#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TET2	54790	hgsc.bcm.edu	37	4	106182925	106182925	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:106182925delC	ENST00000540549.1	+	8	4824	c.3964delC	c.(3964-3966)ctgfs	p.L1322fs	TET2_ENST00000380013.4_Frame_Shift_Del_p.L1322fs|TET2_ENST00000545826.1_3'UTR|TET2_ENST00000513237.1_Frame_Shift_Del_p.L1343fs			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1322					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		GGAAGAGAAACTGGAGTCTCA	0.313			"""Mis N, F"""		MDS																																p.K1321fs		Pindel,Atlas-Indel	.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	1762	.	0			c.3963delA						PASS	.						87.0	74.0	78.0					4																	106182925		692	1588	2280	SO:0001589	frameshift_variant	54790	exon8			.	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.3964delC	4.37:g.106182925delC	ENSP00000442788:p.Leu1322fs	Somatic	229	.	.		WXS	Illumina HiSeq	Phase_I	251	39	0.155	NM_001127208	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Frame_Shift_Del	DEL	ENST00000540549.1	37	CCDS47120.1																																																																																			.	.	none		0.313	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
PRRC2C	23215	hgsc.bcm.edu	37	1	171557627	171557628	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:171557627_171557628delAC	ENST00000338920.4	+	33	8413_8414	c.8176_8177delAC	c.(8176-8178)acafs	p.T2726fs	PRRC2C_ENST00000367742.3_Frame_Shift_Del_p.T2728fs|PRRC2C_ENST00000392078.3_Frame_Shift_Del_p.T2728fs|PRRC2C_ENST00000426496.2_Frame_Shift_Del_p.T2661fs	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2726					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										ACCATTTCCTACACAGTTTGCA	0.396																																					p.2725_2726del		Atlas-Indel	.											BAT2D1_ENST00000392078,NS,carcinoma,+2,2	.	.	2	0			c.8175_8176del						PASS	.																																			SO:0001589	frameshift_variant	23215	exon33			.	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.8176_8177delAC	1.37:g.171557629_171557630delAC	ENSP00000343629:p.Thr2726fs	Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	118	20	0.169492	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Frame_Shift_Del	DEL	ENST00000338920.4	37	CCDS1296.2																																																																																			.	.	none		0.396	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
ARHGEF26	26084	hgsc.bcm.edu	37	3	153842198	153842199	+	Splice_Site	INS	-	-	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:153842198_153842199insA	ENST00000356448.4	+	3	1367_1368		c.e3-1		ARHGEF26_ENST00000465817.1_Splice_Site|ARHGEF26_ENST00000465093.1_Splice_Site	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26						endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						ttGTCTCTTAGAAAAAAATGCT	0.267																																					.	GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)	Atlas-Indel	.											.	ARHGEF26	158	.	0			c.1084-1->A						PASS	.																																			SO:0001630	splice_region_variant	26084	exon3			.	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1084-1->A	3.37:g.153842205_153842205dupA		Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	31	10	0.322581	NM_001251962	B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Splice_Site	INS	ENST00000356448.4	37	CCDS46938.1																																																																																			.	.	none		0.267	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353287.3	NM_015595	Intron
EPB41L4A	64097	hgsc.bcm.edu	37	5	111500817	111500818	+	Splice_Site	INS	-	-	AAAAT	rs369027426		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:111500817_111500818insAAAAT	ENST00000261486.5	-	23	2209		c.e23-2		EPB41L4A_ENST00000507810.1_Intron|EPB41L4A-AS1_ENST00000413221.2_lincRNA	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		ATTTCTTCTCTAAAATATATTT	0.312																																					.		Atlas-Indel	.											.	EPB41L4A	130	.	0			c.1933-2->ATTTT						PASS	.																																			SO:0001630	splice_region_variant	64097	exon24			.	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.1933-2->ATTTT	5.37:g.111500818_111500822dupAAAAT		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	130	11	0.0846154	NM_022140	A4FUI6	Splice_Site	INS	ENST00000261486.5	37	CCDS43350.1																																																																																			.	.	alt		0.312	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		Intron
MUSK	4593	hgsc.bcm.edu	37	9	113496632	113496632	+	Frame_Shift_Del	DEL	A	A	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:113496632delA	ENST00000374448.4	+	6	864	c.730delA	c.(730-732)accfs	p.T244fs	MUSK_ENST00000416899.2_Frame_Shift_Del_p.T244fs|MUSK_ENST00000189978.5_Frame_Shift_Del_p.T244fs	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	244	Ig-like 3.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						CCCCACCATCACCTGGATTGA	0.507																																					p.I253fs		Pindel,Atlas-Indel	.											.	MUSK	112	.	0			c.759delC						PASS	.						140.0	128.0	132.0					9																	113496632		2052	4215	6267	SO:0001589	frameshift_variant	4593	exon7			.	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.730delA	9.37:g.113496632delA	ENSP00000363571:p.Thr244fs	Somatic	98	.	.		WXS	Illumina HiSeq	Phase_I	105	17	0.162	NM_001166280	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Frame_Shift_Del	DEL	ENST00000374448.4	37	CCDS48005.1																																																																																			.	.	none		0.507	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
OR5AK2	390181	hgsc.bcm.edu	37	11	56756917	56756917	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:56756917delT	ENST00000326855.2	+	1	571	c.529delT	c.(529-531)tttfs	p.F178fs		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						CATCAATCACTTTTTCTGTGA	0.398																																					p.H176fs		Atlas-Indel	.											.	OR5AK2	45	.	0			c.528delC						PASS	.						346.0	311.0	323.0					11																	56756917		2201	4296	6497	SO:0001589	frameshift_variant	390181	exon1			.	AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.529delT	11.37:g.56756917delT	ENSP00000322784:p.Phe178fs	Somatic	250	0	0		WXS	Illumina HiSeq	Phase_I	294	47	0.159864	NM_001005323	B2RNZ9	Frame_Shift_Del	DEL	ENST00000326855.2	37	CCDS31538.1																																																																																			.	.	none		0.398	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392446.1	NM_001005323	
TBP	6908	hgsc.bcm.edu	37	6	170871013	170871014	+	In_Frame_Ins	INS	-	-	CAG	rs201732168|rs113202486|rs574714675|rs71010672	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:170871013_170871014insCAG	ENST00000392092.2	+	3	468_469	c.189_190insCAG	c.(190-192)cag>CAGcag	p.64_64Q>QQ	TBP_ENST00000540980.1_In_Frame_Ins_p.44_44Q>QQ|TBP_ENST00000230354.6_In_Frame_Ins_p.64_64Q>QQ	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q63_Q64insQ(1)|p.Q63Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagca	0.55																																					p.Q63delinsQQ		Atlas-Indel	.											TBP,NS,carcinoma,0,5	TBP	58	5	2	Insertion - In frame(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	c.189_190insCAG						PASS	.																																			SO:0001652	inframe_insertion	6908	exon3			.	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.211_213dupCAG	6.37:g.170871020_170871022dupCAG	ENSP00000375942:p.Gln95dup	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	73	46	0.630137	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Ins	INS	ENST00000392092.2	37	CCDS5315.1																																																																																			-|0.138;CAG|0.862	0.862	strong		0.550	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
RBM14	10432	hgsc.bcm.edu	37	11	66392639	66392640	+	In_Frame_Ins	INS	-	-	CTA			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:66392639_66392640insCTA	ENST00000310137.4	+	2	1431_1432	c.1292_1293insCTA	c.(1291-1296)gcctat>gcCTActat	p.432_433insY	RBM14-RBM4_ENST00000511114.1_Intron|RBM4_ENST00000503028.2_Intron|RBM14_ENST00000393979.3_Intron|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Intron|RBM14_ENST00000409738.4_Intron|RBM14-RBM4_ENST00000412278.2_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	432	Ala-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CAACCTGCTGCCTATGTGGCAC	0.614																																					p.A431delinsAY		Pindel,Atlas-Indel	.											.	RBM14	59	.	0			c.1292_1293insCTA						PASS	.																																			SO:0001652	inframe_insertion	10432	exon2			.	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.1293_1295dupCTA	11.37:g.66392640_66392642dupCTA	ENSP00000311747:p.Tyr432_Tyr432dup	Somatic	80	.	.		WXS	Illumina HiSeq	Phase_I	70	12	0.171	NM_006328	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	In_Frame_Ins	INS	ENST00000310137.4	37	CCDS8147.1																																																																																			.	.	none		0.614	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328	
TET2	54790	hgsc.bcm.edu	37	4	106158250	106158259	+	Frame_Shift_Del	DEL	CAGAAGCAAG	CAGAAGCAAG	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	CAGAAGCAAG	CAGAAGCAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:106158250_106158259delCAGAAGCAAG	ENST00000540549.1	+	3	4011_4020	c.3151_3160delCAGAAGCAAG	c.(3151-3162)cagaagcaagtafs	p.QKQV1051fs	TET2_ENST00000380013.4_Frame_Shift_Del_p.QKQV1051fs|TET2_ENST00000545826.1_Frame_Shift_Del_p.QKQV1051fs|TET2_ENST00000413648.2_Frame_Shift_Del_p.QKQV1051fs|TET2_ENST00000305737.2_Frame_Shift_Del_p.QKQV1051fs|TET2_ENST00000513237.1_Frame_Shift_Del_p.QKQV1072fs|TET2_ENST00000394764.1_Frame_Shift_Del_p.QKQV1051fs			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1051					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.Q1053*(2)|p.Q1051*(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TCTCAAATCACAGAAGCAAGTAAAAGTTGA	0.443			"""Mis N, F"""		MDS																																p.1050_1053del		Pindel,Atlas-Indel	.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	1762	.	3	Substitution - Nonsense(3)	haematopoietic_and_lymphoid_tissue(3)	c.3150_3159del						PASS	.																																			SO:0001589	frameshift_variant	54790	exon3			.	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.3151_3160delCAGAAGCAAG	4.37:g.106158250_106158259delCAGAAGCAAG	ENSP00000442788:p.Gln1051fs	Somatic	86	.	.		WXS	Illumina HiSeq	Phase_I	133	23	0.173	NM_017628	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Frame_Shift_Del	DEL	ENST00000540549.1	37	CCDS47120.1																																																																																			.	.	none		0.443	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
PCLO	27445	hgsc.bcm.edu	37	7	82595469	82595469	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:82595469delT	ENST00000333891.9	-	4	3972	c.3635delA	c.(3634-3636)aagfs	p.K1212fs	PCLO_ENST00000423517.2_Frame_Shift_Del_p.K1212fs	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGGGAGTGGCTTTTTTTCTTG	0.368																																					p.K1212fs		Pindel,Atlas-Indel	.											.	PCLO	1506	.	0			c.3636delG						PASS	.						164.0	155.0	158.0					7																	82595469		1796	4076	5872	SO:0001589	frameshift_variant	27445	exon4			.	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3635delA	7.37:g.82595469delT	ENSP00000334319:p.Lys1212fs	Somatic	189	.	.		WXS	Illumina HiSeq	Phase_I	259	39	0.151	NM_014510		Frame_Shift_Del	DEL	ENST00000333891.9	37	CCDS47630.1																																																																																			.	.	none		0.368	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
BTBD7	55727	hgsc.bcm.edu	37	14	93709220	93709221	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:93709220_93709221insT	ENST00000334746.5	-	11	3104_3105	c.2797_2798insA	c.(2797-2799)acafs	p.T933fs	BTBD7_ENST00000554565.1_Frame_Shift_Ins_p.T582fs|BTBD7_ENST00000393170.2_Frame_Shift_Ins_p.T507fs	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	933					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		TCTGGTGTCTGTTTTTTGCTCT	0.485																																					p.T933fs		Pindel,Atlas-Indel	.											.	BTBD7	112	.	0			c.2798_2799insA						PASS	.																																			SO:0001589	frameshift_variant	55727	exon11			.	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.2798dupA	14.37:g.93709226_93709226dupT	ENSP00000335615:p.Thr933fs	Somatic	279	.	.		WXS	Illumina HiSeq	Phase_I	367	68	0.185	NM_001002860	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Frame_Shift_Ins	INS	ENST00000334746.5	37	CCDS32146.1																																																																																			.	.	none		0.485	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860	
ZNF516	9658	hgsc.bcm.edu	37	18	74090958	74090958	+	Frame_Shift_Del	DEL	G	G	-	rs398079646|rs398033573|rs56087742		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:74090958delG	ENST00000443185.2	-	5	3428	c.3111delC	c.(3109-3111)cccfs	p.P1037fs	ZNF516_ENST00000524431.2_5'UTR|RP11-504I13.3_ENST00000583287.1_RNA	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	1037					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		AGTGTAGGACGGGGGGGCGCC	0.652													GGGGGG|GGGGGGG|GGGGGG|insertion	5008	1.0	1.0	1.0	5008	,	,		13278	1.0		1.0	False		,,,				2504	1.0				p.V1038fs		Pindel	.											.	ZNF516	102	.	0			c.3112delG						PASS	.			3517,17		1755,7,5	7.0	7.0	7.0			-0.6	0.0	18	dbSNP_131	33	7701,27		3846,9,9	no	frameshift	ZNF516	NM_014643.3		5601,16,14	A1A1,A1R,RR		0.3494,0.481,0.3907			74090958	11218,44	1730	3829	5559	SO:0001589	frameshift_variant	9658	exon5			.	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.3111delC	18.37:g.74090958delG	ENSP00000394757:p.Pro1037fs	Somatic	32	.	.		WXS	Illumina HiSeq	Phase_I	26	12	0.462	NM_014643		Frame_Shift_Del	DEL	ENST00000443185.2	37																																																																																				G|0.016;-|0.984	0.984	strong		0.652	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
HMGN2P46	283651	hgsc.bcm.edu	37	15	45848231	45848231	+	lincRNA	DEL	T	T	-	rs372861121|rs368577527		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:45848231delT	ENST00000557965.1	+	0	0				HMGN2P46_ENST00000409454.1_RNA																							TTTGTTTAGCTTTTTTTTTTT	0.323																																					.		Pindel	.											.	.	.	.	0			.						PASS	.																																					283651	.			.																													15.37:g.45848231delT		Somatic	24	.	.		WXS	Illumina HiSeq	Phase_I	38	10	0.263	.		RNA	DEL	ENST00000557965.1	37																																																																																				.	.	weak		0.323	RP11-96O20.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000416553.1		
VSIG10	54621	hgsc.bcm.edu	37	12	118506328	118506333	+	In_Frame_Del	DEL	TCCTCC	TCCTCC	-	rs67582641|rs199991783|rs72125532	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	TCCTCC	TCCTCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:118506328_118506333delTCCTCC	ENST00000359236.5	-	8	1692_1697	c.1416_1421delGGAGGA	c.(1414-1422)gaggaggaa>gaa	p.472_474EEE>E		NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	472	Glu-rich.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						TGCAGCAtcttcctcctcctcctcct	0.485														1628	0.32508	0.3737	0.2939	5008	,	,		23177	0.5248		0.1829	False		,,,				2504	0.2219				p.473_474del		Pindel	.											.	VSIG10	41	.	0			c.1417_1422del						PASS	.																																			SO:0001651	inframe_deletion	54621	exon8			.		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.1416_1421delGGAGGA	12.37:g.118506334_118506339delTCCTCC	ENSP00000352172:p.Glu472_Glu473del	Somatic	221	0	0.000		WXS	Illumina HiSeq	Phase_I	209	65	0.311	NM_019086	Q9NWQ7	In_Frame_Del	DEL	ENST00000359236.5	37	CCDS44992.1																																																																																			.	.	strong		0.485	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2	NM_019086	
OR13C2	392376	hgsc.bcm.edu	37	9	107367665	107367666	+	Frame_Shift_Del	DEL	GC	GC	-	rs377668801|rs143760725|rs144815315|rs140970710	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:107367665_107367666delGC	ENST00000542196.1	-	1	285_286	c.243_244delGC	c.(241-246)acgctafs	p.L82fs		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						AAGCTCACTAGCGTGGAGGGAA	0.515														1574	0.314297	0.4138	0.2003	5008	,	,		20880	0.4097		0.16	False		,,,				2504	0.3211				p.82_82del		Pindel	.											.	OR13C2	46	.	0			c.244_245del						PASS	.			2387,1861		730,927,467						2.2	0.0		dbSNP_134	35	1565,6681		171,1223,2729	no	frameshift	OR13C2	NM_001004481.1		901,2150,3196	A1A1,A1R,RR		18.9789,43.8089,31.6312				3952,8542				SO:0001589	frameshift_variant	392376	exon1			.		CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.243_244delGC	9.37:g.107367665_107367666delGC	ENSP00000438815:p.Leu82fs	Somatic	396	.	.		WXS	Illumina HiSeq	Phase_I	447	89	0.199	NM_001004481	B9EGV8|Q6IF54	Frame_Shift_Del	DEL	ENST00000542196.1	37	CCDS35092.1																																																																																			.	.	strong		0.515	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053489.2	NM_001004481	
KRT3	3850	hgsc.bcm.edu	37	12	53189414	53189431	+	In_Frame_Del	DEL	CCAAAGCCACCAGCCCCT	CCAAAGCCACCAGCCCCT	-	rs148531142|rs184322044|rs142692092		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	CCAAAGCCACCAGCCCCT	CCAAAGCCACCAGCCCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:53189414_53189431delCCAAAGCCACCAGCCCCT	ENST00000417996.2	-	1	470_487	c.396_413delAGGGGCTGGTGGCTTTGG	c.(394-414)ggaggggctggtggctttggt>ggt	p.132_138GGAGGFG>G	KRT3_ENST00000309505.3_In_Frame_Del_p.132_138GGAGGFG>G	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	132	Gly-rich.|Head.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						accaggaccaccaaagccaccagcccctccaaagccac	0.633																																					p.133_138del		Pindel	.											.	KRT3	65	.	0			c.397_414del						PASS	.			595,3499		80,435,1532						-0.9	0.2			185	257,7693		40,177,3758	no	coding	KRT3	NM_057088.2		120,612,5290	A1A1,A1R,RR		3.2327,14.5335,7.0741				852,11192				SO:0001651	inframe_deletion	3850	exon1			.		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.396_413delAGGGGCTGGTGGCTTTGG	12.37:g.53189414_53189431delCCAAAGCCACCAGCCCCT	ENSP00000413479:p.Gly132_Phe137del	Somatic	131	.	.		WXS	Illumina HiSeq	Phase_I	133	22	0.165	NM_057088	A6NIS2|Q701L8	In_Frame_Del	DEL	ENST00000417996.2	37	CCDS44895.1																																																																																			.	.	none		0.633	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
SMARCA2	6595	hgsc.bcm.edu	37	9	2039777	2039779	+	In_Frame_Del	DEL	CAG	CAG	-	rs376509101|rs62639301	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:2039777_2039779delCAG	ENST00000382203.1	+	4	876_878	c.667_669delCAG	c.(667-669)cagdel	p.Q238del	SMARCA2_ENST00000382194.1_In_Frame_Del_p.Q238del|SMARCA2_ENST00000491574.1_3'UTR|RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000349721.2_In_Frame_Del_p.Q238del|SMARCA2_ENST00000357248.2_In_Frame_Del_p.Q238del			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	238	Poly-Gln.			Missing (in Ref. 1; CAA51407). {ECO:0000305}.	aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		gcagcagcaacagcagcagcagc	0.635																																					p.222_223del		Pindel	.											SMARCA2_ENST00000349721,NS,carcinoma,0,2	SMARCA2	313	2	0			c.666_668del						PASS	.																																			SO:0001651	inframe_deletion	6595	exon4			.	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.667_669delCAG	9.37:g.2039786_2039788delCAG	ENSP00000371638:p.Gln238del	Somatic	64	.	.		WXS	Illumina HiSeq	Phase_I	102	26	0.255	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	In_Frame_Del	DEL	ENST00000382203.1	37	CCDS34977.1																																																																																			.	.	weak		0.635	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
SYTL2	54843	hgsc.bcm.edu	37	11	85447546	85447546	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:85447546T>C	ENST00000528231.1	-	5	858	c.581A>G	c.(580-582)gAg>gGg	p.E194G	SYTL2_ENST00000389960.4_Missense_Mutation_p.E194G|SYTL2_ENST00000316356.4_Missense_Mutation_p.E195G|SYTL2_ENST00000524452.1_Missense_Mutation_p.E194G|SYTL2_ENST00000527523.1_Missense_Mutation_p.E146G	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	194					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		ATATTTACCCTCTTTTGAAGT	0.328																																					p.E195G		Atlas-SNP	.											.	SYTL2	231	.	0			c.A584G						PASS	.						84.0	84.0	84.0					11																	85447546		2202	4297	6499	SO:0001583	missense	54843	exon5			TTACCCTCTTTTG	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.581A>G	11.37:g.85447546T>C	ENSP00000431701:p.Glu194Gly	Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	88	4	0.0454545	NM_001162953	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	37	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.147895	0.57151	.	.	ENSG00000137501	ENST00000389960;ENST00000316356;ENST00000528231;ENST00000527523;ENST00000524452	T;T;T;T;T	0.27720	1.73;1.75;1.75;1.65;1.73	5.93	5.93	0.95920	.	.	.	.	.	T	0.37489	0.1005	L	0.54323	1.7	0.80722	D	1	P;P;P;P;P	0.40834	0.73;0.546;0.611;0.546;0.554	P;B;B;B;B	0.45406	0.479;0.208;0.05;0.156;0.299	T	0.07290	-1.0780	8	.	.	.	.	14.6214	0.68588	0.0:0.0:0.0:1.0	.	146;194;194;195;52	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15	.;.;SYTL2_HUMAN;.;.	G	194;195;194;146;194	ENSP00000374610:E194G;ENSP00000318803:E195G;ENSP00000431701:E194G;ENSP00000434010:E146G;ENSP00000435238:E194G	.	E	-	2	0	SYTL2	85125194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.569000	0.60865	2.271000	0.75665	0.533000	0.62120	GAG	.	.	none		0.328	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927	
B4GALNT2	124872	hgsc.bcm.edu	37	17	47246178	47246178	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:47246178G>T	ENST00000300404.2	+	10	1470	c.1411G>T	c.(1411-1413)Ggc>Tgc	p.G471C	B4GALNT2_ENST00000504681.1_Missense_Mutation_p.G385C|B4GALNT2_ENST00000393354.2_Missense_Mutation_p.G411C	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	471					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)			endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			GGTGACCAGTGGCGTGGTCAA	0.567																																					p.G471C	GBM(124;244 1635 8663 18097 33175)	Atlas-SNP	.											B4GALNT2,colon,carcinoma,-2,1	B4GALNT2	67	1	0			c.G1411T						PASS	.						81.0	59.0	66.0					17																	47246178		2203	4300	6503	SO:0001583	missense	124872	exon10			ACCAGTGGCGTGG	AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.1411G>T	17.37:g.47246178G>T	ENSP00000300404:p.Gly471Cys	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	95	4	0.0421053	NM_153446	B4DZE4|Q14CP1|Q86Y40	Missense_Mutation	SNP	ENST00000300404.2	37	CCDS11544.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716785	0.89205	.	.	ENSG00000167080	ENST00000504681;ENST00000393354;ENST00000300404	T;T;T	0.25749	1.78;1.78;1.78	5.28	5.28	0.74379	.	0.000000	0.64402	D	0.000001	T	0.53238	0.1784	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.51756	-0.8665	10	0.38643	T	0.18	-22.868	17.6682	0.88209	0.0:0.0:1.0:0.0	.	411;471	Q8NHY0-2;Q8NHY0	.;B4GN2_HUMAN	C	385;411;471	ENSP00000425510:G385C;ENSP00000377022:G411C;ENSP00000300404:G471C	ENSP00000300404:G471C	G	+	1	0	B4GALNT2	44601177	1.000000	0.71417	0.626000	0.29213	0.892000	0.51952	8.715000	0.91416	2.450000	0.82876	0.561000	0.74099	GGC	.	.	none		0.567	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446	
LMO7	4008	hgsc.bcm.edu	37	13	76415865	76415865	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:76415865C>A	ENST00000321797.8	+	22	3799	c.3078C>A	c.(3076-3078)gaC>gaA	p.D1026E	LMO7_ENST00000377534.3_Missense_Mutation_p.D1311E|LMO7_ENST00000341547.4_Missense_Mutation_p.D977E|LMO7_ENST00000465261.2_Missense_Mutation_p.D1026E|LMO7_ENST00000526202.1_Missense_Mutation_p.D903E|LMO7_ENST00000357063.3_Missense_Mutation_p.D1311E			Q8WWI1	LMO7_HUMAN	LIM domain 7	1311					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AGTCTTCAGACAGAGAAGGAA	0.527																																					p.D1026E		Atlas-SNP	.											.	LMO7	334	.	0			c.C3078A						PASS	.						96.0	97.0	96.0					13																	76415865		2203	4300	6503	SO:0001583	missense	4008	exon21			TTCAGACAGAGAA	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.3078C>A	13.37:g.76415865C>A	ENSP00000317802:p.Asp1026Glu	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	93	30	0.322581	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.74|14.74	2.624220|2.624220	0.46840|0.46840	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000321797;ENST00000526202;ENST00000465261|ENST00000447038;ENST00000525914	T;T;T;T;T;T;T|.	0.39997|.	1.65;1.63;1.64;1.06;1.06;1.07;1.05|.	5.95|5.95	4.09|4.09	0.47781|0.47781	.|.	0.607412|.	0.18332|.	N|.	0.144459|.	T|T	0.43389|0.43389	0.1245|0.1245	L|L	0.45581|0.45581	1.43|1.43	0.31577|0.31577	N|N	0.655654|0.655654	B;B;B;B;B|.	0.31318|.	0.06;0.319;0.012;0.06;0.119|.	B;B;B;B;B|.	0.26416|.	0.018;0.069;0.007;0.031;0.052|.	T|T	0.47837|0.47837	-0.9086|-0.9086	10|5	0.14656|.	T|.	0.56|.	-25.6026|-25.6026	4.7211|4.7211	0.12918|0.12918	0.1534:0.6166:0.1482:0.0818|0.1534:0.6166:0.1482:0.0818	.|.	903;977;1311;1026;1259|.	E9PMS6;Q8WWI1-3;Q8WWI1;E9PLH4;F8J2B5|.	.;.;LMO7_HUMAN;.;.|.	E|K	977;1311;1311;925;1026;903;1026|935;195	ENSP00000342112:D977E;ENSP00000349571:D1311E;ENSP00000366757:D1311E;ENSP00000366719:D925E;ENSP00000317802:D1026E;ENSP00000431129:D903E;ENSP00000433352:D1026E|.	ENSP00000317802:D1026E|.	D|Q	+|+	3|1	2|0	LMO7|LMO7	75313866|75313866	0.914000|0.914000	0.31030|0.31030	0.999000|0.999000	0.59377|0.59377	0.914000|0.914000	0.54420|0.54420	0.510000|0.510000	0.22723|0.22723	2.825000|2.825000	0.97269|0.97269	0.655000|0.655000	0.94253|0.94253	GAC|CAG	.	.	none		0.527	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
ARHGAP22	58504	hgsc.bcm.edu	37	10	49654625	49654625	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr10:49654625A>G	ENST00000249601.4	-	10	2202	c.1906T>C	c.(1906-1908)Tcc>Ccc	p.S636P	ARHGAP22_ENST00000417247.2_Missense_Mutation_p.S546P|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.S642P|ARHGAP22_ENST00000477708.2_Missense_Mutation_p.S469P|ARHGAP22_ENST00000374170.1_Missense_Mutation_p.S477P|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.S527P|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.S652P	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	636					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TCTAACCGGGACATTCGTTTT	0.502																																					p.S652P		Atlas-SNP	.											.	ARHGAP22	94	.	0			c.T1954C						PASS	.						126.0	115.0	118.0					10																	49654625		2203	4300	6503	SO:0001583	missense	58504	exon10			ACCGGGACATTCG	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.1906T>C	10.37:g.49654625A>G	ENSP00000249601:p.Ser636Pro	Somatic	269	0	0		WXS	Illumina HiSeq	Phase_I	231	55	0.238095	NM_001256024	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	37	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	A	10.90	1.482037	0.26598	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000477708;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98	4.42	0.456	0.16655	.	0.502966	0.20316	N	0.094726	T	0.49881	0.1583	L	0.51422	1.61	0.09310	N	0.999995	B;P;P;P;P;D	0.64830	0.337;0.475;0.744;0.475;0.744;0.994	B;B;B;B;B;P	0.59703	0.063;0.099;0.26;0.099;0.134;0.862	T	0.45877	-0.9231	10	0.44086	T	0.13	.	12.1264	0.53919	0.4414:0.5586:0.0:0.0	.	642;636;652;636;546;469	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3;D6R9V6	.;.;.;RHG22_HUMAN;.;.	P	636;527;477;469;546;642;652	ENSP00000249601:S636P;ENSP00000363287:S527P;ENSP00000363285:S477P;ENSP00000422868:S469P;ENSP00000410054:S546P;ENSP00000416701:S642P;ENSP00000412461:S652P	ENSP00000249601:S636P	S	-	1	0	ARHGAP22	49324631	0.002000	0.14202	0.014000	0.15608	0.008000	0.06430	-0.001000	0.12947	0.080000	0.16959	0.459000	0.35465	TCC	.	.	none		0.502	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
TNF	7124	hgsc.bcm.edu	37	6	31543674	31543674	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:31543674C>G	ENST00000449264.2	+	1	331	c.156C>G	c.(154-156)caC>caG	p.H52Q		NM_000594.3	NP_000585.2	P01375	TNFA_HUMAN	tumor necrosis factor	52		Cleavage; by SPPL2A or SPPL2B.			activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nicotine (GO:0071316)|cellular response to organic cyclic compound (GO:0071407)|chronic inflammatory response to antigenic stimulus (GO:0002439)|defense response to Gram-positive bacterium (GO:0050830)|embryonic digestive tract development (GO:0048566)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glucose metabolic process (GO:0006006)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JNK cascade (GO:0007254)|leukocyte tethering or rolling (GO:0050901)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|necroptotic signaling pathway (GO:0097527)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of branching involved in lung morphogenesis (GO:0061048)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of glucose import (GO:0046325)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of L-glutamate transport (GO:0002037)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid storage (GO:0010888)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|organ morphogenesis (GO:0009887)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle development (GO:0051798)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of mononuclear cell migration (GO:0071677)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of podosome assembly (GO:0071803)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein transport (GO:0051222)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translational initiation by iron (GO:0045994)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|receptor biosynthetic process (GO:0032800)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of immunoglobulin secretion (GO:0051023)|regulation of insulin secretion (GO:0050796)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to salt stress (GO:0009651)|response to virus (GO:0009615)|sequestering of triglyceride (GO:0030730)|skeletal muscle contraction (GO:0003009)|transformed cell apoptotic process (GO:0006927)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	cytokine activity (GO:0005125)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|transcription regulatory region DNA binding (GO:0044212)|tumor necrosis factor receptor binding (GO:0005164)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(3)	8		Ovarian(999;0.00556)			Adalimumab(DB00051)|Amrinone(DB01427)|Certolizumab pegol(DB08904)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Epinephrine(DB00668)|Etanercept(DB00005)|Glucosamine(DB01296)|golimumab(DB06674)|Infliximab(DB00065)|Pomalidomide(DB08910)|Pranlukast(DB01411)|Pseudoephedrine(DB00852)|Thalidomide(DB01041)	GCCTGCTGCACTTTGGAGTGA	0.627									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.H52Q		Atlas-SNP	.											.	TNF	15	.	0			c.C156G						PASS	.						45.0	45.0	45.0					6																	31543674		2203	4300	6503	SO:0001583	missense	7124	exon1	Familial Cancer Database	incl.: Familial Head and Neck Cancer	GCTGCACTTTGGA	X02910	CCDS4702.1	6p21.3	2013-05-22	2010-05-04		ENSG00000232810	ENSG00000232810		"""Tumor necrosis factor (ligand) superfamily"""	11892	protein-coding gene	gene with protein product	"""TNF superfamily, member 2"""	191160	"""tumor necrosis factor (TNF superfamily, member 2)"""	TNFA		2413547, 6392892	Standard	NM_000594		Approved	TNFSF2, DIF, TNF-alpha	uc003nui.4	P01375	OTTHUMG00000031194	ENST00000449264.2:c.156C>G	6.37:g.31543674C>G	ENSP00000398698:p.His52Gln	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	78	24	0.307692	NM_000594	O43647|Q9P1Q2|Q9UIV3	Missense_Mutation	SNP	ENST00000449264.2	37	CCDS4702.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.256573	0.39896	.	.	ENSG00000232810	ENST00000449264	T	0.74737	-0.87	5.77	3.99	0.46301	.	0.294531	0.38058	N	0.001824	T	0.50120	0.1597	L	0.58583	1.82	0.51767	D	0.999937	B	0.18166	0.026	B	0.18871	0.023	T	0.51004	-0.8760	10	0.23302	T	0.38	.	6.9811	0.24704	0.0:0.743:0.0:0.257	.	52	P01375	TNFA_HUMAN	Q	52	ENSP00000398698:H52Q	ENSP00000398698:H52Q	H	+	3	2	TNF	31651653	0.998000	0.40836	1.000000	0.80357	0.943000	0.58893	0.436000	0.21526	1.445000	0.47624	0.655000	0.94253	CAC	.	.	none		0.627	TNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076390.2		
COL11A1	1301	hgsc.bcm.edu	37	1	103364535	103364535	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:103364535C>A	ENST00000370096.3	-	55	4414	c.4102G>T	c.(4102-4104)Gca>Tca	p.A1368S	COL11A1_ENST00000512756.1_Missense_Mutation_p.A1252S|COL11A1_ENST00000353414.4_Missense_Mutation_p.A1329S|COL11A1_ENST00000358392.2_Missense_Mutation_p.A1380S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1368	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TCTGCACCTGCAGCTCCAGGA	0.274																																					p.A1380S		Atlas-SNP	.											.	COL11A1	972	.	0			c.G4138T						PASS	.						44.0	45.0	44.0					1																	103364535		2201	4298	6499	SO:0001583	missense	1301	exon55			CACCTGCAGCTCC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4102G>T	1.37:g.103364535C>A	ENSP00000359114:p.Ala1368Ser	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	101	46	0.455446	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.807087	0.31961	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.94330	-3.4;-3.4;-3.4;-3.4	6.06	1.46	0.22682	.	0.409732	0.27509	N	0.019059	D	0.84543	0.5495	L	0.43152	1.355	0.24453	N	0.994478	B;B;P;B;B	0.37708	0.043;0.073;0.606;0.0;0.03	B;B;P;B;B	0.49012	0.027;0.059;0.598;0.001;0.037	T	0.77130	-0.2701	10	0.20519	T	0.43	.	4.6044	0.12371	0.1589:0.3328:0.0:0.5083	.	1252;1329;1380;1368;588	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	S	1368;1380;1329;588;1252	ENSP00000359114:A1368S;ENSP00000351163:A1380S;ENSP00000302551:A1329S;ENSP00000426533:A1252S	ENSP00000302551:A1329S	A	-	1	0	COL11A1	103137123	0.906000	0.30813	0.990000	0.47175	0.983000	0.72400	0.385000	0.20685	-0.012000	0.14223	0.650000	0.86243	GCA	.	.	none		0.274	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
ADAM32	203102	hgsc.bcm.edu	37	8	39091507	39091507	+	Missense_Mutation	SNP	G	G	A	rs536001133		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:39091507G>A	ENST00000379907.4	+	16	1851	c.1724G>A	c.(1723-1725)cGa>cAa	p.R575Q	ADAM32_ENST00000519315.1_Missense_Mutation_p.R469Q|ADAM32_ENST00000437682.2_Missense_Mutation_p.R476Q	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	575						integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R574Q(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			GCTTTCGTACGAGATTCTGTA	0.393													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12732	0.0		0.0	False		,,,				2504	0.0				p.R575Q		Atlas-SNP	.											ADAM32,colon,carcinoma,0,1	ADAM32	70	1	1	Substitution - Missense(1)	large_intestine(1)	c.G1724A						scavenged	.						77.0	68.0	70.0					8																	39091507		1857	4096	5953	SO:0001583	missense	203102	exon16			TCGTACGAGATTC	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.1724G>A	8.37:g.39091507G>A	ENSP00000369238:p.Arg575Gln	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	135	4	0.0296296	NM_145004	Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	37	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.507520	0.44558	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907	T;T;T	0.22134	1.97;1.97;1.97	4.88	2.92	0.33932	ADAM, cysteine-rich (2);	0.968320	0.08316	N	0.964580	T	0.28433	0.0703	L	0.38838	1.175	0.09310	N	1	D;D;P	0.76494	0.981;0.999;0.462	P;D;B	0.68483	0.72;0.958;0.169	T	0.21759	-1.0236	10	0.12103	T	0.63	.	5.0256	0.14383	0.1066:0.0:0.6705:0.2228	.	476;469;575	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	Q	476;469;575	ENSP00000405978:R476Q;ENSP00000429422:R469Q;ENSP00000369238:R575Q	ENSP00000369238:R575Q	R	+	2	0	ADAM32	39210664	0.001000	0.12720	0.020000	0.16555	0.155000	0.21991	0.435000	0.21510	1.286000	0.44565	0.650000	0.86243	CGA	.	.	none		0.393	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
ALAS2	212	hgsc.bcm.edu	37	X	55041425	55041425	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:55041425C>T	ENST00000330807.5	-	9	1329	c.1192G>A	c.(1192-1194)Ggc>Agc	p.G398S	ALAS2_ENST00000335854.4_Missense_Mutation_p.G361S|ALAS2_ENST00000498636.1_5'UTR|ALAS2_ENST00000396198.3_Missense_Mutation_p.G385S	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	398					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	GCAATGTAGCCGCCCACACAG	0.532																																					p.G398S		Atlas-SNP	.											.	ALAS2	163	.	0			c.G1192A						PASS	.						32.0	31.0	32.0					X																	55041425		2203	4300	6503	SO:0001583	missense	212	exon9			TGTAGCCGCCCAC		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.1192G>A	X.37:g.55041425C>T	ENSP00000332369:p.Gly398Ser	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	109	17	0.155963	NM_000032	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	ENST00000330807.5	37	CCDS14366.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.630705	0.87660	.	.	ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854	D;D;D	0.98684	-5.07;-5.07;-5.07	5.64	5.64	0.86602	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.093208	0.64402	D	0.000001	D	0.99501	0.9822	H	0.97682	4.055	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.995;0.995;0.997	D	0.98150	1.0441	10	0.87932	D	0	-10.8077	17.643	0.88142	0.0:1.0:0.0:0.0	.	361;385;398	A8K6C4;Q5JZF5;P22557	.;.;HEM0_HUMAN	S	398;385;361	ENSP00000332369:G398S;ENSP00000379501:G385S;ENSP00000337131:G361S	ENSP00000332369:G398S	G	-	1	0	ALAS2	55058150	1.000000	0.71417	0.910000	0.35882	0.622000	0.37654	7.818000	0.86416	2.524000	0.85096	0.600000	0.82982	GGC	.	.	none		0.532	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3	NM_000032	
SGK1	6446	hgsc.bcm.edu	37	6	134493825	134493825	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134493825G>A	ENST00000237305.7	-	7	725	c.637C>T	c.(637-639)Ctg>Ttg	p.L213L	SGK1_ENST00000367857.5_Silent_p.L203L|SGK1_ENST00000413996.3_Silent_p.L227L|SGK1_ENST00000367858.5_Silent_p.L308L|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000475719.2_Silent_p.L169L|SGK1_ENST00000528577.1_Silent_p.L241L	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	213	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		AGTGAATGCAGGTAGCCCAAG	0.502																																					p.L308L		Atlas-SNP	.											SGK1_ENST00000528577,NS,carcinoma,0,5	SGK1	387	5	0			c.C922T						PASS	.						71.0	63.0	66.0					6																	134493825		2203	4300	6503	SO:0001819	synonymous_variant	6446	exon9			AATGCAGGTAGCC	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.637C>T	6.37:g.134493825G>A		Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	108	15	0.138889	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Silent	SNP	ENST00000237305.7	37	CCDS5170.1																																																																																			.	.	none		0.502	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
TENM1	10178	hgsc.bcm.edu	37	X	123870854	123870854	+	Silent	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:123870854A>G	ENST00000371130.3	-	4	792	c.729T>C	c.(727-729)caT>caC	p.H243H	TENM1_ENST00000422452.2_Silent_p.H243H	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	243	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGTTATGCAGATGGACTGAAT	0.532																																					p.H243H		Atlas-SNP	.											.	.	.	.	0			c.T729C						PASS	.						178.0	161.0	166.0					X																	123870854		2203	4300	6503	SO:0001819	synonymous_variant	10178	exon4			ATGCAGATGGACT	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.729T>C	X.37:g.123870854A>G		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	86	14	0.162791	NM_001163278	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																			.	.	none		0.532	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
PRKRA	8575	hgsc.bcm.edu	37	2	179300871	179300871	+	Splice_Site	SNP	C	C	T	rs200649428		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:179300871C>T	ENST00000325748.4	-	7	985		c.e7+1		PRKRA_ENST00000487082.1_Splice_Site|AC009948.5_ENST00000454488.1_RNA|AC009948.5_ENST00000453026.2_RNA|AC009948.5_ENST00000436616.2_RNA|PRKRA_ENST00000438687.3_Splice_Site|PRKRA_ENST00000432031.2_Splice_Site	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator						cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			AAAAATCATACCTATATCCAA	0.294																																					.	Melanoma(200;68 3001 23825 48764)	Atlas-SNP	.											PRKRA,caecum,carcinoma,0,1	PRKRA	56	1	0			c.709+1G>A						scavenged	.						64.0	72.0	69.0					2																	179300871		2203	4299	6502	SO:0001630	splice_region_variant	8575	exon8			ATCATACCTATAT	AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.784+1G>A	2.37:g.179300871C>T		Somatic	46	3	0.0652174		WXS	Illumina HiSeq	Phase_I	46	7	0.152174	NM_001139518	A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Splice_Site	SNP	ENST00000325748.4	37	CCDS2279.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.432561	0.83776	.	.	ENSG00000180228	ENST00000325748;ENST00000438687;ENST00000487082;ENST00000432031	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9579	0.86264	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRKRA	179009117	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.411000	0.73298	2.739000	0.93911	0.655000	0.94253	.	.	.	weak		0.294	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255782.2	NM_003690	Intron
MSMP	692094	hgsc.bcm.edu	37	9	35753722	35753722	+	Silent	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:35753722A>G	ENST00000436428.2	-	2	313	c.174T>C	c.(172-174)tcT>tcC	p.S58S	MSMP_ENST00000414286.1_5'UTR|RGP1_ENST00000378078.4_3'UTR|RP11-112J3.15_ENST00000425499.2_RNA	NM_001044264.2	NP_001037729.1	Q1L6U9	MSMP_HUMAN	microseminoprotein, prostate associated	58						cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(2)|kidney(1)|lung(3)|prostate(3)	9						TGCGGAGCCAAGACTCACCCA	0.527																																					p.S58S		Atlas-SNP	.											.	MSMP	15	.	0			c.T174C						PASS	.						44.0	46.0	45.0					9																	35753722		2045	4202	6247	SO:0001819	synonymous_variant	692094	exon2			GAGCCAAGACTCA	DQ012170	CCDS43797.1	9p13.3	2012-10-02			ENSG00000215183	ENSG00000215183			29663	protein-coding gene	gene with protein product		612191				17338636	Standard	NM_001044264		Approved	PC-3, PSMP	uc003zyb.2	Q1L6U9	OTTHUMG00000019882	ENST00000436428.2:c.174T>C	9.37:g.35753722A>G		Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	133	34	0.255639	NM_001044264		Silent	SNP	ENST00000436428.2	37	CCDS43797.1																																																																																			.	.	none		0.527	MSMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052384.2	NM_001044264	
C10orf76	79591	hgsc.bcm.edu	37	10	103771512	103771512	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr10:103771512G>A	ENST00000370033.4	-	11	918	c.799C>T	c.(799-801)Caa>Taa	p.Q267*		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	267						integral component of membrane (GO:0016021)		p.Q267K(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		AAACCACTTTGGTGTTCTTCT	0.343																																					p.Q267X		Atlas-SNP	.											C10orf76,NS,carcinoma,0,2	C10orf76	48	2	1	Substitution - Missense(1)	endometrium(1)	c.C799T						scavenged	.						125.0	124.0	124.0					10																	103771512		1823	4079	5902	SO:0001587	stop_gained	79591	exon11			CACTTTGGTGTTC	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.799C>T	10.37:g.103771512G>A	ENSP00000359050:p.Gln267*	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	181	3	0.0165746	NM_024541	Q2TB87|Q9H8Z9	Nonsense_Mutation	SNP	ENST00000370033.4	37	CCDS41563.1	.	.	.	.	.	.	.	.	.	.	G	37	6.526959	0.97637	.	.	ENSG00000120029	ENST00000370033	.	.	.	6.17	6.17	0.99709	.	0.051755	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-12.8406	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	267	.	ENSP00000359050:Q267X	Q	-	1	0	C10orf76	103761502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.097000	0.89539	2.941000	0.99782	0.655000	0.94253	CAA	.	.	none		0.343	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1	NM_024541	
LOXHD1	125336	hgsc.bcm.edu	37	18	44109205	44109205	+	Missense_Mutation	SNP	C	C	T	rs199695409		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:44109205C>T	ENST00000398722.4	-	22	3630	c.3631G>A	c.(3631-3633)Ggg>Agg	p.G1211R	LOXHD1_ENST00000582408.1_Missense_Mutation_p.G378R|LOXHD1_ENST00000441551.2_Missense_Mutation_p.G1283R|LOXHD1_ENST00000300591.6_Missense_Mutation_p.G378R|LOXHD1_ENST00000441893.2_Missense_Mutation_p.G422R|LOXHD1_ENST00000579038.1_Missense_Mutation_p.G282R|LOXHD1_ENST00000536736.1_Missense_Mutation_p.G1489R			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1211	PLAT 9. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						CCAGTGTCCCCGAGGTCTCCA	0.567																																					p.G1489R		Atlas-SNP	.											LOXHD1_ENST00000398722,NS,malignant_melanoma,+1,2	LOXHD1	367	2	0			c.G4465A						scavenged	.	C	ARG/GLY,ARG/GLY	0,1384		0,0,692	172.0	158.0	162.0		1132,4465	5.1	1.0	18		162	1,3181		0,1,1590	yes	missense,missense	LOXHD1	NM_001145472.2,NM_144612.6	125,125	0,1,2282	TT,TC,CC		0.0314,0.0,0.0219	probably-damaging,probably-damaging	378/1115,1489/2212	44109205	1,4565	692	1591	2283	SO:0001583	missense	125336	exon29			TGTCCCCGAGGTC	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.3631G>A	18.37:g.44109205C>T	ENSP00000381707:p.Gly1211Arg	Somatic	286	0	0		WXS	Illumina HiSeq	Phase_I	287	6	0.0209059	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	ENST00000398722.4	37		.	.	.	.	.	.	.	.	.	.	C	16.90	3.250381	0.59212	0.0	3.14E-4	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730	T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71	5.09	5.09	0.68999	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.049843	0.85682	N	0.000000	D	0.83889	0.5352	M	0.73319	2.225	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;1.0	D	0.85677	0.1298	10	0.87932	D	0	.	18.4563	0.90721	0.0:1.0:0.0:0.0	.	1489;422;1211;1211	F5GZB4;F8WA52;Q8IVV2-2;Q8IVV2	.;.;.;LOXH1_HUMAN	R	378;1211;1489;422;1211	ENSP00000300591:G378R;ENSP00000381707:G1211R;ENSP00000444586:G1489R;ENSP00000409062:G422R	ENSP00000300591:G378R	G	-	1	0	LOXHD1	42363203	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.544000	0.82117	2.538000	0.85594	0.561000	0.74099	GGG	.	.	weak		0.567	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
NCAPD3	23310	hgsc.bcm.edu	37	11	134054582	134054582	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:134054582C>T	ENST00000534548.2	-	19	2465	c.2401G>A	c.(2401-2403)Gcc>Acc	p.A801T	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	801					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.A801T(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CTCTGCAAGGCGTCAACAGCT	0.473																																					p.A801T		Atlas-SNP	.											NCAPD3,caecum,carcinoma,0,1	NCAPD3	141	1	1	Substitution - Missense(1)	large_intestine(1)	c.G2401A						scavenged	.						81.0	76.0	78.0					11																	134054582		2201	4297	6498	SO:0001583	missense	23310	exon19			GCAAGGCGTCAAC	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2401G>A	11.37:g.134054582C>T	ENSP00000433681:p.Ala801Thr	Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	130	4	0.0307692	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	0.049	-1.254899	0.01457	.	.	ENSG00000151503	ENST00000534548	T	0.67523	-0.27	5.59	-1.63	0.08345	Armadillo-like helical (1);Armadillo-type fold (1);	0.481174	0.25219	N	0.032244	T	0.29126	0.0724	N	0.02247	-0.625	0.23515	N	0.997515	B	0.09022	0.002	B	0.06405	0.002	T	0.28038	-1.0056	10	0.09084	T	0.74	-7.5009	5.5339	0.17001	0.2728:0.504:0.0:0.2231	.	801	P42695	CNDD3_HUMAN	T	801	ENSP00000433681:A801T	ENSP00000431612:A801T	A	-	1	0	NCAPD3	133559792	0.537000	0.26386	0.041000	0.18516	0.189000	0.23516	0.459000	0.21908	-0.213000	0.10094	-0.150000	0.13652	GCC	.	.	none		0.473	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
NBPF10	100132406	hgsc.bcm.edu	37	1	145296403	145296403	+	Silent	SNP	C	C	T	rs4996269	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:145296403C>T	ENST00000342960.5	+	3	360	c.325C>T	c.(325-327)Cta>Tta	p.L109L	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	109						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GCTGACCCAGCTAAGGGAGAA	0.517																																					p.L109L		Atlas-SNP	.											NBPF10,NS,carcinoma,0,1	NBPF10	221	1	0			c.C325T						scavenged	.																																			SO:0001819	synonymous_variant	100132406	exon3			ACCCAGCTAAGGG	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.325C>T	1.37:g.145296403C>T		Somatic	82	2	0.0243902		WXS	Illumina HiSeq	Phase_I	72	3	0.0416667	NM_001039703	Q5RHC0|Q9NWN6	Silent	SNP	ENST00000342960.5	37	CCDS53355.1																																																																																			T|0.001;G|0.956	0.001	strong		0.517	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
NLRC3	197358	hgsc.bcm.edu	37	16	3614077	3614077	+	RNA	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:3614077C>T	ENST00000301749.7	-	0	1266				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000324659.8_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CGTTAAAGCCCCGGATCTCCG	0.607																																					p.R287R		Atlas-SNP	.											NLRC3,NS,carcinoma,-2,1	NLRC3	103	1	0			c.G861A						PASS	.						47.0	53.0	51.0					16																	3614077		2025	4166	6191			197358	exon5			AAAGCCCCGGATC	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3614077C>T		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	28	11	0.392857	NM_178844	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Silent	SNP	ENST00000301749.7	37																																																																																				.	.	none		0.607	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
NCOA3	8202	hgsc.bcm.edu	37	20	46279860	46279860	+	Silent	SNP	G	G	A	rs151060280	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:46279860G>A	ENST00000371998.3	+	20	3977	c.3786G>A	c.(3784-3786)caG>caA	p.Q1262Q	NCOA3_ENST00000372004.3_Silent_p.Q1258Q|NCOA3_ENST00000341724.6_Silent_p.Q1188Q|NCOA3_ENST00000371997.3_Silent_p.Q1253Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1262	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q1262Q(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcagcagcagcaacagc	0.567																																					p.Q1262Q		Atlas-SNP	.											NCOA3,bladder,carcinoma,0,6	NCOA3	156	6	1	Substitution - coding silent(1)	endometrium(1)	c.G3786A						PASS	.	G	,,,	10,4396	11.4+/-27.6	1,8,2194	53.0	58.0	56.0		3783,3759,3774,3786	-0.1	0.1	20	dbSNP_134	56	12,8588	9.1+/-34.3	0,12,4288	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NCOA3	NM_001174087.1,NM_001174088.1,NM_006534.3,NM_181659.2	,,,	1,20,6482	AA,AG,GG		0.1395,0.227,0.1692	,,,	1261/1424,1253/1416,1258/1421,1262/1425	46279860	22,12984	2203	4300	6503	SO:0001819	synonymous_variant	8202	exon20			GCAGCAGCAGCAA	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3786G>A	20.37:g.46279860G>A		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	82	5	0.0609756	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			G|0.997;A|0.003	0.003	strong		0.567	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
DYSF	8291	hgsc.bcm.edu	37	2	71909727	71909727	+	Missense_Mutation	SNP	C	C	T	rs121908955		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:71909727C>T	ENST00000258104.3	+	54	6401	c.6124C>T	c.(6124-6126)Cgt>Tgt	p.R2042C	DYSF_ENST00000413539.2_Missense_Mutation_p.R2073C|DYSF_ENST00000409366.1_Missense_Mutation_p.R2064C|DYSF_ENST00000409744.1_Missense_Mutation_p.R2050C|DYSF_ENST00000394120.2_Missense_Mutation_p.R2043C|DYSF_ENST00000409651.1_Missense_Mutation_p.R2074C|DYSF_ENST00000409582.3_Missense_Mutation_p.R2080C|DYSF_ENST00000410020.3_Missense_Mutation_p.R2081C|DYSF_ENST00000410041.1_Missense_Mutation_p.R2060C|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000429174.2_Missense_Mutation_p.R2063C|DYSF_ENST00000409762.1_Missense_Mutation_p.R2059C	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	2042			R -> C (in MMD1, LGMD2B and proximodistal myopathy). {ECO:0000269|PubMed:16100712, ECO:0000269|PubMed:16996541, ECO:0000269|PubMed:18853459, ECO:0000269|PubMed:9731526}.		plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CCTGTGGCGGCGTTTCCGGTG	0.582																																					p.R2081C		Atlas-SNP	.											DYSF_ENST00000410020,NS,carcinoma,-1,2	DYSF	536	2	0			c.C6241T	GRCh37	CM980578	DYSF	M	rs121908955	scavenged	.						177.0	127.0	144.0					2																	71909727		2203	4300	6503	SO:0001583	missense	8291	exon55			TGGCGGCGTTTCC	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.6124C>T	2.37:g.71909727C>T	ENSP00000258104:p.Arg2042Cys	Somatic	215	0	0		WXS	Illumina HiSeq	Phase_I	199	4	0.0201005	NM_001130987	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830707	0.71258	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78;-1.78;-1.78;-1.78;-1.78;-1.78;-1.78	5.1	3.16	0.36331	.	0.000000	0.85682	D	0.000000	D	0.90338	0.6977	M	0.84219	2.685	0.58432	A	0.999999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.993;0.999;0.999;0.999;0.999;0.996;0.993;0.998;0.993;0.999;0.983;0.988;0.999;0.999;0.999	D	0.93138	0.6539	9	0.72032	D	0.01	-16.4755	11.5496	0.50713	0.4234:0.5766:0.0:0.0	.	806;2074;2081;2064;2029;2060;2050;2059;2049;2073;2080;2063;2028;2043;2042	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	C	2073;2059;2080;2063;2042;2074;2043;2050;2064;2081;2060	ENSP00000407046:R2073C;ENSP00000387137:R2059C;ENSP00000386547:R2080C;ENSP00000398305:R2063C;ENSP00000258104:R2042C;ENSP00000386683:R2074C;ENSP00000377678:R2043C;ENSP00000386285:R2050C;ENSP00000386512:R2064C;ENSP00000386881:R2081C;ENSP00000386617:R2060C	ENSP00000258104:R2042C	R	+	1	0	DYSF	71763235	0.997000	0.39634	0.994000	0.49952	0.994000	0.84299	1.016000	0.29976	1.232000	0.43678	0.655000	0.94253	CGT	.	.	weak		0.582	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
HECW1	23072	hgsc.bcm.edu	37	7	43283515	43283515	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:43283515A>G	ENST00000395891.2	+	3	616	c.11A>G	c.(10-12)cAc>cGc	p.H4R	HECW1_ENST00000453890.1_Missense_Mutation_p.H4R|AC004692.4_ENST00000457315.1_RNA|AC004692.4_ENST00000458590.1_RNA|AC004692.4_ENST00000458680.1_RNA	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	4					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						ATGCTGCTGCACCTGTGTAGT	0.448																																					p.H4R		Atlas-SNP	.											.	HECW1	540	.	0			c.A11G						PASS	.						235.0	234.0	234.0					7																	43283515		2082	4218	6300	SO:0001583	missense	23072	exon3			TGCTGCACCTGTG	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.11A>G	7.37:g.43283515A>G	ENSP00000379228:p.His4Arg	Somatic	249	0	0		WXS	Illumina HiSeq	Phase_I	222	52	0.234234	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	A	6.186	0.402502	0.11696	.	.	ENSG00000002746	ENST00000395891;ENST00000453890	T;T	0.34472	1.36;1.36	4.67	4.67	0.58626	.	2.499770	0.02291	U	0.070289	T	0.49983	0.1589	N	0.22421	0.69	0.31746	N	0.635233	D;D	0.57899	0.981;0.981	D;D	0.69824	0.966;0.966	T	0.46133	-0.9213	10	0.20519	T	0.43	.	14.1181	0.65167	1.0:0.0:0.0:0.0	.	4;4	B4DH42;Q76N89	.;HECW1_HUMAN	R	4	ENSP00000379228:H4R;ENSP00000407774:H4R	ENSP00000379228:H4R	H	+	2	0	HECW1	43250040	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.982000	0.76173	1.742000	0.51746	0.460000	0.39030	CAC	.	.	none		0.448	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
GAREM	64762	hgsc.bcm.edu	37	18	29850212	29850212	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:29850212G>A	ENST00000269209.6	-	5	1704	c.1701C>T	c.(1699-1701)acC>acT	p.T567T	GAREM_ENST00000399218.4_Silent_p.T567T			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	567					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										AGTAGGACAAGGTGGGGCTGG	0.557																																					p.T567T		Atlas-SNP	.											.	.	.	.	0			c.C1701T						PASS	.						154.0	129.0	137.0					18																	29850212		2203	4300	6503	SO:0001819	synonymous_variant	64762	exon5			GGACAAGGTGGGG	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1701C>T	18.37:g.29850212G>A		Somatic	192	0	0		WXS	Illumina HiSeq	Phase_I	185	53	0.286486	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Silent	SNP	ENST00000269209.6	37	CCDS56057.1																																																																																			.	.	none		0.557	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
LACTB	114294	hgsc.bcm.edu	37	15	63433784	63433784	+	Missense_Mutation	SNP	C	C	T	rs556545187		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:63433784C>T	ENST00000261893.4	+	6	1496	c.1424C>T	c.(1423-1425)tCg>tTg	p.S475L	RPS27L_ENST00000559763.1_Intron	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	475						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						ACGTATGGTTCGTGTAGAAAG	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		20385	0.0		0.0	False		,,,				2504	0.001				p.S475L	Melanoma(85;443 1381 6215 27308 35583)	Atlas-SNP	.											LACTB,NS,carcinoma,-1,1	LACTB	29	1	0			c.C1424T						PASS	.						77.0	66.0	70.0					15																	63433784		2203	4300	6503	SO:0001583	missense	114294	exon6			ATGGTTCGTGTAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.1424C>T	15.37:g.63433784C>T	ENSP00000261893:p.Ser475Leu	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	163	39	0.239264	NM_032857	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	.	.	.	.	.	.	.	.	.	.	C	2.400	-0.337917	0.05278	.	.	ENSG00000103642	ENST00000261893	T	0.40476	1.03	5.64	5.64	0.86602	Beta-lactamase/transpeptidase-like (2);Beta-lactamase-related (1);	0.334872	0.37178	N	0.002209	T	0.20373	0.0490	N	0.22421	0.69	0.23838	N	0.996708	P	0.37500	0.597	B	0.30782	0.12	T	0.17561	-1.0365	10	0.11485	T	0.65	-11.5505	5.3675	0.16121	0.1481:0.6328:0.1427:0.0764	.	475	P83111	LACTB_HUMAN	L	475	ENSP00000261893:S475L	ENSP00000261893:S475L	S	+	2	0	LACTB	61220837	0.996000	0.38824	0.874000	0.34290	0.217000	0.24651	2.416000	0.44644	2.817000	0.96982	0.563000	0.77884	TCG	.	.	none		0.483	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
MUC2	4583	hgsc.bcm.edu	37	11	1093245	1093245	+	Silent	SNP	A	A	T	rs200003195		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:1093245A>T	ENST00000441003.2	+	30	5091	c.5064A>T	c.(5062-5064)ccA>ccT	p.P1688P	MUC2_ENST00000359061.5_Silent_p.P1655P|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccaacacccaccg	0.632																																					p.P1688P		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,2	MUC2	614	2	0			c.A5064T						scavenged	.						88.0	139.0	121.0					11																	1093245		1819	3301	5120	SO:0001819	synonymous_variant	4583	exon30			AACCCCAACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5064A>T	11.37:g.1093245A>T		Somatic	53	5	0.0943396		WXS	Illumina HiSeq	Phase_I	42	8	0.190476	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.	.	weak		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CSDE1	7812	hgsc.bcm.edu	37	1	115275286	115275286	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:115275286C>T	ENST00000358528.4	-	10	1415	c.989G>A	c.(988-990)cGa>cAa	p.R330Q	CSDE1_ENST00000261443.5_Missense_Mutation_p.R299Q|CSDE1_ENST00000530886.1_Missense_Mutation_p.R200Q|CSDE1_ENST00000534699.1_Missense_Mutation_p.R330Q|CSDE1_ENST00000369530.1_Missense_Mutation_p.R345Q|CSDE1_ENST00000339438.6_Missense_Mutation_p.R299Q|CSDE1_ENST00000438362.2_Missense_Mutation_p.R376Q	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	330	CSD 4; truncated.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R330L(1)		NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTGGTTGCTCGCTCTAATTT	0.398																																					p.R376Q		Atlas-SNP	.											CSDE1_ENST00000369530,NS,carcinoma,-1,2	CSDE1	145	2	1	Substitution - Missense(1)	lung(1)	c.G1127A						scavenged	.						180.0	177.0	178.0					1																	115275286		2203	4300	6503	SO:0001583	missense	7812	exon11			GTTGCTCGCTCTA		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.989G>A	1.37:g.115275286C>T	ENSP00000351329:p.Arg330Gln	Somatic	192	0	0		WXS	Illumina HiSeq	Phase_I	234	3	0.0128205	NM_001242891	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	37	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	C	31	5.091403	0.94149	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.73860	0.3641	L	0.57536	1.79	0.80722	D	1	D;D;D	0.71674	0.958;0.997;0.998	B;D;D	0.72982	0.273;0.953;0.979	T	0.74000	-0.3805	9	0.66056	D	0.02	-1.9878	20.2374	0.98362	0.0:1.0:0.0:0.0	.	345;330;376	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	Q	299;376;330;299;200;345;330	.	ENSP00000261443:R299Q	R	-	2	0	CSDE1	115076809	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.787000	0.95880	0.591000	0.81541	CGA	.	.	none		0.398	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158	
ARHGAP8	23779	hgsc.bcm.edu	37	22	45221390	45221390	+	Silent	SNP	C	C	T	rs368897846		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:45221390C>T	ENST00000389774.2	+	8	747	c.606C>T	c.(604-606)caC>caT	p.H202H	ARHGAP8_ENST00000389773.5_Silent_p.H293H|PRR5-ARHGAP8_ENST00000352766.7_Silent_p.H381H|ARHGAP8_ENST00000517296.3_Silent_p.H381H|PRR5-ARHGAP8_ENST00000361473.5_Silent_p.H302H|ARHGAP8_ENST00000356099.6_Silent_p.H171H|ARHGAP8_ENST00000336963.4_Silent_p.H171H	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	202					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.H202Q(1)|p.H207Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		AGAGCCTGCACGAGGGCCGGA	0.662																																					p.H293H		Atlas-SNP	.											PRR5-ARHGAP8,NS,carcinoma,0,2	PRR5-ARHGAP8	53	2	2	Substitution - Missense(2)	lung(2)	c.C879T						PASS	.	C	,,,	0,4404		0,0,2202	35.0	37.0	36.0		606,513,879,513	1.0	0.0	22		36	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ARHGAP8,PRR5-ARHGAP8	NM_001017526.1,NM_001198726.1,NM_181334.4,NM_181335.2	,,,	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	,,,	202/465,171/306,293/556,171/434	45221390	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	553158	exon10			CCTGCACGAGGGC	AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.606C>T	22.37:g.45221390C>T		Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	99	18	0.181818	NM_181334	A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Silent	SNP	ENST00000389774.2	37	CCDS33664.1	.	.	.	.	.	.	.	.	.	.	c	4.721	0.134002	0.09032	0.0	1.16E-4	ENSG00000248405	ENST00000515632	.	.	.	4.46	1.03	0.20045	.	.	.	.	.	T	0.33498	0.0865	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26744	-1.0094	4	.	.	.	.	8.4748	0.33007	0.3768:0.4931:0.1301:0.0	.	.	.	.	M	225	.	.	T	+	2	0	PRR5-ARHGAP8	43600054	0.233000	0.23772	0.026000	0.17262	0.101000	0.19017	0.419000	0.21247	1.055000	0.40461	0.556000	0.70494	ACG	.	.	weak		0.662	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701	
