.00936	0.0031	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.34725	-0.9817	10	0.02654	T	1	-4.9914	14.0678	0.64841	0.2008:0.6751:0.0:0.1241	.	142	P16403	H12_HUMAN	T	142	ENSP00000339566:A142T	ENSP00000339566:A142T	A	-	1	0	HIST1H1C	26164212	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.462000	0.02364	-1.623000	0.01558	-0.238000	0.12139	GCT	.	.	none		0.577	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
ZNF143	7702	hgsc.bcm.edu	37	11	9492960	9492960	+	Silent	SNP	C	C	T	rs563295110		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:9492960C>T	ENST00000396602.2	+	2	224	c.105C>T	c.(103-105)acC>acT	p.T35T	ZNF143_ENST00000299606.2_Silent_p.T35T|ZNF143_ENST00000396604.1_Silent_p.T35T|ZNF143_ENST00000530463.1_Silent_p.T35T|ZNF143_ENST00000396597.3_Silent_p.T35T	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	35					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		AGGCAGTCACCGTGGCAGGTG	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		18802	0.001		0.0	False		,,,				2504	0.0				p.T35T		Atlas-SNP	.											ZNF143,NS,carcinoma,0,1	ZNF143	38	1	0			c.C105T						scavenged	.						131.0	104.0	113.0					11																	9492960		2201	4294	6495	SO:0001819	synonymous_variant	7702	exon2			AGTCACCGTGGCA	U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.105C>T	11.37:g.9492960C>T		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	110	3	0.0272727	NM_003442	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Silent	SNP	ENST00000396602.2	37	CCDS7799.2																																																																																			.	.	none		0.423	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313921.2	NM_003442	
REC114	283677	hgsc.bcm.edu	37	15	73852122	73852122	+	Silent	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:73852122T>C	ENST00000331090.6	+	6	694	c.666T>C	c.(664-666)caT>caC	p.H222H	C15orf60_ENST00000560581.1_Silent_p.H194H	NM_001042367.1	NP_001035826.1	Q7Z4M0	RE114_HUMAN		222					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)					endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|pancreas(1)|prostate(2)	17						AGCTGCCCCATGTCTATGAAC	0.468																																					p.H222H		Atlas-SNP	.											C15orf60,right_upper_lobe,carcinoma,+2,1	C15orf60	26	1	0			c.T666C						scavenged	.						84.0	83.0	83.0					15																	73852122		1854	4084	5938	SO:0001819	synonymous_variant	283677	exon6			GCCCCATGTCTAT																												ENST00000331090.6:c.666T>C	15.37:g.73852122T>C		Somatic	116	1	0.00862069		WXS	Illumina HiSeq	Phase_I	120	3	0.025	NM_001042367		Silent	SNP	ENST00000331090.6	37	CCDS45296.1																																																																																			.	.	none		0.468	C15orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419069.1		
APEH	327	hgsc.bcm.edu	37	3	49723379	49723379	+	IGR	SNP	T	T	C	rs4052580		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:49723379T>C	ENST00000296456.5	+	0	3220				MST1_ENST00000449682.2_Silent_p.A388A|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000383728.3_3'UTR|MST1_ENST00000494828.2_5'Flank	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ACTGCTCCCCTGCGCCGTGGT	0.711																																					p.A388A		Atlas-SNP	.											MST1,rectum,carcinoma,0,2	MST1	84	2	0			c.A1164G						scavenged	.						14.0	16.0	15.0					3																	49723379		2180	4265	6445	SO:0001628	intergenic_variant	4485	exon10			CTCCCCTGCGCCG	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723379T>C		Somatic	16	3	0.1875		WXS	Illumina HiSeq	Phase_I	45	15	0.333333	NM_020998	Q9BQ33|Q9P0Y2	Silent	SNP	ENST00000296456.5	37	CCDS2801.1																																																																																			T|1.000;|0.000	.	weak		0.711	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
ZCCHC12	170261	hgsc.bcm.edu	37	X	117959875	117959875	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chrX:117959875A>G	ENST00000310164.2	+	4	1175	c.668A>G	c.(667-669)gAt>gGt	p.D223G		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	223					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						GAGGATTGGGATGATGCTTTT	0.483																																					p.D223G		Atlas-SNP	.											.	ZCCHC12	60	.	0			c.A668G						PASS	.						59.0	52.0	55.0					X																	117959875		2203	4300	6503	SO:0001583	missense	170261	exon4			ATTGGGATGATGC	AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.668A>G	X.37:g.117959875A>G	ENSP00000308921:p.Asp223Gly	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	77	4	0.0519481	NM_173798	B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	ENST00000310164.2	37	CCDS14574.1	.	.	.	.	.	.	.	.	.	.	A	7.022	0.558807	0.13436	.	.	ENSG00000174460	ENST00000310164	T	0.34472	1.36	3.0	3.0	0.34707	.	.	.	.	.	T	0.36908	0.0984	M	0.72479	2.2	0.26670	N	0.971746	B	0.33612	0.419	B	0.35413	0.202	T	0.36187	-0.9758	9	0.59425	D	0.04	-9.0207	6.8214	0.23859	1.0:0.0:0.0:0.0	.	223	Q6PEW1	ZCH12_HUMAN	G	223	ENSP00000308921:D223G	ENSP00000308921:D223G	D	+	2	0	ZCCHC12	117843903	1.000000	0.71417	0.968000	0.41197	0.127000	0.20565	3.563000	0.53784	1.412000	0.46977	0.486000	0.48141	GAT	.	.	none		0.483	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058014.1	NM_173798	
FAT4	79633	hgsc.bcm.edu	37	4	126412648	126412648	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:126412648C>T	ENST00000394329.3	+	17	14684	c.14671C>T	c.(14671-14673)Cga>Tga	p.R4891*	FAT4_ENST00000335110.5_Nonsense_Mutation_p.R3132*	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4891					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ACTGAAGCCTCGAAGGTACCA	0.527																																					p.R4891X		Atlas-SNP	.											FAT4_ENST00000394329,NS,carcinoma,0,2	FAT4	1752	2	0			c.C14671T						scavenged	.						57.0	57.0	57.0					4																	126412648		2203	4300	6503	SO:0001587	stop_gained	79633	exon17			AAGCCTCGAAGGT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.14671C>T	4.37:g.126412648C>T	ENSP00000377862:p.Arg4891*	Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	139	2	0.0143885	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Nonsense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	52	19.781489	0.99923	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	.	.	.	5.19	-5.33	0.02713	.	0.000000	0.34178	U	0.004190	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	19.3004	0.94141	0.2838:0.7162:0.0:0.0	.	.	.	.	X	4891;3132	.	ENSP00000335169:R3132X	R	+	1	2	FAT4	126632098	0.401000	0.25303	0.082000	0.20525	0.179000	0.23085	0.673000	0.25203	-0.335000	0.08451	0.491000	0.48974	CGA	.	.	none		0.527	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
COL3A1	1281	hgsc.bcm.edu	37	2	189849577	189849577	+	Silent	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:189849577A>G	ENST00000304636.3	+	2	341	c.171A>G	c.(169-171)tcA>tcG	p.S57S	COL3A1_ENST00000317840.5_Silent_p.S57S	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	57	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TCTGTGACTCAGGATCCGTTC	0.463																																					p.S57S		Atlas-SNP	.											.	COL3A1	292	.	0			c.A171G						PASS	.						168.0	145.0	153.0					2																	189849577		2203	4299	6502	SO:0001819	synonymous_variant	1281	exon2			TGACTCAGGATCC	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.171A>G	2.37:g.189849577A>G		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	122	42	0.344262	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Silent	SNP	ENST00000304636.3	37	CCDS2297.1																																																																																			.	.	none		0.463	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
ARHGAP11A	9824	hgsc.bcm.edu	37	15	32926229	32926229	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:32926229A>T	ENST00000361627.3	+	10	2053	c.1331A>T	c.(1330-1332)aAt>aTt	p.N444I	ARHGAP11A_ENST00000563864.1_Missense_Mutation_p.N416I|ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.N255I|ARHGAP11A_ENST00000567348.1_Missense_Mutation_p.N444I|ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.N255I	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	444					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		CTAGGGAAAAATGGCAGAGAA	0.353																																					p.N444I	Colon(45;757 1134 30003 36652)	Atlas-SNP	.											.	ARHGAP11A	84	.	0			c.A1331T						PASS	.						36.0	35.0	35.0					15																	32926229		2201	4300	6501	SO:0001583	missense	9824	exon10			GGAAAAATGGCAG	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.1331A>T	15.37:g.32926229A>T	ENSP00000355090:p.Asn444Ile	Somatic	282	0	0		WXS	Illumina HiSeq	Phase_I	237	48	0.202532	NM_199357	B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	37	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	.	17.09	3.300482	0.60195	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.10288	2.89	5.51	-3.26	0.05064	.	0.454459	0.22141	N	0.064049	T	0.15478	0.0373	L	0.44542	1.39	0.32060	N	0.595807	P;D	0.57571	0.901;0.98	B;P	0.54312	0.296;0.748	T	0.06844	-1.0804	10	0.87932	D	0	.	13.7577	0.62946	0.3388:0.0:0.6612:0.0	.	444;255	Q6P4F7;B4DZN9	RHGBA_HUMAN;.	I	444;255	ENSP00000355090:N444I	ENSP00000355090:N444I	N	+	2	0	ARHGAP11A	30713521	1.000000	0.71417	0.899000	0.35326	0.825000	0.46686	1.904000	0.39868	-0.528000	0.06366	-0.290000	0.09829	AAT	.	.	none		0.353	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783	
DSCAM	1826	hgsc.bcm.edu	37	21	41465696	41465696	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:41465696C>A	ENST00000400454.1	-	21	4279	c.3802G>T	c.(3802-3804)Gga>Tga	p.G1268*		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1268	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TTGCCTCTTCCGGCTGAAGTA	0.493																																					p.G1268X	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											DSCAM,NS,carcinoma,+1,1	DSCAM	347	1	0			c.G3802T						scavenged	.						67.0	64.0	65.0					21																	41465696		1963	4161	6124	SO:0001587	stop_gained	1826	exon21			CTCTTCCGGCTGA	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3802G>T	21.37:g.41465696C>A	ENSP00000383303:p.Gly1268*	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	122	3	0.0245902	NM_001271534	O60468	Nonsense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	42	9.217036	0.99103	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.7356	0.91753	0.0:1.0:0.0:0.0	.	.	.	.	X	1268;1020	.	ENSP00000383303:G1268X	G	-	1	0	DSCAM	40387566	1.000000	0.71417	0.763000	0.31416	0.875000	0.50365	7.726000	0.84824	2.415000	0.81967	0.467000	0.42956	GGA	.	.	none		0.493	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