HECW2	57520	hgsc.bcm.edu	37	2	197090577	197090577	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:197090577C>T	ENST00000260983.3	-	23	4117	c.3935G>A	c.(3934-3936)aGg>aAg	p.R1312K	HECW2_ENST00000409111.1_Missense_Mutation_p.R956K	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1312	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						ACCAAGGATCCTACCACTGAA	0.423																																					p.R1312K		Atlas-SNP	.											HECW2,colon,carcinoma,0,1	HECW2	239	1	0			c.G3935A						scavenged	.						130.0	103.0	112.0					2																	197090577		2203	4300	6503	SO:0001583	missense	57520	exon23			AGGATCCTACCAC	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3935G>A	2.37:g.197090577C>T	ENSP00000260983:p.Arg1312Lys	Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	158	2	0.0126582	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	34	5.406414	0.96051	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.55588	0.51;0.51	5.17	5.17	0.71159	HECT (4);	0.102624	0.64402	D	0.000002	T	0.69682	0.3138	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.71745	-0.4500	10	0.87932	D	0	.	18.8684	0.92303	0.0:1.0:0.0:0.0	.	1312	Q9P2P5	HECW2_HUMAN	K	956;1312	ENSP00000386775:R956K;ENSP00000260983:R1312K	ENSP00000260983:R1312K	R	-	2	0	HECW2	196798822	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.320000	0.79064	2.701000	0.92244	0.561000	0.74099	AGG	.	.	none		0.423	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
RAF1	5894	hgsc.bcm.edu	37	3	12645694	12645694	+	Missense_Mutation	SNP	A	A	G	rs3730271		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:12645694A>G	ENST00000251849.4	-	7	1214	c.775T>C	c.(775-777)Tcc>Ccc	p.S259P	RAF1_ENST00000542177.1_Missense_Mutation_p.S178P|RAF1_ENST00000534997.1_Missense_Mutation_p.S44P|RAF1_ENST00000442415.2_Missense_Mutation_p.S259P	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	259			S -> A (in an ovarian serous carcinoma sample; somatic mutation; increased ERK activation). {ECO:0000269|PubMed:17344846}.|S -> F (in NS5). {ECO:0000269|PubMed:17603483}.		activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S259A(1)	ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	TTAGGTGTGGATGTCGACCTC	0.512			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.S259P		Atlas-SNP	.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	RAF1,caecum,carcinoma,0,3	RAF1	66	3	1	Substitution - Missense(1)	ovary(1)	c.T775C	GRCh37	CM086899	RAF1	M	rs3730271	PASS	.						155.0	138.0	144.0					3																	12645694		2203	4300	6503	SO:0001583	missense	5894	exon7	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GTGTGGATGTCGA	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.775T>C	3.37:g.12645694A>G	ENSP00000251849:p.Ser259Pro	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	165	37	0.224242	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.111444	0.56398	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	T;T;T;T;T	0.77877	-1.1;-1.13;-1.06;-0.98;-1.08	5.73	5.73	0.89815	.	0.094049	0.85682	D	0.000000	D	0.88288	0.6396	M	0.81802	2.56	0.80722	D	1	P;D;B	0.76494	0.633;0.999;0.205	B;D;B	0.70487	0.349;0.969;0.111	D	0.89783	0.3962	10	0.87932	D	0	.	16.3123	0.82883	1.0:0.0:0.0:0.0	rs3730271;rs3730271	178;44;259	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	P	259;259;138;44;178	ENSP00000251849:S259P;ENSP00000401888:S259P;ENSP00000398591:S138P;ENSP00000441186:S44P;ENSP00000443567:S178P	ENSP00000251849:S259P	S	-	1	0	RAF1	12620694	1.000000	0.71417	0.984000	0.44739	0.289000	0.27227	9.282000	0.95840	2.308000	0.77769	0.533000	0.62120	TCC	A|1.000;|0.000	.	weak		0.512	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
PIK3CA	5290	hgsc.bcm.edu	37	3	178916936	178916936	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:178916936G>T	ENST00000263967.3	+	2	480	c.323G>T	c.(322-324)cGt>cTt	p.R108L		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	108					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.R108H(11)|p.R108L(2)|p.G106_R108delGNR(2)|p.G106_R108del(2)|p.R108P(1)|p.R108del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GTAGGCAACCGTGAAGAAAAG	0.338		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.R108L	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,colon,carcinoma,0,39	PIK3CA	8460	39	19	Substitution - Missense(14)|Deletion - In frame(5)	endometrium(7)|large_intestine(5)|lung(4)|breast(2)|central_nervous_system(1)	c.G323T						scavenged	.						87.0	82.0	84.0					3																	178916936		1822	4071	5893	SO:0001583	missense	5290	exon2			GCAACCGTGAAGA		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.323G>T	3.37:g.178916936G>T	ENSP00000263967:p.Arg108Leu	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	59	3	0.0508475	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.594124	0.86953	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.74002	0.83;-0.8	5.52	5.52	0.82312	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	T	0.81545	0.4845	M	0.64404	1.975	0.80722	D	1	D	0.56035	0.974	P	0.54460	0.753	T	0.80502	-0.1354	9	.	.	.	-11.9048	19.4271	0.94746	0.0:0.0:1.0:0.0	.	108	P42336	PK3CA_HUMAN	L	108	ENSP00000263967:R108L;ENSP00000417479:R108L	.	R	+	2	0	PIK3CA	180399630	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.630000	0.83225	2.584000	0.87258	0.555000	0.69702	CGT	.	.	none		0.338	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
KCNA10	3744	hgsc.bcm.edu	37	1	111060343	111060343	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:111060343C>T	ENST00000369771.2	-	1	1454	c.1067G>A	c.(1066-1068)cGc>cAc	p.R356H		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	356					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	CTTGGAGTGGCGCGAGAGCTT	0.572																																					p.R356H		Atlas-SNP	.											KCNA10,NS,carcinoma,-1,2	KCNA10	92	2	0			c.G1067A						scavenged	.						112.0	107.0	109.0					1																	111060343		2203	4300	6503	SO:0001583	missense	3744	exon1			GAGTGGCGCGAGA	U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.1067G>A	1.37:g.111060343C>T	ENSP00000358786:p.Arg356His	Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	166	2	0.0120482	NM_005549		Missense_Mutation	SNP	ENST00000369771.2	37	CCDS826.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.364565	0.82463	.	.	ENSG00000143105	ENST00000369771	D	0.98602	-5.02	5.63	5.63	0.86233	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99245	0.9737	M	0.92555	3.32	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.99414	1.0931	10	0.87932	D	0	.	18.3064	0.90184	0.0:1.0:0.0:0.0	.	356	Q16322	KCA10_HUMAN	H	356	ENSP00000358786:R356H	ENSP00000358786:R356H	R	-	2	0	KCNA10	110861866	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	7.815000	0.86186	2.676000	0.91093	0.558000	0.71614	CGC	.	.	none		0.572	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1	NM_005549	
ZNF585B	92285	hgsc.bcm.edu	37	19	37677388	37677388	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:37677388C>T	ENST00000532828.2	-	5	1302	c.1051G>A	c.(1051-1053)Gag>Aag	p.E351K	ZNF585B_ENST00000527838.1_3'UTR|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000531805.1_Missense_Mutation_p.E296K|ZNF585B_ENST00000312908.5_5'UTR	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	351					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAAGATTTCTCTCTACTTTGA	0.398																																					p.E351K	Melanoma(93;882 1454 18863 28917 48427)	Atlas-SNP	.											ZNF585B,NS,carcinoma,+2,2	ZNF585B	91	2	0			c.G1051A						scavenged	.						124.0	118.0	120.0					19																	37677388		2203	4300	6503	SO:0001583	missense	92285	exon5			ATTTCTCTCTACT	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.1051G>A	19.37:g.37677388C>T	ENSP00000433773:p.Glu351Lys	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	133	2	0.0150376	NM_152279	Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	37	CCDS12500.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432432	0.62844	.	.	ENSG00000245680	ENST00000531805;ENST00000532828	T;T	0.41065	1.01;1.01	2.93	2.93	0.34026	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38005	N	0.001847	T	0.47783	0.1464	L	0.28054	0.825	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.77557	0.99;0.947	T	0.47935	-0.9078	10	0.51188	T	0.08	.	11.5938	0.50962	0.0:1.0:0.0:0.0	.	296;351	E9PQH3;Q52M93	.;Z585B_HUMAN	K	296;351	ENSP00000436774:E296K;ENSP00000433773:E351K	ENSP00000436774:E296K	E	-	1	0	ZNF585B	42369228	0.997000	0.39634	0.942000	0.38095	0.483000	0.33249	4.324000	0.59228	1.623000	0.50342	0.455000	0.32223	GAG	.	.	none		0.398	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279	
ZFHX4	79776	hgsc.bcm.edu	37	8	77776035	77776035	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:77776035A>T	ENST00000521891.2	+	11	10533	c.10085A>T	c.(10084-10086)gAt>gTt	p.D3362V	ZFHX4_ENST00000518282.1_Missense_Mutation_p.D3336V|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D3317V|ZFHX4_ENST00000050961.6_Missense_Mutation_p.D3313V	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3313					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AACTCCAACGATGCTTCAGAA	0.433										HNSCC(33;0.089)																											p.D3362V		Atlas-SNP	.											.	ZFHX4	878	.	0			c.A10085T						PASS	.						21.0	21.0	21.0					8																	77776035		1851	3991	5842	SO:0001583	missense	79776	exon11			CCAACGATGCTTC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10085A>T	8.37:g.77776035A>T	ENSP00000430497:p.Asp3362Val	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	48	8	0.166667	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	2.721	-0.266537	0.05754	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.54479	0.57;0.62;0.61;0.58	4.5	4.5	0.54988	.	0.932477	0.08819	U	0.889077	T	0.39989	0.1099	N	0.11560	0.145	0.48762	D	0.999701	B	0.20459	0.045	B	0.25614	0.062	T	0.17745	-1.0359	10	0.72032	D	0.01	.	13.9762	0.64275	1.0:0.0:0.0:0.0	.	3317	Q86UP3-4	.	V	3362;3346;3317;3313;3336	ENSP00000430497:D3362V;ENSP00000399605:D3317V;ENSP00000050961:D3313V;ENSP00000430848:D3336V	ENSP00000050961:D3313V	D	+	2	0	ZFHX4	77938590	1.000000	0.71417	0.644000	0.29465	0.313000	0.28021	7.047000	0.76599	1.907000	0.55213	0.496000	0.49642	GAT	.	.	none		0.433	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
FBXL7	23194	hgsc.bcm.edu	37	5	15928178	15928178	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:15928178C>A	ENST00000504595.1	+	3	788	c.307C>A	c.(307-309)Ctc>Atc	p.L103I	FBXL7_ENST00000329673.7_Missense_Mutation_p.L91I|FBXL7_ENST00000510662.1_Missense_Mutation_p.L56I	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	103					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						GCTCATCCGGCTCGCCTCCAG	0.677																																					p.L103I		Atlas-SNP	.											FBXL7,NS,carcinoma,-2,1	FBXL7	138	1	0			c.C307A						PASS	.						19.0	25.0	23.0					5																	15928178		2032	4180	6212	SO:0001583	missense	23194	exon3			ATCCGGCTCGCCT	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.307C>A	5.37:g.15928178C>A	ENSP00000423630:p.Leu103Ile	Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	54	15	0.277778	NM_012304	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.486928	0.26686	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.10573	2.89;2.86;2.89	5.52	4.65	0.58169	.	0.324591	0.29868	N	0.011000	T	0.06781	0.0173	N	0.19112	0.55	0.38780	D	0.954745	B	0.09022	0.002	B	0.04013	0.001	T	0.26467	-1.0102	10	0.37606	T	0.19	.	6.5028	0.22178	0.1505:0.7051:0.0:0.1444	.	103	Q9UJT9	FBXL7_HUMAN	I	103;56;91	ENSP00000423630:L103I;ENSP00000425184:L56I;ENSP00000329632:L91I	ENSP00000329632:L91I	L	+	1	0	FBXL7	15981178	0.998000	0.40836	0.893000	0.35052	0.928000	0.56348	1.263000	0.33004	1.324000	0.45282	-0.311000	0.09066	CTC	.	.	none		0.677	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
DOCK3	1795	hgsc.bcm.edu	37	3	51394558	51394558	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:51394558G>A	ENST00000266037.9	+	44	4692	c.4669G>A	c.(4669-4671)Gca>Aca	p.A1557T		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1557	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TGGAGGCATTGCACGCTATCA	0.522																																					p.A1557T		Atlas-SNP	.											.	DOCK3	397	.	0			c.G4669A						PASS	.						100.0	94.0	96.0					3																	51394558		2067	4226	6293	SO:0001583	missense	1795	exon44			GGCATTGCACGCT	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4669G>A	3.37:g.51394558G>A	ENSP00000266037:p.Ala1557Thr	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	93	23	0.247312	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.135619	0.56828	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.17370	2.28	5.84	5.84	0.93424	.	0.052235	0.85682	D	0.000000	T	0.16599	0.0399	L	0.38838	1.175	0.58432	D	0.999998	B	0.26672	0.156	B	0.29267	0.1	T	0.03130	-1.1069	10	0.34782	T	0.22	.	14.9171	0.70807	0.0:0.0:0.8569:0.1431	.	1557	Q8IZD9	DOCK3_HUMAN	T	1557;353	ENSP00000266037:A1557T	ENSP00000266037:A1557T	A	+	1	0	DOCK3	51369598	1.000000	0.71417	0.861000	0.33841	0.989000	0.77384	7.871000	0.87180	2.765000	0.95021	0.655000	0.94253	GCA	.	.	none		0.522	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
UGT1A9	54600	hgsc.bcm.edu	37	2	234580967	234580967	+	Silent	SNP	A	A	G	rs28946876	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:234580967A>G	ENST00000354728.4	+	1	469	c.387A>G	c.(385-387)aaA>aaG	p.K129K	UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Silent_p.K129K|UGT1A1_ENST00000373450.4_Intron			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	129					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	GTTTGTTTAAAGACAAAAAAT	0.313																																					p.K129K		Atlas-SNP	.											UGT1A9,colon,carcinoma,0,1	UGT1A9	79	1	0			c.A387G						scavenged	.						99.0	101.0	101.0					2																	234580967		2203	4300	6503	SO:0001819	synonymous_variant	54600	exon1			GTTTAAAGACAAA	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.387A>G	2.37:g.234580967A>G		Somatic	88	1	0.0113636		WXS	Illumina HiSeq	Phase_I	119	8	0.0672269	NM_021027	B8K285|P36509|Q9HAX0	Silent	SNP	ENST00000354728.4	37	CCDS2505.1																																																																																			.	.	alt		0.313	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
SLC16A7	9194	hgsc.bcm.edu	37	12	60173423	60173423	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:60173423C>T	ENST00000261187.4	+	5	1564	c.1400C>T	c.(1399-1401)gCa>gTa	p.A467V	SLC16A7_ENST00000552024.1_Missense_Mutation_p.A467V|SLC16A7_ENST00000552432.1_Missense_Mutation_p.A467V|SLC16A7_ENST00000547379.1_Missense_Mutation_p.A467V|SLC16A7_ENST00000543448.1_Missense_Mutation_p.A368V	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	467					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	GTTTCAAATGCACAGAGTGTA	0.358																																					p.A467V		Atlas-SNP	.											.	SLC16A7	82	.	0			c.C1400T						PASS	.						75.0	72.0	73.0					12																	60173423		2203	4300	6503	SO:0001583	missense	9194	exon6			CAAATGCACAGAG	AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.1400C>T	12.37:g.60173423C>T	ENSP00000261187:p.Ala467Val	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	97	4	0.0412371	NM_001270622	Q8NEM3|Q9UPB3	Missense_Mutation	SNP	ENST00000261187.4	37	CCDS8961.1	.	.	.	.	.	.	.	.	.	.	C	9.231	1.035740	0.19590	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000261187;ENST00000543448	T;T;T;T;T	0.17691	2.4;2.4;2.4;2.4;2.26	5.05	1.63	0.23807	.	4.485940	0.00687	N	0.000717	T	0.09774	0.0240	N	0.11560	0.145	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.23119	-1.0197	9	.	.	.	.	4.8693	0.13624	0.0:0.5139:0.1597:0.3264	.	467	O60669	MOT2_HUMAN	V	467;467;467;467;368	ENSP00000449547:A467V;ENSP00000448071:A467V;ENSP00000448742:A467V;ENSP00000261187:A467V;ENSP00000443731:A368V	.	A	+	2	0	SLC16A7	58459690	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	0.432000	0.21461	0.622000	0.30249	0.467000	0.42956	GCA	.	.	none		0.358	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731	
HDLBP	3069	hgsc.bcm.edu	37	2	242192901	242192901	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:242192901C>T	ENST00000391975.1	-	10	1427	c.1200G>A	c.(1198-1200)gaG>gaA	p.E400E	HDLBP_ENST00000391976.2_Silent_p.E400E|HDLBP_ENST00000310931.4_Silent_p.E400E|HDLBP_ENST00000476807.1_5'Flank|HDLBP_ENST00000427183.2_Silent_p.E367E	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	400	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CCTCTGTGAACTCGATGTGAA	0.527																																					p.E400E		Atlas-SNP	.											HDLBP,caecum,carcinoma,-2,1	HDLBP	118	1	0			c.G1200A						scavenged	.						164.0	142.0	150.0					2																	242192901		2203	4300	6503	SO:0001819	synonymous_variant	3069	exon10			TGTGAACTCGATG		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1200G>A	2.37:g.242192901C>T		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	140	4	0.0285714	NM_005336	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Silent	SNP	ENST00000391975.1	37	CCDS2547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.161|9.161	1.018677|1.018677	0.19355|0.19355	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000453141|ENST00000373292	.|.	.|.	.|.	5.76|5.76	3.73|3.73	0.42828|0.42828	.|.	.|.	.|.	.|.	.|.	T|T	0.55481|0.55481	0.1923|0.1923	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.52510|0.52510	-0.8566|-0.8566	4|4	.|.	.|.	.|.	-26.6763|-26.6763	6.34|6.34	0.21316|0.21316	0.0:0.6769:0.0:0.3231|0.0:0.6769:0.0:0.3231	.|.	.|.	.|.	.|.	N|I	278|209	.|.	.|.	S|V	-|-	2|1	0|0	HDLBP|HDLBP	241841574|241841574	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.886000|0.886000	0.51366|0.51366	1.341000|1.341000	0.33907|0.33907	1.447000|1.447000	0.47661|0.47661	0.655000|0.655000	0.94253|0.94253	AGT|GTT	.	.	none		0.527	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12907708	12907708	+	Silent	SNP	A	A	G	rs4026149	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:12907708A>G	ENST00000317869.6	-	2	660	c.435T>C	c.(433-435)cgT>cgC	p.R145R		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	145						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						ATAGACGTTGACGTTTCGAGG	0.483																																					p.R145R		Atlas-SNP	.											HNRNPCL1,NS,carcinoma,-1,1	HNRNPCL1	68	1	0			c.T435C						scavenged	.						120.0	124.0	122.0					1																	12907708		2201	4297	6498	SO:0001819	synonymous_variant	343069	exon2			ACGTTGACGTTTC	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.435T>C	1.37:g.12907708A>G		Somatic	267	14	0.0524345		WXS	Illumina HiSeq	Phase_I	330	19	0.0575758	NM_001013631	B2RP44	Silent	SNP	ENST00000317869.6	37	CCDS30591.1																																																																																			A|0.667;G|0.333	0.333	strong		0.483	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
POM121C	100101267	hgsc.bcm.edu	37	7	75050842	75050842	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:75050842G>A	ENST00000257665.5	-	11	3418	c.3419C>T	c.(3418-3420)cCg>cTg	p.P1140L	POM121C_ENST00000453279.2_Missense_Mutation_p.P898L|POM121C_ENST00000473168.1_5'Flank			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	1140	Pore side. {ECO:0000255}.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						GAAGGCAAACGGTGTGCTCTG	0.607																																					p.P898L		Atlas-SNP	.											POM121C,NS,carcinoma,0,1	POM121C	46	1	0			c.C2693T						scavenged	.						9.0	13.0	12.0					7																	75050842		2145	4273	6418	SO:0001583	missense	100101267	exon13			GCAAACGGTGTGC		CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.3419C>T	7.37:g.75050842G>A	ENSP00000257665:p.Pro1140Leu	Somatic	318	0	0		WXS	Illumina HiSeq	Phase_I	294	3	0.0102041	NM_001099415	O75115|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000257665.5	37		.	.	.	.	.	.	.	.	.	.	G	10.66	1.414049	0.25465	.	.	ENSG00000135213	ENST00000257665;ENST00000453279	T;T	0.27890	3.09;1.64	3.28	2.39	0.29439	.	0.207503	0.24107	N	0.041492	T	0.27384	0.0672	L	0.60455	1.87	0.09310	N	1	P	0.50710	0.938	B	0.40940	0.344	T	0.17471	-1.0368	10	0.87932	D	0	.	8.0747	0.30710	0.1193:0.0:0.8807:0.0	.	1140	A8CG34	P121C_HUMAN	L	1140;898	ENSP00000257665:P1140L;ENSP00000414208:P898L	ENSP00000257665:P1140L	P	-	2	0	POM121C	74888778	0.963000	0.33076	0.001000	0.08648	0.219000	0.24729	4.332000	0.59279	0.484000	0.27630	0.195000	0.17529	CCG	.	.	none		0.607	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000343919.2	NM_001099415	
KATNBL1	79768	hgsc.bcm.edu	37	15	34445143	34445143	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:34445143C>T	ENST00000256544.3	-	4	428	c.286G>A	c.(286-288)Gac>Aac	p.D96N		NM_024713.2	NP_078989.1	Q9H079	KTBL1_HUMAN	katanin p80 subunit B-like 1	96						nucleolus (GO:0005730)											TTTGCCATGTCACAGCCCCCA	0.413																																					p.D96N		Atlas-SNP	.											C15orf29,NS,carcinoma,0,1	.	.	1	0			c.G286A						scavenged	.						97.0	102.0	100.0					15																	34445143		2201	4298	6499	SO:0001583	missense	79768	exon4			CCATGTCACAGCC	AL136908	CCDS10034.1	15q13.2	2012-09-27	2012-09-27	2012-09-27	ENSG00000134152	ENSG00000134152			26199	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 29"""	C15orf29		11230166	Standard	NM_024713		Approved	FLJ22557	uc001zhp.3	Q9H079	OTTHUMG00000129368	ENST00000256544.3:c.286G>A	15.37:g.34445143C>T	ENSP00000256544:p.Asp96Asn	Somatic	173	1	0.00578035		WXS	Illumina HiSeq	Phase_I	193	3	0.015544	NM_024713	A8KAF6|Q2TAC0|Q9H670	Missense_Mutation	SNP	ENST00000256544.3	37	CCDS10034.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.676144	0.47886	.	.	ENSG00000134152	ENST00000256544	.	.	.	5.47	4.54	0.55810	.	0.322034	0.36338	N	0.002651	T	0.37544	0.1007	N	0.11560	0.145	0.41592	D	0.988803	B	0.02656	0.0	B	0.06405	0.002	T	0.21008	-1.0258	9	0.36615	T	0.2	.	12.9194	0.58224	0.0:0.8676:0.0:0.1324	.	96	Q9H079	CO029_HUMAN	N	96	.	ENSP00000256544:D96N	D	-	1	0	C15orf29	32232435	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.627000	0.54252	2.572000	0.86782	0.655000	0.94253	GAC	.	.	none		0.413	KATNBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251520.1	NM_024713	
MME	4311	hgsc.bcm.edu	37	3	154858001	154858001	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:154858001C>T	ENST00000460393.1	+	10	997	c.877C>T	c.(877-879)Cga>Tga	p.R293*	MME_ENST00000493237.1_Nonsense_Mutation_p.R293*|MME_ENST00000360490.2_Nonsense_Mutation_p.R293*|MME_ENST00000492661.1_Nonsense_Mutation_p.R293*|MME_ENST00000462745.1_Nonsense_Mutation_p.R293*	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	293					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	ACCTGAAGATCGAAATGATCC	0.303																																					p.R293X		Atlas-SNP	.											MME,colon,carcinoma,-1,2	MME	133	2	0			c.C877T						scavenged	.						75.0	69.0	71.0					3																	154858001		2203	4300	6503	SO:0001587	stop_gained	4311	exon10			GAAGATCGAAATG		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.877C>T	3.37:g.154858001C>T	ENSP00000418525:p.Arg293*	Somatic	116	2	0.0172414		WXS	Illumina HiSeq	Phase_I	149	3	0.0201342	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Nonsense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	C	34	5.397259	0.96009	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	.	.	.	5.23	2.07	0.26955	.	0.140473	0.45867	D	0.000338	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.4936	13.5191	0.61557	0.6899:0.3101:0.0:0.0	.	.	.	.	X	293	.	ENSP00000353679:R293X	R	+	1	2	MME	156340695	0.996000	0.38824	0.998000	0.56505	0.704000	0.40688	1.308000	0.33528	0.609000	0.30018	0.655000	0.94253	CGA	.	.	none		0.303	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
HLA-A	3105	hgsc.bcm.edu	37	6	29910335	29910335	+	Missense_Mutation	SNP	C	C	T	rs200058378		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:29910335C>T	ENST00000396634.1	+	3	346	c.5C>T	c.(4-6)gCc>gTc	p.A2V	HLA-A_ENST00000376802.2_Missense_Mutation_p.A2V|HLA-A_ENST00000376809.5_Missense_Mutation_p.A2V|HLA-A_ENST00000376806.5_Missense_Mutation_p.A2V			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	2					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CCGAGGATGGCCGTCATGGCG	0.672									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.A2V		Atlas-SNP	.											HLA-A,NS,carcinoma,-1,1	HLA-A	89	1	0			c.C5T						scavenged	.						36.0	38.0	37.0					6																	29910335		2201	4296	6497	SO:0001583	missense	3105	exon1	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	GGATGGCCGTCAT	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.5C>T	6.37:g.29910335C>T	ENSP00000379873:p.Ala2Val	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	140	5	0.0357143	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	8.183	0.794292	0.16327	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00662	5.94;5.93;5.94;5.94	2.6	-4.04	0.04010	.	.	.	.	.	T	0.00552	0.0018	L	0.27053	0.805	0.09310	N	1	D;B;D;B	0.76494	0.999;0.003;0.997;0.001	D;B;D;B	0.75484	0.986;0.014;0.986;0.014	T	0.50065	-0.8871	9	0.56958	D	0.05	.	4.6272	0.12484	0.4071:0.1733:0.4196:0.0	.	2;2;2;2	Q5SRN7;P16188;Q5SRN5;P04439	.;1A30_HUMAN;.;1A03_HUMAN	V	2	ENSP00000379873:A2V;ENSP00000366002:A2V;ENSP00000366005:A2V;ENSP00000365998:A2V	ENSP00000348012:A2V	A	+	2	0	HLA-A	30018314	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.890000	0.01613	-0.952000	0.03649	-0.531000	0.04308	GCC	C|0.999;T|0.001	0.001	weak		0.672	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
INPP4A	3631	hgsc.bcm.edu	37	2	99193602	99193602	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:99193602C>T	ENST00000523221.1	+	23	2797	c.2797C>T	c.(2797-2799)Cgc>Tgc	p.R933C	INPP4A_ENST00000409463.1_Missense_Mutation_p.R262C|INPP4A_ENST00000409851.3_Missense_Mutation_p.R928C|INPP4A_ENST00000409540.3_Missense_Mutation_p.R894C|INPP4A_ENST00000409016.4_Missense_Mutation_p.R894C|INPP4A_ENST00000074304.5_Missense_Mutation_p.R933C|INPP4A_ENST00000545415.1_Missense_Mutation_p.R894C			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	933					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						GGAGTGCATGCGCAGGTGAGT	0.677																																					p.R933C		Atlas-SNP	.											INPP4A_ENST00000409540,NS,carcinoma,0,3	INPP4A	205	3	0			c.C2797T						scavenged	.						22.0	25.0	24.0					2																	99193602		2130	4228	6358	SO:0001583	missense	3631	exon25			TGCATGCGCAGGT	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.2797C>T	2.37:g.99193602C>T	ENSP00000427722:p.Arg933Cys	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	61	2	0.0327869	NM_001134224	O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	ENST00000523221.1	37	CCDS46369.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313426	0.81358	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000409463;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T;T	0.63096	0.37;0.76;-0.02;0.76;0.37;0.4;0.76	4.71	3.76	0.43208	.	0.052546	0.85682	D	0.000000	T	0.81004	0.4733	M	0.89601	3.045	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.998;1.0;0.999;0.999	D	0.84449	0.0587	10	0.87932	D	0	-17.0482	12.1237	0.53905	0.2186:0.7814:0.0:0.0	.	894;894;262;933;928	Q96PE3-2;Q96PE3-4;B8ZZB2;Q96PE3;Q96PE3-3	.;.;.;INP4A_HUMAN;.	C	894;928;262;933;894;894;933	ENSP00000386704:R894C;ENSP00000386777:R928C;ENSP00000386329:R262C;ENSP00000074304:R933C;ENSP00000442149:R894C;ENSP00000387294:R894C;ENSP00000427722:R933C	ENSP00000074304:R933C	R	+	1	0	INPP4A	98560034	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.116000	0.50399	2.460000	0.83146	0.462000	0.41574	CGC	.	.	none		0.677	INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376095.1	NM_001566	
NCOA3	8202	hgsc.bcm.edu	37	20	46279827	46279827	+	Silent	SNP	G	G	A	rs6018623	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:46279827G>A	ENST00000371998.3	+	20	3944	c.3753G>A	c.(3751-3753)caG>caA	p.Q1251Q	NCOA3_ENST00000372004.3_Silent_p.Q1247Q|NCOA3_ENST00000341724.6_Silent_p.Q1177Q|NCOA3_ENST00000371997.3_Silent_p.Q1242Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1251	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcagcagcagcagcaac	0.552													G|||	876	0.17492	0.1906	0.1571	5008	,	,		14950	0.1617		0.1928	False		,,,				2504	0.1616				p.Q1251Q		Atlas-SNP	.											.	NCOA3	156	.	0			c.G3753A						PASS	.	G	,,,	850,3556	326.4+/-299.6	85,680,1438	49.0	55.0	53.0		3750,3726,3741,3753	4.4	1.0	20	dbSNP_114	53	959,7641	191.8+/-238.0	90,779,3431	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NCOA3	NM_001174087.1,NM_001174088.1,NM_006534.3,NM_181659.2	,,,	175,1459,4869	AA,AG,GG		11.1512,19.2919,13.909	,,,	1250/1424,1242/1416,1247/1421,1251/1425	46279827	1809,11197	2203	4300	6503	SO:0001819	synonymous_variant	8202	exon20			GCAGCAGCAGCAG	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3753G>A	20.37:g.46279827G>A		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	78	24	0.307692	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			G|0.861;A|0.139	0.139	strong		0.552	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
RHPN2	85415	hgsc.bcm.edu	37	19	33493200	33493200	+	Missense_Mutation	SNP	G	G	A	rs200623446	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:33493200G>A	ENST00000254260.3	-	9	1093	c.1058C>T	c.(1057-1059)gCg>gTg	p.A353V	RHPN2_ENST00000400226.4_Missense_Mutation_p.A202V	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	353	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GGCCAGGGCCGCGTAGTGGTG	0.637																																					p.A353V		Atlas-SNP	.											RHPN2,caecum,carcinoma,-1,17	RHPN2	107	17	0			c.C1058T						scavenged	.						50.0	48.0	49.0					19																	33493200		2203	4300	6503	SO:0001583	missense	85415	exon9			AGGGCCGCGTAGT	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1058C>T	19.37:g.33493200G>A	ENSP00000254260:p.Ala353Val	Somatic	131	3	0.0229008		WXS	Illumina HiSeq	Phase_I	127	6	0.0472441	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.276172	0.23307	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.18810	2.19;2.19	4.61	-4.16	0.03869	BRO1 domain (3);	1.055030	0.07227	N	0.861852	T	0.14830	0.0358	L	0.39898	1.24	0.09310	N	1	B	0.18013	0.025	B	0.15484	0.013	T	0.36114	-0.9761	10	0.30078	T	0.28	0.2931	7.8623	0.29517	0.0:0.2524:0.4684:0.2792	.	353	Q8IUC4	RHPN2_HUMAN	V	353;83;202	ENSP00000254260:A353V;ENSP00000402244:A202V	ENSP00000254260:A353V	A	-	2	0	RHPN2	38185040	0.000000	0.05858	0.001000	0.08648	0.375000	0.29983	0.178000	0.16820	-0.540000	0.06265	0.455000	0.32223	GCG	G|0.935;A|0.065	0.065	strong		0.637	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
NBEA	26960	hgsc.bcm.edu	37	13	36167546	36167546	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:36167546T>A	ENST00000400445.3	+	47	7792	c.7258T>A	c.(7258-7260)Tct>Act	p.S2420T	NBEA_ENST00000379939.2_Missense_Mutation_p.S2417T|NBEA_ENST00000310336.4_Missense_Mutation_p.S2420T|NBEA_ENST00000379922.3_5'UTR|NBEA_ENST00000537702.1_Missense_Mutation_p.S213T|NBEA_ENST00000540320.1_Missense_Mutation_p.S2420T	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2420	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026, ECO:0000305}.				protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CGTTGCAAGGTCTTGGAGAAC	0.333																																					p.S2420T		Atlas-SNP	.											NBEA,NS,carcinoma,-1,1	NBEA	340	1	0			c.T7258A						scavenged	.						138.0	124.0	128.0					13																	36167546		1840	4086	5926	SO:0001583	missense	26960	exon47			GCAAGGTCTTGGA	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.7258T>A	13.37:g.36167546T>A	ENSP00000383295:p.Ser2420Thr	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	90	3	0.0333333	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	T	17.26	3.345069	0.61073	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000543274;ENST00000537702	T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07	5.78	5.78	0.91487	BEACH domain (4);	0.000000	0.85682	D	0.000000	T	0.40645	0.1125	N	0.16478	0.41	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.10450	0.002;0.005	T	0.32693	-0.9897	10	0.08381	T	0.77	.	16.0914	0.81091	0.0:0.0:0.0:1.0	.	2420;2417	Q8NFP9;Q5T321	NBEA_HUMAN;.	T	2420;2420;2417;2420;1047;213;213	ENSP00000440951:S2420T;ENSP00000383295:S2420T;ENSP00000369271:S2417T;ENSP00000308534:S2420T;ENSP00000440233:S213T	ENSP00000308534:S2420T	S	+	1	0	NBEA	35065546	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	7.609000	0.82925	2.200000	0.70718	0.455000	0.32223	TCT	.	.	none		0.333	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
MTOR	2475	hgsc.bcm.edu	37	1	11174434	11174434	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:11174434A>G	ENST00000361445.4	-	53	7317	c.7241T>C	c.(7240-7242)gTc>gCc	p.V2414A	MTOR_ENST00000376838.1_Missense_Mutation_p.V619A	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2414	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CACGGCCATGACACTGTCCTT	0.542																																					p.V2414A		Atlas-SNP	.											MTOR,NS,lymphoid_neoplasm,-1,1	MTOR	327	1	0			c.T7241C						scavenged	.						163.0	133.0	143.0					1																	11174434		2203	4300	6503	SO:0001583	missense	2475	exon53			GCCATGACACTGT	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7241T>C	1.37:g.11174434A>G	ENSP00000354558:p.Val2414Ala	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	149	5	0.033557	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	A	34	5.307021	0.95629	.	.	ENSG00000198793	ENST00000361445;ENST00000376838;ENST00000455339	D;D;D	0.81821	-1.54;-1.54;-1.54	5.89	5.89	0.94794	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.86932	0.6052	M	0.78637	2.42	0.80722	D	1	P	0.50710	0.938	P	0.53450	0.726	D	0.88639	0.3174	10	0.87932	D	0	-11.6488	15.497	0.75662	1.0:0.0:0.0:0.0	.	2414	P42345	MTOR_HUMAN	A	2414;619;70	ENSP00000354558:V2414A;ENSP00000366034:V619A;ENSP00000398745:V70A	ENSP00000354558:V2414A	V	-	2	0	MTOR	11097021	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.923000	0.92808	2.254000	0.74563	0.533000	0.62120	GTC	.	.	none		0.542	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
CDH10	1008	hgsc.bcm.edu	37	5	24593514	24593514	+	Missense_Mutation	SNP	G	G	A	rs140810299		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:24593514G>A	ENST00000264463.4	-	2	593	c.86C>T	c.(85-87)aCg>aTg	p.T29M	RP11-116O11.1_ENST00000510391.1_RNA	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	29					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TGGCACAGGCGTCCTTCTGAA	0.403										HNSCC(23;0.051)			G|||	1	0.000199681	0.0	0.0	5008	,	,		16405	0.0		0.001	False		,,,				2504	0.0				p.T29M		Atlas-SNP	.											.	CDH10	391	.	0			c.C86T						PASS	.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	105.0	98.0	101.0		86	2.5	1.0	5	dbSNP_134	101	0,8598		0,0,4299	no	missense	CDH10	NM_006727.3	81	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	benign	29/789	24593514	1,13003	2203	4299	6502	SO:0001583	missense	1008	exon2			ACAGGCGTCCTTC	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.86C>T	5.37:g.24593514G>A	ENSP00000264463:p.Thr29Met	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	185	36	0.194595	NM_006727	Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	CCDS3892.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.53	1.375184	0.24857	2.27E-4	0.0	ENSG00000040731	ENST00000264463	T	0.56103	0.48	4.36	2.53	0.30540	.	0.543154	0.19943	N	0.102617	T	0.43897	0.1268	L	0.50333	1.59	0.28771	N	0.900348	B	0.17852	0.024	B	0.14578	0.011	T	0.41787	-0.9489	10	0.45353	T	0.12	.	9.2453	0.37523	0.1795:0.0:0.8205:0.0	.	29	Q9Y6N8	CAD10_HUMAN	M	29	ENSP00000264463:T29M	ENSP00000264463:T29M	T	-	2	0	CDH10	24629271	1.000000	0.71417	0.993000	0.49108	0.503000	0.33858	6.687000	0.74552	0.962000	0.38057	-0.244000	0.11960	ACG	G|1.000;A|0.000	0.000	strong		0.403	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
RBMS3	27303	hgsc.bcm.edu	37	3	29938966	29938966	+	Splice_Site	SNP	G	G	T	rs13060292		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:29938966G>T	ENST00000383767.2	+	9	1224	c.888G>T	c.(886-888)caG>caT	p.Q296H	RBMS3_ENST00000383766.2_Splice_Site_p.Q295H|RBMS3_ENST00000396583.3_Splice_Site_p.Q309H|RBMS3_ENST00000456853.1_Splice_Site_p.Q309H|RBMS3_ENST00000452462.1_Splice_Site_p.Q296H|RBMS3_ENST00000434693.2_Splice_Site_p.Q295H|RBMS3_ENST00000273139.9_Splice_Site_p.Q296H			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	296					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				CCACATACCAGGTATGTCCAA	0.403																																					p.Q309H		Atlas-SNP	.											.	RBMS3	62	.	0			c.G927T						PASS	.						204.0	184.0	191.0					3																	29938966		2203	4300	6503	SO:0001630	splice_region_variant	27303	exon10			ATACCAGGTATGT	AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.888+1G>T	3.37:g.29938966G>T		Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	175	39	0.222857	NM_001177712	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	G	31	5.100850	0.94245	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T	0.30182	1.54;1.59;1.56;1.58;1.67;1.57;1.59	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.61677	0.2366	M	0.85373	2.75	0.80722	D	1	D;D;P;D	0.89917	1.0;0.999;0.756;0.999	D;D;P;D	0.76071	0.987;0.981;0.644;0.971	T	0.66524	-0.5902	9	.	.	.	.	18.754	0.91825	0.0:0.0:1.0:0.0	.	296;309;295;296	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	H	295;309;296;296;295;296;309	ENSP00000395592:Q295H;ENSP00000379828:Q309H;ENSP00000373277:Q296H;ENSP00000273139:Q296H;ENSP00000373276:Q295H;ENSP00000397926:Q296H;ENSP00000400519:Q309H	.	Q	+	3	2	RBMS3	29913970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.433000	0.82419	0.655000	0.94253	CAG	.	.	alt		0.403	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	Missense_Mutation
PRRC2B	84726	hgsc.bcm.edu	37	9	134322483	134322483	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:134322483G>A	ENST00000357304.4	+	7	922	c.867G>A	c.(865-867)ccG>ccA	p.P289P	PRRC2B_ENST00000405995.1_Silent_p.P289P|PRRC2B_ENST00000372249.1_5'Flank|PRRC2B_ENST00000458550.1_Silent_p.P289P	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	289							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TGTGTTCGCCGAAGTCATCAG	0.428																																					p.P289P		Atlas-SNP	.											.	PRRC2B	266	.	0			c.G867A						PASS	.						108.0	103.0	105.0					9																	134322483		1937	4141	6078	SO:0001819	synonymous_variant	84726	exon7			TTCGCCGAAGTCA	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.867G>A	9.37:g.134322483G>A		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	146	25	0.171233	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Silent	SNP	ENST00000357304.4	37	CCDS48044.1																																																																																			.	.	none		0.428	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
BCLAF1	9774	hgsc.bcm.edu	37	6	136582487	136582487	+	Silent	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:136582487T>C	ENST00000531224.1	-	12	2925	c.2673A>G	c.(2671-2673)aaA>aaG	p.K891K	BCLAF1_ENST00000527536.1_Silent_p.K842K|BCLAF1_ENST00000392348.2_Silent_p.K840K|BCLAF1_ENST00000031135.9_Silent_p.K109K|BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000527759.1_Silent_p.K889K|BCLAF1_ENST00000353331.4_Silent_p.K840K|BCLAF1_ENST00000530767.1_Silent_p.K718K	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	891					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CCCCTTGGTATTTGTCATGAG	0.408																																					p.K891K	Colon(142;1534 1789 5427 7063 28491)	Atlas-SNP	.											BCLAF1_ENST00000531224,lower_third,carcinoma,-2,1	BCLAF1	203	1	0			c.A2673G						scavenged	.						237.0	240.0	239.0					6																	136582487		2203	4300	6503	SO:0001819	synonymous_variant	9774	exon12			TTGGTATTTGTCA	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2673A>G	6.37:g.136582487T>C		Somatic	347	0	0		WXS	Illumina HiSeq	Phase_I	354	4	0.0112994	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Silent	SNP	ENST00000531224.1	37	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	T	6.238	0.411983	0.11812	.	.	ENSG00000029363	ENST00000534762	.	.	.	5.5	4.35	0.52113	.	.	.	.	.	T	0.49795	0.1578	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49872	-0.8893	4	.	.	.	-8.6357	11.122	0.48296	0.0:0.0725:0.0:0.9275	.	.	.	.	V	158	.	.	I	-	1	0	BCLAF1	136624180	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.276000	0.43408	0.928000	0.37168	0.533000	0.62120	ATA	.	.	none		0.408	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
ADAMTS18	170692	hgsc.bcm.edu	37	16	77387748	77387748	+	Missense_Mutation	SNP	T	T	C	rs149505308		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:77387748T>C	ENST00000282849.5	-	10	1914	c.1496A>G	c.(1495-1497)aAg>aGg	p.K499R		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	499	Disintegrin.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TCCTGCTTGCTTGGGCTCATC	0.423													T|||	1	0.000199681	0.0008	0.0	5008	,	,		20263	0.0		0.0	False		,,,				2504	0.0				p.K499R		Atlas-SNP	.											ADAMTS18,NS,carcinoma,+1,1	ADAMTS18	270	1	0			c.A1496G						scavenged	.	T	ARG/LYS	14,4382	21.2+/-45.6	1,12,2185	309.0	280.0	290.0		1496	5.2	1.0	16	dbSNP_134	290	0,8600		0,0,4300	yes	missense	ADAMTS18	NM_199355.2	26	1,12,6485	CC,CT,TT		0.0,0.3185,0.1077	benign	499/1222	77387748	14,12982	2198	4300	6498	SO:0001583	missense	170692	exon10			GCTTGCTTGGGCT	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.1496A>G	16.37:g.77387748T>C	ENSP00000282849:p.Lys499Arg	Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	277	5	0.0180505	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.374169	0.42105	0.003185	0.0	ENSG00000140873	ENST00000282849	T	0.03524	3.9	5.22	5.22	0.72569	Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.06096	0.0158	L	0.58101	1.795	0.51767	D	0.999935	B;B	0.18610	0.029;0.023	B;B	0.18263	0.012;0.021	T	0.28299	-1.0048	10	0.29301	T	0.29	.	14.4909	0.67649	0.0:0.0:0.0:1.0	.	499;499	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	R	499	ENSP00000282849:K499R	ENSP00000282849:K499R	K	-	2	0	ADAMTS18	75945249	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.599000	0.61076	2.200000	0.70718	0.524000	0.50904	AAG	T|0.999;C|0.001	0.001	strong		0.423	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
DDX52	11056	hgsc.bcm.edu	37	17	35979827	35979827	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:35979827A>C	ENST00000349699.2	-	13	1678	c.1635T>G	c.(1633-1635)ttT>ttG	p.F545L	DDX52_ENST00000394367.3_Missense_Mutation_p.F437L	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	545	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Lys-rich.					membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				GTAGTTTCTGAAAACCTTTTA	0.338																																					p.F545L		Atlas-SNP	.											.	DDX52	40	.	0			c.T1635G						PASS	.						96.0	99.0	98.0					17																	35979827		2203	4300	6503	SO:0001583	missense	11056	exon13			TTTCTGAAAACCT	AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.1635T>G	17.37:g.35979827A>C	ENSP00000268854:p.Phe545Leu	Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	179	40	0.223464	NM_007010	Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	ENST00000349699.2	37	CCDS11323.1	.	.	.	.	.	.	.	.	.	.	A	4.181	0.032244	0.08101	.	.	ENSG00000141141	ENST00000349699;ENST00000394367	T;T	0.13307	2.6;2.63	5.87	0.492	0.16872	Helicase, C-terminal (1);	0.095278	0.64402	N	0.000001	T	0.02494	0.0076	N	0.01015	-1.05	0.38208	D	0.940389	B	0.02656	0.0	B	0.04013	0.001	T	0.37731	-0.9693	10	0.06365	T	0.9	.	1.6637	0.02797	0.3737:0.1278:0.3671:0.1314	.	545	Q9Y2R4	DDX52_HUMAN	L	545;437	ENSP00000268854:F545L;ENSP00000377893:F437L	ENSP00000268854:F545L	F	-	3	2	DDX52	33053940	0.998000	0.40836	0.991000	0.47740	0.741000	0.42261	0.324000	0.19610	-0.090000	0.12462	-0.242000	0.12053	TTT	.	.	none		0.338	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256795.1	NM_152300	
TMEM255B	348013	hgsc.bcm.edu	37	13	114514733	114514733	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:114514733C>G	ENST00000375353.3	+	9	865	c.838C>G	c.(838-840)Ccc>Gcc	p.P280A	TMEM255B_ENST00000467169.1_3'UTR	NM_182614.2	NP_872420.1	Q8WV15	T255B_HUMAN	transmembrane protein 255B	280	Pro-rich.					integral component of membrane (GO:0016021)											CCCAGTTGCGCCCTCCTCTGC	0.647																																					p.P280A		Atlas-SNP	.											.	.	.	.	0			c.C838G						PASS	.						47.0	53.0	51.0					13																	114514733		2203	4300	6503	SO:0001583	missense	348013	exon9			GTTGCGCCCTCCT	BC018995	CCDS45071.1	13q34	2012-11-30	2012-11-30	2012-11-30	ENSG00000184497	ENSG00000184497			28297	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member B"""	FAM70B		12477932	Standard	NM_182614		Approved	MGC20579	uc001vuh.3	Q8WV15	OTTHUMG00000017398	ENST00000375353.3:c.838C>G	13.37:g.114514733C>G	ENSP00000364502:p.Pro280Ala	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	110	15	0.136364	NM_182614		Missense_Mutation	SNP	ENST00000375353.3	37	CCDS45071.1	.	.	.	.	.	.	.	.	.	.	C	4.207	0.037268	0.08148	.	.	ENSG00000184497	ENST00000375353	T	0.40225	1.04	4.35	-5.0	0.03001	.	.	.	.	.	T	0.28400	0.0702	L	0.50333	1.59	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.30268	-0.9984	9	0.46703	T	0.11	-1.715	1.5609	0.02594	0.1161:0.2033:0.1673:0.5134	.	280	Q8WV15	FA70B_HUMAN	A	280	ENSP00000364502:P280A	ENSP00000364502:P280A	P	+	1	0	FAM70B	113599210	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.015000	0.12634	-1.335000	0.02241	0.484000	0.47621	CCC	.	.	none		0.647	TMEM255B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045953.4	NM_182614	
AMER1	139285	hgsc.bcm.edu	37	X	63411917	63411917	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:63411917G>A	ENST00000330258.3	-	2	1522	c.1250C>T	c.(1249-1251)cCa>cTa	p.P417L	AMER1_ENST00000374869.3_Missense_Mutation_p.P417L|AMER1_ENST00000403336.1_Missense_Mutation_p.P417L	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	417					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									ATTGGGCCGTGGATACATTTG	0.517																																					p.P417L		Atlas-SNP	.											.	.	.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.C1250T						PASS	.						219.0	200.0	207.0					X																	63411917		2203	4300	6503	SO:0001583	missense	139285	exon2			GGCCGTGGATACA	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1250C>T	X.37:g.63411917G>A	ENSP00000329117:p.Pro417Leu	Somatic	198	0	0		WXS	Illumina HiSeq	Phase_I	190	35	0.184211	NM_152424	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	0.352	-0.944210	0.02322	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.29917	1.55;1.55;1.55	4.64	2.68	0.31781	.	0.510469	0.18585	N	0.136891	T	0.25306	0.0615	L	0.46157	1.445	0.27490	N	0.952304	B	0.10296	0.003	B	0.14578	0.011	T	0.16453	-1.0402	10	0.44086	T	0.13	-0.1509	8.3007	0.32012	0.2172:0.0:0.7828:0.0	.	417	Q5JTC6	F123B_HUMAN	L	417	ENSP00000364003:P417L;ENSP00000329117:P417L;ENSP00000384722:P417L	ENSP00000329117:P417L	P	-	2	0	FAM123B	63328642	0.138000	0.22547	0.195000	0.23364	0.065000	0.16274	1.140000	0.31516	0.559000	0.29153	0.600000	0.82982	CCA	.	.	none		0.517	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
TTC9	23508	hgsc.bcm.edu	37	14	71109098	71109098	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:71109098G>A	ENST00000256367.2	+	1	595	c.252G>A	c.(250-252)ttG>ttA	p.L84L	CTD-2540L5.5_ENST00000553982.1_lincRNA|CTD-2540L5.6_ENST00000500016.1_lincRNA	NM_015351.1	NP_056166.1	Q92623	TTC9A_HUMAN	tetratricopeptide repeat domain 9	84										skin(1)	1				all cancers(60;0.00545)|BRCA - Breast invasive adenocarcinoma(234;0.00747)|OV - Ovarian serous cystadenocarcinoma(108;0.0538)		ACCGGGCGTTGCTGGAGCTGA	0.682																																					p.L84L		Atlas-SNP	.											.	TTC9	11	.	0			c.G252A						PASS	.						10.0	12.0	11.0					14																	71109098		1871	4083	5954	SO:0001819	synonymous_variant	23508	exon1			GGCGTTGCTGGAG	D86980	CCDS45132.1	14q24.2	2014-08-12			ENSG00000133985			"""Tetratricopeptide (TTC) repeat domain containing"""	20267	protein-coding gene	gene with protein product		610488					Standard	NM_015351		Approved	KIAA0227, TTC9A	uc001xmi.2	Q92623	OTTHUMG00000172133	ENST00000256367.2:c.252G>A	14.37:g.71109098G>A		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	64	6	0.09375	NM_015351	Q86WT2	Silent	SNP	ENST00000256367.2	37	CCDS45132.1																																																																																			.	.	none		0.682	TTC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417024.1	XM_027236	
UXS1	80146	hgsc.bcm.edu	37	2	106729179	106729179	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:106729179C>T	ENST00000409501.3	-	10	844	c.787G>A	c.(787-789)Ggg>Agg	p.G263R	UXS1_ENST00000540130.1_Missense_Mutation_p.G206R|UXS1_ENST00000409032.1_Missense_Mutation_p.G95R|UXS1_ENST00000283148.7_Missense_Mutation_p.G268R|UXS1_ENST00000428048.2_Missense_Mutation_p.G107R			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	263					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						ATGCGTGGCCCAAAGGTGTTG	0.602																																					p.G268R		Atlas-SNP	.											.	UXS1	75	.	0			c.G802A						PASS	.						72.0	74.0	74.0					2																	106729179		2106	4232	6338	SO:0001583	missense	80146	exon10			GTGGCCCAAAGGT	AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.787G>A	2.37:g.106729179C>T	ENSP00000387019:p.Gly263Arg	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	65	10	0.153846	NM_001253875	Q8NBX3|Q9H5C2	Missense_Mutation	SNP	ENST00000409501.3	37	CCDS46378.1	.	.	.	.	.	.	.	.	.	.	C	31	5.081668	0.94050	.	.	ENSG00000115652	ENST00000283148;ENST00000540130;ENST00000409501;ENST00000409032;ENST00000428048;ENST00000441952;ENST00000416298;ENST00000444193	D;D;D;D;D;D;D;D	0.98649	-5.05;-5.05;-5.05;-5.05;-5.05;-5.05;-5.05;-5.05	5.25	5.25	0.73442	NAD-dependent epimerase/dehydratase (1);	0.000000	0.85682	D	0.000000	D	0.99677	0.9879	H	0.99964	5.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.96850	0.9624	10	0.87932	D	0	.	18.4398	0.90662	0.0:1.0:0.0:0.0	.	107;268;263	B4E3U7;Q8NBZ7-2;Q8NBZ7	.;.;UXS1_HUMAN	R	268;206;263;95;107;107;95;95	ENSP00000283148:G268R;ENSP00000438265:G206R;ENSP00000387019:G263R;ENSP00000387096:G95R;ENSP00000394334:G107R;ENSP00000416656:G107R;ENSP00000403612:G95R;ENSP00000404468:G95R	ENSP00000283148:G268R	G	-	1	0	UXS1	106095611	1.000000	0.71417	0.986000	0.45419	0.950000	0.60333	6.730000	0.74780	2.452000	0.82932	0.561000	0.74099	GGG	.	.	none		0.602	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329778.1	NM_025076.3	
MUC5B	727897	hgsc.bcm.edu	37	11	1258274	1258274	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:1258274C>T	ENST00000529681.1	+	25	3235	c.3177C>T	c.(3175-3177)ccC>ccT	p.P1059P	MUC5B_ENST00000447027.1_Silent_p.P1062P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1059	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AGCTCTCCCCCTCCTGCCCGG	0.657																																					p.P1059P		Atlas-SNP	.											.	MUC5B	473	.	0			c.C3177T						PASS	.						42.0	59.0	53.0					11																	1258274		2100	4204	6304	SO:0001819	synonymous_variant	727897	exon25			CTCCCCCTCCTGC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3177C>T	11.37:g.1258274C>T		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	59	4	0.0677966	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.	.	none		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
CPXM1	56265	hgsc.bcm.edu	37	20	2775239	2775239	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:2775239A>T	ENST00000380605.2	-	13	1971	c.1907T>A	c.(1906-1908)cTt>cAt	p.L636H		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	636					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						AGCAATCCCAAGCTCCGTGTC	0.587																																					p.L636H		Atlas-SNP	.											.	CPXM1	107	.	0			c.T1907A						PASS	.						183.0	117.0	140.0					20																	2775239		2203	4300	6503	SO:0001583	missense	56265	exon13			ATCCCAAGCTCCG	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1907T>A	20.37:g.2775239A>T	ENSP00000369979:p.Leu636His	Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	55	16	0.290909	NM_019609	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	37	CCDS13033.1	.	.	.	.	.	.	.	.	.	.	A	10.31	1.314694	0.23908	.	.	ENSG00000088882	ENST00000380605;ENST00000421947	T	0.42131	0.98	5.53	1.79	0.24919	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.516425	0.19628	N	0.109747	T	0.25005	0.0607	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.13202	-1.0518	10	0.44086	T	0.13	-3.0776	4.3529	0.11163	0.4832:0.0:0.0892:0.4276	.	636	Q96SM3	CPXM1_HUMAN	H	636;332	ENSP00000369979:L636H	ENSP00000369979:L636H	L	-	2	0	CPXM1	2723239	0.000000	0.05858	0.155000	0.22561	0.974000	0.67602	-0.008000	0.12788	0.507000	0.28148	0.533000	0.62120	CTT	.	.	none		0.587	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
COL15A1	1306	hgsc.bcm.edu	37	9	101765754	101765754	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:101765754C>T	ENST00000375001.3	+	8	1508	c.1085C>T	c.(1084-1086)gCg>gTg	p.A362V		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	362	4 X tandem repeats.|Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.A362V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GCAACAGCAGCGGGGCTGGCC	0.582																																					p.A362V		Atlas-SNP	.											COL15A1,colon,carcinoma,0,1	COL15A1	211	1	1	Substitution - Missense(1)	large_intestine(1)	c.C1085T						scavenged	.						77.0	82.0	80.0					9																	101765754		2203	4300	6503	SO:0001583	missense	1306	exon8			CAGCAGCGGGGCT	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1085C>T	9.37:g.101765754C>T	ENSP00000364140:p.Ala362Val	Somatic	269	0	0		WXS	Illumina HiSeq	Phase_I	278	4	0.0143885	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	C	3.922	-0.017883	0.07681	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.90900	-2.75	3.57	1.63	0.23807	.	3.066200	0.00843	N	0.001768	D	0.82637	0.5080	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.68345	-0.5433	10	0.25106	T	0.35	-0.7227	6.7373	0.23417	0.1731:0.7209:0.0:0.1059	.	362	P39059	COFA1_HUMAN	V	362;332	ENSP00000364140:A362V	ENSP00000364140:A362V	A	+	2	0	COL15A1	100805575	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.889000	0.28282	0.121000	0.18284	-1.134000	0.01955	GCG	.	.	none		0.582	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
HECW2	57520	hgsc.bcm.edu	37	2	197092929	197092929	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:197092929C>A	ENST00000260983.3	-	22	3996	c.3814G>T	c.(3814-3816)Gaa>Taa	p.E1272*	HECW2_ENST00000409111.1_Nonsense_Mutation_p.E916*	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1272	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TTAAAGAGTTCTCTGGATACC	0.348																																					p.E1272X		Atlas-SNP	.											.	HECW2	239	.	0			c.G3814T						PASS	.						83.0	86.0	85.0					2																	197092929		2203	4300	6503	SO:0001587	stop_gained	57520	exon22			AGAGTTCTCTGGA	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3814G>T	2.37:g.197092929C>A	ENSP00000260983:p.Glu1272*	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	216	60	0.277778	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Nonsense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	45	11.371157	0.99552	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.4587	0.94906	0.0:1.0:0.0:0.0	.	.	.	.	X	916;1272	.	ENSP00000260983:E1272X	E	-	1	0	HECW2	196801174	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.828000	0.97474	0.655000	0.94253	GAA	.	.	none		0.348	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
PIGQ	9091	hgsc.bcm.edu	37	16	632296	632296	+	Intron	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:632296G>A	ENST00000026218.5	+	10	1619				PIGQ_ENST00000321878.5_Missense_Mutation_p.R527H|PIGQ_ENST00000409527.2_Missense_Mutation_p.R527H	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q						C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				AGGCCCCTCCGCCTCCTGATG	0.692																																					p.R527H		Atlas-SNP	.											.	PIGQ	43	.	0			c.G1580A						PASS	.						23.0	23.0	23.0					16																	632296		2195	4293	6488	SO:0001627	intron_variant	9091	exon10			CCCTCCGCCTCCT	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1532-587G>A	16.37:g.632296G>A		Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	107	44	0.411215	NM_004204	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	37	CCDS10411.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635080	0.29068	.	.	ENSG00000007541	ENST00000409527;ENST00000321878;ENST00000540241	T;T	0.44482	0.92;0.92	5.08	5.08	0.68730	.	.	.	.	.	T	0.32041	0.0816	L	0.28400	0.85	0.80722	D	1	B	0.23377	0.084	B	0.17098	0.017	T	0.09509	-1.0671	9	0.14656	T	0.56	.	17.4349	0.87548	0.0:0.0:1.0:0.0	.	527	Q9BRB3-2	.	H	527;527;85	ENSP00000386760:R527H;ENSP00000326674:R527H	ENSP00000326674:R527H	R	+	2	0	PIGQ	572297	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	4.179000	0.58290	2.361000	0.80049	0.561000	0.74099	CGC	.	.	none		0.692	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000239270.2	NM_004204	
OR51A2	401667	hgsc.bcm.edu	37	11	4976659	4976659	+	Silent	SNP	A	A	T	rs3986369	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:4976659A>T	ENST00000380371.1	-	1	284	c.285T>A	c.(283-285)tcT>tcA	p.S95S	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGGCACTAGAAGAAGTTTCAG	0.438													a|||	717	0.143171	0.0968	0.1931	5008	,	,		13905	0.2312		0.172	False		,,,				2504	0.0501				p.S95S		Atlas-SNP	.											OR51A2,NS,carcinoma,0,1	OR51A2	40	1	0			c.T285A						scavenged	.						137.0	106.0	117.0					11																	4976659		1865	3319	5184	SO:0001819	synonymous_variant	401667	exon1			ACTAGAAGAAGTT	AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.285T>A	11.37:g.4976659A>T		Somatic	231	1	0.004329		WXS	Illumina HiSeq	Phase_I	276	4	0.0144928	NM_001004748		Silent	SNP	ENST00000380371.1	37	CCDS31368.1																																																																																			A|0.689;T|0.311	0.311	strong		0.438	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142809.1	NM_001004748	
SYTL1	84958	hgsc.bcm.edu	37	1	27674316	27674316	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:27674316C>T	ENST00000543823.1	+	3	820	c.358C>T	c.(358-360)Cac>Tac	p.H120Y	SYTL1_ENST00000318074.5_Missense_Mutation_p.H120Y|SYTL1_ENST00000490170.1_3'UTR			Q8IYJ3	SYTL1_HUMAN	synaptotagmin-like 1	120					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|melanosome (GO:0042470)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)			NS(1)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	12		Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0908)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.0013)|KIRC - Kidney renal clear cell carcinoma(1967;0.00158)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GGCTCCAGGCCACGACAGGGA	0.637																																					p.H120Y		Atlas-SNP	.											SYTL1,NS,carcinoma,-1,1	SYTL1	57	1	0			c.C358T						scavenged	.						44.0	50.0	48.0					1																	27674316		2203	4300	6503	SO:0001583	missense	84958	exon4			CCAGGCCACGACA	AK027902	CCDS298.1, CCDS53286.1	1p35.3	2008-02-05			ENSG00000142765	ENSG00000142765			15584	protein-coding gene	gene with protein product		608042				12137562	Standard	NM_032872		Approved	SLP1, JFC1, FLJ14996, exophilin-7	uc001bnw.2	Q8IYJ3	OTTHUMG00000005770	ENST00000543823.1:c.358C>T	1.37:g.27674316C>T	ENSP00000440704:p.His120Tyr	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	126	3	0.0238095	NM_032872	Q5SSC9|Q96BB6|Q96GU6|Q96S89|Q96SI0	Missense_Mutation	SNP	ENST00000543823.1	37	CCDS53286.1	.	.	.	.	.	.	.	.	.	.	C	1.702	-0.501185	0.04261	.	.	ENSG00000142765	ENST00000318074;ENST00000543823	T;T	0.24350	1.86;1.86	3.73	1.29	0.21616	.	1.807560	0.02321	N	0.072992	T	0.19446	0.0467	N	0.14661	0.345	0.09310	N	1	B;P;B;B	0.42584	0.0;0.784;0.0;0.0	B;B;B;B	0.41271	0.0;0.352;0.0;0.001	T	0.26780	-1.0093	10	0.62326	D	0.03	-0.3957	7.8397	0.29391	0.5672:0.4328:0.0:0.0	.	120;120;120;120	A8KAH3;G3V181;Q8IYJ3;Q8IYJ3-2	.;.;SYTL1_HUMAN;.	Y	120	ENSP00000316464:H120Y;ENSP00000440704:H120Y	ENSP00000316464:H120Y	H	+	1	0	SYTL1	27546903	0.000000	0.05858	0.009000	0.14445	0.028000	0.11728	0.276000	0.18716	0.249000	0.21456	-0.364000	0.07487	CAC	.	.	none		0.637	SYTL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032872	
SSX2IP	117178	hgsc.bcm.edu	37	1	85128001	85128001	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:85128001T>G	ENST00000342203.3	-	8	1070	c.807A>C	c.(805-807)caA>caC	p.Q269H	SSX2IP_ENST00000603677.1_Intron|SSX2IP_ENST00000605755.1_Missense_Mutation_p.Q242H|SSX2IP_ENST00000437941.2_Missense_Mutation_p.Q242H|SSX2IP_ENST00000370612.4_Missense_Mutation_p.Q269H	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	269					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		CCATTAGGATTTGTTTCTGAC	0.323																																					p.Q269H		Atlas-SNP	.											.	SSX2IP	53	.	0			c.A807C						PASS	.						113.0	124.0	120.0					1																	85128001		2203	4300	6503	SO:0001583	missense	117178	exon9			TAGGATTTGTTTC		CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.807A>C	1.37:g.85128001T>G	ENSP00000340279:p.Gln269His	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	131	8	0.0610687	NM_001166417	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	ENST00000342203.3	37	CCDS699.1	.	.	.	.	.	.	.	.	.	.	T	18.44	3.624299	0.66901	.	.	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000544699;ENST00000370612	T;T	0.47869	0.85;0.83	5.65	4.53	0.55603	.	0.219097	0.49305	D	0.000151	T	0.46405	0.1391	M	0.63428	1.95	0.41120	D	0.985803	D;D;D	0.64830	0.994;0.994;0.994	P;P;P	0.58820	0.846;0.783;0.783	T	0.53865	-0.8378	10	0.87932	D	0	-3.6859	7.8139	0.29247	0.0:0.2925:0.0:0.7075	.	265;269;242	F5H549;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	H	269;242;265;269	ENSP00000340279:Q269H;ENSP00000412781:Q242H	ENSP00000340279:Q269H	Q	-	3	2	SSX2IP	84900589	0.991000	0.36638	1.000000	0.80357	0.996000	0.88848	0.235000	0.17948	0.994000	0.38892	0.482000	0.46254	CAA	.	.	none		0.323	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	NM_014021	
ULK3	25989	hgsc.bcm.edu	37	15	75131687	75131687	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:75131687T>C	ENST00000440863.2	-	8	971	c.880A>G	c.(880-882)Aaa>Gaa	p.K294E	ULK3_ENST00000569437.1_Missense_Mutation_p.K294E|ULK3_ENST00000568667.1_Missense_Mutation_p.K305E	NM_001099436.1	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51 like kinase 3	294	MIT 1.				autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cellular senescence (GO:0090398)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)	2						TCCTGGTCTTTCTTCACAGCC	0.592																																					p.K294E		Atlas-SNP	.											.	ULK3	30	.	0			c.A880G						PASS	.						38.0	42.0	41.0					15																	75131687		1947	4121	6068	SO:0001583	missense	25989	exon8			GGTCTTTCTTCAC	BC048289		15q24.1	2013-07-02	2013-07-02			ENSG00000140474			19703	protein-coding gene	gene with protein product		613472	"""unc-51-like kinase 3 (C. elegans)"""				Standard	XM_005254289		Approved	DKFZP434C131, FLJ90566	uc010bkf.1	Q6PHR2		ENST00000440863.2:c.880A>G	15.37:g.75131687T>C	ENSP00000400312:p.Lys294Glu	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	118	10	0.0847458	NM_001099436	B2RXK3|B4DRQ7|D3DW68|Q9NPN5|Q9UFS4	Missense_Mutation	SNP	ENST00000440863.2	37	CCDS45305.1	.	.	.	.	.	.	.	.	.	.	T	14.52	2.560326	0.45590	.	.	ENSG00000140474	ENST00000440863;ENST00000418051	T	0.68903	-0.36	5.05	5.05	0.67936	MIT (2);	.	.	.	.	T	0.50343	0.1610	N	0.17082	0.46	0.46061	D	0.998848	B;B;B;B	0.31680	0.335;0.335;0.199;0.11	B;B;B;B	0.31290	0.127;0.127;0.072;0.031	T	0.50250	-0.8850	9	0.30854	T	0.27	-15.4837	13.6385	0.62235	0.0:0.0:0.0:1.0	.	305;204;294;294	B4DFT0;B4DFS6;Q6PHR2;Q6PHR2-3	.;.;ULK3_HUMAN;.	E	294;305	ENSP00000400312:K294E	ENSP00000393658:K305E	K	-	1	0	ULK3	72918740	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.864000	0.69575	1.907000	0.55213	0.402000	0.26972	AAA	.	.	none		0.592	ULK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421734.4	NM_015518	
CAMK4	814	hgsc.bcm.edu	37	5	110560276	110560276	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:110560276A>T	ENST00000282356.4	+	1	493	c.95A>T	c.(94-96)tAc>tTc	p.Y32F	CAMK4_ENST00000512453.1_Missense_Mutation_p.Y32F	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	32					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		GTCCCGGATTACTGGATCGAC	0.682																																					p.Y32F		Atlas-SNP	.											.	CAMK4	77	.	0			c.A95T						PASS	.						27.0	30.0	29.0					5																	110560276		2202	4300	6502	SO:0001583	missense	814	exon1			CGGATTACTGGAT	D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.95A>T	5.37:g.110560276A>T	ENSP00000282356:p.Tyr32Phe	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	141	30	0.212766	NM_001744	D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	CCDS4103.1	.	.	.	.	.	.	.	.	.	.	A	15.17	2.753876	0.49362	.	.	ENSG00000152495	ENST00000508074;ENST00000512453;ENST00000282356	T;T;T	0.66995	0.73;-0.24;-0.24	4.16	4.16	0.48862	Protein kinase-like domain (1);	0.074149	0.56097	D	0.000028	T	0.51126	0.1656	N	0.19112	0.55	0.41715	D	0.989476	B	0.18610	0.029	B	0.18871	0.023	T	0.51348	-0.8717	10	0.48119	T	0.1	.	12.4796	0.55833	1.0:0.0:0.0:0.0	.	32	Q16566	KCC4_HUMAN	F	32	ENSP00000426940:Y32F;ENSP00000422634:Y32F;ENSP00000282356:Y32F	ENSP00000282356:Y32F	Y	+	2	0	CAMK4	110588175	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.960000	0.56752	1.649000	0.50652	0.377000	0.23210	TAC	.	.	none		0.682	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744	
SCAND1	51282	hgsc.bcm.edu	37	20	34542105	34542105	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:34542105G>C	ENST00000373991.3	-	3	1172	c.102C>G	c.(100-102)aaC>aaG	p.N34K	SCAND1_ENST00000305978.2_Missense_Mutation_p.N34K			P57086	SCND1_HUMAN	SCAN domain containing 1	34					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)					Breast(12;0.00631)|all_lung(11;0.0233)					AGCCCACACAGTTACGCTCAG	0.697																																					p.N97K		Atlas-SNP	.											.	SCAND1	2	.	0			c.C291G						PASS	.						11.0	12.0	12.0					20																	34542105		2173	4249	6422	SO:0001583	missense	51282	exon2			CACACAGTTACGC	AF204271	CCDS13269.1	20q11.1-q11.23	2013-01-08	2002-01-14		ENSG00000171222	ENSG00000171222		"""-"""	10566	protein-coding gene	gene with protein product		610416	"""SCAN domain-containing 1"""			10777584, 10747874, 12444922	Standard	NM_016558		Approved	SDP1, RAZ1	uc002xen.2	P57086	OTTHUMG00000032370	ENST00000373991.3:c.102C>G	20.37:g.34542105G>C	ENSP00000363103:p.Asn34Lys	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	69	5	0.0724638	NM_033630	Q6IAG7	Missense_Mutation	SNP	ENST00000373991.3	37	CCDS13269.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078518	0.36662	.	.	ENSG00000171222	ENST00000305978;ENST00000373991	T;T	0.08370	3.1;3.1	4.31	1.19	0.21007	.	0.828409	0.10092	N	0.717113	T	0.05823	0.0152	N	0.24115	0.695	0.09310	N	1	B	0.19583	0.037	B	0.21546	0.035	T	0.47169	-0.9138	10	0.17369	T	0.5	.	8.3967	0.32561	0.2657:0.0:0.7343:0.0	.	34	P57086	SCND1_HUMAN	K	34	ENSP00000301995:N34K;ENSP00000363103:N34K	ENSP00000301995:N34K	N	-	3	2	SCAND1	34005519	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.103000	0.10940	0.182000	0.20032	0.561000	0.74099	AAC	.	.	none		0.697	SCAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078958.2	NM_016558	
NCOA3	8202	hgsc.bcm.edu	37	20	46279836	46279836	+	Silent	SNP	A	A	G	rs2664522|rs147879509|rs397778717|rs3830809		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:46279836A>G	ENST00000371998.3	+	20	3953	c.3762A>G	c.(3760-3762)caA>caG	p.Q1254Q	NCOA3_ENST00000372004.3_Silent_p.Q1250Q|NCOA3_ENST00000341724.6_Silent_p.Q1180Q|NCOA3_ENST00000371997.3_Silent_p.Q1245Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1254	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcagcaacagcagcagc	0.552																																					p.Q1254Q		Atlas-SNP	.											NCOA3,NS,carcinoma,0,1	NCOA3	156	1	0			c.A3762G						scavenged	.						45.0	52.0	50.0					20																	46279836		2201	4299	6500	SO:0001819	synonymous_variant	8202	exon20			GCAGCAACAGCAG	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3762A>G	20.37:g.46279836A>G		Somatic	74	2	0.027027		WXS	Illumina HiSeq	Phase_I	71	12	0.169014	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			.	.	weak		0.552	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
IRS4	8471	hgsc.bcm.edu	37	X	107976167	107976167	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:107976167C>T	ENST00000372129.2	-	1	3484	c.3408G>A	c.(3406-3408)gcG>gcA	p.A1136A	RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	1136	Ala-rich.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GCGCGGAGGCCGCAGCTACAA	0.642																																					p.A1136A		Atlas-SNP	.											.	IRS4	253	.	0			c.G3408A						PASS	.						30.0	35.0	34.0					X																	107976167		2196	4283	6479	SO:0001819	synonymous_variant	8471	exon1			GGAGGCCGCAGCT	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.3408G>A	X.37:g.107976167C>T		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	15	7	0.466667	NM_003604		Silent	SNP	ENST00000372129.2	37	CCDS14544.1																																																																																			.	.	none		0.642	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36654042	36654042	+	Missense_Mutation	SNP	A	A	G	rs552987504		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:36654042A>G	ENST00000431231.2	+	21	3360	c.3292A>G	c.(3292-3294)Agt>Ggt	p.S1098G	ARHGAP23_ENST00000443378.1_Missense_Mutation_p.S1004G|ARHGAP23_ENST00000437668.3_Missense_Mutation_p.S1098G	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1098					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						CTGGTTCTTCAGTGACGAAGA	0.582																																					p.S1098G		Atlas-SNP	.											.	ARHGAP23	48	.	0			c.A3292G						PASS	.						35.0	31.0	32.0					17																	36654042		692	1591	2283	SO:0001583	missense	57636	exon21			TTCTTCAGTGACG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3292A>G	17.37:g.36654042A>G	ENSP00000393539:p.Ser1098Gly	Somatic	418	0	0		WXS	Illumina HiSeq	Phase_I	366	66	0.180328	NM_001199417		Missense_Mutation	SNP	ENST00000431231.2	37	CCDS56027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.38|16.38	3.105859|3.105859	0.56291|0.56291	.|.	.|.	ENSG00000225485|ENSG00000225485	ENST00000548703|ENST00000437668;ENST00000431231;ENST00000443378	.|T;T;T	.|0.15834	.|2.39;2.76;2.71	4.66|4.66	4.66|4.66	0.58398|0.58398	.|Rho GTPase-activating protein domain (1);	.|0.102279	.|0.64402	.|D	.|0.000006	T|T	0.19525|0.19525	0.0469|0.0469	L|L	0.52573|0.52573	1.65|1.65	0.38885|0.38885	D|D	0.956999|0.956999	.|B;P	.|0.50943	.|0.23;0.94	.|B;P	.|0.44946	.|0.082;0.465	T|T	0.05289|0.05289	-1.0894|-1.0894	5|10	.|0.25751	.|T	.|0.34	.|.	13.4901|13.4901	0.61390|0.61390	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1098;1098	.|Q9P227;Q9P227-2	.|RHG23_HUMAN;.	R|G	78|1098;1098;1004	.|ENSP00000394153:S1098G;ENSP00000393539:S1098G;ENSP00000407333:S1004G	.|ENSP00000393539:S1098G	Q|S	+|+	2|1	0|0	ARHGAP23|ARHGAP23	33907568|33907568	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	6.237000|6.237000	0.72345|0.72345	2.084000|2.084000	0.62774|0.62774	0.455000|0.455000	0.32223|0.32223	CAG|AGT	.	.	none		0.582	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
CKAP5	9793	hgsc.bcm.edu	37	11	46831321	46831321	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:46831321T>A	ENST00000529230.1	-	6	780	c.734A>T	c.(733-735)cAa>cTa	p.Q245L	CKAP5_ENST00000415402.1_Missense_Mutation_p.Q245L|CKAP5_ENST00000354558.3_Missense_Mutation_p.Q245L|CKAP5_ENST00000312055.5_Missense_Mutation_p.Q245L			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	245					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						AGCAGACTGTTGTTGTTCCAA	0.428																																					p.Q245L	Ovarian(4;85 273 2202 4844 13323)	Atlas-SNP	.											.	CKAP5	134	.	0			c.A734T						PASS	.						214.0	203.0	207.0					11																	46831321		2201	4299	6500	SO:0001583	missense	9793	exon6			GACTGTTGTTGTT		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.734A>T	11.37:g.46831321T>A	ENSP00000432768:p.Gln245Leu	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	222	38	0.171171	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.232689	0.79688	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000378629;ENST00000354558	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.78	3.39	0.38822	Armadillo-like helical (1);Armadillo-type fold (1);	0.052954	0.85682	D	0.000000	T	0.49830	0.1580	L	0.46157	1.445	0.58432	D	0.999998	P;B;D	0.54772	0.908;0.062;0.968	D;B;P	0.64144	0.922;0.055;0.449	T	0.33111	-0.9881	10	0.31617	T	0.26	-16.6184	8.6638	0.34108	0.0:0.0672:0.1296:0.8032	.	245;245;245	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	L	245	ENSP00000432768:Q245L;ENSP00000395302:Q245L;ENSP00000310227:Q245L;ENSP00000346566:Q245L	ENSP00000310227:Q245L	Q	-	2	0	CKAP5	46787897	1.000000	0.71417	0.958000	0.39756	0.988000	0.76386	7.607000	0.82883	0.418000	0.25898	-0.297000	0.09499	CAA	.	.	none		0.428	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
SGK1	6446	hgsc.bcm.edu	37	6	134494426	134494426	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134494426G>C	ENST00000237305.7	-	5	491	c.403C>G	c.(403-405)Ctg>Gtg	p.L135V	SGK1_ENST00000367857.5_Missense_Mutation_p.L125V|SGK1_ENST00000413996.3_Missense_Mutation_p.L149V|SGK1_ENST00000367858.5_Missense_Mutation_p.L230V|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000475719.2_Missense_Mutation_p.L135V|SGK1_ENST00000528577.1_Missense_Mutation_p.L163V	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	135	Glu/Lys-rich.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TTCTTTTTCAGGATTGCTTTC	0.378																																					p.L230V		Atlas-SNP	.											.	SGK1	387	.	0			c.C688G						PASS	.						114.0	113.0	113.0					6																	134494426		2203	4300	6503	SO:0001583	missense	6446	exon7			TTTTCAGGATTGC	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.403C>G	6.37:g.134494426G>C	ENSP00000237305:p.Leu135Val	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	149	27	0.181208	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450776	0.26074	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719	T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;1.88	6.17	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.36799	0.0980	L	0.33753	1.03	0.80722	D	1	B;B;B;B;B;B	0.27140	0.007;0.169;0.017;0.002;0.013;0.003	B;B;B;B;B;B	0.31442	0.01;0.13;0.1;0.006;0.035;0.01	T	0.31280	-0.9949	10	0.16896	T	0.51	.	15.9715	0.80025	0.0648:0.0:0.9352:0.0	.	163;149;135;125;230;135	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	V	230;149;135;125;163;135	ENSP00000356832:L230V;ENSP00000396242:L149V;ENSP00000237305:L135V;ENSP00000356831:L125V;ENSP00000434450:L163V;ENSP00000434302:L135V	ENSP00000237305:L135V	L	-	1	2	SGK1	134536119	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.089000	0.57685	1.599000	0.50093	0.655000	0.94253	CTG	.	.	none		0.378	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
PI15	51050	hgsc.bcm.edu	37	8	75737657	75737657	+	Missense_Mutation	SNP	G	G	A	rs141788887	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:75737657G>A	ENST00000260113.2	+	2	352	c.173G>A	c.(172-174)cGg>cAg	p.R58Q	RP11-758M4.4_ENST00000518128.1_RNA|RP11-758M4.4_ENST00000523860.1_RNA|PI15_ENST00000523773.1_Missense_Mutation_p.R58Q	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	58						extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			AAAGCCAGGCGGAAGCGCTAC	0.448													G|||	10	0.00199681	0.0068	0.0014	5008	,	,		17888	0.0		0.0	False		,,,				2504	0.0				p.R58Q		Atlas-SNP	.											.	PI15	73	.	0			c.G173A						PASS	.	G	GLN/ARG	28,4378	35.2+/-66.4	0,28,2175	85.0	76.0	79.0		173	4.4	1.0	8	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PI15	NM_015886.3	43	0,29,6474	AA,AG,GG		0.0116,0.6355,0.223	probably-damaging	58/259	75737657	29,12977	2203	4300	6503	SO:0001583	missense	51050	exon2			CCAGGCGGAAGCG	D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.173G>A	8.37:g.75737657G>A	ENSP00000260113:p.Arg58Gln	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	87	14	0.16092	NM_015886	Q68CY1	Missense_Mutation	SNP	ENST00000260113.2	37	CCDS6218.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	13.03	2.115943	0.37339	0.006355	1.16E-4	ENSG00000137558	ENST00000260113;ENST00000523773	T;T	0.09630	2.96;2.96	5.35	4.45	0.53987	CAP domain (2);	0.169477	0.49916	D	0.000123	T	0.07773	0.0195	M	0.68593	2.085	0.48040	D	0.999577	P	0.49559	0.925	B	0.34301	0.179	T	0.28713	-1.0035	10	0.13108	T	0.6	.	16.2838	0.82709	0.0:0.1326:0.8674:0.0	.	58	O43692	PI15_HUMAN	Q	58	ENSP00000260113:R58Q;ENSP00000428567:R58Q	ENSP00000260113:R58Q	R	+	2	0	PI15	75900212	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.032000	0.64140	1.585000	0.49928	0.655000	0.94253	CGG	G|0.997;A|0.003	0.003	strong		0.448	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886	
NUP210	23225	hgsc.bcm.edu	37	3	13368892	13368892	+	Silent	SNP	G	G	A	rs2271509	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:13368892G>A	ENST00000254508.5	-	32	4414	c.4332C>T	c.(4330-4332)tgC>tgT	p.C1444C		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1444					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					TGCGGACAACGCAGGTGTTGT	0.612													G|||	1985	0.396366	0.4592	0.3775	5008	,	,		19707	0.3016		0.4891	False		,,,				2504	0.3272				p.C1444C		Atlas-SNP	.											NUP210,NS,carcinoma,0,2	NUP210	182	2	0			c.C4332T						scavenged	.	G		2074,2332	564.7+/-381.5	474,1126,603	53.0	41.0	45.0		4332	1.7	0.1	3	dbSNP_100	45	4402,4198	577.9+/-390.6	1134,2134,1032	no	coding-synonymous	NUP210	NM_024923.2		1608,3260,1635	AA,AG,GG		48.814,47.0722,49.7924		1444/1888	13368892	6476,6530	2203	4300	6503	SO:0001819	synonymous_variant	23225	exon32			GACAACGCAGGTG	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4332C>T	3.37:g.13368892G>A		Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	121	2	0.0165289	NM_024923	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Silent	SNP	ENST00000254508.5	37	CCDS33704.1																																																																																			G|0.541;A|0.459	0.459	strong		0.612	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
PAPSS1	9061	hgsc.bcm.edu	37	4	108578129	108578129	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:108578129C>T	ENST00000265174.4	-	7	1090	c.818G>A	c.(817-819)gGt>gAt	p.G273D	PAPSS1_ENST00000511304.1_5'UTR	NM_005443.4	NP_005434.4	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 1	273					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			NS(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|ovary(1)	16		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		GGTTGCCCAACCTTCTGCCAA	0.388																																					p.G273D		Atlas-SNP	.											PAPSS1,NS,carcinoma,0,1	PAPSS1	57	1	0			c.G818A						scavenged	.						116.0	111.0	113.0					4																	108578129		2203	4300	6503	SO:0001583	missense	9061	exon7			GCCCAACCTTCTG	Y10387	CCDS3676.1	4q24	2012-07-13			ENSG00000138801	ENSG00000138801	2.7.7.4, 2.7.1.25		8603	protein-coding gene	gene with protein product		603262				9576487, 9771708	Standard	NM_005443		Approved	ATPSK1, PAPSS	uc003hyk.3	O43252	OTTHUMG00000131210	ENST00000265174.4:c.818G>A	4.37:g.108578129C>T	ENSP00000265174:p.Gly273Asp	Somatic	214	0	0		WXS	Illumina HiSeq	Phase_I	264	3	0.0113636	NM_005443	O43841|O75332|Q96FB1|Q96TF4|Q9P1P9|Q9UE98	Missense_Mutation	SNP	ENST00000265174.4	37	CCDS3676.1	.	.	.	.	.	.	.	.	.	.	C	33	5.210836	0.95069	.	.	ENSG00000138801	ENST00000265174	T	0.79141	-1.24	6.16	6.16	0.99307	Sulphate adenylyltransferase (1);PUA-like domain (1);	0.000000	0.85682	D	0.000000	D	0.92463	0.7607	H	0.95365	3.66	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93392	0.6752	10	0.87932	D	0	-20.1705	20.8598	0.99761	0.0:1.0:0.0:0.0	.	273	O43252	PAPS1_HUMAN	D	273	ENSP00000265174:G273D	ENSP00000265174:G273D	G	-	2	0	PAPSS1	108797578	1.000000	0.71417	0.980000	0.43619	0.926000	0.56050	7.294000	0.78760	2.937000	0.99478	0.650000	0.86243	GGT	.	.	none		0.388	PAPSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253946.2		
TMC5	79838	hgsc.bcm.edu	37	16	19498605	19498605	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:19498605T>C	ENST00000396229.2	+	17	3279	c.2530T>C	c.(2530-2532)Tcc>Ccc	p.S844P	TMC5_ENST00000564959.1_Missense_Mutation_p.S527P|TMC5_ENST00000381414.4_Missense_Mutation_p.S844P|TMC5_ENST00000542583.2_Missense_Mutation_p.S844P|TMC5_ENST00000561503.1_Missense_Mutation_p.S485P|CTA-363E6.6_ENST00000561762.1_RNA|TMC5_ENST00000219821.5_Missense_Mutation_p.S598P|TMC5_ENST00000541464.1_Missense_Mutation_p.S792P	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	844					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CTTTTTCCCATCCTTCACCGG	0.532																																					p.S844P		Atlas-SNP	.											.	TMC5	169	.	0			c.T2530C						PASS	.						75.0	65.0	69.0					16																	19498605		2197	4300	6497	SO:0001583	missense	79838	exon17			TTCCCATCCTTCA	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2530T>C	16.37:g.19498605T>C	ENSP00000379531:p.Ser844Pro	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	98	17	0.173469	NM_001105249	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	37	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.499431	0.85069	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T;T	0.71817	-0.34;-0.28;-0.48;-0.48;-0.6	5.72	5.72	0.89469	.	0.165964	0.56097	D	0.000036	D	0.84982	0.5593	M	0.84948	2.725	0.44862	D	0.997878	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.999;0.999	D;D;D;D;D;D	0.87578	0.998;0.979;0.994;0.992;0.991;0.996	D	0.85275	0.1058	10	0.37606	T	0.19	-27.6788	14.9732	0.71249	0.0:0.0:0.0:1.0	.	792;527;598;598;844;844	F5GYU8;E7EU57;Q6UXY8-3;B3KUQ8;Q6UXY8;Q6UXY8-2	.;.;.;.;TMC5_HUMAN;.	P	792;844;844;844;598;527	ENSP00000441227:S792P;ENSP00000370822:S844P;ENSP00000379531:S844P;ENSP00000446274:S844P;ENSP00000219821:S598P	ENSP00000219821:S598P	S	+	1	0	TMC5	19406106	1.000000	0.71417	0.957000	0.39632	0.995000	0.86356	5.372000	0.66156	2.176000	0.68965	0.533000	0.62120	TCC	.	.	none		0.532	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
TNFRSF14	8764	hgsc.bcm.edu	37	1	2491336	2491336	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:2491336T>C	ENST00000355716.4	+	4	678	c.379T>C	c.(379-381)Tgc>Cgc	p.C127R	RP3-395M20.8_ENST00000452793.1_RNA|RP3-395M20.8_ENST00000416860.2_RNA|TNFRSF14_ENST00000409119.1_Missense_Mutation_p.C127R	NM_003820.2	NP_003811.2	Q92956	TNR14_HUMAN	tumor necrosis factor receptor superfamily, member 14	127					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell migration (GO:2000406)|T cell costimulation (GO:0031295)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			kidney(1)	1	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;1.11e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000326)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		AGGCCACTTCTGCATCGTCCA	0.692			"""Mis, N, F"""		follicular lymphoma																																p.C127R		Atlas-SNP	.		Rec	yes		1	1p36.32	8764	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""		L	.	TNFRSF14	89	.	0			c.T379C						PASS	.						35.0	36.0	35.0					1																	2491336		2193	4297	6490	SO:0001583	missense	8764	exon4			CACTTCTGCATCG	U70321	CCDS44046.1	1p36.32	2012-02-27	2011-08-11		ENSG00000157873	ENSG00000157873		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11912	protein-coding gene	gene with protein product	"""herpesvirus entry mediator"""	602746	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""			8898196, 9162061	Standard	XM_006711018		Approved	HVEM, ATAR, TR2, LIGHTR, HVEA, CD270	uc001ajt.1	Q92956	OTTHUMG00000000792	ENST00000355716.4:c.379T>C	1.37:g.2491336T>C	ENSP00000347948:p.Cys127Arg	Somatic	357	1	0.00280112		WXS	Illumina HiSeq	Phase_I	113	39	0.345133	NM_003820	B3KW30|B9DI89|Q6IB95|Q8N634|Q8WXR1|Q96J31|Q9UM65	Missense_Mutation	SNP	ENST00000355716.4	37	CCDS44046.1	.	.	.	.	.	.	.	.	.	.	T	13.73	2.325399	0.41197	.	.	ENSG00000157873	ENST00000426449;ENST00000434817;ENST00000435221;ENST00000451778;ENST00000409119;ENST00000355716	T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03;-0.03	3.57	3.57	0.40892	TNFR/CD27/30/40/95 cysteine-rich region (1);	.	.	.	.	T	0.79358	0.4432	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81549	-0.0882	9	0.87932	D	0	-11.917	8.7123	0.34391	0.0:0.0:0.0:1.0	.	127	Q92956	TNR14_HUMAN	R	127	ENSP00000411854:C127R;ENSP00000415254:C127R;ENSP00000399292:C127R;ENSP00000399533:C127R;ENSP00000386859:C127R;ENSP00000347948:C127R	ENSP00000347948:C127R	C	+	1	0	TNFRSF14	2483082	0.009000	0.17119	0.985000	0.45067	0.221000	0.24807	0.389000	0.20751	1.642000	0.50584	0.379000	0.24179	TGC	.	.	none		0.692	TNFRSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002088.1		
DDX41	51428	hgsc.bcm.edu	37	5	176942194	176942194	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:176942194G>A	ENST00000507955.1	-	7	1160	c.637C>T	c.(637-639)Ccc>Tcc	p.P213S	DDX41_ENST00000506965.1_5'UTR	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	213	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			CACATGGTGGGGATGCCCTGG	0.532																																					p.P213S		Atlas-SNP	.											DDX41_ENST00000507955,NS,carcinoma,0,1	DDX41	49	1	0			c.C637T						scavenged	.						255.0	217.0	230.0					5																	176942194		2203	4300	6503	SO:0001583	missense	51428	exon7			TGGTGGGGATGCC	AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.637C>T	5.37:g.176942194G>A	ENSP00000422753:p.Pro213Ser	Somatic	185	1	0.00540541		WXS	Illumina HiSeq	Phase_I	191	2	0.0104712	NM_016222	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	ENST00000507955.1	37	CCDS4427.1	.	.	.	.	.	.	.	.	.	.	G	32	5.189742	0.94923	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	T;T	0.52754	0.65;0.65	5.53	5.53	0.82687	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.73776	0.3630	M	0.84773	2.715	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.77918	-0.2408	10	0.87932	D	0	-28.2262	19.4714	0.94965	0.0:0.0:1.0:0.0	.	213	Q9UJV9	DDX41_HUMAN	S	231;213	ENSP00000330349:P231S;ENSP00000422753:P213S	ENSP00000330349:P231S	P	-	1	0	DDX41	176874800	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	9.497000	0.97970	2.596000	0.87737	0.563000	0.77884	CCC	.	.	none		0.532	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253432.2	NM_016222	
PRDM16	63976	hgsc.bcm.edu	37	1	3301766	3301766	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:3301766G>A	ENST00000270722.5	+	4	538	c.489G>A	c.(487-489)gcG>gcA	p.A163A	PRDM16_ENST00000442529.2_Silent_p.A163A|PRDM16_ENST00000378398.3_Silent_p.A163A|PRDM16_ENST00000441472.2_Silent_p.A163A|PRDM16_ENST00000378391.2_Silent_p.A163A|PRDM16_ENST00000514189.1_Silent_p.A164A|PRDM16_ENST00000511072.1_Silent_p.A164A|PRDM16_ENST00000512462.1_3'UTR			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	163	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CAAATCAGGCGGGGGCTGGCA	0.597			T	EVI1	"""MDS, AML"""																																p.A163A		Atlas-SNP	.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	PRDM16,NS,carcinoma,+1,1	PRDM16	147	1	0			c.G489A						scavenged	.						92.0	105.0	101.0					1																	3301766		2164	4263	6427	SO:0001819	synonymous_variant	63976	exon4			TCAGGCGGGGGCT	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.489G>A	1.37:g.3301766G>A		Somatic	202	0	0		WXS	Illumina HiSeq	Phase_I	195	2	0.0102564	NM_022114	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Silent	SNP	ENST00000270722.5	37	CCDS41236.2																																																																																			.	.	none		0.597	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
ZFX	7543	hgsc.bcm.edu	37	X	24229366	24229366	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:24229366G>A	ENST00000379177.1	+	11	2718	c.2291G>A	c.(2290-2292)cGg>cAg	p.R764Q	ZFX_ENST00000338565.3_Missense_Mutation_p.R714Q|ZFX_ENST00000540034.1_Missense_Mutation_p.R803Q|ZFX_ENST00000539115.1_Missense_Mutation_p.R535Q|ZFX_ENST00000304543.5_Missense_Mutation_p.R764Q|ZFX_ENST00000379188.3_Missense_Mutation_p.R764Q	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	764					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						GGCTTTAAACGGCACGTTATT	0.448																																					p.R764Q	Esophageal Squamous(20;306 562 7346 32868 37983)	Atlas-SNP	.											.	ZFX	61	.	0			c.G2291A						PASS	.						178.0	149.0	158.0					X																	24229366		2203	4300	6503	SO:0001583	missense	7543	exon10			TTAAACGGCACGT		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.2291G>A	X.37:g.24229366G>A	ENSP00000368475:p.Arg764Gln	Somatic	205	0	0		WXS	Illumina HiSeq	Phase_I	240	53	0.220833	NM_003410	B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	ENST00000379177.1	37	CCDS14211.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.961282	0.74016	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38	5.19	5.19	0.71726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000014	T	0.36771	0.0979	L	0.48362	1.52	0.54753	D	0.999989	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.998;0.999;0.993	T	0.03433	-1.1037	10	0.42905	T	0.14	-6.7851	18.0792	0.89437	0.0:0.0:1.0:0.0	.	803;486;764	B9EG97;F5GYV7;P17010	.;.;ZFX_HUMAN	Q	535;764;486;764;764;803;714	ENSP00000438233:R535Q;ENSP00000368486:R764Q;ENSP00000368475:R764Q;ENSP00000304985:R764Q;ENSP00000441382:R803Q;ENSP00000343384:R714Q	ENSP00000304985:R764Q	R	+	2	0	ZFX	24139287	1.000000	0.71417	0.924000	0.36721	0.948000	0.59901	9.813000	0.99286	2.291000	0.77112	0.594000	0.82650	CGG	.	.	none		0.448	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410	
SGK1	6446	hgsc.bcm.edu	37	6	134494432	134494432	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134494432C>G	ENST00000237305.7	-	5	485	c.397G>C	c.(397-399)Gca>Cca	p.A133P	SGK1_ENST00000367857.5_Missense_Mutation_p.A123P|SGK1_ENST00000413996.3_Missense_Mutation_p.A147P|SGK1_ENST00000367858.5_Missense_Mutation_p.A228P|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000475719.2_Missense_Mutation_p.A133P|SGK1_ENST00000528577.1_Missense_Mutation_p.A161P	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	133	Glu/Lys-rich.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TTCAGGATTGCTTTCTTCTGT	0.383																																					p.A228P		Atlas-SNP	.											.	SGK1	387	.	0			c.G682C						PASS	.						114.0	114.0	114.0					6																	134494432		2203	4300	6503	SO:0001583	missense	6446	exon7			GGATTGCTTTCTT	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.397G>C	6.37:g.134494432C>G	ENSP00000237305:p.Ala133Pro	Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	157	21	0.133758	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565036	0.86439	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719	T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;1.81	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.096985	0.64402	D	0.000001	T	0.61702	0.2368	N	0.24115	0.695	0.80722	D	1	D;D;P;P;D;P	0.67145	0.977;0.979;0.907;0.936;0.996;0.948	P;P;P;P;P;P	0.60117	0.706;0.578;0.864;0.578;0.869;0.703	T	0.64326	-0.6434	10	0.62326	D	0.03	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	161;147;133;123;228;133	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	P	228;147;133;123;161;133	ENSP00000356832:A228P;ENSP00000396242:A147P;ENSP00000237305:A133P;ENSP00000356831:A123P;ENSP00000434450:A161P;ENSP00000434302:A133P	ENSP00000237305:A133P	A	-	1	0	SGK1	134536125	1.000000	0.71417	0.994000	0.49952	0.999000	0.98932	5.920000	0.70017	2.941000	0.99782	0.655000	0.94253	GCA	.	.	none		0.383	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
PPP2R5A	5525	hgsc.bcm.edu	37	1	212506921	212506921	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:212506921C>T	ENST00000261461.2	+	3	1035	c.461C>T	c.(460-462)gCc>gTc	p.A154V	PPP2R5A_ENST00000498129.2_3'UTR|RP11-384C4.7_ENST00000442146.1_RNA|PPP2R5A_ENST00000537030.3_Missense_Mutation_p.A97V	NM_006243.3	NP_006234.1	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B', alpha	154					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of lipid kinase activity (GO:0090219)|positive regulation of protein dephosphorylation (GO:0035307)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|M band (GO:0031430)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|Z disc (GO:0030018)	kinase binding (GO:0019900)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		ACGCTTGAGGCCTCTTGGCCT	0.373																																					p.A154V		Atlas-SNP	.											PPP2R5A,NS,carcinoma,+1,1	PPP2R5A	48	1	0			c.C461T						scavenged	.						91.0	87.0	88.0					1																	212506921		2203	4300	6503	SO:0001583	missense	5525	exon3			TTGAGGCCTCTTG	BC022474	CCDS1503.1, CCDS55686.1	1q32.2-q32.3	2010-06-18	2010-04-14		ENSG00000066027	ENSG00000066027		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9309	protein-coding gene	gene with protein product		601643	"""protein phosphatase 2, regulatory subunit B (B56), alpha isoform"", ""protein phosphatase 2, regulatory subunit B', alpha isoform"""			7592815	Standard	NM_006243		Approved	PR61A, B56A	uc001hjb.3	Q15172	OTTHUMG00000036750	ENST00000261461.2:c.461C>T	1.37:g.212506921C>T	ENSP00000261461:p.Ala154Val	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	141	2	0.0141844	NM_006243	B2R6D2|B7Z7L2|D3DT99|Q2NL72|Q5VVB2|Q8TBI9	Missense_Mutation	SNP	ENST00000261461.2	37	CCDS1503.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.829345	0.50845	.	.	ENSG00000066027	ENST00000542178;ENST00000261461;ENST00000537030	.	.	.	5.29	5.29	0.74685	Armadillo-type fold (1);	0.047406	0.85682	D	0.000000	T	0.55417	0.1919	L	0.41710	1.295	0.58432	D	0.999995	B;B	0.27264	0.068;0.173	B;B	0.23852	0.028;0.049	T	0.50915	-0.8771	9	0.29301	T	0.29	-4.8806	18.9315	0.92568	0.0:1.0:0.0:0.0	.	97;154	B7Z7L2;Q15172	.;2A5A_HUMAN	V	154;154;97	.	ENSP00000261461:A154V	A	+	2	0	PPP2R5A	210573544	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.861000	0.69553	2.489000	0.83994	0.555000	0.69702	GCC	.	.	none		0.373	PPP2R5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089302.1	NM_006243	
SLC6A6	6533	hgsc.bcm.edu	37	3	14523273	14523273	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:14523273T>C	ENST00000454876.2	+	14	1975	c.1646T>C	c.(1645-1647)cTg>cCg	p.L549P	SLC6A6_ENST00000360861.3_Missense_Mutation_p.L549P			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	549					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						GGCTGGAGCCTGGCCCTTTCC	0.592																																					p.L549P		Atlas-SNP	.											.	SLC6A6	58	.	0			c.T1646C						PASS	.						136.0	119.0	125.0					3																	14523273		2203	4300	6503	SO:0001583	missense	6533	exon14			GGAGCCTGGCCCT		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.1646T>C	3.37:g.14523273T>C	ENSP00000398063:p.Leu549Pro	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	85	14	0.164706	NM_003043	B2RNU7|Q9BRI2|Q9BXB0	Missense_Mutation	SNP	ENST00000454876.2	37	CCDS33705.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.350042	0.82132	.	.	ENSG00000131389	ENST00000454876;ENST00000360861	T;T	0.80123	-1.34;-1.34	4.5	4.5	0.54988	.	0.074225	0.51477	D	0.000099	D	0.91713	0.7380	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.93800	0.7100	10	0.87932	D	0	.	14.1214	0.65189	0.0:0.0:0.0:1.0	.	549	P31641	SC6A6_HUMAN	P	549	ENSP00000398063:L549P;ENSP00000354107:L549P	ENSP00000354107:L549P	L	+	2	0	SLC6A6	14498277	1.000000	0.71417	0.997000	0.53966	0.937000	0.57800	7.988000	0.88194	1.789000	0.52484	0.377000	0.23210	CTG	.	.	none		0.592	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340507.1	NM_003043	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122289	38122289	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:38122289C>T	ENST00000406386.3	+	7	3981	c.3726C>T	c.(3724-3726)ccC>ccT	p.P1242P		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1242					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TCCTGGCACCCTCACCTTCAC	0.701																																					p.P1242P		Atlas-SNP	.											.	TRIOBP	262	.	0			c.C3726T						PASS	.						27.0	35.0	32.0					22																	38122289		1912	4097	6009	SO:0001819	synonymous_variant	11078	exon7			GGCACCCTCACCT	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3726C>T	22.37:g.38122289C>T		Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	82	4	0.0487805	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	CCDS43015.1																																																																																			.	.	none		0.701	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
NF1	4763	hgsc.bcm.edu	37	17	29667603	29667603	+	Silent	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:29667603T>G	ENST00000358273.4	+	47	7385	c.7002T>G	c.(7000-7002)ggT>ggG	p.G2334G	NF1_ENST00000356175.3_Silent_p.G2313G|NF1_ENST00000444181.2_Silent_p.G127G|NF1_ENST00000417592.2_Silent_p.G47G	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2334					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ATTCAGCAGGTACCGCACTTC	0.438			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.G2334G		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.T7002G						PASS	.						122.0	108.0	113.0					17																	29667603		2203	4300	6503	SO:0001819	synonymous_variant	4763	exon47	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	AGCAGGTACCGCA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7002T>G	17.37:g.29667603T>G		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	155	22	0.141935	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	ENST00000358273.4	37	CCDS42292.1																																																																																			.	.	none		0.438	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
STK17A	9263	hgsc.bcm.edu	37	7	43664438	43664438	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:43664438C>G	ENST00000319357.5	+	7	1421	c.1242C>G	c.(1240-1242)taC>taG	p.Y414*		NM_004760.2	NP_004751.2	Q9UEE5	ST17A_HUMAN	serine/threonine kinase 17a	414					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein phosphorylation (GO:0006468)|regulation of reactive oxygen species metabolic process (GO:2000377)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						AATTTATCTACTGAGCAATAT	0.348																																					p.Y414X		Atlas-SNP	.											.	STK17A	31	.	0			c.C1242G						PASS	.						37.0	39.0	38.0					7																	43664438		2200	4298	6498	SO:0001587	stop_gained	9263	exon7			TATCTACTGAGCA	AB011420	CCDS5470.1	7p13	2008-05-15	2007-02-12		ENSG00000164543	ENSG00000164543			11395	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 1"""	604726	"""serine/threonine kinase 17a (apoptosis-inducing)"""			9786912	Standard	NM_004760		Approved	DRAK1	uc003tih.3	Q9UEE5	OTTHUMG00000022825	ENST00000319357.5:c.1242C>G	7.37:g.43664438C>G	ENSP00000319192:p.Tyr414*	Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	23	9	0.391304	NM_004760	A4D1V6|Q8IVC8	Nonsense_Mutation	SNP	ENST00000319357.5	37	CCDS5470.1	.	.	.	.	.	.	.	.	.	.	C	38	6.861793	0.97893	.	.	ENSG00000164543	ENST00000319357	.	.	.	4.94	4.94	0.65067	.	0.000000	0.43260	D	0.000582	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1523	0.89678	0.0:1.0:0.0:0.0	.	.	.	.	X	414	.	ENSP00000319192:Y414X	Y	+	3	2	STK17A	43630963	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.531000	0.53546	2.259000	0.74868	0.557000	0.71058	TAC	.	.	none		0.348	STK17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250902.1	NM_004760	
TTLL4	9654	hgsc.bcm.edu	37	2	219602439	219602439	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:219602439C>T	ENST00000392102.1	+	3	380	c.40C>T	c.(40-42)Cgc>Tgc	p.R14C	TTLL4_ENST00000258398.4_Missense_Mutation_p.R14C|TTLL4_ENST00000442769.1_Missense_Mutation_p.R14C|TTLL4_ENST00000457313.1_Intron	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	14					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TATTGGCCTCCGCCAGAAAAA	0.592																																					p.R14C	GBM(172;1818 2053 15407 20943 49753)	Atlas-SNP	.											.	TTLL4	96	.	0			c.C40T						PASS	.						57.0	57.0	57.0					2																	219602439		2203	4300	6503	SO:0001583	missense	9654	exon3			GGCCTCCGCCAGA		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.40C>T	2.37:g.219602439C>T	ENSP00000375951:p.Arg14Cys	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	120	17	0.141667	NM_014640	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	37	CCDS2422.1	.	.	.	.	.	.	.	.	.	.	c	7.873	0.728577	0.15507	.	.	ENSG00000135912	ENST00000415717;ENST00000392102;ENST00000437755;ENST00000442769;ENST00000424644;ENST00000258398	T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83	5.32	0.493	0.16878	.	0.620848	0.15371	N	0.265860	T	0.14141	0.0342	N	0.20986	0.625	0.28758	N	0.901088	B;B	0.13145	0.004;0.007	B;B	0.04013	0.001;0.001	T	0.14476	-1.0471	10	0.87932	D	0	.	4.2465	0.10674	0.1639:0.4106:0.0:0.4255	.	14;14	E7EX20;Q14679	.;TTLL4_HUMAN	C	14	ENSP00000411228:R14C;ENSP00000375951:R14C;ENSP00000391342:R14C;ENSP00000396555:R14C;ENSP00000405485:R14C;ENSP00000258398:R14C	ENSP00000258398:R14C	R	+	1	0	TTLL4	219310683	0.139000	0.22563	0.923000	0.36655	0.461000	0.32589	-0.000000	0.12993	0.011000	0.14865	-0.970000	0.02610	CGC	.	.	none		0.592	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
PARP1	142	hgsc.bcm.edu	37	1	226573325	226573325	+	Silent	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:226573325T>C	ENST00000366794.5	-	7	1034	c.891A>G	c.(889-891)gaA>gaG	p.E297E		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	297					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		GACCCGAGCATTCCTCGCAGG	0.562								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.E297E		Atlas-SNP	.											.	PARP1	100	.	0			c.A891G						PASS	.						115.0	98.0	103.0					1																	226573325		2203	4300	6503	SO:0001819	synonymous_variant	142	exon7			CGAGCATTCCTCG	BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.891A>G	1.37:g.226573325T>C		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	108	5	0.0462963	NM_001618	B1ANJ4|Q8IUZ9	Silent	SNP	ENST00000366794.5	37	CCDS1554.1																																																																																			.	.	none		0.562	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
RAB11A	8766	hgsc.bcm.edu	37	15	66170250	66170250	+	Silent	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:66170250T>C	ENST00000261890.2	+	3	515	c.387T>C	c.(385-387)cgT>cgC	p.R129R	RAB11A_ENST00000564910.1_Silent_p.R59R|RAB11A_ENST00000569896.1_Silent_p.R129R|RAB11A_ENST00000565075.1_Silent_p.R129R|RAB11A_ENST00000435304.2_Silent_p.R129R	NM_001206836.1|NM_004663.4	NP_001193765.1|NP_004654.1	P62491	RB11A_HUMAN	RAB11A, member RAS oncogene family	129					cytokinesis (GO:0000910)|establishment of protein localization to membrane (GO:0090150)|exosomal secretion (GO:1990182)|GTP catabolic process (GO:0006184)|melanosome transport (GO:0032402)|multivesicular body assembly (GO:0036258)|neuron projection development (GO:0031175)|plasma membrane to endosome transport (GO:0048227)|positive regulation of axon extension (GO:0045773)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of multivesicular body size (GO:0010796)|regulation of protein transport (GO:0051223)|small GTPase mediated signal transduction (GO:0007264)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	axon (GO:0030424)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|syntaxin binding (GO:0019905)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5						GTGATCTACGTCATCTCAGGG	0.398																																					p.R129R		Atlas-SNP	.											RAB11A,NS,carcinoma,+1,1	RAB11A	14	1	0			c.T387C						scavenged	.						248.0	216.0	227.0					15																	66170250		2201	4299	6500	SO:0001819	synonymous_variant	8766	exon3			TCTACGTCATCTC	X56740	CCDS10212.1, CCDS58373.1	15q22.31	2008-05-14			ENSG00000103769	ENSG00000103769		"""RAB, member RAS oncogene"""	9760	protein-coding gene	gene with protein product		605570				1704119, 9662449	Standard	NM_004663		Approved	YL8	uc002apk.3	P62491	OTTHUMG00000133162	ENST00000261890.2:c.387T>C	15.37:g.66170250T>C		Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	126	5	0.0396825	NM_004663	B2R4B6|B4DT13|P24410|Q5TZN9|Q9JLX1	Silent	SNP	ENST00000261890.2	37	CCDS10212.1																																																																																			.	.	none		0.398	RAB11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256864.1		
PCDHB2	56133	hgsc.bcm.edu	37	5	140476395	140476395	+	Missense_Mutation	SNP	T	T	C	rs384081|rs71574501		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:140476395T>C	ENST00000194155.4	+	1	2169	c.2021T>C	c.(2020-2022)cTg>cCg	p.L674P		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	674			L -> P (in dbSNP:rs384081).		calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L674R(1)|p.L674>?(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTACCTGCTGCTCCCGGAG	0.687																																					p.L674P		Atlas-SNP	.											PCDHB2,NS,carcinoma,0,1	PCDHB2	163	1	2	Substitution - Missense(1)|Complex(1)	large_intestine(1)|prostate(1)	c.T2021C						scavenged	.						64.0	64.0	64.0					5																	140476395		2186	4260	6446	SO:0001583	missense	56133	exon1			ACCTGCTGCTCCC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2021T>C	5.37:g.140476395T>C	ENSP00000194155:p.Leu674Pro	Somatic	32	4	0.125		WXS	Illumina HiSeq	Phase_I	19	5	0.263158	NM_018936	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.554966	0.00138	.	.	ENSG00000112852	ENST00000194155	T	0.50813	0.73	3.99	2.01	0.26516	.	.	.	.	.	T	0.04634	0.0126	N	0.00002	-3.62	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44952	-0.9294	9	0.02654	T	1	.	2.2987	0.04156	0.2432:0.3102:0.3437:0.103	rs384081;rs17096845;rs17844380	674	Q9Y5E7	PCDB2_HUMAN	P	674	ENSP00000194155:L674P	ENSP00000194155:L674P	L	+	2	0	PCDHB2	140456579	0.000000	0.05858	0.250000	0.24296	0.430000	0.31655	-0.349000	0.07731	0.795000	0.33922	-0.365000	0.07479	CTG	CT|0.500;TG|0.500	.	alt		0.687	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
NBPF10	100132406	hgsc.bcm.edu	37	1	145323656	145323656	+	Missense_Mutation	SNP	A	A	T	rs75252120	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:145323656A>T	ENST00000342960.5	+	27	3528	c.3493A>T	c.(3493-3495)Att>Ttt	p.I1165F	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	752						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.I1165F(3)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TATTGCAGGAATTAAAAAGGA	0.473																																					p.I1165F		Atlas-SNP	.											NBPF10,NS,carcinoma,0,7	NBPF10	221	7	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.A3493T						scavenged	.																																			SO:0001583	missense	100132406	exon27			GCAGGAATTAAAA	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.3493A>T	1.37:g.145323656A>T	ENSP00000345684:p.Ile1165Phe	Somatic	31	1	0.0322581		WXS	Illumina HiSeq	Phase_I	28	5	0.178571	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	7.524	0.657305	0.14580	.	.	ENSG00000163386	ENST00000342960	T	0.03441	3.93	.	.	.	.	.	.	.	.	T	0.02342	0.0072	M	0.67953	2.075	0.09310	N	1	.	.	.	.	.	.	T	0.44065	-0.9352	5	0.28530	T	0.3	.	.	.	.	.	.	.	.	F	1165	ENSP00000345684:I1165F	ENSP00000345684:I1165F	I	+	1	0	NBPF10	144035013	0.353000	0.24904	0.005000	0.12908	0.123000	0.20343	1.122000	0.31295	0.386000	0.24997	0.128000	0.15822	ATT	A|0.625;T|0.375	0.375	strong		0.473	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
OLFML2B	25903	hgsc.bcm.edu	37	1	161953800	161953800	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:161953800C>T	ENST00000294794.3	-	8	2341	c.1918G>A	c.(1918-1920)Ggc>Agc	p.G640S	OLFML2B_ENST00000367938.1_Missense_Mutation_p.G123S|OLFML2B_ENST00000367940.2_Missense_Mutation_p.G641S	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	640	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			TGGCTGAAGCCCTCATCGTCC	0.617																																					p.G640S		Atlas-SNP	.											OLFML2B,NS,carcinoma,+2,1	OLFML2B	114	1	0			c.G1918A						scavenged	.						78.0	69.0	72.0					1																	161953800		2203	4300	6503	SO:0001583	missense	25903	exon8			TGAAGCCCTCATC	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1918G>A	1.37:g.161953800C>T	ENSP00000294794:p.Gly640Ser	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	106	3	0.0283019	NM_015441	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	37	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083611	0.76642	.	.	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	D;D;D	0.89552	-2.53;-2.53;-2.53	5.36	4.45	0.53987	Olfactomedin-like (3);	.	.	.	.	D	0.91978	0.7459	M	0.77616	2.38	0.45914	D	0.998750	D;D	0.76494	0.999;0.998	D;D	0.76575	0.988;0.975	D	0.92955	0.6384	8	0.62326	D	0.03	.	11.6895	0.51508	0.0:0.9134:0.0:0.0866	.	641;640	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	S	640;641;123	ENSP00000294794:G640S;ENSP00000356917:G641S;ENSP00000356915:G123S	ENSP00000294794:G640S	G	-	1	0	OLFML2B	160220424	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	4.560000	0.60802	1.244000	0.43870	0.561000	0.74099	GGC	.	.	none		0.617	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
CDH16	1014	hgsc.bcm.edu	37	16	66944286	66944286	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:66944286G>A	ENST00000299752.4	-	15	2237	c.2044C>T	c.(2044-2046)Cat>Tat	p.H682Y	CDH16_ENST00000394055.3_Missense_Mutation_p.H660Y|CDH16_ENST00000570262.1_Missense_Mutation_p.H602Y|CDH16_ENST00000568632.1_Missense_Mutation_p.H585Y|CDH16_ENST00000565796.1_Missense_Mutation_p.H643Y	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	682	Ectodomain G.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		ATCAAGCCATGGTCTTGGCGG	0.632																																					p.H682Y		Atlas-SNP	.											.	CDH16	91	.	0			c.C2044T						PASS	.						111.0	113.0	112.0					16																	66944286		2200	4300	6500	SO:0001583	missense	1014	exon15			AGCCATGGTCTTG	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.2044C>T	16.37:g.66944286G>A	ENSP00000299752:p.His682Tyr	Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	135	25	0.185185	NM_004062	B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	ENST00000299752.4	37	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	G	0.692	-0.794195	0.02862	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.55234	0.53;0.53	4.61	2.56	0.30785	.	0.293204	0.32884	N	0.005525	T	0.29491	0.0735	L	0.31294	0.92	0.25809	N	0.984415	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.26538	-1.0100	10	0.02654	T	1	-0.7022	4.7712	0.13157	0.3365:0.0:0.6635:0.0	.	660;682;682	O75309-2;B2R7S8;O75309	.;.;CAD16_HUMAN	Y	660;682;646	ENSP00000377619:H660Y;ENSP00000299752:H682Y	ENSP00000299752:H682Y	H	-	1	0	CDH16	65501787	0.596000	0.26866	0.456000	0.27044	0.193000	0.23685	1.826000	0.39092	0.477000	0.27464	0.455000	0.32223	CAT	.	.	none		0.632	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	
PRDM9	56979	hgsc.bcm.edu	37	5	23526430	23526430	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:23526430C>T	ENST00000296682.3	+	11	1415	c.1233C>T	c.(1231-1233)caC>caT	p.H411H		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	411					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AACGCAATCACTCCTCTCAGA	0.483										HNSCC(3;0.000094)																											p.H411H		Atlas-SNP	.											.	PRDM9	344	.	0			c.C1233T						PASS	.						131.0	123.0	126.0					5																	23526430		2203	4300	6503	SO:0001819	synonymous_variant	56979	exon11			CAATCACTCCTCT	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1233C>T	5.37:g.23526430C>T		Somatic	240	0	0		WXS	Illumina HiSeq	Phase_I	231	38	0.164502	NM_020227	B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	CCDS43307.1																																																																																			.	.	none		0.483	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
AHNAK2	113146	hgsc.bcm.edu	37	14	105412770	105412770	+	Silent	SNP	C	C	T	rs372139093		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:105412770C>T	ENST00000333244.5	-	7	9137	c.9018G>A	c.(9016-9018)ccG>ccA	p.P3006P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3006						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCTCCACCTTCGGCGCAGACA	0.597																																					p.P3006P		Atlas-SNP	.											AHNAK2_ENST00000333244,NS,carcinoma,0,1	AHNAK2	719	1	0			c.G9018A						scavenged	.						219.0	230.0	227.0					14																	105412770		2011	4151	6162	SO:0001819	synonymous_variant	113146	exon7			CACCTTCGGCGCA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9018G>A	14.37:g.105412770C>T		Somatic	287	0	0		WXS	Illumina HiSeq	Phase_I	256	3	0.0117188	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.	.	alt		0.597	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
MAPK7	5598	hgsc.bcm.edu	37	17	19285517	19285517	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:19285517C>T	ENST00000308406.5	+	5	2287	c.1901C>T	c.(1900-1902)cCa>cTa	p.P634L	MAPK7_ENST00000395604.3_Missense_Mutation_p.P634L|MAPK7_ENST00000571657.1_Intron|MAPK7_ENST00000395602.4_Missense_Mutation_p.P634L|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000299612.7_Missense_Mutation_p.P495L	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	634	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.|Pro-rich.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)			autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					CCTGCCTGCCCACCCCCTGGC	0.706																																					p.P634L		Atlas-SNP	.											.	MAPK7	72	.	0			c.C1901T						PASS	.						17.0	18.0	18.0					17																	19285517		2190	4285	6475	SO:0001583	missense	5598	exon5			CCTGCCCACCCCC	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1901C>T	17.37:g.19285517C>T	ENSP00000311005:p.Pro634Leu	Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	59	13	0.220339	NM_002749	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	C	9.264	1.043860	0.19748	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.77489	-0.78;-1.1;-0.78;-0.78	4.87	2.72	0.32119	.	0.502080	0.21467	N	0.074080	T	0.55130	0.1901	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49952	-0.8884	10	0.59425	D	0.04	-0.6152	6.3873	0.21568	0.1809:0.7178:0.0:0.1013	.	634	Q13164	MK07_HUMAN	L	634;495;634;634	ENSP00000311005:P634L;ENSP00000299612:P495L;ENSP00000378968:P634L;ENSP00000378966:P634L	ENSP00000299612:P495L	P	+	2	0	MAPK7	19226110	0.001000	0.12720	0.025000	0.17156	0.710000	0.40934	0.264000	0.18497	1.174000	0.42811	0.313000	0.20887	CCA	.	.	none		0.706	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033	
NCAPD3	23310	hgsc.bcm.edu	37	11	134055332	134055332	+	Missense_Mutation	SNP	G	G	A	rs143833204	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:134055332G>A	ENST00000534548.2	-	17	2199	c.2135C>T	c.(2134-2136)aCg>aTg	p.T712M	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	712					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.T712M(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CGAATGTTCCGTGCCAGTGTG	0.423													G|||	5	0.000998403	0.0015	0.0029	5008	,	,		17054	0.001		0.0	False		,,,				2504	0.0				p.T712M		Atlas-SNP	.											NCAPD3,NS,carcinoma,0,1	NCAPD3	141	1	1	Substitution - Missense(1)	endometrium(1)	c.C2135T						scavenged	.	G	MET/THR	5,4397	9.9+/-24.2	0,5,2196	97.0	96.0	96.0		2135	1.8	0.3	11	dbSNP_134	96	0,8594		0,0,4297	yes	missense	NCAPD3	NM_015261.2	81	0,5,6493	AA,AG,GG		0.0,0.1136,0.0385	benign	712/1499	134055332	5,12991	2201	4297	6498	SO:0001583	missense	23310	exon17			TGTTCCGTGCCAG	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2135C>T	11.37:g.134055332G>A	ENSP00000433681:p.Thr712Met	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	107	2	0.0186916	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	10.35	1.326484	0.24080	0.001136	0.0	ENSG00000151503	ENST00000534548	T	0.26810	1.71	5.94	1.83	0.25207	Armadillo-type fold (1);	0.245360	0.48286	N	0.000184	T	0.23846	0.0577	M	0.67953	2.075	0.80722	D	1	B	0.24186	0.099	B	0.17979	0.02	T	0.04203	-1.0969	10	0.54805	T	0.06	-4.1569	7.0072	0.24844	0.1965:0.0:0.6796:0.1238	.	712	P42695	CNDD3_HUMAN	M	712	ENSP00000433681:T712M	ENSP00000431612:T712M	T	-	2	0	NCAPD3	133560542	1.000000	0.71417	0.294000	0.24946	0.365000	0.29674	3.753000	0.55180	0.073000	0.16731	-1.000000	0.02509	ACG	G|0.999;A|0.001	0.001	strong		0.423	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
DSCR4	10281	hgsc.bcm.edu	37	21	39493346	39493346	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr21:39493346A>G	ENST00000328264.3	-	1	108	c.4T>C	c.(4-6)Tcg>Ccg	p.S2P	DSCR4_ENST00000398948.1_Missense_Mutation_p.S2P|DSCR8_ENST00000400477.3_5'Flank|DSCR8_ENST00000357704.4_5'Flank	NM_005867.2	NP_005858.1	P56555	DSCR4_HUMAN	Down syndrome critical region gene 4	2										large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	6						atgattaacgacatggacaca	0.498																																					p.S2P		Atlas-SNP	.											.	DSCR4	20	.	0			c.T4C						PASS	.						95.0	84.0	88.0					21																	39493346		2203	4300	6503	SO:0001583	missense	10281	exon1			TTAACGACATGGA	AB000099	CCDS33554.1	21q22.2	2012-04-19			ENSG00000184029	ENSG00000184029			3045	protein-coding gene	gene with protein product		604829				9455479	Standard	NM_005867		Approved	DCRB	uc002ywp.3	P56555	OTTHUMG00000086673	ENST00000328264.3:c.4T>C	21.37:g.39493346A>G	ENSP00000328676:p.Ser2Pro	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	58	15	0.258621	NM_005867	Q4VB31	Missense_Mutation	SNP	ENST00000328264.3	37	CCDS33554.1	.	.	.	.	.	.	.	.	.	.	A	6.972	0.549360	0.13374	.	.	ENSG00000184029	ENST00000398948;ENST00000328264	.	.	.	0.235	0.235	0.15431	.	.	.	.	.	T	0.51210	0.1661	.	.	.	0.09310	N	1	P	0.51449	0.945	P	0.57425	0.82	T	0.40156	-0.9578	6	0.87932	D	0	.	.	.	.	.	2	P56555	DSCR4_HUMAN	P	2	.	ENSP00000328676:S2P	S	-	1	0	DSCR4	38415216	0.003000	0.15002	0.015000	0.15790	0.015000	0.08874	-0.597000	0.05713	0.263000	0.21812	0.260000	0.18958	TCG	.	.	none		0.498	DSCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000194834.1	NM_005867	
PLK4	10733	hgsc.bcm.edu	37	4	128807324	128807324	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:128807324C>T	ENST00000270861.5	+	5	1073	c.799C>T	c.(799-801)Cga>Tga	p.R267*	PLK4_ENST00000514379.1_Nonsense_Mutation_p.R226*|PLK4_ENST00000507249.1_Nonsense_Mutation_p.R267*|PLK4_ENST00000515069.1_Nonsense_Mutation_p.R267*|PLK4_ENST00000513090.1_Nonsense_Mutation_p.R235*	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	267					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R267R(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						TTTTATGTCCCGAAATTCTTC	0.393																																					p.R267X	Colon(135;508 1718 19061 31832 42879)	Atlas-SNP	.											PLK4,NS,carcinoma,-1,1	PLK4	65	1	1	Substitution - coding silent(1)	lung(1)	c.C799T						scavenged	.						104.0	108.0	107.0					4																	128807324		2203	4300	6503	SO:0001587	stop_gained	10733	exon5			ATGTCCCGAAATT	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.799C>T	4.37:g.128807324C>T	ENSP00000270861:p.Arg267*	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	217	3	0.0138249	NM_014264	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Nonsense_Mutation	SNP	ENST00000270861.5	37	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	C	37	6.232566	0.97399	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379	.	.	.	5.88	3.01	0.34805	.	0.719377	0.14186	N	0.335687	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.3305	3.3227	0.07056	0.353:0.3563:0.2125:0.0782	.	.	.	.	X	267;267;235;267;226	.	ENSP00000270861:R267X	R	+	1	2	PLK4	129026774	0.970000	0.33590	0.826000	0.32828	0.991000	0.79684	1.517000	0.35867	0.768000	0.33290	0.655000	0.94253	CGA	.	.	none		0.393	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
MUC4	4585	hgsc.bcm.edu	37	3	195506569	195506569	+	Missense_Mutation	SNP	A	A	G	rs201891747	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:195506569A>G	ENST00000463781.3	-	2	12341	c.11882T>C	c.(11881-11883)gTa>gCa	p.V3961A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V3961A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAGT	0.592													.|||	988	0.197284	0.1755	0.2075	5008	,	,		8418	0.0804		0.336	False		,,,				2504	0.1973				p.V3961A		Atlas-SNP	.											MUC4_ENST00000463781,NS,lymphoid_neoplasm,0,1	MUC4	1505	1	0			c.T11882C						scavenged	.						17.0	11.0	13.0					3																	195506569		677	1513	2190	SO:0001583	missense	4585	exon2			GTGGATACTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11882T>C	3.37:g.195506569A>G	ENSP00000417498:p.Val3961Ala	Somatic	35	9	0.257143		WXS	Illumina HiSeq	Phase_I	37	16	0.432432	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	0.974	-0.699236	0.03279	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.36;1.3	.	.	.	.	.	.	.	.	T	0.16642	0.0400	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.18935	-1.0321	7	.	.	.	6.9246	3.9397	0.09321	0.6657:0.0:0.3343:0.0	.	3833	E7ESK3	.	A	3961	ENSP00000417498:V3961A;ENSP00000420243:V3961A	.	V	-	2	0	MUC4	196991348	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-4.523000	0.00221	-2.036000	0.00922	-2.094000	0.00368	GTA	.	.	weak		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LAMA4	3910	hgsc.bcm.edu	37	6	112537639	112537639	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:112537639G>A	ENST00000230538.7	-	3	624	c.227C>T	c.(226-228)tCg>tTg	p.S76L	LAMA4_ENST00000522006.1_Missense_Mutation_p.S76L|LAMA4_ENST00000431543.2_Missense_Mutation_p.S76L|LAMA4_ENST00000389463.4_Missense_Mutation_p.S76L|LAMA4_ENST00000424408.2_Missense_Mutation_p.S76L|RP1-142L7.9_ENST00000603682.1_lincRNA|LAMA4_ENST00000524032.1_5'UTR	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	76					blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		ACATTCTCCCGACAGGGTGTG	0.433																																					p.S76L		Atlas-SNP	.											.	LAMA4	227	.	0			c.C227T						PASS	.						111.0	93.0	99.0					6																	112537639		2203	4300	6503	SO:0001583	missense	3910	exon3			TCTCCCGACAGGG		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.227C>T	6.37:g.112537639G>A	ENSP00000230538:p.Ser76Leu	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	100	25	0.25	NM_001105206	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819282	0.50633	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408;ENST00000454881;ENST00000521398;ENST00000542588;ENST00000368639;ENST00000519932;ENST00000431543;ENST00000243219;ENST00000521690	T;T;T;T;T;D;D	0.97731	2.5;2.49;2.49;2.49;1.6;-4.51;-4.51	5.84	5.84	0.93424	.	0.216402	0.41001	D	0.000980	D	0.96917	0.8993	N	0.24115	0.695	0.80722	D	1	D;P;D	0.89917	1.0;0.916;0.998	D;P;D	0.74023	0.964;0.541;0.982	D	0.96804	0.9591	10	0.38643	T	0.18	.	17.6392	0.88130	0.0:0.0:1.0:0.0	.	76;76;76	Q6LET9;Q16363;Q16363-2	.;LAMA4_HUMAN;.	L	76	ENSP00000230538:S76L;ENSP00000429488:S76L;ENSP00000374114:S76L;ENSP00000416470:S76L;ENSP00000430336:S76L;ENSP00000428583:S76L;ENSP00000412136:S76L	ENSP00000230538:S76L	S	-	2	0	LAMA4	112644332	0.998000	0.40836	0.238000	0.24106	0.008000	0.06430	6.253000	0.72453	2.748000	0.94277	0.650000	0.86243	TCG	.	.	none		0.433	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
ZNF141	7700	hgsc.bcm.edu	37	4	367267	367267	+	Silent	SNP	T	T	C	rs201021508	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:367267T>C	ENST00000240499.7	+	4	1190	c.1041T>C	c.(1039-1041)gcT>gcC	p.A347A	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	347					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						GTGGCAAAGCTTTTAGACAGT	0.423													t|||	135	0.0269569	0.0219	0.0259	5008	,	,		21511	0.0169		0.0169	False		,,,				2504	0.0552				p.A347A		Atlas-SNP	.											ZNF141,rectum,carcinoma,0,1	ZNF141	48	1	0			c.T1041C						scavenged	.						41.0	44.0	43.0					4																	367267		2202	4299	6501	SO:0001819	synonymous_variant	7700	exon4			CAAAGCTTTTAGA	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.1041T>C	4.37:g.367267T>C		Somatic	32	1	0.03125		WXS	Illumina HiSeq	Phase_I	42	4	0.0952381	NM_003441	Q6DK07	Silent	SNP	ENST00000240499.7	37	CCDS33931.1																																																																																			T|0.999;C|0.001	0.001	weak		0.423	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
OR10H1	26539	hgsc.bcm.edu	37	19	15918678	15918678	+	Missense_Mutation	SNP	G	G	A	rs201182090	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:15918678G>A	ENST00000334920.2	-	1	258	c.170C>T	c.(169-171)aCg>aTg	p.T57M		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						GTACATGGGCGTGTGGAGGCT	0.632																																					p.T57M		Atlas-SNP	.											OR10H1,NS,carcinoma,+1,4	OR10H1	59	4	0			c.C170T						scavenged	.						112.0	97.0	102.0					19																	15918678		2203	4300	6503	SO:0001583	missense	26539	exon1			ATGGGCGTGTGGA	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.170C>T	19.37:g.15918678G>A	ENSP00000335596:p.Thr57Met	Somatic	308	2	0.00649351		WXS	Illumina HiSeq	Phase_I	237	7	0.0295359	NM_013940	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	37	CCDS12335.1	.	.	.	.	.	.	.	.	.	.	g	12.04	1.820067	0.32145	.	.	ENSG00000186723	ENST00000334920	T	0.01113	5.32	4.47	2.34	0.29019	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000093	T	0.02119	0.0066	M	0.88450	2.955	0.22354	N	0.999172	P	0.42556	0.783	B	0.32342	0.144	T	0.39981	-0.9587	10	0.72032	D	0.01	.	8.5187	0.33262	0.1944:0.0:0.8056:0.0	.	57	Q9Y4A9	O10H1_HUMAN	M	57	ENSP00000335596:T57M	ENSP00000335596:T57M	T	-	2	0	OR10H1	15779678	0.204000	0.23447	0.905000	0.35620	0.898000	0.52572	0.506000	0.22658	0.351000	0.24027	0.643000	0.83706	ACG	G|0.980;A|0.020	0.020	strong		0.632	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		