TLL1	7092	hgsc.bcm.edu	37	4	166913969	166913969	+	Silent	SNP	C	C	T	rs377042841		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr4:166913969C>T	ENST00000061240.2	+	3	941	c.294C>T	c.(292-294)gaC>gaT	p.D98D	TLL1_ENST00000507499.1_Silent_p.D98D|TLL1_ENST00000513213.1_Silent_p.D98D	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	98					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GACTTGGAGACCATGCTATGT	0.363																																					p.D98D		Atlas-SNP	.											.	TLL1	194	.	0			c.C294T						PASS	.						131.0	129.0	130.0					4																	166913969		2203	4299	6502	SO:0001819	synonymous_variant	7092	exon3			TGGAGACCATGCT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.294C>T	4.37:g.166913969C>T		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	80	4	0.05	NM_001204760	B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	ENST00000061240.2	37	CCDS3811.1																																																																																			.	.	alt		0.363	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
ZBED2	79413	hgsc.bcm.edu	37	3	111312927	111312927	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:111312927G>A	ENST00000317012.4	-	2	1130	c.122C>T	c.(121-123)gCt>gTt	p.A41V	CD96_ENST00000438817.2_Intron|CD96_ENST00000283285.5_Intron|CD96_ENST00000352690.4_Intron	NM_024508.4	NP_078784.2	Q9BTP6	ZBED2_HUMAN	zinc finger, BED-type containing 2	41							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(1)|skin(2)	6						AGTGGGCATAGCACTCACAAA	0.532																																					p.A41V		Atlas-SNP	.											.	ZBED2	22	.	0			c.C122T						PASS	.						243.0	203.0	217.0					3																	111312927		2203	4300	6503	SO:0001583	missense	79413	exon2			GGCATAGCACTCA	BC003536	CCDS2960.2	3p13-q13.2	2013-05-03			ENSG00000177494	ENSG00000177494		"""Zinc fingers, BED-type"""	20710	protein-coding gene	gene with protein product		615246				23533661	Standard	NM_024508		Approved	MGC10796	uc003dxy.3	Q9BTP6	OTTHUMG00000074061	ENST00000317012.4:c.122C>T	3.37:g.111312927G>A	ENSP00000321370:p.Ala41Val	Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	190	76	0.4	NM_024508	D3DN62	Missense_Mutation	SNP	ENST00000317012.4	37	CCDS2960.2	.	.	.	.	.	.	.	.	.	.	G	4.764	0.142084	0.09083	.	.	ENSG00000177494	ENST00000317012	.	.	.	3.16	2.27	0.28462	.	.	.	.	.	T	0.25005	0.0607	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19844	-1.0293	8	0.22706	T	0.39	.	6.0802	0.19936	0.1484:0.0:0.8516:0.0	.	41	Q9BTP6	ZBED2_HUMAN	V	41	.	ENSP00000321370:A41V	A	-	2	0	ZBED2	112795617	0.000000	0.05858	0.002000	0.10522	0.053000	0.15095	0.323000	0.19593	0.654000	0.30846	0.563000	0.77884	GCT	.	.	none		0.532	ZBED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157228.2	NM_024508	
ETV5	2119	hgsc.bcm.edu	37	3	185797673	185797673	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:185797673G>A	ENST00000306376.5	-	7	829	c.583C>T	c.(583-585)Cga>Tga	p.R195*	ETV5-AS1_ENST00000453370.1_RNA|ETV5_ENST00000434744.1_Nonsense_Mutation_p.R195*|ETV5_ENST00000537818.1_Nonsense_Mutation_p.R237*	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	195					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			TGTGGTGGTCGGGGGACCGCA	0.587			T	"""TMPRSS2, SCL45A3"""	Prostate																																p.R195X		Atlas-SNP	.		Dom	yes		3	3q28	2119	ets variant gene 5		E	.	ETV5	106	.	0			c.C583T						PASS	.						120.0	118.0	119.0					3																	185797673		2203	4300	6503	SO:0001587	stop_gained	2119	exon7			GTGGTCGGGGGAC	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.583C>T	3.37:g.185797673G>A	ENSP00000306894:p.Arg195*	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	166	74	0.445783	NM_004454	A6NH46|B7Z7D7|Q6IBN5	Nonsense_Mutation	SNP	ENST00000306376.5	37	CCDS33906.1	.	.	.	.	.	.	.	.	.	.	G	39	7.294772	0.98192	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	.	.	.	5.34	3.39	0.38822	.	0.818906	0.11352	N	0.572821	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	11.3294	0.49467	0.0:0.0:0.6711:0.3289	.	.	.	.	X	195;195;237	.	ENSP00000306894:R195X	R	-	1	2	ETV5	187280367	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	5.489000	0.66875	1.201000	0.43203	0.563000	0.77884	CGA	.	.	none		0.587	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
ALX4	60529	hgsc.bcm.edu	37	11	44331309	44331309	+	Missense_Mutation	SNP	G	G	A	rs12421995	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:44331309G>A	ENST00000329255.3	-	1	407	c.304C>T	c.(304-306)Ccg>Tcg	p.P102S		NM_021926.3	NP_068745.2	Q9H161	ALX4_HUMAN	ALX homeobox 4	102			P -> S (in dbSNP:rs12421995). {ECO:0000269|PubMed:11137991}.		anterior/posterior pattern specification (GO:0009952)|digestive tract development (GO:0048565)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|hair follicle development (GO:0001942)|muscle organ development (GO:0007517)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of apoptotic process (GO:0042981)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	16						ggctgcggcggcggctggggc	0.731													G|||	1863	0.372005	0.0287	0.3473	5008	,	,		9331	0.506		0.4364	False		,,,				2504	0.6493				p.P102S		Atlas-SNP	.											.	ALX4	58	.	0			c.C304T						PASS	.						2.0	2.0	2.0					11																	44331309		903	2415	3318	SO:0001583	missense	60529	exon1			GCGGCGGCGGCTG	AF294629	CCDS31468.1	11p11.2	2011-06-20	2008-11-04		ENSG00000052850	ENSG00000052850		"""Homeoboxes / PRD class"""	450	protein-coding gene	gene with protein product		605420	"""parietal foramina 2"", ""aristaless-like homeobox 4"""	PFM2		11017806, 8644736	Standard	NM_021926		Approved	FPP, PFM, KIAA1788	uc001myb.3	Q9H161	OTTHUMG00000166557	ENST00000329255.3:c.304C>T	11.37:g.44331309G>A	ENSP00000332744:p.Pro102Ser	Somatic	1	0	0		WXS	Illumina HiSeq	Phase_I	9	5	0.555556	NM_021926	Q96JN7|Q9H198|Q9HAY9	Missense_Mutation	SNP	ENST00000329255.3	37	CCDS31468.1	794	0.36355311355311354	31	0.06300813008130081	124	0.3425414364640884	286	0.5	353	0.4656992084432718	g	2.092	-0.408130	0.04832	.	.	ENSG00000052850	ENST00000329255	T	0.23552	1.9	4.17	2.11	0.27256	.	0.432725	0.21550	N	0.072754	T	0.00012	0.0000	L	0.54323	1.7	0.43708	P	0.003821999999999992	B	0.12630	0.006	B	0.06405	0.002	T	0.45498	-0.9257	9	0.08599	T	0.76	.	9.0455	0.36345	0.0:0.2181:0.6318:0.1501	rs12421995	102	Q9H161	ALX4_HUMAN	S	102	ENSP00000332744:P102S	ENSP00000332744:P102S	P	-	1	0	ALX4	44287885	.	.	0.370000	0.25965	0.012000	0.07955	.	.	0.243000	0.21327	-0.319000	0.08680	CCG	G|0.635;A|0.365	0.365	strong		0.731	ALX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390399.1		
FOLH1	2346	hgsc.bcm.edu	37	11	49175427	49175427	+	Silent	SNP	A	A	G	rs199517010		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:49175427A>G	ENST00000256999.2	-	17	2201	c.1941T>C	c.(1939-1941)agT>agC	p.S647S	FOLH1_ENST00000340334.7_Silent_p.S632S|FOLH1_ENST00000533034.1_Silent_p.S632S|FOLH1_ENST00000343844.4_Silent_p.S339S|FOLH1_ENST00000356696.3_Silent_p.S647S	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	647					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.S647S(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GGAGTCTCTCACTGAACTTGG	0.294																																					p.S647S		Atlas-SNP	.											FOLH1,mouth,carcinoma,0,1	FOLH1	141	1	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.T1941C						scavenged	.						83.0	85.0	84.0					11																	49175427		2201	4296	6497	SO:0001819	synonymous_variant	2346	exon17			TCTCTCACTGAAC	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1941T>C	11.37:g.49175427A>G		Somatic	262	5	0.019084		WXS	Illumina HiSeq	Phase_I	252	9	0.0357143	NM_004476	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																			A|0.999;G|0.001	0.001	weak		0.294	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
ESPNL	339768	hgsc.bcm.edu	37	2	239040089	239040089	+	Missense_Mutation	SNP	C	C	T	rs199724430	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:239040089C>T	ENST00000343063.3	+	9	2997	c.2734C>T	c.(2734-2736)Cgc>Tgc	p.R912C	ESPNL_ENST00000477241.1_3'UTR|ESPNL_ENST00000409506.1_Missense_Mutation_p.R544C|ESPNL_ENST00000409169.1_Missense_Mutation_p.R868C	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	912										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GGCCGCCGGCCGCCGGGCCTG	0.692													C|||	11	0.00219649	0.0	0.0	5008	,	,		13571	0.0109		0.0	False		,,,				2504	0.0				p.R912C		Atlas-SNP	.											ESPNL,NS,carcinoma,-1,1	ESPNL	63	1	0			c.C2734T						scavenged	.	C	CYS/ARG	2,4188		0,2,2093	9.0	12.0	11.0		2734	2.9	0.9	2		11	0,8228		0,0,4114	no	missense	ESPNL	NM_194312.2	180	0,2,6207	TT,TC,CC		0.0,0.0477,0.0161	probably-damaging	912/1006	239040089	2,12416	2095	4114	6209	SO:0001583	missense	339768	exon9			GCCGGCCGCCGGG	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.2734C>T	2.37:g.239040089C>T	ENSP00000339115:p.Arg912Cys	Somatic	1	1	1		WXS	Illumina HiSeq	Phase_I	11	6	0.545455	NM_194312	Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	37	CCDS2525.1	4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	C	17.11	3.304542	0.60305	4.77E-4	0.0	ENSG00000144488	ENST00000343063;ENST00000409169;ENST00000409506	T;T;T	0.70749	-0.51;0.58;0.22	4.72	2.87	0.33458	.	0.258957	0.31897	N	0.006898	T	0.72137	0.3423	M	0.68593	2.085	0.46823	D	0.999212	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.959	T	0.73430	-0.3985	10	0.87932	D	0	-35.1335	4.8076	0.13328	0.1532:0.6129:0.1486:0.0853	.	868;912	Q6ZVH7-2;Q6ZVH7	.;ESPNL_HUMAN	C	912;868;544	ENSP00000339115:R912C;ENSP00000386577:R868C;ENSP00000386579:R544C	ENSP00000339115:R912C	R	+	1	0	ESPNL	238704828	0.042000	0.20092	0.896000	0.35187	0.865000	0.49528	1.688000	0.37690	0.401000	0.25424	0.460000	0.39030	CGC	C|0.998;T|0.002	0.002	strong		0.692	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312	