RNF166	115992	hgsc.bcm.edu	37	16	88766062	88766062	+	Missense_Mutation	SNP	C	C	T	rs144508728		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:88766062C>T	ENST00000312838.4	-	3	486	c.391G>A	c.(391-393)Gtc>Atc	p.V131I	RNF166_ENST00000568683.1_Missense_Mutation_p.V22I|RNF166_ENST00000562499.1_5'Flank|RNF166_ENST00000541206.2_Missense_Mutation_p.V22I|RNF166_ENST00000537718.2_Missense_Mutation_p.V22I|RP5-1142A6.5_ENST00000561699.1_RNA|RNF166_ENST00000567844.1_Missense_Mutation_p.V50I	NM_178841.3	NP_849163.1	Q96A37	RN166_HUMAN	ring finger protein 166	131							zinc ion binding (GO:0008270)			endometrium(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0476)		ACCACGGGGACGAACTTGGGG	0.622																																					p.V131I		Atlas-SNP	.											.	RNF166	3	.	0			c.G391A						PASS	.	C	ILE/VAL,ILE/VAL,ILE/VAL	1,4393	2.1+/-5.4	0,1,2196	135.0	105.0	115.0		148,64,391	4.6	1.0	16	dbSNP_134	115	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense	RNF166	NM_001171815.1,NM_001171816.1,NM_178841.3	29,29,29	0,2,6494	TT,TC,CC		0.0116,0.0228,0.0154	benign,benign,benign	50/157,22/129,131/238	88766062	2,12990	2197	4299	6496	SO:0001583	missense	115992	exon3			CGGGGACGAACTT	AK057106	CCDS10969.1, CCDS54056.1, CCDS54057.1	16q24.3	2013-01-09			ENSG00000158717	ENSG00000158717		"""RING-type (C3HC4) zinc fingers"""	28856	protein-coding gene	gene with protein product						12477932	Standard	NM_178841		Approved	MGC2647, MGC14381	uc002flk.3	Q96A37	OTTHUMG00000137863	ENST00000312838.4:c.391G>A	16.37:g.88766062C>T	ENSP00000326095:p.Val131Ile	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	99	4	0.040404	NM_178841	B3KQ03|D3DX75|H3BTU8|Q96DM0	Missense_Mutation	SNP	ENST00000312838.4	37	CCDS10969.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905259	0.52333	2.28E-4	1.16E-4	ENSG00000158717	ENST00000312838;ENST00000537718;ENST00000541206	T	0.15718	2.4	4.57	4.57	0.56435	.	0.136393	0.49305	D	0.000153	T	0.07954	0.0199	N	0.14661	0.345	0.44309	D	0.997187	P	0.44659	0.84	B	0.25405	0.06	T	0.35500	-0.9786	10	0.18710	T	0.47	-28.0268	16.9747	0.86310	0.0:1.0:0.0:0.0	.	131	Q96A37	RN166_HUMAN	I	131;50;22	ENSP00000326095:V131I	ENSP00000326095:V131I	V	-	1	0	RNF166	87293563	0.998000	0.40836	0.987000	0.45799	0.967000	0.64934	3.918000	0.56432	2.115000	0.64714	0.313000	0.20887	GTC	C|1.000;T|0.000	0.000	weak		0.622	RNF166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269544.1	NM_178841	
FAM175B	23172	hgsc.bcm.edu	37	10	126508012	126508012	+	Missense_Mutation	SNP	G	G	A	rs377610141		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr10:126508012G>A	ENST00000298492.5	+	4	305	c.260G>A	c.(259-261)cGg>cAg	p.R87Q		NM_032182.3	NP_115558.3	Q15018	F175B_HUMAN	family with sequence similarity 175, member B	87	MPN-like.				cellular response to freezing (GO:0071497)	BRISC complex (GO:0070552)|cytoplasm (GO:0005737)	polyubiquitin binding (GO:0031593)			NS(1)	1						CTTAAAGATCGGAGAAAGGTA	0.353																																					p.R87Q		Atlas-SNP	.											FAM175B_ENST00000298492,NS,carcinoma,+1,1	FAM175B	39	1	0			c.G260A						scavenged	.	G	GLN/ARG	0,3704		0,0,1852	205.0	192.0	196.0		260	5.1	1.0	10		196	1,8197		0,1,4098	no	missense	FAM175B	NM_032182.3	43	0,1,5950	AA,AG,GG		0.0122,0.0,0.0084	probably-damaging	87/416	126508012	1,11901	1852	4099	5951	SO:0001583	missense	23172	exon4			AAGATCGGAGAAA	D63877	CCDS31308.2	10q26.2	2013-01-24	2008-07-02	2008-07-02	ENSG00000165660	ENSG00000165660			28975	protein-coding gene	gene with protein product	"""Abraxas brother"""	611144	"""KIAA0157"""	KIAA0157		8590280	Standard	NM_032182		Approved	Em:AC068896.4, ABRO1	uc001lib.4	Q15018	OTTHUMG00000019218	ENST00000298492.5:c.260G>A	10.37:g.126508012G>A	ENSP00000298492:p.Arg87Gln	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	130	4	0.0307692	NM_032182	B4DKR2|Q96H11	Missense_Mutation	SNP	ENST00000298492.5	37	CCDS31308.2	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812787	0.70912	0.0	1.22E-4	ENSG00000165660	ENST00000298492	T	0.41400	1.0	6.04	5.14	0.70334	.	0.072630	0.56097	D	0.000025	T	0.38268	0.1034	L	0.52364	1.645	0.52501	D	0.999955	D	0.56521	0.976	B	0.42422	0.387	T	0.17715	-1.0360	10	0.18710	T	0.47	-4.5542	15.0721	0.72046	0.0673:0.0:0.9327:0.0	.	87	Q15018	F175B_HUMAN	Q	87	ENSP00000298492:R87Q	ENSP00000298492:R87Q	R	+	2	0	FAM175B	126498002	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.201000	0.72124	1.571000	0.49722	0.561000	0.74099	CGG	.	.	none		0.353	FAM175B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050891.2	NM_032182	
KLRC3	3823	hgsc.bcm.edu	37	12	10588444	10588444	+	Missense_Mutation	SNP	G	G	C	rs111237999	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:10588444G>C	ENST00000539033.1	-	1	156	c.142C>G	c.(142-144)Cct>Gct	p.P48A	KLRC2_ENST00000536833.2_Intron|KLRC2_ENST00000381901.1_Missense_Mutation_p.P48A|KLRC2_ENST00000381902.2_Missense_Mutation_p.P48A																							TTCAGGGAAGGATTTTGAAGA	0.363													G|||	125	0.0249601	0.0386	0.0101	5008	,	,		16153	0.0298		0.0268	False		,,,				2504	0.0102				p.P48A		Atlas-SNP	.											KLRC2,NS,carcinoma,+1,1	KLRC2	29	1	0			c.C142G						scavenged	.						94.0	104.0	101.0					12																	10588444		1994	3988	5982	SO:0001583	missense	3822	exon1			GGGAAGGATTTTG																												ENST00000539033.1:c.142C>G	12.37:g.10588444G>C	ENSP00000437563:p.Pro48Ala	Somatic	231	19	0.0822511		WXS	Illumina HiSeq	Phase_I	292	28	0.0958904	NM_002260		Missense_Mutation	SNP	ENST00000539033.1	37		.	.	.	.	.	.	.	.	.	.	G	0	-2.662523	0.00107	.	.	ENSG00000255641;ENSG00000205809;ENSG00000205809	ENST00000539033;ENST00000381902;ENST00000381901	T;T;T	0.04119	3.7;3.7;3.7	2.57	-1.4	0.08968	.	0.714893	0.12708	N	0.445758	T	0.01222	0.0040	N	0.00637	-1.305	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.46925	-0.9156	10	0.02654	T	1	.	9.8776	0.41213	0.0:0.3246:0.6754:0.0	rs34194304	34;48;48	Q3KQS7;P26717;F5H6K3	.;NKG2C_HUMAN;.	A	48	ENSP00000437563:P48A;ENSP00000371327:P48A;ENSP00000371326:P48A	ENSP00000371326:P48A	P	-	1	0	KLRC2;RP11-277P12.6	10479711	0.000000	0.05858	0.020000	0.16555	0.010000	0.07245	-0.911000	0.04050	-0.034000	0.13713	-1.406000	0.01132	CCT	.	.	weak		0.363	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000400274.1		
LRRC37A2	474170	hgsc.bcm.edu	37	17	44630768	44630768	+	Missense_Mutation	SNP	A	A	G	rs200445221		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:44630768A>G	ENST00000576629.1	+	12	5307	c.4812A>G	c.(4810-4812)atA>atG	p.I1604M	ARL17A_ENST00000445552.2_Intron|ARL17A_ENST00000337845.7_Intron|LRRC37A2_ENST00000333412.3_Missense_Mutation_p.I1604M|ARL17A_ENST00000329240.4_Intron|ARL17A_ENST00000573185.1_Intron|ARL17A_ENST00000570550.1_Intron			A6NM11	L37A2_HUMAN	leucine rich repeat containing 37, member A2	1604						integral component of membrane (GO:0016021)		p.I1604M(2)		endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|pancreas(4)|prostate(2)	15		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TAAAACAGATATGTTGTCACC	0.338																																					p.I1604M		Atlas-SNP	.											LRRC37A2,NS,carcinoma,0,2	LRRC37A2	37	2	2	Substitution - Missense(2)	prostate(2)	c.A4812G						scavenged	.						66.0	120.0	102.0					17																	44630768		2198	4293	6491	SO:0001583	missense	474170	exon11			ACAGATATGTTGT	AY386262	CCDS42353.1	17q21.31	2013-05-14			ENSG00000238083	ENSG00000238083			32404	protein-coding gene	gene with protein product	"""c114 SLIT-like testicular protein"""						Standard	NM_001006607		Approved	FLJ45049	uc002ikn.1	A6NM11	OTTHUMG00000178032	ENST00000576629.1:c.4812A>G	17.37:g.44630768A>G	ENSP00000459551:p.Ile1604Met	Somatic	1038	9	0.00867052		WXS	Illumina HiSeq	Phase_I	1189	17	0.0142977	NM_001006607	B7ZMC3	Missense_Mutation	SNP	ENST00000576629.1	37	CCDS42353.1	.	.	.	.	.	.	.	.	.	.	a	11.80	1.747925	0.30955	.	.	ENSG00000238083	ENST00000333412	T	0.53857	0.6	2.45	1.28	0.21552	.	.	.	.	.	T	0.60792	0.2296	L	0.53249	1.67	0.20307	N	0.999911	D;D	0.89917	1.0;0.997	D;D	0.80764	0.994;0.916	T	0.48958	-0.8988	9	0.87932	D	0	.	3.1223	0.06395	0.2434:0.0:0.2508:0.5058	.	565;1604	B3KRJ4;A6NM11	.;L37A2_HUMAN	M	1604	ENSP00000333071:I1604M	ENSP00000333071:I1604M	I	+	3	3	LRRC37A2	41986084	0.009000	0.17119	0.240000	0.24138	0.009000	0.06853	-0.890000	0.04140	-0.033000	0.13736	-1.974000	0.00461	ATA	.	.	alt		0.338	LRRC37A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440299.2	NM_001006607	
KIF24	347240	hgsc.bcm.edu	37	9	34311190	34311190	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:34311190T>C	ENST00000402558.2	-	1	179	c.155A>G	c.(154-156)aAa>aGa	p.K52R	KIF24_ENST00000379166.2_Missense_Mutation_p.K52R|KIF24_ENST00000379174.3_Missense_Mutation_p.K52R|KIF24_ENST00000345050.2_Missense_Mutation_p.K52R			Q5T7B8	KIF24_HUMAN	kinesin family member 24	52	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			GAAGAGACGTTTGCGGTCGTT	0.413																																					p.K52R		Atlas-SNP	.											KIF24,NS,carcinoma,+1,2	KIF24	64	2	0			c.A155G						scavenged	.						108.0	98.0	101.0					9																	34311190		1880	4115	5995	SO:0001583	missense	347240	exon2			AGACGTTTGCGGT	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.155A>G	9.37:g.34311190T>C	ENSP00000384433:p.Lys52Arg	Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	174	2	0.0114943	NM_194313	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	CCDS6551.2	.	.	.	.	.	.	.	.	.	.	T	13.00	2.106809	0.37145	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	5.48	4.35	0.52113	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.42821	D	0.000652	T	0.51109	0.1655	N	0.17082	0.46	0.29168	N	0.877346	D;D	0.57899	0.976;0.981	P;P	0.57101	0.629;0.813	T	0.43360	-0.9396	10	0.21014	T	0.42	.	10.7788	0.46365	0.0:0.0741:0.0:0.9259	.	52;52	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	R	52	ENSP00000384433:K52R;ENSP00000368472:K52R;ENSP00000368464:K52R;ENSP00000340179:K52R	ENSP00000340179:K52R	K	-	2	0	KIF24	34301190	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.920000	0.56446	2.089000	0.63090	0.528000	0.53228	AAA	.	.	none		0.413	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5		
FUBP1	8880	hgsc.bcm.edu	37	1	78429757	78429757	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:78429757C>T	ENST00000370768.2	-	12	1112	c.1031G>A	c.(1030-1032)cGa>cAa	p.R344Q	FUBP1_ENST00000436586.2_Missense_Mutation_p.R365Q|FUBP1_ENST00000370767.1_Missense_Mutation_p.R344Q	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	344					positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						CTGAACACTTCGAAGAAGGTC	0.358			"""F, N"""		oligodendroglioma																																p.R344Q		Atlas-SNP	.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	FUBP1_ENST00000370768,colon,carcinoma,-1,1	FUBP1	112	1	0			c.G1031A						scavenged	.						193.0	184.0	187.0					1																	78429757		2203	4300	6503	SO:0001583	missense	8880	exon12			ACACTTCGAAGAA	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1031G>A	1.37:g.78429757C>T	ENSP00000359804:p.Arg344Gln	Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	190	4	0.0210526	NM_003902	Q12828	Missense_Mutation	SNP	ENST00000370768.2	37	CCDS683.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.604263	0.46423	.	.	ENSG00000162613	ENST00000370773;ENST00000370767;ENST00000370768;ENST00000394922;ENST00000436586	T;T;T	0.44083	0.93;0.93;0.93	5.81	5.81	0.92471	K Homology (1);	0.000000	0.85682	D	0.000000	T	0.09555	0.0235	N	0.03324	-0.35	0.80722	D	1	B;B	0.33494	0.414;0.119	B;B	0.19391	0.025;0.015	T	0.17776	-1.0358	10	0.10902	T	0.67	-15.3337	20.0643	0.97702	0.0:1.0:0.0:0.0	.	365;344	B4DT31;Q96AE4	.;FUBP1_HUMAN	Q	343;344;344;343;365	ENSP00000359803:R344Q;ENSP00000359804:R344Q;ENSP00000389536:R365Q	ENSP00000294623:R343Q	R	-	2	0	FUBP1	78202345	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.907000	0.69908	2.737000	0.93849	0.650000	0.86243	CGA	.	.	none		0.358	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346595	39346595	+	Missense_Mutation	SNP	T	T	A	rs377187211|rs148036927|rs11283848	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:39346595T>A	ENST00000398470.1	+	1	457	c.457T>A	c.(457-459)Tgc>Agc	p.C153S	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_Missense_Mutation_p.C70S	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	153	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)		p.T152_C153>S(2)		breast(1)|lung(3)	4						CCAGCCCACCTGCTGTGGGTC	0.582																																					p.C153S		Atlas-SNP	.											KRTAP9-1_ENST00000398470,rectum,carcinoma,0,2	KRTAP9-1	34	2	2	Complex - deletion inframe(2)	breast(2)	c.T457A						PASS	.																																			SO:0001583	missense	728318	exon1			CCCACCTGCTGTG	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.457T>A	17.37:g.39346595T>A	ENSP00000381488:p.Cys153Ser	Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	71	10	0.140845	NM_001190460		Missense_Mutation	SNP	ENST00000398470.1	37	CCDS56029.1	.	.	.	.	.	.	.	.	.	.	T	11.97	1.796850	0.31777	.	.	ENSG00000240542	ENST00000398470;ENST00000318329	T;T	0.02085	4.46;6.06	3.56	2.46	0.29980	.	.	.	.	.	T	0.06234	0.0161	M	0.73430	2.235	0.09310	N	0.999998	.	.	.	.	.	.	T	0.15636	-1.0430	7	0.51188	T	0.08	.	7.8228	0.29296	0.1856:0.0:0.0:0.8144	.	.	.	.	S	153;70	ENSP00000381488:C153S;ENSP00000325023:C70S	ENSP00000325023:C70S	C	+	1	0	KRTAP9-1	36600121	0.004000	0.15560	0.064000	0.19789	0.084000	0.17831	0.909000	0.28558	0.705000	0.31890	0.338000	0.21704	TGC	.	.	none		0.582	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
IGLL5	100423062	hgsc.bcm.edu	37	22	23230365	23230365	+	Silent	SNP	A	A	T	rs559053132	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:23230365A>T	ENST00000526893.1	+	1	406	c.132A>T	c.(130-132)gcA>gcT	p.A44A	IGLL5_ENST00000531372.1_Silent_p.A44A|IGLL5_ENST00000532223.2_Silent_p.A44A|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	44						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CAATGGTTGCACCGCAAAGCG	0.677																																					p.H9L		Atlas-SNP	.											.	IGLL5	26	.	0			c.A26T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GGTTGCACCGCAA	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.132A>T	22.37:g.23230365A>T		Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	114	28	0.245614	NM_001256296		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.677	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
OR5H6	79295	hgsc.bcm.edu	37	3	97983269	97983269	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:97983269C>A	ENST00000383696.2	+	1	182	c.141C>A	c.(139-141)ttC>ttA	p.F47L	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TCCTGGCATTCTTGGTAATAT	0.413																																					p.F47L		Atlas-SNP	.											OR5H6,bladder,carcinoma,0,1	OR5H6	89	1	0			c.C141A						PASS	.						207.0	217.0	213.0					3																	97983269		2203	4299	6502	SO:0001583	missense	79295	exon1			GGCATTCTTGGTA	BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.141C>A	3.37:g.97983269C>A	ENSP00000373196:p.Phe47Leu	Somatic	261	0	0		WXS	Illumina HiSeq	Phase_I	296	74	0.25	NM_001005479	Q6IF88	Missense_Mutation	SNP	ENST00000383696.2	37	CCDS33800.1	.	.	.	.	.	.	.	.	.	.	-	13.32	2.202696	0.38905	.	.	ENSG00000230301	ENST00000383696	T	0.04454	3.62	2.19	0.231	0.15377	.	0.000000	0.44902	D	0.000416	T	0.13756	0.0333	M	0.66297	2.02	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.02533	-1.1145	10	0.72032	D	0.01	.	6.0007	0.19519	0.0:0.6814:0.0:0.3186	.	47	Q8NGV6	OR5H6_HUMAN	L	47	ENSP00000373196:F47L	ENSP00000373196:F47L	F	+	3	2	OR5H6	99465959	0.000000	0.05858	0.002000	0.10522	0.058000	0.15608	-0.601000	0.05687	0.251000	0.21505	0.194000	0.17425	TTC	.	.	none		0.413	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2		
KLK6	5653	hgsc.bcm.edu	37	19	51466703	51466703	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:51466703G>A	ENST00000376851.3	-	4	739	c.300C>T	c.(298-300)gcC>gcT	p.A100A	KLK6_ENST00000310157.2_Silent_p.A100A|KLK6_ENST00000456750.2_5'Flank|KLK6_ENST00000391808.1_5'UTR|KLK6_ENST00000376853.4_Intron|KLK6_ENST00000594641.1_Silent_p.A100A|CTB-147C22.8_ENST00000601506.1_RNA	NM_001012964.1	NP_001012982.1	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6	100	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amyloid precursor protein metabolic process (GO:0042982)|central nervous system development (GO:0007417)|collagen catabolic process (GO:0030574)|hormone metabolic process (GO:0042445)|myelination (GO:0042552)|neuron death (GO:0070997)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|protein autoprocessing (GO:0016540)|regulation of cell differentiation (GO:0045595)|regulation of neuron projection development (GO:0010975)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|skin(4)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		CATGGCTGGCGGCATCATAGT	0.582																																					p.A100A		Atlas-SNP	.											.	KLK6	35	.	0			c.C300T						PASS	.						81.0	63.0	69.0					19																	51466703		2203	4300	6503	SO:0001819	synonymous_variant	5653	exon4			GCTGGCGGCATCA	U62801	CCDS12811.1, CCDS42599.1	19q13.3	2011-09-07	2006-10-27			ENSG00000167755		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6367	protein-coding gene	gene with protein product		602652	"""protease, serine, 18"", ""kallikrein 6 (neurosin, zyme)"""	PRSS9, PRSS18		9003450, 16800724, 16800723	Standard	NM_002774		Approved	Bssp, Klk7, neurosin	uc002pui.3	Q92876		ENST00000376851.3:c.300C>T	19.37:g.51466703G>A		Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	133	28	0.210526	NM_001012964	A6NJA1|A8MW09|Q6H301	Silent	SNP	ENST00000376851.3	37	CCDS12811.1																																																																																			.	.	none		0.582	KLK6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465060.1	NM_002774	
KRTCAP3	200634	hgsc.bcm.edu	37	2	27666008	27666008	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:27666008T>C	ENST00000543753.1	+	4	388	c.341T>C	c.(340-342)cTt>cCt	p.L114P	KRTCAP3_ENST00000288873.3_Missense_Mutation_p.L114P|KRTCAP3_ENST00000407293.1_Missense_Mutation_p.L96P	NM_001168364.1	NP_001161836.1	Q53RY4	KCP3_HUMAN	keratinocyte associated protein 3	114						integral component of membrane (GO:0016021)				large_intestine(1)|lung(2)	3	Acute lymphoblastic leukemia(172;0.155)					CTGGGCCTCCTTCTTGCTGTG	0.627																																					p.L114P		Atlas-SNP	.											.	KRTCAP3	12	.	0			c.T341C						PASS	.						138.0	144.0	142.0					2																	27666008		2203	4300	6503	SO:0001583	missense	200634	exon4			GCCTCCTTCTTGC	AY157576	CCDS1754.1	2p23.3	2008-02-05			ENSG00000157992	ENSG00000157992			28943	protein-coding gene	gene with protein product							Standard	NM_173853		Approved	KCP3	uc002rks.3	Q53RY4	OTTHUMG00000097782	ENST00000543753.1:c.341T>C	2.37:g.27666008T>C	ENSP00000442400:p.Leu114Pro	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	100	4	0.04	NM_173853	B7ZL49|Q6UW42|Q8IWS5	Missense_Mutation	SNP	ENST00000543753.1	37	CCDS1754.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.014958	0.75161	.	.	ENSG00000157992	ENST00000543753;ENST00000288873;ENST00000407293	T;T;T	0.51071	0.72;0.72;0.72	5.77	5.77	0.91146	.	0.187045	0.47093	D	0.000255	T	0.64461	0.2600	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.67925	-0.5544	10	0.87932	D	0	-14.8246	10.1184	0.42605	0.0:0.0789:0.0:0.9211	.	114	Q53RY4	KCP3_HUMAN	P	114;114;96	ENSP00000442400:L114P;ENSP00000288873:L114P;ENSP00000384689:L96P	ENSP00000288873:L114P	L	+	2	0	KRTCAP3	27519512	0.998000	0.40836	0.993000	0.49108	0.893000	0.52053	3.967000	0.56802	2.201000	0.70794	0.459000	0.35465	CTT	.	.	none		0.627	KRTCAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215025.1	NM_173853	
PCMTD1	115294	hgsc.bcm.edu	37	8	52733102	52733102	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:52733102G>A	ENST00000360540.5	-	7	1289	c.883C>T	c.(883-885)Ctt>Ttt	p.L295F	PCMTD1_ENST00000522514.1_Missense_Mutation_p.L295F|PCMTD1_ENST00000544451.1_Missense_Mutation_p.L219F|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	295						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.L295F(2)		NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TGAGGAATAAGCTGATTACCC	0.418																																					p.L295F		Atlas-SNP	.											PCMTD1,extremity,malignant_melanoma,0,3	PCMTD1	73	3	2	Substitution - Missense(2)	NS(1)|skin(1)	c.C883T						scavenged	.						178.0	172.0	174.0					8																	52733102		2203	4300	6503	SO:0001583	missense	115294	exon6			GAATAAGCTGATT		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.883C>T	8.37:g.52733102G>A	ENSP00000353739:p.Leu295Phe	Somatic	275	2	0.00727273		WXS	Illumina HiSeq	Phase_I	310	6	0.0193548	NM_052937	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025780	0.75390	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.49720	0.77;0.77;0.77	5.97	5.1	0.69264	.	0.063724	0.64402	N	0.000004	T	0.64800	0.2631	L	0.57536	1.79	0.80722	D	1	D;B;P	0.76494	0.999;0.412;0.954	D;B;P	0.85130	0.997;0.148;0.649	T	0.65459	-0.6163	10	0.46703	T	0.11	-65.0248	14.9395	0.70983	0.0681:0.0:0.9319:0.0	.	165;219;295	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	F	295;219;295	ENSP00000353739:L295F;ENSP00000444026:L219F;ENSP00000428099:L295F	ENSP00000353739:L295F	L	-	1	0	PCMTD1	52895655	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	7.107000	0.77047	1.532000	0.49169	0.655000	0.94253	CTT	.	.	none		0.418	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
AKR7A2	8574	hgsc.bcm.edu	37	1	19632532	19632532	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:19632532A>G	ENST00000235835.3	-	6	919	c.898T>C	c.(898-900)Tac>Cac	p.Y300H	RNU6-1099P_ENST00000363533.1_RNA	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	300					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GAGTGGTGGTACATCCACCGG	0.627																																					p.Y300H		Atlas-SNP	.											AKR7A2,NS,carcinoma,+2,1	AKR7A2	19	1	0			c.T898C						scavenged	.						68.0	67.0	67.0					1																	19632532		2203	4300	6503	SO:0001583	missense	8574	exon6			GGTGGTACATCCA	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.898T>C	1.37:g.19632532A>G	ENSP00000235835:p.Tyr300His	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	104	3	0.0288462	NM_003689	O75749|Q5TG63	Missense_Mutation	SNP	ENST00000235835.3	37	CCDS194.1	.	.	.	.	.	.	.	.	.	.	A	19.61	3.859419	0.71834	.	.	ENSG00000053371	ENST00000235835;ENST00000330072;ENST00000489286	T;T	0.25579	1.79;1.79	3.84	3.84	0.44239	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.40839	0.1133	L	0.52126	1.63	0.51233	D	0.999911	D	0.89917	1.0	D	0.85130	0.997	T	0.10337	-1.0634	10	0.30854	T	0.27	.	10.9159	0.47135	1.0:0.0:0.0:0.0	.	300	O43488	ARK72_HUMAN	H	300;255;162	ENSP00000235835:Y300H;ENSP00000339084:Y255H	ENSP00000235835:Y300H	Y	-	1	0	AKR7A2	19505119	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	8.543000	0.90651	1.741000	0.51731	0.459000	0.35465	TAC	.	.	none		0.627	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	NM_003689	
LIMS1	3987	hgsc.bcm.edu	37	2	109300340	109300340	+	Splice_Site	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:109300340G>A	ENST00000393310.1	+	10	1030		c.e10-1		LIMS1_ENST00000332345.6_Splice_Site|LIMS1_ENST00000542845.1_Splice_Site|LIMS1_ENST00000410093.1_Splice_Site|LIMS1_ENST00000338045.3_Splice_Site|LIMS1_ENST00000409441.1_Splice_Site|LIMS1_ENST00000544547.1_Splice_Site	NM_001193488.1	NP_001180417.1	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1						cell aging (GO:0007569)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chordate embryonic development (GO:0043009)|establishment or maintenance of cell polarity (GO:0007163)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|protein heterooligomerization (GO:0051291)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	10						TTTGTCTTTAGGAATAAGTTT	0.323																																					.		Atlas-SNP	.											.	LIMS1	38	.	0			c.900-1G>A						PASS	.						52.0	55.0	54.0					2																	109300340		2200	4299	6499	SO:0001630	splice_region_variant	3987	exon10			TCTTTAGGAATAA		CCDS2078.1, CCDS54382.1, CCDS54383.1, CCDS54384.1, CCDS54385.1	2q12.3	2008-05-23			ENSG00000169756	ENSG00000169756			6616	protein-coding gene	gene with protein product		602567				7517666, 10022929	Standard	NM_001193482		Approved	PINCH, PINCH1	uc002tek.4	P48059	OTTHUMG00000130983	ENST00000393310.1:c.864-1G>A	2.37:g.109300340G>A		Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	202	46	0.227723	NM_001193483	B2RAJ4|B7Z483|B7Z7R3|B7Z907|Q53TE0|Q9BS44	Splice_Site	SNP	ENST00000393310.1	37	CCDS2078.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573303	0.86542	.	.	ENSG00000169756	ENST00000544547;ENST00000332345;ENST00000393310;ENST00000410093;ENST00000409441;ENST00000338045;ENST00000542845	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LIMS1	108666772	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.827000	0.99397	2.873000	0.98535	0.563000	0.77884	.	.	.	none		0.323	LIMS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253596.1	NM_004987	Intron
PITPNM2	57605	hgsc.bcm.edu	37	12	123471235	123471235	+	Silent	SNP	C	C	T	rs147680163		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:123471235C>T	ENST00000542749.1	-	22	3618	c.3555G>A	c.(3553-3555)ccG>ccA	p.P1185P	PITPNM2_ENST00000280562.5_Silent_p.P1179P|PITPNM2_ENST00000320201.4_Silent_p.P1185P|PITPNM2_ENST00000392428.1_Silent_p.P906P			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	1185					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TGTGCCGCAGCGGGTCATGCA	0.687													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16633	0.0		0.0	False		,,,				2504	0.0				p.P1185P		Atlas-SNP	.											PITPNM2,bladder,carcinoma,0,1	PITPNM2	105	1	0			c.G3555A						scavenged	.	C		17,4389	24.3+/-50.5	1,15,2187	44.0	42.0	43.0		3555	-6.4	0.9	12	dbSNP_134	43	0,8600		0,0,4300	no	coding-synonymous	PITPNM2	NM_020845.2		1,15,6487	TT,TC,CC		0.0,0.3858,0.1307		1185/1350	123471235	17,12989	2203	4300	6503	SO:0001819	synonymous_variant	57605	exon23			CCGCAGCGGGTCA	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.3555G>A	12.37:g.123471235C>T		Somatic	172	1	0.00581395		WXS	Illumina HiSeq	Phase_I	178	3	0.0168539	NM_020845	Q9P271	Silent	SNP	ENST00000542749.1	37	CCDS9242.1																																																																																			C|0.998;T|0.002	0.002	strong		0.687	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
PDE5A	8654	hgsc.bcm.edu	37	4	120460116	120460116	+	Splice_Site	SNP	G	G	A	rs142017762		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:120460116G>A	ENST00000354960.3	-	11	1950	c.1631C>T	c.(1630-1632)gCg>gTg	p.A544V	PDE5A_ENST00000394439.1_Splice_Site_p.A492V|PDE5A_ENST00000512739.1_5'UTR|PDE5A_ENST00000264805.5_Splice_Site_p.A502V|RP11-33B1.1_ENST00000498873.1_RNA	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	544					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	GATAATTACCGCTAACGACTG	0.343																																					p.A544V		Atlas-SNP	.											.	PDE5A	83	.	0			c.C1631T						PASS	.	G	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	137.0	152.0	147.0		1631,1505,1475	4.9	1.0	4	dbSNP_134	147	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice,missense-near-splice,missense-near-splice	PDE5A	NM_001083.3,NM_033430.2,NM_033437.3	64,64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	544/876,502/834,492/824	120460116	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	8654	exon11			ATTACCGCTAACG	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.1632+1C>T	4.37:g.120460116G>A		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	127	16	0.125984	NM_001083	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	ENST00000354960.3	37	CCDS3713.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.832877	0.50951	0.0	1.16E-4	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805	T;T;T	0.62941	-0.01;0.04;0.04	5.8	4.94	0.65067	.	0.317482	0.32655	N	0.005809	T	0.46483	0.1395	N	0.16478	0.41	0.47737	D	0.999504	B;B	0.13145	0.007;0.002	B;B	0.04013	0.0;0.001	T	0.30794	-0.9966	10	0.23302	T	0.38	.	15.7381	0.77863	0.0:0.0:0.8623:0.1377	.	544;502	O76074;O76074-2	PDE5A_HUMAN;.	V	544;492;502	ENSP00000347046:A544V;ENSP00000377957:A492V;ENSP00000264805:A502V	ENSP00000264805:A502V	A	-	2	0	PDE5A	120679564	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	4.056000	0.57448	1.411000	0.46957	0.650000	0.86243	GCG	G|1.000;A|0.000	0.000	weak		0.343	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083	Missense_Mutation
SCN11A	11280	hgsc.bcm.edu	37	3	38924723	38924723	+	Splice_Site	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:38924723C>T	ENST00000302328.3	-	18	3418		c.e18+1		SCN11A_ENST00000450244.1_Splice_Site|SCN11A_ENST00000444237.2_Splice_Site|SCN11A_ENST00000456224.3_Splice_Site	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGATGATTTACCAGTGCCCCA	0.488																																					.		Atlas-SNP	.											.	SCN11A	296	.	0			c.3219+1G>A						PASS	.						93.0	83.0	87.0					3																	38924723		2203	4300	6503	SO:0001630	splice_region_variant	11280	exon19			GATTTACCAGTGC	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3219+1G>A	3.37:g.38924723C>T		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	82	4	0.0487805	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Splice_Site	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	31	5.080272	0.94050	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.776	0.96393	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SCN11A	38899727	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.453000	0.80700	2.840000	0.97914	0.655000	0.94253	.	.	.	none		0.488	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	Intron
ACKR4	51554	hgsc.bcm.edu	37	3	132319326	132319326	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:132319326C>T	ENST00000249887.2	+	2	181	c.85C>T	c.(85-87)Ctg>Ttg	p.L29L	ACAD11_ENST00000355458.3_Intron|ACAD11_ENST00000545291.1_Intron|ACAD11_ENST00000264990.6_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	29					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.L29L(1)									TCAATATGAACTGATCTGTAT	0.378																																					p.L29L		Atlas-SNP	.											CCRL1,NS,carcinoma,0,2	CCRL1	30	2	1	Substitution - coding silent(1)	endometrium(1)	c.C85T						scavenged	.						58.0	58.0	58.0					3																	132319326		2203	4300	6503	SO:0001819	synonymous_variant	51554	exon1			TATGAACTGATCT	AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.85C>T	3.37:g.132319326C>T		Somatic	408	3	0.00735294		WXS	Illumina HiSeq	Phase_I	538	10	0.0185874	NM_178445	B2R9U7	Silent	SNP	ENST00000249887.2	37	CCDS3075.1																																																																																			.	.	none		0.378	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357238.2	NM_016557	
PLXNB2	23654	hgsc.bcm.edu	37	22	50728063	50728063	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:50728063G>A	ENST00000449103.1	-	3	1091	c.951C>T	c.(949-951)gaC>gaT	p.D317D	PLXNB2_ENST00000359337.4_Silent_p.D317D			O15031	PLXB2_HUMAN	plexin B2	317	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGTGCACCTTGTCCAGCGGGA	0.642																																					p.D317D		Atlas-SNP	.											.	PLXNB2	172	.	0			c.C951T						PASS	.						42.0	51.0	48.0					22																	50728063		1949	4160	6109	SO:0001819	synonymous_variant	23654	exon3			CACCTTGTCCAGC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.951C>T	22.37:g.50728063G>A		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	42	10	0.238095	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	ENST00000449103.1	37	CCDS43035.1																																																																																			.	.	none		0.642	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
CYYR1	116159	hgsc.bcm.edu	37	21	27945186	27945186	+	Splice_Site	SNP	C	C	T	rs576125420		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr21:27945186C>T	ENST00000299340.4	-	1	417		c.e1+1		CYYR1_ENST00000435845.2_Splice_Site|CYYR1_ENST00000400043.3_Splice_Site	NM_052954.2	NP_443186.1	Q96J86	CYYR1_HUMAN	cysteine/tyrosine-rich 1							integral component of membrane (GO:0016021)				large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	15						CCGTCACTGACCTGCGTAGAC	0.662																																					.		Atlas-SNP	.											.	CYYR1	38	.	0			c.73+1G>A						PASS	.						58.0	58.0	58.0					21																	27945186		2203	4299	6502	SO:0001630	splice_region_variant	116159	exon2			CACTGACCTGCGT	AY061853	CCDS13578.1	21q21.2	2014-07-04	2005-07-24		ENSG00000166265	ENSG00000166265			16274	protein-coding gene	gene with protein product			"""cysteine and tyrosine-rich 1"""	C21orf95		12036297, 12062809, 24981926	Standard	NM_052954		Approved		uc002ymd.3	Q96J86	OTTHUMG00000078689	ENST00000299340.4:c.73+1G>A	21.37:g.27945186C>T		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	104	20	0.192308	NM_052954	A0A059TD09|A8MTU9|B2R845|Q53ER3|Q5JPD0|Q96NV7|R9QAJ4|W8CQB3	Splice_Site	SNP	ENST00000299340.4	37	CCDS13578.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919627	0.73098	.	.	ENSG00000166265	ENST00000299340;ENST00000435845;ENST00000400043	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.227	0.59921	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CYYR1	26867057	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.229000	0.51278	2.835000	0.97688	0.650000	0.86243	.	.	.	none		0.662	CYYR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171654.2	NM_052954	Intron
SEMA3A	10371	hgsc.bcm.edu	37	7	83610791	83610791	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:83610791G>A	ENST00000265362.4	-	14	1812	c.1498C>T	c.(1498-1500)Caa>Taa	p.Q500*	SEMA3A_ENST00000436949.1_Nonsense_Mutation_p.Q500*	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	500	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						ATATATAGTTGTTGCTGTGGA	0.418																																					p.Q500X		Atlas-SNP	.											.	SEMA3A	121	.	0			c.C1498T						PASS	.						55.0	56.0	56.0					7																	83610791		2203	4300	6503	SO:0001587	stop_gained	10371	exon14			ATAGTTGTTGCTG	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1498C>T	7.37:g.83610791G>A	ENSP00000265362:p.Gln500*	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	90	14	0.155556	NM_006080		Nonsense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	G	40	8.476428	0.98827	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	19.8579	0.96771	0.0:0.0:1.0:0.0	.	.	.	.	X	500	.	ENSP00000265362:Q500X	Q	-	1	0	SEMA3A	83448727	1.000000	0.71417	0.996000	0.52242	0.707000	0.40811	9.807000	0.99171	2.687000	0.91594	0.655000	0.94253	CAA	.	.	none		0.418	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
THRB	7068	hgsc.bcm.edu	37	3	24231681	24231681	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:24231681G>A	ENST00000356447.4	-	4	451	c.167C>T	c.(166-168)cCa>cTa	p.P56L	THRB_ENST00000416420.1_Missense_Mutation_p.P56L|THRB_ENST00000396671.2_Missense_Mutation_p.P56L	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	56	Modulating.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GATGAGATGTGGCGACGACTG	0.502																																					p.P56L	Melanoma(21;896 1043 15021 37958)	Atlas-SNP	.											.	THRB	52	.	0			c.C167T						PASS	.						247.0	234.0	239.0					3																	24231681		2203	4300	6503	SO:0001583	missense	7068	exon4			AGATGTGGCGACG		CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.167C>T	3.37:g.24231681G>A	ENSP00000348827:p.Pro56Leu	Somatic	204	0	0		WXS	Illumina HiSeq	Phase_I	246	48	0.195122	NM_000461	B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Missense_Mutation	SNP	ENST00000356447.4	37	CCDS2641.1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.433453	0.25813	.	.	ENSG00000151090	ENST00000396671;ENST00000356447;ENST00000416420;ENST00000413780;ENST00000415021;ENST00000447875;ENST00000453729;ENST00000431815;ENST00000447414;ENST00000428492;ENST00000418247	D;D;D;D	0.96427	-3.13;-3.13;-3.13;-4.01	5.81	4.0	0.46444	.	.	.	.	.	D	0.91372	0.7278	N	0.24115	0.695	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	D	0.84018	0.0352	9	0.59425	D	0.04	.	6.734	0.23399	0.0673:0.1301:0.667:0.1356	.	56	P10828	THB_HUMAN	L	56;56;56;25;56;56;56;56;56;56;56	ENSP00000379904:P56L;ENSP00000348827:P56L;ENSP00000414444:P56L;ENSP00000414100:P25L	ENSP00000348827:P56L	P	-	2	0	THRB	24206685	0.034000	0.19679	0.421000	0.26609	0.342000	0.28953	1.173000	0.31920	0.781000	0.33589	0.655000	0.94253	CCA	.	.	none		0.502	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252877.3	NM_000461	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230348	23230348	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:23230348C>T	ENST00000526893.1	+	1	389	c.115C>T	c.(115-117)Ctg>Ttg	p.L39L	IGLL5_ENST00000531372.1_Silent_p.L39L|IGLL5_ENST00000532223.2_Silent_p.L39L|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	39						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCATGGCCTGCTGCGCCCAAT	0.687																																					p.L39L		Atlas-SNP	.											.	IGLL5	26	.	0			c.C115T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GGCCTGCTGCGCC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.115C>T	22.37:g.23230348C>T		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	118	5	0.0423729	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.687	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
ABCA3	21	hgsc.bcm.edu	37	16	2339491	2339491	+	Missense_Mutation	SNP	C	C	T	rs145565697	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:2339491C>T	ENST00000301732.5	-	20	3344	c.2644G>A	c.(2644-2646)Gac>Aac	p.D882N	ABCA3_ENST00000382381.3_Missense_Mutation_p.D824N	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	882					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CCAATGCCGTCGGAGGGGTCC	0.687													C|||	2	0.000399361	0.0015	0.0	5008	,	,		17193	0.0		0.0	False		,,,				2504	0.0				p.D882N		Atlas-SNP	.											.	ABCA3	176	.	0			c.G2644A						PASS	.	C	ASN/ASP	10,4380		0,10,2185	32.0	29.0	30.0		2644	0.5	0.0	16	dbSNP_134	30	0,8598		0,0,4299	yes	missense	ABCA3	NM_001089.2	23	0,10,6484	TT,TC,CC		0.0,0.2278,0.077	benign	882/1705	2339491	10,12978	2195	4299	6494	SO:0001583	missense	21	exon20			TGCCGTCGGAGGG	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2644G>A	16.37:g.2339491C>T	ENSP00000301732:p.Asp882Asn	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	90	4	0.0444444	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.348915	0.24426	0.002278	0.0	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.91740	-2.9	4.68	0.543	0.17179	.	0.223978	0.44688	N	0.000432	D	0.84813	0.5555	L	0.36672	1.1	0.52099	D	0.999942	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.72360	-0.4317	10	0.30854	T	0.27	.	8.3806	0.32468	0.0:0.673:0.0:0.327	.	882;886;882	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	N	882;886	ENSP00000301732:D882N	ENSP00000301732:D882N	D	-	1	0	ABCA3	2279492	0.951000	0.32395	0.000000	0.03702	0.215000	0.24574	2.187000	0.42602	-0.026000	0.13895	0.561000	0.74099	GAC	C|0.998;T|0.002	0.002	strong		0.687	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
PCDH12	51294	hgsc.bcm.edu	37	5	141325355	141325355	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:141325355C>T	ENST00000231484.3	-	4	4356	c.3146G>A	c.(3145-3147)cGg>cAg	p.R1049Q		NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	1049					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGCTCAGCCGGTCCAGGGC	0.677																																					p.R1049Q		Atlas-SNP	.											PCDH12,NS,carcinoma,+1,1	PCDH12	133	1	0			c.G3146A						scavenged	.						30.0	34.0	33.0					5																	141325355		2201	4291	6492	SO:0001583	missense	51294	exon4			CTCAGCCGGTCCA	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.3146G>A	5.37:g.141325355C>T	ENSP00000231484:p.Arg1049Gln	Somatic	206	0	0		WXS	Illumina HiSeq	Phase_I	204	3	0.0147059	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	37	CCDS4269.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.299221	0.23650	.	.	ENSG00000113555	ENST00000231484	T	0.52295	0.67	5.55	3.71	0.42584	.	0.654612	0.15274	N	0.271073	T	0.34890	0.0913	L	0.47716	1.5	0.24248	N	0.995332	P	0.35328	0.495	B	0.25291	0.059	T	0.14952	-1.0454	10	0.40728	T	0.16	.	7.865	0.29533	0.1611:0.7521:0.0:0.0867	.	1049	Q9NPG4	PCD12_HUMAN	Q	1049	ENSP00000231484:R1049Q	ENSP00000231484:R1049Q	R	-	2	0	PCDH12	141305539	1.000000	0.71417	0.702000	0.30337	0.167000	0.22549	3.377000	0.52425	0.660000	0.30964	0.655000	0.94253	CGG	.	.	none		0.677	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
SERPINC1	462	hgsc.bcm.edu	37	1	173878965	173878965	+	Missense_Mutation	SNP	C	C	T	rs572313182	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:173878965C>T	ENST00000367698.3	-	5	996	c.878G>A	c.(877-879)cGg>cAg	p.R293Q	SERPINC1_ENST00000494024.1_5'Flank	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	293			Missing (in AT3D; type-I). {ECO:0000269|PubMed:7878627}.|R -> P (in AT3D). {ECO:0000269|PubMed:23910795}.		blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	AGCCACGCGCCGATAACGGAA	0.527													C|||	3	0.000599042	0.0	0.0	5008	,	,		21039	0.0		0.0	False		,,,				2504	0.0031				p.R293Q		Atlas-SNP	.											SERPINC1,NS,carcinoma,-1,1	SERPINC1	57	1	0			c.G878A	GRCh37	CM063129	SERPINC1	M		scavenged	.						110.0	96.0	101.0					1																	173878965		2203	4300	6503	SO:0001583	missense	462	exon5			ACGCGCCGATAAC	X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.878G>A	1.37:g.173878965C>T	ENSP00000356671:p.Arg293Gln	Somatic	115	2	0.0173913		WXS	Illumina HiSeq	Phase_I	125	2	0.016	NM_000488	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Missense_Mutation	SNP	ENST00000367698.3	37	CCDS1313.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.823619	0.32237	.	.	ENSG00000117601	ENST00000367698	D	0.82526	-1.62	5.45	4.48	0.54585	Serpin domain (3);	0.474877	0.23614	N	0.046311	T	0.60064	0.2240	L	0.45422	1.42	0.09310	N	1	P	0.37864	0.61	B	0.21917	0.037	T	0.59295	-0.7481	10	0.44086	T	0.13	.	12.7135	0.57102	0.1652:0.8348:0.0:0.0	.	293	P01008	ANT3_HUMAN	Q	293	ENSP00000356671:R293Q	ENSP00000356671:R293Q	R	-	2	0	SERPINC1	172145588	0.000000	0.05858	0.992000	0.48379	0.904000	0.53231	0.220000	0.17660	2.555000	0.86185	0.655000	0.94253	CGG	.	.	none		0.527	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090734.1	NM_000488	
ABCB11	8647	hgsc.bcm.edu	37	2	169830315	169830315	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:169830315C>T	ENST00000263817.6	-	13	1468	c.1344G>A	c.(1342-1344)ggG>ggA	p.G448G		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	448	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CTGTCATTTCCCCTGGTTTAA	0.433																																					p.G448G		Atlas-SNP	.											ABCB11,NS,carcinoma,-1,1	ABCB11	136	1	0			c.G1344A						scavenged	.						146.0	139.0	141.0					2																	169830315		1872	4111	5983	SO:0001819	synonymous_variant	8647	exon13			CATTTCCCCTGGT	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.1344G>A	2.37:g.169830315C>T		Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	166	3	0.0180723	NM_003742	Q53TL2|Q9UNB2	Silent	SNP	ENST00000263817.6	37	CCDS46444.1																																																																																			.	.	none		0.433	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742	
TNF	7124	hgsc.bcm.edu	37	6	31543635	31543635	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:31543635G>A	ENST00000449264.2	+	1	292	c.117G>A	c.(115-117)ctG>ctA	p.L39L		NM_000594.3	NP_000585.2	P01375	TNFA_HUMAN	tumor necrosis factor	39		Cleavage; by SPPL2A or SPPL2B.			activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nicotine (GO:0071316)|cellular response to organic cyclic compound (GO:0071407)|chronic inflammatory response to antigenic stimulus (GO:0002439)|defense response to Gram-positive bacterium (GO:0050830)|embryonic digestive tract development (GO:0048566)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glucose metabolic process (GO:0006006)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JNK cascade (GO:0007254)|leukocyte tethering or rolling (GO:0050901)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|necroptotic signaling pathway (GO:0097527)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of branching involved in lung morphogenesis (GO:0061048)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of glucose import (GO:0046325)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of L-glutamate transport (GO:0002037)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid storage (GO:0010888)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|organ morphogenesis (GO:0009887)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle development (GO:0051798)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of mononuclear cell migration (GO:0071677)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of podosome assembly (GO:0071803)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein transport (GO:0051222)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translational initiation by iron (GO:0045994)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|receptor biosynthetic process (GO:0032800)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of immunoglobulin secretion (GO:0051023)|regulation of insulin secretion (GO:0050796)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to salt stress (GO:0009651)|response to virus (GO:0009615)|sequestering of triglyceride (GO:0030730)|skeletal muscle contraction (GO:0003009)|transformed cell apoptotic process (GO:0006927)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	cytokine activity (GO:0005125)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|transcription regulatory region DNA binding (GO:0044212)|tumor necrosis factor receptor binding (GO:0005164)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(3)	8		Ovarian(999;0.00556)			Adalimumab(DB00051)|Amrinone(DB01427)|Certolizumab pegol(DB08904)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Epinephrine(DB00668)|Etanercept(DB00005)|Glucosamine(DB01296)|golimumab(DB06674)|Infliximab(DB00065)|Pomalidomide(DB08910)|Pranlukast(DB01411)|Pseudoephedrine(DB00852)|Thalidomide(DB01041)	TCTCCTTCCTGATCGTGGCAG	0.652									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.L39L		Atlas-SNP	.											.	TNF	15	.	0			c.G117A						PASS	.						66.0	67.0	67.0					6																	31543635		2203	4300	6503	SO:0001819	synonymous_variant	7124	exon1	Familial Cancer Database	incl.: Familial Head and Neck Cancer	CTTCCTGATCGTG	X02910	CCDS4702.1	6p21.3	2013-05-22	2010-05-04		ENSG00000232810	ENSG00000232810		"""Tumor necrosis factor (ligand) superfamily"""	11892	protein-coding gene	gene with protein product	"""TNF superfamily, member 2"""	191160	"""tumor necrosis factor (TNF superfamily, member 2)"""	TNFA		2413547, 6392892	Standard	NM_000594		Approved	TNFSF2, DIF, TNF-alpha	uc003nui.4	P01375	OTTHUMG00000031194	ENST00000449264.2:c.117G>A	6.37:g.31543635G>A		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	69	25	0.362319	NM_000594	O43647|Q9P1Q2|Q9UIV3	Silent	SNP	ENST00000449264.2	37	CCDS4702.1																																																																																			.	.	none		0.652	TNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076390.2		
ZNF181	339318	hgsc.bcm.edu	37	19	35232117	35232117	+	Silent	SNP	C	C	T	rs200927726		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:35232117C>T	ENST00000492450.1	+	4	920	c.831C>T	c.(829-831)ggC>ggT	p.G277G	ZNF181_ENST00000392232.3_Silent_p.G321G|ZNF181_ENST00000459757.2_Silent_p.G276G			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	277					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G213G(1)		endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTAGCCATGGCTCATCCCTTA	0.443																																					p.G277G		Atlas-SNP	.											ZNF181,NS,carcinoma,+2,2	ZNF181	65	2	1	Substitution - coding silent(1)	kidney(1)	c.C831T						scavenged	.						90.0	95.0	93.0					19																	35232117		2203	4300	6503	SO:0001819	synonymous_variant	339318	exon4			CCATGGCTCATCC	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.831C>T	19.37:g.35232117C>T		Somatic	92	2	0.0217391		WXS	Illumina HiSeq	Phase_I	73	4	0.0547945	NM_001029997	B7ZKX3|Q49A75	Silent	SNP	ENST00000492450.1	37	CCDS32990.2																																																																																			C|0.999;T|0.001	0.001	weak		0.443	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	NM_001029997	
ADCY4	196883	hgsc.bcm.edu	37	14	24788543	24788543	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:24788543C>T	ENST00000310677.4	-	23	2946	c.2833G>A	c.(2833-2835)Gca>Aca	p.A945T	ADCY4_ENST00000554068.2_Missense_Mutation_p.A945T|ADCY4_ENST00000418030.2_Missense_Mutation_p.A945T	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	945					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		ACCTGTTGTGCATCCTGTCCA	0.552																																					p.A945T		Atlas-SNP	.											ADCY4,NS,carcinoma,+1,1	ADCY4	86	1	0			c.G2833A						scavenged	.						214.0	163.0	181.0					14																	24788543		2203	4300	6503	SO:0001583	missense	196883	exon23			GTTGTGCATCCTG	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.2833G>A	14.37:g.24788543C>T	ENSP00000312126:p.Ala945Thr	Somatic	302	0	0		WXS	Illumina HiSeq	Phase_I	328	4	0.0121951	NM_001198592	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	ENST00000310677.4	37	CCDS9627.1	.	.	.	.	.	.	.	.	.	.	C	6.076	0.382330	0.11524	.	.	ENSG00000129467	ENST00000310677;ENST00000554068;ENST00000418030	T;T;T	0.30448	1.53;1.53;1.53	5.77	-1.24	0.09435	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.439500	0.19419	N	0.114743	T	0.16811	0.0404	L	0.39397	1.21	0.09310	N	0.999998	B	0.02656	0.0	B	0.08055	0.003	T	0.24261	-1.0165	10	0.13470	T	0.59	.	4.1052	0.10033	0.2524:0.3645:0.0:0.3831	.	945	Q8NFM4	ADCY4_HUMAN	T	945	ENSP00000312126:A945T;ENSP00000452250:A945T;ENSP00000393177:A945T	ENSP00000312126:A945T	A	-	1	0	ADCY4	23858383	0.001000	0.12720	0.098000	0.21074	0.947000	0.59692	-0.324000	0.07986	-0.139000	0.11414	-0.182000	0.12963	GCA	.	.	none		0.552	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
NTNG2	84628	hgsc.bcm.edu	37	9	135042392	135042392	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:135042392C>T	ENST00000393229.3	+	2	950	c.174C>T	c.(172-174)ggC>ggT	p.G58G	NTNG2_ENST00000393228.4_Silent_p.G58G|NTNG2_ENST00000360670.3_Silent_p.G58G|NTNG2_ENST00000372179.3_Silent_p.G58G	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	58	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		AGCCCTCAGGCATCACATGTG	0.587																																					p.G58G		Atlas-SNP	.											NTNG2,colon,carcinoma,+2,1	NTNG2	66	1	0			c.C174T						scavenged	.						112.0	116.0	115.0					9																	135042392		2203	4300	6503	SO:0001819	synonymous_variant	84628	exon2			CTCAGGCATCACA	AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.174C>T	9.37:g.135042392C>T		Somatic	181	0	0		WXS	Illumina HiSeq	Phase_I	161	3	0.0186335	NM_032536	Q5JUJ2|Q6UXY0|Q96JH0	Silent	SNP	ENST00000393229.3	37	CCDS6946.1																																																																																			.	.	none		0.587	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	NM_032536	
PRKD2	25865	hgsc.bcm.edu	37	19	47204071	47204071	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:47204071C>T	ENST00000291281.4	-	7	1331	c.1106G>A	c.(1105-1107)gGa>gAa	p.G369E	PRKD2_ENST00000595515.1_Missense_Mutation_p.G369E|PRKD2_ENST00000601806.1_Missense_Mutation_p.G212E|PRKD2_ENST00000600194.1_Missense_Mutation_p.G212E|PRKD2_ENST00000433867.1_Missense_Mutation_p.G369E			Q9BZL6	KPCD2_HUMAN	protein kinase D2	369					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GGCCTTGCCTCCCTCGCCTTC	0.572																																					p.G369E		Atlas-SNP	.											.	PRKD2	94	.	0			c.G1106A						PASS	.						62.0	50.0	54.0					19																	47204071		2203	4300	6503	SO:0001583	missense	25865	exon7			TTGCCTCCCTCGC	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1106G>A	19.37:g.47204071C>T	ENSP00000291281:p.Gly369Glu	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	69	4	0.057971	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	37	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	5.174	0.217694	0.09810	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.63744	-0.06;-0.06	4.28	-0.572	0.11745	.	1.007170	0.07985	N	0.986164	T	0.44767	0.1309	L	0.47716	1.5	0.24460	N	0.99445	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.33007	-0.9885	10	0.05436	T	0.98	-3.4373	4.0249	0.09683	0.0:0.415:0.1761:0.4089	.	369;369	E7ER94;Q9BZL6	.;KPCD2_HUMAN	E	369	ENSP00000291281:G369E;ENSP00000393978:G369E	ENSP00000291281:G369E	G	-	2	0	PRKD2	51895911	0.359000	0.24955	0.792000	0.32020	0.882000	0.50991	0.493000	0.22451	0.198000	0.20407	0.555000	0.69702	GGA	.	.	none		0.572	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
IFNA4	3441	hgsc.bcm.edu	37	9	21187146	21187146	+	Missense_Mutation	SNP	C	C	T	rs201186279		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:21187146C>T	ENST00000421715.1	-	1	452	c.385G>A	c.(385-387)Gtg>Atg	p.V129M		NM_021068.2	NP_066546.1	P05014	IFNA4_HUMAN	interferon, alpha 4	129					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.V129M(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GTCTCTTCCACCCCAACCTCC	0.458													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19919	0.0		0.0	False		,,,				2504	0.0				p.V129M	NSCLC(154;890 1986 23660 27800 51138)	Atlas-SNP	.											IFNA4,NS,carcinoma,0,1	IFNA4	34	1	1	Substitution - Missense(1)	endometrium(1)	c.G385A						scavenged	.						35.0	38.0	37.0					9																	21187146		2182	4253	6435	SO:0001583	missense	3441	exon1			CTTCCACCCCAAC		CCDS6498.1	9p22	2010-08-24			ENSG00000236637	ENSG00000236637		"""Interferons"""	5425	protein-coding gene	gene with protein product		147564				1385305	Standard	NM_021068		Approved	MGC142200, IFN-alpha4a	uc003zon.2	P05014	OTTHUMG00000019660	ENST00000421715.1:c.385G>A	9.37:g.21187146C>T	ENSP00000412897:p.Val129Met	Somatic	402	4	0.00995025		WXS	Illumina HiSeq	Phase_I	487	7	0.0143737	NM_021068	P13358|Q14CS4|Q5VV15	Missense_Mutation	SNP	ENST00000421715.1	37	CCDS6498.1	.	.	.	.	.	.	.	.	.	.	-	4.271	0.049496	0.08243	.	.	ENSG00000236637	ENST00000421715	T	0.03441	3.93	2.96	-5.93	0.02254	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.507550	0.03550	N	0.225260	T	0.05593	0.0147	M	0.73319	2.225	0.09310	N	1	B	0.18741	0.03	B	0.28305	0.088	T	0.38351	-0.9665	10	0.52906	T	0.07	.	1.8132	0.03095	0.1267:0.2025:0.3717:0.2991	.	129	P05014	IFNA4_HUMAN	M	129	ENSP00000412897:V129M	ENSP00000412897:V129M	V	-	1	0	IFNA4	21177146	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.851000	0.01669	-1.988000	0.00980	-1.417000	0.01113	GTG	.	.	weak		0.458	IFNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051889.1	NM_021068	
HSPD1	3329	hgsc.bcm.edu	37	2	198363534	198363534	+	Silent	SNP	C	C	T	rs565153254		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:198363534C>T	ENST00000388968.3	-	2	306	c.39G>A	c.(37-39)ccG>ccA	p.P13P	HSPE1_ENST00000409468.1_5'Flank|HSPE1-MOB4_ENST00000604458.1_5'Flank|HSPD1_ENST00000544407.1_Silent_p.P13P|HSPD1_ENST00000345042.2_Silent_p.P13P|HSPE1_ENST00000409729.1_5'Flank|HSPE1_ENST00000233893.5_5'Flank	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	13					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)	p.P13P(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			CCCTGGACACCGGTCTCATCT	0.502																																					p.P13P		Atlas-SNP	.											HSPD1_ENST00000426480,NS,haematopoietic_neoplasm,0,3	HSPD1	68	3	1	Substitution - coding silent(1)	breast(1)	c.G39A						scavenged	.						52.0	49.0	50.0					2																	198363534		2203	4300	6503	SO:0001819	synonymous_variant	3329	exon2			GGACACCGGTCTC	M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.39G>A	2.37:g.198363534C>T		Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	283	5	0.0176678	NM_002156	B2R5M6|B7Z712|Q38L19|Q9UCR6	Silent	SNP	ENST00000388968.3	37	CCDS33357.1																																																																																			.	.	none		0.502	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335324.2	NM_002156	
FLNC	2318	hgsc.bcm.edu	37	7	128483878	128483878	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:128483878G>A	ENST00000325888.8	+	19	3101	c.2840G>A	c.(2839-2841)gGc>gAc	p.G947D	FLNC_ENST00000346177.6_Missense_Mutation_p.G947D	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	947					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GTGACTTATGGCGGGGACCCT	0.532																																					p.G947D		Atlas-SNP	.											.	FLNC	339	.	0			c.G2840A						PASS	.						85.0	87.0	86.0					7																	128483878		1932	4140	6072	SO:0001583	missense	2318	exon19			CTTATGGCGGGGA	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.2840G>A	7.37:g.128483878G>A	ENSP00000327145:p.Gly947Asp	Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	114	37	0.324561	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	19.02	3.746324	0.69418	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.91521	-2.86;-2.86	5.32	5.32	0.75619	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.95108	0.8415	M	0.71920	2.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.95440	0.8524	10	0.87932	D	0	.	18.9962	0.92813	0.0:0.0:1.0:0.0	.	947;947	Q14315-2;Q14315	.;FLNC_HUMAN	D	947	ENSP00000327145:G947D;ENSP00000344002:G947D	ENSP00000327145:G947D	G	+	2	0	FLNC	128271114	1.000000	0.71417	1.000000	0.80357	0.453000	0.32348	9.783000	0.99037	2.481000	0.83766	0.561000	0.74099	GGC	.	.	none		0.532	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
SLCO1B7	338821	hgsc.bcm.edu	37	12	21201693	21201693	+	Missense_Mutation	SNP	T	T	A	rs370821380		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:21201693T>A	ENST00000421593.2	+	8	1042	c.1042T>A	c.(1042-1044)Tat>Aat	p.Y348N	SLCO1B7_ENST00000554957.1_Missense_Mutation_p.Y395N|LST3_ENST00000540229.1_Intron|SLCO1B3_ENST00000553473.1_Intron|LST3_ENST00000381541.3_Missense_Mutation_p.Y395N	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)	348						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TTCAGGAGGATATATCATTAA	0.353																																					p.Y348N		Atlas-SNP	.											.	SLCO1B7	85	.	0			c.T1042A						PASS	.						48.0	48.0	48.0					12																	21201693		2014	4205	6219	SO:0001583	missense	338821	exon8			GGAGGATATATCA	AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	ENST00000421593.2:c.1042T>A	12.37:g.21201693T>A	ENSP00000394168:p.Tyr348Asn	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	176	46	0.261364	NM_001009562	Q71QF0	Missense_Mutation	SNP	ENST00000421593.2	37	CCDS44843.1	.	.	.	.	.	.	.	.	.	.	.	13.38	2.220808	0.39201	.	.	ENSG00000257046;ENSG00000205754;ENSG00000205754	ENST00000381541;ENST00000554957;ENST00000421593	T;T;T	0.81415	-1.41;-1.41;-1.49	3.45	3.45	0.39498	.	0.479354	0.21186	N	0.078723	D	0.85898	0.5804	M	0.83012	2.62	0.25795	N	0.984577	D;P	0.54397	0.966;0.942	P;P	0.58873	0.847;0.847	T	0.77723	-0.2481	10	0.72032	D	0.01	.	5.4437	0.16523	0.0:0.1313:0.0:0.8687	.	348;395	G3V0H7;F5H094	.;.	N	395;395;348	ENSP00000370952:Y395N;ENSP00000452013:Y395N;ENSP00000394168:Y348N	ENSP00000370952:Y395N	Y	+	1	0	SLCO1B7;RP11-545J16.1	21092960	0.369000	0.25039	0.990000	0.47175	0.727000	0.41649	0.316000	0.19469	1.554000	0.49487	0.416000	0.27883	TAT	.	.	alt		0.353	SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402066.1	NM_001009562	
CTBS	1486	hgsc.bcm.edu	37	1	85040024	85040024	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:85040024C>T	ENST00000370630.5	-	1	123	c.75G>A	c.(73-75)ctG>ctA	p.L25L	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	25					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		ccagcagcgccagcagcgcTA	0.726																																					p.L25L		Atlas-SNP	.											CTBS,NS,carcinoma,0,1	CTBS	24	1	0			c.G75A						scavenged	.						3.0	4.0	4.0					1																	85040024		1689	3502	5191	SO:0001819	synonymous_variant	1486	exon1			CAGCGCCAGCAGC	M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.75G>A	1.37:g.85040024C>T		Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	3	2	0.666667	NM_004388	Q5VX50	Silent	SNP	ENST00000370630.5	37	CCDS698.1																																																																																			.	.	none		0.726	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027457.2	NM_004388	
LCE1F	353137	hgsc.bcm.edu	37	1	152749039	152749039	+	Silent	SNP	T	T	C	rs202038292|rs149277953	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:152749039T>C	ENST00000334371.2	+	1	192	c.192T>C	c.(190-192)ggT>ggC	p.G64G		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	64	Poly-Gly.				keratinization (GO:0031424)			p.G64_G65delGG(1)		kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTCTGGGGGTGGTGGCTGCT	0.672																																					p.G64G		Atlas-SNP	.											LCE1F,NS,carcinoma,+2,1	LCE1F	42	1	1	Deletion - In frame(1)	stomach(1)	c.T192C						scavenged	.						30.0	33.0	32.0					1																	152749039		2201	4299	6500	SO:0001819	synonymous_variant	353137	exon1			TGGGGGTGGTGGC		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.192T>C	1.37:g.152749039T>C		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	93	5	0.0537634	NM_178354		Silent	SNP	ENST00000334371.2	37	CCDS1023.1																																																																																			T|0.954;C|0.046	0.046	strong		0.672	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305785	39305785	+	Missense_Mutation	SNP	A	A	T	rs411367		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:39305785A>T	ENST00000343246.4	-	1	269	c.235T>A	c.(235-237)Tgc>Agc	p.C79S		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	79	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tggcagcagcaggggcggcag	0.657																																					p.C79S		Atlas-SNP	.											KRTAP4-5,colon,carcinoma,0,3	KRTAP4-5	34	3	0			c.T235A						PASS	.						12.0	18.0	16.0					17																	39305785		2089	4172	6261	SO:0001583	missense	85289	exon1			AGCAGCAGGGGCG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.235T>A	17.37:g.39305785A>T	ENSP00000340546:p.Cys79Ser	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	56	11	0.196429	NM_033188		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	773	0.35393772893772896	210	0.4268292682926829	126	0.34806629834254144	175	0.30594405594405594	262	0.34564643799472294	.	0.010	-1.763522	0.00651	.	.	ENSG00000198271	ENST00000343246	T	0.00534	6.74	2.78	-5.56	0.02529	.	0.768893	0.10092	N	0.717076	T	0.00012	0.0000	N	0.01431	-0.87	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.23297	-1.0192	9	0.02654	T	1	.	5.4481	0.16548	0.6146:0.0:0.1542:0.2312	rs411367;rs6503604	79	Q9BYR2	KRA45_HUMAN	S	79	ENSP00000340546:C79S	ENSP00000340546:C79S	C	-	1	0	KRTAP4-5	36559311	0.977000	0.34250	0.000000	0.03702	0.000000	0.00434	-0.260000	0.08708	-1.272000	0.02427	-2.057000	0.00402	TGC	A|0.646;T|0.354	0.354	strong		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