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39324333	39324333	+	Missense_Mutation	SNP	T	T	A	rs12953139	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:39324333T>A	ENST00000391356.2	-	1	91	c.92A>T	c.(91-93)cAg>cTg	p.Q31L		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	31					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGGTGGTCTGGCAGCAGCT	0.637																																					p.Q31L		Atlas-SNP	.											KRTAP4-3,NS,carcinoma,0,1	KRTAP4-3	40	1	0			c.A92T						scavenged	.						29.0	32.0	31.0					17																	39324333		2195	4293	6488	SO:0001583	missense	85290	exon1			GTGGTCTGGCAGC	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.92A>T	17.37:g.39324333T>A	ENSP00000375151:p.Gln31Leu	Somatic	151	2	0.013245		WXS	Illumina HiSeq	Phase_I	208	62	0.298077	NM_033187		Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	8.661	0.900435	0.17686	.	.	ENSG00000196156	ENST00000391356	T	0.01629	4.72	5.15	0.112	0.14623	.	.	.	.	.	T	0.03608	0.0103	M	0.85373	2.75	0.80722	P	0.0	B	0.34181	0.44	B	0.38378	0.272	T	0.11131	-1.0600	8	0.35671	T	0.21	.	3.821	0.08836	0.1588:0.2591:0.0:0.5822	.	31	Q9BYR4	KRA43_HUMAN	L	31	ENSP00000375151:Q31L	ENSP00000375151:Q31L	Q	-	2	0	KRTAP4-3	36577859	0.006000	0.16342	0.208000	0.23602	0.204000	0.24138	0.129000	0.15830	0.020000	0.15106	0.533000	0.62120	CAG	A|0.046;T|0.954	0.046	strong		0.637	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
APEH	327	hgsc.bcm.edu	37	3	49723296	49723296	+	IGR	SNP	G	G	A	rs2087733	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:49723296G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000449682.2_Missense_Mutation_p.P416L|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000383728.3_3'UTR|MST1_ENST00000494828.2_5'Flank	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.P402L(4)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GACTCACTGCGGCTTGTGCGG	0.677													G|||	3	0.000599042	0.0	0.0	5008	,	,		23747	0.0		0.003	False		,,,				2504	0.0				p.P416L		Atlas-SNP	.											MST1,trunk,malignant_melanoma,0,3	MST1	84	3	4	Substitution - Missense(4)	NS(2)|lung(1)|skin(1)	c.C1247T						scavenged	.						67.0	64.0	65.0					3																	49723296		2197	4282	6479	SO:0001628	intergenic_variant	4485	exon10			CACTGCGGCTTGT	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723296G>A		Somatic	68	1	0.0147059		WXS	Illumina HiSeq	Phase_I	121	4	0.0330578	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117796	0.37339	.	.	ENSG00000173531	ENST00000449682	T	0.66280	-0.2	5.1	5.1	0.69264	.	0.000000	0.42053	D	0.000772	T	0.52980	0.1768	L	0.33137	0.985	0.80722	D	1	B	0.18013	0.025	B	0.17979	0.02	T	0.48969	-0.8987	10	0.38643	T	0.18	.	16.2918	0.82756	0.0:0.0:1.0:0.0	rs2087733	416	G3XAK1	.	L	416	ENSP00000414287:P416L	ENSP00000414287:P416L	P	-	2	0	MST1	49698300	1.000000	0.71417	0.996000	0.52242	0.047000	0.14425	8.980000	0.93460	2.373000	0.80994	0.561000	0.74099	CCG	G|0.375;A|0.625	0.625	strong		0.677	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
MST1L	11223	hgsc.bcm.edu	37	1	17085791	17085791	+	RNA	SNP	G	G	A	rs2297532		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:17085791G>A	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										TCTGTACAACGCCGGATCTGG	0.692																																					p.R344C		Atlas-SNP	.											Q13209_HUMAN,NS,carcinoma,0,4	.	.	4	0			c.C1030T						scavenged	.																																					11223	exon8			TACAACGCCGGAT	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085791G>A		Somatic	128	3	0.0234375		WXS	Illumina HiSeq	Phase_I	143	7	0.048951	NM_001271733	B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37		124	0.056776556776556776	29	0.05894308943089431	16	0.04419889502762431	48	0.08391608391608392	31	0.040897097625329816	.	15.12	2.737865	0.49045	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.000000	0.42548	D	0.000696	T	0.09069	0.0224	.	.	.	.	.	.	D	0.89917	1.0	D	0.78314	0.991	T	0.53136	-0.8481	6	0.87932	D	0	.	5.8178	0.18506	0.001:0.0:0.999:0.0	rs2297532;rs3981961;rs3982167;rs9701622;rs57280630	344	Q2TV78-2	.	C	334;344;344	.	ENSP00000439273:R344C	R	-	1	0	MST1P9	16958378	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	6.473000	0.73572	-0.000000	0.14550	0.000000	0.15137	CGT	G|0.943;A|0.057	0.057	strong		0.692	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733	
SWAP70	23075	hgsc.bcm.edu	37	11	9685820	9685820	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:9685820C>T	ENST00000318950.6	+	1	197	c.94C>T	c.(94-96)Ctc>Ttc	p.L32F	SWAP70_ENST00000447399.2_Missense_Mutation_p.L32F	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	32					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		CAAGTCCCAGCTCAAGGTGGG	0.692																																					p.L32F		Atlas-SNP	.											.	SWAP70	40	.	0			c.C94T						PASS	.						30.0	24.0	26.0					11																	9685820		2179	4272	6451	SO:0001583	missense	23075	exon1			TCCCAGCTCAAGG	AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.94C>T	11.37:g.9685820C>T	ENSP00000315630:p.Leu32Phe	Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	222	97	0.436937	NM_015055	D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Missense_Mutation	SNP	ENST00000318950.6	37	CCDS31426.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.750499	0.89753	.	.	ENSG00000133789	ENST00000447399;ENST00000318950	D;T	0.86865	-2.18;2.55	5.5	5.5	0.81552	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.93943	0.8061	M	0.81497	2.545	0.80722	D	1	D;P;D	0.76494	0.998;0.891;0.999	D;P;D	0.85130	0.996;0.49;0.997	D	0.94379	0.7603	10	0.87932	D	0	-6.5908	19.0354	0.92974	0.0:1.0:0.0:0.0	.	32;32;32	E7EMB1;Q9UH65;B3KUB9	.;SWP70_HUMAN;.	F	32	ENSP00000399056:L32F;ENSP00000315630:L32F	ENSP00000315630:L32F	L	+	1	0	SWAP70	9642396	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.705000	0.54823	2.584000	0.87258	0.563000	0.77884	CTC	.	.	none		0.692	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386766.2	NM_015055	
SH3YL1	26751	hgsc.bcm.edu	37	2	218939	218939	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:218939C>T	ENST00000405430.1	-	12	1277	c.901G>A	c.(901-903)Gat>Aat	p.D301N	SH3YL1_ENST00000403658.1_Missense_Mutation_p.D186N|SH3YL1_ENST00000403657.1_Missense_Mutation_p.D186N|SH3YL1_ENST00000415006.2_Missense_Mutation_p.D205N|SH3YL1_ENST00000403712.2_Missense_Mutation_p.D282N|SH3YL1_ENST00000468321.1_5'UTR|SH3YL1_ENST00000356150.5_Missense_Mutation_p.D301N			Q96HL8	SH3Y1_HUMAN	SH3 and SYLF domain containing 1	301	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				phosphatidylinositol biosynthetic process (GO:0006661)|regulation of ruffle assembly (GO:1900027)	ruffle membrane (GO:0032587)	phosphatase binding (GO:0019902)|phosphatidylinositol binding (GO:0035091)			large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)		AAATTCAAATCCCCAGGCTGC	0.373																																					p.D301N		Atlas-SNP	.											.	SH3YL1	49	.	0			c.G901A						PASS	.						102.0	93.0	96.0					2																	218939		1826	4079	5905	SO:0001583	missense	26751	exon10			TCAAATCCCCAGG		CCDS42646.1, CCDS42646.2, CCDS54332.1, CCDS62841.1	2p25.3	2013-10-18	2013-10-18		ENSG00000035115	ENSG00000035115			29546	protein-coding gene	gene with protein product			"""SH3 domain containing, Ysc84-like 1 (S. cerevisiae)"""			21624956	Standard	NM_001282687		Approved	Ray, DKFZP586F1318	uc002qvx.3	Q96HL8	OTTHUMG00000151359	ENST00000405430.1:c.901G>A	2.37:g.218939C>T	ENSP00000384269:p.Asp301Asn	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	94	43	0.457447	NM_015677	A8K8E7|B7WNJ4|B7WPL6|Q8NEL2|Q9H5X4|Q9Y3V5	Missense_Mutation	SNP	ENST00000405430.1	37		.	.	.	.	.	.	.	.	.	.	C	32	5.170694	0.94807	.	.	ENSG00000035115	ENST00000415006;ENST00000403712;ENST00000403657;ENST00000405430;ENST00000356150;ENST00000403658;ENST00000451005	T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85	6.03	6.03	0.97812	Src homology-3 domain (5);	0.108509	0.64402	D	0.000010	T	0.81969	0.4935	H	0.98487	4.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;0.997;0.998	D	0.88284	0.2938	10	0.87932	D	0	-11.8105	18.0605	0.89375	0.0:1.0:0.0:0.0	.	186;282;301;205	Q96HL8-4;Q96HL8-2;Q96HL8;Q96HL8-3	.;.;SH3Y1_HUMAN;.	N	205;282;186;301;301;186;214	ENSP00000404143:D205N;ENSP00000384276:D282N;ENSP00000385668:D186N;ENSP00000384269:D301N;ENSP00000348471:D301N;ENSP00000383928:D186N;ENSP00000416312:D214N	ENSP00000348471:D301N	D	-	1	0	SH3YL1	208939	1.000000	0.71417	0.981000	0.43875	0.982000	0.71751	6.441000	0.73439	2.854000	0.98071	0.655000	0.94253	GAT	.	.	none		0.373	SH3YL1-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322352.1	NM_015677	
PIANP	196500	hgsc.bcm.edu	37	12	6806573	6806573	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:6806573G>T	ENST00000540656.1	-	3	741	c.403C>A	c.(403-405)Cct>Act	p.P135T	PIANP_ENST00000534837.1_Missense_Mutation_p.P135T|PIANP_ENST00000320591.5_Missense_Mutation_p.P135T	NM_001244015.1	NP_001230944.1	Q8IYJ0	PIANP_HUMAN	PILR alpha associated neural protein	135						integral component of membrane (GO:0016021)											AGCCCATGAGGGGCTGCAAAA	0.602																																					p.P135T		Atlas-SNP	.											.	.	.	.	0			c.C403A						PASS	.						50.0	54.0	53.0					12																	6806573		1940	4123	6063	SO:0001583	missense	196500	exon3			CATGAGGGGCTGC	BC035736	CCDS44818.1, CCDS58205.1	12p13.31	2012-08-17	2012-08-17	2012-08-17	ENSG00000139200	ENSG00000139200			25338	protein-coding gene	gene with protein product	"""PILR-associating neural protein"""		"""chromosome 12 open reading frame 53"""	C12orf53		12975309	Standard	NM_153685		Approved	DKFZp547D2210, PANP	uc001qqf.2	Q8IYJ0	OTTHUMG00000168664	ENST00000540656.1:c.403C>A	12.37:g.6806573G>T	ENSP00000442157:p.Pro135Thr	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	109	5	0.0458716	NM_001244014	A8K0T3|B3KPF7|B3KRI6|Q6UX35	Missense_Mutation	SNP	ENST00000540656.1	37	CCDS44818.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148879	0.57151	.	.	ENSG00000139200	ENST00000540656;ENST00000320591;ENST00000534837;ENST00000439553;ENST00000545917	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	4.05	4.05	0.47172	.	0.135360	0.50627	D	0.000106	T	0.19846	0.0477	N	0.14661	0.345	0.31623	N	0.650026	P	0.40282	0.711	B	0.27887	0.084	T	0.28650	-1.0037	10	0.72032	D	0.01	-9.1833	8.2372	0.31634	0.1749:0.0:0.8251:0.0	.	135	Q8IYJ0	CL053_HUMAN	T	135;135;135;109;135	ENSP00000442157:P135T;ENSP00000317818:P135T;ENSP00000443919:P135T;ENSP00000444605:P135T	ENSP00000317818:P135T	P	-	1	0	C12orf53	6676834	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.423000	0.59861	1.802000	0.52723	0.305000	0.20034	CCT	.	.	none		0.602	PIANP-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400524.1	NM_153685	