DDX39B	7919	hgsc.bcm.edu	37	6	31500627	31500627	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:31500627T>C	ENST00000396172.1	-	7	1427	c.797A>G	c.(796-798)tAc>tGc	p.Y266C	DDX39B_ENST00000458640.1_Missense_Mutation_p.Y266C|DDX39B_ENST00000415382.2_Missense_Mutation_p.Y188C|DDX39B_ENST00000376177.2_Missense_Mutation_p.Y266C|ATP6V1G2-DDX39B_ENST00000376185.1_3'UTR|DDX39B_ENST00000417556.2_Missense_Mutation_p.Y281C|DDX39B_ENST00000462421.1_5'Flank	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B	266	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						CAGTTTCACGTAGTACTGCTG	0.552																																					p.Y266C		Atlas-SNP	.											.	DDX39B	38	.	0			c.A797G						PASS	.						125.0	100.0	109.0					6																	31500627		1511	2709	4220	SO:0001583	missense	7919	exon7			TTCACGTAGTACT	Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.797A>G	6.37:g.31500627T>C	ENSP00000379475:p.Tyr266Cys	Somatic	189	0	0		WXS	Illumina HiSeq	Phase_I	208	93	0.447115	NM_004640	B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	Missense_Mutation	SNP	ENST00000396172.1	37	CCDS4697.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.74|19.74	3.883915|3.883915	0.72410|0.72410	.|.	.|.	ENSG00000198563|ENSG00000198563	ENST00000417023|ENST00000376177;ENST00000458640;ENST00000396172;ENST00000417556;ENST00000415382;ENST00000431908;ENST00000427214	.|D;T;T;T;T;T;T	.|0.92752	.|-3.1;3.44;3.44;3.44;3.44;3.44;3.33	5.46|5.46	4.28|4.28	0.50868|0.50868	.|Helicase, C-terminal (1);	.|0.079694	.|0.51477	.|D	.|0.000087	D|D	0.95053|0.95053	0.8398|0.8398	M|M	0.86740|0.86740	2.835|2.835	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.988	.|D;D;D;P	.|0.91635	.|0.999;0.999;0.994;0.693	D|D	0.95212|0.95212	0.8326|0.8326	5|10	.|0.87932	.|D	.|0	-12.1399|-12.1399	10.7351|10.7351	0.46120|0.46120	0.0:0.0:0.1602:0.8398|0.0:0.0:0.1602:0.8398	.|.	.|188;266;266;281	.|B4DP52;Q13838;Q5STU3;F8VQ10	.|.;DX39B_HUMAN;.;.	A|C	30|266;266;266;281;188;188;266	.|ENSP00000365347:Y266C;ENSP00000416269:Y266C;ENSP00000379475:Y266C;ENSP00000412582:Y281C;ENSP00000392669:Y188C;ENSP00000408000:Y188C;ENSP00000399371:Y266C	.|ENSP00000365347:Y266C	T|Y	-|-	1|2	0|0	DDX39B|DDX39B	31608606|31608606	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.673000|7.673000	0.83973|0.83973	0.886000|0.886000	0.36113|0.36113	0.533000|0.533000	0.62120|0.62120	ACG|TAC	.	.	none		0.552	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259083.1	NM_004640	
USP34	9736	hgsc.bcm.edu	37	2	61454211	61454211	+	Missense_Mutation	SNP	C	C	T	rs371000877		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:61454211C>T	ENST00000398571.2	-	62	7662	c.7586G>A	c.(7585-7587)cGa>cAa	p.R2529Q		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2529					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R2529Q(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CCTTTCTGATCGAGACTGTTC	0.348																																					p.R2529Q		Atlas-SNP	.											USP34,rectum,carcinoma,0,1	USP34	334	1	1	Substitution - Missense(1)	large_intestine(1)	c.G7586A						scavenged	.	C	GLN/ARG	0,3694		0,0,1847	110.0	97.0	101.0		7586	5.3	1.0	2		101	1,8171		0,1,4085	no	missense	USP34	NM_014709.3	43	0,1,5932	TT,TC,CC		0.0122,0.0,0.0084	probably-damaging	2529/3547	61454211	1,11865	1847	4086	5933	SO:0001583	missense	9736	exon62			TCTGATCGAGACT	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.7586G>A	2.37:g.61454211C>T	ENSP00000381577:p.Arg2529Gln	Somatic	186	0	0		WXS	Illumina HiSeq	Phase_I	203	3	0.0147783	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	C	36	5.644478	0.96704	0.0	1.22E-4	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.05513	3.77;3.43	5.29	5.29	0.74685	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.10981	0.0268	L	0.59436	1.845	0.80722	D	1	P	0.47409	0.895	B	0.40940	0.344	T	0.02053	-1.1222	10	0.62326	D	0.03	.	18.9386	0.92597	0.0:1.0:0.0:0.0	.	2529	Q70CQ2	UBP34_HUMAN	Q	2377;2377;2529;807	ENSP00000381577:R2529Q;ENSP00000410559:R807Q	ENSP00000263989:R2377Q	R	-	2	0	USP34	61307715	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.745000	0.85046	2.478000	0.83669	0.650000	0.86243	CGA	.	.	weak		0.348	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
TENM4	26011	hgsc.bcm.edu	37	11	78380664	78380664	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:78380664G>A	ENST00000278550.7	-	32	7188	c.6726C>T	c.(6724-6726)cgC>cgT	p.R2242R		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2242					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TGATGCGGTCGCGGATGTCAT	0.572																																					p.R2242R		Atlas-SNP	.											ODZ4_ENST00000278550,colon,carcinoma,-1,2	.	.	2	0			c.C6726T						PASS	.						170.0	174.0	173.0					11																	78380664		2171	4252	6423	SO:0001819	synonymous_variant	26011	exon32			GCGGTCGCGGATG	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6726C>T	11.37:g.78380664G>A		Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	143	37	0.258741	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	CCDS44688.1																																																																																			.	.	none		0.572	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
RBM27	54439	hgsc.bcm.edu	37	5	145613242	145613242	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:145613242T>G	ENST00000265271.5	+	7	1246	c.1080T>G	c.(1078-1080)agT>agG	p.S360R	RBM27_ENST00000506502.1_Missense_Mutation_p.S360R	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	360	Pro-rich.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGGCCATAGTATGAGACTTC	0.562																																					p.S360R		Atlas-SNP	.											.	RBM27	119	.	0			c.T1080G						PASS	.						41.0	42.0	42.0					5																	145613242		1568	3582	5150	SO:0001583	missense	54439	exon7			CCATAGTATGAGA	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.1080T>G	5.37:g.145613242T>G	ENSP00000265271:p.Ser360Arg	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	106	31	0.292453	NM_018989	Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	37	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	T	14.01	2.406658	0.42715	.	.	ENSG00000091009	ENST00000265271	T	0.46451	0.87	5.52	1.85	0.25348	.	0.476754	0.24611	N	0.037051	T	0.20414	0.0491	N	0.08118	0	0.27233	N	0.959348	B;B	0.23058	0.001;0.079	B;B	0.21546	0.001;0.035	T	0.19257	-1.0311	10	0.20519	T	0.43	-1.2398	10.0623	0.42282	0.0:0.3859:0.0:0.6141	.	360;360	Q9P2N5;B3KY61	RBM27_HUMAN;.	R	360	ENSP00000265271:S360R	ENSP00000265271:S360R	S	+	3	2	RBM27	145593435	0.269000	0.24143	0.979000	0.43373	0.998000	0.95712	-0.066000	0.11598	0.139000	0.18822	0.533000	0.62120	AGT	.	.	none		0.562	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
VWA7	80737	hgsc.bcm.edu	37	6	31744405	31744405	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:31744405T>C	ENST00000375688.4	-	2	352	c.152A>G	c.(151-153)gAg>gGg	p.E51G	VWA7_ENST00000375686.3_Missense_Mutation_p.E51G|Y_RNA_ENST00000364685.1_RNA|VWA7_ENST00000447450.1_Missense_Mutation_p.E51G|VWA7_ENST00000467576.1_5'UTR			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	51						extracellular region (GO:0005576)											GAGCGCTGCCTCCTCAGTTAG	0.642																																					p.E51G		Atlas-SNP	.											.	.	.	.	0			c.A152G						PASS	.						19.0	9.0	13.0					6																	31744405		1410	2507	3917	SO:0001583	missense	80737	exon2			GCTGCCTCCTCAG		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.152A>G	6.37:g.31744405T>C	ENSP00000364840:p.Glu51Gly	Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	158	67	0.424051	NM_025258	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	T	17.59	3.427819	0.62733	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	T;T;T	0.13778	2.56;2.56;2.56	4.92	3.74	0.42951	.	0.199559	0.41823	D	0.000801	T	0.05914	0.0154	L	0.50333	1.59	0.31474	N	0.667961	B	0.29646	0.253	B	0.31337	0.128	T	0.13737	-1.0498	10	0.51188	T	0.08	-10.4076	10.0134	0.42001	0.0:0.0:0.1703:0.8297	.	51	Q9Y334	G7C_HUMAN	G	51	ENSP00000364840:E51G;ENSP00000364838:E51G;ENSP00000390554:E51G	ENSP00000364838:E51G	E	-	2	0	C6orf27	31852384	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.464000	0.53057	0.881000	0.35993	0.455000	0.32223	GAG	.	.	none		0.642	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
PCDH9	5101	hgsc.bcm.edu	37	13	66879059	66879059	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:66879059A>C	ENST00000377865.2	-	4	3576	c.3442T>G	c.(3442-3444)Ttg>Gtg	p.L1148V	PCDH9_ENST00000328454.5_Missense_Mutation_p.L1114V|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000544246.1_Missense_Mutation_p.L1148V|PCDH9_ENST00000456367.1_Missense_Mutation_p.L1114V			Q9HC56	PCDH9_HUMAN	protocadherin 9	1148					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TATGGACCCAAGCCAGGAGGC	0.517																																					p.L1148V		Atlas-SNP	.											.	PCDH9	252	.	0			c.T3442G						PASS	.						121.0	105.0	111.0					13																	66879059		2203	4300	6503	SO:0001583	missense	5101	exon5			GACCCAAGCCAGG	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3442T>G	13.37:g.66879059A>C	ENSP00000367096:p.Leu1148Val	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	112	20	0.178571	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.771484	0.49680	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.54675	0.64;0.64;0.56;0.56	6.16	5.03	0.67393	.	0.000000	0.38217	N	0.001780	T	0.43122	0.1233	L	0.39898	1.24	0.30218	N	0.797123	P;P;P	0.46859	0.85;0.885;0.85	B;B;B	0.43301	0.301;0.415;0.301	T	0.51100	-0.8748	10	0.45353	T	0.12	.	7.8316	0.29347	0.7928:0.0:0.2072:0.0	.	1106;1114;1148	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	V	1148;1148;1114;1114	ENSP00000442186:L1148V;ENSP00000367096:L1148V;ENSP00000401699:L1114V;ENSP00000332060:L1114V	ENSP00000332060:L1114V	L	-	1	2	PCDH9	65777060	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.940000	0.40223	2.367000	0.80283	0.528000	0.53228	TTG	.	.	none		0.517	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
ADAM29	11086	hgsc.bcm.edu	37	4	175897508	175897508	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:175897508A>G	ENST00000359240.3	+	5	1502	c.832A>G	c.(832-834)Acg>Gcg	p.T278A	ADAM29_ENST00000404450.4_Missense_Mutation_p.T278A|ADAM29_ENST00000445694.1_Missense_Mutation_p.T278A|ADAM29_ENST00000514159.1_Missense_Mutation_p.T278A|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	278	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GGAGAACATTACGCCCCGGAT	0.428																																					p.T278A	Ovarian(140;1727 1835 21805 25838 41440)	Atlas-SNP	.											ADAM29,rectum,carcinoma,-1,1	ADAM29	262	1	0			c.A832G						scavenged	.						145.0	139.0	141.0					4																	175897508		2203	4300	6503	SO:0001583	missense	11086	exon4			AACATTACGCCCC	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.832A>G	4.37:g.175897508A>G	ENSP00000352177:p.Thr278Ala	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	179	6	0.0335196	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	A	3.239	-0.155766	0.06544	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.09350	2.99;2.99;2.99;2.99	4.13	-8.26	0.01021	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	6.208930	0.00695	N	0.000753	T	0.05868	0.0153	N	0.25647	0.755	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.29119	-1.0022	9	.	.	.	.	0.1078	0.00054	0.3261:0.2277:0.1843:0.2619	.	278	Q9UKF5	ADA29_HUMAN	A	278	ENSP00000352177:T278A;ENSP00000414544:T278A;ENSP00000384229:T278A;ENSP00000423517:T278A	.	T	+	1	0	ADAM29	176134083	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.288000	0.00525	-4.603000	0.00040	-1.960000	0.00479	ACG	.	.	none		0.428	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
SIRPA	140885	hgsc.bcm.edu	37	20	1902270	1902270	+	Silent	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:1902270T>C	ENST00000358771.4	+	3	818	c.666T>C	c.(664-666)gtT>gtC	p.V222V	SIRPA_ENST00000400068.3_Silent_p.V222V|SIRPA_ENST00000356025.3_Silent_p.V222V	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	222	Ig-like C1-type 1.		V -> I.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GCGAGGACGTTCACTCTCAAG	0.592																																					p.V222V	GBM(155;1668 1920 5945 42733 48121)	Atlas-SNP	.											SIRPA,NS,carcinoma,+2,1	SIRPA	83	1	0			c.T666C						scavenged	.						71.0	64.0	66.0					20																	1902270		2203	4296	6499	SO:0001819	synonymous_variant	140885	exon4			GGACGTTCACTCT	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.666T>C	20.37:g.1902270T>C		Somatic	488	0	0		WXS	Illumina HiSeq	Phase_I	424	4	0.00943396	NM_001040022	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Silent	SNP	ENST00000358771.4	37	CCDS13022.1																																																																																			.	.	none		0.592	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
FHOD3	80206	hgsc.bcm.edu	37	18	34340708	34340708	+	Silent	SNP	C	C	T	rs200423151		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:34340708C>T	ENST00000359247.4	+	22	3987	c.3987C>T	c.(3985-3987)ccC>ccT	p.P1329P	FHOD3_ENST00000590592.1_Silent_p.P1529P|FHOD3_ENST00000257209.4_Silent_p.P1346P|FHOD3_ENST00000445677.1_Silent_p.P1308P|FHOD3_ENST00000591635.1_Silent_p.P542P|FHOD3_ENST00000592128.1_Silent_p.P325P	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1329					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACGCCACCCCCGCGCTGGGCG	0.687													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13615	0.0		0.0	False		,,,				2504	0.0				p.P1346P		Atlas-SNP	.											.	FHOD3	210	.	0			c.C4038T						PASS	.						23.0	22.0	22.0					18																	34340708		2193	4295	6488	SO:0001819	synonymous_variant	80206	exon23			CACCCCCGCGCTG	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3987C>T	18.37:g.34340708C>T		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	22	5	0.227273	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	37																																																																																				C|1.000;T|0.000	0.000	strong		0.687	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
ACOX1	51	hgsc.bcm.edu	37	17	73945836	73945836	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:73945836C>T	ENST00000301608.4	-	10	1501	c.1441G>A	c.(1441-1443)Gaa>Aaa	p.E481K	ACOX1_ENST00000293217.5_Missense_Mutation_p.E481K|ACOX1_ENST00000537812.1_Missense_Mutation_p.E443K	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	481					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)			large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	GTTAGGCTTTCGGGGCTGTTG	0.572																																					p.E481K		Atlas-SNP	.											ACOX1_ENST00000301608,NS,carcinoma,0,4	ACOX1	85	4	0			c.G1441A						scavenged	.						118.0	95.0	103.0					17																	73945836		2203	4300	6503	SO:0001583	missense	51	exon10			GGCTTTCGGGGCT	U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.1441G>A	17.37:g.73945836C>T	ENSP00000301608:p.Glu481Lys	Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	165	2	0.0121212	NM_007292	A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	ENST00000301608.4	37	CCDS11735.1	.	.	.	.	.	.	.	.	.	.	C	1.654	-0.513165	0.04200	.	.	ENSG00000161533	ENST00000301608;ENST00000293217;ENST00000537812;ENST00000539791;ENST00000538781	T;T;T	0.39787	1.06;1.06;1.06	5.62	2.33	0.28932	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.760089	0.13248	N	0.402332	T	0.26048	0.0635	L	0.33668	1.02	0.09310	N	1	B;B;B;B	0.12013	0.0;0.0;0.005;0.004	B;B;B;B	0.12837	0.001;0.001;0.008;0.004	T	0.23691	-1.0181	10	0.13470	T	0.59	-10.6768	5.1665	0.15088	0.2256:0.3816:0.3256:0.0671	.	413;443;481;481	F5H0M0;F5GYQ8;Q15067;Q15067-2	.;.;ACOX1_HUMAN;.	K	481;481;443;481;413	ENSP00000301608:E481K;ENSP00000293217:E481K;ENSP00000441257:E443K	ENSP00000293217:E481K	E	-	1	0	ACOX1	71457431	0.000000	0.05858	0.505000	0.27651	0.050000	0.14768	0.049000	0.14099	0.705000	0.31890	0.650000	0.86243	GAA	.	.	none		0.572	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439503.1		
SDHA	6389	hgsc.bcm.edu	37	5	256470	256470	+	Missense_Mutation	SNP	G	G	A	rs3211483		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:256470G>A	ENST00000264932.6	+	15	2045	c.1930G>A	c.(1930-1932)Gtg>Atg	p.V644M	SDHA_ENST00000504309.1_Missense_Mutation_p.V563M|SDHA_ENST00000510361.1_Missense_Mutation_p.V596M|SDHA_ENST00000507522.1_3'UTR	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	644					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	ATATAGACCCGTGATCGACAA	0.428									Familial Paragangliomas																												p.V644M		Atlas-SNP	.											SDHA,NS,adenocarcinoma,0,2	SDHA	80	2	0			c.G1930A						scavenged	.						91.0	104.0	99.0					5																	256470		2203	4300	6503	SO:0001583	missense	6389	exon15	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	AGACCCGTGATCG	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1930G>A	5.37:g.256470G>A	ENSP00000264932:p.Val644Met	Somatic	135	1	0.00740741		WXS	Illumina HiSeq	Phase_I	135	4	0.0296296	NM_004168	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	15.71|15.71	2.915077|2.915077	0.52546|0.52546	.|.	.|.	ENSG00000073578|ENSG00000073578	ENST00000515815|ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	.|D;D;D	.|0.84730	.|-1.89;-1.89;-1.89	4.12|4.12	4.12|4.12	0.48240|0.48240	.|Fumarate reductase/succinate dehydrogenase flavoprotein-like, C-terminal (1);Fumarate reductase/succinate dehydrogenase flavoprotein, C-terminal (1);	.|0.000000	.|0.64402	.|U	.|0.000002	D|D	0.94056|0.94056	0.8095|0.8095	H|H	0.94582|0.94582	3.555|3.555	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;0.999;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.997;0.993;0.997	D|D	0.95511|0.95511	0.8586|0.8586	5|10	.|0.87932	.|D	.|0	.|.	13.8591|13.8591	0.63548|0.63548	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	rs3211483;rs17415232|rs3211483;rs17415232	.|596;238;563;644	.|E9PBJ5;B3KYA5;D6RFM5;P31040	.|.;.;.;DHSA_HUMAN	H|M	126|644;499;563;596	.|ENSP00000264932:V644M;ENSP00000426514:V563M;ENSP00000427703:V596M	.|ENSP00000264932:V644M	R|V	+|+	2|1	0|0	SDHA|SDHA	309470|309470	1.000000|1.000000	0.71417|0.71417	0.642000|0.642000	0.29436|0.29436	0.242000|0.242000	0.25591|0.25591	8.735000|8.735000	0.91549|0.91549	1.861000|1.861000	0.53984|0.53984	0.305000|0.305000	0.20034|0.20034	CGT|GTG	G|1.000;|0.000	.	weak		0.428	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
ZNF423	23090	hgsc.bcm.edu	37	16	49670344	49670344	+	Missense_Mutation	SNP	G	G	A	rs544721667		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:49670344G>A	ENST00000561648.1	-	4	2772	c.2719C>T	c.(2719-2721)Cgg>Tgg	p.R907W	ZNF423_ENST00000262383.2_Missense_Mutation_p.R907W|ZNF423_ENST00000563137.2_Missense_Mutation_p.R847W|ZNF423_ENST00000535559.1_Missense_Mutation_p.R790W|ZNF423_ENST00000562871.1_Missense_Mutation_p.R847W|ZNF423_ENST00000562520.1_Missense_Mutation_p.R847W|ZNF423_ENST00000567169.1_Missense_Mutation_p.R790W	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	907					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TTGTGGTCCCGCAGCCGGTGA	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		20967	0.0		0.0	False		,,,				2504	0.001				p.R907W		Atlas-SNP	.											ZNF423_ENST00000262383,NS,carcinoma,+2,2	ZNF423	463	2	0			c.C2719T						PASS	.						61.0	59.0	60.0					16																	49670344		2198	4300	6498	SO:0001583	missense	23090	exon4			GGTCCCGCAGCCG	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2719C>T	16.37:g.49670344G>A	ENSP00000455426:p.Arg907Trp	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	119	23	0.193277	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.204654	0.58234	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.10382	2.88;2.93	4.81	2.74	0.32292	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.27063	0.0663	M	0.62723	1.935	0.43540	D	0.995834	D	0.89917	1.0	D	0.72625	0.978	T	0.01574	-1.1321	9	.	.	.	-25.0868	13.064	0.59022	0.0:0.0:0.463:0.537	.	907	Q2M1K9	ZN423_HUMAN	W	907;790	ENSP00000262383:R907W;ENSP00000442321:R790W	.	R	-	1	2	ZNF423	48227845	0.829000	0.29322	0.997000	0.53966	0.985000	0.73830	0.897000	0.28390	1.028000	0.39785	-0.268000	0.10319	CGG	.	.	none		0.592	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
KCNK10	54207	hgsc.bcm.edu	37	14	88652049	88652049	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:88652049C>T	ENST00000340700.5	-	7	1898	c.1447G>A	c.(1447-1449)Gag>Aag	p.E483K	KCNK10_ENST00000312350.5_Missense_Mutation_p.E488K|KCNK10_ENST00000319231.5_Missense_Mutation_p.E488K	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	483					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						TTCTTCTCCTCGTCCAGGGAG	0.502																																					p.E488K		Atlas-SNP	.											.	KCNK10	273	.	0			c.G1462A						PASS	.						149.0	148.0	148.0					14																	88652049		2203	4300	6503	SO:0001583	missense	54207	exon7			TCTCCTCGTCCAG	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1447G>A	14.37:g.88652049C>T	ENSP00000343104:p.Glu483Lys	Somatic	252	0	0		WXS	Illumina HiSeq	Phase_I	275	68	0.247273	NM_138318	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944729	0.73672	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	D;D;D	0.94232	-3.36;-3.37;-3.38	5.5	5.5	0.81552	.	0.667612	0.15589	N	0.254476	D	0.90930	0.7149	L	0.46157	1.445	0.51767	D	0.999937	B;B;B	0.29612	0.251;0.251;0.251	B;B;B	0.15052	0.012;0.008;0.012	D	0.88801	0.3285	10	0.72032	D	0.01	.	18.3984	0.90507	0.0:1.0:0.0:0.0	.	483;488;488	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	K	483;488;488	ENSP00000343104:E483K;ENSP00000310568:E488K;ENSP00000312811:E488K	ENSP00000310568:E488K	E	-	1	0	KCNK10	87721802	1.000000	0.71417	0.929000	0.37066	0.786000	0.44442	7.294000	0.78760	2.599000	0.87857	0.655000	0.94253	GAG	.	.	none		0.502	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
C16orf46	123775	hgsc.bcm.edu	37	16	81097482	81097482	+	Missense_Mutation	SNP	G	G	A	rs367739815		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:81097482G>A	ENST00000299578.5	-	3	314	c.79C>T	c.(79-81)Cca>Tca	p.P27S	C16orf46_ENST00000444657.3_Intron|RP11-303E16.8_ENST00000564536.1_RNA|C16orf46_ENST00000378611.4_Missense_Mutation_p.P27S	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	27						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						GTATAGGTTGGTTCTGTTTCT	0.343																																					p.P27S		Atlas-SNP	.											C16orf46_ENST00000378611,NS,malignant_melanoma,0,2	C16orf46	57	2	0			c.C79T						scavenged	.						166.0	150.0	155.0					16																	81097482		2202	4300	6502	SO:0001583	missense	123775	exon2			AGGTTGGTTCTGT	BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.79C>T	16.37:g.81097482G>A	ENSP00000299578:p.Pro27Ser	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	141	2	0.0141844	NM_001100873	Q96MA7	Missense_Mutation	SNP	ENST00000299578.5	37	CCDS10932.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189749	0.38707	.	.	ENSG00000166455	ENST00000378611;ENST00000299578	T;T	0.13778	2.56;2.56	5.37	0.624	0.17659	.	0.852033	0.10217	N	0.701381	T	0.08088	0.0202	N	0.19112	0.55	0.09310	N	1	B;B	0.25169	0.119;0.119	B;B	0.26416	0.069;0.069	T	0.36016	-0.9765	10	0.49607	T	0.09	.	3.8287	0.08865	0.3893:0.4015:0.2092:0.0	.	27;27	Q6P387-2;Q6P387	.;CP046_HUMAN	S	27	ENSP00000367874:P27S;ENSP00000299578:P27S	ENSP00000299578:P27S	P	-	1	0	C16orf46	79654983	0.000000	0.05858	0.001000	0.08648	0.849000	0.48306	0.728000	0.26013	0.581000	0.29539	0.563000	0.77884	CCA	.	.	alt		0.343	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269054.2	NM_152337	
TIAM2	26230	hgsc.bcm.edu	37	6	155458711	155458711	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:155458711G>A	ENST00000461783.3	+	7	2868	c.1595G>A	c.(1594-1596)cGa>cAa	p.R532Q	TIAM2_ENST00000456144.1_Missense_Mutation_p.R532Q|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000318981.5_Missense_Mutation_p.R532Q|TIAM2_ENST00000360366.4_Missense_Mutation_p.R532Q|TIAM2_ENST00000529824.2_Missense_Mutation_p.R532Q			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	532	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CTGGTGGCACGAAGGAAATGG	0.572																																					p.R532Q		Atlas-SNP	.											TIAM2,NS,malignant_melanoma,0,1	TIAM2	161	1	0			c.G1595A						scavenged	.						71.0	74.0	73.0					6																	155458711		2203	4300	6503	SO:0001583	missense	26230	exon4			TGGCACGAAGGAA		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1595G>A	6.37:g.155458711G>A	ENSP00000437188:p.Arg532Gln	Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	25	6	0.24	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	G	36	5.662895	0.96734	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	6.08	6.08	0.98989	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.82176	0.4980	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.989;0.993	T	0.82076	-0.0636	10	0.87932	D	0	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	532;532	Q8IVF5-2;Q8IVF5	.;TIAM2_HUMAN	Q	532;778;532;532;532;532;532	ENSP00000437188:R532Q;ENSP00000434901:R532Q;ENSP00000407746:R532Q;ENSP00000327315:R532Q;ENSP00000353528:R532Q;ENSP00000433348:R532Q	ENSP00000327315:R532Q	R	+	2	0	TIAM2	155500403	1.000000	0.71417	0.992000	0.48379	0.967000	0.64934	9.476000	0.97823	2.894000	0.99253	0.655000	0.94253	CGA	.	.	none		0.572	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
RHBDF1	64285	hgsc.bcm.edu	37	16	112797	112797	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:112797C>A	ENST00000262316.6	-	6	913	c.771G>T	c.(769-771)gaG>gaT	p.E257D	RHBDF1_ENST00000454039.2_Missense_Mutation_p.E257D	NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	257					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				ATGTGTCCAGCTCATCGGGGA	0.602																																					p.E257D		Atlas-SNP	.											.	RHBDF1	54	.	0			c.G771T						PASS	.						112.0	118.0	116.0					16																	112797		2203	4300	6503	SO:0001583	missense	64285	exon6			GTCCAGCTCATCG	BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.771G>T	16.37:g.112797C>A	ENSP00000262316:p.Glu257Asp	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	95	18	0.189474	NM_022450	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Missense_Mutation	SNP	ENST00000262316.6	37	CCDS32344.1	.	.	.	.	.	.	.	.	.	.	.	10.61	1.397914	0.25205	.	.	ENSG00000007384	ENST00000262316;ENST00000454039	T;T	0.64260	-0.09;-0.09	4.56	3.57	0.40892	.	0.102644	0.64402	D	0.000003	T	0.44074	0.1276	N	0.20401	0.57	0.47621	D	0.999476	B;B;B	0.29481	0.085;0.245;0.002	B;B;B	0.36608	0.074;0.229;0.02	T	0.22591	-1.0212	10	0.09590	T	0.72	-35.6303	8.8488	0.35188	0.0:0.8267:0.0:0.1733	.	257;280;257	F5GWL4;B4E3Q0;Q96CC6	.;.;RHDF1_HUMAN	D	257	ENSP00000262316:E257D;ENSP00000392133:E257D	ENSP00000262316:E257D	E	-	3	2	RHBDF1	52797	0.997000	0.39634	0.999000	0.59377	0.981000	0.71138	0.894000	0.28350	2.359000	0.80004	0.462000	0.41574	GAG	.	.	none		0.602	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134178.2	NM_022450	
FER	2241	hgsc.bcm.edu	37	5	108207168	108207168	+	Silent	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:108207168T>C	ENST00000281092.4	+	7	1152	c.768T>C	c.(766-768)ccT>ccC	p.P256P	FER_ENST00000536402.1_Silent_p.P256P|FER_ENST00000438717.2_Silent_p.P81P	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	256	Important for interaction with membranes containing phosphoinositides.				actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		AGATAGATCCTAGTACAGAAT	0.313																																					p.P256P	Colon(146;1051 1799 9836 27344 47401)	Atlas-SNP	.											FER,NS,carcinoma,+1,1	FER	100	1	0			c.T768C						scavenged	.						100.0	105.0	103.0					5																	108207168		2202	4298	6500	SO:0001819	synonymous_variant	2241	exon7			AGATCCTAGTACA	J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.768T>C	5.37:g.108207168T>C		Somatic	249	0	0		WXS	Illumina HiSeq	Phase_I	303	5	0.0165017	NM_005246	B2RCR4|B4DSQ2|H2FLB8	Silent	SNP	ENST00000281092.4	37	CCDS4098.1																																																																																			.	.	none		0.313	FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250664.1	NM_005246	
ZFC3H1	196441	hgsc.bcm.edu	37	12	72017233	72017233	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:72017233A>G	ENST00000378743.3	-	24	5009	c.4651T>C	c.(4651-4653)Tca>Cca	p.S1551P		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1551					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACAATTCTTGAAGGATTATCA	0.343																																					p.S1551P		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.T4651C						PASS	.						103.0	93.0	96.0					12																	72017233		1834	4087	5921	SO:0001583	missense	196441	exon24			TTCTTGAAGGATT	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4651T>C	12.37:g.72017233A>G	ENSP00000368017:p.Ser1551Pro	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	90	4	0.0444444	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.623719	0.66901	.	.	ENSG00000133858	ENST00000378743	T	0.34072	1.38	4.98	4.98	0.66077	.	0.170588	0.39985	N	0.001204	T	0.48409	0.1498	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.45116	-0.9283	10	0.44086	T	0.13	.	14.6713	0.68945	1.0:0.0:0.0:0.0	.	1551	O60293	ZC3H1_HUMAN	P	1551	ENSP00000368017:S1551P	ENSP00000368017:S1551P	S	-	1	0	ZFC3H1	70303500	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	4.627000	0.61276	1.868000	0.54150	0.460000	0.39030	TCA	.	.	none		0.343	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
SGK1	6446	hgsc.bcm.edu	37	6	134495706	134495706	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134495706C>T	ENST00000237305.7	-	2	183	c.95G>A	c.(94-96)aGg>aAg	p.R32K	SGK1_ENST00000367857.5_Missense_Mutation_p.R22K|SGK1_ENST00000413996.3_Missense_Mutation_p.R46K|SGK1_ENST00000367858.5_Missense_Mutation_p.R127K|SGK1_ENST00000489458.2_5'Flank|SGK1_ENST00000475719.2_Missense_Mutation_p.R32K|SGK1_ENST00000528577.1_Missense_Mutation_p.R60K	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	32	Necessary for localization to the mitochondria.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)	p.R32M(1)|p.R127M(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CAGACCCATCCTCCTCTGCTT	0.428											OREG0017675	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R127K		Atlas-SNP	.											SGK1_ENST00000367858,NS,lymphoid_neoplasm,0,2	SGK1	387	2	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.G380A						PASS	.						79.0	79.0	79.0					6																	134495706		2203	4300	6503	SO:0001583	missense	6446	exon4			CCCATCCTCCTCT	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.95G>A	6.37:g.134495706C>T	ENSP00000237305:p.Arg32Lys	Somatic	76	0	0	1611	WXS	Illumina HiSeq	Phase_I	48	12	0.25	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823755	0.71143	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T;T	0.43688	1.39;1.39;1.39;1.39;1.39;1.39;0.94	5.89	5.89	0.94794	.	0.083857	0.85682	D	0.000000	T	0.27559	0.0677	L	0.37630	1.12	0.80722	D	1	B;B;B;B;B;B	0.15719	0.014;0.001;0.011;0.004;0.014;0.003	B;B;B;B;B;B	0.25405	0.03;0.002;0.02;0.03;0.06;0.007	T	0.03545	-1.1026	10	0.40728	T	0.16	.	20.2576	0.98430	0.0:1.0:0.0:0.0	.	60;46;32;22;127;32	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	K	127;46;32;22;60;32;96	ENSP00000356832:R127K;ENSP00000396242:R46K;ENSP00000237305:R32K;ENSP00000356831:R22K;ENSP00000434450:R60K;ENSP00000434302:R32K;ENSP00000435577:R96K	ENSP00000237305:R32K	R	-	2	0	SGK1	134537399	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.276000	0.51646	2.783000	0.95769	0.655000	0.94253	AGG	.	.	none		0.428	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
SGK1	6446	hgsc.bcm.edu	37	6	134495711	134495711	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134495711C>T	ENST00000237305.7	-	2	178	c.90G>A	c.(88-90)caG>caA	p.Q30Q	SGK1_ENST00000367857.5_Silent_p.Q20Q|SGK1_ENST00000413996.3_Silent_p.Q44Q|SGK1_ENST00000367858.5_Silent_p.Q125Q|SGK1_ENST00000489458.2_5'Flank|SGK1_ENST00000475719.2_Silent_p.Q30Q|SGK1_ENST00000528577.1_Silent_p.Q58Q	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	30	Necessary for localization to the mitochondria.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CCATCCTCCTCTGCTTCATGA	0.433											OREG0017675	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q125Q		Atlas-SNP	.											.	SGK1	387	.	0			c.G375A						PASS	.						76.0	76.0	76.0					6																	134495711		2203	4300	6503	SO:0001819	synonymous_variant	6446	exon4			CCTCCTCTGCTTC	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.90G>A	6.37:g.134495711C>T		Somatic	78	0	0	1611	WXS	Illumina HiSeq	Phase_I	47	13	0.276596	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Silent	SNP	ENST00000237305.7	37	CCDS5170.1																																																																																			.	.	none		0.433	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
DDX3X	1654	hgsc.bcm.edu	37	X	41206198	41206198	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:41206198C>T	ENST00000399959.2	+	15	2557	c.1702C>T	c.(1702-1704)Ccg>Tcg	p.P568S	DDX3X_ENST00000457138.2_Missense_Mutation_p.P552S|DDX3X_ENST00000478993.1_3'UTR|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000441189.2_Intron	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	568	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						ACAAGAAGTGCCGTCTTGGTT	0.403										HNSCC(61;0.18)																											p.P568S		Atlas-SNP	.											.	DDX3X	138	.	0			c.C1702T						PASS	.						93.0	90.0	91.0					X																	41206198		2172	4275	6447	SO:0001583	missense	1654	exon15			GAAGTGCCGTCTT	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1702C>T	X.37:g.41206198C>T	ENSP00000382840:p.Pro568Ser	Somatic	248	0	0		WXS	Illumina HiSeq	Phase_I	241	15	0.0622407	NM_001193416	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	ENST00000399959.2	37	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782891	0.90282	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.27402	1.67;1.69	5.28	5.28	0.74379	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58221	0.2107	M	0.76002	2.32	0.80722	D	1	B;D;D;D	0.89917	0.002;1.0;1.0;1.0	B;D;D;D	0.97110	0.0;0.936;1.0;1.0	T	0.63404	-0.6645	10	0.87932	D	0	-8.1884	18.0954	0.89488	0.0:1.0:0.0:0.0	.	438;552;580;568	B4DLU5;B4E3E8;Q59GX6;O00571	.;.;.;DDX3X_HUMAN	S	568;552	ENSP00000382840:P568S;ENSP00000392494:P552S	ENSP00000382840:P568S	P	+	1	0	DDX3X	41091142	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.773000	0.85462	2.209000	0.71365	0.529000	0.55759	CCG	.	.	none		0.403	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005	
CHCHD4	131474	hgsc.bcm.edu	37	3	14154566	14154566	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:14154566C>T	ENST00000396914.3	-	3	431	c.250G>A	c.(250-252)Ggg>Agg	p.G84R	CHCHD4_ENST00000295767.5_Missense_Mutation_p.G97R	NM_001098502.1	NP_001091972.1	Q8N4Q1	MIA40_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 4	84	CHCH.				'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein import into mitochondrial intermembrane space (GO:0045041)|protein maturation by protein folding (GO:0022417)|protein targeting to mitochondrion (GO:0006626)	mitochondrial intermembrane space (GO:0005758)	protein disulfide oxidoreductase activity (GO:0015035)	p.G97R(2)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5						CAGTCTGACCCCTTGATCTCC	0.537																																					p.G97R		Atlas-SNP	.											CHCHD4,NS,carcinoma,0,1	CHCHD4	8	1	2	Substitution - Missense(2)	lung(2)	c.G289A						scavenged	.						92.0	87.0	89.0					3																	14154566		2203	4300	6503	SO:0001583	missense	131474	exon4			CTGACCCCTTGAT	BC017082	CCDS2617.1, CCDS43054.1	3p25.1	2012-10-15			ENSG00000163528	ENSG00000163528		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	26467	protein-coding gene	gene with protein product	"""translocase of inner mitochondrial membrane 40 homolog (S. cerevisiae)"", ""mitochondrial intermembrane space import and assembly 40 homolog (S. cerevisiae)"""	611077				22214851	Standard	NM_001098502		Approved	FLJ31709, TIMM40, MIA40	uc003byj.4	Q8N4Q1	OTTHUMG00000129805	ENST00000396914.3:c.250G>A	3.37:g.14154566C>T	ENSP00000380122:p.Gly84Arg	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	128	2	0.015625	NM_144636	A8K3Z9|Q96AI2|Q96MY6	Missense_Mutation	SNP	ENST00000396914.3	37	CCDS43054.1	.	.	.	.	.	.	.	.	.	.	C	35	5.464116	0.96257	.	.	ENSG00000163528	ENST00000295767;ENST00000396914	T;T	0.77489	-1.1;-1.1	5.61	5.61	0.85477	CHCH (1);	0.000000	0.85682	D	0.000000	D	0.91382	0.7281	M	0.92784	3.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92913	0.6349	10	0.87932	D	0	-34.5809	19.6398	0.95753	0.0:1.0:0.0:0.0	.	84;97	Q8N4Q1;Q8N4Q1-2	MIA40_HUMAN;.	R	97;84	ENSP00000295767:G97R;ENSP00000380122:G84R	ENSP00000295767:G97R	G	-	1	0	CHCHD4	14129567	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.646000	0.83445	2.641000	0.89580	0.591000	0.81541	GGG	.	.	none		0.537	CHCHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340423.1	NM_144636	
SI	6476	hgsc.bcm.edu	37	3	164704969	164704969	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:164704969C>T	ENST00000264382.3	-	45	5216	c.5154G>A	c.(5152-5154)caG>caA	p.Q1718Q		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1718	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CCTGTGCCATCTGATTATCAT	0.343										HNSCC(35;0.089)																											p.Q1718Q		Atlas-SNP	.											SI,NS,carcinoma,0,1	SI	500	1	0			c.G5154A						scavenged	.						162.0	160.0	160.0					3																	164704969		2203	4300	6503	SO:0001819	synonymous_variant	6476	exon45			TGCCATCTGATTA	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.5154G>A	3.37:g.164704969C>T		Somatic	216	0	0		WXS	Illumina HiSeq	Phase_I	248	4	0.016129	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	37	CCDS3196.1																																																																																			.	.	none		0.343	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
LOXHD1	125336	hgsc.bcm.edu	37	18	44126858	44126858	+	Splice_Site	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:44126858C>A	ENST00000398722.4	-	15	2679	c.2680G>T	c.(2680-2682)Gat>Tat	p.D894Y	LOXHD1_ENST00000582408.1_Splice_Site_p.D61Y|LOXHD1_ENST00000441551.2_Splice_Site_p.D966Y|LOXHD1_ENST00000300591.6_Splice_Site_p.D61Y|LOXHD1_ENST00000441893.2_Splice_Site_p.D105Y|LOXHD1_ENST00000579038.1_5'UTR|LOXHD1_ENST00000536736.1_Splice_Site_p.D1172Y			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	894					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TTTAGAAAACCTTTCTGCTCC	0.577																																					p.D1172Y		Atlas-SNP	.											.	LOXHD1	367	.	0			c.G3514T						PASS	.						79.0	92.0	88.0					18																	44126858		692	1591	2283	SO:0001630	splice_region_variant	125336	exon22			GAAAACCTTTCTG	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2680+1G>T	18.37:g.44126858C>A		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	82	5	0.0609756	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	ENST00000398722.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.51|12.51	1.959039|1.959039	0.34565|0.34565	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730;ENST00000536111;ENST00000420097|ENST00000441551	T;T;T;T;T|.	0.28255|.	1.62;1.62;1.62;1.62;1.62|.	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	0.231618|.	0.44285|.	D|.	0.000464|.	T|T	0.67059|0.67059	0.2853|0.2853	L|L	0.44542|0.44542	1.39|1.39	0.47276|0.47276	D|D	0.999371|0.999371	D;D;D|.	0.89917|.	0.998;0.999;1.0|.	D;D;D|.	0.91635|.	0.996;0.997;0.999|.	T|T	0.64402|0.64402	-0.6416|-0.6416	9|5	.|.	.|.	.|.	.|.	18.0981|18.0981	0.89497|0.89497	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1172;105;894|.	F5GZB4;F8WA52;Q8IVV2-2|.	.;.;.|.	Y|I	61;894;1172;105;894;74;74|1152	ENSP00000300591:D61Y;ENSP00000381707:D894Y;ENSP00000444586:D1172Y;ENSP00000409062:D105Y;ENSP00000440060:D74Y|.	.|.	D|R	-|-	1|2	0|0	LOXHD1|LOXHD1	42380856|42380856	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.721000|0.721000	0.41392|0.41392	4.899000|4.899000	0.63245|0.63245	2.265000|2.265000	0.75225|0.75225	0.557000|0.557000	0.71058|0.71058	GAT|AGA	.	.	none		0.577	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	Missense_Mutation
KCNJ12	3768	hgsc.bcm.edu	37	17	21318951	21318951	+	Silent	SNP	C	C	T	rs75757803	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:21318951C>T	ENST00000583088.1	+	3	1192	c.297C>T	c.(295-297)ggC>ggT	p.G99G	KCNJ12_ENST00000331718.5_Silent_p.G99G	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	99					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	TGCTGTTCGGCATCATCTTCT	0.637										Prostate(3;0.18)			.|||	25	0.00499201	0.0182	0.0014	5008	,	,		38536	0.0		0.0	False		,,,				2504	0.0				p.G99G		Atlas-SNP	.											KCNJ12,NS,carcinoma,+2,1	.	.	1	0			c.C297T						scavenged	.						116.0	75.0	89.0					17																	21318951		2203	4300	6503	SO:0001819	synonymous_variant	100134444	exon3			GTTCGGCATCATC	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.297C>T	17.37:g.21318951C>T		Somatic	189	48	0.253968		WXS	Illumina HiSeq	Phase_I	169	41	0.242604	NM_001194958	O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	37	CCDS11219.1																																																																																			C|0.500;T|0.500	0.500	weak		0.637	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
EID2B	126272	hgsc.bcm.edu	37	19	40023308	40023308	+	Silent	SNP	A	A	G	rs1123301	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:40023308A>G	ENST00000326282.4	-	1	186	c.135T>C	c.(133-135)gcT>gcC	p.A45A	EID2B_ENST00000601837.1_Intron|CTB-60E11.9_ENST00000594676.1_RNA	NM_152361.1	NP_689574.1			EP300 interacting inhibitor of differentiation 2B											endometrium(1)|lung(1)|urinary_tract(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;8.61e-26)|all cancers(26;2.76e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGCCTTCCCGAGCCTCCTGCA	0.751													.|||	4013	0.801318	0.8646	0.6484	5008	,	,		13555	0.8442		0.7425	False		,,,				2504	0.8405				p.A45A		Atlas-SNP	.											EID2B,NS,carcinoma,0,1	EID2B	9	1	0			c.T135C						scavenged	.	G		3691,533		1630,431,51	7.0	9.0	8.0		135	0.0	0.0	19	dbSNP_86	8	6168,2264		2313,1542,361	no	coding-synonymous	EID2B	NM_152361.1		3943,1973,412	GG,GA,AA		26.8501,12.6184,22.1002		45/162	40023308	9859,2797	2112	4216	6328	SO:0001819	synonymous_variant	126272	exon1			TTCCCGAGCCTCC	AK096263	CCDS12539.1	19q13.2	2008-02-05				ENSG00000176401			26796	protein-coding gene	gene with protein product						15970276	Standard	NM_152361		Approved	EID-3, FLJ38944	uc002olz.1	Q96D98		ENST00000326282.4:c.135T>C	19.37:g.40023308A>G		Somatic	6	1	0.166667		WXS	Illumina HiSeq	Phase_I	6	5	0.833333	NM_152361		Silent	SNP	ENST00000326282.4	37	CCDS12539.1																																																																																			A|0.234;G|0.766	0.766	strong		0.751	EID2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464961.1	NM_152361	
LILRA6	79168	hgsc.bcm.edu	37	19	54744358	54744358	+	Nonsense_Mutation	SNP	A	A	C	rs1052992	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:54744358A>C	ENST00000396365.2	-	6	1089	c.1050T>G	c.(1048-1050)taT>taG	p.Y350*	LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000245621.5_Nonsense_Mutation_p.Y350*|LILRA6_ENST00000419410.2_Nonsense_Mutation_p.Y350*|LILRA6_ENST00000270464.5_Intron|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000391735.3_3'UTR	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	350	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.Y350*(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AAGTGTCAAAATAACCCCGTG	0.557													.|||	381	0.0760783	0.0749	0.0303	5008	,	,		17493	0.2163		0.0239	False		,,,				2504	0.0194				p.Y350X		Atlas-SNP	.											LILRA6,NS,carcinoma,0,1	LILRA6	75	1	1	Substitution - Nonsense(1)	ovary(1)	c.T1050G						scavenged	.						72.0	100.0	90.0					19																	54744358		2084	4248	6332	SO:0001587	stop_gained	79168	exon6			GTCAAAATAACCC	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.1050T>G	19.37:g.54744358A>C	ENSP00000379651:p.Tyr350*	Somatic	28	24	0.857143		WXS	Illumina HiSeq	Phase_I	25	24	0.96	NM_024318		Nonsense_Mutation	SNP	ENST00000396365.2	37	CCDS42610.1	.	.	.	.	.	.	.	.	.	.	a	15.47	2.843898	0.51164	.	.	ENSG00000244482	ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	.	.	.	1.86	-2.86	0.05717	.	6.418410	0.00397	N	0.000047	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.8525	0.01175	0.3877:0.2736:0.192:0.1467	rs1052992;rs2361803;rs3193476	.	.	.	X	350	.	ENSP00000245621:Y350X	Y	-	3	2	LILRA6	59436170	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.095000	0.00152	-1.064000	0.03172	-1.043000	0.02367	TAT	A|1.000;|0.000	.	weak		0.557	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318	
C1QTNF9	338872	hgsc.bcm.edu	37	13	24895902	24895902	+	Missense_Mutation	SNP	C	C	A	rs530287667	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:24895902C>A	ENST00000382071.2	+	4	1083	c.998C>A	c.(997-999)cCg>cAg	p.P333Q	AL359736.1_ENST00000422229.2_5'Flank|C1QTNF9-AS1_ENST00000449656.1_RNA|C1QTNF9_ENST00000332018.4_Missense_Mutation_p.P333Q			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9	333	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		TTCAGCAGCCCGTGACAGAGG	0.453													C|||	3	0.000599042	0.0	0.0	5008	,	,		18131	0.001		0.0	False		,,,				2504	0.002				p.P333Q		Atlas-SNP	.											C1QTNF9,bladder,carcinoma,0,1	C1QTNF9	22	1	0			c.C998A						scavenged	.						100.0	108.0	105.0					13																	24895902		2203	4300	6503	SO:0001583	missense	338872	exon4			GCAGCCCGTGACA	BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.998C>A	13.37:g.24895902C>A	ENSP00000371503:p.Pro333Gln	Somatic	119	3	0.0252101		WXS	Illumina HiSeq	Phase_I	154	4	0.025974	NM_178540	A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Missense_Mutation	SNP	ENST00000382071.2	37	CCDS9306.1	.	.	.	.	.	.	.	.	.	.	c	12.12	1.842333	0.32513	.	.	ENSG00000240654	ENST00000382071;ENST00000332018	D;D	0.90324	-2.65;-2.65	3.53	-2.97	0.05530	Tumour necrosis factor-like (1);Complement C1q protein (1);	2.280360	0.02327	N	0.073533	T	0.80433	0.4622	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.67011	-0.5778	10	0.87932	D	0	.	2.2666	0.04080	0.4242:0.198:0.2782:0.0995	.	333	P0C862	C1T9A_HUMAN	Q	333	ENSP00000371503:P333Q;ENSP00000333737:P333Q	ENSP00000333737:P333Q	P	+	2	0	C1QTNF9	23793902	0.077000	0.21312	0.001000	0.08648	0.011000	0.07611	0.085000	0.14912	-0.409000	0.07553	-0.687000	0.03738	CCG	.	.	none		0.453	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044177.1	NM_178540	
PIK3CD	5293	hgsc.bcm.edu	37	1	9787030	9787030	+	Missense_Mutation	SNP	G	G	A	rs397518423		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:9787030G>A	ENST00000377346.4	+	24	3256	c.3061G>A	c.(3061-3063)Gaa>Aaa	p.E1021K	CLSTN1_ENST00000477264.1_5'Flank|PIK3CD_ENST00000361110.2_Missense_Mutation_p.E1045K|PIK3CD_ENST00000536656.1_Missense_Mutation_p.E1045K	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	1021	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		E -> K (in APDS; results in gain of function causing enhanced membrane association and kinase activity). {ECO:0000269|PubMed:24136356}.		adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	GAAGTTTAACGAAGCCCTCCG	0.567																																					p.E1021K		Atlas-SNP	.											PIK3CD,NS,lymphoid_neoplasm,0,2	PIK3CD	86	2	0			c.G3061A	GRCh37	CM067447	PIK3CD	M		PASS	.						79.0	71.0	74.0					1																	9787030		2203	4300	6503	SO:0001583	missense	5293	exon24			TTTAACGAAGCCC		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.3061G>A	1.37:g.9787030G>A	ENSP00000366563:p.Glu1021Lys	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	117	59	0.504274	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	CCDS104.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810780	0.50421	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	T;T;T	0.81415	-1.49;-1.49;-1.49	4.65	3.72	0.42706	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.86431	0.5931	L	0.53729	1.69	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;P;D	0.74674	0.984;0.876;0.941	D	0.87336	0.2328	10	0.87932	D	0	-17.4746	14.041	0.64674	0.0:0.0:0.8477:0.1523	.	1020;1045;1021	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	K	1045;1021;1045;1045	ENSP00000446444:E1045K;ENSP00000366563:E1021K;ENSP00000354410:E1045K	ENSP00000353766:E1045K	E	+	1	0	PIK3CD	9709617	1.000000	0.71417	0.115000	0.21578	0.699000	0.40488	9.865000	0.99609	0.945000	0.37605	-0.187000	0.12897	GAA	.	.	none		0.567	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
NOTCH3	4854	hgsc.bcm.edu	37	19	15290007	15290007	+	Missense_Mutation	SNP	C	C	T	rs10408676	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:15290007C>T	ENST00000263388.2	-	22	3622	c.3547G>A	c.(3547-3549)Gtg>Atg	p.V1183M		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1183	EGF-like 30; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		V -> M (in dbSNP:rs10408676). {ECO:0000269|PubMed:9388399}.		forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			ACCAGGTCCACGCAGGTGCCA	0.632													C|||	423	0.0844649	0.289	0.0259	5008	,	,		18528	0.0		0.007	False		,,,				2504	0.0164				p.V1183M		Atlas-SNP	.											.	NOTCH3	340	.	0			c.G3547A						PASS	.	C	MET/VAL	1066,3340	371.5+/-320.0	150,766,1287	35.0	40.0	38.0		3547	3.9	1.0	19	dbSNP_119	38	67,8533	38.3+/-94.2	0,67,4233	yes	missense	NOTCH3	NM_000435.2	21	150,833,5520	TT,TC,CC		0.7791,24.1943,8.7114	possibly-damaging	1183/2322	15290007	1133,11873	2203	4300	6503	SO:0001583	missense	4854	exon22			GGTCCACGCAGGT	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3547G>A	19.37:g.15290007C>T	ENSP00000263388:p.Val1183Met	Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	48	14	0.291667	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	145	0.06639194139194139	125	0.2540650406504065	14	0.03867403314917127	0	0.0	6	0.0079155672823219	C	19.66	3.868866	0.72065	0.241943	0.007791	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.95103	-3.61	3.9	3.9	0.45041	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.00356	0.0011	M	0.80183	2.485	0.21445	P	0.999688477	D;P	0.58620	0.983;0.698	P;B	0.54629	0.757;0.384	T	0.00000	-1.3391	8	0.56958	D	0.05	.	8.7049	0.34349	0.0:0.8903:0.0:0.1097	rs10408676;rs60652871;rs10408676	1134;1183	Q59FL3;Q9UM47	.;NOTC3_HUMAN	M	1183;1133	ENSP00000263388:V1183M	ENSP00000263388:V1183M	V	-	1	0	NOTCH3	15151007	0.965000	0.33210	0.992000	0.48379	0.925000	0.55904	2.324000	0.43831	1.720000	0.51447	0.561000	0.74099	GTG	C|0.924;T|0.076	0.076	strong		0.632	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
MAPK10	5602	hgsc.bcm.edu	37	4	87022299	87022299	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:87022299C>T	ENST00000359221.3	-	8	1162	c.636G>A	c.(634-636)agG>agA	p.R212R	MAPK10_ENST00000395169.3_Silent_p.R174R|MAPK10_ENST00000395161.2_Silent_p.R212R|MAPK10_ENST00000395157.3_Silent_p.R67R|MAPK10_ENST00000395166.1_Silent_p.R174R|MAPK10_ENST00000361569.2_Silent_p.R212R|MAPK10_ENST00000449047.2_Silent_p.R67R|MAPK10_ENST00000513839.1_5'Flank|MAPK10_ENST00000395160.3_Silent_p.R67R			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	212	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)	p.R212S(1)|p.R67S(1)		breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		TGCCTGCTGTCCTGGCCAGTC	0.448																																					p.R212R		Atlas-SNP	.											MAPK10_ENST00000449047,NS,carcinoma,0,1	MAPK10	106	1	2	Substitution - Missense(2)	lung(2)	c.G636A						PASS	.						119.0	100.0	107.0					4																	87022299		2203	4300	6503	SO:0001819	synonymous_variant	5602	exon8			TGCTGTCCTGGCC	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.636G>A	4.37:g.87022299C>T		Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	174	45	0.258621	NM_002753	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Silent	SNP	ENST00000359221.3	37	CCDS34026.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.409014	0.25378	.	.	ENSG00000109339	ENST00000515400	.	.	.	5.84	3.2	0.36748	.	.	.	.	.	T	0.59487	0.2197	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55153	-0.8185	4	.	.	.	-18.4515	9.8477	0.41037	0.0:0.7294:0.0:0.2706	.	.	.	.	N	125	.	.	D	-	1	0	MAPK10	87241323	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	0.528000	0.23002	0.822000	0.34565	0.557000	0.71058	GAC	.	.	none		0.448	MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2		
BCL7B	9275	hgsc.bcm.edu	37	7	72952324	72952324	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:72952324C>T	ENST00000223368.2	-	5	879	c.456G>A	c.(454-456)tcG>tcA	p.S152S	BCL7B_ENST00000482231.1_5'UTR|BCL7B_ENST00000411832.1_Silent_p.S95S	NM_001707.3	NP_001698.2	Q9BQE9	BCL7B_HUMAN	B-cell CLL/lymphoma 7B	152							actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	9		Lung NSC(55;0.0659)|all_lung(88;0.152)				CAGCAACTTCCGAGGAGGGCA	0.537																																					p.S152S		Atlas-SNP	.											BCL7B,NS,carcinoma,-1,1	BCL7B	16	1	0			c.G456A						scavenged	.						115.0	104.0	108.0					7																	72952324		2203	4300	6503	SO:0001819	synonymous_variant	9275	exon5			AACTTCCGAGGAG	X89985	CCDS5550.1, CCDS56489.1, CCDS75613.1	7q11.23	2008-07-18			ENSG00000106635	ENSG00000106635			1005	protein-coding gene	gene with protein product		605846				8605326, 9806765	Standard	NM_001707		Approved		uc003tyf.2	Q9BQE9	OTTHUMG00000023412	ENST00000223368.2:c.456G>A	7.37:g.72952324C>T		Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	149	2	0.0134228	NM_001707	A8K226|C9JWD3|D3DXF0|O43769|Q13845|Q6ZW75	Silent	SNP	ENST00000223368.2	37	CCDS5550.1																																																																																			.	.	none		0.537	BCL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252194.1	NM_001707	
CMTM7	112616	hgsc.bcm.edu	37	3	32491043	32491043	+	Splice_Site	SNP	C	C	T	rs375912380		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:32491043C>T	ENST00000334983.5	+	3	667	c.431C>T	c.(430-432)gCg>gTg	p.A144V	CMTM7_ENST00000349718.4_Intron	NM_138410.2	NP_612419.1	Q96FZ5	CKLF7_HUMAN	CKLF-like MARVEL transmembrane domain containing 7	144	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(1)|lung(2)	4						GTAGCCGGAGCGGTGAGGATG	0.493																																					p.A144V		Atlas-SNP	.											CMTM7,NS,carcinoma,-1,1	CMTM7	14	1	0			c.C431T						scavenged	.	C	VAL/ALA,	2,4404	4.2+/-10.8	0,2,2201	87.0	88.0	88.0		431,	5.7	1.0	3		88	0,8600		0,0,4300	no	missense-near-splice,intron	CMTM7	NM_138410.2,NM_181472.1	64,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,	144/176,	32491043	2,13004	2203	4300	6503	SO:0001630	splice_region_variant	112616	exon3			CCGGAGCGGTGAG	AF479263	CCDS33730.1, CCDS33731.1	3p22.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000153551	ENSG00000153551			19178	protein-coding gene	gene with protein product		607890	"""chemokine-like factor super family 7"", ""chemokine-like factor superfamily 7"""	CKLFSF7			Standard	NM_138410		Approved	FLJ30992	uc003cey.1	Q96FZ5	OTTHUMG00000155869	ENST00000334983.5:c.432+1C>T	3.37:g.32491043C>T		Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	191	4	0.0209424	NM_138410	Q5VLK1	Missense_Mutation	SNP	ENST00000334983.5	37	CCDS33730.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.891854	0.91889	4.54E-4	0.0	ENSG00000153551	ENST00000334983	T	0.22743	1.94	5.69	5.69	0.88448	Marvel (1);MARVEL-like domain (1);	0.214085	0.40554	N	0.001075	T	0.36468	0.0968	L	0.55834	1.745	0.80722	D	1	D	0.71674	0.998	P	0.60682	0.878	T	0.04090	-1.0978	10	0.08599	T	0.76	-17.026	18.6607	0.91471	0.0:1.0:0.0:0.0	.	144	Q96FZ5	CKLF7_HUMAN	V	144	ENSP00000335605:A144V	ENSP00000335605:A144V	A	+	2	0	CMTM7	32466047	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	5.405000	0.66351	2.683000	0.91414	0.650000	0.86243	GCG	.	.	weak		0.493	CMTM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342084.1		Missense_Mutation
ACTN2	88	hgsc.bcm.edu	37	1	236923039	236923039	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:236923039A>T	ENST00000366578.4	+	19	2483	c.2317A>T	c.(2317-2319)Atg>Ttg	p.M773L	ACTN2_ENST00000542672.1_Missense_Mutation_p.M773L|ACTN2_ENST00000546208.1_Missense_Mutation_p.M267L	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	773	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GAATGGCCTGATGGATCATGA	0.413																																					p.M773L		Atlas-SNP	.											ACTN2,rectum,carcinoma,-2,1	ACTN2	191	1	0			c.A2317T						scavenged	.						149.0	133.0	139.0					1																	236923039		2203	4300	6503	SO:0001583	missense	88	exon19			GGCCTGATGGATC	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2317A>T	1.37:g.236923039A>T	ENSP00000355537:p.Met773Leu	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	125	2	0.016	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	A	7.321	0.617034	0.14129	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.75704	-0.96;-0.96;-0.96	5.41	4.21	0.49690	EF-hand-like domain (1);	0.036669	0.85682	D	0.000000	T	0.37489	0.1005	N	0.00608	-1.33	0.50813	D	0.999896	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.001;0.003;0.002	T	0.50303	-0.8844	10	0.02654	T	1	.	11.266	0.49110	0.8633:0.0:0.0:0.1367	.	558;773;543;773	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	L	773;773;267;542	ENSP00000443495:M773L;ENSP00000355537:M773L;ENSP00000438384:M267L	ENSP00000355537:M773L	M	+	1	0	ACTN2	234989662	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.098000	0.76974	2.055000	0.61198	0.533000	0.62120	ATG	.	.	none		0.413	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
PLXNA1	5361	hgsc.bcm.edu	37	3	126733600	126733600	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:126733600G>A	ENST00000393409.2	+	13	2803	c.2803G>A	c.(2803-2805)Gcc>Acc	p.A935T	PLXNA1_ENST00000251772.4_Missense_Mutation_p.A912T	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	935	IPT/TIG 1.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		TGCCCATGACGCCCTGGTGGA	0.697																																					p.A935T		Atlas-SNP	.											.	PLXNA1	185	.	0			c.G2803A						PASS	.						62.0	46.0	52.0					3																	126733600		2202	4299	6501	SO:0001583	missense	5361	exon13			CATGACGCCCTGG	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2803G>A	3.37:g.126733600G>A	ENSP00000377061:p.Ala935Thr	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	67	13	0.19403	NM_032242		Missense_Mutation	SNP	ENST00000393409.2	37	CCDS33847.2	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402308	0.83230	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.77098	-1.07;-1.07	4.21	4.21	0.49690	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000008	D	0.84088	0.5395	L	0.55743	1.74	0.58432	D	0.999999	D	0.60575	0.988	D	0.63488	0.915	D	0.84986	0.0891	10	0.48119	T	0.1	.	16.7531	0.85492	0.0:0.0:1.0:0.0	.	935	Q9UIW2	PLXA1_HUMAN	T	935;912	ENSP00000377061:A935T;ENSP00000251772:A912T	ENSP00000251772:A912T	A	+	1	0	PLXNA1	128216290	1.000000	0.71417	0.927000	0.36925	0.341000	0.28922	7.032000	0.76498	2.184000	0.69523	0.484000	0.47621	GCC	.	.	none		0.697	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
UPP1	7378	hgsc.bcm.edu	37	7	48142960	48142960	+	Missense_Mutation	SNP	C	C	T	rs140206015		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:48142960C>T	ENST00000331803.4	+	7	1011	c.388C>T	c.(388-390)Cgg>Tgg	p.R130W	UPP1_ENST00000429491.2_Intron|UPP1_ENST00000341253.4_Missense_Mutation_p.R130W|UPP1_ENST00000395564.4_Missense_Mutation_p.R130W|UPP1_ENST00000482015.1_Intron			Q16831	UPP1_HUMAN	uridine phosphorylase 1	130					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)			breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	GTACTATGCCCGGTGCTCCAA	0.522																																					p.R130W		Atlas-SNP	.											UPP1,NS,carcinoma,-1,1	UPP1	35	1	0			c.C388T						scavenged	.						195.0	164.0	174.0					7																	48142960		2203	4300	6503	SO:0001583	missense	7378	exon6			TATGCCCGGTGCT	AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.388C>T	7.37:g.48142960C>T	ENSP00000330032:p.Arg130Trp	Somatic	186	0	0		WXS	Illumina HiSeq	Phase_I	215	4	0.0186047	NM_003364	D3DVM4|Q15362	Missense_Mutation	SNP	ENST00000331803.4	37	CCDS5507.1	.	.	.	.	.	.	.	.	.	.	C	19.01	3.743077	0.69418	.	.	ENSG00000183696	ENST00000416681;ENST00000331803;ENST00000341253;ENST00000395564;ENST00000436673	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.43	-3.61	0.04556	Nucleoside phosphorylase domain (1);	0.491473	0.21862	N	0.068001	T	0.62417	0.2426	M	0.78049	2.395	0.44816	D	0.997823	D;D	0.89917	1.0;0.999	D;P	0.66847	0.947;0.898	T	0.64537	-0.6384	10	0.72032	D	0.01	-15.333	13.0541	0.58969	0.2932:0.6403:0.0665:0.0	.	130;130	B4DND0;Q16831	.;UPP1_HUMAN	W	130	ENSP00000405209:R130W;ENSP00000330032:R130W;ENSP00000342878:R130W;ENSP00000378931:R130W;ENSP00000390118:R130W	ENSP00000330032:R130W	R	+	1	2	UPP1	48109485	0.001000	0.12720	0.015000	0.15790	0.790000	0.44656	0.143000	0.16115	-1.151000	0.02836	-0.457000	0.05445	CGG	C|1.000;G|0.000	.	alt		0.522	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251360.1	NM_003364	
MRPL49	740	hgsc.bcm.edu	37	11	64889279	64889279	+	5'Flank	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:64889279G>C	ENST00000279242.2	+	0	0				FAU_ENST00000279259.3_Missense_Mutation_p.L3V|FAU_ENST00000527548.1_Missense_Mutation_p.L3V|MRPL49_ENST00000531705.1_5'Flank|FAU_ENST00000529259.1_Missense_Mutation_p.L3V|FAU_ENST00000531743.1_Missense_Mutation_p.L3V|MRPL49_ENST00000534078.1_5'Flank|FAU_ENST00000434372.2_Missense_Mutation_p.L3V|FAU_ENST00000529639.1_Missense_Mutation_p.L3V|FAU_ENST00000525297.1_Missense_Mutation_p.L3V|MRPL49_ENST00000526171.1_5'Flank	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49						translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|ovary(1)	2						CGGACAAAGAGCTGCATATTG	0.537																																					p.L3V		Atlas-SNP	.											FAU,NS,carcinoma,+2,1	FAU	17	1	0			c.C7G						PASS	.						67.0	61.0	63.0					11																	64889279		2201	4297	6498	SO:0001631	upstream_gene_variant	2197	exon2			CAAAGAGCTGCAT		CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608		11.37:g.64889279G>C	Exception_encountered	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	87	22	0.252874	NM_001997	B2R4G6	Missense_Mutation	SNP	ENST00000279242.2	37	CCDS8096.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409753	0.83340	.	.	ENSG00000149806	ENST00000529639;ENST00000531743;ENST00000525297;ENST00000527548;ENST00000279259;ENST00000529259;ENST00000526555;ENST00000434372	T;T;T;T;T;T;T;T	0.60548	1.11;1.11;0.18;1.11;1.11;1.11;1.11;1.11	5.92	4.99	0.66335	Ubiquitin supergroup (1);Ubiquitin (1);	0.058047	0.64402	N	0.000001	T	0.57607	0.2065	M	0.71920	2.185	0.80722	D	1	P;P	0.41393	0.461;0.748	B;B	0.37480	0.181;0.251	T	0.64647	-0.6358	10	0.72032	D	0.01	-4.6526	14.7826	0.69776	0.0:0.145:0.8549:0.0	.	3;3	E9PMS9;P35544	.;UBIM_HUMAN	V	3	ENSP00000435370:L3V;ENSP00000431822:L3V;ENSP00000436110:L3V;ENSP00000434440:L3V;ENSP00000279259:L3V;ENSP00000434680:L3V;ENSP00000433139:L3V;ENSP00000413848:L3V	ENSP00000279259:L3V	L	-	1	0	FAU	64645855	1.000000	0.71417	0.994000	0.49952	0.853000	0.48598	4.503000	0.60407	1.476000	0.48215	0.650000	0.86243	CTC	.	.	none		0.537	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385293.1	NM_004927	