MUC4	4585	hgsc.bcm.edu	37	3	195515134	195515134	+	Missense_Mutation	SNP	G	G	T	rs374418206		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr3:195515134G>T	ENST00000463781.3	-	2	3776	c.3317C>A	c.(3316-3318)cCt>cAt	p.P1106H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P1106H|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	538					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P1106H(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGAGGT	0.572																																					p.P1106H		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,5	MUC4	1505	5	2	Substitution - Missense(2)	skin(2)	c.C3317A						scavenged	.						8.0	7.0	7.0					3																	195515134		649	1454	2103	SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3317C>A	3.37:g.195515134G>T	ENSP00000417498:p.Pro1106His	Somatic	91	8	0.0879121		WXS	Illumina HiSeq	Phase_I	118	13	0.110169	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.963	0.178958	0.09443	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34072	1.38;1.38	0.814	0.814	0.18756	.	.	.	.	.	T	0.38427	0.1040	N	0.19112	0.55	0.09310	N	1	D	0.76494	0.999	D	0.77557	0.99	T	0.21655	-1.0239	8	.	.	.	.	7.6132	0.28142	0.0:0.0:1.0:0.0	.	1106	E7ESK3	.	H	1106	ENSP00000417498:P1106H;ENSP00000420243:P1106H	.	P	-	2	0	MUC4	196999529	0.103000	0.21917	0.003000	0.11579	0.286000	0.27126	3.387000	0.52501	0.776000	0.33473	0.064000	0.15345	CCT	.	.	weak		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
POTEE	445582	hgsc.bcm.edu	37	2	132021684	132021684	+	Missense_Mutation	SNP	C	C	A	rs2672150		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:132021684C>A	ENST00000356920.5	+	15	2750	c.2656C>A	c.(2656-2658)Cct>Act	p.P886T	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	886	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GCGGGAACTGCCTGACTACCT	0.592																																					p.P886T		Atlas-SNP	.											ENSG00000188219,NS,carcinoma,-1,1	.	.	1	0			c.C2656A						scavenged	.						46.0	47.0	47.0					2																	132021684		2203	4281	6484	SO:0001583	missense	445582	exon15			GAACTGCCTGACT	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2656C>A	2.37:g.132021684C>A	ENSP00000439189:p.Pro886Thr	Somatic	446	4	0.00896861		WXS	Illumina HiSeq	Phase_I	507	5	0.00986193	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	3.880	-0.026136	0.07589	.	.	ENSG00000188219	ENST00000356920	T	0.04360	3.64	.	.	.	.	.	.	.	.	T	0.00241	0.0007	N	0.00000	-5.39	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.59606	-0.7423	8	0.02654	T	1	.	4.0636	0.09849	0.6406:0.3593:1.0E-4:0.0	.	886	Q6S8J3	POTEE_HUMAN	T	886	ENSP00000439189:P886T	ENSP00000439189:P886T	P	+	1	0	AC131180.1	131738154	1.000000	0.71417	0.081000	0.20488	0.082000	0.17680	4.531000	0.60602	-2.143000	0.00803	-2.210000	0.00300	CCT	.	.	weak		0.592	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
HLA-DQA2	3118	hgsc.bcm.edu	37	6	32713608	32713608	+	Silent	SNP	G	G	A	rs199931222		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:32713608G>A	ENST00000374940.3	+	3	474	c.372G>A	c.(370-372)acG>acA	p.T124T		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	124	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	TTCCTGTGACGCTGGGTCAGC	0.512																																					p.T124T		Atlas-SNP	.											HLA-DQA2,colon,carcinoma,+1,1	HLA-DQA2	27	1	0			c.G372A						scavenged	.						199.0	156.0	171.0					6																	32713608		1511	2709	4220	SO:0001819	synonymous_variant	3118	exon3			TGTGACGCTGGGT		CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.372G>A	6.37:g.32713608G>A		Somatic	316	4	0.0126582		WXS	Illumina HiSeq	Phase_I	346	9	0.0260116	NM_020056	A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Silent	SNP	ENST00000374940.3	37	CCDS4753.1																																																																																			G|0.998;A|0.002	0.002	weak		0.512	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076179.2	NM_020056	
CD1C	911	hgsc.bcm.edu	37	1	158261083	158261083	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:158261083G>A	ENST00000368170.3	+	2	500	c.221G>A	c.(220-222)gGc>gAc	p.G74D		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	74					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					TGGTCCAAGGGCAACTTCAGC	0.473																																					p.G74D		Atlas-SNP	.											CD1C,NS,carcinoma,+1,1	CD1C	100	1	0			c.G221A						scavenged	.						129.0	120.0	123.0					1																	158261083		2203	4300	6503	SO:0001583	missense	911	exon2			CCAAGGGCAACTT	M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.221G>A	1.37:g.158261083G>A	ENSP00000357152:p.Gly74Asp	Somatic	224	0	0		WXS	Illumina HiSeq	Phase_I	263	3	0.0114068	NM_001765	Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	ENST00000368170.3	37	CCDS1175.1	.	.	.	.	.	.	.	.	.	.	-	13.07	2.126748	0.37533	.	.	ENSG00000158481	ENST00000368169;ENST00000368170	T	0.07688	3.17	3.52	0.21	0.15231	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.829560	0.09964	N	0.733069	T	0.15565	0.0375	M	0.88570	2.965	0.09310	N	1	P	0.38827	0.649	D	0.67382	0.951	T	0.40289	-0.9571	10	0.87932	D	0	.	1.6481	0.02766	0.1354:0.1985:0.4623:0.2039	.	74	P29017	CD1C_HUMAN	D	74	ENSP00000357152:G74D	ENSP00000357151:G74D	G	+	2	0	CD1C	156527707	0.003000	0.15002	0.000000	0.03702	0.005000	0.04900	0.483000	0.22292	0.054000	0.16065	-0.155000	0.13514	GGC	.	.	none		0.473	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046351.2	NM_001765	
CCAR1	55749	hgsc.bcm.edu	37	10	70549639	70549639	+	Silent	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr10:70549639G>A	ENST00000265872.6	+	24	3479	c.3360G>A	c.(3358-3360)acG>acA	p.T1120T	CCAR1_ENST00000535016.1_Silent_p.T1105T|CCAR1_ENST00000543719.1_Silent_p.T1105T	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	1120					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						ACTTATCTACGGTAATGGATG	0.284																																					p.T1120T		Atlas-SNP	.											.	CCAR1	118	.	0			c.G3360A						PASS	.						45.0	48.0	47.0					10																	70549639		2201	4293	6494	SO:0001819	synonymous_variant	55749	exon24			ATCTACGGTAATG	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.3360G>A	10.37:g.70549639G>A		Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	167	8	0.0479042	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Silent	SNP	ENST00000265872.6	37	CCDS7282.1																																																																																			.	.	none		0.284	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	
PCLO	27445	hgsc.bcm.edu	37	7	82784833	82784833	+	Missense_Mutation	SNP	T	T	G	rs71074627		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr7:82784833T>G	ENST00000333891.9	-	2	1461	c.1124A>C	c.(1123-1125)cAg>cCg	p.Q375P	PCLO_ENST00000423517.2_Missense_Mutation_p.Q375P	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGACCCAGTCTGCTGAGCTGG	0.587																																					p.Q375P		Atlas-SNP	.											Q9Y6V0-3,NS,carcinoma,+1,2	PCLO	1506	2	0			c.A1124C						scavenged	.						51.0	52.0	52.0					7																	82784833		1971	4166	6137	SO:0001583	missense	27445	exon2			CCAGTCTGCTGAG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1124A>C	7.37:g.82784833T>G	ENSP00000334319:p.Gln375Pro	Somatic	148	5	0.0337838		WXS	Illumina HiSeq	Phase_I	146	7	0.0479452	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	3.271	-0.149197	0.06585	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.18338	2.23;2.22	5.28	-1.91	0.07641	.	.	.	.	.	T	0.13243	0.0321	L	0.39898	1.24	0.22001	N	0.999425	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.32929	-0.9888	9	0.87932	D	0	.	8.2544	0.31746	0.2246:0.0:0.4622:0.3132	.	375;375	Q9Y6V0-5;Q9Y6V0-6	.;.	P	375	ENSP00000334319:Q375P;ENSP00000388393:Q375P	ENSP00000334319:Q375P	Q	-	2	0	PCLO	82622769	0.976000	0.34144	0.001000	0.08648	0.658000	0.38924	1.551000	0.36233	-0.136000	0.11475	-0.264000	0.10439	CAG	.	.	none		0.587	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
KRTAP9-9	81870	hgsc.bcm.edu	37	17	39411694	39411694	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:39411694G>C	ENST00000394008.1	+	1	59	c.57G>C	c.(55-57)tgG>tgC	p.W19C		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	24	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CCACCTGCTGGAAGCCCACCA	0.622																																					p.W19C		Atlas-SNP	.											KRTAP9-9,NS,carcinoma,+2,1	KRTAP9-9	24	1	0			c.G57C						scavenged	.																																			SO:0001583	missense	81870	exon1			CTGCTGGAAGCCC	AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.57G>C	17.37:g.39411694G>C	ENSP00000377576:p.Trp19Cys	Somatic	24	2	0.0833333		WXS	Illumina HiSeq	Phase_I	15	2	0.133333	NM_030975	B5MDD6|Q9BYQ1	Missense_Mutation	SNP	ENST00000394008.1	37	CCDS54127.1	.	.	.	.	.	.	.	.	.	.	.	0.100	-1.153249	0.01700	.	.	ENSG00000198083	ENST00000394008	T	0.00711	5.8	3.04	-5.55	0.02536	.	.	.	.	.	T	0.00210	0.0006	N	0.00152	-1.975	0.20196	N	0.999925	B	0.02656	0.0	B	0.04013	0.001	T	0.42865	-0.9426	9	0.02654	T	1	.	6.8781	0.24158	0.0:0.2867:0.1571:0.5562	.	24	Q9BYP9	KRA99_HUMAN	C	19	ENSP00000377576:W19C	ENSP00000377576:W19C	W	+	3	0	KRTAP9-9	36665220	0.000000	0.05858	0.005000	0.12908	0.435000	0.31806	-0.843000	0.04350	-1.036000	0.03287	0.456000	0.33151	TGG	.	.	none		0.622	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257710.1	NM_030975	
FMO5	2330	hgsc.bcm.edu	37	1	146656089	146656089	+	IGR	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:146656089C>T	ENST00000254090.4	-	0	2632				RP11-337C18.10_ENST00000606856.1_RNA|FMO5_ENST00000441068.2_Silent_p.K459K|RP11-337C18.8_ENST00000607149.1_RNA|RP11-337C18.8_ENST00000606757.1_RNA	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					ccttaggcccctttattccgg	0.348																																					p.K459K		Atlas-SNP	.											.	FMO5	94	.	0			c.G1377A						PASS	.						98.0	87.0	90.0					1																	146656089		692	1591	2283	SO:0001628	intergenic_variant	2330	exon9			AGGCCCCTTTATT	Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607		1.37:g.146656089C>T		Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	76	4	0.0526316	NM_001144829	B2RBG1|C9JJD1|Q8IV22	Silent	SNP	ENST00000254090.4	37	CCDS926.1																																																																																			.	.	none		0.348	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040373.2	NM_001461	
GOLGA6B	55889	hgsc.bcm.edu	37	15	72954595	72954595	+	Missense_Mutation	SNP	A	A	G	rs200411442	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr15:72954595A>G	ENST00000421285.3	+	11	850	c.850A>G	c.(850-852)Aag>Gag	p.K284E	RN7SL853P_ENST00000477951.2_RNA	NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	284						Golgi apparatus (GO:0005794)		p.K284E(2)		NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						TTTCTCAGCTAAGCCCCCATC	0.522																																					p.K284E		Atlas-SNP	.											GOLGA6B,NS,carcinoma,0,2	GOLGA6B	30	2	2	Substitution - Missense(2)	prostate(2)	c.A850G						scavenged	.						36.0	35.0	35.0					15																	72954595		1854	3747	5601	SO:0001583	missense	55889	exon11			TCAGCTAAGCCCC		CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.850A>G	15.37:g.72954595A>G	ENSP00000408132:p.Lys284Glu	Somatic	190	2	0.0105263		WXS	Illumina HiSeq	Phase_I	357	4	0.0112045	NM_018652	A8MYY7	Missense_Mutation	SNP	ENST00000421285.3	37	CCDS10245.2	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.289869	0.00248	.	.	ENSG00000215186	ENST00000421285	T	0.20598	2.06	0.69	-1.38	0.09027	.	.	.	.	.	T	0.03871	0.0109	N	0.00468	-1.46	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.33111	-0.9881	9	0.02654	T	1	.	6.2533	0.20859	0.2269:0.0:0.7731:0.0	.	284	A6NDN3	GOG6B_HUMAN	E	284	ENSP00000408132:K284E	ENSP00000408132:K284E	K	+	1	0	GOLGA6B	70741649	0.001000	0.12720	0.068000	0.19968	0.040000	0.13550	0.170000	0.16663	-1.260000	0.02465	-1.888000	0.00539	AAG	A|0.500;G|0.500	0.500	weak		0.522	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257474.4	NM_018652	
FLG	2312	hgsc.bcm.edu	37	1	152284344	152284344	+	Silent	SNP	T	T	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:152284344T>G	ENST00000368799.1	-	3	3053	c.3018A>C	c.(3016-3018)ggA>ggC	p.G1006G	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1006	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTGAGGAGTTCCTGATTGTC	0.582									Ichthyosis																												p.G1006G		Atlas-SNP	.											FLG,NS,carcinoma,-2,1	FLG	900	1	0			c.A3018C						scavenged	.						295.0	297.0	296.0					1																	152284344		2203	4300	6503	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	AGGAGTTCCTGAT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3018A>C	1.37:g.152284344T>G		Somatic	322	5	0.015528		WXS	Illumina HiSeq	Phase_I	405	12	0.0296296	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			.	.	none		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CYP2A13	1553	hgsc.bcm.edu	37	19	41594954	41594954	+	Nonsense_Mutation	SNP	C	C	T	rs72552266	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:41594954C>T	ENST00000330436.3	+	2	301	c.301C>T	c.(301-303)Cga>Tga	p.R101*		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	101			R -> Q (in allele CYP2A13*4). {ECO:0000269|PubMed:15618722}.		small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GTTCAGCGGGCGAGGCGAGCA	0.637													N|||	19	0.00379393	0.0	0.0058	5008	,	,		17843	0.001		0.0119	False		,,,				2504	0.002				p.R101X		Atlas-SNP	.											CYP2A13,caecum,carcinoma,-1,1	CYP2A13	90	1	0			c.C301T	GRCh37	CM032880	CYP2A13	M	rs72552266	scavenged	.						60.0	57.0	58.0					19																	41594954		2202	4276	6478	SO:0001587	stop_gained	1553	exon2			AGCGGGCGAGGCG	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.301C>T	19.37:g.41594954C>T	ENSP00000332679:p.Arg101*	Somatic	240	10	0.0416667		WXS	Illumina HiSeq	Phase_I	256	9	0.0351562	NM_000766	Q53YR8|Q6R569|Q6R570|Q9H2X2	Nonsense_Mutation	SNP	ENST00000330436.3	37	CCDS12571.1	50	0.022893772893772892	25	0.0508130081300813	6	0.016574585635359115	1	0.0017482517482517483	18	0.023746701846965697	.	13.66	2.304807	0.40795	.	.	ENSG00000197838	ENST00000330436	.	.	.	3.49	2.42	0.29668	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.9774	0.30164	0.1802:0.6446:0.1752:0.0	.	.	.	.	X	101	.	ENSP00000332679:R101X	R	+	1	2	CYP2A13	46286794	0.081000	0.21417	0.343000	0.25615	0.105000	0.19272	0.470000	0.22084	0.794000	0.33899	-0.572000	0.04151	CGA	C|0.985;T|0.015	0.015	strong		0.637	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
PSG4	5672	hgsc.bcm.edu	37	19	43708388	43708388	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:43708388A>C	ENST00000405312.3	-	2	317	c.80T>G	c.(79-81)tTc>tGc	p.F27C	PSG4_ENST00000433626.2_Missense_Mutation_p.F27C|PSG4_ENST00000244295.9_Missense_Mutation_p.F27C	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	27					female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				CGGATTCCAGAAGTTTAAAAG	0.468																																					p.X27X		Atlas-SNP	.											.	PSG4	129	.	0			c.G80G						PASS	.						107.0	121.0	116.0					19																	43708388		2144	4269	6413	SO:0001583	missense	5672	exon2			TTCCAGAAGTTTA		CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.80T>G	19.37:g.43708388A>C	ENSP00000384770:p.Phe27Cys	Somatic	200	0	0		WXS	Illumina HiSeq	Phase_I	190	74	0.389474	NM_002780	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Silent	SNP	ENST00000405312.3	37	CCDS46093.1	.	.	.	.	.	.	.	.	.	.	N	7.311	0.615088	0.14129	.	.	ENSG00000243137	ENST00000244295;ENST00000405312;ENST00000433626;ENST00000451895	T;T;T;T	0.50813	1.16;0.73;1.87;3.24	1.65	0.446	0.16602	.	.	.	.	.	T	0.34193	0.0889	L	0.33624	1.015	0.09310	N	1	B;B;B	0.28324	0.207;0.154;0.012	B;B;B	0.33254	0.091;0.16;0.033	T	0.36962	-0.9726	9	0.72032	D	0.01	.	3.5161	0.07726	0.6473:0.0:0.0:0.3527	.	27;27;27	E7EX79;Q00888-2;Q00888	.;.;PSG4_HUMAN	C	27;27;27;43	ENSP00000244295:F27C;ENSP00000384770:F27C;ENSP00000387864:F27C;ENSP00000388134:F43C	ENSP00000244295:F27C	F	-	2	0	PSG4	48400228	0.058000	0.20735	0.279000	0.24732	0.035000	0.12851	-0.188000	0.09642	0.069000	0.16605	0.145000	0.16022	TTC	.	.	none		0.468	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633	
PRKD2	25865	hgsc.bcm.edu	37	19	47193879	47193879	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:47193879C>T	ENST00000291281.4	-	13	2012	c.1787G>A	c.(1786-1788)cGg>cAg	p.R596Q	PRKD2_ENST00000600194.1_Missense_Mutation_p.R439Q|PRKD2_ENST00000433867.1_Missense_Mutation_p.R596Q|PRKD2_ENST00000601806.1_Missense_Mutation_p.R439Q|RN7SL364P_ENST00000473668.2_RNA|PRKD2_ENST00000595515.1_Missense_Mutation_p.R596Q			Q9BZL6	KPCD2_HUMAN	protein kinase D2	596	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		CACTTCATTCCGGAGCTGGCT	0.572																																					p.R596Q		Atlas-SNP	.											PRKD2,brain,primitive_neuroectodermal_tumour-medulloblastoma,-1,1	PRKD2	94	1	0			c.G1787A						scavenged	.						118.0	104.0	109.0					19																	47193879		2203	4300	6503	SO:0001583	missense	25865	exon13			TCATTCCGGAGCT	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1787G>A	19.37:g.47193879C>T	ENSP00000291281:p.Arg596Gln	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	157	3	0.0191083	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	37	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	34	5.389220	0.95988	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	D;D	0.82803	-1.65;-1.65	5.0	5.0	0.66597	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.073143	0.51477	D	0.000092	D	0.84088	0.5395	N	0.13299	0.325	0.50313	D	0.999864	P;D	0.71674	0.891;0.998	B;D	0.73708	0.398;0.981	D	0.86955	0.2088	10	0.62326	D	0.03	-26.3847	17.5028	0.87736	0.0:1.0:0.0:0.0	.	596;596	E7ER94;Q9BZL6	.;KPCD2_HUMAN	Q	596	ENSP00000291281:R596Q;ENSP00000393978:R596Q	ENSP00000291281:R596Q	R	-	2	0	PRKD2	51885719	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.688000	0.84153	2.499000	0.84300	0.650000	0.86243	CGG	.	.	none		0.572	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
KRTAP10-11	386678	hgsc.bcm.edu	37	21	46067180	46067180	+	Missense_Mutation	SNP	C	C	T	rs462007	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:46067180C>T	ENST00000334670.8	+	1	850	c.805C>T	c.(805-807)Cgc>Tgc	p.R269C	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	269	25 X 5 AA repeats of C-C-X(3).			R -> C (in Ref. 1; BAD01546 and 3; AAI31612). {ECO:0000305}.		keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						CAGCTGCTGCCGCCCGGCCTC	0.682													T|||	4087	0.816094	0.9887	0.7954	5008	,	,		19081	0.6796		0.8062	False		,,,				2504	0.7485				p.R269C		Atlas-SNP	.											.	KRTAP10-11	36	.	0			c.C805T						PASS	.	T	,CYS/ARG	4211,193	107.3+/-145.7	2012,187,3	42.0	54.0	50.0		,805	3.0	0.3	21	dbSNP_80	50	6723,1865	319.0+/-313.9	2635,1453,206	no	intron,missense	TSPEAR,KRTAP10-11	NM_144991.2,NM_198692.2	,180	4647,1640,209	TT,TC,CC		21.7163,4.3824,15.8405	,probably-damaging	,269/299	46067180	10934,2058	2202	4294	6496	SO:0001583	missense	386678	exon1			TGCTGCCGCCCGG	AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.805C>T	21.37:g.46067180C>T	ENSP00000334197:p.Arg269Cys	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	132	33	0.25	NM_198692	A2RRF9	Missense_Mutation	SNP	ENST00000334670.8	37	CCDS42962.1	1775	0.8127289377289377	480	0.975609756097561	298	0.8232044198895028	383	0.6695804195804196	614	0.8100263852242744	t	8.562	0.877898	0.17395	0.956176	0.782837	ENSG00000243489	ENST00000334670	T	0.00686	5.85	3.93	3.04	0.35103	.	.	.	.	.	T	0.00012	0.0000	M	0.63843	1.955	0.37916	P	0.06845500000000004	D	0.89917	1.0	P	0.61874	0.895	T	0.43410	-0.9393	8	0.54805	T	0.06	.	6.258	0.20884	0.1641:0.725:0.0:0.1109	rs462007;rs58847266	269	P60412	KR10B_HUMAN	C	269	ENSP00000334197:R269C	ENSP00000334197:R269C	R	+	1	0	KRTAP10-11	44891608	0.000000	0.05858	0.334000	0.25495	0.053000	0.15095	-1.248000	0.02890	0.187000	0.20147	-1.295000	0.01343	CGC	C|0.202;T|0.798	0.798	strong		0.682	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128029.1	NM_198692	
ZDBF2	57683	hgsc.bcm.edu	37	2	207174869	207174869	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:207174869A>G	ENST00000374423.3	+	5	6003	c.5617A>G	c.(5617-5619)Aaa>Gaa	p.K1873E		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1873							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TTCGAAGGGGAAAAAAAAGGT	0.413																																					p.K1873E		Atlas-SNP	.											ZDBF2_ENST00000374423,caecum,carcinoma,0,2	ZDBF2	531	2	0			c.A5617G						PASS	.						58.0	57.0	57.0					2																	207174869		1921	4134	6055	SO:0001583	missense	57683	exon5			AAGGGGAAAAAAA	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5617A>G	2.37:g.207174869A>G	ENSP00000363545:p.Lys1873Glu	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	77	26	0.337662	NM_020923	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	A	4.072	0.011280	0.07912	.	.	ENSG00000204186	ENST00000374423	T	0.38887	1.11	5.48	2.13	0.27403	.	.	.	.	.	T	0.12817	0.0311	N	0.01048	-1.04	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.30268	-0.9984	9	0.12766	T	0.61	.	5.7718	0.18257	0.2703:0.1494:0.5803:0.0	.	1873	Q9HCK1	ZDBF2_HUMAN	E	1873	ENSP00000363545:K1873E	ENSP00000363545:K1873E	K	+	1	0	ZDBF2	206883114	0.934000	0.31675	0.002000	0.10522	0.026000	0.11368	2.260000	0.43267	1.234000	0.43709	0.451000	0.29950	AAA	.	.	none		0.413	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