DSEL	92126	hgsc.bcm.edu	37	18	65180867	65180867	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:65180867C>A	ENST00000310045.7	-	2	2482	c.1009G>T	c.(1009-1011)Gtg>Ttg	p.V337L	CTD-2541J13.2_ENST00000583493.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	327					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GCTATACCCACAGTTCTTTGG	0.383																																					p.V337L		Atlas-SNP	.											.	DSEL	196	.	0			c.G1009T						PASS	.						69.0	74.0	72.0					18																	65180867		2203	4300	6503	SO:0001583	missense	92126	exon2			TACCCACAGTTCT	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1009G>T	18.37:g.65180867C>A	ENSP00000310565:p.Val337Leu	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	72	13	0.180556	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.743918	0.49151	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.27402	1.67	4.9	4.9	0.64082	.	0.000000	0.64402	U	0.000002	T	0.31231	0.0790	M	0.71581	2.175	0.44694	D	0.997686	P	0.37955	0.612	B	0.33960	0.173	T	0.11665	-1.0578	10	0.39692	T	0.17	-13.9785	11.9105	0.52737	0.0:0.9195:0.0:0.0805	.	327	Q8IZU8	DSEL_HUMAN	L	337;327	ENSP00000310565:V337L	ENSP00000310565:V337L	V	-	1	0	DSEL	63331847	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.819000	0.62664	2.460000	0.83146	0.563000	0.77884	GTG	.	.	none		0.383	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
MUC21	394263	hgsc.bcm.edu	37	6	30954754	30954754	+	Missense_Mutation	SNP	G	G	A	rs9262365	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:30954754G>A	ENST00000376296.3	+	2	1043	c.802G>A	c.(802-804)Ggc>Agc	p.G268S	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	268	28 X 15 AA approximate tandem repeats.|Ser-rich.			G -> S (in Ref. 3; AAQ88781 and 4; CAQ08321). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CAGTGGGGCCGGCACAGCCAC	0.632																																					p.G268S		Atlas-SNP	.											MUC21,NS,carcinoma,0,1	MUC21	98	1	0			c.G802A						scavenged	.						154.0	154.0	154.0					6																	30954754		2203	4300	6503	SO:0001583	missense	394263	exon2			GGGGCCGGCACAG	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.802G>A	6.37:g.30954754G>A	ENSP00000365473:p.Gly268Ser	Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	145	4	0.0275862	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	A	2.261	-0.369337	0.05069	.	.	ENSG00000204544	ENST00000376296	T	0.01369	4.97	3.74	-0.338	0.12651	.	.	.	.	.	T	0.00178	0.0005	N	0.01576	-0.805	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.19778	-1.0295	8	.	.	.	-0.7336	4.2134	0.10522	0.5818:0.0:0.2661:0.1521	.	268	Q5SSG8	MUC21_HUMAN	S	268	ENSP00000365473:G268S	.	G	+	1	0	MUC21	31062733	0.003000	0.15002	0.000000	0.03702	0.174000	0.22865	1.375000	0.34295	-0.310000	0.08766	-0.490000	0.04691	GGC	G|0.901;A|0.099	0.099	strong		0.632	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
KRTAP5-7	440050	hgsc.bcm.edu	37	11	71238705	71238705	+	Missense_Mutation	SNP	G	G	A	rs536797652		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:71238705G>A	ENST00000398536.4	+	1	393	c.359G>A	c.(358-360)tGc>tAc	p.C120Y		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	120	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.C120Y(2)		breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						tgtaagccctgctgctgccag	0.607													g|||	1	0.000199681	0.0008	0.0	5008	,	,		20154	0.0		0.0	False		,,,				2504	0.0				p.C120Y		Atlas-SNP	.											KRTAP5-7,NS,carcinoma,0,3	KRTAP5-7	23	3	2	Substitution - Missense(2)	kidney(2)	c.G359A						scavenged	.						129.0	139.0	136.0					11																	71238705		2200	4294	6494	SO:0001583	missense	440050	exon1			AGCCCTGCTGCTG	AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.359G>A	11.37:g.71238705G>A	ENSP00000417330:p.Cys120Tyr	Somatic	139	1	0.00719424		WXS	Illumina HiSeq	Phase_I	135	3	0.0222222	NM_001012503	B2RNM3|Q701N5	Missense_Mutation	SNP	ENST00000398536.4	37	CCDS41682.1	.	.	.	.	.	.	.	.	.	.	N	4.462	0.085611	0.08583	.	.	ENSG00000244411	ENST00000398536	T	0.01304	5.03	1.87	1.87	0.25490	.	.	.	.	.	T	0.01421	0.0046	L	0.60455	1.87	0.26143	N	0.980242	B	0.12630	0.006	B	0.08055	0.003	T	0.51733	-0.8668	9	0.02654	T	1	.	4.3831	0.11304	0.201:0.0:0.799:0.0	.	120	Q6L8G8	KRA57_HUMAN	Y	120	ENSP00000417330:C120Y	ENSP00000417330:C120Y	C	+	2	0	KRTAP5-7	70916353	0.718000	0.27976	0.999000	0.59377	0.075000	0.17131	2.143000	0.42187	1.367000	0.46095	0.289000	0.19496	TGC	.	.	none		0.607	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127953.1		
FAM83D	81610	hgsc.bcm.edu	37	20	37555095	37555095	+	Missense_Mutation	SNP	C	C	G	rs542789388		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:37555095C>G	ENST00000217429.4	+	1	141	c.100C>G	c.(100-102)Ctg>Gtg	p.L34V		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	4					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				CATGGCTCTGCTGTCCGAGGG	0.672																																					p.L34V		Atlas-SNP	.											.	FAM83D	60	.	0			c.C100G						PASS	.						13.0	17.0	15.0					20																	37555095		1906	4100	6006	SO:0001583	missense	81610	exon1			GCTCTGCTGTCCG	AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.100C>G	20.37:g.37555095C>G	ENSP00000217429:p.Leu34Val	Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	29	6	0.206897	NM_030919	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Missense_Mutation	SNP	ENST00000217429.4	37	CCDS42872.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471206	0.43942	.	.	ENSG00000101447	ENST00000217429;ENST00000424027	T	0.12255	2.7	5.48	-0.0886	0.13672	.	6.575320	0.00481	N	0.000125	T	0.08268	0.0206	N	0.14661	0.345	0.09310	N	1	B;B	0.31548	0.22;0.328	B;B	0.31101	0.058;0.124	T	0.22836	-1.0205	10	0.19590	T	0.45	.	5.1809	0.15160	0.2481:0.5461:0.0:0.2058	.	4;4	Q9H4H8;Q9H4H8-2	FA83D_HUMAN;.	V	34;4	ENSP00000217429:L34V	ENSP00000217429:L34V	L	+	1	2	FAM83D	36988509	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.197000	0.17197	0.029000	0.15352	0.655000	0.94253	CTG	.	.	none		0.672	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1		
ZNF563	147837	hgsc.bcm.edu	37	19	12430265	12430265	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:12430265C>T	ENST00000293725.5	-	4	779	c.574G>A	c.(574-576)Ggt>Agt	p.G192S	ZNF563_ENST00000595977.1_Missense_Mutation_p.G192S	NM_145276.2	NP_660319.1	Q8TA94	ZN563_HUMAN	zinc finger protein 563	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						CTATTTCCACCTTGCACTACC	0.423																																					p.G192S	GBM(39;623 795 5132 29510 31476)	Atlas-SNP	.											ZNF563,NS,carcinoma,0,1	ZNF563	77	1	0			c.G574A						scavenged	.						156.0	154.0	155.0					19																	12430265		2203	4300	6503	SO:0001583	missense	147837	exon4			TTCCACCTTGCAC	BC022523	CCDS12270.1	19p13.2	2013-09-20			ENSG00000188868	ENSG00000188868		"""Zinc fingers, C2H2-type"", ""-"""	30498	protein-coding gene	gene with protein product							Standard	NM_145276		Approved	FLJ34797	uc002mtp.3	Q8TA94	OTTHUMG00000156413	ENST00000293725.5:c.574G>A	19.37:g.12430265C>T	ENSP00000293725:p.Gly192Ser	Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	162	2	0.0123457	NM_145276	B2R9E7|Q8NAT7	Missense_Mutation	SNP	ENST00000293725.5	37	CCDS12270.1	.	.	.	.	.	.	.	.	.	.	C	9.547	1.114807	0.20795	.	.	ENSG00000188868	ENST00000293725;ENST00000318168	T	0.15834	2.39	1.15	-1.61	0.08399	Zinc finger, C2H2 (1);	.	.	.	.	T	0.06826	0.0174	N	0.00621	-1.32	0.09310	N	1	B;P	0.45634	0.095;0.863	B;P	0.49953	0.047;0.627	T	0.27806	-1.0063	9	0.36615	T	0.2	.	6.4571	0.21936	0.0:0.5113:0.0:0.4887	.	192;192	Q8TA94-2;Q8TA94	.;ZN563_HUMAN	S	192	ENSP00000293725:G192S	ENSP00000293725:G192S	G	-	1	0	ZNF563	12291265	0.000000	0.05858	0.000000	0.03702	0.402000	0.30811	-0.248000	0.08854	-0.595000	0.05828	0.313000	0.20887	GGT	.	.	none		0.423	ZNF563-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344114.1	NM_145276	
FLG	2312	hgsc.bcm.edu	37	1	152284305	152284305	+	Silent	SNP	C	C	T	rs145495264	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:152284305C>T	ENST00000368799.1	-	3	3092	c.3057G>A	c.(3055-3057)gcG>gcA	p.A1019A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1019	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.A1019A(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGGGATGACGCAGCCTGTC	0.587									Ichthyosis				T|||	3	0.000599042	0.0	0.0	5008	,	,		20996	0.0		0.001	False		,,,				2504	0.002				p.A1019A		Atlas-SNP	.											FLG,NS,carcinoma,-1,3	FLG	900	3	1	Substitution - coding silent(1)	endometrium(1)	c.G3057A						scavenged	.						343.0	342.0	342.0					1																	152284305		2203	4300	6503	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GGATGACGCAGCC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3057G>A	1.37:g.152284305C>T		Somatic	270	1	0.0037037		WXS	Illumina HiSeq	Phase_I	316	6	0.0189873	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			C|0.999;T|0.001	0.001	weak		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
DDX11	1663	hgsc.bcm.edu	37	12	31250830	31250830	+	Missense_Mutation	SNP	C	C	G	rs2911826		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:31250830C>G	ENST00000407793.2	+	18	2025	c.1774C>G	c.(1774-1776)Cag>Gag	p.Q592E	DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000228264.6_Missense_Mutation_p.Q566E|DDX11_ENST00000545668.1_Missense_Mutation_p.Q592E|DDX11_ENST00000542838.1_Missense_Mutation_p.Q592E|DDX11_ENST00000539673.1_3'UTR|DDX11_ENST00000350437.4_Missense_Mutation_p.Q592E	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	592					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.Q592E(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAGCCTCAGTCAGAGCACCCT	0.582										Multiple Myeloma(12;0.14)																											p.Q592E		Atlas-SNP	.											DDX11,extremity,malignant_melanoma,0,1	DDX11	188	1	1	Substitution - Missense(1)	skin(1)	c.C1774G						scavenged	.						81.0	80.0	81.0					12																	31250830		2203	4300	6503	SO:0001583	missense	1663	exon18			CTCAGTCAGAGCA	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1774C>G	12.37:g.31250830C>G	ENSP00000384703:p.Gln592Glu	Somatic	203	6	0.0295567		WXS	Illumina HiSeq	Phase_I	220	11	0.05	NM_030653	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	C	5.933	0.356089	0.11239	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	3.23	3.23	0.37069	.	0.250227	0.40728	N	0.001040	T	0.21550	0.0519	L	0.54965	1.715	0.80722	D	1	B;B;B;B	0.22909	0.048;0.077;0.023;0.048	B;B;B;B	0.18871	0.023;0.017;0.015;0.023	T	0.04481	-1.0948	10	0.11794	T	0.64	.	12.0234	0.53356	0.0:1.0:0.0:0.0	rs2911826	566;592;592;592	Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	E	592;592;317;566;592;592	ENSP00000443426:Q592E;ENSP00000384703:Q592E;ENSP00000228264:Q566E;ENSP00000440402:Q592E;ENSP00000309965:Q592E	ENSP00000228264:Q566E	Q	+	1	0	DDX11	31142097	1.000000	0.71417	0.998000	0.56505	0.511000	0.34104	3.091000	0.50199	1.632000	0.50472	0.505000	0.49811	CAG	.	.	weak		0.582	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
SGK1	6446	hgsc.bcm.edu	37	6	134495211	134495211	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134495211C>G	ENST00000237305.7	-	3	248	c.160G>C	c.(160-162)Gtt>Ctt	p.V54L	SGK1_ENST00000367857.5_Missense_Mutation_p.V44L|SGK1_ENST00000413996.3_Missense_Mutation_p.V68L|SGK1_ENST00000367858.5_Missense_Mutation_p.V149L|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000475719.2_Missense_Mutation_p.V54L|SGK1_ENST00000528577.1_Missense_Mutation_p.V82L	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	54	Necessary for localization to the mitochondria.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		ATGGACTGAACTTCAGGGCTG	0.498																																					p.V149L		Atlas-SNP	.											SGK1_ENST00000528577,NS,lymphoid_neoplasm,0,5	SGK1	387	5	0			c.G445C						PASS	.						122.0	115.0	117.0					6																	134495211		2203	4300	6503	SO:0001583	missense	6446	exon5			ACTGAACTTCAGG	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.160G>C	6.37:g.134495211C>G	ENSP00000237305:p.Val54Leu	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	73	6	0.0821918	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408672	0.83340	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T;T	0.38077	1.71;1.71;1.71;1.71;1.71;1.71;1.16	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.57636	0.2067	M	0.76574	2.34	0.80722	D	1	P;D;B;B;B;B	0.67145	0.529;0.996;0.117;0.289;0.262;0.19	B;D;B;B;B;B	0.76071	0.17;0.987;0.056;0.105;0.276;0.056	T	0.56890	-0.7904	10	0.59425	D	0.04	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	82;68;54;44;149;54	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	L	149;68;54;44;82;54;118	ENSP00000356832:V149L;ENSP00000396242:V68L;ENSP00000237305:V54L;ENSP00000356831:V44L;ENSP00000434450:V82L;ENSP00000434302:V54L;ENSP00000435577:V118L	ENSP00000237305:V54L	V	-	1	0	SGK1	134536904	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.487000	0.81328	2.840000	0.97914	0.655000	0.94253	GTT	.	.	none		0.498	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
INHBB	3625	hgsc.bcm.edu	37	2	121107185	121107185	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:121107185G>A	ENST00000295228.3	+	2	1005	c.959G>A	c.(958-960)tGg>tAg	p.W320*		NM_002193.2	NP_002184.2	P09529	INHBB_HUMAN	inhibin, beta B	320					activin receptor signaling pathway (GO:0032924)|cell differentiation (GO:0030154)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|cellular response to starvation (GO:0009267)|defense response (GO:0006952)|fat cell differentiation (GO:0045444)|growth (GO:0040007)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of hepatocyte growth factor biosynthetic process (GO:0048178)|negative regulation of insulin secretion (GO:0046676)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|response to mechanical stimulus (GO:0009612)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|host cell surface receptor binding (GO:0046789)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(4)|pancreas(2)|skin(2)	15		Prostate(154;0.122)				TGGAACGACTGGATCATAGCA	0.622																																					p.W320X		Atlas-SNP	.											INHBB,NS,malignant_melanoma,-1,1	INHBB	29	1	0			c.G959A						PASS	.						78.0	75.0	76.0					2																	121107185		2203	4300	6503	SO:0001587	stop_gained	3625	exon2			ACGACTGGATCAT		CCDS2132.1	2q14.2	2014-01-30	2007-07-30		ENSG00000163083	ENSG00000163083		"""Endogenous ligands"""	6067	protein-coding gene	gene with protein product		147390	"""inhibin, beta B (activin AB beta polypeptide)"""			3345731	Standard	NM_002193		Approved		uc002tmn.2	P09529	OTTHUMG00000131437	ENST00000295228.3:c.959G>A	2.37:g.121107185G>A	ENSP00000295228:p.Trp320*	Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	100	4	0.04	NM_002193	Q53T31|Q8N1D3	Nonsense_Mutation	SNP	ENST00000295228.3	37	CCDS2132.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144622	0.57044	.	.	ENSG00000163083	ENST00000295228	.	.	.	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.61	16.4938	0.84209	0.0:0.0:1.0:0.0	.	.	.	.	X	320	.	ENSP00000295228:W320X	W	+	2	0	INHBB	120823655	1.000000	0.71417	1.000000	0.80357	0.066000	0.16364	9.507000	0.97996	2.495000	0.84180	0.563000	0.77884	TGG	.	.	none		0.622	INHBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254234.1		
GTF3C3	9330	hgsc.bcm.edu	37	2	197657782	197657782	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:197657782C>T	ENST00000263956.3	-	3	398	c.309G>A	c.(307-309)gaG>gaA	p.E103E	GTF3C3_ENST00000409364.3_Silent_p.E103E|GTF3C3_ENST00000470386.1_5'Flank	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	103	Glu-rich.				5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.E103E(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						cctcctcctcctcttcttcct	0.468																																					p.E103E		Atlas-SNP	.											GTF3C3,NS,carcinoma,0,3	GTF3C3	96	3	1	Substitution - coding silent(1)	endometrium(1)	c.G309A						scavenged	.						65.0	63.0	64.0					2																	197657782		2203	4300	6503	SO:0001819	synonymous_variant	9330	exon3			CTCCTCCTCTTCT	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.309G>A	2.37:g.197657782C>T		Somatic	212	0	0		WXS	Illumina HiSeq	Phase_I	269	8	0.0297398	NM_001206774	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Silent	SNP	ENST00000263956.3	37	CCDS2316.1																																																																																			.	.	none		0.468	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
MCMDC2	157777	hgsc.bcm.edu	37	8	67796149	67796149	+	Silent	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:67796149A>G	ENST00000422365.2	+	9	1164	c.993A>G	c.(991-993)gtA>gtG	p.V331V	MCMDC2_ENST00000492775.1_Silent_p.V331V|MCMDC2_ENST00000313616.5_Silent_p.V331V|MCMDC2_ENST00000396592.3_Silent_p.V331V|MCMDC2_ENST00000541540.1_Silent_p.V268V	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	331					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						TGAGTCTAGTACAGACAACTG	0.378																																					p.V331V		Atlas-SNP	.											.	MCMDC2	84	.	0			c.A993G						PASS	.						75.0	71.0	72.0					8																	67796149		2203	4300	6503	SO:0001819	synonymous_variant	157777	exon9			TCTAGTACAGACA	BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.993A>G	8.37:g.67796149A>G		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	103	5	0.0485437	NM_173518	B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Silent	SNP	ENST00000422365.2	37	CCDS6197.2																																																																																			.	.	none		0.378	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347350.1	NM_173518	
KRTAP4-9	100132386	hgsc.bcm.edu	37	17	39261693	39261693	+	Missense_Mutation	SNP	A	A	T	rs113059833		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:39261693A>T	ENST00000391415.1	+	1	110	c.53A>T	c.(52-54)gAc>gTc	p.D18V		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	18					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.D18V(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						TGCGGCCAAGACCTCTGTCAG	0.627																																					p.D18V		Atlas-SNP	.											KRTAP4-9,NS,carcinoma,0,6	KRTAP4-9	110	6	1	Substitution - Missense(1)	endometrium(1)	c.A53T						scavenged	.						18.0	22.0	21.0					17																	39261693		692	1590	2282	SO:0001583	missense	100132386	exon1			GCCAAGACCTCTG	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.53A>T	17.37:g.39261693A>T	ENSP00000375234:p.Asp18Val	Somatic	51	1	0.0196078		WXS	Illumina HiSeq	Phase_I	75	8	0.106667	NM_001146041		Missense_Mutation	SNP	ENST00000391415.1	37	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	6.082	0.383461	0.11524	.	.	ENSG00000212722	ENST00000391415;ENST00000333994	T	0.32272	1.46	2.51	0.174	0.15040	.	.	.	.	.	T	0.25865	0.0630	M	0.64404	1.975	0.30580	P	0.762648	B	0.17852	0.024	B	0.14023	0.01	T	0.23154	-1.0196	8	0.45353	T	0.12	.	3.5681	0.07907	0.2702:0.2037:0.5261:0.0	.	18	Q9BYQ8	KRA49_HUMAN	V	18	ENSP00000375234:D18V	ENSP00000334461:D18V	D	+	2	0	KRTAP4-9	36515219	0.000000	0.05858	0.388000	0.26195	0.320000	0.28249	0.098000	0.15189	-0.245000	0.09625	0.155000	0.16302	GAC	T|1.000;|0.000	1.000	weak		0.627	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041	
SMG1	23049	hgsc.bcm.edu	37	16	18847712	18847712	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:18847712G>A	ENST00000446231.2	-	47	8159	c.7747C>T	c.(7747-7749)Ctt>Ttt	p.L2583F	SMG1_ENST00000389467.3_Missense_Mutation_p.L2583F			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2583					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ATCTCTTGAAGCAAGCTTGCA	0.383																																					p.L2583F		Atlas-SNP	.											.	SMG1	401	.	0			c.C7747T						PASS	.						125.0	115.0	118.0					16																	18847712		1903	4133	6036	SO:0001583	missense	23049	exon47			CTTGAAGCAAGCT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.7747C>T	16.37:g.18847712G>A	ENSP00000402515:p.Leu2583Phe	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	125	22	0.176	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688557	0.68271	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01215	5.16;5.16	6.17	6.17	0.99709	Armadillo-type fold (1);	0.000000	0.64402	D	0.000010	T	0.02888	0.0086	N	0.19112	0.55	0.45427	D	0.998404	D	0.58620	0.983	P	0.56474	0.799	T	0.63782	-0.6559	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	2583	Q96Q15	SMG1_HUMAN	F	2583	ENSP00000402515:L2583F;ENSP00000374118:L2583F	ENSP00000374118:L2583F	L	-	1	0	SMG1	18755213	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.862000	0.87013	2.941000	0.99782	0.655000	0.94253	CTT	.	.	none		0.383	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
TACR3	6870	hgsc.bcm.edu	37	4	104511045	104511045	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:104511045T>C	ENST00000304883.2	-	5	1332	c.1192A>G	c.(1192-1194)Agc>Ggc	p.S398G	RP11-297P16.3_ENST00000512401.1_RNA|RP11-297P16.3_ENST00000502936.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	398					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		TACATACTGCTTTGCCGGTTT	0.507																																					p.S398G		Atlas-SNP	.											.	TACR3	102	.	0			c.A1192G						PASS	.						207.0	193.0	198.0					4																	104511045		2203	4300	6503	SO:0001583	missense	6870	exon5			TACTGCTTTGCCG	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1192A>G	4.37:g.104511045T>C	ENSP00000303325:p.Ser398Gly	Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	252	58	0.230159	NM_001059	Q0P510	Missense_Mutation	SNP	ENST00000304883.2	37	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.701190	0.48307	.	.	ENSG00000169836	ENST00000304883	T	0.66460	-0.21	5.81	4.64	0.57946	.	0.043074	0.85682	N	0.000000	T	0.57110	0.2031	L	0.45422	1.42	0.47476	D	0.999437	B	0.11235	0.004	B	0.10450	0.005	T	0.51068	-0.8752	10	0.33141	T	0.24	.	11.0731	0.48014	0.0:0.072:0.0:0.928	.	398	P29371	NK3R_HUMAN	G	398	ENSP00000303325:S398G	ENSP00000303325:S398G	S	-	1	0	TACR3	104730494	1.000000	0.71417	0.974000	0.42286	0.982000	0.71751	5.850000	0.69473	1.034000	0.39945	0.482000	0.46254	AGC	.	.	none		0.507	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
NTPCR	84284	hgsc.bcm.edu	37	1	233113956	233113956	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:233113956C>T	ENST00000366628.5	+	5	639	c.552C>T	c.(550-552)tgC>tgT	p.C184C	NTPCR_ENST00000490098.1_3'UTR	NM_032324.1	NP_115700.1	Q9BSD7	NTPCR_HUMAN	nucleoside-triphosphatase, cancer-related	184						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|nucleoside-triphosphatase activity (GO:0017111)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(1)|ovary(1)	4						TCGTGACGTGCGTGCAGAGCA	0.537																																					p.C184C		Atlas-SNP	.											.	NTPCR	15	.	0			c.C552T						PASS	.						111.0	88.0	96.0					1																	233113956		2203	4300	6503	SO:0001819	synonymous_variant	84284	exon5			GACGTGCGTGCAG	BC005102	CCDS1597.1	1q42.2	2010-12-20	2010-12-20	2010-12-20	ENSG00000135778	ENSG00000135778	3.6.1.15		28204	protein-coding gene	gene with protein product	"""human cancer-related NTPase"""		"""chromosome 1 open reading frame 57"""	C1orf57		17291528	Standard	NM_032324		Approved	MGC13186, HCR-NTPase	uc001hvj.1	Q9BSD7	OTTHUMG00000037822	ENST00000366628.5:c.552C>T	1.37:g.233113956C>T		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	89	4	0.0449438	NM_032324		Silent	SNP	ENST00000366628.5	37	CCDS1597.1																																																																																			.	.	none		0.537	NTPCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092324.2	NM_032324	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240781	39240781	+	Missense_Mutation	SNP	C	C	G	rs372960430|rs553572799	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:39240781C>G	ENST00000391417.4	+	1	323	c.323C>G	c.(322-324)aCc>aGc	p.T108S		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	133	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						tgccagcccacctgctgccgc	0.662																																					p.T108S		Atlas-SNP	.											KRTAP4-9_ENST00000377734,NS,carcinoma,0,2	KRTAP4-7	49	2	0			c.C323G						scavenged	.						13.0	15.0	14.0					17																	39240781		1874	3648	5522	SO:0001583	missense	100132476	exon1			AGCCCACCTGCTG	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.323C>G	17.37:g.39240781C>G	ENSP00000375236:p.Thr108Ser	Somatic	42	1	0.0238095		WXS	Illumina HiSeq	Phase_I	36	4	0.111111	NM_033061	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	1.159	-0.644403	0.03531	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.00580	6.43	3.41	1.04	0.20106	.	1.411810	0.05113	N	0.489187	T	0.00356	0.0011	.	.	.	0.19575	N	0.999961	B	0.17268	0.021	B	0.15052	0.012	T	0.35351	-0.9792	9	0.07175	T	0.84	.	7.6942	0.28585	0.1798:0.6442:0.176:0.0	.	108	Q9BYR0	KRA47_HUMAN	S	108;99	ENSP00000375236:T108S	ENSP00000375236:T108S	T	+	2	0	KRTAP4-9;KRTAP4-7	36494307	0.000000	0.05858	0.287000	0.24848	0.438000	0.31896	-2.909000	0.00699	0.494000	0.27859	0.455000	0.32223	ACC	.	.	alt		0.662	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
RBMS3	27303	hgsc.bcm.edu	37	3	29938967	29938967	+	Splice_Site	SNP	G	G	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:29938967G>T	ENST00000383767.2	+	9	1224		c.e9+1		RBMS3_ENST00000383766.2_Splice_Site|RBMS3_ENST00000396583.3_Splice_Site|RBMS3_ENST00000456853.1_Splice_Site|RBMS3_ENST00000452462.1_Splice_Site|RBMS3_ENST00000434693.2_Splice_Site|RBMS3_ENST00000273139.9_Splice_Site			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3						positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				CACATACCAGGTATGTCCAAT	0.398																																					.		Atlas-SNP	.											.	RBMS3	62	.	0			c.927+1G>T						PASS	.						204.0	183.0	190.0					3																	29938967		2203	4300	6503	SO:0001630	splice_region_variant	27303	exon10			TACCAGGTATGTC	AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.888+1G>T	3.37:g.29938967G>T		Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	177	41	0.231638	NM_001177712	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Splice_Site	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.872761	0.91587	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.754	0.91825	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBMS3	29913971	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.433000	0.82419	0.655000	0.94253	.	.	.	none		0.398	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	Intron
ASXL3	80816	hgsc.bcm.edu	37	18	31319710	31319710	+	Missense_Mutation	SNP	C	C	T	rs201776257		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:31319710C>T	ENST00000269197.5	+	11	2342	c.2342C>T	c.(2341-2343)cCg>cTg	p.P781L		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	781	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CCACTCTCCCCGCAGAAAGAT	0.463																																					p.P781L		Atlas-SNP	.											ASXL3_ENST00000269197,right_lower_lobe,carcinoma,+1,2	ASXL3	405	2	0			c.C2342T						scavenged	.	C	LEU/PRO	1,3775		0,1,1887	37.0	38.0	38.0		2342	6.0	0.7	18		38	3,8235		0,3,4116	yes	missense	ASXL3	NM_030632.1	98	0,4,6003	TT,TC,CC		0.0364,0.0265,0.0333	possibly-damaging	781/2249	31319710	4,12010	1888	4119	6007	SO:0001583	missense	80816	exon11			TCTCCCCGCAGAA	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2342C>T	18.37:g.31319710C>T	ENSP00000269197:p.Pro781Leu	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	66	2	0.030303	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803611	0.31869	2.65E-4	3.64E-4	ENSG00000141431	ENST00000269197	T	0.16743	2.32	6.04	6.04	0.98038	.	0.736921	0.12683	N	0.447839	T	0.15825	0.0381	L	0.34521	1.04	0.51767	D	0.999933	P	0.42161	0.772	B	0.31390	0.129	T	0.14671	-1.0464	10	0.66056	D	0.02	.	19.583	0.95478	0.0:1.0:0.0:0.0	.	781	Q9C0F0	ASXL3_HUMAN	L	781	ENSP00000269197:P781L	ENSP00000269197:P781L	P	+	2	0	ASXL3	29573708	0.035000	0.19736	0.704000	0.30370	0.211000	0.24417	2.695000	0.47043	2.873000	0.98535	0.563000	0.77884	CCG	.	.	weak		0.463	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
FAM8A1	51439	hgsc.bcm.edu	37	6	17602826	17602826	+	Nonsense_Mutation	SNP	G	G	T	rs74444948	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:17602826G>T	ENST00000259963.3	+	2	773	c.718G>T	c.(718-720)Gaa>Taa	p.E240*		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	240						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			TACAGGCAGAGAATATGTTAT	0.328																																					p.E240X		Atlas-SNP	.											FAM8A1,NS,carcinoma,-1,2	FAM8A1	26	2	0			c.G718T						scavenged	.						100.0	101.0	101.0					6																	17602826		2203	4299	6502	SO:0001587	stop_gained	51439	exon2			GGCAGAGAATATG	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.718G>T	6.37:g.17602826G>T	ENSP00000259963:p.Glu240*	Somatic	58	5	0.0862069		WXS	Illumina HiSeq	Phase_I	53	9	0.169811	NM_016255	B2R725	Nonsense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	G	37	6.420554	0.97555	.	.	ENSG00000137414	ENST00000259963	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-11.04	18.5673	0.91121	0.0:0.0:1.0:0.0	.	.	.	.	X	240	.	ENSP00000259963:E240X	E	+	1	0	FAM8A1	17710805	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.467000	0.97671	2.356000	0.79943	0.644000	0.83932	GAA	G|0.992;T|0.008	0.008	strong		0.328	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
SP140	11262	hgsc.bcm.edu	37	2	231102990	231102990	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:231102990T>G	ENST00000392045.3	+	3	414	c.300T>G	c.(298-300)agT>agG	p.S100R	SP140_ENST00000420434.3_Missense_Mutation_p.S100R|SP140_ENST00000544128.1_3'UTR|SP140_ENST00000343805.6_Missense_Mutation_p.S100R|SP140_ENST00000486687.2_Missense_Mutation_p.S100R|SP140_ENST00000373645.3_Missense_Mutation_p.S100R|SP140_ENST00000417495.3_Missense_Mutation_p.S100R|SP140_ENST00000350136.5_Missense_Mutation_p.S80R	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	100	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GTGTACTCAGTGAACTGGAGA	0.388																																					p.S100R		Atlas-SNP	.											.	SP140	121	.	0			c.T300G						PASS	.						127.0	117.0	120.0					2																	231102990		2203	4300	6503	SO:0001583	missense	11262	exon3			ACTCAGTGAACTG	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.300T>G	2.37:g.231102990T>G	ENSP00000375899:p.Ser100Arg	Somatic	181	0	0		WXS	Illumina HiSeq	Phase_I	230	51	0.221739	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	T	12.17	1.856712	0.32791	.	.	ENSG00000079263	ENST00000537563;ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434;ENST00000373645	D;D;D;D;D;D	0.94931	-3.56;-3.56;-3.56;-3.56;-3.56;-3.56	3.7	-4.24	0.03777	Sp100 (2);	.	.	.	.	D	0.92792	0.7708	M	0.68317	2.08	0.09310	N	1	B;B;B;P;B;B	0.41232	0.288;0.288;0.244;0.743;0.45;0.122	B;B;B;P;B;B	0.50192	0.148;0.148;0.092;0.634;0.243;0.063	D	0.85321	0.1084	9	0.87932	D	0	-2.9298	0.0805	0.00031	0.3142:0.2021:0.1609:0.3228	.	100;100;100;100;100;100	E7EUR5;E7ESH9;E9PFJ6;Q13342;E7EX75;Q6NSG4	.;.;.;LY10_HUMAN;.;.	R	100;100;100;80;100;100;100;100;100	ENSP00000440107:S100R;ENSP00000345846:S80R;ENSP00000375899:S100R;ENSP00000342096:S100R;ENSP00000398210:S100R;ENSP00000362749:S100R	ENSP00000342096:S100R	S	+	3	2	SP140	230811234	0.000000	0.05858	0.001000	0.08648	0.793000	0.44817	-0.731000	0.04909	-0.792000	0.04480	0.533000	0.62120	AGT	.	.	none		0.388	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
LILRB3	11025	hgsc.bcm.edu	37	19	54721049	54721049	+	Silent	SNP	A	A	G	rs60566950	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:54721049A>G	ENST00000391750.1	-	14	1945	c.1809T>C	c.(1807-1809)ctT>ctC	p.L603L	LILRB3_ENST00000469273.1_5'UTR|LILRB3_ENST00000245620.9_Silent_p.L604L|LILRA6_ENST00000440558.2_Silent_p.L603L|LILRB3_ENST00000346401.6_Silent_p.L615L|LILRA6_ENST00000419410.2_Silent_p.L604L|LILRA6_ENST00000270464.5_Silent_p.L604L|LILRB3_ENST00000424807.1_Silent_p.L603L|LILRB3_ENST00000407860.2_Silent_p.L620L|LILRA6_ENST00000391735.3_3'UTR			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	603					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCTTCCGTCTAAGGGTCAAGC	0.632													.|||	155	0.0309505	0.0998	0.0086	5008	,	,		17459	0.0		0.0	False		,,,				2504	0.0174				p.L604L		Atlas-SNP	.											LILRB3,NS,carcinoma,0,1	LILRB3	67	1	0			c.T1812C						scavenged	.	A	,	147,4257		24,99,2079	104.0	105.0	104.0		1812,1809	0.8	0.0	19	dbSNP_129	104	5,8595		0,5,4295	no	coding-synonymous,coding-synonymous	LILRB3	NM_001081450.1,NM_006864.2	,	24,104,6374	GG,GA,AA		0.0581,3.3379,1.1689	,	604/633,603/632	54721049	152,12852	2202	4300	6502	SO:0001819	synonymous_variant	11025	exon13			CCGTCTAAGGGTC	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1809T>C	19.37:g.54721049A>G		Somatic	354	0	0		WXS	Illumina HiSeq	Phase_I	336	4	0.0119048	NM_001081450	C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	ENST00000391750.1	37	CCDS33105.1																																																																																			A|0.980;G|0.020	0.020	strong		0.632	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
RALYL	138046	hgsc.bcm.edu	37	8	85774611	85774611	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:85774611C>T	ENST00000521268.1	+	6	1599	c.494C>T	c.(493-495)aCg>aTg	p.T165M	RALYL_ENST00000521695.1_Missense_Mutation_p.T165M|RALYL_ENST00000521376.1_Missense_Mutation_p.T76M|RALYL_ENST00000522455.1_Missense_Mutation_p.T165M|RALYL_ENST00000523850.1_Missense_Mutation_p.T92M|RALYL_ENST00000518566.1_Missense_Mutation_p.T154M|RALYL_ENST00000517638.1_Missense_Mutation_p.T178M	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	165							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						GCAGTCACAACGACTCGCAGG	0.483																																					p.T178M		Atlas-SNP	.											.	RALYL	123	.	0			c.C533T						PASS	.						56.0	61.0	59.0					8																	85774611		1929	4136	6065	SO:0001583	missense	138046	exon6			TCACAACGACTCG		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.494C>T	8.37:g.85774611C>T	ENSP00000430367:p.Thr165Met	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	53	13	0.245283	NM_001100391	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	ENST00000521268.1	37	CCDS55253.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.526572	0.64860	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850;ENST00000521376	T;T;T;T;T;T;T	0.18657	2.83;2.83;2.83;2.85;2.83;2.42;2.2	5.1	5.1	0.69264	.	0.214143	0.49305	D	0.000143	T	0.35941	0.0949	M	0.61703	1.905	0.09310	N	1	P;D;P;P;D	0.60160	0.791;0.987;0.939;0.93;0.987	B;P;B;P;P	0.51016	0.336;0.588;0.337;0.656;0.588	T	0.19192	-1.0313	10	0.62326	D	0.03	-3.4988	18.8851	0.92375	0.0:1.0:0.0:0.0	.	154;165;92;178;165	B3KT61;B3KSX3;Q86SE5-2;G3V129;Q86SE5	.;.;.;.;RALYL_HUMAN	M	165;165;165;154;178;92;76	ENSP00000430394:T165M;ENSP00000428667:T165M;ENSP00000430367:T165M;ENSP00000430065:T154M;ENSP00000430128:T178M;ENSP00000428807:T92M;ENSP00000428310:T76M	ENSP00000430128:T178M	T	+	2	0	RALYL	85937166	0.679000	0.27596	0.011000	0.14972	0.798000	0.45092	5.613000	0.67688	2.511000	0.84671	0.551000	0.68910	ACG	.	.	none		0.483	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1		
SOX15	6665	hgsc.bcm.edu	37	17	7492686	7492686	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:7492686C>T	ENST00000250055.2	-	1	802	c.309G>A	c.(307-309)aaG>aaA	p.K103K	SOX15_ENST00000570788.1_Silent_p.K103K|MPDU1_ENST00000423172.2_Intron|SOX15_ENST00000538513.2_Silent_p.K103K|FXR2_ENST00000573057.1_5'Flank	NM_006942.1	NP_008873.1	O60248	SOX15_HUMAN	SRY (sex determining region Y)-box 15	103					cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|male gonad development (GO:0008584)|myoblast development (GO:0048627)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue regeneration (GO:0043403)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)	2						CGCGGAGCCGCTTGGCCTCCT	0.682											OREG0024139	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K103K		Atlas-SNP	.											.	SOX15	10	.	0			c.G309A						PASS	.						24.0	27.0	26.0					17																	7492686		2202	4299	6501	SO:0001819	synonymous_variant	6665	exon1			GAGCCGCTTGGCC	AJ006222	CCDS32549.1	17p13.1	2014-08-12	2002-07-22	2002-07-26	ENSG00000129194	ENSG00000129194		"""SRY (sex determining region Y)-boxes"""	11196	protein-coding gene	gene with protein product		601297	"""SRY (sex determining region Y)-box 20"""	SOX20		8978787, 9730625	Standard	NM_006942		Approved	SOX27, SOX26	uc002ghz.1	O60248	OTTHUMG00000178146	ENST00000250055.2:c.309G>A	17.37:g.7492686C>T		Somatic	155	0	0	642	WXS	Illumina HiSeq	Phase_I	79	11	0.139241	NM_006942	B4DWU7|D3DTQ0|P35717|Q9Y6W7	Silent	SNP	ENST00000250055.2	37	CCDS32549.1																																																																																			.	.	none		0.682	SOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440757.1	NM_006942	
FAM8A1	51439	hgsc.bcm.edu	37	6	17606159	17606159	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:17606159C>A	ENST00000259963.3	+	4	1067	c.1012C>A	c.(1012-1014)Ctt>Att	p.L338I		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	338	RDD.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			CCTGCTGGGGCTTCGAGTTGT	0.423																																					p.L338I		Atlas-SNP	.											FAM8A1,colon,carcinoma,-1,1	FAM8A1	26	1	0			c.C1012A						scavenged	.						137.0	124.0	128.0					6																	17606159		2203	4300	6503	SO:0001583	missense	51439	exon4			CTGGGGCTTCGAG	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.1012C>A	6.37:g.17606159C>A	ENSP00000259963:p.Leu338Ile	Somatic	218	1	0.00458716		WXS	Illumina HiSeq	Phase_I	215	3	0.0139535	NM_016255	B2R725	Missense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932068	0.73442	.	.	ENSG00000137414	ENST00000542476;ENST00000259963	.	.	.	5.87	4.98	0.66077	RDD (1);	0.000000	0.85682	D	0.000000	T	0.58552	0.2130	L	0.37630	1.12	0.58432	D	0.999993	D	0.76494	0.999	D	0.71656	0.974	T	0.61978	-0.6951	9	0.44086	T	0.13	-12.3698	16.897	0.86102	0.0:0.8718:0.1282:0.0	.	338	Q9UBU6	FA8A1_HUMAN	I	88;338	.	ENSP00000259963:L338I	L	+	1	0	FAM8A1	17714138	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	7.438000	0.80431	1.435000	0.47434	0.650000	0.86243	CTT	.	.	none		0.423	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
ASPN	54829	hgsc.bcm.edu	37	9	95237027	95237027	+	Missense_Mutation	SNP	A	A	C	rs200538582|rs397840756|rs557103556|rs3078372|rs397838876		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:95237027A>C	ENST00000375544.3	-	2	396	c.153T>G	c.(151-153)gaT>gaG	p.D51E	ASPN_ENST00000395538.3_Missense_Mutation_p.D51E|ASPN_ENST00000450139.2_Missense_Mutation_p.D23E|CENPP_ENST00000375587.3_Intron|ASPN_ENST00000375543.1_Missense_Mutation_p.D51E	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	51	Poly-Asp.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						AGTTGTCCtcatcatcatcat	0.398																																					p.D51E		Atlas-SNP	.											ASPN,caecum,carcinoma,0,1	ASPN	52	1	0			c.T153G						scavenged	.						109.0	92.0	98.0					9																	95237027		2203	4300	6503	SO:0001583	missense	54829	exon2			GTCCTCATCATCA	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.153T>G	9.37:g.95237027A>C	ENSP00000364694:p.Asp51Glu	Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	65	5	0.0769231	NM_001193335	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	ENST00000375544.3	37		.	.	.	.	.	.	.	.	.	.	G	0.561	-0.845374	0.02671	.	.	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538;ENST00000450139	T;T;T	0.54675	0.62;0.56;0.56	4.66	-6.14	0.02111	.	0.405245	0.21419	N	0.074846	T	0.34221	0.0890	L	0.49350	1.555	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.002;0.003	T	0.44097	-0.9350	10	0.06891	T	0.86	.	9.9603	0.41693	0.5846:0.1655:0.2499:0.0	.	51;51	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	E	51;51;51;23	ENSP00000364694:D51E;ENSP00000364693:D51E;ENSP00000378909:D51E	ENSP00000364693:D51E	D	-	3	2	ASPN	94276848	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.517000	0.00954	-2.861000	0.00327	-3.764000	0.00021	GAT	.	.	weak		0.398	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1	NM_017680	
PCMTD1	115294	hgsc.bcm.edu	37	8	52733214	52733214	+	Missense_Mutation	SNP	A	A	C	rs200377849		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:52733214A>C	ENST00000360540.5	-	7	1177	c.771T>G	c.(769-771)aaT>aaG	p.N257K	PCMTD1_ENST00000522514.1_Missense_Mutation_p.N257K|PCMTD1_ENST00000544451.1_Missense_Mutation_p.N181K|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	257						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.N257K(1)		NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CATTTATGAAATTTCTAAGTG	0.388																																					p.N257K		Atlas-SNP	.											PCMTD1,trunk,malignant_melanoma,0,1	PCMTD1	73	1	1	Substitution - Missense(1)	skin(1)	c.T771G						scavenged	.						78.0	81.0	80.0					8																	52733214		2203	4300	6503	SO:0001583	missense	115294	exon6			TATGAAATTTCTA		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.771T>G	8.37:g.52733214A>C	ENSP00000353739:p.Asn257Lys	Somatic	266	2	0.0075188		WXS	Illumina HiSeq	Phase_I	235	6	0.0255319	NM_052937	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.991059	0.35131	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.47528	0.84;0.84;0.84	5.56	-0.996	0.10218	.	0.046341	0.85682	D	0.000000	T	0.38983	0.1061	N	0.20530	0.585	0.53005	D	0.999961	P;D;B	0.65815	0.651;0.995;0.002	B;P;B	0.60886	0.122;0.88;0.002	T	0.41556	-0.9502	10	0.02654	T	1	-22.28	11.477	0.50304	0.3747:0.0:0.6253:0.0	.	127;181;257	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	K	257;181;257	ENSP00000353739:N257K;ENSP00000444026:N181K;ENSP00000428099:N257K	ENSP00000353739:N257K	N	-	3	2	PCMTD1	52895767	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	3.249000	0.51437	-0.122000	0.11766	-0.250000	0.11733	AAT	.	.	weak		0.388	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
MTR	4548	hgsc.bcm.edu	37	1	237057789	237057789	+	Missense_Mutation	SNP	G	G	A	rs146071220	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:237057789G>A	ENST00000366577.5	+	30	3731	c.3337G>A	c.(3337-3339)Gcc>Acc	p.A1113T	MTR_ENST00000535889.1_Missense_Mutation_p.A1062T|MTR_ENST00000470570.1_3'UTR	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	1113	AdoMet activation. {ECO:0000255|PROSITE- ProRule:PRU00346}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	GCTGAGCAAGGCCTATGAGGA	0.592													G|||	8	0.00159744	0.0061	0.0	5008	,	,		17936	0.0		0.0	False		,,,				2504	0.0				p.A1113T		Atlas-SNP	.											MTR,NS,carcinoma,-1,1	MTR	127	1	0			c.G3337A						scavenged	.	G	THR/ALA	31,4375	37.6+/-69.7	0,31,2172	131.0	106.0	115.0		3337	2.7	0.8	1	dbSNP_134	115	0,8600		0,0,4300	yes	missense	MTR	NM_000254.2	58	0,31,6472	AA,AG,GG		0.0,0.7036,0.2384	benign	1113/1266	237057789	31,12975	2203	4300	6503	SO:0001583	missense	4548	exon30			AGCAAGGCCTATG	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.3337G>A	1.37:g.237057789G>A	ENSP00000355536:p.Ala1113Thr	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	81	3	0.037037	NM_000254	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	ENST00000366577.5	37	CCDS1614.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	G	14.58	2.577977	0.45902	0.007036	0.0	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889;ENST00000366576	T;T;T	0.76316	-1.01;-1.01;-1.01	5.57	2.68	0.31781	Vitamin B12-dependent methionine synthase, activation domain (4);	0.415672	0.26532	N	0.023857	T	0.57710	0.2072	L	0.33710	1.025	0.27679	N	0.946491	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.49661	-0.8916	10	0.27785	T	0.31	-7.5278	11.6366	0.51207	0.1958:0.0:0.8042:0.0	.	1113;1062;1113	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	T	967;1113;1062;667	ENSP00000355536:A1113T;ENSP00000441845:A1062T;ENSP00000355535:A667T	ENSP00000355535:A667T	A	+	1	0	MTR	235124412	0.998000	0.40836	0.812000	0.32479	0.975000	0.68041	1.627000	0.37050	0.397000	0.25310	-0.119000	0.15052	GCC	G|0.997;A|0.003	0.003	strong		0.592	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254	
OR2L2	26246	hgsc.bcm.edu	37	1	248201941	248201941	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:248201941C>T	ENST00000366479.2	+	1	468	c.372C>T	c.(370-372)gcC>gcT	p.A124A	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GTTATGTGGCCATTTGCTTTC	0.443																																					p.A124A		Atlas-SNP	.											OR2L2,NS,carcinoma,+1,1	OR2L2	115	1	0			c.C372T						scavenged	.						164.0	144.0	151.0					1																	248201941		2203	4300	6503	SO:0001819	synonymous_variant	26246	exon1			TGTGGCCATTTGC	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.372C>T	1.37:g.248201941C>T		Somatic	188	0	0		WXS	Illumina HiSeq	Phase_I	218	3	0.0137615	NM_001004686	Q2M3T5	Silent	SNP	ENST00000366479.2	37	CCDS31103.1																																																																																			.	.	none		0.443	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686	
OR5W2	390148	hgsc.bcm.edu	37	11	55681542	55681542	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:55681542C>A	ENST00000344514.1	-	1	516	c.517G>T	c.(517-519)Gag>Tag	p.E173*		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TGATTAATCTCATTAGACCCA	0.418																																					p.E173X	Melanoma(48;171 1190 15239 43886 49348)	Atlas-SNP	.											OR5W2,colon,carcinoma,+2,1	OR5W2	112	1	0			c.G517T						PASS	.						84.0	77.0	79.0					11																	55681542		2201	4296	6497	SO:0001587	stop_gained	390148	exon1			TAATCTCATTAGA	BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.517G>T	11.37:g.55681542C>A	ENSP00000342448:p.Glu173*	Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	69	15	0.217391	NM_001001960		Nonsense_Mutation	SNP	ENST00000344514.1	37	CCDS31513.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861330	0.71949	.	.	ENSG00000187612	ENST00000344514	.	.	.	5.0	4.09	0.47781	.	0.000000	0.40818	N	0.001006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	11.1192	0.48279	0.0:0.9092:0.0:0.0908	.	.	.	.	X	173	.	ENSP00000342448:E173X	E	-	1	0	OR5W2	55438118	0.000000	0.05858	0.625000	0.29200	0.981000	0.71138	-0.662000	0.05305	1.097000	0.41459	0.542000	0.68232	GAG	.	.	none		0.418	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960	
SGK1	6446	hgsc.bcm.edu	37	6	134495170	134495170	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134495170C>G	ENST00000237305.7	-	3	289	c.201G>C	c.(199-201)gaG>gaC	p.E67D	SGK1_ENST00000367857.5_Missense_Mutation_p.E57D|SGK1_ENST00000413996.3_Missense_Mutation_p.E81D|SGK1_ENST00000367858.5_Missense_Mutation_p.E162D|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000475719.2_Missense_Mutation_p.E67D|SGK1_ENST00000528577.1_Missense_Mutation_p.E95D	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	67					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CATTCATAAGCTCAGGCTCCT	0.483																																					p.E162D		Atlas-SNP	.											.	SGK1	387	.	0			c.G486C						PASS	.						150.0	144.0	146.0					6																	134495170		2203	4300	6503	SO:0001583	missense	6446	exon5			CATAAGCTCAGGC	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.201G>C	6.37:g.134495170C>G	ENSP00000237305:p.Glu67Asp	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	71	5	0.0704225	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893621	0.52121	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.66;-0.66;-0.64;-0.64	5.99	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	L	0.45137	1.4	0.80722	D	1	B;B;B;B;B;B	0.18461	0.005;0.028;0.001;0.013;0.017;0.001	B;B;B;B;B;B	0.21917	0.012;0.011;0.001;0.007;0.037;0.003	T	0.36383	-0.9750	10	0.30854	T	0.27	.	7.4903	0.27458	0.0:0.6523:0.0:0.3477	.	95;81;67;57;162;67	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	D	162;81;67;57;95;67;131	ENSP00000356832:E162D;ENSP00000396242:E81D;ENSP00000237305:E67D;ENSP00000356831:E57D;ENSP00000434450:E95D;ENSP00000434302:E67D	ENSP00000237305:E67D	E	-	3	2	SGK1	134536863	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.890000	0.39728	0.848000	0.35191	0.655000	0.94253	GAG	.	.	none		0.483	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
HECTD4	283450	hgsc.bcm.edu	37	12	112622063	112622063	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:112622063G>A	ENST00000430131.2	-	60	10586	c.9441C>T	c.(9439-9441)tcC>tcT	p.S3147S	HECTD4_ENST00000550722.1_Silent_p.S3423S|HECTD4_ENST00000377560.5_Silent_p.S3397S			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3147					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CTGTGTACATGGAGCCCATGT	0.637																																					p.S3435S		Atlas-SNP	.											.	.	.	.	0			c.C10305T						PASS	.						74.0	85.0	82.0					12																	112622063		1990	4157	6147	SO:0001819	synonymous_variant	283450	exon61			GTACATGGAGCCC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9441C>T	12.37:g.112622063G>A		Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	82	18	0.219512	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37																																																																																				.	.	none		0.637	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
ALKBH8	91801	hgsc.bcm.edu	37	11	107423860	107423860	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:107423860A>T	ENST00000428149.2	-	5	720	c.569T>A	c.(568-570)gTa>gAa	p.V190E	ALKBH8_ENST00000530933.1_5'Flank|ALKBH8_ENST00000417449.2_Missense_Mutation_p.V193E|ALKBH8_ENST00000389568.3_Missense_Mutation_p.V190E|ALKBH8_ENST00000429370.1_Missense_Mutation_p.V190E	NM_138775.2	NP_620130.2	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8 (E. coli)	190					cellular response to DNA damage stimulus (GO:0006974)|tRNA methylation (GO:0030488)	cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|RNA binding (GO:0003723)|tRNA (uracil) methyltransferase activity (GO:0016300)	p.V190A(2)		breast(2)|large_intestine(2)|lung(5)	9		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		ATCTTTATCTACATTGTTGTT	0.308																																					p.V190E		Atlas-SNP	.											ALKBH8_ENST00000428149,colon,carcinoma,0,2	ALKBH8	88	2	2	Substitution - Missense(2)	large_intestine(2)	c.T569A						scavenged	.						139.0	128.0	132.0					11																	107423860		2200	4294	6494	SO:0001583	missense	91801	exon5			TTATCTACATTGT	AF086489	CCDS8337.2, CCDS73376.1	11q22.3	2013-10-04			ENSG00000137760	ENSG00000137760	2.1.1.229	"""Alkylation repair homologs"", ""RNA binding motif (RRM) containing"""	25189	protein-coding gene	gene with protein product		613306				20123966	Standard	NM_138775		Approved	MGC10235	uc009yxp.3	Q96BT7	OTTHUMG00000157008	ENST00000428149.2:c.569T>A	11.37:g.107423860A>T	ENSP00000415885:p.Val190Glu	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	74	3	0.0405405	NM_138775	B1Q2M0|B4DEF6|Q8N989	Missense_Mutation	SNP	ENST00000428149.2	37	CCDS8337.2	.	.	.	.	.	.	.	.	.	.	A	25.1	4.602662	0.87157	.	.	ENSG00000137760	ENST00000428149;ENST00000429370;ENST00000389568;ENST00000417449	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.52	5.52	0.82312	.	0.062750	0.64402	D	0.000007	T	0.56411	0.1983	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.61182	-0.7114	10	0.87932	D	0	-25.9757	14.8123	0.70006	1.0:0.0:0.0:0.0	.	190	Q96BT7	ALKB8_HUMAN	E	190;190;190;193	ENSP00000415885:V190E;ENSP00000391225:V190E;ENSP00000374219:V190E;ENSP00000397673:V193E	ENSP00000260318:V190E	V	-	2	0	ALKBH8	106929070	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.572000	0.90756	2.095000	0.63458	0.482000	0.46254	GTA	.	.	none		0.308	ALKBH8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347071.2	NM_138775	
DIDO1	11083	hgsc.bcm.edu	37	20	61511760	61511760	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:61511760C>T	ENST00000266070.4	-	16	5873	c.5548G>A	c.(5548-5550)Ggg>Agg	p.G1850R	DIDO1_ENST00000395343.1_Missense_Mutation_p.G1850R	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1850	Pro-rich.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CTCTTCTCCCCATGGGGATCC	0.607																																					p.G1850R	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											DIDO1,NS,carcinoma,0,2	DIDO1	321	2	0			c.G5548A						scavenged	.						58.0	62.0	61.0					20																	61511760		2203	4295	6498	SO:0001583	missense	11083	exon16			TCTCCCCATGGGG	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.5548G>A	20.37:g.61511760C>T	ENSP00000266070:p.Gly1850Arg	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	95	2	0.0210526	NM_001193369	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.856353	0.51376	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.09255	3.0;3.0	4.97	4.97	0.65823	.	0.000000	0.43747	D	0.000530	T	0.17280	0.0415	L	0.57536	1.79	0.80722	D	1	D	0.54964	0.969	P	0.51806	0.68	T	0.00525	-1.1689	10	0.49607	T	0.09	-36.8057	7.3758	0.26827	0.168:0.7401:0.0:0.0919	.	1850	Q9BTC0	DIDO1_HUMAN	R	1850	ENSP00000266070:G1850R;ENSP00000378752:G1850R	ENSP00000266070:G1850R	G	-	1	0	DIDO1	60982205	0.996000	0.38824	0.622000	0.29159	0.375000	0.29983	3.566000	0.53805	2.270000	0.75569	0.561000	0.74099	GGG	.	.	none		0.607	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
GRIK4	2900	hgsc.bcm.edu	37	11	120831697	120831697	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:120831697C>T	ENST00000527524.2	+	17	2241	c.1954C>T	c.(1954-1956)Ccc>Tcc	p.P652S	GRIK4_ENST00000438375.2_Missense_Mutation_p.P652S	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	652					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		CATGGATGTGCCCATTGAGTC	0.532																																					p.P652S		Atlas-SNP	.											GRIK4,NS,carcinoma,-1,1	GRIK4	149	1	0			c.C1954T						PASS	.						140.0	111.0	121.0					11																	120831697		2203	4299	6502	SO:0001583	missense	2900	exon15			GATGTGCCCATTG	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1954C>T	11.37:g.120831697C>T	ENSP00000435648:p.Pro652Ser	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	130	31	0.238462	NM_014619	A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	37	CCDS8433.1	.	.	.	.	.	.	.	.	.	.	C	34	5.386043	0.95967	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.11495	2.77;2.77	5.51	5.51	0.81932	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.35278	0.0926	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.03240	-1.1057	10	0.66056	D	0.02	.	19.0461	0.93020	0.0:1.0:0.0:0.0	.	652;652	A6H8K8;Q16099	.;GRIK4_HUMAN	S	652	ENSP00000435648:P652S;ENSP00000404063:P652S	ENSP00000404063:P652S	P	+	1	0	GRIK4	120336907	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.593000	0.87608	0.655000	0.94253	CCC	.	.	none		0.532	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
KLHL6	89857	hgsc.bcm.edu	37	3	183209942	183209942	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:183209942C>G	ENST00000341319.3	-	7	1674	c.1639G>C	c.(1639-1641)Gag>Cag	p.E547Q		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	547					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CTGGCCCGCTCGTGGCTGAGC	0.657																																					p.E547Q		Atlas-SNP	.											.	KLHL6	100	.	0			c.G1639C						PASS	.						39.0	39.0	39.0					3																	183209942		2202	4299	6501	SO:0001583	missense	89857	exon7			CCCGCTCGTGGCT	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1639G>C	3.37:g.183209942C>G	ENSP00000341342:p.Glu547Gln	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	152	27	0.177632	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940006	0.73557	.	.	ENSG00000172578	ENST00000341319	T	0.66815	-0.23	5.8	5.8	0.92144	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.73489	0.3593	L	0.33668	1.02	0.50467	D	0.999877	D	0.60575	0.988	D	0.66497	0.944	T	0.67245	-0.5719	10	0.22706	T	0.39	.	20.029	0.97531	0.0:1.0:0.0:0.0	.	547	Q8WZ60	KLHL6_HUMAN	Q	547	ENSP00000341342:E547Q	ENSP00000341342:E547Q	E	-	1	0	KLHL6	184692636	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.907000	0.69908	2.742000	0.94016	0.591000	0.81541	GAG	.	.	none		0.657	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
PRAMEF1	65121	hgsc.bcm.edu	37	1	12854401	12854401	+	Nonsense_Mutation	SNP	G	G	T	rs201717831		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:12854401G>T	ENST00000332296.7	+	3	728	c.625G>T	c.(625-627)Gag>Tag	p.E209*	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	209					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TAGTATTCAAGAGCTGGAAAT	0.398																																					p.E209X		Atlas-SNP	.											PRAMEF1,NS,carcinoma,0,2	PRAMEF1	78	2	0			c.G625T						scavenged	.						363.0	333.0	343.0					1																	12854401		2203	4300	6503	SO:0001587	stop_gained	65121	exon3			ATTCAAGAGCTGG	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.625G>T	1.37:g.12854401G>T	ENSP00000332134:p.Glu209*	Somatic	501	29	0.0578842		WXS	Illumina HiSeq	Phase_I	458	37	0.080786	NM_023013	Q9UQP2	Nonsense_Mutation	SNP	ENST00000332296.7	37	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	16.09	3.023241	0.54683	.	.	ENSG00000116721	ENST00000332296	.	.	.	1.74	0.76	0.18442	.	0.742629	0.12834	N	0.435382	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	3.5875	0.07977	0.2694:0.0:0.7306:0.0	.	.	.	.	X	209	.	ENSP00000332134:E209X	E	+	1	0	PRAMEF1	12776988	0.002000	0.14202	0.001000	0.08648	0.004000	0.04260	0.426000	0.21363	0.256000	0.21614	0.543000	0.68304	GAG	G|0.500;C|0.500	.	alt		0.398	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
CHD8	57680	hgsc.bcm.edu	37	14	21870201	21870201	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:21870201C>T	ENST00000557364.1	-	20	4240	c.3977G>A	c.(3976-3978)tGt>tAt	p.C1326Y	CHD8_ENST00000430710.3_Missense_Mutation_p.C1047Y|CHD8_ENST00000399982.2_Missense_Mutation_p.C1326Y|CHD8_ENST00000555962.1_5'UTR			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1326					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GTCCTCTTCACAAAACTTGGA	0.403																																					p.C1326Y		Atlas-SNP	.											.	CHD8	339	.	0			c.G3977A						PASS	.						163.0	157.0	159.0					14																	21870201		2037	4224	6261	SO:0001583	missense	57680	exon19			TCTTCACAAAACT	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.3977G>A	14.37:g.21870201C>T	ENSP00000451601:p.Cys1326Tyr	Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	197	31	0.15736	NM_001170629	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	37	CCDS53885.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109408	0.77096	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.85702	-2.02;-2.02;-2.02	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.91835	0.7416	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.89666	0.3880	10	0.38643	T	0.18	-18.0066	19.6509	0.95805	0.0:1.0:0.0:0.0	.	1326;1047	Q9HCK8;Q9HCK8-2	CHD8_HUMAN;.	Y	1047;1326;1046;1326	ENSP00000406288:C1047Y;ENSP00000382863:C1326Y;ENSP00000451601:C1326Y	ENSP00000262707:C1046Y	C	-	2	0	CHD8	20940041	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	TGT	.	.	none		0.403	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
NBPF15	284565	hgsc.bcm.edu	37	1	148594563	148594563	+	Missense_Mutation	SNP	G	G	T	rs146229961		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:148594563G>T	ENST00000369187.3	+	19	2425	c.1936G>T	c.(1936-1938)Gtg>Ttg	p.V646L	NBPF15_ENST00000442702.2_Missense_Mutation_p.V646L	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	646	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					CGCCCTTTACGTGGACAATAG	0.443																																					p.V646L		Atlas-SNP	.											NBPF15,brain,glioma,0,1	NBPF15	20	1	0			c.G1936T						scavenged	.						73.0	97.0	89.0					1																	148594563		2159	4285	6444	SO:0001583	missense	284565	exon19			CTTTACGTGGACA	BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.1936G>T	1.37:g.148594563G>T	ENSP00000358188:p.Val646Leu	Somatic	472	45	0.095339		WXS	Illumina HiSeq	Phase_I	538	44	0.0817844	NM_173638	Q3BBV9|Q8IX77	Missense_Mutation	SNP	ENST00000369187.3	37	CCDS932.1	.	.	.	.	.	.	.	.	.	.	.	3.518	-0.098353	0.07010	.	.	ENSG00000243452	ENST00000442702;ENST00000369187	T;T	0.10668	2.85;2.85	0.502	-1.0	0.10196	DUF1220 (2);	.	.	.	.	T	0.04048	0.0113	M	0.77103	2.36	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.39563	-0.9608	8	0.51188	T	0.08	.	.	.	.	.	646	Q8N660	NBPFF_HUMAN	L	646	ENSP00000416864:V646L;ENSP00000358188:V646L	ENSP00000358188:V646L	V	+	1	0	NBPF15	146861187	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-1.793000	0.01755	-0.873000	0.04032	-1.415000	0.01116	GTG	G|0.996;T|0.005	0.005	strong		0.443	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038609.3	NM_173638	
ZNF572	137209	hgsc.bcm.edu	37	8	125989722	125989722	+	Silent	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:125989722A>G	ENST00000319286.5	+	3	1366	c.1212A>G	c.(1210-1212)agA>agG	p.R404R		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	404					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			GACATCAGAGAACACATACAG	0.423										HNSCC(60;0.17)																											p.R404R		Atlas-SNP	.											ZNF572,colon,carcinoma,+1,1	ZNF572	82	1	0			c.A1212G						PASS	.						83.0	80.0	81.0					8																	125989722		2203	4300	6503	SO:0001819	synonymous_variant	137209	exon3			TCAGAGAACACAT	BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.1212A>G	8.37:g.125989722A>G		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	65	4	0.0615385	NM_152412	A1L4F1|Q8N1Q0	Silent	SNP	ENST00000319286.5	37	CCDS6354.1																																																																																			.	.	none		0.423	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381359.1	NM_152412	
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39324333	39324333	+	Missense_Mutation	SNP	T	T	A	rs12953139	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:39324333T>A	ENST00000391356.2	-	1	91	c.92A>T	c.(91-93)cAg>cTg	p.Q31L		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	31					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGGTGGTCTGGCAGCAGCT	0.637																																					p.Q31L		Atlas-SNP	.											KRTAP4-3,NS,carcinoma,0,1	KRTAP4-3	40	1	0			c.A92T						scavenged	.						29.0	32.0	31.0					17																	39324333		2195	4293	6488	SO:0001583	missense	85290	exon1			GTGGTCTGGCAGC	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.92A>T	17.37:g.39324333T>A	ENSP00000375151:p.Gln31Leu	Somatic	142	1	0.00704225		WXS	Illumina HiSeq	Phase_I	197	41	0.208122	NM_033187		Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	8.661	0.900435	0.17686	.	.	ENSG00000196156	ENST00000391356	T	0.01629	4.72	5.15	0.112	0.14623	.	.	.	.	.	T	0.03608	0.0103	M	0.85373	2.75	0.80722	P	0.0	B	0.34181	0.44	B	0.38378	0.272	T	0.11131	-1.0600	8	0.35671	T	0.21	.	3.821	0.08836	0.1588:0.2591:0.0:0.5822	.	31	Q9BYR4	KRA43_HUMAN	L	31	ENSP00000375151:Q31L	ENSP00000375151:Q31L	Q	-	2	0	KRTAP4-3	36577859	0.006000	0.16342	0.208000	0.23602	0.204000	0.24138	0.129000	0.15830	0.020000	0.15106	0.533000	0.62120	CAG	A|0.046;T|0.954	0.046	strong		0.637	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
SP140	11262	hgsc.bcm.edu	37	2	231157487	231157487	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:231157487T>C	ENST00000392045.3	+	20	2066	c.1952T>C	c.(1951-1953)cTa>cCa	p.L651P	SP140_ENST00000420434.3_Missense_Mutation_p.L624P|SP140_ENST00000343805.6_Missense_Mutation_p.L591P|SP140_ENST00000486687.2_Missense_Mutation_p.L575P|SP140_ENST00000417495.3_Missense_Mutation_p.L537P|SP140_ENST00000350136.5_Missense_Mutation_p.L520P	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	651	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GGGTGGCCCCTACGATGGCTG	0.488																																					p.L651P		Atlas-SNP	.											SP140_ENST00000392045,NS,carcinoma,+1,1	SP140	121	1	0			c.T1952C						scavenged	.						80.0	88.0	85.0					2																	231157487		1992	4136	6128	SO:0001583	missense	11262	exon20			GGCCCCTACGATG	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.1952T>C	2.37:g.231157487T>C	ENSP00000375899:p.Leu651Pro	Somatic	113	20	0.176991		WXS	Illumina HiSeq	Phase_I	117	19	0.162393	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	T	14.92	2.678190	0.47886	.	.	ENSG00000079263	ENST00000486687;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07	3.19	3.19	0.36642	SAND domain-like (2);SAND domain (3);	.	.	.	.	D	0.88485	0.6449	M	0.90369	3.11	0.27953	N	0.937061	D;D;D;D	0.89917	0.999;0.995;0.997;1.0	D;D;D;D	0.91635	0.997;0.979;0.994;0.999	T	0.79458	-0.1795	9	0.87932	D	0	-11.9146	8.4594	0.32919	0.0:0.0:0.0:1.0	.	624;537;591;651	E7EUR5;E7ESH9;E9PFJ6;Q13342	.;.;.;LY10_HUMAN	P	575;520;651;537;591;624	ENSP00000440107:L575P;ENSP00000345846:L520P;ENSP00000375899:L651P;ENSP00000342096:L591P;ENSP00000398210:L624P	ENSP00000342096:L591P	L	+	2	0	SP140	230865731	0.621000	0.27077	0.012000	0.15200	0.417000	0.31264	3.422000	0.52749	1.438000	0.47492	0.369000	0.22263	CTA	.	.	none		0.488	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
SULF1	23213	hgsc.bcm.edu	37	8	70512971	70512971	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:70512971G>A	ENST00000260128.4	+	9	1585	c.868G>A	c.(868-870)Gat>Aat	p.D290N	SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000402687.4_Missense_Mutation_p.D290N|SULF1_ENST00000419716.3_Missense_Mutation_p.D290N|SULF1_ENST00000458141.2_Missense_Mutation_p.D290N	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	290					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			GATGTCAGTGGATGATTCTGT	0.438																																					p.D290N		Atlas-SNP	.											.	SULF1	153	.	0			c.G868A						PASS	.						163.0	155.0	158.0					8																	70512971		2203	4300	6503	SO:0001583	missense	23213	exon9			TCAGTGGATGATT	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.868G>A	8.37:g.70512971G>A	ENSP00000260128:p.Asp290Asn	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	106	22	0.207547	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.929844	0.92389	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	D;D;D;D	0.99842	-7.1;-7.1;-7.1;-7.1	6.16	6.16	0.99307	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.042703	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90082	3.085	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.97261	0.9904	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	290	Q8IWU6	SULF1_HUMAN	N	290	ENSP00000403040:D290N;ENSP00000260128:D290N;ENSP00000385704:D290N;ENSP00000390315:D290N	ENSP00000260128:D290N	D	+	1	0	SULF1	70675525	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.905000	0.87416	2.937000	0.99478	0.650000	0.86243	GAT	.	.	none		0.438	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
VMP1	81671	hgsc.bcm.edu	37	17	57915717	57915717	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:57915717C>T	ENST00000262291.4	+	11	1346	c.1036C>T	c.(1036-1038)Cgg>Tgg	p.R346W	VMP1_ENST00000588617.1_3'UTR|VMP1_ENST00000539763.1_Missense_Mutation_p.R154W|VMP1_ENST00000536180.1_Missense_Mutation_p.R249W|VMP1_ENST00000537567.1_Missense_Mutation_p.R212W|VMP1_ENST00000545362.1_Missense_Mutation_p.R290W|MIR21_ENST00000362134.1_RNA	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	346					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)		p.R346W(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						GGAGGCTCAACGGCAGAAGCT	0.502																																					p.R346W		Atlas-SNP	.											VMP1,caecum,carcinoma,0,1	VMP1	49	1	1	Substitution - Missense(1)	large_intestine(1)	c.C1036T						scavenged	.						90.0	84.0	86.0					17																	57915717		2203	4300	6503	SO:0001583	missense	81671	exon11			GCTCAACGGCAGA		CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.1036C>T	17.37:g.57915717C>T	ENSP00000262291:p.Arg346Trp	Somatic	228	0	0		WXS	Illumina HiSeq	Phase_I	226	3	0.0132743	NM_030938	B4DVV9|Q9H0P4|Q9P089	Missense_Mutation	SNP	ENST00000262291.4	37	CCDS11619.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.512058	0.85389	.	.	ENSG00000062716	ENST00000262291;ENST00000537567;ENST00000539763;ENST00000536180;ENST00000545362	.	.	.	5.95	5.95	0.96441	.	0.049123	0.85682	D	0.000000	T	0.76471	0.3992	M	0.78456	2.415	0.80722	D	1	D;D;D;D	0.67145	0.992;0.987;0.996;0.994	P;P;P;P	0.57846	0.761;0.629;0.721;0.828	T	0.79006	-0.1979	9	0.87932	D	0	-10.0857	16.0297	0.80570	0.1422:0.8578:0.0:0.0	.	212;249;290;346	B4DED7;B4DGZ7;F5H2J3;Q96GC9	.;.;.;VMP1_HUMAN	W	346;212;154;249;290	.	ENSP00000262291:R346W	R	+	1	2	VMP1	55270499	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.010000	0.57117	2.827000	0.97445	0.650000	0.86243	CGG	.	.	none		0.502	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1	NM_030938	
COASY	80347	hgsc.bcm.edu	37	17	40716156	40716156	+	Missense_Mutation	SNP	G	G	A	rs367865615		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:40716156G>A	ENST00000393818.2	+	2	1334	c.878G>A	c.(877-879)cGt>cAt	p.R293H	MLX_ENST00000246912.4_5'Flank|COASY_ENST00000421097.2_Missense_Mutation_p.R293H|COASY_ENST00000449624.1_5'UTR|RP11-400F19.8_ENST00000585572.1_RNA|MLX_ENST00000435881.2_5'Flank|MLX_ENST00000346833.4_5'Flank|COASY_ENST00000420359.1_Missense_Mutation_p.R293H|COASY_ENST00000590958.1_Missense_Mutation_p.R322H	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	293	Phosphopantetheine adenylyltransferase.				cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		GAGACCTATCGTGGGGGGATG	0.622																																					p.R322H		Atlas-SNP	.											.	COASY	45	.	0			c.G965A						PASS	.						39.0	41.0	40.0					17																	40716156		2203	4300	6503	SO:0001583	missense	80347	exon4			CCTATCGTGGGGG	AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.878G>A	17.37:g.40716156G>A	ENSP00000377406:p.Arg293His	Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	153	41	0.267974	NM_001042532	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Missense_Mutation	SNP	ENST00000393818.2	37	CCDS11429.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500814	0.85176	.	.	ENSG00000068120	ENST00000421097;ENST00000420359;ENST00000393818	D;D;D	0.96459	-4.01;-4.02;-4.02	5.23	5.23	0.72850	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.106801	0.64402	D	0.000014	D	0.97498	0.9181	M	0.62266	1.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.973	D	0.97758	1.0219	10	0.87932	D	0	-11.0142	16.6827	0.85297	0.0:0.0:1.0:0.0	.	322;293	Q13057-2;Q13057	.;COASY_HUMAN	H	322;293;293	ENSP00000393564:R322H;ENSP00000413338:R293H;ENSP00000377406:R293H	ENSP00000377406:R293H	R	+	2	0	COASY	37969682	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.983000	0.40648	2.882000	0.98803	0.655000	0.94253	CGT	.	.	alt		0.622	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450409.1	NM_025233	
BRIP1	83990	hgsc.bcm.edu	37	17	59760682	59760682	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:59760682T>G	ENST00000259008.2	-	20	3992	c.3725A>C	c.(3724-3726)aAa>aCa	p.K1242T		NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	1242					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						AAACATGCCTTTATTTTTGGA	0.284			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																													p.K1242T		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	.	BRIP1	237	.	0			c.A3725C						PASS	.						63.0	66.0	65.0					17																	59760682		2202	4292	6494	SO:0001583	missense	83990	exon20			ATGCCTTTATTTT	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.3725A>C	17.37:g.59760682T>G	ENSP00000259008:p.Lys1242Thr	Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	102	20	0.196078	NM_032043	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000259008.2	37	CCDS11631.1	.	.	.	.	.	.	.	.	.	.	T	12.26	1.883513	0.33255	.	.	ENSG00000136492	ENST00000259008	T	0.77620	-1.11	4.35	4.35	0.52113	.	.	.	.	.	T	0.63010	0.2475	N	0.19112	0.55	0.80722	D	1	P	0.40970	0.734	B	0.39617	0.305	T	0.61153	-0.7120	8	.	.	.	.	11.1816	0.48631	0.0:0.0:0.0:1.0	.	1242	Q9BX63	FANCJ_HUMAN	T	1242	ENSP00000259008:K1242T	.	K	-	2	0	BRIP1	57115464	1.000000	0.71417	0.914000	0.36105	0.079000	0.17450	2.496000	0.45346	1.710000	0.51325	0.383000	0.25322	AAA	.	.	none		0.284	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043	
GH2	2689	hgsc.bcm.edu	37	17	61957782	61957782	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:61957782T>A	ENST00000423893.2	-	5	614	c.553A>T	c.(553-555)Aac>Tac	p.N185Y	GH2_ENST00000332800.7_3'UTR|GH2_ENST00000456543.2_Missense_Mutation_p.R183S|GH2_ENST00000449787.2_Missense_Mutation_p.N170Y			P01242	SOM2_HUMAN	growth hormone 2	185					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						AGCCCGTAGTTCTTGAGCAGT	0.557																																					p.N185Y		Atlas-SNP	.											.	GH2	73	.	0			c.A553T						PASS	.						201.0	164.0	177.0					17																	61957782		2203	4300	6503	SO:0001583	missense	2689	exon5			CGTAGTTCTTGAG	J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.553A>T	17.37:g.61957782T>A	ENSP00000409294:p.Asn185Tyr	Somatic	460	0	0		WXS	Illumina HiSeq	Phase_I	412	95	0.230583	NM_002059	B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	ENST00000423893.2	37	CCDS11647.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	12.27|12.27	1.886442|1.886442	0.33348|0.33348	.|.	.|.	ENSG00000136487|ENSG00000136487	ENST00000423893;ENST00000449787|ENST00000456543	D;D|D	0.88664|0.88896	-2.41;-2.41|-2.44	2.74|2.74	2.74|2.74	0.32292|0.32292	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);|.	.|.	.|.	.|.	.|.	D|D	0.93115|0.93115	0.7808|0.7808	M|M	0.93939|0.93939	3.475|3.475	0.80722|0.80722	D|D	1|1	D;D|P	0.89917|0.52170	1.0;1.0|0.951	D;D|P	0.97110|0.56088	1.0;0.998|0.791	D|D	0.91600|0.91600	0.5294|0.5294	9|9	0.87932|0.48119	D|T	0|0.1	.|.	5.5287|5.5287	0.16972|0.16972	0.0:0.1365:0.0:0.8635|0.0:0.1365:0.0:0.8635	.|.	185;170|183	P01242;O14643|O14644	SOM2_HUMAN;.|.	Y|S	185;170|183	ENSP00000409294:N185Y;ENSP00000410618:N170Y|ENSP00000394122:R183S	ENSP00000409294:N185Y|ENSP00000394122:R183S	N|R	-|-	1|3	0|2	GH2|GH2	59311514|59311514	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.020000|0.020000	0.10135|0.10135	3.546000|3.546000	0.53656|0.53656	1.255000|1.255000	0.44051|0.44051	0.254000|0.254000	0.18369|0.18369	AAC|AGA	.	.	none		0.557	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417665.1	NM_002059	
SEMG1	6406	hgsc.bcm.edu	37	20	43837052	43837052	+	Missense_Mutation	SNP	C	C	A	rs199672858	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:43837052C>A	ENST00000372781.3	+	2	1171	c.1114C>A	c.(1114-1116)Cgc>Agc	p.R372S	SEMG1_ENST00000244069.6_Missense_Mutation_p.R312S	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	372	2 X 60 AA tandem repeats, type 1.|Repeat-rich region. {ECO:0000250}.		R -> L (in dbSNP:rs2233887). {ECO:0000269|PubMed:14629036}.		insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				TGTATCCCAACGCAGTATTTA	0.418																																					p.R372S		Atlas-SNP	.											SEMG1,bladder,carcinoma,0,3	SEMG1	71	3	0			c.C1114A						scavenged	.						77.0	71.0	73.0					20																	43837052		2203	4300	6503	SO:0001583	missense	6406	exon2			TCCCAACGCAGTA		CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.1114C>A	20.37:g.43837052C>A	ENSP00000361867:p.Arg372Ser	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	158	3	0.0189873	NM_003007	Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Missense_Mutation	SNP	ENST00000372781.3	37	CCDS13345.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.712711	0.00712	.	.	ENSG00000124233	ENST00000244069;ENST00000372781	T;T	0.03951	3.75;3.75	0.951	-1.9	0.07665	.	.	.	.	.	T	0.00754	0.0025	N	0.00082	-2.215	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34079	-0.9843	9	0.09590	T	0.72	.	0.297	0.00267	0.2228:0.2395:0.2981:0.2396	.	312;372	P04279-2;P04279	.;SEMG1_HUMAN	S	312;372	ENSP00000244069:R312S;ENSP00000361867:R372S	ENSP00000244069:R312S	R	+	1	0	SEMG1	43270466	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.965000	0.03829	-2.064000	0.00888	-1.625000	0.00788	CGC	C|1.000;T|0.000	.	alt		0.418	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079416.3	NM_003007	
HNRNPH1	3187	hgsc.bcm.edu	37	5	179044053	179044053	+	Splice_Site	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:179044053G>A	ENST00000356731.5	-	9	2651	c.1116C>T	c.(1114-1116)taC>taT	p.Y372Y	HNRNPH1_ENST00000524180.1_5'Flank|HNRNPH1_ENST00000442819.2_Splice_Site_p.Y372Y|HNRNPH1_ENST00000511300.2_Silent_p.Y102Y|HNRNPH1_ENST00000329433.6_Splice_Site_p.Y372Y|HNRNPH1_ENST00000510411.1_Silent_p.Y372Y|HNRNPH1_ENST00000393432.4_Splice_Site_p.Y372Y			P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1 (H)	372	2 X 16 AA Gly-rich approximate repeats.|2 X 19 AA perfect repeats.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|skin(1)	14						TTTGGCTACCGTAAGCACCAC	0.373																																					p.Y372Y		Atlas-SNP	.											HNRPH1,NS,carcinoma,-2,3	HNRNPH1	62	3	0			c.C1116T						scavenged	.						105.0	102.0	103.0					5																	179044053		2203	4300	6503	SO:0001630	splice_region_variant	3187	exon10			GCTACCGTAAGCA	BC001348	CCDS4446.1	5q35.3	2013-02-12		2008-04-18	ENSG00000169045	ENSG00000169045		"""RNA binding motif (RRM) containing"""	5041	protein-coding gene	gene with protein product		601035		HNRPH1		7499401	Standard	NM_005520		Approved	hnRNPH	uc003mkf.5	P31943	OTTHUMG00000130908	ENST00000356731.5:c.1117+1C>T	5.37:g.179044053G>A		Somatic	383	3	0.0078329		WXS	Illumina HiSeq	Phase_I	399	7	0.0175439	NM_001257293	B3KW86|D3DWQ2|Q6IBM4	Silent	SNP	ENST00000356731.5	37	CCDS4446.1	.	.	.	.	.	.	.	.	.	.	g	12.51	1.960606	0.34565	.	.	ENSG00000169045	ENST00000521173	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	T	0.58750	0.2144	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57271	-0.7840	4	.	.	.	-9.1144	8.0021	0.30304	0.192:0.0:0.808:0.0	.	.	.	.	M	247	.	.	T	-	2	0	HNRNPH1	178976659	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.877000	0.28106	2.730000	0.93505	0.644000	0.83932	ACG	.	.	none		0.373	HNRNPH1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253497.3	NM_005520	Silent
RBBP8NL	140893	hgsc.bcm.edu	37	20	60992303	60992303	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:60992303C>T	ENST00000252998.1	-	4	333	c.177G>A	c.(175-177)gaG>gaA	p.E59E		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	59						extracellular space (GO:0005615)											CCCGCAGGTTCTCCTTCAGTG	0.627																																					p.E59E		Atlas-SNP	.											C20orf151,NS,carcinoma,0,1	.	.	1	0			c.G177A						scavenged	.						103.0	72.0	82.0					20																	60992303		2202	4297	6499	SO:0001819	synonymous_variant	140893	exon4			CAGGTTCTCCTTC	AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.177G>A	20.37:g.60992303C>T		Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	99	3	0.030303	NM_080833	B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Silent	SNP	ENST00000252998.1	37	CCDS13498.1																																																																																			.	.	none		0.627	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080029.1	NM_080833	
ASNSD1	54529	hgsc.bcm.edu	37	2	190532027	190532027	+	Missense_Mutation	SNP	C	C	T	rs140770284		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:190532027C>T	ENST00000260952.4	+	4	1582	c.1169C>T	c.(1168-1170)gCt>gTt	p.A390V	ASNSD1_ENST00000607062.1_Intron	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	390	Asparagine synthetase.				asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			AAAGATGTTGCTGCTGCTGCT	0.418																																					p.A390V		Atlas-SNP	.											ASNSD1,rectum,carcinoma,+1,1	ASNSD1	63	1	0			c.C1169T						scavenged	.						47.0	46.0	47.0					2																	190532027		2203	4300	6503	SO:0001583	missense	54529	exon4			ATGTTGCTGCTGC	AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.1169C>T	2.37:g.190532027C>T	ENSP00000260952:p.Ala390Val	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	105	3	0.0285714	NM_019048	D3DPH6|Q3LIC3|Q4ZG45	Missense_Mutation	SNP	ENST00000260952.4	37	CCDS2300.1	.	.	.	.	.	.	.	.	.	.	C	3.934	-0.015602	0.07681	.	.	ENSG00000138381	ENST00000260952;ENST00000420250	T;T	0.38722	1.12;1.12	5.13	2.2	0.27929	Rossmann-like alpha/beta/alpha sandwich fold (1);Asparagine synthase (1);	0.697413	0.14112	N	0.340663	T	0.27900	0.0687	L	0.28400	0.85	0.09310	N	1	P	0.35793	0.521	B	0.37650	0.255	T	0.15378	-1.0439	10	0.07030	T	0.85	-1.5679	10.0459	0.42186	0.4503:0.4376:0.1121:0.0	.	390	Q9NWL6	ASND1_HUMAN	V	390	ENSP00000260952:A390V;ENSP00000406790:A390V	ENSP00000260952:A390V	A	+	2	0	ASNSD1	190240272	0.001000	0.12720	0.005000	0.12908	0.196000	0.23810	0.144000	0.16135	0.263000	0.21812	0.655000	0.94253	GCT	.	.	none		0.418	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255919.3	NM_019048	
OR51A2	401667	hgsc.bcm.edu	37	11	4976656	4976656	+	Silent	SNP	A	A	G	rs3986370|rs386750080	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:4976656A>G	ENST00000380371.1	-	1	287	c.288T>C	c.(286-288)tcT>tcC	p.S96S	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCAGGCACTAGAAGAAGTTT	0.438													a|||	717	0.143171	0.0968	0.1931	5008	,	,		13868	0.2312		0.172	False		,,,				2504	0.0501				p.S96S		Atlas-SNP	.											OR51A2,NS,carcinoma,-1,1	OR51A2	40	1	0			c.T288C						scavenged	.						138.0	107.0	118.0					11																	4976656		1863	3321	5184	SO:0001819	synonymous_variant	401667	exon1			GGCACTAGAAGAA	AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.288T>C	11.37:g.4976656A>G		Somatic	234	1	0.0042735		WXS	Illumina HiSeq	Phase_I	278	4	0.0143885	NM_001004748		Silent	SNP	ENST00000380371.1	37	CCDS31368.1																																																																																			.	.	weak		0.438	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142809.1	NM_001004748	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125555738	125555738	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:125555738A>G	ENST00000431078.1	+	19	3419	c.3055A>G	c.(3055-3057)Acc>Gcc	p.T1019A		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1019	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CTATCCTGTGACCAAGAATAT	0.443																																					p.T1019A		Atlas-SNP	.											CNTNAP5,NS,carcinoma,-2,1	CNTNAP5	405	1	0			c.A3055G						scavenged	.						141.0	131.0	134.0					2																	125555738		1924	4119	6043	SO:0001583	missense	129684	exon19			CCTGTGACCAAGA	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3055A>G	2.37:g.125555738A>G	ENSP00000399013:p.Thr1019Ala	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	179	3	0.0167598	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	A	9.807	1.182229	0.21787	.	.	ENSG00000155052	ENST00000431078	T	0.44482	0.92	5.93	5.93	0.95920	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.124353	0.35040	N	0.003483	T	0.26412	0.0645	N	0.25789	0.76	0.32824	D	0.50315	B	0.09022	0.002	B	0.08055	0.003	T	0.27640	-1.0068	10	0.07030	T	0.85	.	10.7519	0.46213	0.8583:0.0:0.0:0.1417	.	1019	Q8WYK1	CNTP5_HUMAN	A	1019	ENSP00000399013:T1019A	ENSP00000399013:T1019A	T	+	1	0	CNTNAP5	125272208	0.999000	0.42202	1.000000	0.80357	0.984000	0.73092	3.684000	0.54671	2.271000	0.75665	0.533000	0.62120	ACC	.	.	none		0.443	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
ALDH3B2	222	hgsc.bcm.edu	37	11	67432799	67432799	+	Silent	SNP	G	G	A	rs80147122		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:67432799G>A	ENST00000349015.3	-	7	1101	c.663C>T	c.(661-663)cgC>cgT	p.R221R	ALDH3B2_ENST00000531881.1_5'Flank|ALDH3B2_ENST00000530069.1_Silent_p.R221R	NM_000695.3	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3 family, member B2	221					alcohol metabolic process (GO:0006066)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)		3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	18						CAATGGCCACGCGGCTGCAGC	0.632																																					p.R221R		Atlas-SNP	.											ALDH3B2,NS,haematopoietic_neoplasm,0,2	ALDH3B2	46	2	0			c.C663T						scavenged	.						52.0	59.0	57.0					11																	67432799		2200	4293	6493	SO:0001819	synonymous_variant	222	exon7			GGCCACGCGGCTG	U37519	CCDS31622.1	11q13.2	2014-09-04			ENSG00000132746	ENSG00000132746	1.2.1.5	"""Aldehyde dehydrogenases"""	411	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 8"", ""acetaldehyde dehydrogenase 8"""	601917		ALDH8		8890755, 9161417	Standard	NM_000695		Approved		uc001oms.3	P48448	OTTHUMG00000167284	ENST00000349015.3:c.663C>T	11.37:g.67432799G>A		Somatic	277	2	0.00722022		WXS	Illumina HiSeq	Phase_I	243	3	0.0123457	NM_001031615	Q53Y98|Q8NAL5|Q96IB2	Silent	SNP	ENST00000349015.3	37	CCDS31622.1																																																																																			.	.	strong		0.632	ALDH3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394004.1	NM_000695	
PCMTD1	115294	hgsc.bcm.edu	37	8	52733209	52733209	+	Missense_Mutation	SNP	A	A	G	rs202074278		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:52733209A>G	ENST00000360540.5	-	7	1182	c.776T>C	c.(775-777)aTa>aCa	p.I259T	PCMTD1_ENST00000522514.1_Missense_Mutation_p.I259T|PCMTD1_ENST00000544451.1_Missense_Mutation_p.I183T|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	259						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.I259T(1)		NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CTCATCATTTATGAAATTTCT	0.403																																					p.I259T		Atlas-SNP	.											PCMTD1,NS,carcinoma,0,2	PCMTD1	73	2	1	Substitution - Missense(1)	prostate(1)	c.T776C						scavenged	.																																			SO:0001583	missense	115294	exon6			TCATTTATGAAAT		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.776T>C	8.37:g.52733209A>G	ENSP00000353739:p.Ile259Thr	Somatic	274	2	0.00729927		WXS	Illumina HiSeq	Phase_I	245	8	0.0326531	NM_052937	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.469272	0.43839	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.44881	0.91;0.91;0.91	5.77	5.77	0.91146	.	0.154593	0.64402	D	0.000017	T	0.43055	0.1230	L	0.34521	1.04	0.51482	D	0.999929	B;D;B	0.56287	0.01;0.975;0.009	B;P;B	0.48815	0.005;0.591;0.015	T	0.38628	-0.9652	10	0.59425	D	0.04	-40.7211	16.0858	0.81049	1.0:0.0:0.0:0.0	.	129;183;259	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	T	259;183;259	ENSP00000353739:I259T;ENSP00000444026:I183T;ENSP00000428099:I259T	ENSP00000353739:I259T	I	-	2	0	PCMTD1	52895762	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	6.577000	0.74027	2.198000	0.70561	0.533000	0.62120	ATA	.	.	weak		0.403	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
TOR1AIP1	26092	hgsc.bcm.edu	37	1	179852022	179852022	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:179852022C>T	ENST00000606911.2	+	1	576	c.385C>T	c.(385-387)Cgc>Tgc	p.R129C	TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.R129C|TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.R8C|RP11-533E19.7_ENST00000610272.1_lincRNA|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.R129C			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	129					positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						AAGGACTACCCGCCTTCAGCA	0.597																																					p.R129C		Atlas-SNP	.											.	TOR1AIP1	58	.	0			c.C385T						PASS	.						36.0	42.0	40.0					1																	179852022		2203	4300	6503	SO:0001583	missense	26092	exon1			ACTACCCGCCTTC		CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.385C>T	1.37:g.179852022C>T	ENSP00000476687:p.Arg129Cys	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	92	4	0.0434783	NM_001267578	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	ENST00000606911.2	37	CCDS1335.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703232	0.48412	.	.	ENSG00000143337	ENST00000528443;ENST00000325993;ENST00000271583;ENST00000435319	T;T;T	0.26810	1.71;1.71;1.71	3.48	1.49	0.22878	.	0.353873	0.20615	N	0.088900	T	0.38506	0.1043	M	0.61703	1.905	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.65773	0.91;0.938	T	0.12426	-1.0548	10	0.72032	D	0.01	-0.3755	4.6478	0.12580	0.0:0.6448:0.2268:0.1284	.	129;129	Q5JTV8;E9PKD1	TOIP1_HUMAN;.	C	129	ENSP00000435365:R129C;ENSP00000271583:R129C;ENSP00000393292:R129C	ENSP00000271583:R129C	R	+	1	0	TOR1AIP1	178118645	0.004000	0.15560	0.005000	0.12908	0.019000	0.09904	1.565000	0.36386	0.267000	0.21916	0.563000	0.77884	CGC	.	.	none		0.597	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000100313.4	NM_015602	
PPP1R3A	5506	hgsc.bcm.edu	37	7	113519094	113519094	+	Missense_Mutation	SNP	C	C	T	rs199968105		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:113519094C>T	ENST00000284601.3	-	4	2121	c.2053G>A	c.(2053-2055)Gtg>Atg	p.V685M		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	685					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TTTCCCCACACGTCTTCACAA	0.388																																					p.V685M		Atlas-SNP	.											PPP1R3A,right_upper_lobe,carcinoma,+2,1	PPP1R3A	317	1	0			c.G2053A						scavenged	.						257.0	251.0	253.0					7																	113519094		2203	4300	6503	SO:0001583	missense	5506	exon4			CCCACACGTCTTC	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2053G>A	7.37:g.113519094C>T	ENSP00000284601:p.Val685Met	Somatic	285	1	0.00350877		WXS	Illumina HiSeq	Phase_I	347	4	0.0115274	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.399609	0.00014	.	.	ENSG00000154415	ENST00000284601	T	0.14516	2.5	5.8	-2.4	0.06583	.	1.697530	0.02436	N	0.084042	T	0.04679	0.0127	N	0.00972	-1.085	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.33854	-0.9852	10	0.30078	T	0.28	-8.422	7.0302	0.24962	0.0:0.2938:0.3934:0.3128	.	685	Q16821	PPR3A_HUMAN	M	685	ENSP00000284601:V685M	ENSP00000284601:V685M	V	-	1	0	PPP1R3A	113306330	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.691000	0.01920	-0.382000	0.07870	-1.281000	0.01382	GTG	C|0.999;T|0.001	0.001	weak		0.388	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
NBEA	26960	hgsc.bcm.edu	37	13	35632915	35632915	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:35632915G>A	ENST00000400445.3	+	8	1688	c.1154G>A	c.(1153-1155)gGt>gAt	p.G385D	NBEA_ENST00000379939.2_Missense_Mutation_p.G385D|NBEA_ENST00000310336.4_Missense_Mutation_p.G385D|NBEA_ENST00000540320.1_Missense_Mutation_p.G385D	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	385					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GTATTCTGTGGTCAACTTGGT	0.358																																					p.G385D		Atlas-SNP	.											.	NBEA	340	.	0			c.G1154A						PASS	.						34.0	31.0	32.0					13																	35632915		1799	4063	5862	SO:0001583	missense	26960	exon8			TCTGTGGTCAACT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.1154G>A	13.37:g.35632915G>A	ENSP00000383295:p.Gly385Asp	Somatic	344	0	0		WXS	Illumina HiSeq	Phase_I	395	68	0.172152	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.004746	0.93287	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.94608	0.8262	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94886	0.8043	10	0.72032	D	0.01	.	19.6016	0.95566	0.0:0.0:1.0:0.0	.	385	Q5T321	.	D	385	ENSP00000440951:G385D;ENSP00000383295:G385D;ENSP00000369271:G385D;ENSP00000308534:G385D	ENSP00000308534:G385D	G	+	2	0	NBEA	34530915	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.813000	0.99286	2.718000	0.92993	0.650000	0.86243	GGT	.	.	none		0.358	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
CCR6	1235	hgsc.bcm.edu	37	6	167550741	167550741	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:167550741C>A	ENST00000341935.5	+	3	1575	c.1023C>A	c.(1021-1023)taC>taA	p.Y341*	RP11-517H2.6_ENST00000609590.1_RNA|CCR6_ENST00000400926.2_Nonsense_Mutation_p.Y341*|CCR6_ENST00000349984.4_Nonsense_Mutation_p.Y341*	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	341					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		GAAGGAAGTACAAGTCCTCAG	0.493																																					p.Y341X		Atlas-SNP	.											.	CCR6	36	.	0			c.C1023A						PASS	.						75.0	73.0	74.0					6																	167550741		2203	4300	6503	SO:0001587	stop_gained	1235	exon3			GAAGTACAAGTCC	U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.1023C>A	6.37:g.167550741C>A	ENSP00000343952:p.Tyr341*	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	137	27	0.19708	NM_004367	E1P5C6|P78553|Q92846	Nonsense_Mutation	SNP	ENST00000341935.5	37	CCDS5298.1	.	.	.	.	.	.	.	.	.	.	C	34	5.358683	0.95854	.	.	ENSG00000112486	ENST00000400926;ENST00000341935;ENST00000349984	.	.	.	4.64	0.654	0.17833	.	6.339280	0.01476	U	0.016474	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9574	0.19281	0.0:0.5143:0.1513:0.3344	.	.	.	.	X	341	.	ENSP00000343952:Y341X	Y	+	3	2	CCR6	167470731	0.636000	0.27207	0.000000	0.03702	0.011000	0.07611	0.126000	0.15769	0.122000	0.18314	0.655000	0.94253	TAC	.	.	none		0.493	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043118.1		
TMEM184C	55751	hgsc.bcm.edu	37	4	148539118	148539118	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:148539118C>T	ENST00000296582.3	+	1	585	c.11C>T	c.(10-12)aCt>aTt	p.T4I	TMEM184C_ENST00000508208.1_Missense_Mutation_p.T4I|RP11-425A23.1_ENST00000508072.1_RNA	NM_018241.2	NP_060711.2	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	4						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(2)|prostate(1)	16						ATGCCTTGCACTTGTACCTGG	0.478											OREG0016353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T4I		Atlas-SNP	.											.	TMEM184C	25	.	0			c.C11T						PASS	.						264.0	246.0	252.0					4																	148539118		2203	4300	6503	SO:0001583	missense	55751	exon1			CTTGCACTTGTAC	AF305823	CCDS3770.1	4q31.22	2008-06-05	2008-06-05	2008-06-05		ENSG00000164168			25587	protein-coding gene	gene with protein product		613937	"""transmembrane protein 34"""	TMEM34			Standard	NM_018241		Approved	FLJ10846	uc003ila.4	Q9NVA4		ENST00000296582.3:c.11C>T	4.37:g.148539118C>T	ENSP00000296582:p.Thr4Ile	Somatic	205	0	0	1718	WXS	Illumina HiSeq	Phase_I	220	51	0.231818	NM_018241	D3DP04|Q86X84|Q969I7|Q9NXM2	Missense_Mutation	SNP	ENST00000296582.3	37	CCDS3770.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.374141	0.82573	.	.	ENSG00000164168	ENST00000296582;ENST00000508208	.	.	.	5.45	5.45	0.79879	.	0.138744	0.48767	D	0.000162	T	0.57621	0.2066	L	0.43152	1.355	0.51233	D	0.999917	B	0.31680	0.335	B	0.28139	0.086	T	0.58951	-0.7545	9	0.56958	D	0.05	-10.0523	19.6609	0.95871	0.0:1.0:0.0:0.0	.	4	Q9NVA4	T184C_HUMAN	I	4	.	ENSP00000296582:T4I	T	+	2	0	TMEM184C	148758568	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	7.185000	0.77714	2.720000	0.93068	0.557000	0.71058	ACT	.	.	none		0.478	TMEM184C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364644.1	NM_018241	
EPHA6	285220	hgsc.bcm.edu	37	3	97251298	97251298	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:97251298G>A	ENST00000514100.1	+	8	715	c.473G>A	c.(472-474)cGg>cAg	p.R158Q	EPHA6_ENST00000502694.1_Missense_Mutation_p.R158Q|EPHA6_ENST00000389672.5_Missense_Mutation_p.R766Q|EPHA6_ENST00000442602.2_Missense_Mutation_p.R132Q	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	672	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CACATGGATCGGCAAAGAAGA	0.438																																					p.R766Q		Atlas-SNP	.											EPHA6,NS,carcinoma,+1,1	EPHA6	439	1	0			c.G2297A						scavenged	.						93.0	90.0	91.0					3																	97251298		1862	4119	5981	SO:0001583	missense	285220	exon11			TGGATCGGCAAAG	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.473G>A	3.37:g.97251298G>A	ENSP00000421711:p.Arg158Gln	Somatic	96	1	0.0104167		WXS	Illumina HiSeq	Phase_I	122	27	0.221311	NM_001080448	D6RAL5	Missense_Mutation	SNP	ENST00000514100.1	37		.	.	.	.	.	.	.	.	.	.	G	20.5	3.999696	0.74818	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694;ENST00000442602	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.85	5.85	0.93711	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.81889	0.4918	N	0.20304	0.555	0.51767	D	0.999937	P;B;D;P	0.62365	0.508;0.04;0.991;0.568	B;B;P;B	0.52109	0.073;0.019;0.69;0.039	D	0.83686	0.0174	9	0.59425	D	0.04	.	20.1542	0.98100	0.0:0.0:1.0:0.0	.	132;671;158;158	B4DXQ6;Q9UF33;Q9UF33-2;D6RAL5	.;EPHA6_HUMAN;.;.	Q	766;158;158;132	ENSP00000374323:R766Q;ENSP00000421711:R158Q;ENSP00000423950:R158Q;ENSP00000403100:R132Q	ENSP00000374323:R766Q	R	+	2	0	EPHA6	98733988	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.613000	0.54152	2.767000	0.95098	0.563000	0.77884	CGG	.	.	none		0.438	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448	
DNER	92737	hgsc.bcm.edu	37	2	230253013	230253013	+	Missense_Mutation	SNP	G	G	A	rs368405241		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:230253013G>A	ENST00000341772.4	-	11	1957	c.1823C>T	c.(1822-1824)cCg>cTg	p.P608L		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	608	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)	p.P608L(1)		NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		CCAACCATGCGGGCAGTGGCA	0.473													G|||	1	0.000199681	0.0	0.0014	5008	,	,		14257	0.0		0.0	False		,,,				2504	0.0				p.P608L		Atlas-SNP	.											DNER,NS,carcinoma,0,1	DNER	129	1	1	Substitution - Missense(1)	endometrium(1)	c.C1823T						scavenged	.						140.0	138.0	139.0					2																	230253013		2203	4300	6503	SO:0001583	missense	92737	exon11			CCATGCGGGCAGT	AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.1823C>T	2.37:g.230253013G>A	ENSP00000345229:p.Pro608Leu	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	81	3	0.037037	NM_139072	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	ENST00000341772.4	37	CCDS33390.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698903	0.88830	.	.	ENSG00000187957	ENST00000341772;ENST00000543700	D	0.89746	-2.56	5.65	5.65	0.86999	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.92031	0.7475	L	0.38531	1.155	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91456	0.5185	10	0.44086	T	0.13	.	19.3285	0.94273	0.0:0.0:1.0:0.0	.	608	Q8NFT8	DNER_HUMAN	L	608;326	ENSP00000345229:P608L	ENSP00000345229:P608L	P	-	2	0	DNER	229961257	1.000000	0.71417	0.987000	0.45799	0.910000	0.53928	7.129000	0.77225	2.661000	0.90470	0.637000	0.83480	CCG	.	.	alt		0.473	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	NM_139072	
FRAS1	80144	hgsc.bcm.edu	37	4	79188493	79188493	+	Silent	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:79188493A>G	ENST00000325942.6	+	9	1328	c.888A>G	c.(886-888)gaA>gaG	p.E296E	FRAS1_ENST00000264899.6_Silent_p.E296E|FRAS1_ENST00000264895.6_Silent_p.E296E	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	296	VWFC 5. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ACCAGGACGAAATGTGGAAGG	0.577																																					p.E296E		Atlas-SNP	.											FRAS1_ENST00000325942,pharynx,carcinoma,+2,2	FRAS1	779	2	0			c.A888G						scavenged	.						85.0	90.0	89.0					4																	79188493		2158	4244	6402	SO:0001819	synonymous_variant	80144	exon9			GGACGAAATGTGG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.888A>G	4.37:g.79188493A>G		Somatic	255	0	0		WXS	Illumina HiSeq	Phase_I	320	4	0.0125	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000325942.6	37	CCDS54772.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.822|0.822	-0.748330|-0.748330	0.03065|0.03065	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000502446|ENST00000508900	.|.	.|.	.|.	5.19|5.19	-1.92|-1.92	0.07618|0.07618	.|.	.|.	.|.	.|.	.|.	T|T	0.37945|0.37945	0.1022|0.1022	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.31586|0.31586	-0.9938|-0.9938	4|4	.|.	.|.	.|.	.|.	0.2694|0.2694	0.00229|0.00229	0.231:0.2821:0.2116:0.2753|0.231:0.2821:0.2116:0.2753	.|.	.|.	.|.	.|.	R|D	225|139	.|.	.|.	K|N	+|+	2|1	0|0	FRAS1|FRAS1	79407517|79407517	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.045000|0.045000	0.14185|0.14185	0.725000|0.725000	0.25970|0.25970	-0.213000|-0.213000	0.10094|0.10094	-0.290000|-0.290000	0.09829|0.09829	AAA|AAT	.	.	none		0.577	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
RFTN1	23180	hgsc.bcm.edu	37	3	16419279	16419279	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:16419279G>A	ENST00000334133.4	-	5	1044	c.772C>T	c.(772-774)Ctg>Ttg	p.L258L	RFTN1_ENST00000432519.1_Silent_p.L222L	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	258					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						GGTCCATCCAGTGTCTTGCTC	0.587																																					p.L258L		Atlas-SNP	.											.	RFTN1	79	.	0			c.C772T						PASS	.						70.0	74.0	73.0					3																	16419279		2203	4300	6503	SO:0001819	synonymous_variant	23180	exon5			CATCCAGTGTCTT	D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.772C>T	3.37:g.16419279G>A		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	82	28	0.341463	NM_015150	Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Silent	SNP	ENST00000334133.4	37	CCDS33712.1																																																																																			.	.	none		0.587	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150	
LTBP1	4052	hgsc.bcm.edu	37	2	33614282	33614282	+	Silent	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:33614282G>C	ENST00000404816.2	+	32	5096	c.4743G>C	c.(4741-4743)gtG>gtC	p.V1581V	LTBP1_ENST00000407925.1_Silent_p.V1255V|LTBP1_ENST00000418533.2_Silent_p.V1213V|LTBP1_ENST00000354476.3_Silent_p.V1582V|LTBP1_ENST00000272273.5_Silent_p.V479V|LTBP1_ENST00000402934.1_Silent_p.V1200V|LTBP1_ENST00000404525.1_Silent_p.V1202V|LTBP1_ENST00000390003.4_Silent_p.V1256V			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1581					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ACATCCCCGTGACGGGACGCC	0.562																																					p.V1581V		Atlas-SNP	.											.	LTBP1	317	.	0			c.G4743C						PASS	.						115.0	103.0	107.0					2																	33614282		2203	4300	6503	SO:0001819	synonymous_variant	4052	exon32			CCCCGTGACGGGA		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.4743G>C	2.37:g.33614282G>C		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	148	48	0.324324	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	37	CCDS33177.2																																																																																			.	.	none		0.562	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
RPLP2	6181	hgsc.bcm.edu	37	11	812762	812762	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:812762G>T	ENST00000321153.4	+	5	668	c.274G>T	c.(274-276)Gag>Tag	p.E92*	RPLP2_ENST00000530797.1_Nonsense_Mutation_p.E92*|SNORA52_ENST00000362915.1_RNA|RPLP2_ENST00000532004.1_3'UTR	NM_001004.3	NP_000995.1	P05387	RLA2_HUMAN	ribosomal protein, large, P2	92					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(1)	1		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTCCACAGCAGAGGAGAAGAA	0.537																																					p.E92X		Atlas-SNP	.											RPLP2,NS,carcinoma,0,1	RPLP2	2	1	0			c.G274T						scavenged	.						118.0	110.0	113.0					11																	812762		2203	4299	6502	SO:0001587	stop_gained	6181	exon5			ACAGCAGAGGAGA	M17887	CCDS7717.1	11p15.5	2011-07-29			ENSG00000177600	ENSG00000177600		"""L ribosomal proteins"""	10377	protein-coding gene	gene with protein product	"""60S acidic ribosomal protein P2"", ""acidic ribosomal phosphoprotein P2"""	180530		D11S2243E		3323886	Standard	NM_001004		Approved	P2, RPP2, MGC71408, LP2	uc001lrq.1	P05387	OTTHUMG00000133317	ENST00000321153.4:c.274G>T	11.37:g.812762G>T	ENSP00000322419:p.Glu92*	Somatic	150	1	0.00666667		WXS	Illumina HiSeq	Phase_I	100	2	0.02	NM_001004	Q6FG96	Nonsense_Mutation	SNP	ENST00000321153.4	37	CCDS7717.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.834249|6.834249	0.97873|0.97873	.|.	.|.	ENSG00000177600|ENSG00000177600	ENST00000321153;ENST00000530797|ENST00000530398	.|.	.|.	.|.	4.42|4.42	3.47|3.47	0.39725|0.39725	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.67776	.|0.2929	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.66705	.|-0.5856	.|4	0.21540|.	T|.	0.41|.	-28.7039|-28.7039	13.5703|13.5703	0.61843|0.61843	0.0:0.1571:0.8429:0.0|0.0:0.1571:0.8429:0.0	.|.	.|.	.|.	.|.	X|H	92|68	.|.	ENSP00000322419:E92X|.	E|Q	+|+	1|3	0|2	RPLP2|RPLP2	802762|802762	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.886000|0.886000	0.51366|0.51366	9.310000|9.310000	0.96267|0.96267	1.154000|1.154000	0.42482|0.42482	0.561000|0.561000	0.74099|0.74099	GAG|CAG	.	.	none		0.537	RPLP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257115.2	NM_001004	
PRAMEF2	65122	hgsc.bcm.edu	37	1	12921277	12921277	+	Silent	SNP	A	A	G	rs3204826	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:12921277A>G	ENST00000240189.2	+	4	1155	c.1068A>G	c.(1066-1068)ttA>ttG	p.L356L		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	356					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L356F(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCCTCGTGTTAGAGGGCTGTC	0.542													.|||	93	0.0185703	0.0091	0.0115	5008	,	,		23369	0.0437		0.008	False		,,,				2504	0.0215				p.L356L		Atlas-SNP	.											PRAMEF2,NS,carcinoma,0,1	PRAMEF2	85	1	1	Substitution - Missense(1)	prostate(1)	c.A1068G						scavenged	.						161.0	158.0	159.0					1																	12921277		2201	4291	6492	SO:0001819	synonymous_variant	65122	exon4			CGTGTTAGAGGGC		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.1068A>G	1.37:g.12921277A>G		Somatic	416	4	0.00961538		WXS	Illumina HiSeq	Phase_I	440	8	0.0181818	NM_023014		Silent	SNP	ENST00000240189.2	37	CCDS149.1																																																																																			A|0.996;G|0.004	0.004	strong		0.542	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
MUC4	4585	hgsc.bcm.edu	37	3	195509606	195509606	+	Missense_Mutation	SNP	C	C	T	rs200244334		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:195509606C>T	ENST00000463781.3	-	2	9304	c.8845G>A	c.(8845-8847)Gac>Aac	p.D2949N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2949N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.592																																					p.D2949N		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.G8845A						scavenged	.						10.0	8.0	9.0					3																	195509606		648	1501	2149	SO:0001583	missense	4585	exon2			AAGTGTCGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8845G>A	3.37:g.195509606C>T	ENSP00000417498:p.Asp2949Asn	Somatic	289	14	0.0484429		WXS	Illumina HiSeq	Phase_I	215	7	0.0325581	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	7.799	0.713161	0.15306	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30182	1.54;1.54	.	.	.	.	.	.	.	.	T	0.11281	0.0275	N	0.19112	0.55	0.09310	N	1	P	0.50710	0.938	B	0.29663	0.105	T	0.19484	-1.0304	7	.	.	.	.	3.2503	0.06812	0.0:0.638:0.0:0.362	.	2821	E7ESK3	.	N	2949	ENSP00000417498:D2949N;ENSP00000420243:D2949N	.	D	-	1	0	MUC4	196994385	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.907000	0.04067	-0.000000	0.14550	0.000000	0.15137	GAC	C|0.625;T|0.375	0.375	strong		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SGK1	6446	hgsc.bcm.edu	37	6	134495159	134495159	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134495159G>A	ENST00000237305.7	-	3	300	c.212C>T	c.(211-213)gCc>gTc	p.A71V	SGK1_ENST00000367857.5_Missense_Mutation_p.A61V|SGK1_ENST00000413996.3_Missense_Mutation_p.A85V|SGK1_ENST00000367858.5_Missense_Mutation_p.A166V|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000475719.2_Missense_Mutation_p.A71V|SGK1_ENST00000528577.1_Missense_Mutation_p.A99V	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	71					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		AGAAGGGTTGGCATTCATAAG	0.453																																					p.A166V		Atlas-SNP	.											SGK1_ENST00000528577,NS,lymphoid_neoplasm,0,5	SGK1	387	5	0			c.C497T						PASS	.						152.0	146.0	148.0					6																	134495159		2203	4300	6503	SO:0001583	missense	6446	exon5			GGGTTGGCATTCA	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.212C>T	6.37:g.134495159G>A	ENSP00000237305:p.Ala71Val	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	64	11	0.171875	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658406	0.47467	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T	0.72835	-0.68;-0.68;-0.68;-0.66;-0.66;-0.69	5.99	5.12	0.69794	.	0.399737	0.30076	N	0.010479	T	0.37293	0.0998	N	0.14661	0.345	0.80722	D	1	B;B;B;B;B;B	0.12630	0.001;0.001;0.001;0.001;0.006;0.0	B;B;B;B;B;B	0.14578	0.004;0.003;0.002;0.005;0.011;0.001	T	0.26950	-1.0088	10	0.25106	T	0.35	.	14.2908	0.66275	0.0:0.0:0.7295:0.2705	.	99;85;71;61;166;71	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	V	166;85;71;61;99;71;135	ENSP00000356832:A166V;ENSP00000396242:A85V;ENSP00000237305:A71V;ENSP00000356831:A61V;ENSP00000434450:A99V;ENSP00000434302:A71V	ENSP00000237305:A71V	A	-	2	0	SGK1	134536852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.654000	0.54453	1.523000	0.49018	0.655000	0.94253	GCC	.	.	none		0.453	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
B2M	567	hgsc.bcm.edu	37	15	45003764	45003764	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:45003764T>C	ENST00000558401.1	+	1	90	c.20T>C	c.(19-21)tTa>tCa	p.L7S	PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Missense_Mutation_p.L7S|B2M_ENST00000544417.1_Missense_Mutation_p.L7S	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	7					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.L7S(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TCCGTGGCCTTAGCTGTGCTC	0.607																																					p.L7S		Atlas-SNP	.											B2M,NS,lymphoid_neoplasm,0,1	B2M	99	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.T20C						scavenged	.						131.0	95.0	107.0					15																	45003764		2198	4298	6496	SO:0001583	missense	567	exon1			TGGCCTTAGCTGT	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.20T>C	15.37:g.45003764T>C	ENSP00000452780:p.Leu7Ser	Somatic	118	1	0.00847458		WXS	Illumina HiSeq	Phase_I	104	24	0.230769	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	T	11.97	1.798275	0.31777	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01422	4.91	5.35	4.22	0.49857	.	2.541080	0.03331	U	0.193423	T	0.04227	0.0117	M	0.73598	2.24	0.09310	N	1	P;P;P	0.46512	0.879;0.808;0.808	P;B;B	0.44394	0.448;0.368;0.368	T	0.44097	-0.9350	10	0.40728	T	0.16	.	8.1935	0.31383	0.0:0.0892:0.0:0.9108	.	7;7;7	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	S	7	ENSP00000437604:L7S	ENSP00000340858:L7S	L	+	2	0	B2M	42791056	0.006000	0.16342	0.001000	0.08648	0.002000	0.02628	0.889000	0.28282	1.144000	0.42321	0.533000	0.62120	TTA	.	.	none		0.607	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
GPRIN2	9721	hgsc.bcm.edu	37	10	46999601	46999601	+	Missense_Mutation	SNP	G	G	A	rs9422022	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr10:46999601G>A	ENST00000374317.1	+	3	994	c.721G>A	c.(721-723)Gtg>Atg	p.V241M	GPRIN2_ENST00000374314.4_Missense_Mutation_p.V241M	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	241			V -> M (in dbSNP:rs9422022).	VR -> MREVG (in Ref. 1; BAA25440 and 3; AAH11672). {ECO:0000305}.						breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CATGAGGGAGGTGAGGGCTGG	0.632													G|||	32	0.00638978	0.0023	0.0014	5008	,	,		31210	0.0139		0.0109	False		,,,				2504	0.0031				p.V241M		Atlas-SNP	.											GPRIN2,caecum,adenoma,0,1	GPRIN2	94	1	0			c.G721A						PASS	.						51.0	53.0	53.0					10																	46999601		2203	4299	6502	SO:0001583	missense	9721	exon3			AGGGAGGTGAGGG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.721G>A	10.37:g.46999601G>A	ENSP00000363436:p.Val241Met	Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	88	10	0.113636	NM_014696	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	786	0.3598901098901099	179	0.3638211382113821	126	0.34806629834254144	219	0.38286713286713286	262	0.34564643799472294	G	3.183	-0.167470	0.06461	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03496	3.91;3.91	5.12	-1.64	0.08318	.	1.524420	0.04254	N	0.339078	T	0.00012	0.0000	L	0.34521	1.04	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.46978	-0.9152	10	0.27082	T	0.32	0.3266	1.758	0.02986	0.326:0.1295:0.4122:0.1323	rs9422022	241	O60269	GRIN2_HUMAN	M	241	ENSP00000363436:V241M;ENSP00000363433:V241M	ENSP00000363433:V241M	V	+	1	0	GPRIN2	46419607	0.099000	0.21834	0.004000	0.12327	0.003000	0.03518	0.140000	0.16056	-0.217000	0.10033	-0.498000	0.04607	GTG	G|0.638;A|0.362	0.362	strong		0.632	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
ZBTB2	57621	hgsc.bcm.edu	37	6	151687092	151687092	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:151687092C>T	ENST00000325144.4	-	3	1249	c.1109G>A	c.(1108-1110)cGc>cAc	p.R370H		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		GATAAATTTGCGTCCACATAT	0.527																																					p.R370H		Atlas-SNP	.											.	ZBTB2	30	.	0			c.G1109A						PASS	.						114.0	111.0	112.0					6																	151687092		2203	4300	6503	SO:0001583	missense	57621	exon3			AATTTGCGTCCAC	BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.1109G>A	6.37:g.151687092C>T	ENSP00000323183:p.Arg370His	Somatic	354	0	0		WXS	Illumina HiSeq	Phase_I	333	14	0.042042	NM_020861	A8K7C7|Q5SZ81|Q9P245	Missense_Mutation	SNP	ENST00000325144.4	37	CCDS5231.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155967	0.57259	.	.	ENSG00000181472	ENST00000325144	T	0.61510	0.1	5.76	5.76	0.90799	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.61565	0.2357	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.66268	-0.5966	10	0.87932	D	0	-41.439	19.976	0.97309	0.0:1.0:0.0:0.0	.	370	Q8N680	ZBTB2_HUMAN	H	370	ENSP00000323183:R370H	ENSP00000323183:R370H	R	-	2	0	ZBTB2	151728785	1.000000	0.71417	0.998000	0.56505	0.912000	0.54170	7.704000	0.84595	2.713000	0.92767	0.655000	0.94253	CGC	.	.	none		0.527	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042715.1	NM_020861	
APMAP	57136	hgsc.bcm.edu	37	20	24954343	24954343	+	Missense_Mutation	SNP	C	C	T	rs115779992	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:24954343C>T	ENST00000217456.2	-	4	649	c.359G>A	c.(358-360)cGg>cAg	p.R120Q	APMAP_ENST00000447138.1_Missense_Mutation_p.R120Q|RNU6-1257P_ENST00000384625.1_RNA	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	120					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										TTTTACGACCCGGCCATCTGC	0.453																																					p.R120Q		Atlas-SNP	.											C20orf3,trunk,malignant_melanoma,-1,1	APMAP	3	1	0			c.G359A						scavenged	.						83.0	75.0	78.0					20																	24954343		2203	4300	6503	SO:0001583	missense	57136	exon4			ACGACCCGGCCAT	AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.359G>A	20.37:g.24954343C>T	ENSP00000217456:p.Arg120Gln	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	103	2	0.0194175	NM_020531	A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	ENST00000217456.2	37	CCDS13166.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.89|13.89	2.370690|2.370690	0.42003|0.42003	.|.	.|.	ENSG00000101474|ENSG00000101474	ENST00000451442|ENST00000217456;ENST00000447138	.|T;T	.|0.34275	.|1.37;1.37	5.43|5.43	2.48|2.48	0.30137|0.30137	.|Six-bladed beta-propeller, TolB-like (1);	.|0.351801	.|0.30930	.|N	.|0.008591	T|T	0.31888|0.31888	0.0811|0.0811	M|M	0.66560|0.66560	2.04|2.04	0.32886|0.32886	D|D	0.511187|0.511187	.|B;B;B	.|0.23316	.|0.049;0.083;0.064	.|B;B;B	.|0.12156	.|0.007;0.007;0.007	T|T	0.30650|0.30650	-0.9971|-0.9971	5|10	.|0.36615	.|T	.|0.2	-10.8339|-10.8339	7.4663|7.4663	0.27324|0.27324	0.0:0.6617:0.0:0.3383|0.0:0.6617:0.0:0.3383	.|.	.|120;104;120	.|Q9HDC9-2;A2A2F9;Q9HDC9	.|.;.;APMAP_HUMAN	R|Q	105|120	.|ENSP00000217456:R120Q;ENSP00000415373:R120Q	.|ENSP00000217456:R120Q	G|R	-|-	1|2	0|0	C20orf3|C20orf3	24902343|24902343	0.988000|0.988000	0.35896|0.35896	0.366000|0.366000	0.25914|0.25914	0.977000|0.977000	0.68977|0.68977	1.068000|1.068000	0.30629|0.30629	0.283000|0.283000	0.22279|0.22279	-0.137000|-0.137000	0.14449|0.14449	GGG|CGG	C|0.997;A|0.003	.	alt		0.453	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078380.2	NM_020531	
ZNF285	26974	hgsc.bcm.edu	37	19	44892153	44892153	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:44892153G>C	ENST00000330997.4	-	4	318	c.254C>G	c.(253-255)aCt>aGt	p.T85S	ZNF285_ENST00000544719.2_Missense_Mutation_p.T85S|CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Missense_Mutation_p.T92S	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	85	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T85S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						CTGACTCACAGTTAAATCCCG	0.413																																					p.T85S		Atlas-SNP	.											ZNF285,NS,carcinoma,0,1	ZNF285	86	1	1	Substitution - Missense(1)	kidney(1)	c.C254G						scavenged	.																																			SO:0001583	missense	26974	exon4			CTCACAGTTAAAT	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.254C>G	19.37:g.44892153G>C	ENSP00000333595:p.Thr85Ser	Somatic	205	4	0.0195122		WXS	Illumina HiSeq	Phase_I	199	6	0.0301508	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	G	8.428	0.848004	0.17034	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.06933	3.24	3.33	-0.0471	0.13844	Krueppel-associated box (1);	.	.	.	.	T	0.04318	0.0119	L	0.27053	0.805	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.06405	0.002;0.002	T	0.46679	-0.9174	9	0.09338	T	0.73	.	3.2813	0.06916	0.2593:0.2247:0.516:0.0	.	109;85	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	S	108;85	ENSP00000333595:T85S	ENSP00000333595:T85S	T	-	2	0	ZNF285	49583993	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	0.199000	0.17237	0.247000	0.21414	0.454000	0.30748	ACT	.	.	none		0.413	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
CD93	22918	hgsc.bcm.edu	37	20	23065878	23065878	+	Missense_Mutation	SNP	C	C	T	rs140540216		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:23065878C>T	ENST00000246006.4	-	1	1099	c.952G>A	c.(952-954)Gtc>Atc	p.V318I		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	318	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.		V -> A. {ECO:0000269|PubMed:11781389}.		macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GGTCCCAGGACGCACGTGGCC	0.637																																					p.V318I		Atlas-SNP	.											CD93,colon,carcinoma,0,1	CD93	84	1	0			c.G952A						PASS	.						39.0	43.0	42.0					20																	23065878		2203	4300	6503	SO:0001583	missense	22918	exon1			CCAGGACGCACGT	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.952G>A	20.37:g.23065878C>T	ENSP00000246006:p.Val318Ile	Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	150	27	0.18	NM_012072	O00274	Missense_Mutation	SNP	ENST00000246006.4	37	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	T	1.767	-0.485219	0.04352	.	.	ENSG00000125810	ENST00000246006	D	0.87412	-2.25	5.42	-2.28	0.06826	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.855870	0.02965	N	0.143707	T	0.75591	0.3870	N	0.25647	0.755	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.59215	-0.7496	10	0.12103	T	0.63	-4.8249	3.9396	0.09321	0.0988:0.4634:0.0974:0.3404	.	318	Q9NPY3	C1QR1_HUMAN	I	318	ENSP00000246006:V318I	ENSP00000246006:V318I	V	-	1	0	CD93	23013878	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.089000	0.01357	-0.557000	0.06126	-1.014000	0.02459	GTC	C|1.000;A|0.000	.	alt		0.637	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
CSMD3	114788	hgsc.bcm.edu	37	8	113316986	113316986	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:113316986T>C	ENST00000297405.5	-	52	8474	c.8230A>G	c.(8230-8232)Act>Gct	p.T2744A	CSMD3_ENST00000343508.3_Missense_Mutation_p.T2704A|CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000352409.3_Missense_Mutation_p.T2674A	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2744	Sushi 16. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CAACTCCAAGTACCATTAGGA	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.T2744A		Atlas-SNP	.											CSMD3_ENST00000343508,right_lower_lobe,carcinoma,+2,2	CSMD3	2325	2	0			c.A8230G						scavenged	.						136.0	121.0	126.0					8																	113316986		2203	4300	6503	SO:0001583	missense	114788	exon52			TCCAAGTACCATT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8230A>G	8.37:g.113316986T>C	ENSP00000297405:p.Thr2744Ala	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	161	2	0.0124224	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	6.669	0.492049	0.12702	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000352409	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.04	3.88	0.44766	Complement control module (2);Sushi/SCR/CCP (3);	0.314601	0.27896	N	0.017405	T	0.62109	0.2401	L	0.37507	1.11	0.43947	D	0.996614	B;P	0.49559	0.008;0.925	B;P	0.56042	0.034;0.79	T	0.55547	-0.8124	10	0.23891	T	0.37	.	10.8162	0.46578	0.0:0.0748:0.0:0.9252	.	2744;2704	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	A	2704;2744;2014;2674	ENSP00000345799:T2704A;ENSP00000297405:T2744A;ENSP00000341558:T2014A;ENSP00000343124:T2674A	ENSP00000297405:T2744A	T	-	1	0	CSMD3	113386162	0.999000	0.42202	0.998000	0.56505	0.352000	0.29268	2.639000	0.46570	0.849000	0.35215	-0.250000	0.11733	ACT	.	.	none		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
TMEM200A	114801	hgsc.bcm.edu	37	6	130761752	130761752	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:130761752G>T	ENST00000296978.3	+	3	1056	c.185G>T	c.(184-186)gGt>gTt	p.G62V	TMEM200A_ENST00000545622.1_Missense_Mutation_p.G62V|TMEM200A_ENST00000392429.1_Missense_Mutation_p.G62V	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	62						integral component of membrane (GO:0016021)		p.G62A(2)		NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		TCCCCATCTGGTTTTTTTCTT	0.473																																					p.G62V		Atlas-SNP	.											TMEM200A,NS,carcinoma,0,2	TMEM200A	108	2	2	Substitution - Missense(2)	kidney(2)	c.G185T						PASS	.						113.0	115.0	114.0					6																	130761752		2203	4300	6503	SO:0001583	missense	114801	exon3			CATCTGGTTTTTT	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.185G>T	6.37:g.130761752G>T	ENSP00000296978:p.Gly62Val	Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	207	37	0.178744	NM_001258277	Q96PX5	Missense_Mutation	SNP	ENST00000296978.3	37	CCDS5140.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787946	0.70337	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.76147	0.3947	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78499	-0.2180	9	0.87932	D	0	.	19.305	0.94157	0.0:0.0:1.0:0.0	.	62	Q86VY9	T200A_HUMAN	V	62	.	ENSP00000296978:G62V	G	+	2	0	TMEM200A	130803445	1.000000	0.71417	0.950000	0.38849	0.599000	0.36880	9.809000	0.99208	2.547000	0.85894	0.655000	0.94253	GGT	.	.	none		0.473	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042201.1	NM_052913	
ANK2	287	hgsc.bcm.edu	37	4	114294465	114294465	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:114294465T>G	ENST00000357077.4	+	45	11772	c.11719T>G	c.(11719-11721)Tat>Gat	p.Y3907D	ANK2_ENST00000510275.2_Missense_Mutation_p.Y505D|ANK2_ENST00000506722.1_Missense_Mutation_p.Y1813D|ANK2_ENST00000264366.6_Missense_Mutation_p.Y3874D|ANK2_ENST00000509550.1_Missense_Mutation_p.Y998D|ANK2_ENST00000394537.3_Missense_Mutation_p.Y1822D	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3907					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CATTAGGCGGTATGTATCCTC	0.383																																					p.Y3907D		Atlas-SNP	.											.	ANK2	576	.	0			c.T11719G						PASS	.						84.0	84.0	84.0					4																	114294465		2203	4300	6503	SO:0001583	missense	287	exon45			AGGCGGTATGTAT	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.11719T>G	4.37:g.114294465T>G	ENSP00000349588:p.Tyr3907Asp	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	148	25	0.168919	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.5|24.5	4.542868|4.542868	0.86022|0.86022	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000514960|ENST00000506722;ENST00000431447;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275;ENST00000505342	.|T;T;T;T;T;D;D	.|0.96491	.|-0.33;-0.31;-0.37;-0.38;-1.08;-2.04;-4.03	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.135690	.|0.33553	.|N	.|0.004794	D|D	0.97626|0.97626	0.9222|0.9222	M|M	0.70595|0.70595	2.14|2.14	0.46317|0.46317	D|D	0.998987|0.998987	.|D;D;D;P;D;D	.|0.71674	.|0.963;0.996;0.979;0.892;0.998;0.984	.|P;D;P;P;D;D	.|0.64506	.|0.642;0.919;0.642;0.643;0.917;0.926	D|D	0.97950|0.97950	1.0331|1.0331	5|10	.|0.56958	.|D	.|0.05	.|.	16.6093|16.6093	0.84858|0.84858	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|998;888;854;1822;3907;1813	.|E9PCH6;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5	.|.;.;.;.;.;.	G|D	854|1813;888;1822;3907;3874;1813;998;505;917	.|ENSP00000421067:Y1813D;ENSP00000378044:Y1822D;ENSP00000349588:Y3907D;ENSP00000264366:Y3874D;ENSP00000426944:Y998D;ENSP00000421023:Y505D;ENSP00000422498:Y917D	.|ENSP00000264366:Y3874D	V|Y	+|+	2|1	0|0	ANK2|ANK2	114513914|114513914	0.979000|0.979000	0.34478|0.34478	0.749000|0.749000	0.31150|0.31150	0.846000|0.846000	0.48090|0.48090	4.663000|4.663000	0.61532|0.61532	2.324000|2.324000	0.78689|0.78689	0.533000|0.533000	0.62120|0.62120	GTA|TAT	.	.	none		0.383	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
FAM209B	388799	hgsc.bcm.edu	37	20	55108530	55108530	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:55108530C>T	ENST00000371325.1	+	1	229	c.133C>T	c.(133-135)Cgg>Tgg	p.R45W		NM_001013646.2	NP_001013668.2	Q5JX69	F209B_HUMAN	family with sequence similarity 209, member B	45						integral component of membrane (GO:0016021)|nucleus (GO:0005634)											CTTTCGGATTCGGCAGAACCT	0.522																																					p.R45W		Atlas-SNP	.											C20orf107,NS,carcinoma,-1,1	.	.	1	0			c.C133T						scavenged	.						171.0	143.0	153.0					20																	55108530		2203	4300	6503	SO:0001583	missense	388799	exon1			CGGATTCGGCAGA	AL109806	CCDS33494.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000213714	ENSG00000213714			16101	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 107"""	C20orf107			Standard	NM_001013646		Approved	dJ1153D9.4	uc002xxz.4	Q5JX69	OTTHUMG00000032800	ENST00000371325.1:c.133C>T	20.37:g.55108530C>T	ENSP00000360376:p.Arg45Trp	Somatic	287	0	0		WXS	Illumina HiSeq	Phase_I	223	3	0.0134529	NM_001013646	Q3KRB5	Missense_Mutation	SNP	ENST00000371325.1	37	CCDS33494.1	.	.	.	.	.	.	.	.	.	.	C	7.205	0.594337	0.13875	.	.	ENSG00000213714	ENST00000371325	T	0.14766	2.48	2.8	-1.6	0.08426	.	0.000000	0.49916	D	0.000132	T	0.26122	0.0637	L	0.57536	1.79	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04708	-1.0932	10	0.52906	T	0.07	-36.4962	8.8173	0.35004	0.3654:0.6346:0.0:0.0	.	45	Q5JX69	CT107_HUMAN	W	45	ENSP00000360376:R45W	ENSP00000360376:R45W	R	+	1	2	C20orf107	54541937	0.025000	0.19082	0.003000	0.11579	0.025000	0.11179	-0.105000	0.10907	-0.526000	0.06383	-0.782000	0.03352	CGG	.	.	none		0.522	FAM209B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079816.1		