NMUR1	10316	hgsc.bcm.edu	37	2	232389859	232389859	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:232389859C>T	ENST00000305141.4	-	3	1309	c.1176G>A	c.(1174-1176)atG>atA	p.M392I		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	392					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		TGCCTGTGGTCATCCTGCTGA	0.672																																					p.M392I		Atlas-SNP	.											.	NMUR1	46	.	0			c.G1176A						PASS	.						39.0	40.0	39.0					2																	232389859		2203	4300	6503	SO:0001583	missense	10316	exon3			TGTGGTCATCCTG	AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.1176G>A	2.37:g.232389859C>T	ENSP00000305877:p.Met392Ile	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	157	60	0.382166	NM_006056	O43664|Q7LDP6|Q8NE20	Missense_Mutation	SNP	ENST00000305141.4	37	CCDS2486.1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.224634	0.39300	.	.	ENSG00000171596	ENST00000305141	T	0.37235	1.21	4.27	3.36	0.38483	.	1.558880	0.04572	N	0.393532	T	0.21103	0.0508	N	0.08118	0	0.20074	N	0.999931	B	0.02656	0.0	B	0.01281	0.0	T	0.16928	-1.0386	10	0.27785	T	0.31	-2.4681	6.9443	0.24510	0.0:0.5308:0.373:0.0962	.	392	Q9HB89	NMUR1_HUMAN	I	392	ENSP00000305877:M392I	ENSP00000305877:M392I	M	-	3	0	NMUR1	232098103	0.995000	0.38212	0.869000	0.34112	0.940000	0.58332	1.786000	0.38694	1.119000	0.41883	0.456000	0.33151	ATG	.	.	none		0.672	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
PLXNC1	10154	hgsc.bcm.edu	37	12	94694764	94694764	+	Silent	SNP	C	C	T	rs113780946		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr12:94694764C>T	ENST00000258526.4	+	28	4566	c.4317C>T	c.(4315-4317)gaC>gaT	p.D1439D	PLXNC1_ENST00000545312.1_Silent_p.D178D|PLXNC1_ENST00000547057.1_Silent_p.D486D	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	1439					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CACATATAGACGGCTGTTTGT	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		18976	0.001		0.0	False		,,,				2504	0.0				p.D1439D		Atlas-SNP	.											PLXNC1,right_lower_lobe,carcinoma,0,1	PLXNC1	135	1	0			c.C4317T						scavenged	.						146.0	131.0	136.0					12																	94694764		2203	4300	6503	SO:0001819	synonymous_variant	10154	exon28			TATAGACGGCTGT	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.4317C>T	12.37:g.94694764C>T		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	204	3	0.0147059	NM_005761	Q59H25	Silent	SNP	ENST00000258526.4	37	CCDS9049.1																																																																																			C|0.999;T|0.001	0.001	strong		0.443	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
IWS1	55677	hgsc.bcm.edu	37	2	128263223	128263223	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:128263223C>T	ENST00000295321.4	-	3	515	c.256G>A	c.(256-258)Gag>Aag	p.E86K	AC010976.2_ENST00000599001.1_RNA|IWS1_ENST00000455721.2_Missense_Mutation_p.E93K|IWS1_ENST00000486662.1_5'UTR	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	86	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CTGTGAAGCTCCTCACTTTCA	0.483																																					p.E86K		Atlas-SNP	.											.	IWS1	61	.	0			c.G256A						PASS	.						168.0	169.0	168.0					2																	128263223		2203	4300	6503	SO:0001583	missense	55677	exon3			GAAGCTCCTCACT	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.256G>A	2.37:g.128263223C>T	ENSP00000295321:p.Glu86Lys	Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	175	55	0.314286	NM_017969	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	ENST00000295321.4	37	CCDS2146.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901973	0.52227	.	.	ENSG00000163166	ENST00000295321;ENST00000455721;ENST00000409725	T;T	0.33438	1.46;1.41	5.4	5.4	0.78164	.	0.301427	0.32608	N	0.005872	T	0.30916	0.0780	L	0.58101	1.795	0.25294	N	0.98934	B	0.21606	0.058	B	0.12837	0.008	T	0.13282	-1.0515	10	0.19590	T	0.45	-3.4505	16.0792	0.80989	0.0:1.0:0.0:0.0	.	86	Q96ST2	IWS1_HUMAN	K	86;93;91	ENSP00000295321:E86K;ENSP00000399245:E93K	ENSP00000295321:E86K	E	-	1	0	IWS1	127979693	0.993000	0.37304	1.000000	0.80357	0.869000	0.49853	3.916000	0.56416	2.524000	0.85096	0.491000	0.48974	GAG	.	.	none		0.483	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
NFKBIA	4792	hgsc.bcm.edu	37	14	35871695	35871695	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr14:35871695G>A	ENST00000216797.5	-	5	912	c.811C>T	c.(811-813)Cag>Tag	p.Q271*	NFKBIA_ENST00000557100.1_5'UTR|NFKBIA_ENST00000557389.1_Nonsense_Mutation_p.Q181*|NFKBIA_ENST00000557140.1_Nonsense_Mutation_p.Q228*	NM_020529.2	NP_065390.1	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	271					apoptotic process (GO:0006915)|cellular response to cold (GO:0070417)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|cytoplasmic sequestering of transcription factor (GO:0042994)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein import into nucleus, translocation (GO:0000060)|regulation of cell proliferation (GO:0042127)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to exogenous dsRNA (GO:0043330)|response to muramyl dipeptide (GO:0032495)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|nuclear localization sequence binding (GO:0008139)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(1)|large_intestine(2)|liver(1)	7	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	Acetylsalicylic acid(DB00945)	AGTGTCAGCTGGCCCAGCTGC	0.562																																					p.Q271X		Atlas-SNP	.											.	NFKBIA	28	.	0			c.C811T						PASS	.						88.0	91.0	90.0					14																	35871695		2203	4300	6503	SO:0001587	stop_gained	4792	exon5			TCAGCTGGCCCAG		CCDS9656.1	14q13	2014-09-17			ENSG00000100906	ENSG00000100906		"""Ankyrin repeat domain containing"""	7797	protein-coding gene	gene with protein product		164008		NFKBI		1829648	Standard	NM_020529		Approved	IKBA, MAD-3, IkappaBalpha	uc001wtf.4	P25963	OTTHUMG00000140220	ENST00000216797.5:c.811C>T	14.37:g.35871695G>A	ENSP00000216797:p.Gln271*	Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	180	46	0.255556	NM_020529	B2R8L6	Nonsense_Mutation	SNP	ENST00000216797.5	37	CCDS9656.1	.	.	.	.	.	.	.	.	.	.	G	38	7.053020	0.98029	.	.	ENSG00000100906	ENST00000216797;ENST00000557140;ENST00000557389	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-12.2413	15.4515	0.75277	0.0:0.1382:0.8618:0.0	.	.	.	.	X	271;228;181	.	ENSP00000216797:Q271X	Q	-	1	0	NFKBIA	34941446	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.992000	0.40737	2.719000	0.93026	0.655000	0.94253	CAG	.	.	none		0.562	NFKBIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276683.1	NM_020529	
ZNF791	163049	hgsc.bcm.edu	37	19	12735492	12735492	+	Silent	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr19:12735492A>G	ENST00000343325.4	+	3	321	c.159A>G	c.(157-159)gaA>gaG	p.E53E	ZNF791_ENST00000540038.1_5'UTR|ZNF490_ENST00000465656.1_Intron|ZNF791_ENST00000446165.1_Intron|ZNF791_ENST00000458122.3_Silent_p.E21E	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	53	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						CGAATGTTGAAGATCAACACA	0.328																																					p.E53E		Atlas-SNP	.											ZNF791,NS,carcinoma,+2,1	ZNF791	53	1	0			c.A159G						scavenged	.						68.0	64.0	66.0					19																	12735492		2203	4300	6503	SO:0001819	synonymous_variant	163049	exon3			TGTTGAAGATCAA	AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.159A>G	19.37:g.12735492A>G		Somatic	195	1	0.00512821		WXS	Illumina HiSeq	Phase_I	208	3	0.0144231	NM_153358	B7Z586|Q8NC99	Silent	SNP	ENST00000343325.4	37	CCDS12273.1																																																																																			.	.	none		0.328	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358	
NAGA	4668	hgsc.bcm.edu	37	22	42463804	42463804	+	Missense_Mutation	SNP	G	G	T	rs140775168	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr22:42463804G>T	ENST00000396398.3	-	3	821	c.289C>A	c.(289-291)Cgc>Agc	p.R97S	NAGA_ENST00000402937.1_Missense_Mutation_p.R97S|NAGA_ENST00000403363.1_Missense_Mutation_p.R97S	NM_000262.2	NP_000253.1	P17050	NAGAB_HUMAN	N-acetylgalactosaminidase, alpha-	97					carbohydrate catabolic process (GO:0016052)|glycolipid catabolic process (GO:0019377)|glycoside catabolic process (GO:0016139)|glycosylceramide catabolic process (GO:0046477)|oligosaccharide metabolic process (GO:0009311)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|alpha-N-acetylgalactosaminidase activity (GO:0008456)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						TGAGGGAAGCGCTTGGGATCC	0.607																																					p.R97S		Atlas-SNP	.											.	NAGA	26	.	0			c.C289A						PASS	.						130.0	112.0	118.0					22																	42463804		2203	4300	6503	SO:0001583	missense	4668	exon3			GGAAGCGCTTGGG		CCDS14030.1	22q13.2	2010-07-09			ENSG00000198951	ENSG00000198951	3.2.1.49		7631	protein-coding gene	gene with protein product		104170					Standard	NM_000262		Approved	D22S674	uc003bbw.4	P17050	OTTHUMG00000151276	ENST00000396398.3:c.289C>A	22.37:g.42463804G>T	ENSP00000379680:p.Arg97Ser	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	80	32	0.4	NM_000262		Missense_Mutation	SNP	ENST00000396398.3	37	CCDS14030.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210448	0.79240	.	.	ENSG00000198951	ENST00000396398;ENST00000403363;ENST00000402937	D;D;D	0.99820	-6.93;-6.93;-6.93	4.66	3.59	0.41128	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99768	0.9905	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96983	0.9716	10	0.72032	D	0.01	-23.1156	10.2175	0.43177	0.0:0.0:0.5995:0.4005	.	97	P17050	NAGAB_HUMAN	S	97	ENSP00000379680:R97S;ENSP00000385283:R97S;ENSP00000384603:R97S	ENSP00000379680:R97S	R	-	1	0	NAGA	40793750	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.394000	0.34509	2.441000	0.82636	0.561000	0.74099	CGC	G|1.000;C|0.000	.	alt		0.607	NAGA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322056.1		
ADNP	23394	hgsc.bcm.edu	37	20	49509225	49509225	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr20:49509225T>C	ENST00000396029.3	-	5	2593	c.2026A>G	c.(2026-2028)Acc>Gcc	p.T676A	ADNP_ENST00000396032.3_Missense_Mutation_p.T676A|ADNP_ENST00000371602.4_Missense_Mutation_p.T676A|ADNP_ENST00000349014.3_Missense_Mutation_p.T676A	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	676					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						GTTGAGGCGGTCATGTTGCTG	0.473																																					p.T676A		Atlas-SNP	.											ADNP,NS,carcinoma,+2,1	ADNP	106	1	0			c.A2026G						scavenged	.						159.0	145.0	150.0					20																	49509225		2203	4300	6503	SO:0001583	missense	23394	exon5			AGGCGGTCATGTT	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2026A>G	20.37:g.49509225T>C	ENSP00000379346:p.Thr676Ala	Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	177	2	0.0112994	NM_015339	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	37	CCDS13433.1	.	.	.	.	.	.	.	.	.	.	T	17.83	3.484379	0.63962	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.77191	0.4094	M	0.64404	1.975	0.58432	D	0.999996	D	0.63880	0.993	D	0.70227	0.968	T	0.79090	-0.1946	9	0.87932	D	0	-14.7065	16.6245	0.84952	0.0:0.0:0.0:1.0	.	676	Q9H2P0	ADNP_HUMAN	A	676	.	ENSP00000342905:T676A	T	-	1	0	ADNP	48942632	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.848000	0.62874	2.323000	0.78572	0.528000	0.53228	ACC	.	.	none		0.473	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
MGAT5	4249	hgsc.bcm.edu	37	2	135102520	135102520	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr2:135102520G>A	ENST00000409645.1	+	9	1249	c.997G>A	c.(997-999)Gga>Aga	p.G333R	MGAT5_ENST00000281923.2_Missense_Mutation_p.G333R			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	333					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		GAAGGTTGTAGGAAACCGATC	0.378																																					p.G333R		Atlas-SNP	.											.	MGAT5	84	.	0			c.G997A						PASS	.						125.0	122.0	123.0					2																	135102520		2203	4300	6503	SO:0001583	missense	4249	exon8			GTTGTAGGAAACC	D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.997G>A	2.37:g.135102520G>A	ENSP00000386377:p.Gly333Arg	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	90	32	0.355556	NM_002410	D3DP70	Missense_Mutation	SNP	ENST00000409645.1	37	CCDS2171.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.578283	0.86645	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.38	5.38	0.77491	.	0.050300	0.85682	D	0.000000	T	0.76666	0.4019	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75428	-0.3321	9	0.46703	T	0.11	-14.1382	19.4972	0.95079	0.0:0.0:1.0:0.0	.	333	Q09328	MGT5A_HUMAN	R	333	.	ENSP00000281923:G333R	G	+	1	0	MGAT5	134818990	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	9.758000	0.98927	2.668000	0.90789	0.563000	0.77884	GGA	.	.	none		0.378	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410	
MTCL1	23255	hgsc.bcm.edu	37	18	8806921	8806921	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr18:8806921T>C	ENST00000306329.11	+	9	3424	c.3424T>C	c.(3424-3426)Ttc>Ctc	p.F1142L	SOGA2_ENST00000306285.7_Missense_Mutation_p.F138L|SOGA2_ENST00000400050.3_Missense_Mutation_p.F782L|SOGA2_ENST00000359865.3_Missense_Mutation_p.F823L|SOGA2_ENST00000517570.1_Missense_Mutation_p.F782L|SOGA2_ENST00000518815.1_Missense_Mutation_p.F138L																							GTTCAGCGCCTTCAAGGCCTT	0.587																																					p.F823L		Atlas-SNP	.											CCDC165,NS,carcinoma,-2,1	.	.	1	0			c.T2467C						scavenged	.						70.0	61.0	64.0					18																	8806921		2203	4300	6503	SO:0001583	missense	23255	exon11			AGCGCCTTCAAGG																												ENST00000306329.11:c.3424T>C	18.37:g.8806921T>C	ENSP00000305027:p.Phe1142Leu	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	62	3	0.0483871	NM_015210		Missense_Mutation	SNP	ENST00000306329.11	37		.	.	.	.	.	.	.	.	.	.	T	0.201	-1.045061	0.01997	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	5.54	4.67	0.58626	.	0.145473	0.32444	N	0.006085	T	0.04543	0.0124	N	0.00621	-1.32	0.23704	N	0.997068	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.39418	-0.9615	10	0.02654	T	1	-19.4729	6.0193	0.19620	0.0:0.6353:0.1402:0.2244	.	1133;823	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	L	844;782;823;782;138	ENSP00000429556:F782L;ENSP00000352927:F823L;ENSP00000382924:F782L;ENSP00000303670:F138L	ENSP00000303670:F138L	F	+	1	0	CCDC165	8796921	0.802000	0.28943	0.123000	0.21794	0.132000	0.20833	1.531000	0.36018	1.461000	0.47929	-0.242000	0.12053	TTC	.	.	none		0.587	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
CR1L	1379	hgsc.bcm.edu	37	1	207871000	207871000	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:207871000A>G	ENST00000508064.2	+	6	1075	c.1015A>G	c.(1015-1017)Agc>Ggc	p.S339G	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	339	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GGGAGACTGGAGCCCTGCAGC	0.512																																					p.S339G		Atlas-SNP	.											CR1L_ENST00000508064,NS,carcinoma,-2,4	CR1L	97	4	0			c.A1015G						scavenged	.						176.0	175.0	175.0					1																	207871000		1911	4128	6039	SO:0001583	missense	1379	exon6			GACTGGAGCCCTG	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1015A>G	1.37:g.207871000A>G	ENSP00000421736:p.Ser339Gly	Somatic	471	2	0.00424628		WXS	Illumina HiSeq	Phase_I	438	5	0.0114155	NM_175710	Q32MC9|Q8NEU7	Missense_Mutation	SNP	ENST00000508064.2	37	CCDS44310.1	.	.	.	.	.	.	.	.	.	.	.	12.53	1.966724	0.34659	.	.	ENSG00000197721	ENST00000444269;ENST00000508064	T	0.69040	-0.37	2.44	2.44	0.29823	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.78253	0.4254	H	0.94582	3.555	0.26329	N	0.977544	P	0.50943	0.94	P	0.50162	0.633	T	0.70464	-0.4864	9	0.66056	D	0.02	.	6.7062	0.23252	1.0:0.0:0.0:0.0	.	339	Q2VPA4	CR1L_HUMAN	G	339	ENSP00000421736:S339G	ENSP00000434864:S283G	S	+	1	0	CR1L	205937623	1.000000	0.71417	0.902000	0.35471	0.284000	0.27059	3.655000	0.54460	1.113000	0.41760	0.248000	0.18094	AGC	.	.	none		0.512	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735	
MUC6	4588	hgsc.bcm.edu	37	11	1016835	1016835	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:1016835A>G	ENST00000421673.2	-	31	6016	c.5966T>C	c.(5965-5967)tTc>tCc	p.F1989S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1989	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.F1989Y(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGGTCTGGAAGGATGTTGC	0.567																																					p.F1989S		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	2	Substitution - Missense(2)	lung(2)	c.T5966C						scavenged	.						1541.0	1526.0	1531.0					11																	1016835		2203	4299	6502	SO:0001583	missense	4588	exon31			GTCTGGAAGGATG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5966T>C	11.37:g.1016835A>G	ENSP00000406861:p.Phe1989Ser	Somatic	1543	15	0.00972132		WXS	Illumina HiSeq	Phase_I	1704	43	0.0252347	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	A	12.65	2.002866	0.35320	.	.	ENSG00000184956	ENST00000421673	T	0.18657	2.2	3.08	-0.788	0.10939	.	.	.	.	.	T	0.12390	0.0301	L	0.38531	1.155	0.09310	N	1	B	0.15930	0.015	B	0.14578	0.011	T	0.41106	-0.9527	9	0.07644	T	0.81	.	6.7728	0.23602	0.4725:0.0:0.5275:0.0	.	1989	Q6W4X9	MUC6_HUMAN	S	1989	ENSP00000406861:F1989S	ENSP00000406861:F1989S	F	-	2	0	MUC6	1006835	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.386000	0.07370	-0.019000	0.14055	0.254000	0.18369	TTC	.	.	none		0.567	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
STAT3	6774	hgsc.bcm.edu	37	17	40474482	40474482	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr17:40474482T>A	ENST00000264657.5	-	21	2231	c.1919A>T	c.(1918-1920)tAc>tTc	p.Y640F	STAT3_ENST00000389272.3_Missense_Mutation_p.Y542F|STAT3_ENST00000585517.1_Missense_Mutation_p.Y640F|STAT3_ENST00000404395.3_Missense_Mutation_p.Y640F|STAT3_ENST00000588969.1_Missense_Mutation_p.Y640F	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	640	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CTGCTTTGTGTATGGTTCCAC	0.463									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.Y640F		Atlas-SNP	.											STAT3,NS,lymphoid_neoplasm,0,46	STAT3	268	46	0			c.A1919T						PASS	.						243.0	213.0	223.0					17																	40474482		2203	4300	6503	SO:0001583	missense	6774	exon21	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	TTTGTGTATGGTT	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1919A>T	17.37:g.40474482T>A	ENSP00000264657:p.Tyr640Phe	Somatic	228	0	0		WXS	Illumina HiSeq	Phase_I	271	137	0.505535	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.813449	0.70912	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	D;D;D	0.89196	-2.48;-2.48;-2.48	4.64	4.64	0.57946	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.87120	0.6098	N	0.16016	0.355	0.80722	D	1	D;D;D	0.59357	0.982;0.985;0.985	D;D;D	0.78314	0.984;0.991;0.991	T	0.82589	-0.0382	10	0.06891	T	0.86	-37.3581	14.2314	0.65895	0.0:0.0:0.0:1.0	.	640;640;640	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	F	640;542;640	ENSP00000264657:Y640F;ENSP00000373923:Y542F;ENSP00000384943:Y640F	ENSP00000264657:Y640F	Y	-	2	0	STAT3	37728008	1.000000	0.71417	0.964000	0.40570	0.715000	0.41141	7.868000	0.87116	1.953000	0.56701	0.460000	0.39030	TAC	.	.	none		0.463	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
PCLO	27445	hgsc.bcm.edu	37	7	82545106	82545106	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr7:82545106A>G	ENST00000333891.9	-	7	12533	c.12196T>C	c.(12196-12198)Ttt>Ctt	p.F4066L	PCLO_ENST00000423517.2_Missense_Mutation_p.F4066L|PCLO_ENST00000437081.1_Missense_Mutation_p.F786L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGAAGGCTAAATGCGGTGCTT	0.438																																					p.F4066L		Atlas-SNP	.											.	PCLO	1506	.	0			c.T12196C						PASS	.						94.0	83.0	86.0					7																	82545106		1946	4159	6105	SO:0001583	missense	27445	exon7			GGCTAAATGCGGT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12196T>C	7.37:g.82545106A>G	ENSP00000334319:p.Phe4066Leu	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	78	31	0.397436	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	A	16.24	3.067747	0.55539	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.16457	2.34;2.34	5.84	5.84	0.93424	.	.	.	.	.	T	0.31040	0.0784	L	0.59436	1.845	0.51482	D	0.999927	P;D;D	0.61697	0.78;0.99;0.99	B;P;P	0.52514	0.192;0.701;0.701	T	0.02378	-1.1168	9	0.87932	D	0	.	16.2109	0.82158	1.0:0.0:0.0:0.0	.	3997;4066;4066	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	L	4066;4066;786	ENSP00000334319:F4066L;ENSP00000388393:F4066L	ENSP00000334319:F4066L	F	-	1	0	PCLO	82383042	1.000000	0.71417	0.984000	0.44739	0.968000	0.65278	9.339000	0.96797	2.230000	0.72887	0.455000	0.32223	TTT	.	.	none		0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