ALKBH1	8846	hgsc.bcm.edu	37	14	78140406	78140406	+	Missense_Mutation	SNP	C	C	T	rs370329463		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:78140406C>T	ENST00000216489.3	-	6	934	c.919G>A	c.(919-921)Gca>Aca	p.A307T		NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	307	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)			endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GGGAGAGGTGCCTCTAGGCAG	0.547																																					p.A307T		Atlas-SNP	.											ALKBH1,NS,carcinoma,0,1	ALKBH1	30	1	0			c.G919A						scavenged	.	C	THR/ALA	0,4406		0,0,2203	70.0	67.0	68.0		919	1.0	0.0	14		68	1,8599	1.2+/-3.3	0,1,4299	no	missense	ALKBH1	NM_006020.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	307/390	78140406	1,13005	2203	4300	6503	SO:0001583	missense	8846	exon6			GAGGTGCCTCTAG	X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.919G>A	14.37:g.78140406C>T	ENSP00000216489:p.Ala307Thr	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	118	2	0.0169492	NM_006020	Q8TAU1|Q9ULA7	Missense_Mutation	SNP	ENST00000216489.3	37	CCDS32127.1	.	.	.	.	.	.	.	.	.	.	C	2.059	-0.415868	0.04766	0.0	1.16E-4	ENSG00000100601	ENST00000216489	T	0.31769	1.48	5.95	0.973	0.19710	Oxoglutarate/iron-dependent oxygenase (1);	0.928117	0.09464	N	0.798622	T	0.10937	0.0267	N	0.02247	-0.625	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.36625	-0.9740	10	0.12766	T	0.61	-38.5984	6.9655	0.24621	0.0:0.3738:0.1605:0.4657	.	307	Q13686	ALKB1_HUMAN	T	307	ENSP00000216489:A307T	ENSP00000216489:A307T	A	-	1	0	ALKBH1	77210159	0.001000	0.12720	0.004000	0.12327	0.495000	0.33615	0.471000	0.22100	0.171000	0.19730	-0.302000	0.09304	GCA	.	.	weak		0.547	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414037.1	NM_006020	
ADM2	79924	hgsc.bcm.edu	37	22	50921164	50921164	+	Silent	SNP	A	A	C	rs72438078|rs3840963	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:50921164A>C	ENST00000395738.2	+	2	571	c.279A>C	c.(277-279)cgA>cgC	p.R93R	ADM2_ENST00000395737.1_Silent_p.R93R|ADM2_ENST00000362068.2_Missense_Mutation_p.E10A	NM_001253845.1|NM_024866.5	NP_001240774.1|NP_079142.2	Q7Z4H4	ADM2_HUMAN	adrenomedullin 2	93					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|digestion (GO:0007586)|feeding behavior (GO:0007631)|negative regulation of blood pressure (GO:0045776)|positive regulation of angiogenesis (GO:0045766)|positive regulation of gene expression (GO:0010628)|protein phosphorylation (GO:0006468)	extracellular region (GO:0005576)	protein complex binding (GO:0032403)	p.H95_R100delHSGPRR(1)		breast(1)|kidney(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGGGCCCCCGAAGACACTCGG	0.697																																					p.R93R		Atlas-SNP	.											ADM2,rectum,carcinoma,0,2	ADM2	15	2	1	Deletion - In frame(1)	breast(1)	c.A279C						PASS	.																																			SO:0001819	synonymous_variant	79924	exon2			CCCCCGAAGACAC	AF529213	CCDS33682.1	22q13.33	2013-02-25			ENSG00000128165	ENSG00000128165		"""Endogenous ligands"""	28898	protein-coding gene	gene with protein product		608682				14706825	Standard	NM_024866		Approved	AM2, FLJ21135	uc003blj.3	Q7Z4H4	OTTHUMG00000150202	ENST00000395738.2:c.279A>C	22.37:g.50921164A>C		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	36	10	0.277778	NM_024866	Q3LFQ0	Silent	SNP	ENST00000395738.2	37	CCDS33682.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.058801	0.55325	.	.	ENSG00000128165	ENST00000362068	.	.	.	4.21	-5.89	0.02282	.	.	.	.	.	T	0.08670	0.0215	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35151	-0.9800	5	0.08381	T	0.77	.	0.8616	0.01194	0.2188:0.3176:0.2553:0.2083	.	.	.	.	A	10	.	ENSP00000354955:E10A	E	+	2	0	ADM2	49268030	0.000000	0.05858	0.002000	0.10522	0.479000	0.33129	-1.143000	0.03200	-0.430000	0.07318	0.368000	0.22195	GAA	.	.	none		0.697	ADM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316816.1	NM_024866	
SLC35G6	643664	hgsc.bcm.edu	37	17	7386272	7386272	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:7386272C>T	ENST00000412468.2	+	2	1084	c.969C>T	c.(967-969)atC>atT	p.I323I	ZBTB4_ENST00000311403.4_Intron|POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	323	EamA 2.					integral component of membrane (GO:0016021)		p.I323I(1)									TTGCCATCATCACAGCCTGGA	0.557																																					p.I323I		Atlas-SNP	.											POLR2A_ENST00000412468,NS,carcinoma,0,1	.	.	1	1	Substitution - coding silent(1)	prostate(1)	c.C969T						scavenged	.																																			SO:0001819	synonymous_variant	643664	exon2			CATCATCACAGCC		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.969C>T	17.37:g.7386272C>T		Somatic	151	1	0.00662252		WXS	Illumina HiSeq	Phase_I	141	3	0.0212766	NM_001102614		Silent	SNP	ENST00000412468.2	37	CCDS45603.1																																																																																			.	.	none		0.557	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
FLG	2312	hgsc.bcm.edu	37	1	152280691	152280691	+	Missense_Mutation	SNP	A	A	T	rs117945779	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:152280691A>T	ENST00000368799.1	-	3	6706	c.6671T>A	c.(6670-6672)cTg>cAg	p.L2224Q	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2224	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGCCCACCAGTGAGTGTCT	0.542									Ichthyosis				-|||	959	0.191494	0.1936	0.1873	5008	,	,		22319	0.3026		0.0706	False		,,,				2504	0.2014				p.L2224Q		Atlas-SNP	.											FLG,NS,malignant_melanoma,+1,1	FLG	900	1	0			c.T6671A						scavenged	.						260.0	255.0	257.0					1																	152280691		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CCCACCAGTGAGT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6671T>A	1.37:g.152280691A>T	ENSP00000357789:p.Leu2224Gln	Somatic	358	30	0.0837989		WXS	Illumina HiSeq	Phase_I	406	39	0.0960591	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	t	2.028	-0.423196	0.04734	.	.	ENSG00000143631	ENST00000368799	T	0.02656	4.21	0.883	-0.332	0.12675	.	.	.	.	.	T	0.00144	0.0004	N	0.00034	-2.56	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30119	-0.9989	9	0.08381	T	0.77	.	1.4068	0.02283	0.3248:0.2503:0.0:0.4249	.	2224	P20930	FILA_HUMAN	Q	2224	ENSP00000357789:L2224Q	ENSP00000357789:L2224Q	L	-	2	0	FLG	150547315	0.313000	0.24554	0.000000	0.03702	0.001000	0.01503	-0.556000	0.05992	-0.732000	0.04856	-0.721000	0.03606	CTG	.	.	weak		0.542	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
MADCAM1	8174	hgsc.bcm.edu	37	19	501802	501802	+	Missense_Mutation	SNP	G	G	C	rs75905809		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:501802G>C	ENST00000215637.3	+	4	847	c.801G>C	c.(799-801)aaG>aaC	p.K267N	AC005775.2_ENST00000592413.1_RNA|MADCAM1_ENST00000346144.4_Intron|MADCAM1_ENST00000382683.4_Intron|MADCAM1_ENST00000587541.1_Missense_Mutation_p.K48N	NM_130760.2	NP_570116.2	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion molecule 1	267	5.5 X 8 AA tandem repeats of [PS]-P-D-T- T-S-[QP]-E.|Mucin-like.				aging (GO:0007568)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|embryo development (GO:0009790)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding involved in cell-matrix adhesion (GO:0098640)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCCGACAAGACCTCCCCGG	0.721																																					p.K267N		Atlas-SNP	.											MADCAM1,rectum,carcinoma,+1,1	MADCAM1	29	1	0			c.G801C						scavenged	.						12.0	14.0	13.0					19																	501802		2117	4139	6256	SO:0001583	missense	8174	exon4			CGACAAGACCTCC	U43628	CCDS12028.1, CCDS12029.1	19p13.3	2013-01-11			ENSG00000099866	ENSG00000099866		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6765	protein-coding gene	gene with protein product	"""mucosal addressin cell adhesion molecule-1"""	102670				9162097, 8609404	Standard	NM_130762		Approved	MACAM1	uc002los.3	Q13477	OTTHUMG00000180548	ENST00000215637.3:c.801G>C	19.37:g.501802G>C	ENSP00000215637:p.Lys267Asn	Somatic	146	39	0.267123		WXS	Illumina HiSeq	Phase_I	81	30	0.37037	NM_130760	A5PKV4|B2RPL9|O60222|O75867|Q5UGI7	Missense_Mutation	SNP	ENST00000215637.3	37	CCDS12028.1	.	.	.	.	.	.	.	.	.	.	g	1.225	-0.625782	0.03610	.	.	ENSG00000099866	ENST00000537731;ENST00000542525;ENST00000543297;ENST00000215637	T	0.10573	2.86	3.12	-6.25	0.02039	.	2.146880	0.03414	N	0.205240	T	0.04318	0.0119	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34179	-0.9839	10	0.16896	T	0.51	.	3.4407	0.07462	0.2616:0.3054:0.3464:0.0866	.	267	Q13477	MADCA_HUMAN	N	291;283;275;267	ENSP00000215637:K267N	ENSP00000215637:K267N	K	+	3	2	MADCAM1	452802	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.864000	0.00347	-2.471000	0.00529	-1.635000	0.00777	AAG	G|0.500;C|0.500	0.500	weak		0.721	MADCAM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451884.1	NM_130760	
ZNF285	26974	hgsc.bcm.edu	37	19	44891043	44891043	+	Missense_Mutation	SNP	G	G	T	rs77661661		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:44891043G>T	ENST00000330997.4	-	4	1428	c.1364C>A	c.(1363-1365)cCa>cAa	p.P455Q	ZNF285_ENST00000544719.2_Missense_Mutation_p.P455Q|CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Missense_Mutation_p.P462Q	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P455Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GCATTTGTATGGTTTCTCCCC	0.448																																					p.P455Q		Atlas-SNP	.											ZNF285,trunk,malignant_melanoma,0,1	ZNF285	86	1	1	Substitution - Missense(1)	skin(1)	c.C1364A						scavenged	.																																			SO:0001583	missense	26974	exon4			TTGTATGGTTTCT	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1364C>A	19.37:g.44891043G>T	ENSP00000333595:p.Pro455Gln	Somatic	103	2	0.0194175		WXS	Illumina HiSeq	Phase_I	132	4	0.030303	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.224441	0.58668	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.17213	2.29	3.36	3.36	0.38483	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41834	0.1176	M	0.75447	2.3	0.30665	N	0.754012	D;B	0.89917	1.0;0.012	D;B	0.83275	0.996;0.04	T	0.45323	-0.9269	9	0.62326	D	0.03	.	13.918	0.63914	0.0:0.0:1.0:0.0	.	479;455	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	Q	478;455	ENSP00000333595:P455Q	ENSP00000333595:P455Q	P	-	2	0	ZNF285	49582883	1.000000	0.71417	0.862000	0.33874	0.982000	0.71751	5.120000	0.64685	1.598000	0.50083	0.298000	0.19748	CCA	.	.	weak		0.448	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
PCDHB2	56133	hgsc.bcm.edu	37	5	140476396	140476396	+	Silent	SNP	G	G	T	rs429198|rs71574501	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:140476396G>T	ENST00000194155.4	+	1	2170	c.2022G>T	c.(2020-2022)ctG>ctT	p.L674L		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	674			L -> P (in dbSNP:rs384081).		calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L674>?(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTACCTGCTGCTCCCGGAGG	0.692																																					p.L674L		Atlas-SNP	.											PCDHB2,NS,carcinoma,+1,1	PCDHB2	163	1	1	Complex(1)	large_intestine(1)	c.G2022T						scavenged	.						65.0	65.0	65.0					5																	140476396		2188	4262	6450	SO:0001819	synonymous_variant	56133	exon1			CCTGCTGCTCCCG	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2022G>T	5.37:g.140476396G>T		Somatic	31	4	0.129032		WXS	Illumina HiSeq	Phase_I	19	5	0.263158	NM_018936	Q4KMU1	Silent	SNP	ENST00000194155.4	37	CCDS4244.1																																																																																			G|0.895;T|0.105	0.105	strong		0.692	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
SEMG2	6407	hgsc.bcm.edu	37	20	43851631	43851631	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:43851631C>A	ENST00000372769.3	+	2	1448	c.1358C>A	c.(1357-1359)cCt>cAt	p.P453H		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	453	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)	p.P453H(1)		autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				GTAACAATTCCTAGTCAAGAT	0.393																																					p.P453H		Atlas-SNP	.											SEMG2,NS,carcinoma,0,1	SEMG2	92	1	1	Substitution - Missense(1)	prostate(1)	c.C1358A						scavenged	.						79.0	77.0	77.0					20																	43851631		2203	4300	6503	SO:0001583	missense	6407	exon2			CAATTCCTAGTCA		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.1358C>A	20.37:g.43851631C>A	ENSP00000361855:p.Pro453His	Somatic	92	1	0.0108696		WXS	Illumina HiSeq	Phase_I	131	2	0.0152672	NM_003008	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	37	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	C	9.336	1.061813	0.19987	.	.	ENSG00000124157	ENST00000372769	T	0.12147	2.71	1.38	-2.41	0.06562	.	.	.	.	.	T	0.27205	0.0667	M	0.74647	2.275	0.09310	N	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.983	T	0.12502	-1.0545	9	0.44086	T	0.13	.	1.9378	0.03340	0.2658:0.3235:0.0:0.4107	.	453;453	A8K6Z6;Q02383	.;SEMG2_HUMAN	H	453	ENSP00000361855:P453H	ENSP00000361855:P453H	P	+	2	0	SEMG2	43285045	0.007000	0.16637	0.000000	0.03702	0.001000	0.01503	0.648000	0.24828	-0.814000	0.04352	-0.136000	0.14681	CCT	.	.	none		0.393	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008	
ZFAT	57623	hgsc.bcm.edu	37	8	135613905	135613905	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:135613905G>A	ENST00000377838.3	-	6	2231	c.2057C>T	c.(2056-2058)cCt>cTt	p.P686L	ZFAT_ENST00000520356.1_Missense_Mutation_p.P674L|ZFAT_ENST00000520214.1_Missense_Mutation_p.P674L|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000429442.2_Missense_Mutation_p.P674L|ZFAT_ENST00000523399.1_Missense_Mutation_p.P624L|ZFAT_ENST00000520727.1_Missense_Mutation_p.P674L	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	686					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			AGCTACTGGAGGGAGGAGGTC	0.597																																					p.P686L		Atlas-SNP	.											.	ZFAT	265	.	0			c.C2057T						PASS	.						68.0	73.0	72.0					8																	135613905		2041	4199	6240	SO:0001583	missense	57623	exon6			ACTGGAGGGAGGA	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.2057C>T	8.37:g.135613905G>A	ENSP00000367069:p.Pro686Leu	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	111	5	0.045045	NM_020863	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235411	0.22626	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399;ENST00000398946	T;T;T;T;T;T	0.09911	3.0;2.93;2.93;2.93;2.93;2.96	5.0	4.12	0.48240	.	0.066393	0.64402	D	0.000013	T	0.07683	0.0193	L	0.27053	0.805	0.09310	N	0.999997	B;B;B;B	0.25272	0.016;0.004;0.122;0.001	B;B;B;B	0.28305	0.009;0.004;0.088;0.002	T	0.33445	-0.9868	10	0.24483	T	0.36	-8.8579	8.1168	0.30948	0.2492:0.0:0.7508:0.0	.	624;674;674;686	E9PER3;E9PBN4;Q9P243-3;Q9P243	.;.;.;ZFAT_HUMAN	L	674;674;674;686;674;573;624;674	ENSP00000427879:P674L;ENSP00000427831:P674L;ENSP00000394501:P674L;ENSP00000367069:P686L;ENSP00000428483:P674L;ENSP00000429091:P624L	ENSP00000326997:P573L	P	-	2	0	ZFAT	135683087	0.003000	0.15002	0.039000	0.18376	0.809000	0.45718	1.438000	0.35002	1.327000	0.45338	0.561000	0.74099	CCT	.	.	none		0.597	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
MKI67	4288	hgsc.bcm.edu	37	10	129906293	129906293	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr10:129906293T>C	ENST00000368654.3	-	13	4186	c.3811A>G	c.(3811-3813)Aga>Gga	p.R1271G	MKI67_ENST00000368653.3_Missense_Mutation_p.R911G	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1271	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTGATACTTCTCTTGGGTCGT	0.502																																					p.R1271G		Atlas-SNP	.											MKI67,NS,carcinoma,+1,1	MKI67	363	1	0			c.A3811G						scavenged	.						220.0	212.0	215.0					10																	129906293		2203	4300	6503	SO:0001583	missense	4288	exon13			TACTTCTCTTGGG	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.3811A>G	10.37:g.129906293T>C	ENSP00000357643:p.Arg1271Gly	Somatic	218	1	0.00458716		WXS	Illumina HiSeq	Phase_I	274	4	0.0145985	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	10.41	1.342549	0.24339	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02258	4.37;4.37	3.04	1.89	0.25635	.	0.366064	0.19808	N	0.105599	T	0.02848	0.0085	L	0.44542	1.39	0.09310	N	1	P;P;P	0.43542	0.612;0.612;0.81	B;B;P	0.45946	0.181;0.138;0.498	T	0.44711	-0.9310	10	0.24483	T	0.36	.	5.873	0.18814	0.0:0.2436:0.0:0.7564	.	1270;911;1271	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	G	1271;911;1270	ENSP00000357643:R1271G;ENSP00000357642:R911G	ENSP00000357642:R911G	R	-	1	2	MKI67	129796283	0.000000	0.05858	0.003000	0.11579	0.017000	0.09413	0.502000	0.22594	0.381000	0.24851	0.379000	0.24179	AGA	.	.	none		0.502	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
KLF10	7071	hgsc.bcm.edu	37	8	103664424	103664424	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:103664424C>T	ENST00000285407.6	-	2	538	c.238G>A	c.(238-240)Gga>Aga	p.G80R	KLF10_ENST00000395884.3_Missense_Mutation_p.G69R	NM_005655.2	NP_005646.1	Q13118	KLF10_HUMAN	Kruppel-like factor 10	80					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular response to peptide (GO:1901653)|cellular response to starvation (GO:0009267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of circadian rhythm (GO:0042752)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(3)	18	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			TCAGGTGTTCCCGGAAGCAGA	0.318											OREG0018913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G80R	Esophageal Squamous(16;495 519 2144 16528 44005)	Atlas-SNP	.											KLF10,NS,carcinoma,+2,1	KLF10	44	1	0			c.G238A						scavenged	.						70.0	69.0	69.0					8																	103664424		2203	4300	6503	SO:0001583	missense	7071	exon2			GTGTTCCCGGAAG	U21847	CCDS6294.1, CCDS47905.1	8q22.3	2014-09-17	2004-11-29	2004-12-01	ENSG00000155090	ENSG00000155090		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11810	protein-coding gene	gene with protein product		601878	"""TGFB inducible early growth response"""	TIEG		8584037, 9721211	Standard	NM_001032282		Approved	EGRA, TIEG1	uc011lhk.1	Q13118	OTTHUMG00000164735	ENST00000285407.6:c.238G>A	8.37:g.103664424C>T	ENSP00000285407:p.Gly80Arg	Somatic	78	0	0	1375	WXS	Illumina HiSeq	Phase_I	89	2	0.0224719	NM_005655	A8MVH0|B2R794|L0R4P6|L0R679|O75411|Q503B2	Missense_Mutation	SNP	ENST00000285407.6	37	CCDS6294.1	.	.	.	.	.	.	.	.	.	.	C	9.817	1.184656	0.21870	.	.	ENSG00000155090	ENST00000285407;ENST00000395884	T;T	0.12672	2.66;2.72	6.01	3.28	0.37604	.	0.357499	0.30219	N	0.010133	T	0.14657	0.0354	L	0.57536	1.79	0.09310	N	1	P;P	0.47191	0.891;0.693	B;B	0.43251	0.413;0.413	T	0.11767	-1.0574	10	0.51188	T	0.08	.	6.5283	0.22312	0.0:0.5695:0.2319:0.1986	.	80;69	Q13118;O75411	KLF10_HUMAN;.	R	80;69	ENSP00000285407:G80R;ENSP00000379222:G69R	ENSP00000285407:G80R	G	-	1	0	KLF10	103733600	0.095000	0.21747	0.056000	0.19401	0.547000	0.35210	1.392000	0.34486	0.442000	0.26555	0.650000	0.86243	GGA	.	.	none		0.318	KLF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379967.1		
FAM98B	283742	hgsc.bcm.edu	37	15	38776833	38776833	+	IGR	SNP	T	T	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:38776833T>A	ENST00000491535.1	+	0	3111				FAM98B_ENST00000397609.2_Silent_p.G425G	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)	p.G425G(2)		endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		gtggtggtggtggaggaggtg	0.428																																					p.G425G		Atlas-SNP	.											FAM98B_ENST00000397609,NS,carcinoma,0,2	FAM98B	53	2	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.T1275A						scavenged	.						17.0	17.0	17.0					15																	38776833		1500	3373	4873	SO:0001628	intergenic_variant	283742	exon8			TGGTGGTGGAGGA		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831		15.37:g.38776833T>A		Somatic	61	1	0.0163934		WXS	Illumina HiSeq	Phase_I	74	2	0.027027	NM_173611	A8MUW5|Q8N935	Silent	SNP	ENST00000491535.1	37	CCDS42015.1																																																																																			.	.	none		0.428	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252071.2	NM_173611	
MYH11	4629	hgsc.bcm.edu	37	16	15880586	15880586	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:15880586G>A	ENST00000300036.5	-	5	643	c.534C>T	c.(532-534)ggC>ggT	p.G178G	MYH11_ENST00000576790.2_Silent_p.G178G|MYH11_ENST00000396324.3_Silent_p.G178G|MYH11_ENST00000452625.2_Silent_p.G178G	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	178	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTCCAGACTCGCCTCTGAAAG	0.522			T	CBFB	AML																																p.G178G		Atlas-SNP	.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	520	.	0			c.C534T						PASS	.						107.0	86.0	93.0					16																	15880586		2197	4300	6497	SO:0001819	synonymous_variant	4629	exon5			AGACTCGCCTCTG	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.534C>T	16.37:g.15880586G>A		Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	178	47	0.264045	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	CCDS10565.1																																																																																			.	.	none		0.522	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
GBA2	57704	hgsc.bcm.edu	37	9	35739047	35739047	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:35739047C>T	ENST00000378103.3	-	11	2270	c.1747G>A	c.(1747-1749)Gca>Aca	p.A583T	GBA2_ENST00000545786.1_Missense_Mutation_p.A589T|GBA2_ENST00000378094.4_Missense_Mutation_p.A583T|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000378088.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	583					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)	p.A583S(1)		NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTCACAGGTGCCATCACCCCA	0.582																																					p.A583T		Atlas-SNP	.											GBA2,colon,carcinoma,0,1	GBA2	77	1	1	Substitution - Missense(1)	large_intestine(1)	c.G1747A						scavenged	.						82.0	77.0	79.0					9																	35739047		2203	4300	6503	SO:0001583	missense	57704	exon11			CAGGTGCCATCAC	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1747G>A	9.37:g.35739047C>T	ENSP00000367343:p.Ala583Thr	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	148	2	0.0135135	NM_020944	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.454524	0.63290	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.69	5.69	0.88448	Six-hairpin glycosidase-like (1);Glucosylceramidase (1);	0.207432	0.51477	D	0.000088	T	0.70596	0.3242	M	0.74881	2.28	0.58432	D	0.999998	P;P;P	0.39326	0.668;0.51;0.477	B;B;P	0.44477	0.434;0.154;0.451	T	0.69053	-0.5247	9	0.36615	T	0.2	-3.5453	19.8052	0.96529	0.0:1.0:0.0:0.0	.	589;583;583	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	T	583;583;589	.	ENSP00000367334:A583T	A	-	1	0	GBA2	35729047	1.000000	0.71417	0.778000	0.31720	0.932000	0.56968	4.664000	0.61540	2.688000	0.91661	0.561000	0.74099	GCA	.	.	none		0.582	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
BCL11B	64919	hgsc.bcm.edu	37	14	99641016	99641016	+	Silent	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:99641016C>G	ENST00000357195.3	-	4	2166	c.2157G>C	c.(2155-2157)cgG>cgC	p.R719R	BCL11B_ENST00000443726.2_Silent_p.R525R|BCL11B_ENST00000345514.2_Silent_p.R648R	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	719					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		TCATGAAGTGCCGCGACGCCG	0.667			T	TLX3	T-ALL																																p.R719R		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	BCL11B,NS,carcinoma,-2,1	BCL11B	108	1	0			c.G2157C						PASS	.						23.0	20.0	21.0					14																	99641016		2198	4295	6493	SO:0001819	synonymous_variant	64919	exon4			GAAGTGCCGCGAC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.2157G>C	14.37:g.99641016C>G		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	28	7	0.25	NM_138576	Q9H162	Silent	SNP	ENST00000357195.3	37	CCDS9950.1																																																																																			.	.	none		0.667	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
MAP2K1	5604	hgsc.bcm.edu	37	15	66727441	66727441	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:66727441T>C	ENST00000307102.5	+	2	688	c.157T>C	c.(157-159)Ttt>Ctt	p.F53L		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	53			F -> S (in CFC3). {ECO:0000269|PubMed:16439621}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)	p.F53L(2)|p.F53S(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	CCTTGAGGCCTTTCTTACCCA	0.547																																					p.F53L		Atlas-SNP	.											MAP2K1,rectum,carcinoma,0,3	MAP2K1	115	3	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.T157C						scavenged	.						155.0	146.0	149.0					15																	66727441		2201	4299	6500	SO:0001583	missense	5604	exon2			GAGGCCTTTCTTA	L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.157T>C	15.37:g.66727441T>C	ENSP00000302486:p.Phe53Leu	Somatic	88	1	0.0113636		WXS	Illumina HiSeq	Phase_I	94	26	0.276596	NM_002755		Missense_Mutation	SNP	ENST00000307102.5	37	CCDS10216.1	.	.	.	.	.	.	.	.	.	.	T	35	5.500444	0.96355	.	.	ENSG00000169032	ENST00000307102	D	0.93019	-3.15	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.95188	0.8440	M	0.76170	2.325	0.80722	D	1	D;D	0.61080	0.989;0.98	P;P	0.59115	0.852;0.805	D	0.93980	0.7257	10	0.26408	T	0.33	-14.6287	14.0473	0.64712	0.0:0.0:0.0:1.0	.	31;53	B4DFY5;Q02750	.;MP2K1_HUMAN	L	53	ENSP00000302486:F53L	ENSP00000302486:F53L	F	+	1	0	MAP2K1	64514495	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.924000	0.87555	1.911000	0.55334	0.383000	0.25322	TTT	.	.	none		0.547	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256906.4		
ZBTB12	221527	hgsc.bcm.edu	37	6	31868698	31868698	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:31868698G>A	ENST00000375527.2	-	2	560	c.385C>T	c.(385-387)Ccc>Tcc	p.P129S	C2_ENST00000452323.2_5'Flank|C2_ENST00000469372.1_Intron	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	129					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						CCTATTTTGGGCTCAATGAAC	0.582																																					p.P129S		Atlas-SNP	.											.	ZBTB12	25	.	0			c.C385T						PASS	.						74.0	73.0	74.0					6																	31868698		2203	4300	6503	SO:0001583	missense	221527	exon2			TTTTGGGCTCAAT	BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.385C>T	6.37:g.31868698G>A	ENSP00000364677:p.Pro129Ser	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	101	51	0.504951	NM_181842	B0UY00|Q5JQ98	Missense_Mutation	SNP	ENST00000375527.2	37	CCDS4727.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266422	0.59540	.	.	ENSG00000204366	ENST00000375527	T	0.14766	2.48	4.38	3.51	0.40186	.	0.071421	0.56097	U	0.000028	T	0.09335	0.0230	N	0.19112	0.55	0.45066	D	0.998089	D	0.69078	0.997	D	0.68765	0.96	T	0.19289	-1.0310	10	0.19590	T	0.45	.	11.2674	0.49118	0.0928:0.0:0.9072:0.0	.	129	Q9Y330	ZBT12_HUMAN	S	129	ENSP00000364677:P129S	ENSP00000364677:P129S	P	-	1	0	ZBTB12	31976677	1.000000	0.71417	0.991000	0.47740	0.967000	0.64934	6.542000	0.73869	0.823000	0.34589	0.423000	0.28283	CCC	.	.	none		0.582	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076315.2	NM_181842	
MUC5B	727897	hgsc.bcm.edu	37	11	1258241	1258241	+	Silent	SNP	A	A	G	rs79773885		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:1258241A>G	ENST00000529681.1	+	25	3202	c.3144A>G	c.(3142-3144)gcA>gcG	p.A1048A	MUC5B_ENST00000447027.1_Silent_p.A1051A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1048	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGGGGGACGCACTGGAGTTTG	0.672																																					p.A1048A		Atlas-SNP	.											MUC5B,NS,carcinoma,+2,2	MUC5B	473	2	0			c.A3144G						scavenged	.						39.0	55.0	50.0					11																	1258241		2117	4226	6343	SO:0001819	synonymous_variant	727897	exon25			GGACGCACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3144A>G	11.37:g.1258241A>G		Somatic	53	2	0.0377358		WXS	Illumina HiSeq	Phase_I	48	7	0.145833	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			A|0.500;G|0.500	0.500	weak		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
SSFA2	6744	hgsc.bcm.edu	37	2	182792918	182792918	+	Missense_Mutation	SNP	C	C	T	rs201351475		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:182792918C>T	ENST00000431877.2	+	17	3885	c.3706C>T	c.(3706-3708)Cgg>Tgg	p.R1236W	SSFA2_ENST00000320370.7_Intron|SSFA2_ENST00000409001.1_Missense_Mutation_p.R1214W|SSFA2_ENST00000428267.2_Missense_Mutation_p.R1061W|SSFA2_ENST00000409136.1_Missense_Mutation_p.R745W|SSFA2_ENST00000467172.2_3'UTR	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	1236						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			GGAAATCAGACGGGAAATTGT	0.299																																					p.R1236W		Atlas-SNP	.											SSFA2_ENST00000431877,colon,carcinoma,-1,1	SSFA2	130	1	0			c.C3706T						scavenged	.	C	TRP/ARG,	0,1384		0,0,692	155.0	144.0	147.0		3706,	3.0	1.0	2		147	2,3180		0,2,1589	yes	missense,intron	SSFA2	NM_001130445.1,NM_006751.5	101,	0,2,2281	TT,TC,CC		0.0629,0.0,0.0438	probably-damaging,	1236/1260,	182792918	2,4564	692	1591	2283	SO:0001583	missense	6744	exon17			ATCAGACGGGAAA	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.3706C>T	2.37:g.182792918C>T	ENSP00000388731:p.Arg1236Trp	Somatic	224	0	0		WXS	Illumina HiSeq	Phase_I	258	3	0.0116279	NM_001130445	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	ENST00000431877.2	37	CCDS46467.1	.	.	.	.	.	.	.	.	.	.	C	19.80	3.895439	0.72639	0.0	6.29E-4	ENSG00000138434	ENST00000431877;ENST00000409001;ENST00000428267;ENST00000409136	T;T;T;T	0.19806	2.35;2.32;2.32;2.12	5.9	3.04	0.35103	.	0.200831	0.43579	D	0.000556	T	0.20941	0.0504	M	0.73598	2.24	0.41843	D	0.990137	P;P;P;P	0.41710	0.534;0.76;0.534;0.534	B;B;B;B	0.32533	0.097;0.147;0.097;0.097	T	0.04153	-1.0973	10	0.87932	D	0	-6.1578	9.5016	0.39022	0.4755:0.4606:0.0:0.0639	.	1061;745;1214;1236	E7END2;E7EUL7;E9PHV5;P28290	.;.;.;SSFA2_HUMAN	W	1236;1214;1061;745	ENSP00000388731:R1236W;ENSP00000387319:R1214W;ENSP00000409867:R1061W;ENSP00000386916:R745W	ENSP00000387319:R1214W	R	+	1	2	SSFA2	182501163	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	0.948000	0.29096	0.352000	0.24053	0.650000	0.86243	CGG	.	.	weak		0.299	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388697	1388697	+	Missense_Mutation	SNP	C	C	T	rs113316888	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:1388697C>T	ENST00000324803.4	+	1	3358	c.398C>T	c.(397-399)gCg>gTg	p.A133V		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	133					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CGTGCCCATGCGGAGTGCCCG	0.701													N|||	623	0.124401	0.1399	0.1527	5008	,	,		12463	0.2083		0.0736	False		,,,				2504	0.0491				p.A133V		Atlas-SNP	.											CRIPAK,NS,carcinoma,0,1	CRIPAK	185	1	0			c.C398T						scavenged	.						57.0	58.0	58.0					4																	1388697		2192	4288	6480	SO:0001583	missense	285464	exon1			CCCATGCGGAGTG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.398C>T	4.37:g.1388697C>T	ENSP00000323978:p.Ala133Val	Somatic	59	8	0.135593		WXS	Illumina HiSeq	Phase_I	32	10	0.3125	NM_175918	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	11.32	1.604146	0.28534	.	.	ENSG00000179979	ENST00000324803	T	0.18810	2.19	0.948	-1.08	0.09936	.	.	.	.	.	T	0.06645	0.0170	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34378	-0.9831	9	0.02654	T	1	.	2.1758	0.03862	0.2485:0.1979:0.0:0.5536	.	133	Q8N1N5	CRPAK_HUMAN	V	133	ENSP00000323978:A133V	ENSP00000323978:A133V	A	+	2	0	CRIPAK	1378697	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	-2.200000	0.01237	-1.804000	0.01241	-1.950000	0.00486	GCG	C|0.500;T|0.500	0.500	weak		0.701	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
JAKMIP2	9832	hgsc.bcm.edu	37	5	146997574	146997574	+	Missense_Mutation	SNP	G	G	A	rs181696687		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:146997574G>A	ENST00000265272.5	-	19	2713	c.2246C>T	c.(2245-2247)aCg>aTg	p.T749M	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.T707M|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.T728M	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	749						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTACTGCCGTCCTCAGCTC	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		18172	0.0		0.001	False		,,,				2504	0.0				p.T749M		Atlas-SNP	.											JAKMIP2,colon,carcinoma,0,1	JAKMIP2	154	1	0			c.C2246T						scavenged	.						166.0	147.0	153.0					5																	146997574		2203	4300	6503	SO:0001583	missense	9832	exon19			ACTGCCGTCCTCA	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.2246C>T	5.37:g.146997574G>A	ENSP00000265272:p.Thr749Met	Somatic	228	0	0		WXS	Illumina HiSeq	Phase_I	229	5	0.0218341	NM_001270941	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	14.19	2.462034	0.43736	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.23348	1.91;1.91;1.91	5.61	4.73	0.59995	.	0.055194	0.64402	D	0.000001	T	0.23965	0.0580	N	0.08118	0	0.47276	D	0.999377	D;D;D;D	0.64830	0.994;0.994;0.994;0.994	P;P;P;P	0.53954	0.738;0.738;0.738;0.656	T	0.15636	-1.0430	10	0.46703	T	0.11	.	15.3137	0.74056	0.0:0.2644:0.7356:0.0	.	707;749;728;749	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	M	728;749;707;728	ENSP00000421398:T728M;ENSP00000265272:T749M;ENSP00000328989:T707M	ENSP00000265272:T749M	T	-	2	0	JAKMIP2	146977767	1.000000	0.71417	0.982000	0.44146	0.995000	0.86356	5.475000	0.66787	1.496000	0.48567	0.563000	0.77884	ACG	G|1.000;A|0.000	0.000	strong		0.438	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
MTUS2	23281	hgsc.bcm.edu	37	13	30054459	30054459	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:30054459C>T	ENST00000380808.2	+	3	510	c.294C>T	c.(292-294)caC>caT	p.H98H	MTUS2-AS1_ENST00000323380.5_RNA|MTUS2-AS1_ENST00000587588.1_RNA|MTUS2_ENST00000542829.1_Silent_p.H8H|MTUS2_ENST00000431530.3_Silent_p.H1129H	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1119						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AGGAGGAGCACGGTGACCAGC	0.667																																					p.H1129H		Atlas-SNP	.											.	MTUS2	279	.	0			c.C3387T						PASS	.						11.0	15.0	14.0					13																	30054459		2064	4188	6252	SO:0001819	synonymous_variant	23281	exon8			GGAGCACGGTGAC	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000380808.2:c.294C>T	13.37:g.30054459C>T		Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	168	26	0.154762	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	ENST00000380808.2	37	CCDS41874.1																																																																																			.	.	none		0.667	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044335.2	XM_166270	
SUV420H1	51111	hgsc.bcm.edu	37	11	67925541	67925541	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:67925541A>G	ENST00000304363.4	-	11	2625	c.2272T>C	c.(2272-2274)Tat>Cat	p.Y758H		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	758					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TTTGCTACATAGAGATTGTTA	0.358																																					p.Y758H		Atlas-SNP	.											SUV420H1,NS,carcinoma,0,1	SUV420H1	125	1	0			c.T2272C						scavenged	.						185.0	192.0	190.0					11																	67925541		2200	4294	6494	SO:0001583	missense	51111	exon11			CTACATAGAGATT	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.2272T>C	11.37:g.67925541A>G	ENSP00000305899:p.Tyr758His	Somatic	186	0	0		WXS	Illumina HiSeq	Phase_I	186	2	0.0107527	NM_017635	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	ENST00000304363.4	37	CCDS31623.1	.	.	.	.	.	.	.	.	.	.	A	17.42	3.386174	0.61956	.	.	ENSG00000110066	ENST00000304363	T	0.65178	-0.14	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.70544	0.3236	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.74372	-0.3687	10	0.87932	D	0	-22.9436	15.2862	0.73831	1.0:0.0:0.0:0.0	.	758	Q4FZB7	SV421_HUMAN	H	758	ENSP00000305899:Y758H	ENSP00000305899:Y758H	Y	-	1	0	SUV420H1	67682117	1.000000	0.71417	0.962000	0.40283	0.818000	0.46254	8.824000	0.92023	2.029000	0.59856	0.260000	0.18958	TAT	.	.	none		0.358	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635	
TRIM38	10475	hgsc.bcm.edu	37	6	25983696	25983696	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:25983696T>A	ENST00000357085.3	+	8	1655	c.1179T>A	c.(1177-1179)taT>taA	p.Y393*	U91328.21_ENST00000608931.1_RNA|TRIM38_ENST00000349458.3_Nonsense_Mutation_p.Y393*	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	393	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						AGAAAGGCTATGTAGCACTTA	0.478																																					p.Y393X		Atlas-SNP	.											.	TRIM38	50	.	0			c.T1179A						PASS	.						124.0	122.0	123.0					6																	25983696		2203	4300	6503	SO:0001587	stop_gained	10475	exon8			AGGCTATGTAGCA	U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.1179T>A	6.37:g.25983696T>A	ENSP00000349596:p.Tyr393*	Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	170	61	0.358824	NM_006355	B2R862	Nonsense_Mutation	SNP	ENST00000357085.3	37	CCDS4568.1	.	.	.	.	.	.	.	.	.	.	t	27.6	4.847153	0.91277	.	.	ENSG00000112343	ENST00000540262;ENST00000349458;ENST00000357085	.	.	.	4.25	0.426	0.16479	.	0.336568	0.21891	N	0.067596	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.4119	0.27021	0.0:0.455:0.0:0.545	.	.	.	.	X	393	.	ENSP00000230099:Y393X	Y	+	3	2	TRIM38	26091675	0.000000	0.05858	0.001000	0.08648	0.227000	0.25037	-0.723000	0.04952	0.067000	0.16545	0.533000	0.62120	TAT	.	.	none		0.478	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040076.2		
HIST1H1A	3024	hgsc.bcm.edu	37	6	26017331	26017331	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:26017331C>T	ENST00000244573.3	-	1	709	c.630G>A	c.(628-630)gcG>gcA	p.A210A		NM_005325.3	NP_005316.1	Q02539	H11_HUMAN	histone cluster 1, H1a	210					nucleosome assembly (GO:0006334)|spermatogenesis (GO:0007283)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|ovary(3)|prostate(1)	13						TCTTGGGTGCCGCTTTCTTGG	0.463																																					p.A210A		Atlas-SNP	.											.	HIST1H1A	25	.	0			c.G630A						PASS	.						106.0	109.0	108.0					6																	26017331		2203	4300	6503	SO:0001819	synonymous_variant	3024	exon1			GGGTGCCGCTTTC	AF531299	CCDS4569.1	6p22.1	2012-11-16	2006-10-11	2003-02-21	ENSG00000124610	ENSG00000124610		"""Histones / Replication-dependent"""	4715	protein-coding gene	gene with protein product		142709	"""H1 histone family, member 1"", ""histone 1, H1a"""	H1F1		2759094, 12408966	Standard	NM_005325		Approved	H1.1, H1a	uc003nfo.3	Q02539	OTTHUMG00000016413	ENST00000244573.3:c.630G>A	6.37:g.26017331C>T		Somatic	252	0	0		WXS	Illumina HiSeq	Phase_I	245	104	0.42449	NM_005325	Q3MJ34	Silent	SNP	ENST00000244573.3	37	CCDS4569.1																																																																																			.	.	none		0.463	HIST1H1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043884.1	NM_005325	
RAF1	5894	hgsc.bcm.edu	37	3	12627290	12627290	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:12627290G>A	ENST00000251849.4	-	14	1865	c.1426C>T	c.(1426-1428)Ctc>Ttc	p.L476F	RAF1_ENST00000542177.1_Missense_Mutation_p.L395F|RAF1_ENST00000534997.1_Missense_Mutation_p.L261F|RAF1_ENST00000442415.2_Missense_Mutation_p.L496F	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	476	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCTTCATGGAGAAATATATCT	0.388			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.L476F		Atlas-SNP	.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	.	RAF1	66	.	0			c.C1426T						PASS	.						96.0	95.0	95.0					3																	12627290		2203	4300	6503	SO:0001583	missense	5894	exon14	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CATGGAGAAATAT	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.1426C>T	3.37:g.12627290G>A	ENSP00000251849:p.Leu476Phe	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	61	15	0.245902	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.160558	0.78226	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	5.26	5.26	0.73747	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93106	0.7805	M	0.82923	2.615	0.80722	D	1	D;D;D	0.89917	0.985;0.985;1.0	D;D;D	0.87578	0.983;0.946;0.998	D	0.93639	0.6963	10	0.87932	D	0	.	19.0661	0.93110	0.0:0.0:1.0:0.0	.	395;261;476	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	F	476;496;355;261;395	ENSP00000251849:L476F;ENSP00000401888:L496F;ENSP00000398591:L355F;ENSP00000441186:L261F;ENSP00000443567:L395F	ENSP00000251849:L476F	L	-	1	0	RAF1	12602290	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.135000	0.71696	2.746000	0.94184	0.655000	0.94253	CTC	.	.	none		0.388	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
ARL8A	127829	hgsc.bcm.edu	37	1	202113679	202113679	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:202113679G>A	ENST00000272217.2	-	1	190	c.22C>T	c.(22-24)Ctg>Ttg	p.L8L		NM_001256129.1|NM_138795.3	NP_001243058.1|NP_620150.1	Q96BM9	ARL8A_HUMAN	ADP-ribosylation factor-like 8A	8					chromosome segregation (GO:0007059)|GTP catabolic process (GO:0006184)|mitotic nuclear division (GO:0007067)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|midbody (GO:0030496)|spindle midzone (GO:0051233)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						CAGTCCAGCAGCTTGTTGAAC	0.677																																					p.L8L		Atlas-SNP	.											.	ARL8A	14	.	0			c.C22T						PASS	.						79.0	63.0	69.0					1																	202113679		2203	4300	6503	SO:0001819	synonymous_variant	127829	exon1			CCAGCAGCTTGTT	BC015408	CCDS1421.1, CCDS73004.1	1q32.1	2014-05-09	2005-11-03	2005-11-03	ENSG00000143862	ENSG00000143862		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25192	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10B"""	ARL10B		8889548	Standard	NM_001256129		Approved	FLJ45195, Gie2	uc001gxk.2	Q96BM9	OTTHUMG00000035923	ENST00000272217.2:c.22C>T	1.37:g.202113679G>A		Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	29	7	0.241379	NM_138795	B3KXD0	Silent	SNP	ENST00000272217.2	37	CCDS1421.1																																																																																			.	.	none		0.677	ARL8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087493.1	NM_138795	
SYT14	255928	hgsc.bcm.edu	37	1	210334267	210334267	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:210334267G>C	ENST00000472886.1	+	8	1562	c.1548G>C	c.(1546-1548)atG>atC	p.M516I	SYT14_ENST00000422431.1_Missense_Mutation_p.M580I|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000367015.1_Missense_Mutation_p.M478I|SYT14_ENST00000534859.1_Missense_Mutation_p.M542I|SYT14_ENST00000399639.2_3'UTR|SYT14_ENST00000537238.1_Missense_Mutation_p.M478I|SYT14_ENST00000367019.1_Missense_Mutation_p.M535I			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	516	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		GAAAAGAGATGATAGGCTGGA	0.398																																					p.M580I		Atlas-SNP	.											.	SYT14	89	.	0			c.G1740C						PASS	.						139.0	134.0	135.0					1																	210334267		2203	4300	6503	SO:0001583	missense	255928	exon10			AGAGATGATAGGC	AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.1548G>C	1.37:g.210334267G>C	ENSP00000418901:p.Met516Ile	Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	151	26	0.172185	NM_001146261	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	ENST00000472886.1	37	CCDS31014.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747320	0.49257	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.54	5.54	0.83059	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.039837	0.85682	D	0.000000	T	0.61999	0.2392	L	0.39397	1.21	0.80722	D	1	B;B;B;B	0.24426	0.1;0.057;0.103;0.082	B;B;B;B	0.29077	0.098;0.042;0.059;0.087	T	0.55250	-0.8170	10	0.21014	T	0.42	-22.5444	19.8284	0.96626	0.0:0.0:1.0:0.0	.	563;516;535;580	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	I	580;542;478;535;516;478	ENSP00000389039:M580I;ENSP00000442891:M542I;ENSP00000437423:M478I;ENSP00000355986:M535I;ENSP00000418901:M516I;ENSP00000355982:M478I	ENSP00000355982:M478I	M	+	3	0	SYT14	208400890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.338000	0.96553	2.751000	0.94390	0.585000	0.79938	ATG	.	.	none		0.398	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
CDC37	11140	hgsc.bcm.edu	37	19	10506866	10506866	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:10506866C>T	ENST00000222005.2	-	2	169	c.116G>A	c.(115-117)cGc>cAc	p.R39H		NM_007065.3	NP_008996.1	Q16543	CDC37_HUMAN	cell division cycle 37	39					protein targeting (GO:0006605)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	16			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		CTGCTCCATGCGTTCCACCCG	0.647																																					p.R39H		Atlas-SNP	.											CDC37,NS,carcinoma,-1,1	CDC37	32	1	0			c.G116A						scavenged	.						45.0	48.0	47.0					19																	10506866		2203	4300	6503	SO:0001583	missense	11140	exon2			TCCATGCGTTCCA	U63131	CCDS12237.1	19p13.2	2013-01-17	2013-01-17		ENSG00000105401	ENSG00000105401			1735	protein-coding gene	gene with protein product	"""CDC37 cell division cycle 37 homolog"", ""Hsp90 co-chaperone Cdc37"", ""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"""	605065	"""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"", ""CDC37 cell division cycle 37 homolog (S. cerevisiae)"", ""cell division cycle 37 homolog (S. cerevisiae)"""			8703009, 8666233	Standard	NM_007065		Approved	P50CDC37	uc002mof.1	Q16543		ENST00000222005.2:c.116G>A	19.37:g.10506866C>T	ENSP00000222005:p.Arg39His	Somatic	360	2	0.00555556		WXS	Illumina HiSeq	Phase_I	286	3	0.0104895	NM_007065	Q53YA2	Missense_Mutation	SNP	ENST00000222005.2	37	CCDS12237.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.714165	0.89112	.	.	ENSG00000105401	ENST00000222005	T	0.63255	-0.03	4.19	4.19	0.49359	Cdc37, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.76278	0.3965	M	0.79123	2.44	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.61328	0.887;0.887	T	0.80870	-0.1189	10	0.87932	D	0	.	14.3942	0.67001	0.0:1.0:0.0:0.0	.	39;39	Q6FG59;Q16543	.;CDC37_HUMAN	H	39	ENSP00000222005:R39H	ENSP00000222005:R39H	R	-	2	0	CDC37	10367866	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.268000	0.78473	2.058000	0.61347	0.555000	0.69702	CGC	.	.	none		0.647	CDC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451987.1	NM_007065	
RNGTT	8732	hgsc.bcm.edu	37	6	89554108	89554108	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:89554108T>A	ENST00000369485.4	-	11	1423	c.1237A>T	c.(1237-1239)Aag>Tag	p.K413*	RNGTT_ENST00000369475.3_Nonsense_Mutation_p.K413*|RNGTT_ENST00000538899.1_Nonsense_Mutation_p.K353*|RNGTT_ENST00000265607.6_Nonsense_Mutation_p.K413*	NM_003800.3	NP_003791.3	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase	413	GTase.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA processing (GO:0006396)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|mRNA guanylyltransferase activity (GO:0004484)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA guanylyltransferase activity (GO:0008192)|triphosphatase activity (GO:0050355)			endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	21		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		AAAAACGGCTTATTTCTGACG	0.333																																					p.K413X		Atlas-SNP	.											.	RNGTT	52	.	0			c.A1237T						PASS	.						137.0	136.0	137.0					6																	89554108		2203	4300	6503	SO:0001587	stop_gained	8732	exon11			ACGGCTTATTTCT	AF025654	CCDS5017.1	6q16	2011-06-09			ENSG00000111880	ENSG00000111880	2.7.7.50	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	10073	protein-coding gene	gene with protein product		603512				9828141, 9512541	Standard	NM_001286428		Approved	HCE, HCE1, hCAP	uc003pmr.2	O60942	OTTHUMG00000015190	ENST00000369485.4:c.1237A>T	6.37:g.89554108T>A	ENSP00000358497:p.Lys413*	Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	67	16	0.238806	NM_003800	E1P513|E1P514|O43483|O60257|O60351|Q5TCW8|Q8WUM8	Nonsense_Mutation	SNP	ENST00000369485.4	37	CCDS5017.1	.	.	.	.	.	.	.	.	.	.	T	40	7.950168	0.98577	.	.	ENSG00000111880	ENST00000369485;ENST00000265607;ENST00000538899;ENST00000536746;ENST00000369475	.	.	.	5.7	5.7	0.88788	.	0.119116	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.5296	15.9509	0.79835	0.0:0.0:0.0:1.0	.	.	.	.	X	413;413;353;384;413	.	ENSP00000265607:K413X	K	-	1	0	RNGTT	89610827	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.953000	0.87836	2.175000	0.68902	0.460000	0.39030	AAG	.	.	none		0.333	RNGTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041469.1		
SOWAHB	345079	hgsc.bcm.edu	37	4	77818940	77818940	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:77818940C>T	ENST00000334306.2	-	1	62	c.63G>A	c.(61-63)gtG>gtA	p.V21V		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	21																	CAGCGTTGGTCACGCGGCCCC	0.657																																					p.V21V		Atlas-SNP	.											.	.	.	.	0			c.G63A						PASS	.						24.0	26.0	25.0					4																	77818940		2201	4300	6501	SO:0001819	synonymous_variant	345079	exon1			GTTGGTCACGCGG		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.63G>A	4.37:g.77818940C>T		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	41	10	0.243902	NM_001029870	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			.	.	none		0.657	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		Atlas-SNP	.											.	PEX6	44	.	0			c.G399T						PASS	.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_000287	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327	0.327	strong		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
FAM111B	374393	hgsc.bcm.edu	37	11	58891900	58891900	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:58891900C>T	ENST00000343597.3	+	4	521	c.330C>T	c.(328-330)gcC>gcT	p.A110A	FAM111B_ENST00000529618.1_Silent_p.A80A|FAM111B_ENST00000411426.1_Silent_p.A80A	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	110							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						TCTACTCAGCCCTGAGTGCTA	0.338																																					p.A110A		Atlas-SNP	.											FAM111B,colon,carcinoma,+2,1	FAM111B	84	1	0			c.C330T						scavenged	.						80.0	77.0	78.0					11																	58891900		2201	4295	6496	SO:0001819	synonymous_variant	374393	exon4			CTCAGCCCTGAGT	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.330C>T	11.37:g.58891900C>T		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	52	2	0.0384615	NM_198947	B4E2G2|Q6P661	Silent	SNP	ENST00000343597.3	37	CCDS7972.1																																																																																			.	.	none		0.338	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947	
IZUMO3	100129669	hgsc.bcm.edu	37	9	24545513	24545513	+	Silent	SNP	G	G	A	rs6475797	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:24545513G>A	ENST00000543880.2	-	1	366	c.135C>T	c.(133-135)ccC>ccT	p.P45P	RP11-20A20.2_ENST00000602851.1_lincRNA|IZUMO3_ENST00000604921.1_Silent_p.P45P			Q5VZ72	IZUM3_HUMAN	IZUMO family member 3	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)										GAGTTCGGCCGGGGACTTCTG	0.488													A|||	3689	0.736621	0.9486	0.572	5008	,	,		17712	0.8115		0.507	False		,,,				2504	0.726				p.P45P		Atlas-SNP	.											.	.	.	.	0			c.C135T						PASS	.																																			SO:0001819	synonymous_variant	100129669	exon1			TCGGCCGGGGACT		CCDS65020.1	9p21.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000205442	ENSG00000205442		"""-"""	31421	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 134"""	C9orf134		19658160, 22957301	Standard	NM_001271706		Approved	bA20A20.1	uc031tdg.1	Q5VZ72	OTTHUMG00000019704	ENST00000543880.2:c.135C>T	9.37:g.24545513G>A		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	8	8	1	NM_001271706		Silent	SNP	ENST00000543880.2	37																																																																																				G|0.259;A|0.740	0.740	strong		0.488	IZUMO3-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000467652.1	NM_001271706	
ATP2C2	9914	hgsc.bcm.edu	37	16	84473085	84473085	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:84473085A>T	ENST00000262429.4	+	13	1253	c.1164A>T	c.(1162-1164)gaA>gaT	p.E388D	ATP2C2_ENST00000416219.2_Missense_Mutation_p.E388D|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	388					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CTGCCAATGAAATGACAGTGA	0.512																																					p.E388D		Atlas-SNP	.											.	ATP2C2	75	.	0			c.A1164T						PASS	.						234.0	245.0	242.0					16																	84473085		2145	4254	6399	SO:0001583	missense	9914	exon13			CAATGAAATGACA	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.1164A>T	16.37:g.84473085A>T	ENSP00000262429:p.Glu388Asp	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	161	35	0.217391	NM_014861	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	ENST00000262429.4	37	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.441104	0.63067	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	D;D	0.96619	-4.07;-4.07	4.91	-5.36	0.02689	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.64402	D	0.000003	D	0.97620	0.9220	M	0.90198	3.095	0.40064	D	0.975936	D;D;D;P	0.58970	0.984;0.975;0.963;0.946	P;D;P;D	0.64237	0.898;0.923;0.883;0.923	D	0.97061	0.9771	10	0.87932	D	0	.	15.4601	0.75349	0.2567:0.0:0.7433:0.0	.	388;237;405;388	E7ES94;F8WAA5;O75185-2;O75185	.;.;.;AT2C2_HUMAN	D	388;388;237	ENSP00000397925:E388D;ENSP00000262429:E388D	ENSP00000262429:E388D	E	+	3	2	ATP2C2	83030586	1.000000	0.71417	0.830000	0.32933	0.244000	0.25665	0.514000	0.22786	-0.979000	0.03529	-0.441000	0.05720	GAA	.	.	none		0.512	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	
MAGEC1	9947	hgsc.bcm.edu	37	X	140995472	140995472	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:140995472A>G	ENST00000285879.4	+	4	2568	c.2282A>G	c.(2281-2283)gAg>gGg	p.E761G	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	761										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGTTTCCCTGAGAGTCCTCAG	0.542										HNSCC(15;0.026)																											p.E761G		Atlas-SNP	.											.	MAGEC1	317	.	0			c.A2282G						PASS	.						129.0	141.0	137.0					X																	140995472		2203	4300	6503	SO:0001583	missense	9947	exon4			TCCCTGAGAGTCC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2282A>G	X.37:g.140995472A>G	ENSP00000285879:p.Glu761Gly	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	82	12	0.146341	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	-	8.918	0.960479	0.18583	.	.	ENSG00000155495	ENST00000285879	T	0.02552	4.25	1.2	-2.4	0.06583	.	.	.	.	.	T	0.02380	0.0073	N	0.24115	0.695	0.09310	N	1	P	0.39094	0.659	B	0.42959	0.403	T	0.39375	-0.9617	9	0.72032	D	0.01	.	1.9049	0.03275	0.2872:0.2437:0.0:0.4691	.	761	O60732	MAGC1_HUMAN	G	761	ENSP00000285879:E761G	ENSP00000285879:E761G	E	+	2	0	MAGEC1	140823138	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.560000	0.05964	-0.662000	0.05338	0.235000	0.17854	GAG	.	.	none		0.542	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
EPHA3	2042	hgsc.bcm.edu	37	3	89390951	89390951	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:89390951C>T	ENST00000336596.2	+	5	1242	c.1017C>T	c.(1015-1017)acC>acT	p.T339T	EPHA3_ENST00000494014.1_Silent_p.T339T|EPHA3_ENST00000452448.2_Silent_p.T339T	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	339	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TAAACGAGACCTCAGTTATCC	0.403										TSP Lung(6;0.00050)																											p.T339T		Atlas-SNP	.											.	EPHA3	501	.	0			c.C1017T						PASS	.						76.0	79.0	78.0					3																	89390951		2203	4300	6503	SO:0001819	synonymous_variant	2042	exon5			CGAGACCTCAGTT	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1017C>T	3.37:g.89390951C>T		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	93	4	0.0430108	NM_005233	Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	37	CCDS2922.1																																																																																			.	.	none		0.403	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
PSPH	5723	hgsc.bcm.edu	37	7	56085002	56085002	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:56085002C>T	ENST00000395471.3	-	6	1151	c.346G>A	c.(346-348)Gta>Ata	p.V116I	PSPH_ENST00000275605.3_Missense_Mutation_p.V116I|PSPH_ENST00000459834.1_Intron			P78330	SERB_HUMAN	phosphoserine phosphatase	116					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)	p.V116I(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACATGCTCTACAATACTCCTA	0.393																																					p.V116I		Atlas-SNP	.											PSPH,NS,carcinoma,0,2	PSPH	23	2	1	Substitution - Missense(1)	lung(1)	c.G346A						scavenged	.						87.0	75.0	79.0					7																	56085002		2203	4300	6503	SO:0001583	missense	5723	exon6			GCTCTACAATACT	Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.346G>A	7.37:g.56085002C>T	ENSP00000378854:p.Val116Ile	Somatic	464	2	0.00431034		WXS	Illumina HiSeq	Phase_I	488	6	0.0122951	NM_004577	B2RCR5|Q7Z3S5	Missense_Mutation	SNP	ENST00000395471.3	37	CCDS5522.1	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432510	0.25813	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626	D;D;D	0.81908	-1.55;-1.55;-1.55	4.85	4.85	0.62838	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.65228	0.2671	N	0.05124	-0.11	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.18263	0.021;0.021	T	0.62992	-0.6736	10	0.02654	T	1	-16.2549	17.1115	0.86676	0.0:1.0:0.0:0.0	.	116;116	Q53EY1;P78330	.;SERB_HUMAN	I	116	ENSP00000275605:V116I;ENSP00000378854:V116I;ENSP00000398653:V116I	ENSP00000275605:V116I	V	-	1	0	PSPH	56052496	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.551000	0.82182	2.297000	0.77311	0.579000	0.79373	GTA	.	.	none		0.393	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343304.1	NM_004577	
LMO7	4008	hgsc.bcm.edu	37	13	76381767	76381767	+	Missense_Mutation	SNP	G	G	A	rs534047308		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:76381767G>A	ENST00000321797.8	+	8	1370	c.649G>A	c.(649-651)Gag>Aag	p.E217K	LMO7_ENST00000377534.3_Missense_Mutation_p.E502K|LMO7_ENST00000341547.4_Intron|LMO7_ENST00000465261.2_Missense_Mutation_p.E217K|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000357063.3_Missense_Mutation_p.E502K			Q8WWI1	LMO7_HUMAN	LIM domain 7	502					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AGATGACCTCGAGATGGCAGC	0.453													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18167	0.0		0.0	False		,,,				2504	0.0				p.E217K		Atlas-SNP	.											.	LMO7	334	.	0			c.G649A						PASS	.						93.0	86.0	88.0					13																	76381767		1568	3582	5150	SO:0001583	missense	4008	exon7			GACCTCGAGATGG	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.649G>A	13.37:g.76381767G>A	ENSP00000317802:p.Glu217Lys	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	92	4	0.0434783	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.44|13.44	2.238724|2.238724	0.39598|0.39598	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261;ENST00000526528|ENST00000447038	T;T;T;T|.	0.54279|.	0.58;0.58;0.58;0.58|.	5.83|5.83	4.11|4.11	0.48088|0.48088	.|.	0.288711|.	0.37304|.	N|.	0.002146|.	T|T	0.54515|0.54515	0.1863|0.1863	M|M	0.64997|0.64997	1.995|1.995	0.19300|0.19300	N|N	0.999977|0.999977	B;B|.	0.23735|.	0.09;0.022|.	B;B|.	0.11329|.	0.006;0.006|.	T|T	0.45041|0.45041	-0.9288|-0.9288	10|5	0.66056|.	D|.	0.02|.	-4.5653|-4.5653	12.5045|12.5045	0.55973|0.55973	0.1331:0.0:0.8669:0.0|0.1331:0.0:0.8669:0.0	.|.	502;217|.	Q8WWI1;E9PLH4|.	LMO7_HUMAN;.|.	K|Q	502;502;217;217;123|125	ENSP00000349571:E502K;ENSP00000366757:E502K;ENSP00000317802:E217K;ENSP00000433352:E217K|.	ENSP00000317802:E217K|.	E|R	+|+	1|2	0|0	LMO7|LMO7	75279768|75279768	1.000000|1.000000	0.71417|0.71417	0.004000|0.004000	0.12327|0.12327	0.032000|0.032000	0.12392|0.12392	4.278000|4.278000	0.58946|0.58946	0.814000|0.814000	0.34374|0.34374	0.655000|0.655000	0.94253|0.94253	GAG|CGA	.	.	none		0.453	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
MTERF4	130916	hgsc.bcm.edu	37	2	242035741	242035741	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:242035741C>T	ENST00000391980.2	-	4	876	c.818G>A	c.(817-819)cGg>cAg	p.R273Q	MTERFD2_ENST00000406593.1_Missense_Mutation_p.R85Q|MTERFD2_ENST00000464344.2_Intron|MTERFD2_ENST00000495694.1_Intron	NM_182501.3	NP_872307.2	Q7Z6M4	MTEF4_HUMAN		273					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	rRNA binding (GO:0019843)			endometrium(3)|large_intestine(6)|lung(5)|ovary(1)|skin(2)|urinary_tract(3)	20		all_cancers(19;4.67e-31)|all_epithelial(40;8.67e-13)|Breast(86;0.000141)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;2.47e-32)|all cancers(36;1.79e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-14)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;2.81e-06)|Lung(119;0.000509)|LUSC - Lung squamous cell carcinoma(224;0.00442)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0886)		GGTTTGGTACCGTCCCAGGCG	0.473																																					p.R273Q		Atlas-SNP	.											MTERFD2,NS,carcinoma,-1,1	MTERFD2	33	1	0			c.G818A						scavenged	.						139.0	136.0	137.0					2																	242035741		2203	4300	6503	SO:0001583	missense	130916	exon4			TGGTACCGTCCCA																												ENST00000391980.2:c.818G>A	2.37:g.242035741C>T	ENSP00000375840:p.Arg273Gln	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	149	2	0.0134228	NM_182501	A8K6K0|Q9P0E0	Missense_Mutation	SNP	ENST00000391980.2	37	CCDS2544.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936503	0.52972	.	.	ENSG00000122085	ENST00000391980;ENST00000406593;ENST00000439144	T;T;T	0.16324	2.46;2.35;2.64	5.71	4.78	0.61160	.	0.115400	0.39274	N	0.001406	T	0.40094	0.1103	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.05566	-1.0877	10	0.35671	T	0.21	0.3371	13.8133	0.63276	0.2234:0.7766:0.0:0.0	.	273	Q7Z6M4	MTER2_HUMAN	Q	273;85;126	ENSP00000375840:R273Q;ENSP00000384998:R85Q;ENSP00000414989:R126Q	ENSP00000241527:R273Q	R	-	2	0	MTERFD2	241684414	0.790000	0.28787	1.000000	0.80357	0.236000	0.25371	1.934000	0.40163	2.701000	0.92244	0.591000	0.81541	CGG	.	.	none		0.473	MTERFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323798.4		
TMSB4X	7114	hgsc.bcm.edu	37	X	12994912	12994912	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:12994912G>C	ENST00000380635.1	+	3	333	c.117G>C	c.(115-117)aaG>aaC	p.K39N	TMSB4X_ENST00000380633.1_Missense_Mutation_p.K39N|TMSB4X_ENST00000380636.1_Missense_Mutation_p.K39N|TMSB4X_ENST00000451311.2_Missense_Mutation_p.K39N			P62328	TYB4_HUMAN	thymosin beta 4, X-linked	39					actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sequestering of actin monomers (GO:0042989)	cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	poly(A) RNA binding (GO:0044822)			upper_aerodigestive_tract(1)	1						AACAGGAGAAGCAAGCAGGCG	0.393																																					p.K39N		Atlas-SNP	.											.	TMSB4X	3	.	0			c.G117C						PASS	.						56.0	60.0	59.0					X																	12994912		2187	4236	6423	SO:0001583	missense	7114	exon3			GGAGAAGCAAGCA		CCDS35202.1	Xp22.2	2013-05-14	2008-02-25		ENSG00000205542	ENSG00000205542			11881	protein-coding gene	gene with protein product		300159	"""thymosin, beta 4, X chromosome"""	TMSB4		2677145, 9381176	Standard	NM_021109		Approved	TB4X	uc004cvf.3	P62328	OTTHUMG00000021144	ENST00000380635.1:c.117G>C	X.37:g.12994912G>C	ENSP00000370009:p.Lys39Asn	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	81	15	0.185185	NM_021109	P01253|P01254|Q546P5|Q63576|Q9UE55	Missense_Mutation	SNP	ENST00000380635.1	37	CCDS35202.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598583	0.46318	.	.	ENSG00000205542	ENST00000451311;ENST00000380636;ENST00000380635;ENST00000380633	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	4.8	4.8	0.61643	.	0.082982	0.46145	U	0.000307	T	0.72590	0.3479	.	.	.	0.39812	D	0.972719	P	0.44260	0.83	P	0.53062	0.717	T	0.76729	-0.2852	9	0.87932	D	0	-4.3082	8.5344	0.33355	0.1781:0.0:0.8219:0.0	.	39	P62328	TYB4_HUMAN	N	39	ENSP00000414376:K39N;ENSP00000370010:K39N;ENSP00000370009:K39N;ENSP00000370007:K39N	ENSP00000370007:K39N	K	+	3	2	TMSB4X	12904833	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.475000	0.66787	2.129000	0.65627	0.600000	0.82982	AAG	.	.	none		0.393	TMSB4X-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000055779.1	NM_021109	