DPYD	1806	hgsc.bcm.edu	37	1	97548004	97548004	+	Missense_Mutation	SNP	T	T	C	rs568169006		TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr1:97548004T>C	ENST00000370192.3	-	22	2889	c.2789A>G	c.(2788-2790)cAg>cGg	p.Q930R		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	930					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	TCCAAGGTACTGCAGTGCTTT	0.343																																					p.Q930R		Atlas-SNP	.											.	DPYD	219	.	0			c.A2789G						PASS	.						206.0	194.0	198.0					1																	97548004		2203	4299	6502	SO:0001583	missense	1806	exon22			AGGTACTGCAGTG	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.2789A>G	1.37:g.97548004T>C	ENSP00000359211:p.Gln930Arg	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	109	44	0.40367	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	T	6.890	0.533671	0.13188	.	.	ENSG00000188641	ENST00000370192	D	0.89939	-2.59	5.82	3.5	0.40072	.	0.511060	0.21827	N	0.068524	T	0.70789	0.3264	L	0.39245	1.2	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.63651	-0.6589	10	0.31617	T	0.26	-0.5352	6.781	0.23646	0.0:0.1332:0.1289:0.7378	.	930	Q12882	DPYD_HUMAN	R	930	ENSP00000359211:Q930R	ENSP00000359211:Q930R	Q	-	2	0	DPYD	97320592	1.000000	0.71417	0.988000	0.46212	0.110000	0.19582	1.641000	0.37197	0.461000	0.27071	-0.291000	0.09656	CAG	.	.	none		0.343	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
GSX1	219409	hgsc.bcm.edu	37	13	28367061	28367061	+	Silent	SNP	A	A	G	rs1231058	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr13:28367061A>G	ENST00000302945.2	+	1	282	c.234A>G	c.(232-234)ctA>ctG	p.L78L		NM_145657.1	NP_663632.1	Q9H4S2	GSX1_HUMAN	GS homeobox 1	78					adenohypophysis development (GO:0021984)|hypothalamus development (GO:0021854)|neuron fate commitment (GO:0048663)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		cgcTGCCTCTACTCAAGGCTT	0.751													G|||	4592	0.916933	0.9834	0.8732	5008	,	,		10675	0.997		0.7972	False		,,,				2504	0.8988				p.L78L		Atlas-SNP	.											.	GSX1	20	.	0			c.A234G						PASS	.	G		3048,136		1461,126,5	2.0	3.0	3.0		234	1.1	1.0	13	dbSNP_87	3	5457,1143		2229,999,72	no	coding-synonymous	GSX1	NM_145657.1		3690,1125,77	GG,GA,AA		17.3182,4.2714,13.0724		78/265	28367061	8505,1279	1592	3300	4892	SO:0001819	synonymous_variant	219409	exon1			GCCTCTACTCAAG	AB044157	CCDS9326.1	13q12.2	2012-03-09		2007-07-26	ENSG00000169840	ENSG00000169840		"""Homeoboxes / ANTP class : HOXL subclass"""	20374	protein-coding gene	gene with protein product				GSH1			Standard	NM_145657		Approved	Gsh-1	uc001urr.1	Q9H4S2	OTTHUMG00000016637	ENST00000302945.2:c.234A>G	13.37:g.28367061A>G		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_145657	Q9UD62	Silent	SNP	ENST00000302945.2	37	CCDS9326.1																																																																																			A|0.104;G|0.896	0.896	strong		0.751	GSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044309.2	NM_145657	
MORC3	23515	hgsc.bcm.edu	37	21	37734510	37734510	+	Missense_Mutation	SNP	C	C	T	rs541408590	byFrequency	TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:37734510C>T	ENST00000400485.1	+	13	1512	c.1436C>T	c.(1435-1437)cCg>cTg	p.P479L	AP000692.9_ENST00000397184.2_RNA|MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	479					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						ATCAGACAACCGGAAATGATC	0.378													C|||	2	0.000399361	0.0008	0.0	5008	,	,		14350	0.0		0.0	False		,,,				2504	0.001				p.P479L		Atlas-SNP	.											MORC3,caecum,carcinoma,0,1	MORC3	78	1	0			c.C1436T						scavenged	.						60.0	59.0	59.0					21																	37734510		1808	4059	5867	SO:0001583	missense	23515	exon13			GACAACCGGAAAT	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1436C>T	21.37:g.37734510C>T	ENSP00000383333:p.Pro479Leu	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	188	4	0.0212766	NM_015358	A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	C	8.493	0.862478	0.17178	.	.	ENSG00000159256	ENST00000400485	T	0.13307	2.6	5.23	0.265	0.15612	.	1.757550	0.02337	N	0.074516	T	0.08846	0.0219	N	0.12569	0.235	0.36526	D	0.870468	B	0.02656	0.0	B	0.04013	0.001	T	0.21759	-1.0236	10	0.27785	T	0.31	0.4698	7.5116	0.27577	0.0:0.4074:0.0:0.5926	.	479	Q14149	MORC3_HUMAN	L	479	ENSP00000383333:P479L	ENSP00000383333:P479L	P	+	2	0	MORC3	36656380	0.001000	0.12720	0.484000	0.27391	0.866000	0.49608	-1.225000	0.02956	0.196000	0.20367	0.563000	0.77884	CCG	.	.	none		0.378	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
KRTAP10-11	386678	hgsc.bcm.edu	37	21	46067193	46067193	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr21:46067193G>C	ENST00000334670.8	+	1	863	c.818G>C	c.(817-819)tGc>tCc	p.C273S	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	273						keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						CCGGCCTCCTGCGTGTCCCTC	0.677																																					p.C273S		Atlas-SNP	.											KRTAP10-11,NS,carcinoma,-1,1	KRTAP10-11	36	1	0			c.G818C						PASS	.						41.0	52.0	48.0					21																	46067193		2200	4292	6492	SO:0001583	missense	386678	exon1			CCTCCTGCGTGTC	AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.818G>C	21.37:g.46067193G>C	ENSP00000334197:p.Cys273Ser	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	134	6	0.0447761	NM_198692	A2RRF9	Missense_Mutation	SNP	ENST00000334670.8	37	CCDS42962.1	.	.	.	.	.	.	.	.	.	.	g	10.35	1.326226	0.24080	.	.	ENSG00000243489	ENST00000334670	T	0.00648	5.99	3.93	1.85	0.25348	.	.	.	.	.	T	0.00724	0.0024	L	0.45051	1.395	0.21527	N	0.999652	B	0.21071	0.051	B	0.24541	0.054	T	0.44314	-0.9336	9	0.16896	T	0.51	.	7.0501	0.25069	0.1131:0.3795:0.5075:0.0	.	273	P60412	KR10B_HUMAN	S	273	ENSP00000334197:C273S	ENSP00000334197:C273S	C	+	2	0	KRTAP10-11	44891621	0.000000	0.05858	0.035000	0.18076	0.597000	0.36814	-0.005000	0.12855	0.627000	0.30340	0.462000	0.41574	TGC	.	.	none		0.677	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128029.1	NM_198692	
PEX16	9409	hgsc.bcm.edu	37	11	45937288	45937288	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr11:45937288G>A	ENST00000378750.5	-	4	568	c.325C>T	c.(325-327)Cgc>Tgc	p.R109C	PEX16_ENST00000532554.1_Intron|PEX16_ENST00000532681.1_Missense_Mutation_p.R14C|PEX16_ENST00000241041.3_Missense_Mutation_p.R109C			Q9Y5Y5	PEX16_HUMAN	peroxisomal biogenesis factor 16	109					ER-dependent peroxisome organization (GO:0032581)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)|protein localization to endoplasmic reticulum (GO:0070972)|protein targeting to peroxisome (GO:0006625)|protein to membrane docking (GO:0022615)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)			large_intestine(2)|lung(2)|ovary(2)|skin(1)	7				GBM - Glioblastoma multiforme(35;0.223)		ACAAGCCAGCGGCCCACTTCA	0.622																																					p.R109C		Atlas-SNP	.											PEX16,colon,carcinoma,+1,1	PEX16	24	1	0			c.C325T						scavenged	.						162.0	160.0	161.0					11																	45937288		2203	4299	6502	SO:0001583	missense	9409	exon4			GCCAGCGGCCCAC	AF118240	CCDS7917.1, CCDS31472.1	11p	2007-12-14			ENSG00000121680	ENSG00000121680			8857	protein-coding gene	gene with protein product		603360				9922452	Standard	NM_057174		Approved		uc001nbt.3	Q9Y5Y5	OTTHUMG00000167005	ENST00000378750.5:c.325C>T	11.37:g.45937288G>A	ENSP00000368024:p.Arg109Cys	Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	193	3	0.015544	NM_004813	Q9BWB9	Missense_Mutation	SNP	ENST00000378750.5	37	CCDS31472.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.623051	0.87460	.	.	ENSG00000121680	ENST00000241041;ENST00000378750;ENST00000532681;ENST00000525192	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.29	5.29	0.74685	.	0.111909	0.64402	D	0.000013	T	0.57651	0.2068	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.979;0.982	T	0.63391	-0.6648	10	0.87932	D	0	-12.6453	13.499	0.61442	0.0:0.0:0.8437:0.1563	.	109;109	Q9Y5Y5;Q9Y5Y5-2	PEX16_HUMAN;.	C	109;109;14;14	ENSP00000241041:R109C;ENSP00000368024:R109C;ENSP00000434654:R14C;ENSP00000431309:R14C	ENSP00000241041:R109C	R	-	1	0	PEX16	45893864	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.223000	0.78033	2.480000	0.83734	0.561000	0.74099	CGC	.	.	none		0.622	PEX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392398.1	NM_057174	
PIM1	5292	hgsc.bcm.edu	37	6	37138424	37138424	+	Silent	SNP	C	C	T			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr6:37138424C>T	ENST00000373509.5	+	1	446	c.73C>T	c.(73-75)Ctg>Ttg	p.L25L		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	116					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.L25V(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CGCCACCAAGCTGGCGCCCGG	0.726			T	BCL6	NHL																																p.L116L		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,1	PIM1	71	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C346T						scavenged	.						22.0	24.0	24.0					6																	37138424		2196	4289	6485	SO:0001819	synonymous_variant	5292	exon1			ACCAAGCTGGCGC		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.73C>T	6.37:g.37138424C>T		Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	12	3	0.25	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.726	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PCDH17	27253	hgsc.bcm.edu	37	13	58207600	58207600	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8061-01A-11D-2210-10	TCGA-FF-8061-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a29278af-7ecf-403e-b6a9-623ea7879d05	08470796-8ff6-4e18-98d5-f9ee0d079517	g.chr13:58207600G>A	ENST00000377918.3	+	1	946	c.920G>A	c.(919-921)gGc>gAc	p.G307D		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	307	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CGTGTGAAGGGCAATCTGGAC	0.582																																					p.G307D	Melanoma(72;952 1291 1619 12849 33676)	Atlas-SNP	.											PCDH17,NS,carcinoma,+1,1	PCDH17	304	1	0			c.G920A						PASS	.						64.0	61.0	62.0					13																	58207600		2203	4300	6503	SO:0001583	missense	27253	exon1			TGAAGGGCAATCT	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.920G>A	13.37:g.58207600G>A	ENSP00000367151:p.Gly307Asp	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	66	15	0.227273	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663894	0.67700	.	.	ENSG00000118946	ENST00000377918	T	0.51817	0.69	5.57	4.67	0.58626	Cadherin (4);Cadherin-like (1);	0.044369	0.85682	D	0.000000	T	0.59046	0.2165	L	0.39467	1.215	0.80722	D	1	D;D	0.67145	0.995;0.996	D;D	0.76071	0.978;0.987	T	0.54774	-0.8243	9	.	.	.	.	15.9011	0.79377	0.0:0.1353:0.8647:0.0	.	307;307	O14917-2;O14917	.;PCD17_HUMAN	D	307	ENSP00000367151:G307D	.	G	+	2	0	PCDH17	57105601	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.693000	0.74582	2.640000	0.89533	0.650000	0.86243	GGC	.	.	none		0.582	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
